Science.gov

Sample records for adjacent rrna nucleotide

  1. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  2. Complete nucleotide sequences of two adjacent early vaccinia virus genes located within the inverted terminal repetition.

    PubMed

    Venkatesan, S; Gershowitz, A; Moss, B

    1982-11-01

    The proximal part of the 10,000-base pair (bp) inverted terminal repetition of vaccinia virus DNA encodes at least three early mRNAs. A 2,236-bp segment of the repetition was sequenced to characterize two of the genes. This task was facilitated by constructing a series of recombinants containing overlapping deletions; oligonucleotide linkers with synthetic restriction sites provided points for radioactive labeling before sequencing by the chemical degradation method of Maxam and Gilbert (Methods Enzymol. 65:499-560, 1980). The ends of the transcripts were mapped by hybridizing labeled DNA fragments to early viral RNA and resolving nuclease S1-protected fragments in sequencing gels, by sequencing cDNA clones, and from the lengths of the RNAs. The nucleotide sequences for at least 60 bp upstream of both transcriptional initiation sites are more than 80% adenine . thymine rich and contain long runs of adenines and thymines with some homology to procaryotic and eucaryotic consensus sequences. The gene transcribed in the rightward direction encodes an RNA of approximately 530 nucleotides with a single open reading frame of 420 nucleotides. Preceding the first AUG, there is a heptanucleotide that can hybridize to the 3' end of 18S rRNA with only one mismatch. The derived amino acid sequence of the protein indicated a molecular weight of 15,500. The gene transcribed in the leftward direction encodes an RNA 1,000 to 1,100 nucleotides long with an open reading frame of 996 nucleotides and a leader sequence of only 5 to 6 nucleotides. The derived amino acid sequence of this protein indicated a molecular weight of 38,500. The 3' ends of the two transcripts were located within 100 bp of each other. Although there are adenine . thymine-rich clusters near the putative transcriptional termination sites, specific AATAAA polyadenylic acid signal sequences are absent.

  3. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.

    PubMed

    Garcia-Mazcorro, Jose F

    2013-09-01

    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at http://www.hiv.lanl.gov/ was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  4. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  5. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  6. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  7. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    PubMed

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  8. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M

    1982-01-01

    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  9. A genome walking strategy for the identification of nucleotide sequences adjacent to known regions.

    PubMed

    Wang, Hailong; Yao, Ting; Cai, Mei; Xiao, Xiuqing; Ding, Xuezhi; Xia, Liqiu

    2013-02-01

    To identify the transposon insertion sites in a soil actinomycete, Saccharopolyspora spinosa, a genome walking approach, termed SPTA-PCR, was developed. In SPTA-PCR, a simple procedure consisting of TA cloning and a high stringency PCR, following the single primer-mediated, randomly-primed PCR, can eliminate non-target DNA fragments and obtain target fragments specifically. Using SPTA-PCR, the DNA sequence adjacent to the highly conserved region of lectin coding gene in onion plant, Allium chinense, was also cloned. PMID:23108875

  10. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  11. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    PubMed

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method.

  12. Events during eucaryotic rRNA transcription initiation and elongation: Conversion from the closed to the open promoter complex requires nucleotide substrates

    SciTech Connect

    Bateman, E.; Paule, M.R.

    1988-05-01

    Chemical footprinting and topological analysis were carried out on the Acanthamoeba castellanii rRNA transcription initiation factor (TIF) and RNA polymerase I complexes with DNA during transcription initiation and elongation. The results show that the binding of TIF and polymerase to the promoter does not alter the supercoiling of the DNA template and the template does not become sensitive to modification by diethylpyro-carbonate, which can identify melted DNA regions. Thus, in contrast to bacterial RNA polymerase, the eucaryotic RNA polymerase I-promoter complex is in a closed configuration preceding addition of nucleotides in vitro. Initiation and 3'-O-methyl CTP-limited translocation by RNA polymerase I results in separation of the polymerase-TIF footprints, leaving the TIF footprint unaltered. In contrast, initiation and translocation result in a significant change in the conformation of the polymerase-DNA complex, culminating in an unwound DNA region of at least 10 base pairs.

  13. Nucleotide sequence composition adjacent to intronic splice sites improves splicing efficiency via its effect on pre-mRNA local folding in fungi.

    PubMed

    Zafrir, Zohar; Tuller, Tamir

    2015-10-01

    RNA splicing is the central process of intron removal in eukaryotes known to regulate various cellular functions such as growth, development, and response to external signals. The canonical sequences indicating the splicing sites needed for intronic boundary recognition are well known. However, the roles and evolution of the local folding of intronic and exonic sequence features adjacent to splice sites has yet to be thoroughly studied. Here, focusing on four fungi (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus nidulans, and Candida albicans), we performed for the first time a comprehensive high-resolution study aimed at characterizing the encoding of intronic splicing efficiency in pre-mRNA transcripts and its effect on intron evolution. Our analysis supports the conjecture that pre-mRNA local folding strength at intronic boundaries is under selective pressure, as it significantly affects splicing efficiency. Specifically, we show that in the immediate region of 12-30 nucleotides (nt) surrounding the intronic donor site there is a preference for weak pre-mRNA folding; similarly, in the region of 15-33 nt surrounding the acceptor and branch sites there is a preference for weak pre-mRNA folding. We also show that in most cases there is a preference for strong pre-mRNA folding further away from intronic splice sites. In addition, we demonstrate that these signals are not associated with gene-specific functions, and they correlate with splicing efficiency measurements (r = 0.77, P = 2.98 × 10(-21)) and with expression levels of the corresponding genes (P = 1.24 × 10(-19)). We suggest that pre-mRNA folding strength in the above-mentioned regions has a direct effect on splicing efficiency by improving the recognition of intronic boundaries. These new discoveries are contributory steps toward a broader understanding of splicing regulation and intronic/transcript evolution.

  14. Nucleotide sequence composition adjacent to intronic splice sites improves splicing efficiency via its effect on pre-mRNA local folding in fungi.

    PubMed

    Zafrir, Zohar; Tuller, Tamir

    2015-10-01

    RNA splicing is the central process of intron removal in eukaryotes known to regulate various cellular functions such as growth, development, and response to external signals. The canonical sequences indicating the splicing sites needed for intronic boundary recognition are well known. However, the roles and evolution of the local folding of intronic and exonic sequence features adjacent to splice sites has yet to be thoroughly studied. Here, focusing on four fungi (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus nidulans, and Candida albicans), we performed for the first time a comprehensive high-resolution study aimed at characterizing the encoding of intronic splicing efficiency in pre-mRNA transcripts and its effect on intron evolution. Our analysis supports the conjecture that pre-mRNA local folding strength at intronic boundaries is under selective pressure, as it significantly affects splicing efficiency. Specifically, we show that in the immediate region of 12-30 nucleotides (nt) surrounding the intronic donor site there is a preference for weak pre-mRNA folding; similarly, in the region of 15-33 nt surrounding the acceptor and branch sites there is a preference for weak pre-mRNA folding. We also show that in most cases there is a preference for strong pre-mRNA folding further away from intronic splice sites. In addition, we demonstrate that these signals are not associated with gene-specific functions, and they correlate with splicing efficiency measurements (r = 0.77, P = 2.98 × 10(-21)) and with expression levels of the corresponding genes (P = 1.24 × 10(-19)). We suggest that pre-mRNA folding strength in the above-mentioned regions has a direct effect on splicing efficiency by improving the recognition of intronic boundaries. These new discoveries are contributory steps toward a broader understanding of splicing regulation and intronic/transcript evolution. PMID:26246046

  15. Nucleotide sequence composition adjacent to intronic splice sites improves splicing efficiency via its effect on pre-mRNA local folding in fungi

    PubMed Central

    Zafrir, Zohar; Tuller, Tamir

    2015-01-01

    RNA splicing is the central process of intron removal in eukaryotes known to regulate various cellular functions such as growth, development, and response to external signals. The canonical sequences indicating the splicing sites needed for intronic boundary recognition are well known. However, the roles and evolution of the local folding of intronic and exonic sequence features adjacent to splice sites has yet to be thoroughly studied. Here, focusing on four fungi (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus nidulans, and Candida albicans), we performed for the first time a comprehensive high-resolution study aimed at characterizing the encoding of intronic splicing efficiency in pre-mRNA transcripts and its effect on intron evolution. Our analysis supports the conjecture that pre-mRNA local folding strength at intronic boundaries is under selective pressure, as it significantly affects splicing efficiency. Specifically, we show that in the immediate region of 12–30 nucleotides (nt) surrounding the intronic donor site there is a preference for weak pre-mRNA folding; similarly, in the region of 15–33 nt surrounding the acceptor and branch sites there is a preference for weak pre-mRNA folding. We also show that in most cases there is a preference for strong pre-mRNA folding further away from intronic splice sites. In addition, we demonstrate that these signals are not associated with gene-specific functions, and they correlate with splicing efficiency measurements (r = 0.77, P = 2.98 × 10−21) and with expression levels of the corresponding genes (P = 1.24 × 10−19). We suggest that pre-mRNA folding strength in the above-mentioned regions has a direct effect on splicing efficiency by improving the recognition of intronic boundaries. These new discoveries are contributory steps toward a broader understanding of splicing regulation and intronic/transcript evolution. PMID:26246046

  16. Identification of Bacteria in Formalin-Fixed, Paraffin-Embedded Heart Valve Tissue via 16S rRNA Gene Nucleotide Sequencing

    PubMed Central

    Imrit, Kavita; Goldfischer, Michael; Wang, Jie; Green, Jaime; Levine, Jerome; Lombardo, Joseph; Hong, Tao

    2006-01-01

    We applied 16S rRNA gene sequencing to identify bacterial species present in formalin-fixed, paraffin-embedded heart valve tissue. In 40% (12/30) of the cases, we were able to identify the bacterium to the species-genus level. For more recent cases (≤4 years), the success rate was significantly improved, to 70% (P < 0.001). PMID:16825394

  17. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    NASA Astrophysics Data System (ADS)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  18. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    PubMed

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  19. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  20. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from Northern California.

    PubMed

    Chae, J S; Foley, J E; Dumler, J S; Madigan, J E

    2000-04-01

    We examined 11 naturally occurring isolates of Ehrlichia equi in horses and two human granulocytic ehrlichiosis agent isolates in California for sequence diversity in three genes. Ehrlichia equi isolates were from Sierra (n = 6), Mendocino (n = 3), Sonoma (n = 1), and Marin (n = 1) counties, and human granulocytic ehrlichiosis (HGE) agent isolates were obtained from Humboldt county. PCR with specific primers for 16S rRNA, 444 Ep-ank and groESL heat shock operon genes successfully produced amplicons for all 13 clinical samples. The 444 Ep-ank gene of the HGE agent and E. equi isolates from northern California is different from the eastern U.S. isolates BDS and USG3. The translated amino acid sequence of the groESL heat shock operon gene fragment is identical among E. equi, the HGE agent, and E. phagocytophila, with the exception of the northern Californian equine CASOLJ isolate. Microheterogeneity was observed in the 16S rRNA gene sequences of HGE agent and E. equi isolates from northern California. These results suggest that E. equi and the HGE agent found in California are similar or identical but may differ from the isolates of equine and human origin found in the eastern United States. PMID:10747108

  1. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  2. Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical Legumes

    PubMed Central

    Parker, Matthew A.

    2001-01-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5′ portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5′ 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  3. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii.

  4. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  5. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui

    2007-01-01

    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  6. Structural insights into the function of aminoglycoside-resistance A1408 16S rRNA methyltransferases from antibiotic-producing and human pathogenic bacteria

    PubMed Central

    Macmaster, Rachel; Zelinskaya, Natalia; Savic, Miloje; Rankin, C. Robert; Conn, Graeme L.

    2010-01-01

    X-ray crystal structures were determined of the broad-spectrum aminoglycoside-resistance A1408 16S rRNA methyltransferases KamB and NpmA, from the aminoglycoside-producer Streptoalloteichus tenebrarius and human pathogenic Escherichia coli, respectively. Consistent with their common function, both are Class I methyltransferases with additional highly conserved structural motifs that embellish the core SAM-binding fold. In overall structure, the A1408 rRNA methyltransferase were found to be most similar to a second family of Class I methyltransferases of distinct substrate specificity (m7G46 tRNA). Critical residues for A1408 rRNA methyltransferase activity were experimentally defined using protein mutagenesis and bacterial growth assays with kanamycin. Essential residues for SAM coenzyme binding and an extended protein surface that likely interacts with the 30S ribosomal subunit were thus revealed. The structures also suggest potential mechanisms of A1408 target nucleotide selection and positioning. We propose that a dynamic extended loop structure that is positioned adjacent to both the bound SAM and a functionally critical structural motif may mediate concerted conformational changes in rRNA and protein that underpin the specificity of target selection and activation of methyltransferase activity. These new structures provide important new insights that may provide a starting point for strategies to inhibit these emerging causes of pathogenic bacterial resistance to aminoglycosides. PMID:20639535

  7. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  8. Adjacent segment disease.

    PubMed

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  9. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  10. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  11. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  12. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.

    PubMed Central

    Brosius, J; Palmer, M L; Kennedy, P J; Noller, H F

    1978-01-01

    The complete nucleotide sequence of the 16S RNA gene from the rrnB cistron of Escherichia coli has been determined by using three rapid DNA sequencing methods. Nearly all of the structure has been confirmed by two to six independent sequence determinations on both DNA strands. The length of the 16S rRNA chain inferred from the DNA sequence is 1541 nucleotides, in close agreement with previous estimates. We note discrepancies between this sequence and the most recent version of it reported from direct RNA sequencing [Ehresmann, C., Stiegler, P., Carbon, P. & Ebel, J.P. (1977) FEBS Lett. 84, 337-341]. A few of these may be explained by heterogeneity among 16S rRNA sequences from different cistrons. No nucleotide sequences were found in the 16S rRNA gene that cannot be reconciled with RNase digestion products of mature 16S rRNA. Images PMID:368799

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  14. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  15. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  16. Correlated Evolution of Nucleotide Positions within Splice Sites in Mammals.

    PubMed

    Denisov, Stepan; Bazykin, Georgii; Favorov, Alexander; Mironov, Andrey; Gelfand, Mikhail

    2015-01-01

    Splice sites (SSs)--short nucleotide sequences flanking introns--are under selection for spliceosome binding, and adhere to consensus sequences. However, non-consensus nucleotides, many of which probably reduce SS performance, are frequent. Little is known about the mechanisms maintaining such apparently suboptimal SSs. Here, we study the correlations between strengths of nucleotides occupying different positions of the same SS. Such correlations may arise due to epistatic interactions between positions (i.e., a situation when the fitness effect of a nucleotide in one position depends on the nucleotide in another position), their evolutionary history, or to other reasons. Within both the intronic and the exonic parts of donor SSs, nucleotides that increase (decrease) SS strength tend to co-occur with other nucleotides increasing (respectively, decreasing) it, consistent with positive epistasis. Between the intronic and exonic parts of donor SSs, the correlations of nucleotide strengths tend to be negative, consistent with negative epistasis. In the course of evolution, substitutions at a donor SS tend to decrease the strength of its exonic part, and either increase or do not change the strength of its intronic part. In acceptor SSs, the situation is more complicated; the correlations between adjacent positions appear to be driven mainly by avoidance of the AG dinucleotide which may cause aberrant splicing. In summary, both the content and the evolution of SSs is shaped by a complex network of interdependences between adjacent nucleotides that respond to a range of sometimes conflicting selective constraints. PMID:26642327

  17. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  18. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  19. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  20. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.

    1981-01-01

    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  1. Phylogenetic analysis based evolutionary study of 16S rRNA in known Pseudomonas sp

    PubMed Central

    Adhikari, Arindam; Nandi, Suvodip; Bhattacharya, Indrabrata; Roy, Mithu De; Mandal, Tanusri; Dutta, Subrata

    2015-01-01

    Molecular evolution analysis of 16S rRNA sequences of native Pseudomonas strains and different fluorescent pseudomonads were conducted on the basis of Molecular Evolutionary Genetics Analysis version 5.2 (MEGA5.2). Topological evaluations show common origin for native strains with other known strains with available sequences at GenBank database. Phylogenetic affiliation of different Pseudomonas sp based on 16S rRNA gene shows that molecular divergence contributes to the genetic diversity of Pseudomonas sp. Result indicate direct dynamic interactions with the rhizospheric pathogenic microbial community. The selection pressure acting on 16S rRNA gene was related to the nucleotide diversity of Pseudomonas sp in soil rhizosphere community among different agricultural crops. Besides, nucleotide diversity among the whole population was very low and tajima test statistic value (D) was also slightly positive (Tajima׳s test statistics D value 0.351). This data indicated increasing trends of infection of soil-borne pathogens under gangetic-alluvial regions of West Bengal due to high degree of nucleotide diversity with decreased population of plant growth promoting rhizobacteria like fluorescent Pseudomonads in soil. PMID:26664032

  2. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  3. Re-utilization of pyrimidine nucleotides during rat liver regeneration.

    PubMed Central

    Nikolov, E N; Dabeva, M D

    1985-01-01

    The changes in the specific radioactivities of the pool of total acid-soluble uridine nucleotides and of uridine and cytidine components of total cellular and nuclear RNA were monitored in regenerating rat liver for 12 days after partial hepatectomy. Evidence is presented for the re-utilization of pyrimidine nucleotides derived from cytoplasmic RNA degradation for the synthesis of new RNA. The extent of recycling was assessed and the true rate of rRNA turnover determined more accurately. The reutilization of the uridine components of RNA was 7.0%/day during the proliferative and 3.2%/day during the post-proliferative phase, whereas that of the cytidine nucleotides was more pronounced (9.6%/day and 18.1%/day respectively). The results reveal the existence of partial compartmentalization of pyrimidine ribonucleoside triphosphate pools in the nucleus and cytoplasm of rat liver cells. PMID:2408609

  4. Radioimmunoassay for cyclic nucleotides

    SciTech Connect

    Chiang, C.S.

    1984-02-21

    An improved radioimmunoassay for the determination of cyclic nucleotides in body fluids which comprises adding a source of divalent cation prior to assay minimizes the effects of both endogenous calcium ion and EDTA used as an anticoagulant in blood plasma samples.

  5. Nucleotide diversity in gorillas.

    PubMed Central

    Yu, Ning; Jensen-Seaman, Michael I; Chemnick, Leona; Ryder, Oliver; Li, Wen-Hsiung

    2004-01-01

    Comparison of the levels of nucleotide diversity in humans and apes may provide valuable information for inferring the demographic history of these species, the effect of social structure on genetic diversity, patterns of past migration, and signatures of past selection events. Previous DNA sequence data from both the mitochondrial and the nuclear genomes suggested a much higher level of nucleotide diversity in the African apes than in humans. Noting that the nuclear DNA data from the apes were very limited, we previously conducted a DNA polymorphism study in humans and another in chimpanzees and bonobos, using 50 DNA segments randomly chosen from the noncoding, nonrepetitive parts of the human genome. The data revealed that the nucleotide diversity (pi) in bonobos (0.077%) is actually lower than that in humans (0.087%) and that pi in chimpanzees (0.134%) is only 50% higher than that in humans. In the present study we sequenced the same 50 segments in 15 western lowland gorillas and estimated pi to be 0.158%. This is the highest value among the African apes but is only about two times higher than that in humans. Interestingly, available mtDNA sequence data also suggest a twofold higher nucleotide diversity in gorillas than in humans, but suggest a threefold higher nucleotide diversity in chimpanzees than in humans. The higher mtDNA diversity in chimpanzees might be due to the unique pattern in the evolution of chimpanzee mtDNA. From the nuclear DNA pi values, we estimated that the long-term effective population sizes of humans, bonobos, chimpanzees, and gorillas are, respectively, 10,400, 12,300, 21,300, and 25,200. PMID:15082556

  6. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  7. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    PubMed

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  8. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    PubMed

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  9. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  10. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  11. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  12. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  13. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  14. Uracil content of 16S rRNA of thermophilic and psychrophilic prokaryotes correlates inversely with their optimal growth temperatures

    PubMed Central

    Khachane, Amit N.; Timmis, Kenneth N.; dos Santos, Vítor A. P. Martins

    2005-01-01

    We report here the finding of a highly significant inverse correlation of the uracil content of 16S rRNA and the optimum growth temperature (Topt) of cultured thermophilic and psychrophilic prokaryotes. This correlation was significantly different from the weaker correlations between the contents of other nucleotides and Topt. Analysis of the 16S rRNA secondary structure regions revealed a fall in the A:U base-pair content in step with the increase in Topt that was much steeper than that of mismatched base-pairs, which are thermodynamically less stable. These findings indicate that the 16S rRNA sequences of thermophiles and psychrophiles are under a strong thermo-adaptive pressure, and that structure–function constraints play a crucial role in determining their 16S rRNA nucleotide composition. The derived relationship between uracil content and Topt was used to develop an algorithm to predict the Topt values of uncultured prokaryotes lacking cultured close relatives and belonging to the phyla predominantly containing thermophiles. This algorithm may be useful in guiding the design of cultivation conditions for hitherto uncultured microbes. PMID:16030352

  15. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.

    PubMed

    Choi, Y C; Busch, H

    1978-06-27

    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  16. Comparison of Solution Conformations and Stabilities of Modified Helix 69 rRNA Analogues from Bacteria and Human†

    PubMed Central

    Sumita, Minako; Jiang, Jun; SantaLucia, John; Chow, Christine S.

    2012-01-01

    The helix 69 (H69) region of the large subunit (28S) rRNA of H. sapiens contains five pseudouridine (Ψ) residues out of 19 total nucleotides, three of which are highly conserved. In this study, the effects of this abundant modified nucleotide on the structure and stability of H69 were compared with those of uridine in double-stranded (stem) regions. These results were compared with previous hairpin (stem plus single-stranded loop) studies in order to understand the contributions of the loop sequences to H69 structure and stability. The role of a loop nucleotide substitution from an A in bacteria (position 1918 in E. coli 23S rRNA) to a G in eukaryotes (position 3734 in H. sapiens 28S rRNA) was examined. Thermodynamic parameters for the duplex RNAs were obtained through UV melting studies, and differences in the modified and unmodified RNA structures were examined by circular dichroism spectroscopy. The overall folded structure of human H69 appears to be similar to the bacterial RNA, consistent with the idea that ribosome structure and function are highly conserved; however, our results reveal subtle differences in structure and stability between the bacterial and human H69 RNAs in both the stem and loop regions. These findings may be significant with respect to H69 as a potential drug target site. PMID:21858779

  17. [Fragment of mRNA coding part that is complementary to region 1638-1650 of wheat 18S rRNA functions as a translational enhancer].

    PubMed

    Zhigaĭlov, A V; Babaĭlova, E S; Polimbetova, N S; Graĭfer, D M; Karpova, G G; Iskakov, B K

    2012-01-01

    Possible involvement of 18S rRNA fragment 1638-1650 including basements of the helices h44 and h28 and nucleotides of the ribosomal decoding site in the cap-independent translation initiation on plant ribosomes is studied. This rRNA fragment is shown to be accessible for complementary interactions within the 40S ribosomal subunit. It is found that the sequence complementary to the 18S rRNA fragment 1638-1650 is able to enhance efficiency of a reporter mRNA translation when placed just after the initiation codon. The results obtained indicate that in the course of the cap-independent translation initiation, complementary interactions can occur between mRNA coding sequence and 18S rRNA fragment in the region of the ribosomal decoding site.

  18. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  19. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  20. Labeled nucleotide phosphate (NP) probes

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  1. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    PubMed

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  2. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  3. The rRNA and tRNA transcripts of maternally and paternally inherited mitochondrial DNAs of Mytilus galloprovincialis suggest presence of a "degradosome" in mussel mitochondria and necessitate the re-annotation of the l-rRNA/CR boundary.

    PubMed

    Kyriakou, Eleni; Chatzoglou, Evanthia; Zouros, Eleftherios; Rodakis, George C

    2014-04-25

    Species of the genus Mytilus carry two mitochondrial genomes in obligatory coexistence; one transmitted though the eggs (the F type) and one through the sperm (the M type). We have studied the 3' and 5' ends of rRNA and tRNA transcripts using RT-PCR and RNA circularization techniques in both the F and M genomes of Mytilus galloprovincialis. We have found polyadenylated and non-adenylated transcripts for both ribosomal and transfer RNAs. In all these genes the 5' ends of the transcripts coincided with the first nucleotide of the annotated genes, but the 3' ends were heterogeneous. The l-rRNA 3' end is 47 or 48 nucleotides upstream from the one assigned by a previous annotation, which makes the adjacent first domain (variable domain one, VD1) of the main control region (CR) correspondingly longer. We have observed s-rRNA and l-rRNA transcripts with truncated 3' end and polyadenylated tRNA transcripts carrying the CCA trinucleotide. We have also detected polyadenylated RNA remnants carrying the sequences of the control region, which strongly suggests RNA degradation activity and thus presence of degradosomes in Mytilus mitochondria.

  4. Phylogeny of some mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group.

    PubMed

    Pettersson, B; Uhlén, M; Johansson, K E

    1996-10-01

    Almost complete (> 96%) 16S rRNA sequences from nine ruminant mycoplasmas have been determined by solid-phase DNA sequencing. Polymorphisms were found in four of the 16S rRNA sequences, which indicated the existence of two different rRNA operons. Seven polymorphisms were found in Mycoplasma agalatiae, three were found in Mycoplasma bovis, one was found in Mycoplasma alkalescens, and one was found in Mycoplasma bovirhinis. The sequence data were used for construction of phylogenetic trees. All but one of the ruminant mycoplasmas sequenced in this work clustered in the hominis group. A close relationship was found between M. agalactiae and M. bovis, with a 99% nucleotide similarity between their 16S rRNA sequences. They were also found to be members of the Mycoplasma lipophilum cluster of the hominis group. Furthermore, the 16S rRNA comparisons showed that Mycoplasma alkalescens and Mycoplasma canadense are closely related (> 98.5%), and these species were found to cluster in the Mycoplasma hominis cluster of the hominis group. Interestingly, M. bovirhinis grouped in a new phylogenetic cluster of the hominis group. The new cluster, which was supported by bootstrap percentage values, signature nucleotide analysis, and higher-order structural elements, was named the Mycoplasma synoviae cluster. Mycoplasma bovoculi, Mycoplasma conjunctivae, and Mycoplasma ovipneumoniae clustered in the Mycoplasma neurolyticum cluster of the hominis group. Mycoplasma alvi clustered with Mycoplasma pirum in the M. pneumoniae cluster of the pneumoniae group.

  5. Methylation sites in Escherichia coli ribosomal RNA: localization and identification of four new sites of methylation in 23S rRNA.

    PubMed

    Smith, J E; Cooperman, B S; Mitchell, P

    1992-11-10

    Four previously undetermined sites of methylation are mapped in Escherichia coli 23S rRNA employing a novel combination of methods. First, using a double-isotope approach, the total number of methyl groups in 23S rRNA was determined to be 14.9 +/- 1.6. Second, hybridization of methyl-labeled rRNA to complementary DNA restriction fragments and PAGE analysis were used to purify RNA-DNA heteroduplexes and to quantify methyl groups within specific 23S rRNA fragments. Third, the methylated nucleosides in these fragments were identified and quantified using HPLC, confirming the presence of 14 methylation sites in 23S rRNA, four more than had been previously identified. In contrast, a similar set of analyses conducted on 16S rRNA gave evidence for 10 sites of methylation, at all approximate locations consistent with published 16S methylated nucleoside identities and locations. Selected regions of the 23S rRNA molecule containing previously unidentified methylated nucleosides were released by site-directed cleavage with ribonuclease H and isolated by PAGE. Sites of methylation within the RNA fragments were determined by classical oligonucleotide analyses. The four newly identified methylation sites in 23S rRNA are m2G-1835, m5C-1962, m6A-2503, and m2G at one of positions 2445-2447. Together with previously described sites of modification, these new sites form a group that is clustered in a current model for the three-dimensional organization of the 23S rRNA in the 50S ribosomal subunit, at a locus congruent with nucleotides previously implicated in ribosomal function. PMID:1384701

  6. Identification of nine sequence types of the 16S rRNA genes of Campylobacter jejuni subsp. jejuni isolated from broilers

    PubMed Central

    Hansson, Ingrid; Persson, Marianne; Svensson, Linda; Engvall, Eva Olsson; Johansson, Karl-Erik

    2008-01-01

    Background Campylobacter is the most commonly reported bacterial cause of enteritis in humans in the EU Member States and other industrialized countries. One significant source of infection is broilers and consumption of undercooked broiler meat. Campylobacter jejuni is the Campylobacter sp. predominantly found in infected humans and colonized broilers. Sequence analysis of the 16S rRNA gene is very useful for identification of bacteria to genus and species level. The objectives in this study were to determine the degree of intraspecific variation in the 16S rRNA genes of C. jejuni and C. coli and to determine whether the 16S rRNA sequence types correlated with genotypes generated by PFGE analysis of SmaI restricted genomic DNA of the strains. Methods The 16S rRNA genes of 45 strains of C. jejuni and two C. coli strains isolated from broilers were sequenced and compared with 16S rRNA sequences retrieved from the Ribosomal Database Project or GenBank. The strains were also genotyped by PFGE after digestion with SmaI. Results Sequence analyses of the 16S rRNA genes revealed nine sequence types of the Campylobacter strains and the similarities between the different sequence types were in the range 99.6–99.9%. The number of nucleotide substitutions varied between one and six among the nine 16S rRNA sequence types. One of the nine 16S rRNA sequence profiles was common to 12 of the strains from our study and two of these were identified as Campylobacter coli by PCR/REA. The other 10 strains were identified as Campylobacter jejuni. Five of the nine sequence types were also found among the Campylobacter sequences deposited in GenBank. The three 16S rRNA genes in the analysed strains were identical within each individual strain for all 47 strains. Conclusion C. jejuni and C. coli seem to lack polymorphisms in their 16S rRNA gene, but phylogenetic analysis based on 16S rRNA sequences was not always sufficient for differentiation between C. jejuni and C. coli. The strains

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  8. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  9. The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.

    PubMed

    Rubtsov, P M; Musakhanov, M M; Zakharyev, V M; Krayev, A S; Skryabin, K G; Bayev, A A

    1980-12-11

    The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.

  10. Functional importance of individual rRNA 2′-O-ribose methylations revealed by high-resolution phenotyping

    PubMed Central

    Esguerra, Jonathan; Warringer, Jonas; Blomberg, Anders

    2008-01-01

    Ribosomal RNAs contain numerous modifications at specific nucleotides. Despite their evolutionary conservation, the functional role of individual 2′-O-ribose methylations in rRNA is not known. A distinct family of small nucleolar RNAs, box C/D snoRNAs, guides the methylating complex to specific rRNA sites. Using a high-resolution phenotyping approach, we characterized 20 box C/D snoRNA gene deletions for altered growth dynamics under a wide array of environmental perturbations, encompassing intraribosomal antibiotics, inhibitors of specific cellular features, as well as general stressors. Ribosome-specific antibiotics generated phenotypes indicating different and long-ranging structural effects of rRNA methylations on the ribosome. For all studied box C/D snoRNA mutants we uncovered phenotypes to extraribosomal growth inhibitors, most frequently reflected in alteration in growth lag (adaptation time). A number of strains were highly pleiotropic and displayed a great number of sensitive phenotypes, e.g., deletion mutants of snR70 and snR71, which both have clear human homologues, and deletion mutants of snR65 and snR68. Our data indicate that individual rRNA ribose methylations can play either distinct or general roles in the workings of the ribosome. PMID:18256246

  11. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  12. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  13. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis. PMID:26618590

  14. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis.

  15. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  16. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  17. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    PubMed

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification.

  18. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation.

    PubMed

    Malygin, Alexey A; Kossinova, Olga A; Shatsky, Ivan N; Karpova, Galina G

    2013-10-01

    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES-rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors.

  19. Two genetic clusters in swine hemoplasmas revealed by analyses of the 16S rRNA and RNase P RNA genes.

    PubMed

    Watanabe, Yusaku; Fujihara, Masatoshi; Obara, Hisato; Nagai, Kazuya; Harasawa, Ryô

    2011-12-01

    Only two hemoplasma species, Eperythrozoon parvum and Mycoplasma suis, have been recognized in pigs. Here we demonstrate the genetic variations among six hemoplasma strains detected from pigs, by analyzing the 16S rRNA and RNase P RNA (rnpB) genes, and propose a novel hemoplasma taxon that has not been described previously. Phylogenetic trees based on the nucleotide sequence of the 16S rRNA gene indicated that these six hemoplasmas were divided into two clusters representing M. suis and a novel taxon. We further examined the primary and secondary structures of the nucleotide sequences of the rnpB gene of the novel taxon, and found it distinct from that of M. suis. In conclusion, we unveiled a genetic cluster distinct from M. suis, suggesting a new swine hemoplasma species or E. parvum. Our findings also suggest that this novel cluster should be included in the genus Mycoplasma.

  20. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  1. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    PubMed

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  2. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  3. Intragenomic heterogeneity and intergenomic recombination among Vibrio parahaemolyticus 16S rRNA genes.

    PubMed

    Harth, Erika; Romero, Jaime; Torres, Rafael; Espejo, Romilio T

    2007-08-01

    Vibrio parahaemolyticus is a marine bacterium bearing 11 copies of ribosomal operons. In some strains, such as RIMD2210633, the genome includes identical copies of 16S rRNA genes (rrs). However, it is known that other strains of the species, such as strains ATCC 17802 and RIMD2210856, show conspicuous intragenomic rrs heterogeneity. The extent and diversity of the rrs heterogeneity in V. parahaemolyticus were studied in further detail by characterization of the rrs copies in environmental isolates belonging to 21 different genotype groups. Thirteen of these groups showed intragenomic heterogeneity, containing altogether 16 sequences differing within a 25 bp segment of their rrs. These sequences grouped into four clusters differing in at least four nucleotide sites. Some isolates contained rrs alleles from up to three different clusters. Each segment sequence conserved the stem-loop characteristic of the 16S rRNA structure of this 25 bp sequence. The double-stranded stem sequence was quite variable, but almost every variation had a compensatory change to maintain seven to eight paired bases. Conversely, the single-strand loop sequence was conserved. The results may be explained as a consequence of recombination among rrs evolving in different bacteria. The results suggest that intergenomic rrs recombination is very high in V. parahaemolyticus and that it occurs solely among Vibrio species. This high rrs homologous intergenomic recombination could be an effective mechanism to maintain intragenomic rrs cohesion, mediating the dispersal of the most abundant rrs version among the 11 intragenomic loci. PMID:17660428

  4. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  5. On the time-course of adjacent and non-adjacent transposed-letter priming

    PubMed Central

    Ktori, Maria; Kingma, Brechtsje; Hannagan, Thomas; Holcomb, Phillip J.; Grainger, Jonathan

    2014-01-01

    We compared effects of adjacent (e.g., atricle-ARTICLE) and non-adjacent (e.g., actirle-ARTICLE) transposed-letter (TL) primes in an ERP study using the sandwich priming technique. TL priming was measured relative to the standard double-substitution condition. We found significantly stronger priming effects for adjacent transpositions than non-adjacent transpositions (with 2 intervening letters) in behavioral responses (lexical decision latencies), and the adjacent priming effects emerged earlier in the ERP signal, at around 200 ms post-target onset. Non-adjacent priming effects emerged about 50 ms later and were short-lived, being significant only in the 250-300 ms time-window. Adjacent transpositions on the other hand continued to produce priming in the N400 time-window (300-500 ms post-target onset). This qualitatively different pattern of priming effects for adjacent and non-adjacent transpositions is discussed in the light of different accounts of letter transposition effects, and the utility of drawing a distinction between positional flexibility and positional noise. PMID:25364497

  6. The EMBL nucleotide sequence database.

    PubMed Central

    Stoesser, G; Moseley, M A; Sleep, J; McGowran, M; Garcia-Pastor, M; Sterk, P

    1998-01-01

    The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl. html ) constitutes Europe's primary nucleotide sequence resource. DNA and RNA sequences are directly submitted from researchers and genome sequencing groups and collected from the scientific literature and patent applications (Fig. 1). In collaboration with DDBJ and GenBank the database is produced, maintained and distributed at the European Bioinformatics Institute. Database releases are produced quarterly and are distributed on CD-ROM. EBI's network services allow access to the most up-to-date data collection via Internet and World Wide Web interface, providing database searching and sequence similarity facilities plus access to a large number of additional databases. PMID:9399791

  7. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  8. Necessary relations for nucleotide frequencies.

    PubMed

    Sinclair, Robert

    2015-06-01

    Genome composition analysis of di-, tri- and tetra-nucleotide frequencies is known to be evolutionarily informative, and useful in metagenomic studies, where binning of raw sequence data is often an important first step. Patterns appearing in genome composition analysis may be due to evolutionary processes or purely mathematical relations. For example, the total number of dinucleotides in a sequence is equal to the sum of the individual totals of the sixteen types of dinucleotide, and this is entirely independent of any assumptions made regarding mutation or selection, or indeed any physical or chemical process. Before any statistical analysis can be attempted, a knowledge of all necessary mathematical relations is required. I show that 25% of di-, tri- and tetra-nucleotide frequencies can be written as simple sums and differences of the remainder. The vast majority of organisms have circular genomes, for which these relations are exact and necessary. In the case of linear molecules, the absolute error is very nearly zero, and does not grow with contiguous sequence length. As a result of the new, necessary relations presented here, the foundations of the statistical analysis of di-, tri- and tetra-nucleotide frequencies, and k-mer analysis in general, need to be revisited.

  9. Necessary relations for nucleotide frequencies.

    PubMed

    Sinclair, Robert

    2015-06-01

    Genome composition analysis of di-, tri- and tetra-nucleotide frequencies is known to be evolutionarily informative, and useful in metagenomic studies, where binning of raw sequence data is often an important first step. Patterns appearing in genome composition analysis may be due to evolutionary processes or purely mathematical relations. For example, the total number of dinucleotides in a sequence is equal to the sum of the individual totals of the sixteen types of dinucleotide, and this is entirely independent of any assumptions made regarding mutation or selection, or indeed any physical or chemical process. Before any statistical analysis can be attempted, a knowledge of all necessary mathematical relations is required. I show that 25% of di-, tri- and tetra-nucleotide frequencies can be written as simple sums and differences of the remainder. The vast majority of organisms have circular genomes, for which these relations are exact and necessary. In the case of linear molecules, the absolute error is very nearly zero, and does not grow with contiguous sequence length. As a result of the new, necessary relations presented here, the foundations of the statistical analysis of di-, tri- and tetra-nucleotide frequencies, and k-mer analysis in general, need to be revisited. PMID:25843217

  10. Applications of adenine nucleotide measurements in oceanography

    NASA Technical Reports Server (NTRS)

    Holm-Hansen, O.; Hodson, R.; Azam, F.

    1975-01-01

    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  11. Gram-positive bacteria with a high DNA G+C content are characterized by a common insertion within their 23S rRNA genes.

    PubMed

    Roller, C; Ludwig, W; Schleifer, K H

    1992-06-01

    An insertion of about 100 bases within the central part of the 23S rRNA genes was found to be a phylogenetic marker for the bacterial line of descent of Gram-positive bacteria with a high DNA G + C content. The insertion was present in 23S rRNA genes of 64 strains representing the major phylogenetic groups of Gram-positive bacteria with a high DNA G+C content, whereas it was not found in 23S rRNA genes of 55 (eu)bacteria representing Gram-positive bacteria with a low DNA G + C content and all other known (eu)bacterial phyla. The presence of the insertion could be easily demonstrated by comparative gel electrophoretic analysis of in vitro-amplified 23S rDNA fragments, which contained the insertion. The nucleotide sequences of the amplified fragments were determined and sequence similarities of at least 44% were found. The overall similarity values are lower than those of 16S and 23S rRNA sequences of the particular organism. Northern hybridization experiments indicated the presence of the insertion within the mature 23S rRNA of Corynebacterium glutamicum.

  12. Peptide inhibitors of peptidyltransferase alter the conformation of domains IV and V of large subunit rRNA: a model for nascent peptide control of translation.

    PubMed Central

    Harrod, R; Lovett, P S

    1995-01-01

    Peptides of 5 and 8 residues encoded by the leaders of attenuation regulated chloramphenicol-resistance genes inhibit the peptidyltransferase of microorganisms from the three kingdoms. Therefore, the ribosomal target for the peptides is likely to be a conserved structure and/or sequence. The inhibitor peptides "footprint" to nucleotides of domain V in large subunit rRNA when peptide-ribosome complexes are probed with dimethyl sulfate. Accordingly, rRNA was examined as a candidate for the site of peptide binding. Inhibitor peptides MVKTD and MSTSKNAD were mixed with rRNA phenol-extracted from Escherichia coli ribosomes. The conformation of the RNA was then probed by limited digestion with nucleases that cleave at single-stranded (T1 endonuclease) and double-stranded (V1 endonuclease) sites. Both peptides selectively altered the susceptibility of domains IV and V of 23S rRNA to digestion by T1 endonuclease. Peptide effects on cleavage by V1 nuclease were observed only in domain V. The T1 nuclease susceptibility of domain V of in vitro-transcribed 23S rRNA was also altered by the peptides, demonstrating that peptide binding to the rRNA is independent of ribosomal protein. We propose the peptides MVKTD and MSTSKNAD perturb peptidyltransferase center catalytic activities by altering the conformation of domains IV and V of 23S rRNA. These findings provide a general mechanism through which nascent peptides may cis-regulate the catalytic activities of translating ribosomes. Images Fig. 1 Fig. 2 Fig. 4 PMID:7567991

  13. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0.

    PubMed

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5'-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site.

  14. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  15. MINARETS WILDERNESS AND ADJACENT AREAS, CALIFORNIA.

    USGS Publications Warehouse

    Huber, N. King; Thurber, Horace K.

    1984-01-01

    A mineral survey of the Minarets Wilderness and adjacent areas in the central Sierra Nevada, California was conducted. The results of the survey indicate that the study area has a substantiated resource potential for small deposits of copper, silver, zinc, lead, and iron, and a probable mineral-resource potential for molybdenum. No energy-resource potential was identified in the study.

  16. 46 CFR 148.445 - Adjacent spaces.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES CARRIAGE OF BULK SOLID MATERIALS... transporting a material that Table 148.10 of this part associates with a reference to this section, the following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by...

  17. 46 CFR 148.445 - Adjacent spaces.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES CARRIAGE OF BULK SOLID MATERIALS... transporting a material that Table 148.10 of this part associates with a reference to this section, the following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by...

  18. 46 CFR 148.445 - Adjacent spaces.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES CARRIAGE OF BULK SOLID MATERIALS... transporting a material that Table 148.10 of this part associates with a reference to this section, the following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by...

  19. 46 CFR 148.445 - Adjacent spaces.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES CARRIAGE OF BULK SOLID MATERIALS... transporting a material that Table 148.10 of this part associates with a reference to this section, the following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by...

  20. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    PubMed

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  1. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.

    PubMed

    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  2. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  3. The Cfr rRNA Methyltransferase Confers Resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A Antibiotics

    PubMed Central

    Long, Katherine S.; Poehlsgaard, Jacob; Kehrenberg, Corinna; Schwarz, Stefan; Vester, Birte

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and recently shown to encode a methyltransferase that modifies 23S rRNA at A2503. Antimicrobial susceptibility testing shows that S. aureus and E. coli strains expressing the cfr gene exhibit elevated MICs to a number of chemically unrelated drugs. The phenotype is named PhLOPSA for resistance to the following drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind to overlapping sites at the peptidyl transferase center that abut nucleotide A2503, is perturbed upon Cfr-mediated methylation. Decreased drug binding to Cfr-methylated ribosomes has been confirmed by footprinting analysis. No other rRNA methyltransferase is known to confer resistance to five chemically distinct classes of antimicrobials. In addition, the findings described in this study represent the first report of a gene conferring transferable resistance to pleuromutilins and oxazolidinones. PMID:16801432

  4. ComB: SNP calling and mapping analysis for color and nucleotide space platforms.

    PubMed

    Souaiaia, Tade; Frazier, Zach; Chen, Ting

    2011-06-01

    The determination of single nucleotide polymorphisms (SNPs) has become faster and more cost effective since the advent of short read data from next generation sequencing platforms such as Roche's 454 Sequencer, Illumina's Solexa platform, and Applied Biosystems SOLiD sequencer. The SOLiD sequencing platform, which is capable of producing more than 6 GB of sequence data in a single run, uses a unique encoding scheme where color reads represent transitions between adjacent nucleotides. The determination of SNPs from color reads usually involves the translation of color alignments to likely nucleotide strings to facilitate the use of tools designed for nucleotide reads. This technique results in the loss of significant information in the color read, producing many incorrect SNP calls, especially if regions exist with dense or adjacent polymorphism. Additionally, color reads align ambiguously and incorrectly more often than nucleotide reads making integrated SNP calling a difficult challenge. We have developed ComB, a SNP calling tool which operates directly in color space, using a Bayesian model to incorporate unique and ambiguous reads to iteratively determine SNP identity. ComB is capable of accurately calling short consecutive nucleotide polymorphisms and densely clustered SNPs; both of which other SNP calling tools fail to identify. ComB, which is capable of using billions of short reads to accurately and efficiently perform whole human genome SNP calling in parallel, is also capable of using sequence data or even integrating sequence and color space data sets. We use real and simulated data to demonstrate that ComB's iterative strategy and recalibration of quality scores allow it to discover more true SNPs while calling fewer false positives than tools which use only color alignments as well as tools which translate color reads to nucleotide strings.

  5. Nucleotide release by airway epithelia.

    PubMed

    Lazarowski, Eduardo R; Sesma, Juliana I; Seminario, Lucia; Esther, Charles R; Kreda, Silvia M

    2011-01-01

    The purinergic events regulating the airways' innate defenses are initiated by the release of purines from the epithelium, which occurs constitutively and is enhanced by chemical or mechanical stimulation. While the external triggers have been reviewed exhaustively, this chapter focuses on current knowledge of the receptors and signaling cascades mediating nucleotide release. The list of secreted purines now includes ATP, ADP, AMP and nucleotide sugars, and involves at least three distinct mechanisms reflecting the complexity of airway epithelia. First, the constitutive mechanism involves ATP translocation to the ER/Golgi complex as energy source for protein folding, and fusion of Golgi-derived vesicles with the plasma membrane. Second, goblet cells package ATP with mucins into granules, which are discharged in response to P2Y(2)R activation and Ca(2+)-dependent signaling pathways. Finally, non-mucous cells support a regulated mechanism of ATP release involving protease activated receptor (PAR)-elicited G(12/13) activation, leading to the RhoGEF-mediated exchange of GDP for GTP on RhoA, and cytoskeleton rearrangement. Together, these pathways provide fine tuning of epithelial responses regulated by purinergic signaling events. PMID:21560042

  6. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  7. A suppressor of mutations in the region adjacent to iterons of pSC101 ori.

    PubMed Central

    Ohkubo, S; Yamaguchi, K

    1997-01-01

    Some single-base changes in a 14-bp region (the downstream region) adjacent to three repeated sequences (iterons) in pSC101 ori are very deleterious for replication. We isolated a host suppressor mutation for one of these mutations and found that the suppressor suppressed all the mutations tested in the downstream region. The nucleotide sequence of the suppressor revealed that the suppressor gene was identical to dksA, which encodes a multicopy suppressor of the heat shock gene dnaK. PMID:9068662

  8. Adjacent Segment Pathology after Lumbar Spinal Fusion.

    PubMed

    Lee, Jae Chul; Choi, Sung-Woo

    2015-10-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  9. Adjacent Segment Pathology after Lumbar Spinal Fusion

    PubMed Central

    Lee, Jae Chul

    2015-01-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  10. Adjacent Segment Pathology after Anterior Cervical Fusion.

    PubMed

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-06-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion.

  11. Adjacent Segment Pathology after Anterior Cervical Fusion

    PubMed Central

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon

    2016-01-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion. PMID:27340541

  12. The effect of imidazole, cyanamide, and polyornithine on the condensation of nucleotides in aqueous systems.

    NASA Technical Reports Server (NTRS)

    Ibanez, J.; Kimball, A. P.; Oro, J.

    1971-01-01

    Development of two models for the condensation of nucleotides under possibly prebiotic conditions. In the first of these models this type of reaction is promoted by the presence of imidazole and substituted imidazole compounds. The second model involves the condensation of mononucleotides with cyanamide in the presence and absence of a prototemplate such as polyornithine. A tentative mechanism for the role of imidazole catalysis in phosphodiester bond formation between adjacent TMP molecules is suggested.

  13. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.

    PubMed

    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun

    2011-02-01

    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  14. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  15. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones. PMID:24681200

  16. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones.

  17. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  18. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  19. Bacterial community composition in Brazilian Anthrosols and adjacent soils characterized using culturing and molecular identification.

    PubMed

    O'Neill, B; Grossman, J; Tsai, M T; Gomes, J E; Lehmann, J; Peterson, J; Neves, E; Thies, J E

    2009-07-01

    Microbial community composition was examined in two soil types, Anthrosols and adjacent soils, sampled from three locations in the Brazilian Amazon. The Anthrosols, also known as Amazonian dark earths, are highly fertile soils that are a legacy of pre-Columbian settlement. Both Anthrosols and adjacent soils are derived from the same parent material and subject to the same environmental conditions, including rainfall and temperature; however, the Anthrosols contain high levels of charcoal-like black carbon from which they derive their dark color. The Anthrosols typically have higher cation exchange capacity, higher pH, and higher phosphorus and calcium contents. We used culture media prepared from soil extracts to isolate bacteria unique to the two soil types and then sequenced their 16S rRNA genes to determine their phylogenetic placement. Higher numbers of culturable bacteria, by over two orders of magnitude at the deepest sampling depths, were counted in the Anthrosols. Sequences of bacteria isolated on soil extract media yielded five possible new bacterial families. Also, a higher number of families in the bacteria were represented by isolates from the deeper soil depths in the Anthrosols. Higher bacterial populations and a greater diversity of isolates were found in all of the Anthrosols, to a depth of up to 1 m, compared to adjacent soils located within 50-500 m of their associated Anthrosols. Compared to standard culture media, soil extract media revealed diverse soil microbial populations adapted to the unique biochemistry and physiological ecology of these Anthrosols. PMID:19381712

  20. CLUSTOM: a novel method for clustering 16S rRNA next generation sequences by overlap minimization.

    PubMed

    Hwang, Kyuin; Oh, Jeongsu; Kim, Tae-Kyung; Kim, Byung Kwon; Yu, Dong Su; Hou, Bo Kyeng; Caetano-Anollés, Gustavo; Hong, Soon Gyu; Kim, Kyung Mo

    2013-01-01

    The recent nucleic acid sequencing revolution driven by shotgun and high-throughput technologies has led to a rapid increase in the number of sequences for microbial communities. The availability of 16S ribosomal RNA (rRNA) gene sequences from a multitude of natural environments now offers a unique opportunity to study microbial diversity and community structure. The large volume of sequencing data however makes it time consuming to assign individual sequences to phylotypes by searching them against public databases. Since ribosomal sequences have diverged across prokaryotic species, they can be grouped into clusters that represent operational taxonomic units. However, available clustering programs suffer from overlap of sequence spaces in adjacent clusters. In natural environments, gene sequences are homogenous within species but divergent between species. This evolutionary constraint results in an uneven distribution of genetic distances of genes in sequence space. To cluster 16S rRNA sequences more accurately, it is therefore essential to select core sequences that are located at the centers of the distributions represented by the genetic distance of sequences in taxonomic units. Based on this idea, we here describe a novel sequence clustering algorithm named CLUSTOM that minimizes the overlaps between adjacent clusters. The performance of this algorithm was evaluated in a comparative exercise with existing programs, using the reference sequences of the SILVA database as well as published pyrosequencing datasets. The test revealed that our algorithm achieves higher accuracy than ESPRIT-Tree and mothur, few of the best clustering algorithms. Results indicate that the concept of an uneven distribution of sequence distances can effectively and successfully cluster 16S rRNA gene sequences. The algorithm of CLUSTOM has been implemented both as a web and as a standalone command line application, which are available at http://clustom.kribb.re.kr.

  1. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  2. Mosaic organization of DNA nucleotides

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

    1994-01-01

    Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

  3. Nucleotide excision repair in humans.

    PubMed

    Spivak, Graciela

    2015-12-01

    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  4. ATCG nucleotide fluctuation of Deinococcus radiodurans radiation genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Subramaniam, R.; Sullivan, R.; Cheung, E.; Schneider, C.; Tremberger, G., Jr.; Flamholz, A.; Lieberman, D. H.; Cheung, T. D.

    2007-09-01

    The radiation resistance-repair genes in Deinococcus radiodurans (DR) and E-coli were analyzed in terms of the A, T, C, G nucleotide fluctuations. The studied genes were Rec-A, Rec-Q, and the unique DR PprA gene. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis. Fractal analysis using the Higuchi method gave a fractal dimension increase of the Deinococcus radiodurans genes as compared to E-coli, which is comparable to the enhancement observed in the human HAR1 region (HAR1F gene) over that of the chimpanzee. Near neighbor fluctuation was also studied via the Black-Scholes model where the increment sequence was treated as a random walk series. The Deinococcus radiodurans radiation gene standard deviations were consistently higher than that of the E-coli deviations, and agree with the fractal analysis results. The sequence stacking interaction was studied using the published nucleotide-pair melting free energy values and Deinococcus radiodurans radiation genes were shown to possess larger negative free energies. The high sensitivity of the fractal dimension as a biomarker was tested with correlation analysis of the gamma ray dose versus fractal dimension, and the R square values were found to be above 0.9 (N=5). When compared with other nucleotide sequences such as the rRNA sequences, HAR1 and its chimpanzee counterpart, the higher fluctuation (correlated randomness) and larger negative free energy of a DR radiation gene suggested that a radiation resistance-repair sequence exhibited higher complexity. As the HAR1 nucleotide sequence complexity and its transcription activity of co-expressing cortex protein reelin supported a positive selection event in humans, a similar inference of positive selection of coding genes could be drawn for Deinococcus radiodurans when compared to E-coli. The origin of such a positive selection would be consistent with that of a

  5. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  6. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  7. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    PubMed

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  8. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    PubMed

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds. PMID:26189016

  9. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    PubMed

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  10. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.

    PubMed

    Choe, C P; Hancock, J M; Hwang, U W; Kim, W

    1999-12-01

    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  11. Silenced rRNA genes are activated and substitute for partially eliminated active homeologs in the recently formed allotetraploid, Tragopogon mirus (Asteraceae).

    PubMed

    Dobešová, E; Malinská, H; Matyášek, R; Leitch, A R; Soltis, D E; Soltis, P S; Kovařík, A

    2015-03-01

    To study the relationship between uniparental rDNA (encoding 18S, 5.8S and 26S ribosomal RNA) silencing (nucleolar dominance) and rRNA gene dosage, we studied a recently emerged (within the last 80 years) allotetraploid Tragopogon mirus (2n=24), formed from the diploid progenitors T. dubius (2n=12, D-genome donor) and T. porrifolius (2n=12, P-genome donor). Here, we used molecular, cytogenetic and genomic approaches to analyse rRNA gene activity in two sibling T. mirus plants (33A and 33B) with widely different rRNA gene dosages. Plant 33B had ~400 rRNA genes at the D-genome locus, which is typical for T. mirus, accounting for ~25% of total rDNA. We observed characteristic expression dominance of T. dubius-origin genes in all organs. Its sister plant 33A harboured a homozygous macrodeletion that reduced the number of T. dubius-origin genes to about 70 copies (~4% of total rDNA). It showed biparental rDNA expression in root, flower and callus, but not in leaf where D-genome rDNA dominance was maintained. There was upregulation of minor rDNA variants in some tissues. The RNA polymerase I promoters of reactivated T. porrifolius-origin rRNA genes showed reduced DNA methylation, mainly at symmetrical CG and CHG nucleotide motifs. We hypothesise that active, decondensed rDNA units are most likely to be deleted via recombination. The silenced homeologs could be used as a 'first reserve' to ameliorate mutational damage and contribute to evolutionary success of polyploids. Deletion and reactivation cycles may lead to bidirectional homogenisation of rRNA arrays in the long term. PMID:25537492

  12. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    PubMed

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  13. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples. PMID:17596183

  14. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.

    PubMed

    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar

    2015-08-01

    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9. PMID:25871924

  15. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.

    PubMed

    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar

    2015-08-01

    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9.

  16. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  17. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences.

    PubMed

    Wright, Erik S; Yilmaz, L Safak; Noguera, Daniel R

    2012-02-01

    DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu).

  18. Long-range correlations in nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Peng, C.-K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-03-01

    DNA SEQUENCES have been analysed using models, such as an it-step Markov chain, that incorporate the possibility of short-range nucleotide correlations1. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  19. Long-range correlations in nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-01-01

    DNA sequences have been analysed using models, such as an n-step Markov chain, that incorporate the possibility of short-range nucleotide correlations. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  20. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.

    PubMed

    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser

    2016-01-01

    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships.

  1. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.

    PubMed

    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser

    2016-01-01

    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships. PMID:27149706

  2. Single nucleotide markers of D-loop for identification of Indian wild pig (Sus scrofa cristatus)

    PubMed Central

    Srivastava, Gaurav Kumar; Rajput, Nidhi; Jadav, Kajal Kumar; Shrivastav, Avadh Bihari; Joshi, Himanshu R.

    2015-01-01

    Aim: Partial fragment of D-loop region extending from 35 to 770 were compared with corresponding sequences of 16 wild pigs and 9 domestic pig breeds from different parts of the world for detection of single nucleotide polymorphism (SNP) markers in the region. The paper also reappraises SNP markers from two fragments of cytochrome b gene and a fragment 12S rRNA gene distinguishing the Indian wild pig from other pig species of the world. Materials and Methods: Deoxyribonucleic acid (DNA) was isolated from 14 and 12 tissue samples of Indian wild and domestic pigs, respectively, collected from Central India for characterization of the D-loop DNA sequences using universal primers. The sequences obtained were aligned along with the retrieved sequences to analyze species-specific SNP marker. Results: A total of 58 mitochondrial D-loop gene sequences of pig races were aligned to identify 1349 polymorphic sites in the fragment from nucleotide positions 35-770 bp and four SNP markers were identified to differentiate Indian wild pig from all the sequences investigated in this study. With the inclusion of cytochrome b gene and 12S rRNA gene fragments, the present study contributes to the total 15 SNP markers, which have been identified in the mitochondrial fragment of 1936 bp for identification of Indian wild pig. Conclusion: SNP markers have advantages over other marker types and do not require subsequent standardization to compare data across studies or laboratories. PMID:27047129

  3. Examination of ClpB Quaternary Structure and Linkage to Nucleotide Binding.

    PubMed

    Lin, JiaBei; Lucius, Aaron L

    2016-03-29

    Escherichia coli caseinolytic peptidase B (ClpB) is a molecular chaperone with the unique ability to catalyze protein disaggregation in collaboration with the KJE system of chaperones. Like many AAA+ molecular motors, ClpB assembles into hexameric rings, and this reaction is thermodynamically linked to nucleotide binding. Here we show that ClpB exists in a dynamic equilibrium of monomers, dimers, tetramers, and hexamers in the presence of both limiting and excess ATPγS. We find that ClpB monomer is only able to bind one nucleotide, whereas all 12 sites in the hexameric ring are bound by nucleotide at saturating concentrations. Interestingly, dimers and tetramers exhibit stoichiometries of ∼3 and 7, respectively, which is one fewer than the maximum number of binding sites in the formed oligomer. This observation suggests an open conformation for the intermediates based on the need for an adjacent monomer to fully form the binding pocket. We also report the protein-protein interaction constants for dimers, tetramers, and hexamers and their dependencies on nucleotide. These interaction constants make it possible to predict the concentration of hexamers present and able to bind to cochaperones and polypeptide substrates. Such information is essential for the interpretation of many in vitro studies. Finally, the strategies presented here are broadly applicable to a large number of AAA+ molecular motors that assemble upon nucleotide binding and interact with partner proteins. PMID:26891079

  4. Structural Rearrangements in the Active Site of the Thermus thermophilus 16S rRNA Methyltransferase KsgA in a Binary Complex with 5'-Methylthioadenosine

    SciTech Connect

    Demirci, H.; Belardinelli, R; Seri, E; Gregory, S; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    Posttranscriptional modification of ribosomal RNA (rRNA) occurs in all kingdoms of life. The S-adenosyl-l-methionine-dependent methyltransferase KsgA introduces the most highly conserved rRNA modification, the dimethylation of A1518 and A1519 of 16S rRNA. Loss of this dimethylation confers resistance to the antibiotic kasugamycin. Here, we report biochemical studies and high-resolution crystal structures of KsgA from Thermus thermophilus. Methylation of 30S ribosomal subunits by T. thermophilus KsgA is more efficient at low concentrations of magnesium ions, suggesting that partially unfolded RNA is the preferred substrate. The overall structure is similar to that of other methyltransferases but contains an additional ?-helix in a novel N-terminal extension. Comparison of the apoenzyme with complex structures with 5?-methylthioadenosine or adenosine bound in the cofactor-binding site reveals novel features when compared with related enzymes. Several mobile loop regions that restrict access to the cofactor-binding site are observed. In addition, the orientation of residues in the substrate-binding site indicates that conformational changes are required for binding two adjacent residues of the substrate rRNA.

  5. Exchange coupling between laterally adjacent nanomagnets

    NASA Astrophysics Data System (ADS)

    Dey, H.; Csaba, G.; Bernstein, G. H.; Porod, W.

    2016-09-01

    We experimentally demonstrate exchange-coupling between laterally adjacent nanomagnets. Our results show that two neighboring nanomagnets that are each antiferromagnetically exchange-coupled to a common ferromagnetic bottom layer can be brought into strong ferromagnetic interaction. Simulations show that interlayer exchange coupling effectively promotes ferromagnetic alignment between the two nanomagnets, as opposed to antiferromagnetic alignment due to dipole-coupling. In order to experimentally demonstrate the proposed scheme, we fabricated arrays of pairs of elongated, single-domain nanomagnets. Magnetic force microscopy measurements show that most of the pairs are ferromagnetically ordered. The results are in agreement with micromagnetic simulations. The presented scheme can achieve coupling strengths that are significantly stronger than dipole coupling, potentially enabling far-reaching applications in Nanomagnet Logic, spin-wave devices and three-dimensional storage and computing.

  6. Boundary Layers of Air Adjacent to Cylinders

    PubMed Central

    Nobel, Park S.

    1974-01-01

    Using existing heat transfer data, a relatively simple expression was developed for estimating the effective thickness of the boundary layer of air surrounding cylinders. For wind velocities from 10 to 1000 cm/second, the calculated boundary-layer thickness agreed with that determined for water vapor diffusion from a moistened cylindrical surface 2 cm in diameter. It correctly predicted the resistance for water vapor movement across the boundary layers adjacent to the (cylindrical) inflorescence stems of Xanthorrhoea australis R. Br. and Scirpus validus Vahl and the leaves of Allium cepa L. The boundary-layer thickness decreased as the turbulence intensity increased. For a turbulence intensity representative of field conditions (0.5) and for νwindd between 200 and 30,000 cm2/second (where νwind is the mean wind velocity and d is the cylinder diameter), the effective boundary-layer thickness in centimeters was equal to [Formula: see text]. PMID:16658855

  7. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake...

  8. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake...

  9. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake...

  10. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake...

  11. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake...

  12. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    PubMed Central

    Fasullo, Michael; Endres, Lauren

    2015-01-01

    Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP) produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases. PMID:25923076

  13. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  14. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  15. Phylogenetic positions of Clostridium chauvoei and Clostridium septicum based on 16S rRNA gene sequences.

    PubMed

    Kuhnert, P; Capaul, S E; Nicolet, J; Frey, J

    1996-10-01

    The sequences of the 16S rRNA genes (rrs genes) of Clostridium chauvoei, the causative agent of blackleg in cattle, and the phenotypically related organism Clostridium septicum were determined. After amplification of 1,507-bp PCR fragments from the corresponding rrs genes, the sequences were determined in a single round of sequencing by using conserved region primers. A sequence similarity analysis of the sequences revealed the close phylogenetic relationship of C. chauvoei and C. septicum in Clostridium cluster I (M. D. Collins, P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994), which includes Clostridium carnis, Clostridium perfringens, Clostridium botulinum, and Clostridium tetani. We found that 99.3% of the nucleotides in the genes of C. chauvoei and C. septicum are identical.

  16. Phylogenetic relationships of Blepharisma americanum and Colpoda inflata within the phylum ciliophora inferred from complete small subunit rRNA gene sequences.

    PubMed

    Greenwood, S J; Schlegel, M; Sogin, M L; Lynn, D H

    1991-01-01

    The complete small subunit rRNA gene sequences of the heterotrich Blepharisma americanum and the colpodid Colpoda inflata were determined to be 1719 and 1786 nucleotides respectively. The phylogeny produced by comparisons with other ciliates indicated that C. inflata is allied more closely with the nassophoreans and oligohymenophoreans than the spirotrichs. This is consistent with the placement of the colpodids in the Class Copodea. Blepharisma americanum was not grouped with the hypotrichs but instead was placed as the earliest branching ciliate. The distinct separation of B. americanum supports the elevation to class status given the heterotrichs based on morphological characters.

  17. Single Nucleotide Polymorphisms and Osteoarthritis

    PubMed Central

    Wang, Ting; Liang, Yuting; Li, Hong; Li, Haibo; He, Quanze; Xue, Ying; Shen, Cong; Zhang, Chunhua; Xiang, Jingjing; Ding, Jie; Qiao, Longwei; Zheng, Qiping

    2016-01-01

    Abstract Osteoarthritis (OA) is a complex disorder characterized by degenerative articular cartilage and is largely attributed to genetic risk factors. Single nucleotide polymorphisms (SNPs) are common DNA variants that have shown promising and efficiency, compared with positional cloning, to map candidate genes of complex diseases, including OA. In this study, we aim to provide an overview of multiple SNPs from a number of genes that have recently been linked to OA susceptibility. We also performed a comprehensive meta-analysis to evaluate the association of SNP rs7639618 of double von Willebrand factor A domains (DVWA) gene with OA susceptibility. A systematic search of studies on the association of SNPs with susceptibility to OA was conducted in PubMed and Google scholar. Studies subjected to meta-analysis include human and case-control studies that met the Hardy–Weinberg equilibrium model and provide sufficient data to calculate an odds ratio (OR). A total of 9500 OA cases and 9365 controls in 7 case-control studies relating to SNP rs7639618 were included in this study and the ORs with 95% confidence intervals (CIs) were calculated. Over 50 SNPs from different genes have been shown to be associated with either hip (23), or knee (20), or both (13) OA. The ORs of these SNPs for OA and the subtypes are not consistent. As to SNP rs7639618 of DVWA, increased knee OA risk was observed in all genetic models analyzed. Specifically, people from Asian with G-allele showed significantly increased risk of knee OA (A versus G: OR = 1.28, 95% CI 1.13–1.46; AA versus GG: OR = 1.60, 95% CI 1.25–2.05; GA versus GG: OR = 1.31, 95% CI 1.18–1.44; AA versus GA+GG: OR = 1.34, 95% CI 1.12–1.61; AA+GA versus GG: OR = 1.40, 95% CI 1.19–1.64), but not in Caucasians or with hip OA. Our results suggest that multiple SNPs play different roles in the pathogenesis of OA and its subtypes; SNP rs7639618 of DVWA gene is associated with a significantly increased

  18. Functional analysis of the residues C770 and G771 of E. coli 16S rRNA implicated in forming the intersubunit bridge B2c of the ribosome.

    PubMed

    Kim, Hong-Man; Yeom, Ji-Hyun; Ha, Hye-Jung; Kim, Jong-Myung; Lee, Kangseok

    2007-07-01

    Structural analyses have shown that nucleotides at the positions 770 and 771 of Escherichia coli 16S rRNA are implicated in forming one of highly conserved intersubunit bridges of the ribosome, B2c. To examine a functional role of these residues, base substitutions were introduced at these positions and mutant ribosomes were analyzed for their protein synthesis ability using a specialized ribosome system. The results showed requirement of a pyrimidine at the position 770 for ribosome function regardless of the nucleotide identity at the position 771. Sucrose gradient profiles of ribosomes revealed that the loss of protein-synthesis ability of mutant ribosome bearing a base substitution from C to G at the position 770 stems from its inability to form 70S ribosomes. These findings indicate involvement of nucleotide at the position 770, not 771, in ribosomal subunit association and provide a useful rRNA mutation that can be used as a target to investigate the physical interaction between 16S and 23S rRNA.

  19. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    PubMed Central

    Almutairi, Mashal M.; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A.; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H.; Mankin, Alexander S.

    2015-01-01

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism. PMID:26438831

  20. A cluster of methylations in the domain IV of 25S rRNA is required for ribosome stability

    PubMed Central

    Gigova, Andriana; Duggimpudi, Sujitha; Pollex, Tim; Schaefer, Matthias

    2014-01-01

    In all three domains of life ribosomal RNAs are extensively modified at functionally important sites of the ribosome. These modifications are believed to fine-tune the ribosome structure for optimal translation. However, the precise mechanistic effect of modifications on ribosome function remains largely unknown. Here we show that a cluster of methylated nucleotides in domain IV of 25S rRNA is critical for integrity of the large ribosomal subunit. We identified the elusive cytosine-5 methyltransferase for C2278 in yeast as Rcm1 and found that a combined loss of cytosine-5 methylation at C2278 and ribose methylation at G2288 caused dramatic ribosome instability, resulting in loss of 60S ribosomal subunits. Structural and biochemical analyses revealed that this instability was caused by changes in the structure of 25S rRNA and a consequent loss of multiple ribosomal proteins from the large ribosomal subunit. Our data demonstrate that individual RNA modifications can strongly affect structure of large ribonucleoprotein complexes. PMID:25125595

  1. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    PubMed

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  2. Advances in targeting cyclic nucleotide phosphodiesterases.

    PubMed

    Maurice, Donald H; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C

    2014-04-01

    Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants.

  3. Extracellular nucleotides as negative modulators of immunity

    PubMed Central

    Di Virgilio, Francesco; Boeynaems, Jean-Marie; Robson, Simon C.

    2014-01-01

    Nucleotides are well known for being the universal currency of intracellular energy transactions, but over the last decade it has become clear that they are also ubiquitous extracellular messenger. In the immune system there is increasing awareness that nucleotides serve multiple roles as stimulants of lymphocyte proliferation, ROS generation, cytokine and chemokine secretion: in one word as pro-inflammatory mediators. However, although often neglected, extracellular nucleotides exert an additional more subtle function as negative modulators of immunity, or as immunedepressants. The more we understand the peculiar biochemical composition of the microenvironment generated at inflammatory sites, the more we appreciate how chronic exposure to low extracellular nucleotide levels affect immunity and inflammation. A deeper understanding of this complex network will no doubt help design more effective therapies for cancer and chronic inflammatory diseases. PMID:19628431

  4. Extremely acidophilic protists from acid mine drainage host Rickettsiales-lineage endosymbionts that have intervening sequences in their 16S rRNA genes.

    PubMed

    Baker, Brett J; Hugenholtz, Philip; Dawson, Scott C; Banfield, Jillian F

    2003-09-01

    During a molecular phylogenetic survey of extremely acidic (pH < 1), metal-rich acid mine drainage habitats in the Richmond Mine at Iron Mountain, Calif., we detected 16S rRNA gene sequences of a novel bacterial group belonging to the order Rickettsiales in the Alphaproteobacteria. The closest known relatives of this group (92% 16S rRNA gene sequence identity) are endosymbionts of the protist Acanthamoeba. Oligonucleotide 16S rRNA probes were designed and used to observe members of this group within acidophilic protists. To improve visualization of eukaryotic populations in the acid mine drainage samples, broad-specificity probes for eukaryotes were redesigned and combined to highlight this component of the acid mine drainage community. Approximately 4% of protists in the acid mine drainage samples contained endosymbionts. Measurements of internal pH of the protists showed that their cytosol is close to neutral, indicating that the endosymbionts may be neutrophilic. The endosymbionts had a conserved 273-nucleotide intervening sequence (IVS) in variable region V1 of their 16S rRNA genes. The IVS does not match any sequence in current databases, but the predicted secondary structure forms well-defined stem loops. IVSs are uncommon in rRNA genes and appear to be confined to bacteria living in close association with eukaryotes. Based on the phylogenetic novelty of the endosymbiont sequences and initial culture-independent characterization, we propose the name "Candidatus Captivus acidiprotistae." To our knowledge, this is the first report of an endosymbiotic relationship in an extremely acidic habitat.

  5. Mitochondrial 12S rRNA variants in 1642 Han Chinese pediatric subjects with aminoglycoside-induced and nonsyndromic hearing loss

    PubMed Central

    Lu, Jianxin; Li, Zhiyuan; Zhu, Yi; Yang, Aifen; Li, Ronghua; Zheng, Jing; Cai, Qin; Peng, Guanghua; Zheng, Wuwei; Tang, Xiaowen; Chen, Bobei; Chen, Jianfu; Liao, Zhisu; Yang, Li; Li, Yongyan; You, Junyan; Ding, Yu; Yu, Hong; Wang, Jindan; Sun, Dongmei; Zhao, Jianyue; Xue, Ling; Wang, Jieying; Guan, Min-Xin

    2010-01-01

    In this report, we investigated the frequency and spectrum of mitochondrial 12S rRNA variants in a large cohort of 1642 Han Chinese pediatric subjects with aminoglycoside-induced and nonsyndromic hearing loss. Mutational analysis of 12S rRNA gene in these subjects identified 68 (54 known and 14 novel) variants. The frequencies of known 1555A>G and 1494C>T mutations were 3.96% and 0.18%, respectively, in this cohort with nonsyndromic and aminoglycoside-induced hearing loss. Prevalence of other putative deafness-associated mutation at positions 1095 and 961 were 0.61% and 1.7% in this cohort, respectively. Furthermore, the 745A>G, 792C>T, 801A>G, 839A>G, 856A>G, 1027A>G, 1192C>T, 1192C>A, 1310C>T, 1331A>G, 1374A>G and 1452T>C variants conferred increased sensitivity to ototoxic drugs or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants appeared to be polymorphisms. Moreover, 65 Chinese subjects carrying the 1555A>G mutation exhibited bilateral and sensorineural hearing loss. A wide range of severity, age-of-onset and audiometric configuration was observed among these subjects. In particular, the sloping and flat shaped patterns were the common audiograms in individuals carrying the 1555A>G mutation. The phenotypic variability in subjects carrying these 12S rRNA mutations indicated the involvement of nuclear modifier genes, mitochondrial haplotypes, epigenetic and environmental factors in the phenotypic manifestation of these mutations. Therefore, our data demonstrated that mitochondrial 12S rRNA is the hot spot for mutations associated with aminoglycoside ototoxicity. PMID:20100600

  6. In vitro incorporation of LNA nucleotides.

    PubMed

    Veedu, Rakesh N; Vester, Birte; Wengel, Jesper

    2007-01-01

    An LNA modified nucleoside triphosphate 1 was synthesized in order to investigate its potential to act as substrate for DNA strand synthesis by polymerases. Primer extension assays for the incorporation experiments revealed that Phusion High Fidelity DNA polymerase is an efficient enzyme for incorporation of the LNA nucleotide and for extending strand to full length. It was also observed that pfu DNA polymerase could incorporate the LNA nucleotide but it failed to extend the strand to a full length product. PMID:18058567

  7. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  8. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping.

    PubMed

    Brownstein, M J; Carpten, J D; Smith, J R

    1996-06-01

    Taq DNA polymerase can catalyze non-templated addition of a nucleotide (principally adenosine) to the 3' end of PCR-amplified products. Recently, we showed that this activity, which is primer-specific, presents a potential source of error in genotyping studies based on the use of short tandem repeat (STR) markers. Furthermore, in reviewing our data, we found that non-templated nucleotide addition adjacent to a 3' terminal C is favored and that addition adjacent to a 3' terminal A is not. It was clear, however, that features of the template in addition to the 3' terminal base also affect the fraction of product adenylated. To define consensus sequences that promote or inhibit product adenylation, we transplanted sequences between the 5' ends of the reverse primers of markers that are adenylated and those of markers that are not adenylated. It proved difficult to identify a single sequence capable of protecting the products of all markers from non-templated addition of nucleotide. On the other hand, placing the sequence GTTTCTT on the 5' end of reverse primers resulted in nearly 100% adenylation of the 3' end of the forward strand. This modification or related ones (called "PIG-tailing") should facilitate accurate genotyping and efficient T/A cloning.

  9. Regulation of mammalian nucleotide metabolism and biosynthesis.

    PubMed

    Lane, Andrew N; Fan, Teresa W-M

    2015-02-27

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer.

  10. Regulation of mammalian nucleotide metabolism and biosynthesis

    PubMed Central

    Lane, Andrew N.; Fan, Teresa W.-M.

    2015-01-01

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  11. The complete chemical structure of Saccharomyces cerevisiae rRNA: partial pseudouridylation of U2345 in 25S rRNA by snoRNA snR9

    PubMed Central

    Taoka, Masato; Nobe, Yuko; Yamaki, Yuka; Yamauchi, Yoshio; Ishikawa, Hideaki; Takahashi, Nobuhiro; Nakayama, Hiroshi; Isobe, Toshiaki

    2016-01-01

    We present the complete chemical structures of the rRNAs from the eukaryotic model organism, Saccharomyces cerevisiae. The final structures, as determined with mass spectrometry-based methodology that includes a stable isotope-labelled, non-modified reference RNA, contain 112 sites with 12 different post-transcriptional modifications, including a previously unidentified pseudouridine at position 2345 in 25S rRNA. Quantitative mass spectrometry-based stoichiometric analysis of the different modifications at each site indicated that 94 sites were almost fully modified, whereas the remaining 18 sites were modified to a lesser extent. Superimposed three-dimensional modification maps for S. cerevisiae and Schizosaccharomyces pombe rRNAs confirmed that most of the modified nucleotides are located in functionally important interior regions of the ribosomes. We identified snR9 as the snoRNA responsible for pseudouridylation of U2345 and showed that this pseudouridylation occurs co-transcriptionally and competitively with 2′-O-methylation of U2345. This study ends the uncertainty concerning whether all modified nucleotides in S. cerevisiae rRNAs have been identified and provides a resource for future structural, functional and biogenesis studies of the eukaryotic ribosome. PMID:27325748

  12. Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.

    PubMed Central

    Lange, T S; Borovjagin, A V; Gerbi, S A

    1998-01-01

    U8 small nucleolar RNA (snoRNA) is essential for metazoan ribosomal RNA (rRNA) processing in nucleoli. The sequences and structural features in Xenopus U8 snoRNA that are required for its nucleolar localization were analyzed. Fluorescein-labeled U8 snoRNA was injected into Xenopus oocyte nuclei, and fluorescence microscopy of nucleolar preparations revealed that wild-type Xenopus U8 snoRNA localized to nucleoli, regardless of the presence or nature of the 5' cap on the injected U8 snoRNA. Nucleolar localization was observed when loops or stems in the 5' portion of U8 that are critical for U8 snoRNA function in rRNA processing were mutated. Therefore, sites of interaction in U8 snoRNA that potentially tether it to pre-rRNA are not essential for nucleolar localization of U8. Boxes C and D are known to be nucleolar localization elements (NoLEs) for U8 snoRNA and other snoRNAs of the Box C/D family. However, the spatial relationship of Box C to Box D was not crucial for U8 nucleolar localization, as demonstrated here by deletion of sequences in the two stems that separate them. These U8 mutants can localize to nucleoli and function in rRNA processing as well. The single-stranded Cup region in U8, adjacent to evolutionarily conserved Box C, functions as a NoLE in addition to Boxes C and D. Cup is unique to U8 snoRNA and may help bind putative protein(s) needed for nucleolar localization. Alternatively, Cup may help to retain U8 snoRNA within the nucleolus. PMID:9671052

  13. Probing adenosine nucleotide-binding proteins with an affinity-labeled nucleotide probe and mass spectrometry.

    PubMed

    Qiu, Haibo; Wang, Yinsheng

    2007-08-01

    Mass spectrometry combined with chemical labeling strategies has become very important in biological analysis. Herein, we described the application of a biotin-conjugated acyl nucleotide for probing adenosine nucleotide-binding proteins. We demonstrated that the probe reacted specifically with the lysine residue at the nucleotide-binding site of two purified adenosine nucleotide-binding proteins, Escherichia coli recombinase A (RecA) and Saccharomyces cerevisiae alcohol dehydrogenase-I (YADH-I). A single conjugate peptide with a specifically labeled lysine residue was identified, by using LC-MS/MS, from the tryptic digestion mixture of the reaction products of the nucleotide analogue with RecA or YADH-I. The strategy, which involved labeling reaction, enzymatic digestion, affinity purification, and LC-MS/MS analysis, was relatively simple, fast, and straightforward. The method should be generally applicable for the identification of lysine residues at the nucleotide-binding site of other proteins. The biotin-conjugated acyl nucleotide probe also allowed for the enrichment and identification of nucleotide-binding proteins from complex protein mixtures; we showed that more than 50 adenosine nucleotide-binding proteins could be identified from the whole-cell lysates of HeLa-S3 and WM-266-4 cells.

  14. Probing adenosine nucleotide-binding proteins with an affinity labeled-nucleotide probe and mass spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2008-01-01

    Mass spectrometry combined with chemical labeling strategies has become very important in biological analysis. Herein, we described the application of a biotin-conjugated acyl nucleotide for probing adenosine nucleotide-binding proteins. We demonstrated that the probe reacted specifically with the lysine residue at the nucleotide-binding site of two purified adenosine nucleotide-binding proteins, Escherichia coli RecA and Saccharomyces cerevisiae alcohol dehydrogenase-I (YADH-I). A single conjugate peptide with a specifically labeled lysine residue was identified, by using LC-MS/MS, from the tryptic digestion mixture of the reaction products of the nucleotide analog with RecA or YADH-I. The strategy, which involved labeling reaction, enzymatic digestion, affinity purification and LC-MS/MS analysis, was relatively simple, fast and straightforward. The method should be generally applicable for the identification of lysine residues at the nucleotide-binding site of other proteins. The biotin-conjugated acyl nucleotide probe also allowed for the enrichment and identification of nucleotide-binding proteins from complex protein mixtures; we showed that more than 50 adenosine nucleotide-binding proteins could be identified from the whole cell lysates of HeLa-S3 and WM-266-4 cells. PMID:17602667

  15. Gut microbiome compositional and functional differences between tumor and non-tumor adjacent tissues from cohorts from the US and Spain

    PubMed Central

    Allali, Imane; Delgado, Susana; Marron, Pablo Isidro; Astudillo, Aurora; Yeh, Jen Jen; Ghazal, Hassan; Amzazi, Saaïd; Keku, Temitope; Azcarate-Peril, M Andrea

    2015-01-01

    Colorectal cancer (CRC) is the third most common cancer in the world and the second leading cause of cancer deaths in the US and Spain. The molecular mechanisms involved in the etiology of CRC are not yet elucidated due in part to the complexity of the human gut microbiota. In this study, we compared the microbiome composition of 90 tumor and matching adjacent tissue (adjacent) from cohorts from the US and Spain by 16S rRNA amplicon sequencing in order to determine the impact of the geographic origin on the CRC microbiome. Data showed a significantly (P < 0.05) higher Phylogenetic Diversity (PD) for the US (PD Adjacent = 26.3 ± 5.3, PD Tumor = 23.3 ± 6.2) compared to the Spanish cohort (PD Adjacent = 18.9 ± 5.9, PD Tumor = 18.7 ± 6.6) while no significant differences in bacterial diversity were observed between tumor and adjacent tissues for individuals from the same country. Adjacent tissues from the Spanish cohort were enriched in Firmicutes (SP = 43.9% and US = 22.2%, P = 0.0001) and Actinobacteria (SP = 1.6% and US = 0.5%, P = 0.0018) compared to US adjacent tissues, while adjacent tissues from the US had significantly higher abundances of Fusobacteria (US = 8.1% and SP = 1.5%, P = 0.0023) and Sinergistetes (US = 0.3% and SP = 0.1%, P = 0.0097). Comparisons between tumor and adjacent tissues in each cohort identified the genus Eikenella significantly over represented in US tumors (T = 0.024% and A = 0%, P = 0.03), and the genera Fusobacterium (T = 10.4% and A = 1.5%, P = <0.0001), Bulleida (T = 0.36% and A = 0.09%, P = 0.02), Gemella (T = 1.46% and A = 0.19%, P = 0.03), Parvimonas (T = 3.14% and A = 0.86%, P = 0.03), Campylobacter (T = 0.15% and A = 0.008%, P = 0.047), and Streptococcus (T = 2.84% and A = 2.19%, P = 0.05) significantly over represented in Spanish tumors. Predicted metagenome functional content from 16S rRNA surveys showed that bacterial motility proteins and proteins involved in flagellar assembly were over represented in adjacent tissues

  16. Drosophila melanogaster mitochondrial DNA: completion of the nucleotide sequence and evolutionary comparisons.

    PubMed

    Lewis, D L; Farr, C L; Kaguni, L S

    1995-11-01

    The nucleotide sequence of the regions flanking the A+T region of Drosophila melanogaster mitochondrial DNA (mtDNA) has been determined. Included are the genes encoding the transfer RNAs for valine, isoleucine, glutamine and methionine, the small ribosomal RNA and the 5'-coding sequences of the large ribosomal RNA and NADH dehydrogenase subunit II. This completes the nucleotide sequence of the D. melanogaster mitochondrial genome. The circular mtDNA of D. melanogaster varies in size among different populations largely due to length differences in the control region (Fauron & Wolstenholme, 1976; Fauron & Wolstenholme, 1980a, b); the mtDNA region we have sequenced, combined with those sequenced by others, yields a composite genome that is 19,517 bp in length as compared to 16,019 bp for the mtDNA of D. yakuba. D. melanogaster mtDNA exhibits an extreme bias in base composition; it comprises 82.2% deoxyadenylate and thymidylate residues as compared to 78.6% in D. yakuba mtDNA. All genes encoded in the mtDNA of both species are in identical locations and orientations. Nucleotide substitution analysis reveals that tRNA and rRNA genes evolve at less than half the rate of protein coding genes.

  17. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    SciTech Connect

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D.

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  18. Discrimination of Bacillus anthracis and Closely Related Microorganisms by Analysis of 16S and 23S rRNA with Oligonucleotide Microarray

    PubMed Central

    Bavykin, Sergei G.; Mikhailovich, Vladimir M.; Zakharyev, Vladimir M.; Lysov, Yuri p.; Kelly, John J.; Alferov, Oleg S.; Gavin, Igor M.; Kukhtin, Alexander V.; Jackman, Joany; Stahl, David A.; Chandler, Darrell; Mirzabekov, Andrei D.

    2009-01-01

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 minutes. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead

  19. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  20. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  1. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  2. An analysis of the V1 and V2 regions of Vibrio cholerae and Vibrio mimicus 16S rRNA.

    PubMed

    Coelho, A; Momen, H; Vicente, A C; Salles, C A

    1994-02-01

    The V1 and V2 variable regions of the 16S rRNA gene of three strains of V. cholerae and one strain of V. mimicus were amplified by PCR. Fragments containing both regions were cloned into M13mp18 using Smal and sequenced by the dideoxy method. The 263-bp sequence from a strain isolated during the 1991 cholera outbreak in Brazil was deposited in Genbank under the accession number L05178. Except for an extra G in one of the strains, the three V. cholerae sequences were identical. The V. mimicus sequence was very similar, with only two substitutions. We compared these sequences with the Vibrio 16S rRNA sequences described by Dorsch et al. in 1992. It was noted that the V1 region, including helix 6 and its associated loop, comprised two different sizes and sequences in the various Vibrio species. While V. cholerae, V. mimicus, V. vulnificus, V. anguillarum and V. diazotrophicus had a 46-nucleotide V1, other species such as V. parahaemolyticus, V. proteolyticus, V. alginolyticus, V. campbellii and V. hollisae had longer 54- or 55-nucleotide regions, with a different consensus sequence. The phylogeny of Vibrio was analysed using the sequenced region and its equivalent in other species, by means of the "Phylip" software package. Species with a short helix 6 were grouped together, as were species with a long helix. Dorsh et al.'s analysis is discussed in relation to this "helix 6 split".

  3. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  4. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  5. UV light-induced DNA lesions cause dissociation of yeast RNA polymerases-I and establishment of a specialized chromatin structure at rRNA genes

    PubMed Central

    Tremblay, Maxime; Charton, Romain; Wittner, Manuel; Levasseur, Geneviève; Griesenbeck, Joachim; Conconi, Antonio

    2014-01-01

    The cytotoxicity of UV light-induced DNA lesions results from their interference with transcription and replication. DNA lesions arrest elongating RNA polymerases, an event that triggers transcription-coupled nucleotide excision repair. Since arrested RNA polymerases reduce the accessibility of repair factors to DNA lesions, they might be displaced. The fate of arrested RNA polymerases-II at DNA lesions has been extensively studied, yielding partially contradictory results. Considerably less is known about RNA polymerases-I that transcribe nucleosomes-depleted rRNA genes at very high rate. To investigate the fate of arrested RNA polymerases-I at DNA lesions, chromatin-immunoprecipitation, electron microscopy, transcription run-on, psoralen-cross-linking and chromatin-endogenous cleavage were employed. We found that RNA polymerases-I density increased at the 5′-end of the gene, likely due to continued transcription initiation followed by elongation and pausing/release at the first DNA lesion. Most RNA polymerases-I dissociated downstream of the first DNA lesion, concomitant with chromatin closing that resulted from deposition of nucleosomes. Although nucleosomes were deposited, the high mobility group-box Hmo1 (component of actively transcribed rRNA genes) remained associated. After repair of DNA lesions, Hmo1 containing chromatin might help to restore transcription elongation and reopening of rRNA genes chromatin. PMID:24097442

  6. Identification of protein-coding sequences using the hybridization of 18S rRNA and mRNA during translation.

    PubMed

    Xing, Chuanhua; Bitzer, Donald L; Alexander, Winser E; Vouk, Mladen A; Stomp, Anne-Marie

    2009-02-01

    We introduce a new approach in this article to distinguish protein-coding sequences from non-coding sequences utilizing a period-3, free energy signal that arises from the interactions of the 3'-terminal nucleotides of the 18S rRNA with mRNA. We extracted the special features of the amplitude and the phase of the period-3 signal in protein-coding regions, which is not found in non-coding regions, and used them to distinguish protein-coding sequences from non-coding sequences. We tested on all the experimental genes from Saccharomyces cerevisiae and Schizosaccharomyces pombe. The identification was consistent with the corresponding information from GenBank, and produced better performance compared to existing methods that use a period-3 signal. The primary tests on some fly, mouse and human genes suggests that our method is applicable to higher eukaryotic genes. The tests on pseudogenes indicated that most pseudogenes have no period-3 signal. Some exploration of the 3'-tail of 18S rRNA and pattern analysis of protein-coding sequences supported further our assumption that the 3'-tail of 18S rRNA has a role of synchronization throughout translation elongation process. This, in turn, can be utilized for the identification of protein-coding sequences.

  7. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences. [Calyptogena magnifica; Bathymodiolus thermophilus; Lucinoma annulata; Lucinoma aequizonata; Codakia orbicularis

    SciTech Connect

    Distel, D.L.; Lane, D.J.; Olsen, G.J.; Giovannoni, S.J.; Pace, B.; Pace, N.R.; Stahl, D.A.; Felbeck, H.

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis. Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species.

  8. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    PubMed

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area.

  9. [Study of the heterogeneity of 16s rRNA gene and groESL operone in the dna samples of Anaplasma phagocytophilum, Ehrlichia muris, and "Candidatus Neoehrlichia mikurensis" determined in the Ixodes persulcatus ticks in the area of Urals, Siberia, and far east of Russia].

    PubMed

    Rar, V A; Epikhina, T I; Livanova, N N; Panov, V V; Doroshenko, E K; Pukhovskaia, N M; Vysochina, N P; Ivanov, L I

    2011-01-01

    A total of 3552 Ixodes persulcatus from Sverdlovsk, Chelyabinsk, Novosibirsk, Irkutsk regions and Khabarovsk Territory were examined on the Ehrlichia and Anaplasma presence by nested PCR based on the 16S rRNA gene. Both Anaplasma phagocytophilum and Ehrlichia muris DNA were found in I. persulcatus in all studied regions. A. Phagocytophilum was detected in 1.3-6.3% of ticks and E. muris - in 2.0-14.1% of ticks. Moreover, "Candidatus Neoehrlichia mikurensis" DNA was found in 8 ticks collected in Novosibirsk, Irkutsk Regions and Khabarovsk Territory. Partial nucleotide sequences of 16S rRNA gene and groESL operone (1240-1300 bp) were determined for 65 samples of A. Phagocytophilum, 17 samples of E. muris and 4 samples of "Candidatus Neoehrlichia mikurensis". Nucleotide sequences of 16S rRNA gene and groESL operone of E. muris and "Candidatus Neoehrlichia mikurensis" were shown to be highly conservative, and nucleotide sequences of groESL operone of both E. muris and "Candidatus Neoehrlichia mikurensis" differed from the sequences found previously in other species of Ixodid tick. On the basis of analysis of the 16S rRNA gene and groESL operone sequences it was concluded that all revealed samples A. Phagocytophilum could be divided into 2 groups. GroESL operone sequences of A. Phagocytophilum from the first group were identical to each other but significantly differed from the known groESL operone sequences (less than 98.2% of similarity), whereas their 16S rRNA gene sequences were identical to the sequence of widely distributed and pathogenic for human A. Phagocytophilum genetic variant (CAHU-HGEl, GenBank AF093788) or differed from it by a single nucleotide substitution. The nucleotide sequences of groESL operone of A. Phagocytophilum from the second group differed from each other by 1-4 nucleotides and were closely related (99.2-99.4% of similarity) to the sequences of groESL operone ofA. phagocytophilum isolates found in Europe in Ixodes ricinus and roe deer. The

  10. Nucleotide `maps' of digests of deoxyribonucleic acid

    PubMed Central

    Murray, K.

    1970-01-01

    Various digests of 32P-labelled DNA were examined by two-dimensional ionophoresis on cellulose acetate and DEAE-cellulose paper. The products from digestion with pancreatic deoxyribonuclease and Neurospora crassa endonuclease were qualitatively closely similar, but very complex, and were used to investigate the mapping behaviour of nucleotides in various ionophoretic systems. Ionophoresis on DEAE-cellulose paper in triethylamine carbonate, pH 9.7, followed by ionophoresis in the second dimension at pH1.9 gave high resolution of nucleotides in very complex mixtures and permitted the fractionation of larger quantities than is possible on cellulose acetate. High resolution of nucleotides in compact spots was obtained with two-dimensional ionophoresis on cellulose acetate and AE-cellulose paper, a system that is a useful supplement to those based on DEAE-cellulose paper. ImagesPLATE 7PLATE 1PLATE 2PLATE 3PLATE 4PLATE 5PLATE 6 PMID:5476726

  11. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  12. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  13. Regulation of Ion Channels by Pyridine Nucleotides

    PubMed Central

    Kilfoil, Peter J.; Tipparaju, Srinivas M.; Barski, Oleg A.; Bhatnagar, Aruni

    2014-01-01

    Recent research suggests that in addition to their role as soluble electron carriers, pyridine nucleotides [NAD(P)(H)] also regulate ion transport mechanisms. This mode of regulation seems to have been conserved through evolution. Several bacterial ion–transporting proteins or their auxiliary subunits possess nucleotide-binding domains. In eukaryotes, the Kv1 and Kv4 channels interact with pyridine nucleotide–binding β-subunits that belong to the aldo-keto reductase superfamily. Binding of NADP+ to Kvβ removes N-type inactivation of Kv currents, whereas NADPH stabilizes channel inactivation. Pyridine nucleotides also regulate Slo channels by interacting with their cytosolic regulator of potassium conductance domains that show high sequence homology to the bacterial TrkA family of K+ transporters. These nucleotides also have been shown to modify the activity of the plasma membrane KATP channels, the cystic fibrosis transmembrane conductance regulator, the transient receptor potential M2 channel, and the intracellular ryanodine receptor calcium release channels. In addition, pyridine nucleotides also modulate the voltage-gated sodium channel by supporting the activity of its ancillary subunit—the glycerol-3-phosphate dehydrogenase-like protein. Moreover, the NADP+ metabolite, NAADP+, regulates intracellular calcium homeostasis via the 2-pore channel, ryanodine receptor, or transient receptor potential M2 channels. Regulation of ion channels by pyridine nucleotides may be required for integrating cell ion transport to energetics and for sensing oxygen levels or metabolite availability. This mechanism also may be an important component of hypoxic pulmonary vasoconstriction, memory, and circadian rhythms, and disruption of this regulatory axis may be linked to dysregulation of calcium homeostasis and cardiac arrhythmias. PMID:23410881

  14. Evidence for an early gene duplication event in the evolution of the mitochondrial transcription factor B family and maintenance of rRNA methyltransferase activity in human mtTFB1 and mtTFB2.

    PubMed

    Cotney, Justin; Shadel, Gerald S

    2006-11-01

    Most metazoans have two nuclear genes encoding orthologues of the well-characterized Saccharomyces cerevisiae mitochondrial transcription factor B (sc-mtTFB). This class of transcription factors is homologous to the bacterial KsgA family of rRNA methyltransferases, which in Escherichia coli dimethylates adjacent adenine residues in a stem-loop of the 16S rRNA. This posttranscriptional modification is conserved in most metazoan cytoplasmic and mitochondrial rRNAs. Homo sapiens mitochondrial transcription factor B1 (h-mtTFB1) possesses this enzymatic activity, implicating it as a dual-function protein involved in mitochondrial transcription and translation. Here we demonstrate that h-mtTFB2 also has rRNA methyltransferase activity but is a less efficient enzyme than h-mtTFB1. In contrast, sc-mtTFB has no detectable rRNA methyltransferase activity, correlating with the lack of the corresponding modification in the mitochondrial rRNA of budding yeast. Based on these results, and reports that Drosophila melanogaster mtTFB1 and mtTFB2 do not have completely overlapping functions, we propose a model for human mtDNA regulation that takes into account h-mtTFB1 and h-mtTFB2 likely having partially redundant transcription factor and rRNA methyltransferase functions. Finally, phylogenetic analyses of this family of proteins strongly suggest that the presence of two mtTFB homologues in metazoans is the result of a gene duplication event that occurred early in eukaryotic evolution prior to the divergence of fungi and metazoans. This model suggests that, after the gene duplication event, differential selective pressures on the rRNA methyltransferase and transcription factor activities of mtTFB genes occurred, with extreme cases culminating in the loss of one of the paralogous genes in certain species.

  15. Ius Chasma Tributary Valleys and Adjacent Plains

    NASA Technical Reports Server (NTRS)

    2006-01-01

    This image covers valley tributaries of Ius Chasma, as well as the plains adjacent to the valleys. Ius Chasma is one of several canyons that make up the Valles Marineris canyon system. Valles Marineris likely formed by extension associated with the growth of the large volcanoes and topographic high of Tharsis to the northwest. As the ground was pulled apart, large and deep gaps resulted in the valleys seen in the top and bottom of this HiRISE image. Ice that was once in the ground could have also melted to create additional removal of material in the formation of the valleys. HiRISE is able to see the rocks along the walls of both these valleys and also impact craters in the image. Rock layers that appear lower down in elevation appear rougher and are shedding boulders. Near the top of the walls and also seen in patches along the smooth plains are brighter layers. These brighter layers are not shedding boulders so they must represent a different kind of rock formed in a different kind of environment than those further down the walls. Because they are highest in elevation, the bright layers are youngest in age. HiRISE is able to see dozens of the bright layers, which are perhaps only a meter in thickness. Darker sand dunes and ripples cover most of the plains and fill the floors of impact craters.

    Image PSP_001351_1715 was taken by the High Resolution Imaging Science Experiment (HiRISE) camera onboard the Mars Reconnaissance Orbiter spacecraft on November 9, 2006. The complete image is centered at -8.3 degrees latitude, 275.4 degrees East longitude. The range to the target site was 254.3 km (158.9 miles). At this distance the image scale ranges from 25.4 cm/pixel (with 1 x 1 binning) to 101.8 cm/pixel (with 4 x 4 binning). The image shown here has been map-projected to 25 cm/pixel and north is up. The image was taken at a local Mars time of 3:32 PM and the scene is illuminated from the west with a solar incidence angle of 59 degrees, thus the sun was about

  16. Learning Non-Adjacent Regularities at Age 0 ; 7

    ERIC Educational Resources Information Center

    Gervain, Judit; Werker, Janet F.

    2013-01-01

    One important mechanism suggested to underlie the acquisition of grammar is rule learning. Indeed, infants aged 0 ; 7 are able to learn rules based on simple identity relations (adjacent repetitions, ABB: "wo fe fe" and non-adjacent repetitions, ABA: "wo fe wo", respectively; Marcus et al., 1999). One unexplored issue is…

  17. View of north side from exterior stairs of adjacent building, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of north side from exterior stairs of adjacent building, bottom cut off by fringed buildings, view facing south-southwest - U.S. Naval Base, Pearl Harbor, Industrial X-Ray Building, Off Sixth Street, adjacent to and south of Facility No. 11, Pearl City, Honolulu County, HI

  18. Delayed Acquisition of Non-Adjacent Vocalic Distributional Regularities

    ERIC Educational Resources Information Center

    Gonzalez-Gomez, Nayeli; Nazzi, Thierry

    2016-01-01

    The ability to compute non-adjacent regularities is key in the acquisition of a new language. In the domain of phonology/phonotactics, sensitivity to non-adjacent regularities between consonants has been found to appear between 7 and 10 months. The present study focuses on the emergence of a posterior-anterior (PA) bias, a regularity involving two…

  19. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  20. Nucleotide-metabolizing enzymes in Chlamydomonas flagella.

    PubMed

    Watanabe, T; Flavin, M

    1976-01-10

    Nucleotides have at least two functions in eukaryotic cilia and flagella. ATP, originating in the cells, is utilized for motility by energy-transducing protein(s) called dynein, and the binding of guanine nucleotides to tubulin, and probably certain transformations of the bound nucleotides, are prerequisites for the assembly of microtubules. Besides dynein, which can be solubulized from Chlamydomonas flagella as a heterogeneous, Mg2+ or Ca2+-activated ATPase, we have purified and characterized five other flagellar enzymes involved in nucleotide transformations. A homogeneous, low molecular weight, Ca2+-specific adenosine triphosphatase was isolated, which was inhibited by Mg2+ and was not specific for ATP. This enzyme was not formed by treating purified dynein with proteases. It was absent from extracts of Tetrahymena cilia. Its function might be an auxiliary energy transducer, or in steering or tactic responses. Two species of adenylate kinase were isolated, one of which was much elevated in regenerating flagella; the latter was also present in cell bodies. A large part of flagellar nucleoside diphosphokinase activity could not be solubilized. Two soluble enzyme species were identified, one of which was also present in cell bodies. Since these enzymes are of interest because they might function in microtubule assembly, we studied the extent to which brain nucleoside diphosphokinase co-polymerizes with tubulin purified by repeated cycles of polymerization. Arginine kinase was not detected in Chlamydomonas flagellar extracts. PMID:397

  1. Ecotypes of planktonic actinobacteria with identical 16S rRNA genes adapted to thermal niches in temperate, subtropical, and tropical freshwater habitats.

    PubMed

    Hahn, Martin W; Pöckl, Matthias

    2005-02-01

    Seven strains with identical 16S rRNA genes affiliated with the Luna2 cluster (Actinobacteria) were isolated from six freshwater habitats located in temperate (Austria and Australia), subtropical (People's Republic of China), and tropical (Uganda) climatic zones. The isolates had sequence differences at zero to five positions in a 2,310-nucleotide fragment of the ribosomal operon, including part of the intergenic spacer upstream of the 16S rRNA gene, the complete 16S rRNA gene, the complete 16S-23S internal transcribed spacer (ITS1), and a short part of the 23S rRNA gene. Most of the few sequence differences found were located in the internal transcribed spacer sequences. Two isolates obtained from habitats in Asia and Europe, as well as two isolates obtained from different habitats in the People's Republic of China, had identical sequences for the entire fragment sequenced. In spite of minimal sequence differences in the part of the ribosomal operon investigated, the strains exhibited significant differences in their temperature response curves (with one exception), as well as pronounced differences in their temperature optima (25.0 to 35.6 degrees C). The observed differences in temperature adaptation were generally in accordance with the thermal conditions in the habitats where the strains were isolated. Strains obtained from temperate zone habitats had the lowest temperature optima, strains from subtropical habitats had intermediate temperature optima, and a strain from a tropical habitat had the highest temperature optimum. Based on the observed temperature responses, we concluded that the strains investigated are well adapted to the thermal conditions in their home habitats. Consequently, these closely related strains represent different ecotypes adapted to different thermal niches.

  2. Speciation of oxaliplatin adducts with DNA nucleotides.

    PubMed

    Zayed, Aref; Jones, George D D; Reid, Helen J; Shoeib, Tamer; Taylor, Sarah E; Thomas, Anne L; Wood, Joanna P; Sharp, Barry L

    2011-10-01

    This paper describes a set of fast and selective high performance liquid chromatography (HPLC) methods coupled to electro-spray ionisation linear ion trap mass spectrometry (ESI-MS), sector-field inductively coupled plasma mass spectrometry (SF-ICP-MS) and UV detection for in vitro studies of the bifunctional adducts of oxaliplatin with mono-nucleotides, di-nucleotides and cellular DNA. The stationary phases and the optimised conditions used for each separation are discussed. Interaction of oxaliplatin with A and G mono-nucleotides resulted in the formation of five bifunctional platinum diaminocyclohexane (DACHPt) adducts. These were two isomers of the A-DACHPt-A and A-DACHPt-G adducts, and one G-DACHPt-G adduct, as confirmed by MS/MS spectra obtained by collision induced dissociation. These adducts were also characterised by UV absorption data and SF-ICP-MS elemental (195)Pt and (31)P signals. Further, interaction of oxaliplatin with AG and GG di-nucleotides resulted in the formation of three adducts: DACHPt-GG and two isomers of the DACHPt-AG adduct, as confirmed by ESI-MS and the complementary data obtained by UV and SF-ICP-MS. Finally, a very sensitive LC-ICP-MS method for the quantification of oxaliplatin GG intra-strand adducts (DACHPt-GG) was developed and used for monitoring the in vitro formation and repair of these adducts in human colorectal cancer cells. The method detection limit was 0.14 ppb Pt which was equivalent to 0.22 Pt adduct per 10(6) nucleotides based on a 10 μg DNA sample. This detection limit makes this method suitable for in vivo assessment of DACHPt-GG adducts in patients undergoing oxaliplatin chemotherapy.

  3. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  4. Phylogenetic analysis of Lactococcus lactis subspecies based on decoding the sequence of the pepT tripeptidase gene, the pepV dipeptidase gene and 16S rRNA.

    PubMed

    Mori, Sumiko; Mori, Katsumi; Suzuki, Ichirou; Kasumi, Takafumi

    2004-08-01

    Tripeptidase (PepT) and dipeptidase (PepV), the enzymes located in the final stage of the intracellular proteolytic system, were demonstrated to be distributed widely in lactic acid bacteria, especially in lactococci. Both the tripeptidase genes (pepT) and dipeptidase genes (pepV) of 15 lactococcal strains consisting of the type and domestic strains were cloned and sequenced using normal and TAIL PCR methods. Amino acid sequences of these enzymes were highly conserved among strains. Evolutionary distance trees based on the sequence of 1239 nucleotides of pepT and 1416 nucleotide of pepV showed a similar cluster as that obtained from the 1499 fragment of the 16S rRNA. Based on this profile, the species Lactococcus lactis is reasonably divided into three subspecies groups, subsp. lactis, cremoris, and hordniae, as in the current classification. Figure of trees from pepT and pepV were essentially identical to each other and slightly more intricate than that from 16S rRNA. The K nuc values obtained from pepT and pepV genes were approximately ten times as high as that from 16S rRNA. Considering these results, phylogenetic analysis based on pepT and pepV genes may aid in a more precise index of classification of L. lactis subspecies. PepT and PepV seem to have evolved in similar directions in lactococci.

  5. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

    PubMed

    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

    2010-07-01

    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  6. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  7. First description of heterogeneity in 18S rRNA genes in the haploid genome of Cryptosporidium andersoni Kawatabi type.

    PubMed

    Ikarashi, Makoto; Fukuda, Yasuhiro; Honma, Hajime; Kasai, Kenji; Kaneta, Yoshiyasu; Nakai, Yutaka

    2013-09-01

    The Apicomplexan Cryptosporidium andersoni, is a species of gastric Cryptosporidium, is frequently detected in older calves and adult cattle. Genotyping analyses based on 18S ribosomal RNA gene sequences have been performed on a novel C. andersoni genotype, namely the Kawatabi type, and the oocysts were classified into two distinct groups genotypically: Type A (the sequence in GenBank) and Type B (with a thymine nucleotide insertion not in Type A). This study analyzed 3775 cattle at a slaughterhouse and 310 cattle at a farm using microscopy and found 175 Cryptosporidium-positive animals: 171 from the slaughterhouse and four from the farm, and all infecting parasites were determined to be C. andersoni from 18S rRNA gene sequences determined from fecal DNA. In genotyping analyses with single isolated oocysts, about a half of analyzed ones were clearly classified into well known two genotypes (Type A and B). In addition to these two known genotypes, we have detected some oocysts showing mixed signals of Types A and B in the electropherogram from the automated sequencer (the Type C genotype). To determine the genotypic composition of sporozoites carried by the Type C oocysts, we analyzed their 18S rRNA gene sequences using a single sporozoite isolation procedure. Some sporozoites were classified as either Type A or Type B. However, more than half of the analyzed isolated sporozoites showed a mixed signal identical to that of Type C oocysts, and both the Type A and B signals were surely detectable from such sporozoites after a cloning procedure. In conclusion, C. andersoni carries two different genotypes heterogeneously in its haploid genome.

  8. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  9. Lock 4 View east of lock wall and adjacent ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Lock 4 - View east of lock wall and adjacent roadway built atop tow path. The gate pocket can be seen at center. - Savannah & Ogeechee Barge Canal, Between Ogeechee & Savannah Rivers, Savannah, Chatham County, GA

  10. 14. Charles Acey Cobb standing adjacent to the fish screen ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Charles Acey Cobb standing adjacent to the fish screen he designed and installed in the Congdon Canal, facing southeast. Photo dates ca. late 1920's. - Congdon Canal, Fish Screen, Naches River, Yakima, Yakima County, WA

  11. 3. View of north side of house facing from adjacent ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. View of north side of house facing from adjacent vacant property. Original wood lap siding and trim is covered by aluminum siding. Recessed side porch is in middle. - 645 South Eighteenth Street (House), Louisville, Jefferson County, KY

  12. View from water showing south facade and adjacent boat slips ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View from water showing south facade and adjacent boat slips (Facility Nos. S375 & S376) - U.S. Naval Base, Pearl Harbor, Boat House, Hornet Avenue at Independence Street, Pearl City, Honolulu County, HI

  13. OBLIQUE OF SOUTHWEST END AND SOUTHEAST SIDE, WITH ADJACENT FACILITY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OBLIQUE OF SOUTHWEST END AND SOUTHEAST SIDE, WITH ADJACENT FACILITY 391 IN THE FOREGROUND. - U.S. Naval Base, Pearl Harbor, Joint Intelligence Center, Makalapa Drive in Makalapa Administration Area, Pearl City, Honolulu County, HI

  14. Interior building details of Building A, dungeon cell adjacent to ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior building details of Building A, dungeon cell adjacent to northwest cell: granite and brick threshold, poured concrete floors, plastered finished walls, vaulted veiling; northwesterly view - San Quentin State Prison, Building 22, Point San Quentin, San Quentin, Marin County, CA

  15. View of viaduct, looking SE from roof of adjacent parking ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of viaduct, looking SE from roof of adjacent parking garage. - Mulberry Street Viaduct, Spanning Paxton Creek & Cameron Street (State Route 230) at Mulberry Street (State Route 3012), Harrisburg, Dauphin County, PA

  16. Cement Leakage into Adjacent Vertebral Body Following Percutaneous Vertebroplasty

    PubMed Central

    Park, Jae Hoo; Kim, Hyeun Sung

    2016-01-01

    Percutaneous vertebroplasty (PV) is a minimally invasive procedure for osteoporotic vertebral compression fractures that fail to respond to conventional conservative treatment. It significantly improves intolerable back pain within hours, and has a low complication rate. Although rare, PV is not free of complications, most of which are directly related to cement leakage. Because of its association with new adjacent fracture, the importance of cement leakage into the adjacent disc space is paramount. Here, we report an interesting case of cement leakage into the adjacent upper vertebral body as well as disc space following PV. To the best of our knowledge, there has been no report of cement leakage into the adjacent vertebral body following PV. This rare case is presented along with a review of the literature. PMID:27437018

  17. 2. DETAIL OF CONTROL GATE ADJACENT TO LIFT LOCK NO. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. DETAIL OF CONTROL GATE ADJACENT TO LIFT LOCK NO. 7; THIS CONTROL GATE IS A 1980s RECONSTRUCTION. - Illinois & Michigan Canal, Lift Lock No. 7 & Control Gate, East side of DuPage River, Channahon, Will County, IL

  18. 33. HISTORIC PLAQUE MARKING WHERE JOHNSTON DIED, ADJACENT TO PATHWAY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    33. HISTORIC PLAQUE MARKING WHERE JOHNSTON DIED, ADJACENT TO PATHWAY WITH CONCRETE CULVERT LEADING NORTH OUT OF RAVINE TOWARD JOHNSTON MEMORIAL SITE. VIEW NW. - Shiloh National Military Park Tour Roads, Shiloh, Hardin County, TN

  19. VIEW OF LAMP FIXTURE (EXTERIOR) ADJACENT TO ENTRANCE AT SOUTHWEST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF LAMP FIXTURE (EXTERIOR) ADJACENT TO ENTRANCE AT SOUTHWEST CORNER OF BUILDING 23, FACING NORTH - Roosevelt Base, Auditorium-Gymnasium, West Virginia Street between Richardson & Reeves Avenues, Long Beach, Los Angeles County, CA

  20. VIEW OF NORTHERN AND EASTERN SIDES FROM PARKING LOT ADJACENT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF NORTHERN AND EASTERN SIDES FROM PARKING LOT ADJACENT TO BUILDING 199 (POLICE STATION) - U.S. Naval Base, Pearl Harbor, Post Office, Avenue A near Eleventh Avenue, Pearl City, Honolulu County, HI

  1. 73. PASSAGE ADJACENT TO ROOM 232, EAST WING, SECOND FLOOR, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    73. PASSAGE ADJACENT TO ROOM 232, EAST WING, SECOND FLOOR, LOOKING WEST BY NORTHWEST, SHOWING EASTERNMOST ARCH OF FORMER GREAT HALL NORTH ARCADE - Smithsonian Institution Building, 1000 Jefferson Drive, between Ninth & Twelfth Streets, Southwest, Washington, District of Columbia, DC

  2. 28. TOP VIEW OF CIRCUIT BREAKER ADJACENT TO BRIDGE, CATENARY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    28. TOP VIEW OF CIRCUIT BREAKER ADJACENT TO BRIDGE, CATENARY ANCHOR BRIDGE 310, COS COB POWER PLANT - New York, New Haven & Hartford Railroad, Automatic Signalization System, Long Island Sound shoreline between Stamford & New Haven, Stamford, Fairfield County, CT

  3. 1. A BRICK AND CONCRETE FAN HOUSING ADJACENT TO ONE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. A BRICK AND CONCRETE FAN HOUSING ADJACENT TO ONE OF THE ADIT OPENINGS (VIEW TO THE NORTH). - Foster Gulch Mine, Fan Housing, Bear Creek 1 mile Southwest of Town of Bear Creek, Red Lodge, Carbon County, MT

  4. GENERAL VIEW OF WAREHOUSE ADJACENT TO BATCH PLANT, LOOKING NORTHWEST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    GENERAL VIEW OF WAREHOUSE ADJACENT TO BATCH PLANT, LOOKING NORTHWEST FROM DREY STREET PLANT, INSIDE WELCOME WALL - Chambers Window Glass Company, Warehouse & Shipping, North of Drey (Nineteenth) Street, West of Constitution Boulevard, Arnold, Westmoreland County, PA

  5. 10. SLATE PATIO ADJACENT TO SOUTH PORCH OF HOUSE, FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. SLATE PATIO ADJACENT TO SOUTH PORCH OF HOUSE, FROM SOUTHEAST CORNER OF REAR PORCH. SHED IS VISIBLE IN BACKGROUND. - Butt Valley Dam, Gate Tender's House, Butt Valley Reservoir Road, Caribou, Plumas County, CA

  6. Detail of fire alarm boxes located adjacent to the entrance ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail of fire alarm boxes located adjacent to the entrance of the northwest wing - Mare Island Naval Shipyard, Guard House & Barracks, Railroad Avenue near Eighteenth Street, Vallejo, Solano County, CA

  7. Detail exterior view looking north showing piping system adjacent to ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail exterior view looking north showing piping system adjacent to engine house. Gas cooling system is on far right. - Burnsville Natural Gas Pumping Station, Saratoga Avenue between Little Kanawha River & C&O Railroad line, Burnsville, Braxton County, WV

  8. 1. Ninth Street (west) facade. Adjacent on the north is ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Ninth Street (west) facade. Adjacent on the north is the 9th Street facade of 816 E Street. Both buildings were originally one property. - Riley Building, Rendezvous Adult Magazines & Films, 437 Ninth Street, Northwest, Washington, District of Columbia, DC

  9. 2. THREEQUARTER VIEW FROM ADJACENT ACCESS ROAD SHOWING THREE SPANS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. THREE-QUARTER VIEW FROM ADJACENT ACCESS ROAD SHOWING THREE SPANS AND NORTHWEST APPROACH SPANS, LOOKING SOUTHEAST - Red River Bridge, Spanning Red River at U.S. Highway 82, Garland, Miller County, AR

  10. 31. VAL, DETAIL OF LOADING PLATFORM ADJACENT TO LAUNCHER BRIDGE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. VAL, DETAIL OF LOADING PLATFORM ADJACENT TO LAUNCHER BRIDGE LOOKING WEST. - Variable Angle Launcher Complex, Variable Angle Launcher, CA State Highway 39 at Morris Reservior, Azusa, Los Angeles County, CA

  11. Basement, room 23, looking southwest into two adjacent offices with ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Basement, room 23, looking southwest into two adjacent offices with soundproof walls and pedestal flooring - March Air Force Base, Strategic Air Command, Combat Operations Center, 5220 Riverside Drive, Moreno Valley, Riverside County, CA

  12. 52. EASTSIDE PLANT: GENERAL VIEW OF GOVERNOR ADJACENT TO GENERATOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. EASTSIDE PLANT: GENERAL VIEW OF GOVERNOR ADJACENT TO GENERATOR - American Falls Water, Power & Light Company, Island Power Plant, Snake River, below American Falls Dam, American Falls, Power County, ID

  13. 7. August, 1970 9 ORANGE STREET, ADJACENT TO UNITARIAN CHURCH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. August, 1970 9 ORANGE STREET, ADJACENT TO UNITARIAN CHURCH (NOT IN STUDY AREA) - Orange & Union Streets Neighborhood Study, 8-31 Orange Street, 9-21 Union Street & Stone Alley, Nantucket, Nantucket County, MA

  14. Brick incinerator structure located adjacent to "motor courts." This example ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Brick incinerator structure located adjacent to "motor courts." This example is located between Buildings 26 and 27. Facing northeast - Harbor Hills Housing Project, 26607 Western Avenue, Lomita, Los Angeles County, CA

  15. Radiation and thermal stabilities of adenine nucleotides.

    PubMed

    Demidov, V V; Potaman, V N; Solyanina, I P; Trofimov, V I

    1995-03-01

    We have investigated in detail radiation and thermal stabilities and transformations of adenosine mono- and triphosphates in liquid and frozen solid aqueous solutions within a wide range of absorbed radiation dose (up to 75 kGy) and temperature (up to 160 degrees C). Dephosphorylation is the main pathway of high temperature hydrolysis of adenine nucleotides. Basic thermodynamic and kinetic parameters of this process have been determined. Radiolysis of investigated compounds at room temperature results in scission of N-glycosidic bond with a radiation yield about of 1 mol/100 eV. Solution freezing significantly enhances radiation stability of nucleotides as well as other biomolecules. This circumstance is essential in the discussion of panspermia concepts.

  16. Single-nucleotide polymorphism PCR for the detection of Mycoplasma pneumoniae and determination of macrolide resistance in respiratory samples.

    PubMed

    Ji, Misuk; Lee, Nam-Sihk; Oh, Ji-Min; Jo, Ji Yoon; Choi, Eun Hwa; Yoo, Soo Jin; Kim, Hyo-Bin; Hwang, Sang-Hyun; Choi, Sang-Ho; Lee, Sang-Oh; Kim, Mi-Na; Sung, Heungsup

    2014-07-01

    The aim of this study was to develop a single-nucleotide polymorphism (SNP) PCR assay to be performed directly on respiratory samples for the simultaneous detection of Mycoplasma pneumoniae and its 23S rRNA gene mutations, which are responsible for macrolide resistance. For multiplex SNP PCR, two outer primers for amplification of the 23S rRNA gene and two mutant-specific primers for the discrimination of single base changes were designed. A total of 73M. pneumoniae-positive samples and 100M. pneumoniae-negative samples were analyzed using this assay. By SNP PCR, we detected two mutations conferring high-level macrolide resistance in 22 samples (A2063G from 20 and A2064G from 2 samples); these results are identical to those produced by the 23S rRNA gene sequencing of M. pneumoniae-positive samples. Thus, this assay can be used as a practical method for the simultaneous detection of M. pneumoniae and mutations associated with macrolide resistance directly from respiratory samples. PMID:24780151

  17. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  18. Adjacent Segment Disease Perspective and Review of the Literature

    PubMed Central

    Saavedra-Pozo, Fanor M.; Deusdara, Renato A. M.; Benzel, Edward C.

    2014-01-01

    Background Adjacent segment disease has become a common topic in spine surgery circles because of the significant increase in fusion surgery in recent years and the development of motion preservation technologies that theoretically should lead to a decrease in this pathology. The purpose of this review is to organize the evidence available in the current literature on this subject. Methods For this literature review, a search was conducted in PubMed with the following keywords: adjacent segment degeneration and disease. Selection, review, and analysis of the literature were completed according to level of evidence. Results The PubMed search identified 850 articles, from which 41 articles were selected and reviewed. The incidence of adjacent segment disease in the cervical spine is close to 3% without a significant statistical difference between surgical techniques (fusion vs arthroplasty). Authors report the incidence of adjacent segment disease in the lumbar spine to range from 2% to 14%. Damage to the posterior ligamentous complex and sagittal imbalances are important risk factors for both degeneration and disease. Conclusion Insufficient evidence exists at this point to support the idea that total disc arthroplasty is superior to fusion procedures in minimizing the incidence of adjacent segment disease. The etiology is most likely multifactorial but it is becoming abundantly clear that adjacent segment disease is not caused by motion segment fusion alone. Fusion plus the presence of abnormal end-fusion alignment appears to be a major factor in creating end-fusion stresses that result in adjacent segment degeneration and subsequent disease. The data presented cast further doubt on previously established rationales for total disc arthroplasty, at least with regard to the effect of total disc arthroplasty on adjacent segment degeneration pathology. PMID:24688337

  19. Nucleotide Sequence-Based Multitarget Identification

    PubMed Central

    Vinayagamoorthy, T.; Mulatz, Kirk; Hodkinson, Roger

    2003-01-01

    MULTIGEN technology (T. Vinayagamoorthy, U.S. patent 6,197,510, March 2001) is a modification of conventional sequencing technology that generates a single electropherogram consisting of short nucleotide sequences from a mixture of known DNA targets. The target sequences may be present on the same or different nucleic acid molecules. For example, when two DNA targets are sequenced, the first and second sequencing primers are annealed to their respective target sequences, and then a polymerase causes chain extension by the addition of new deoxyribose nucleotides. Since the electrophoretic separation depends on the relative molecular weights of the truncated molecules, the molecular weight of the second sequencing primer was specifically designed to be higher than the combined molecular weight of the first sequencing primer plus the molecular weight of the largest truncated molecule generated from the first target sequence. Thus, the series of truncated molecules produced by the second sequencing primer will have higher molecular weights than those produced by the first sequencing primer. Hence, the truncated molecules produced by these two sequencing primers can be effectively separated in a single lane by standard gel electrophoresis in a single electropherogram without any overlapping of the nucleotide sequences. By using sequencing primers with progressively higher molecular weights, multiple short DNA sequences from a variety of targets can be determined simultaneously. We describe here the basic concept of MULTIGEN technology and three applications: detection of sexually transmitted pathogens (Neisseria gonorrhoeae, Chlamydia trachomatis, and Ureaplasma urealyticum), detection of contaminants in meat samples (coliforms, fecal coliforms, and Escherichia coli O157:H7), and detection of single-nucleotide polymorphisms in the human N-acetyltransferase (NAT1) gene (S. Fronhoffs et al., Carcinogenesis 22:1405-1412, 2001). PMID:12843076

  20. Vacuum ultraviolet photoionization of carbohydrates and nucleotides.

    PubMed

    Shin, Joong-Won; Bernstein, Elliot R

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5(')-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results. PMID:25669546

  1. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    SciTech Connect

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  2. Vacuum ultraviolet photoionization of carbohydrates and nucleotides.

    PubMed

    Shin, Joong-Won; Bernstein, Elliot R

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5(')-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  3. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    NASA Astrophysics Data System (ADS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5'-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  4. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    PubMed

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  5. Analysis of adjacent segment reoperation after lumbar total disc replacement

    PubMed Central

    Rainey, Scott; Blumenthal, Scott L.; Zigler, Jack E.; Guyer, Richard D.; Ohnmeiss, Donna D.

    2012-01-01

    Background Fusion has long been used for treating chronic back pain unresponsive to nonoperative care. However, potential development of adjacent segment degeneration resulting in reoperation is a concern. Total disc replacement (TDR) has been proposed as a method for addressing back pain and preventing or reducing adjacent segment degeneration. The purpose of the study was to determine the reoperation rate at the segment adjacent to a level implanted with a lumbar TDR and to analyze the pre-TDR condition of the adjacent segment. Methods This study was based on a retrospective review of charts and radiographs from a consecutive series of 1000 TDR patients to identify those who underwent reoperation because of adjacent segment degeneration. Some of the patients were part of randomized studies comparing TDR with fusion. Adjacent segment reoperation data were also collected from 67 patients who were randomized to fusion in those studies. The condition of the adjacent segment before the index surgery was compared with its condition before reoperation based on radiographs, magnetic resonance imaging (MRI), and computed tomography. Results Of the 1000 TDR patients, 20 (2.0%) underwent reoperation. The mean length of time from arthroplasty to reoperation was 28.3 months (range, 0.5–85 months). Of the adjacent segments evaluated on preoperative MRI, 38.8% were normal, 38.8% were moderately diseased, and 22.2% were classified as having severe degeneration. None of these levels had a different grading at the time of reoperation compared with the pre-TDR MRI study. Reoperation for adjacent segment degeneration was performed in 4.5% of the fusion patients. Conclusions The 2.0% rate of adjacent segment degeneration resulting in reoperation in this study is similar to the 2.0% to 2.8% range in other studies and lower than the published rates of 7% to 18% after lumbar fusion. By carefully assessing the presence of pre-existing degenerative changes before performing arthroplasty

  6. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  7. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  8. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  9. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  10. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  11. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  12. Phylogenetic Analysis of 16S rRNA Genes and PCR Analysis of the nec1 Gene from Streptomyces spp. Causing Common Scab, Pitted Scab, and Netted Scab in Finland.

    PubMed

    Kreuze, J F; Suomalainen, S; Paulin, L; Valkonen, J P

    1999-06-01

    ABSTRACT The sequences of the 16S rRNA genes (nucleotides 29 to 1,521) from various Streptomyces strains pathogenic to potato were compared. These included 10 pathogenic Streptomyces strains isolated from potato scab lesions in Finland, the type strains of S. aureofaciens NRRL 2209(T) and S. lydicus ATCC 25470(T), 'S. griseus subsp. scabies' ATCC 10246, and two S. griseus strains that were originally deposited to the collection as pathogens. The nucleotide sequence (>94.5% sequence identity [SI]) and length (1,469 to 1,481 nucleotides) of the analyzed region varied. Phylogenetic analysis of 16S rRNA genes placed Finnish strains into three species, supported by previously characterized morphological and physiological traits. Six Finnish strains, including two strains that deviated from the others in one trait (no spiral sporophores or D-xylose utilization), had identical 16S rRNA genes and were identified as S. scabies (99.9% SI to S. scabies ATCC 49173). Three Finnish strains were identified as S. turgidiscabies, a species previously described only in Japan (99.9% SI to S. turgidiscabies ATCC 700248). Finnish strain 317 and S. aureofaciens NRRL 2209 (99.8% SI) were placed in a distinct phylogenetic cluster together with Kitosatospora spp., which suggests that S. aureofaciens may belong to the recently revived genus Kitosatospora. In pathogenicity tests, S. scabies caused characteristic symptoms of common scab, S. turgidiscabies caused mainly pitted scab, and S. aureofaciens caused netted scab and necrotic lesions on stolons of potato cultivars Bintje and Matilda in the greenhouse. The nec1 gene and the intergenic region between nec1 and the 5' transposase pseudogene ORFtnp were successfully amplified by polymerase chain reaction from S. scabies ATCC 49173 and the pathogenic Finnish strains of S. scabies, but not from a nonpathogenic strain of S. scabies, three pathogenic and two nonpathogenic strains of S. turgidiscabies, and S. aureofaciens.

  13. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp.

  14. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. PMID:24769445

  15. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    PubMed

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  16. Pyrrolidine nucleotide analogs with a tunable conformation

    PubMed Central

    Poštová Slavětínská, Lenka; Rejman, Dominik

    2014-01-01

    Summary Conformational preferences of the pyrrolidine ring in nucleotide analogs 7–14 were investigated by means of NMR and molecular modeling. The effect of the relative configuration of hydroxy and nucleobase substituents as well as the effect of the alkylation or acylation of the pyrrolidine nitrogen atom on the conformation of the pyrrolidine ring were studied. The results of a conformational analysis show that the alkylation/acylation can be effectively used for tuning the pyrrolidine conformation over the whole pseudorotation cycle. PMID:25246956

  17. Complete Nucleotide Sequence of Tn10

    PubMed Central

    Chalmers, Ronald; Sewitz, Sven; Lipkow, Karen; Crellin, Paul

    2000-01-01

    The complete nucleotide sequence of Tn10 has been determined. The dinucleotide signature and percent G+C of the sequence had no discontinuities, indicating that Tn10 constitutes a homogeneous unit. The new sequence contained three new open reading frames corresponding to a glutamate permease, repressors of heavy metal resistance operons, and a hypothetical protein in Bacillus subtilis. The glutamate permease was fully functional when expressed, but Tn10 did not protect Escherichia coli from the toxic effects of various metals. PMID:10781570

  18. Transferable Resistance to Aminoglycosides by Methylation of G1405 in 16S rRNA and to Hydrophilic Fluoroquinolones by QepA-Mediated Efflux in Escherichia coli▿

    PubMed Central

    Périchon, Bruno; Courvalin, Patrice; Galimand, Marc

    2007-01-01

    Plasmid pIP1206 was detected in Escherichia coli strain 1540 during the screening of clinical isolates of Enterobacteriaceae for high-level resistance to aminoglycosides. The sequence of this IncFI conjugative plasmid of ca. 100 kb was partially determined. pIP1206 carried the rmtB gene for a ribosome methyltransferase that was shown to modify the N7 position of nucleotide G1405, located in the A site of 16S rRNA. It also contained the qepA (quinolone efflux pump) gene that encodes a 14-transmembrane-segment putative efflux pump belonging to the major facilitator superfamily of proton-dependent transporters. Disruption of membrane proton potential by the efflux pump inhibitor carbonyl cyanide m-chlorophenylhydrazone in a transconjugant harboring the qepA gene resulted in elevation of norfloxacin accumulation. The transporter conferred resistance to the hydrophilic quinolones norfloxacin and ciprofloxacin. PMID:17470656

  19. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes.

    PubMed

    Bueno, Maria Fernanda C; Francisco, Gabriela R; de Oliveira Garcia, Doroti; Doi, Yohei

    2016-01-04

    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6')-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles.

  20. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes

    PubMed Central

    Bueno, Maria Fernanda C.; Francisco, Gabriela R.; de Oliveira Garcia, Doroti

    2016-01-01

    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6′)-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles. PMID:26729503

  1. Phylogenetic analysis of Histoplasma capsulatum based on partial sequence of the D1/D2 region of the 28S rRNA gene.

    PubMed

    Komori, Takashi; Sano, Ayako; Yarita, Kyoko; Kitagawa, Teruyuki; Kamei, Katsuhiko; Nishimura, Kazuko

    2005-01-01

    In order to confirm the phylogenetic relationships of Histoplasma capsulatum, the partial sequences of large subunit (28S) ribosomal gene (D1/D2 region) of 49 isolates were studied. The similarity values of the 49 isolates were more than 99.0% across 617 base pairs, however, the 49 isolates were divided into 9 groups. These 9 groups were independent of 3 varieties, var. capsulatum, var. farciminosum and var. duboisii. These results showed that analysis of the nucleotide sequence of the 28S rRNA gene was very effective for identification of H. capsulatum and that three varieties of H. capsulatum should be reclassified according to the phylogenetic relationship established from analysis of the D1/D2 region sequences. PMID:16282973

  2. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  3. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  4. Laplacian versus adjacency matrix in quantum walk search

    NASA Astrophysics Data System (ADS)

    Wong, Thomas G.; Tarrataca, Luís; Nahimov, Nikolay

    2016-10-01

    A quantum particle evolving by Schrödinger's equation contains, from the kinetic energy of the particle, a term in its Hamiltonian proportional to Laplace's operator. In discrete space, this is replaced by the discrete or graph Laplacian, which gives rise to a continuous-time quantum walk. Besides this natural definition, some quantum walk algorithms instead use the adjacency matrix to effect the walk. While this is equivalent to the Laplacian for regular graphs, it is different for non-regular graphs and is thus an inequivalent quantum walk. We algorithmically explore this distinction by analyzing search on the complete bipartite graph with multiple marked vertices, using both the Laplacian and adjacency matrix. The two walks differ qualitatively and quantitatively in their required jumping rate, runtime, sampling of marked vertices, and in what constitutes a natural initial state. Thus the choice of the Laplacian or adjacency matrix to effect the walk has important algorithmic consequences.

  5. Laplacian versus adjacency matrix in quantum walk search

    NASA Astrophysics Data System (ADS)

    Wong, Thomas G.; Tarrataca, Luís; Nahimov, Nikolay

    2016-06-01

    A quantum particle evolving by Schrödinger's equation contains, from the kinetic energy of the particle, a term in its Hamiltonian proportional to Laplace's operator. In discrete space, this is replaced by the discrete or graph Laplacian, which gives rise to a continuous-time quantum walk. Besides this natural definition, some quantum walk algorithms instead use the adjacency matrix to effect the walk. While this is equivalent to the Laplacian for regular graphs, it is different for non-regular graphs and is thus an inequivalent quantum walk. We algorithmically explore this distinction by analyzing search on the complete bipartite graph with multiple marked vertices, using both the Laplacian and adjacency matrix. The two walks differ qualitatively and quantitatively in their required jumping rate, runtime, sampling of marked vertices, and in what constitutes a natural initial state. Thus the choice of the Laplacian or adjacency matrix to effect the walk has important algorithmic consequences.

  6. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  7. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  8. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  9. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  10. On the Adjacent Eccentric Distance Sum Index of Graphs

    PubMed Central

    Qu, Hui; Cao, Shujuan

    2015-01-01

    For a given graph G, ε(v) and deg(v) denote the eccentricity and the degree of the vertex v in G, respectively. The adjacent eccentric distance sum index of a graph G is defined as ξsv(G)=∑v∈V(G)ε(v)D(v)deg(v), where D(v)=∑u∈V(G)d(u,v) is the sum of all distances from the vertex v. In this paper we derive some bounds for the adjacent eccentric distance sum index in terms of some graph parameters, such as independence number, covering number, vertex connectivity, chromatic number, diameter and some other graph topological indices. PMID:26091095

  11. Molecular disorganization of axons adjacent to human lacunar infarcts.

    PubMed

    Hinman, Jason D; Lee, Monica D; Tung, Spencer; Vinters, Harry V; Carmichael, S Thomas

    2015-03-01

    Cerebral microvascular disease predominantly affects brain white matter and deep grey matter, resulting in ischaemic damage that ranges from lacunar infarcts to white matter hyperintensities seen on magnetic resonance imaging. These lesions are common and result in both clinical stroke syndromes and accumulate over time, resulting in cognitive deficits and dementia. Magnetic resonance imaging studies suggest that these lesions progress over time, accumulate adjacent to prior lesions and have a penumbral region susceptible to further injury. The pathological correlates of this adjacent injury in surviving myelinated axons have not been previously defined. In this study, we sought to determine the molecular organization of axons in tissue adjacent to lacunar infarcts and in the regions surrounding microinfarcts, by determining critical elements in axonal function: the morphology and length of node of Ranvier segments and adjacent paranodal segments. We examined post-mortem brain tissue from six patients with lacunar infarcts and tissue from two patients with autosomal dominant retinal vasculopathy and cerebral leukoencephalopathy (previously known as hereditary endotheliopathy with retinopathy, nephropathy and stroke) who accumulate progressive white matter ischaemic lesions in the form of lacunar and microinfarcts. In axons adjacent to lacunar infarcts yet extending up to 150% of the infarct diameter away, both nodal and paranodal length increase by ∼20% and 80%, respectively, reflecting a loss of normal cell-cell adhesion and signalling between axons and oligodendrocytes. Using premorbid magnetic resonance images, brain regions from patients with retinal vasculopathy and cerebral leukoencephalopathy that harboured periventricular white matter hyperintensities were selected and the molecular organization of axons was determined within these regions. As in regions adjacent to lacunar infarcts, nodal and paranodal length in white matter of these patients is

  12. Molecular disorganization of axons adjacent to human lacunar infarcts

    PubMed Central

    Lee, Monica D.; Tung, Spencer; Vinters, Harry V.; Carmichael, S. Thomas

    2015-01-01

    Cerebral microvascular disease predominantly affects brain white matter and deep grey matter, resulting in ischaemic damage that ranges from lacunar infarcts to white matter hyperintensities seen on magnetic resonance imaging. These lesions are common and result in both clinical stroke syndromes and accumulate over time, resulting in cognitive deficits and dementia. Magnetic resonance imaging studies suggest that these lesions progress over time, accumulate adjacent to prior lesions and have a penumbral region susceptible to further injury. The pathological correlates of this adjacent injury in surviving myelinated axons have not been previously defined. In this study, we sought to determine the molecular organization of axons in tissue adjacent to lacunar infarcts and in the regions surrounding microinfarcts, by determining critical elements in axonal function: the morphology and length of node of Ranvier segments and adjacent paranodal segments. We examined post-mortem brain tissue from six patients with lacunar infarcts and tissue from two patients with autosomal dominant retinal vasculopathy and cerebral leukoencephalopathy (previously known as hereditary endotheliopathy with retinopathy, nephropathy and stroke) who accumulate progressive white matter ischaemic lesions in the form of lacunar and microinfarcts. In axons adjacent to lacunar infarcts yet extending up to 150% of the infarct diameter away, both nodal and paranodal length increase by ∼20% and 80%, respectively, reflecting a loss of normal cell-cell adhesion and signalling between axons and oligodendrocytes. Using premorbid magnetic resonance images, brain regions from patients with retinal vasculopathy and cerebral leukoencephalopathy that harboured periventricular white matter hyperintensities were selected and the molecular organization of axons was determined within these regions. As in regions adjacent to lacunar infarcts, nodal and paranodal length in white matter of these patients is

  13. Nonlinear spin wave coupling in adjacent magnonic crystals

    NASA Astrophysics Data System (ADS)

    Sadovnikov, A. V.; Beginin, E. N.; Morozova, M. A.; Sharaevskii, Yu. P.; Grishin, S. V.; Sheshukova, S. E.; Nikitov, S. A.

    2016-07-01

    We have experimentally studied the coupling of spin waves in the adjacent magnonic crystals. Space- and time-resolved Brillouin light-scattering spectroscopy is used to demonstrate the frequency and intensity dependent spin-wave energy exchange between the side-coupled magnonic crystals. The experiments and the numerical simulation of spin wave propagation in the coupled periodic structures show that the nonlinear phase shift of spin wave in the adjacent magnonic crystals leads to the nonlinear switching regime at the frequencies near the forbidden magnonic gap. The proposed side-coupled magnonic crystals represent a significant advance towards the all-magnonic signal processing in the integrated magnonic circuits.

  14. Structural dynamics of cereal mitochondrial genomes as revealed by complete nucleotide sequencing of the wheat mitochondrial genome.

    PubMed

    Ogihara, Yasunari; Yamazaki, Yukiko; Murai, Koji; Kanno, Akira; Terachi, Toru; Shiina, Takashi; Miyashita, Naohiko; Nasuda, Shuhei; Nakamura, Chiharu; Mori, Naoki; Takumi, Shigeo; Murata, Minoru; Futo, Satoshi; Tsunewaki, Koichiro

    2005-01-01

    The application of a new gene-based strategy for sequencing the wheat mitochondrial genome shows its structure to be a 452 528 bp circular molecule, and provides nucleotide-level evidence of intra-molecular recombination. Single, reciprocal and double recombinant products, and the nucleotide sequences of the repeats that mediate their formation have been identified. The genome has 55 genes with exons, including 35 protein-coding, 3 rRNA and 17 tRNA genes. Nucleotide sequences of seven wheat genes have been determined here for the first time. Nine genes have an exon-intron structure. Gene amplification responsible for the production of multicopy mitochondrial genes, in general, is species-specific, suggesting the recent origin of these genes. About 16, 17, 15, 3.0 and 0.2% of wheat mitochondrial DNA (mtDNA) may be of genic (including introns), open reading frame, repetitive sequence, chloroplast and retro-element origin, respectively. The gene order of the wheat mitochondrial gene map shows little synteny to the rice and maize maps, indicative that thorough gene shuffling occurred during speciation. Almost all unique mtDNA sequences of wheat, as compared with rice and maize mtDNAs, are redundant DNA. Features of the gene-based strategy are discussed, and a mechanistic model of mitochondrial gene amplification is proposed. PMID:16260473

  15. Structural dynamics of cereal mitochondrial genomes as revealed by complete nucleotide sequencing of the wheat mitochondrial genome

    PubMed Central

    Ogihara, Yasunari; Yamazaki, Yukiko; Murai, Koji; Kanno, Akira; Terachi, Toru; Shiina, Takashi; Miyashita, Naohiko; Nasuda, Shuhei; Nakamura, Chiharu; Mori, Naoki; Takumi, Shigeo; Murata, Minoru; Futo, Satoshi; Tsunewaki, Koichiro

    2005-01-01

    The application of a new gene-based strategy for sequencing the wheat mitochondrial genome shows its structure to be a 452 528 bp circular molecule, and provides nucleotide-level evidence of intra-molecular recombination. Single, reciprocal and double recombinant products, and the nucleotide sequences of the repeats that mediate their formation have been identified. The genome has 55 genes with exons, including 35 protein-coding, 3 rRNA and 17 tRNA genes. Nucleotide sequences of seven wheat genes have been determined here for the first time. Nine genes have an exon–intron structure. Gene amplification responsible for the production of multicopy mitochondrial genes, in general, is species-specific, suggesting the recent origin of these genes. About 16, 17, 15, 3.0 and 0.2% of wheat mitochondrial DNA (mtDNA) may be of genic (including introns), open reading frame, repetitive sequence, chloroplast and retro-element origin, respectively. The gene order of the wheat mitochondrial gene map shows little synteny to the rice and maize maps, indicative that thorough gene shuffling occurred during speciation. Almost all unique mtDNA sequences of wheat, as compared with rice and maize mtDNAs, are redundant DNA. Features of the gene-based strategy are discussed, and a mechanistic model of mitochondrial gene amplification is proposed. PMID:16260473

  16. Variance estimation for nucleotide substitution models.

    PubMed

    Chen, Weishan; Wang, Hsiuying

    2015-09-01

    The current variance estimators for most evolutionary models were derived when a nucleotide substitution number estimator was approximated with a simple first order Taylor expansion. In this study, we derive three variance estimators for the F81, F84, HKY85 and TN93 nucleotide substitution models, respectively. They are obtained using the second order Taylor expansion of the substitution number estimator, the first order Taylor expansion of a squared deviation and the second order Taylor expansion of a squared deviation, respectively. These variance estimators are compared with the existing variance estimator in terms of a simulation study. It shows that the variance estimator, which is derived using the second order Taylor expansion of a squared deviation, is more accurate than the other three estimators. In addition, we also compare these estimators with an estimator derived by the bootstrap method. The simulation shows that the performance of this bootstrap estimator is similar to the estimator derived by the second order Taylor expansion of a squared deviation. Since the latter one has an explicit form, it is more efficient than the bootstrap estimator.

  17. Evolutionary relationships among the eukaryotic crown taxa taking into account site-to-site rate variation in 18S rRNA.

    PubMed

    Van de Peer, Y; De Wachter, R

    1997-12-01

    In this study we constructed a bootstrapped distance tree of 500 small subunit ribosomal RNA sequences from organisms belonging to the so-called crown of eukaryote evolution. Taking into account the substitution rate of the individual nucleotides of the rRNA sequence alignment, our results suggest that (1) animals, true fungi, and choanoflagellates share a common origin: The branch joining these taxa is highly supported by bootstrap analysis (bootstrap support [BS] > 90%), (2) stramenopiles and alveolates are sister groups (BS = 75%), (3) within the alveolates, dinoflagellates and apicomplexans share a common ancestor BS > 95%), while in turn they both share a common origin with the ciliates (BS > 80%), and (4) within the stramenopiles, heterokont algae, hyphochytriomycetes, and oomycetes form a monophyletic grouping well supported by bootstrap analysis (BS > 85%), preceded by the well-supported successive divergence of labyrinthulomycetes and bicosoecids. On the other hand, many evolutionary relationships between crown taxa are still obscure on the basis of 18S rRNA. The branching order between the animal-fungal-choanoflagellates clade and the chlorobionts, the alveolates and stramenopiles, red algae, and several smaller groups of organisms remains largely unresolved.When among-site rate variation is not considered, the inferred tree topologies are inferior to those where the substitution rate spectrum for the 18S rRNA is taken into account. This is primarily indicated by the erroneous branching of fast-evolving sequences. Moreover, when different substitution rates among sites are not considered, the animals no longer appear as a monophyletic grouping in most distance trees.

  18. Differentiation of Listeria monocytogenes and Listeria innocua by 16S rRNA genes and intraspecies discrimination of Listeria monocytogenes strains by random amplified polymorphic DNA polymorphisms.

    PubMed Central

    Czajka, J; Bsat, N; Piani, M; Russ, W; Sultana, K; Wiedmann, M; Whitaker, R; Batt, C A

    1993-01-01

    Differences in the 16S rRNA genes (16S rDNA) which can be used to discriminate Listeria monocytogenes from Listeria innocua have been detected. The 16S rDNA were amplified by polymerase chain reaction with a set of oligonucleotide primers which flank a 1.5-kb fragment. Sequence differences were observed in the V2 region of the 16S rDNA both between L. monocytogenes Scott A and L. innocua and between different L. monocytogenes serotypes. Although L. monocytogenes SLCC2371 had the same V2 region sequence as L. innocua, the two species were different within the V9 region at nucleotides 1259 and 1292, in agreement with previous studies (R.-F. Wang, W.-W. Cao, and M.G. Johnson, Appl. Environ. Microbiol. 57:3666-3670, 1991). Intraspecies discrimination of L. monocytogenes strains was achieved by using the patterns generated by random amplified polymorphic DNA primers. Although some distinction can be made within the L. monocytogenes species by their 16S rDNA sequence, a far greater discrimination within species could be made by generating random amplified polymorphic DNA patterns from chromosomal DNA. By using a number of 10-bp primers, unique patterns for each isolate which in all cases examined differentiate between various L. monocytogenes serotypes, even though they may have the same 16S rRNA sequences, could be generated. Images PMID:8439157

  19. U17/snR30 is a ubiquitous snoRNA with two conserved sequence motifs essential for 18S rRNA production.

    PubMed

    Atzorn, Vera; Fragapane, Paola; Kiss, Tamás

    2004-02-01

    Saccharomyces cerevisiae snR30 is an essential box H/ACA small nucleolar RNA (snoRNA) required for the processing of 18S rRNA. Here, we show that the previously characterized human, reptilian, amphibian, and fish U17 snoRNAs represent the vertebrate homologues of yeast snR30. We also demonstrate that U17/snR30 is present in the fission yeast Schizosaccharomyces pombe and the unicellular ciliated protozoan Tetrahymena thermophila. Evolutionary comparison revealed that the 3'-terminal hairpins of U17/snR30 snoRNAs contain two highly conserved sequence motifs, the m1 (AUAUUCCUA) and m2 (AAACCAU) elements. Mutation analysis of yeast snR30 demonstrated that the m1 and m2 elements are essential for early cleavages of the 35S pre-rRNA and, consequently, for the production of mature 18S rRNA. The m1 and m2 motifs occupy the opposite strands of an internal loop structure, and they are located invariantly 7 nucleotides upstream from the ACA box of U17/snR30 snoRNAs. U17/snR30 is the first identified box H/ACA snoRNA that possesses an evolutionarily conserved role in the nucleolytic processing of eukaryotic pre-rRNA.

  20. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  1. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter

    2016-01-01

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  2. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.

    PubMed

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter

    2016-05-19

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes.

  3. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  4. Incorporation of reporter-labeled nucleotides by DNA polymerases.

    PubMed

    Anderson, Jon P; Angerer, Bernhard; Loeb, Lawrence A

    2005-02-01

    The incorporation of fluorescently labeled nucleotides into DNA by DNA polymerases has been used extensively for tagging genes and for labeling DNA. However, we lack studies comparing polymerase efficiencies for incorporating different fluorescently labeled nucleotides. We analyzed the incorporation of fluorescent deoxynucleoside triphosphates by 10 different DNA polymerases, representing a cross-section of DNA polymerases from families A, B, and reverse transcriptase. The substitution of one or more different reporter-labeled nucleotides for the cognate nucleotides was initially investigated by using an in vitro polymerase extension filter-binding assay with natural DNA as a template. Further analysis on longer DNA fragments containing one or more nucleotide analogs was performed using a newly developed extension cut assay. The results indicate that incorporation of fluorescent nucleotides is dependent on the DNA polymerase, fluorophore, linker between the nucleotide and the fluorophore, and position for attachment of the linker and the cognate nucleotide. Of the polymerases tested, Taq and Vent exo DNA polymerases were most efficient at incorporating a variety of fluorescently labeled nucleotides. This study suggests that it should be feasible to copy DNA with reactions mixtures that contain all four fluorescently labeled nucleotides allowing for high-density labeling of DNA. PMID:15727132

  5. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  6. Bacterial community composition of anthropogenic biochar and Amazonian anthrosols assessed by 16S rRNA gene 454 pyrosequencing.

    PubMed

    Taketani, Rodrigo Gouvêa; Lima, Amanda Barbosa; da Conceição Jesus, Ederson; Teixeira, Wenceslau Geraldes; Tiedje, James M; Tsai, Siu Mui

    2013-08-01

    Biochar (BC) is a common minor constituent of soils and is usually derived from the burning of wood materials. In the case of Amazonian dark earth (ADE) soils, the increased amount of this material is believed to be due to anthropogenic action by ancient indigenous populations. In this study, we use 16S rRNA gene pyrosequencing to assess the bacterial diversity observed in the BC found in ADEs as well as in the dark earth itself and the adjacent Acrisol. Samples were taken from two sites, one cultivated with manioc and one with secondary forest cover. Analyses revealed that the community structure found in each sample had unique features. At a coarse phylogenetic resolution, the most abundant phyla in all sequence libraries were Actinobacteria, Acidobacteria, Verrucomicrobia and Proteobacteria that were present in similar relative abundance across all samples. However, the class composition varied between them highlighting the difference between the Acrisol and the remaining samples. This result was also corroborated by the comparison of the OTU composition (at 97 % identity). Also, soil coverage has shown an effect over the community structure observed in all samples. This pattern was found to be significant through unweighted UniFrac as well as P tests. These results indicate that, although the ADEs are found in patches within the Acrisols, the contrasting characteristics found between them led to the development of significantly different communities. PMID:23743632

  7. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    PubMed

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data.

  8. Polyamine/Nucleotide Coacervates Provide Strong Compartmentalization of Mg²⁺, Nucleotides, and RNA.

    PubMed

    Frankel, Erica A; Bevilacqua, Philip C; Keating, Christine D

    2016-03-01

    Phase separation of aqueous solutions containing polyelectrolytes can lead to formation of dense, solute-rich liquid droplets referred to as coacervates, surrounded by a dilute continuous phase of much larger volume. This type of liquid-liquid phase separation is thought to help explain the appearance of polyelectrolyte-rich intracellular droplets in the cytoplasm and nucleoplasm of extant biological cells and may be relevant to protocellular compartmentalization of nucleic acids on the early Earth. Here we describe complex coacervates formed upon mixing the polycation poly(allylamine) (PAH, 15 kDa) with the anionic nucleotides adenosine 5'-mono-, di-, and triphosphate (AMP, ADP, and ATP). Droplet formation was observed over a wide range of pH and MgCl2 concentrations. The nucleotides themselves as well as Mg(2+) and RNA oligonucleotides were all extremely concentrated within the coacervates. Nucleotides present at just 2.5 mM in bulk solution had concentrations greater than 1 M inside the coacervate droplets. A solution with a total Mg(2+) concentration of 10 mM had 1-5 M Mg(2+) in the coacervates, and RNA random sequence (N54) partitioned ∼10,000-fold into the coacervates. Coacervate droplets are thus rich in nucleotides, Mg(2+), and RNA, providing a medium favorable for generating functional RNAs. Compartmentalization of nucleotides at high concentrations could have facilitated their polymerization to form oligonucleotides, which preferentially accumulate in the droplets. Locally high Mg(2+) concentrations could have aided folding and catalysis in an RNA world, making coacervate droplets an appealing platform for exploring protocellular environments. PMID:26844692

  9. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    PubMed

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  10. 4. Elevation looking southwest from adjacent hills on northeast side ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Elevation looking southwest from adjacent hills on northeast side of bridge, taken from river level. Note entire east side and substructure. - Presumpscot Falls Bridge, Spanning Presumptscot River at Allen Avenue extension, 0.75 mile west of U.S. Interstate 95, Falmouth, Cumberland County, ME

  11. 12. VIEW LOOKING WEST FROM THE PARKING LOT ADJACENT TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. VIEW LOOKING WEST FROM THE PARKING LOT ADJACENT TO THE STEEL PLANT OFFICES. BAR AND BILLET MILLS AND, IN THE DISTANCE, THE BASIC OXYGEN FURNACES MAY BE SEEN. - Corrigan, McKinney Steel Company, 3100 East Forty-fifth Street, Cleveland, Cuyahoga County, OH

  12. 8. Exterior view, showing tank and associated piping adjacent to ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. Exterior view, showing tank and associated piping adjacent to Test Cell 6, Systems Integration Laboratory Building (T-28), looking south. - Air Force Plant PJKS, Systems Integration Laboratory, Systems Integration Laboratory Building, Waterton Canyon Road & Colorado Highway 121, Lakewood, Jefferson County, CO

  13. 10. Detail and contextual view of bridge and adjacent farmstead ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Detail and contextual view of bridge and adjacent farmstead setting. Note laced vertical compression members, latticed portal strut, decorative strut bracing, and lightness of diagonal and lateral tension members. View to southeast through southeast portal from truss mid-span. - Red Bank Creek Bridge, Spanning Red Bank Creek at Rawson Road, Red Bluff, Tehama County, CA

  14. 11. Interior detail, Boiler Room, fire door to the adjacent ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Interior detail, Boiler Room, fire door to the adjacent Blacksmith Shop, Roundhouse Machine Shop Extension, Southern Pacific Railroad Carlin Shops, view to southwest (90mm lens). - Southern Pacific Railroad, Carlin Shops, Roundhouse Machine Shop Extension, Foot of Sixth Street, Carlin, Elko County, NV

  15. 1. VIEW FROM SOUTHWEST SHOWING SOUTH (FRONT) ELEVATION, ADJACENT LOUGHRAN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW FROM SOUTHWEST SHOWING SOUTH (FRONT) ELEVATION, ADJACENT LOUGHRAN BUILDING (BASSIN'S RESTAURANT) (HABS No. DC-357), 501-511 14TH STREET (THE LOCKER ROOM) HABS No. DC-356) ON CORNER, AND MUNSEY BUILDING (HABS No. DC-358) - William J. Stone Building, 1345 E Street Northwest, Washington, District of Columbia, DC

  16. VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING RECREATION AREA AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING RECREATION AREA AND ENTRY TO NEIGHBORHOOD. VIEW FACING SOUTHEAST - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, Intersection of Acacia Road and Brich Circle, Pearl City, Honolulu County, HI

  17. VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING INTERSECTION OF ACACIA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING INTERSECTION OF ACACIA ROAD WITH BIRCH CIRCLE. VIEW FACING NORTHEAST - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, Intersection of Acacia Road and Brich Circle, Pearl City, Honolulu County, HI

  18. VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING RECREATION AREA ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING RECREATION AREA ON RIGHT, AND HOUSING AREA ON LEFT. VIEW FACING EAST/NORTHEAST - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, Intersection of Acacia Road and Brich Circle, Pearl City, Honolulu County, HI

  19. VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING WESTERN SIDE OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FROM ATOP ADJACENT RESIDENTIAL TOWER, SHOWING WESTERN SIDE OF NEIGHBORHOOD. VIEW FACING NORTHWEST - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, Intersection of Acacia Road and Brich Circle, Pearl City, Honolulu County, HI

  20. 1. OVERVIEW SHOWING FIRING CONTROL BLOCKHOUSE 0502 AND ADJACENT OBSERVATION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERVIEW SHOWING FIRING CONTROL BLOCKHOUSE 0502 AND ADJACENT OBSERVATION TOWER. WATER BRAKE TROUGH SEGMENT AT LOWER RIGHT. Looking north northeast. - Edwards Air Force Base, South Base Sled Track, Firing & Control Blockhouse for 10,000-foot Track, South of Sled Track at midpoint of 20,000-foot track, Lancaster, Los Angeles County, CA

  1. 22. Float located adjacent to entry stair in filtration bed. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. Float located adjacent to entry stair in filtration bed. The float actuates a valve that maintains water level over the bed. - Lake Whitney Water Filtration Plant, Filtration Plant, South side of Armory Street between Edgehill Road & Whitney Avenue, Hamden, New Haven County, CT

  2. 7. VIEW OF WATER TREATMENT PLANT, ADJACENT TO THE COAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. VIEW OF WATER TREATMENT PLANT, ADJACENT TO THE COAL CONVEYOR; IN THE DISTANCE IS THE FREQUENCY CHANGER HOUSE, WHICH IS ATTACHED TO SWITCH HOUSE NO. 1; LOOKING WEST. - Commonwealth Electric Company, Fisk Street Electrical Generating Station, 1111 West Cermak Avenue, Chicago, Cook County, IL

  3. 4. REAR ELEVATION, DETAIL OF CONSTRUCTION, ADJACENT CORNER POSTS BETWEEN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. REAR ELEVATION, DETAIL OF CONSTRUCTION, ADJACENT CORNER POSTS BETWEEN BUILDING PERIODS 1 AND 3. NOTE REUSED WOOD STRIP NAILED TO BUILDING PERIOD 1 POST INSCRIBED 'ST. LEONARD'. THERE ARE NO NAIL HOLES IN THE PERIOD 3 POST, THE FARRING STRIPS ADJUST FOR CLADDING - Charles' Gift, State Routes 2 & 4, Lusby, Calvert County, MD

  4. Biogeochemistry of hydrothermally and adjacent non-altered soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As a field/lab project, students in the Soil Biogeochemistry class of the University of Nevada, Reno described and characterized seven pedons, developed in hydrothermally and adjacent non-hydrothermally altered andesitic parent material near Reno, NV. Hydrothermally altered soils had considerably lo...

  5. 12. LOG FOUNDATION ELEMENTS OF THE SAWMILL ADJACENT TO THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. LOG FOUNDATION ELEMENTS OF THE SAWMILL ADJACENT TO THE CANAL, LOOKING EAST. BARREN AREA IN FOREGROUND IS DECOMPOSING SAWDUST. DIRT PILE IN BACKGROUND IS THE EDGE OF THE SUMMIT COUNTY LANDFILL. - Snake River Ditch, Headgate on north bank of Snake River, Dillon, Summit County, CO

  6. LEHR NO. 2 AND LEHR NO. 3 ADJACENT TO FURNACE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    LEHR NO. 2 AND LEHR NO. 3 ADJACENT TO FURNACE ROOM; THE PIPES AT THE BOTTOM ARE PART OF THE RADIANT HEATING SYSTEM USED FOR HEATING THE FACTORY DURING COLD WEATHER. - Westmoreland Glass Company, Seventh & Kier Streets, Grapeville, Westmoreland County, PA

  7. How subaerial salt extrusions influence water quality in adjacent aquifers

    NASA Astrophysics Data System (ADS)

    Mehdizadeh, Razieh; Zarei, Mehdi; Raeisi, Ezzat

    2015-12-01

    Brines supplied from salt extrusions cause significant groundwater salinization in arid and semi-arid regions where salt rock is exposed to dissolution by episodic rainfalls. Here we focus on 62 of the 122 diapirs of Hormuz salt emergent in the southern Iran. To consider managing the degradation effect that salt extrusions have on the quality of adjoining aquifers, it is first necessary to understand how they influence adjacent water resources. We evaluate here the impacts that these diapirs have on adjacent aquifers based on investigating their geomorphologies, geologies, hydrologies and hydrogeologies. The results indicate that 28/62 (45%) of our sample of salt diapirs have no significant impact on the quality of groundwater in adjoining aquifers (namely Type N), while the remaining 34/62 (55%) degrade nearby groundwater quality. We offer simple conceptual models that account for how brines flowing from each of these types of salt extrusions contaminate adjacent aquifers. We identify three main mechanisms that lead to contamination: surface impact (Type A), subsurface intrusion (Type B) and indirect infiltration (Type C). A combination of all these mechanisms degrades the water quality in nearby aquifers in 19/62 (31%) of the salt diapirs studied. Having characterized the mechanism(s) by which each diapir affects the adjacent aquifer, we suggest a few possible remediation strategies to be considered. For instance, engineering the surface runoff of diapirs Types A and C into nearby evaporation basins would improve groundwater quality.

  8. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  9. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  10. Hybrid male sterility in rice controlled by interaction between divergent alleles of two adjacent genes.

    PubMed

    Long, Yunming; Zhao, Lifeng; Niu, Baixiao; Su, Jing; Wu, Hao; Chen, Yuanling; Zhang, Qunyu; Guo, Jingxin; Zhuang, Chuxiong; Mei, Mantong; Xia, Jixing; Wang, Lan; Wu, Haibin; Liu, Yao-Guang

    2008-12-01

    Sterility is common in hybrids between divergent populations, such as the indica and japonica subspecies of Asian cultivated rice (Oryza sativa). Although multiple loci for plant hybrid sterility have been identified, it remains unknown how alleles of the loci interact at the molecular level. Here we show that a locus for indica-japonica hybrid male sterility, Sa, comprises two adjacent genes, SaM and SaF, encoding a small ubiquitin-like modifier E3 ligase-like protein and an F-box protein, respectively. Most indica cultivars contain a haplotype SaM(+)SaF(+), whereas all japonica cultivars have SaM(-)SaF(-) that diverged by nucleotide variations in wild rice. Male semi-sterility in this heterozygous complex locus is caused by abortion of pollen carrying SaM(-). This allele-specific gamete elimination results from a selective interaction of SaF(+) with SaM(-), a truncated protein, but not with SaM(+) because of the presence of an inhibitory domain, although SaM(+) is required for this male sterility. Lack of any one of the three alleles in recombinant plants does not produce male sterility. We propose a two-gene/three-component interaction model for this hybrid male sterility system. The findings have implications for overcoming male sterility in inter-subspecific hybrid rice breeding.

  11. Genomic Selection for Adjacent Genetic Markers of Yorkshire Pigs Using Regularized Regression Approaches

    PubMed Central

    Park, Minsu; Kim, Tae-Hun; Cho, Eun-Seok; Kim, Heebal; Oh, Hee-Seok

    2014-01-01

    This study considers a problem of genomic selection (GS) for adjacent genetic markers of Yorkshire pigs which are typically correlated. The GS has been widely used to efficiently estimate target variables such as molecular breeding values using markers across the entire genome. Recently, GS has been applied to animals as well as plants, especially to pigs. For efficient selection of variables with specific traits in pig breeding, it is required that any such variable selection retains some properties: i) it produces a simple model by identifying insignificant variables; ii) it improves the accuracy of the prediction of future data; and iii) it is feasible to handle high-dimensional data in which the number of variables is larger than the number of observations. In this paper, we applied several variable selection methods including least absolute shrinkage and selection operator (LASSO), fused LASSO and elastic net to data with 47K single nucleotide polymorphisms and litter size for 519 observed sows. Based on experiments, we observed that the fused LASSO outperforms other approaches. PMID:25358359

  12. Analysis of Electric Properties of DNA Nucleotides

    NASA Astrophysics Data System (ADS)

    Zikic, R.; Zhang, X.-G.; Krstic, P. S.; Wells, J. C.; Fuentes-Cabrera, M.

    2006-05-01

    Calculation of the quantum tunnelling conductance through the DNA nucleotides between gold nanoelectrodes and analysis of the corresponding molecular spectra reveals that the tunneling conductance at low electric bias can be separated into two simple and approximately independent factors. The first is an exponential factor due to the potential barrier between the molecule and the electrode. The second factor is different for each molecule, but follows a universal form that can be expressed in terms of the bending angle of the DNA base relative to the sugar-phosphate group. This factor is also oscillatory indicating interference and resonance effects inside the molecule. Distinguishable conductances of Adenine (A), Cytosine (C), Guanine (G), and Thymine (T) are correlated to their differences in geometric dimensions.

  13. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  14. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  15. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  16. Nicotinamide nucleotide synthesis in regenerating rat liver

    PubMed Central

    Ferris, G. M.; Clark, J. B.

    1971-01-01

    1. The concentrations and total content of the nicotinamide nucleotides were measured in the livers of rats at various times after partial hepatectomy and laparotomy (sham hepatectomy) and correlated with other events in the regeneration process. 2. The NAD content and concentration in rat liver were relatively unaffected by laparotomy, but fell to a minimum, 25 and 33% below control values respectively, 24h after partial hepatectomy. NADP content and concentration were affected similarly by both laparotomy and partial hepatectomy, falling rapidly and remaining depressed for up to 48h. 3. The effect of injecting various doses of nicotinamide on the liver DNA and NAD 18h after partial hepatectomy was studied and revealed an inverse correlation between NAD content and DNA content. 4. Injections of nicotinamide at various times after partial hepatectomy revealed that the ability to synthesize NAD from nicotinamide was impaired during the first 12h, rose to a peak at 26h and fell again by 48h after partial hepatectomy. 5. The total liver activity of NAD pyrophosphorylase (EC 2.7.7.1) remained at or slightly above the initial value for 12h after partial hepatectomy and then rose continuously until 48h after operation. The activity of NMN pyrophosphorylase (EC 2.4.2.12) showed a similar pattern of change after partial hepatectomy, but was at no time greater than 5% of the activity of NAD pyrophosphorylase. 6. The results are discussed with reference to the control of NAD synthesis in rapidly dividing tissue. It is suggested that the availability of cofactors and substrates for NAD synthesis is more important as a controlling factor than the maximum enzyme activities. It is concluded that the low concentrations of nicotinamide nucleotides in rapidly dividing tissues are the result of competition between NAD synthesis and nucleic acid synthesis for common precursor and cofactors. PMID:4398891

  17. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  18. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  19. A functional single nucleotide polymorphism of SET8 is prognostic for breast cancer.

    PubMed

    Liu, Ben; Zhang, Xining; Song, Fengju; Liu, Qun; Dai, Hongji; Zheng, Hong; Cui, Ping; Zhang, Lina; Zhang, Wei; Chen, Kexin

    2016-06-01

    A single-nucleotide polymorphism (SNP) locus rs16917496 (T > C) within the 3'-untranslated region (3'-UTR) of SET8 was associated with susceptibility in several malignancies including breast cancer. To further elucidate the prognostic relevance of this SNP in breast cancer, we conducted a clinical study as well as SET8 expression analysis in a cohort of 1,190 breast cancer patients. We demonstrated the expression levels of SET8 in TT genotype were higher than in CC genotypes, and high levels of SET8 were associated with poor survival. SET8 expression was significantly higher in breast tumor tissue than in paired adjacent normal tissue. In addition, survival analysis in 315 patients showed SNP rs16917496 was an independent prognostic factor of breast cancer outcome with TT genotype associated with poor survival compared with CC/CT genotypes. Thus, this SNP may serve as a genetic prognostic factor and a treatment target for breast cancer. Future studies are warranted.

  20. Frequency and Correlation of Nearest Neighboring Nucleotides in Human Genome

    NASA Astrophysics Data System (ADS)

    Jin, Neng-zhi; Liu, Zi-xian; Qiu, Wen-yuan

    2009-02-01

    Zipf's approach in linguistics is utilized to analyze the statistical features of frequency and correlation of 16 nearest neighboring nucleotides (AA, AC, AG, ..., TT) in 12 human chromosomes (Y, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, and 12). It is found that these statistical features of nearest neighboring nucleotides in human genome: (i) the frequency distribution is a linear function, and (ii) the correlation distribution is an inverse function. The coefficients of the linear function and inverse function depend on the GC content. It proposes the correlation distribution of nearest neighboring nucleotides for the first time and extends the descriptor about nearest neighboring nucleotides.

  1. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  2. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  3. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  4. Pyridine nucleotide coenzymes: Chemical, biological, and medical aspects. Vol. 2, Pt. A

    SciTech Connect

    Dolphin, D.; Poulson, R.; Avramovic, O.

    1987-01-01

    This text contains the following: History of the Pyridine Nucleotides Nomenclature; Evolution of Pyridine Nucleotide; Relationship Between Biosynthesis and Evolution; Crystal Structure; Coenzyme Conformations; Protein Interactions; Optical Spectroscopy of the Pyridine Nucleotides; Excited States of Pyridine Nucleotide Coenzymes; Fluorescence and Phosphorescence; Nuclear Magnetic Resonance Spectroscopy of Pyridine Nucleotides; Mass Spectrometry of Pyridine Nucleotides; Mechanism of Action of the Pyridine Nucleotides; Chemical Stability and Reactivity of Pyridine Nucleotide Coenzymes; Stereochemistry of Fatty Acid Biosynthesis and Metabolism; Kinetics of Pyridine Nucleotide-Utilizing Enzymes; Preparation and Properties of NAD and NADP Analogs; Model Studies and Biological Activity of Analogs; and Spin-Labeled Pyridine Nucleotide Derivatives.

  5. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  6. Insights into the Origin of Clostridium botulinum Strains: Evolution of Distinct Restriction Endonuclease Sites in rrs (16S rRNA gene).

    PubMed

    Bhushan, Ashish; Mukherjee, Tanmoy; Joshi, Jayadev; Shankar, Pratap; Kalia, Vipin Chandra

    2015-06-01

    Diversity analysis of Clostridium botulinum strains is complicated by high microheterogeneity caused by the presence of 9-22 copies of rrs (16S rRNA gene). The need is to mine genetic markers to identify very closely related strains. Multiple alignments of the nucleotide sequences of the 212 rrs of 13 C. botulinum strains revealed intra- and inter-genomic heterogeneity. Low intragenomic heterogeneity in rrs was evident in strains 230613, Alaska E43, Okra, Eklund 17B, Langeland, 657, Kyoto, BKT015925, and Loch Maree. The most heterogenous rrs sequences were those of C. botulinum strains ATCC 19397, Hall, H04402065, and ATCC 3502. In silico restriction mapping of these rrs sequences was observable with 137 type II Restriction endonucleases (REs). Nucleotide changes (NC) at these RE sites resulted in appearance of distinct and additional sites, and loss in certain others. De novo appearances of RE sites due to NC were recorded at different positions in rrs gene. A nucleotide transition A>G in rrs of C. botulinum Loch Maree and 657 resulted in the generation of 4 and 10 distinct RE sites, respectively. Transitions A>G, G>A, and T>C led to the loss of RE sites. A perusal of the entire NC and in silico RE mapping of rrs of C. botulinum strains provided insights into their evolution. Segregation of strains on the basis of RE digestion patterns of rrs was validated by the cladistic analysis involving six house keeping genes: dnaN, gyrB, metG, prfA, pyrG, and Rho. PMID:25805900

  7. New adjacent Bis-tetrahydrofuran Annonaceous acetogenins from Annona muricata.

    PubMed

    Chang, Fang-Rong; Liaw, Chih-Chuang; Lin, Chih-Yuan; Chou, Chi-Jung; Chiu, Hui-Fen; Wu, Yang-Chang

    2003-03-01

    Bioactivity-guided fractionation led to the isolation of two new Annonaceous acetogenins, annocatacin A ( 1). and annocatacin B ( 2). from the seeds and the leaves, respectively, of Annona muricata. Compounds 1 and 2 are the first examples where the adjacent bis-tetrahydrofuran ring system is located at C-15. The new structures were elucidated and characterized by spectral and chemical methods. Both Annonaceous acetogenins 1 and 2 showed significant in vitro cytotoxicity toward the human hepatoma cell lines, Hep G2 and 2,2,15, and were compared with the known adjacent bis-tetrahydrofuran acetogenins, neoannonin ( 3). desacetyluvaricin ( 4). bullatacin ( 5). asimicin ( 6). annoglaucin ( 7). squamocin ( 8). and rollimusin ( 9).

  8. 38. VIEW OF COTTRELL MAGNETIC IMPULSE GENERATOR ADJACENT TO SIX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    38. VIEW OF COTTRELL MAGNETIC IMPULSE GENERATOR ADJACENT TO SIX GAP ROTARY RECTIFIER. THIS UNIT GENERATED A MAGNETIC PULSE WHICH WAS TRANSMITTED TO THE COLLECTION PLATES IN THE ELECTROSTATIC PRECIPITATOR CHAMBER. THESE PERIODIC PULSES VIBRATE THE PLATES AND CAUSE PRECIPITATED ARTICLES OF SMOKE AND FLY ASH TO FALL TO THE BOTTOM OF THE PRECIPITATOR CHAMBER. - New York, New Haven & Hartford Railroad, Cos Cob Power Plant, Sound Shore Drive, Greenwich, Fairfield County, CT

  9. 20. Interior view of fuel storage pit or vault adjacent ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. Interior view of fuel storage pit or vault adjacent to Test Cell 9 in Component Test Laboratory (T-27), looking west. Photograph shows upgraded instrumentation, piping, tanks, and technological modifications installed in 1997-99 to accommodate component testing requirements for the Atlas V missile. - Air Force Plant PJKS, Systems Integration Laboratory, Components Test Laboratory, Waterton Canyon Road & Colorado Highway 121, Lakewood, Jefferson County, CO

  10. Osmium complex binding to mismatched methylcytosine: effect of adjacent bases.

    PubMed

    Nomura, Akiko; Tainaka, Kazuki; Okamoto, Akimitsu

    2009-01-01

    We investigated the efficiency of osmium complex formation at 5-methylcytosine in mismatched DNA duplexes. Osmium complexation was not observed in fully matched duplexes, whereas the complexation site and efficiency in mismatched duplexes depended on the 5'-neighboring base of the 5-methylcytosine. In particular, when the base adjacent to the 5' side of the mismatched base pair was thymine, a unique side reaction was observed. However, the mismatched base pairs did not influence the selectivity of osmium complexation with methylated DNA.

  11. Jaw position uncertainty and adjacent fields in breast cancer radiotherapy.

    PubMed

    Hedin, Emma; Bäck, Anna; Chakarova, Roumiana

    2015-11-08

    Locoregional treatment of breast cancer involves adjacent, half blocked fields matched at isocenter. The objective of this work is to study the dosimetric effects of the uncertainties in jaw positioning for such a case, and how a treatment planning protocol including adjacent field overlap of 1 mm affects the dose distribution. A representative treatment plan, involving 6 and 15 photon beams, for a patient treated at our hospital is chosen. Monte Carlo method (EGSnrc/BEAMnrc) is used to simulate the treatment. Uncertainties in jaw positioning of ± 1 mm are addressed, which implies extremes in reality of 2 mm field gap/overlap when planning adjacent fields without overlap and 1 mm gap or 3 mm overlap for a planning protocol with 1 mm overlap. Dosimetric parameters for PTV, lung and body are analyzed. Treatment planning protocol with 1 mm overlap of the adjacent fields does not considerably counteract possible underdosage of the target in the case studied. PTV-V95% is for example reduced from 95% for perfectly aligned fields to 90% and 91% for 2 mm and 1 mm gap, respectively. However, the risk of overdosage in PTV and in healthy soft tissue is increased when following the protocol with 1 mm overlap. A 3 mm overlap compared to 2 mm overlap results in an increase in maximum dose to PTV, PTV-D2%, from 113% to 121%. V120% for 'Body-PTV' is also increased from 5 cm(3) to 14 cm(3). A treatment planning protocol with 1 mm overlap does not considerably improve the coverage of PTV in the case of erroneous jaw positions causing gap between fields, but increases the overdosage in PTV and doses to healthy tissue, in the case of overlapping fields, for the case investigated.

  12. Conference room 211, adjacent to commander's quarters, with vault door ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Conference room 211, adjacent to commander's quarters, with vault door at right. Projection area at center is equipped with automatic security drapes. Projection room uses a 45 degree mirror to reflect the image onto the frosted glass screen. Door on far left leads to display area senior battle staff viewing bridge, and the commander's quarters - March Air Force Base, Strategic Air Command, Combat Operations Center, 5220 Riverside Drive, Moreno Valley, Riverside County, CA

  13. Mutual Diffusional Interference Between Adjacent Stomata of a Leaf 1

    PubMed Central

    Cook, G. D.; Viskanta, R.

    1968-01-01

    The mutual diffusional interference between adjacent stomata in laminar flow over a leaf is shown to play a decisive role in determining overall transpiration. The magnitude of this interference varies with the interaction of the vapor diffusional shells forming above each stoma and the air flow over the leaf. The interference decreases with increasing incident radiation and wind velocity. The effect of interference on the stomatal resistance to diffusion plays a major role in the overall variations in transpiration. PMID:16656876

  14. 16S rRNA-, GroEL- and MucZ-based assessment of the taxonomic position of 'Rickettsiella melolonthae' and its implications for the organization of the genus Rickettsiella.

    PubMed

    Leclerque, Andreas; Kleespies, Regina G

    2008-04-01

    'Rickettsiella melolonthae' is an intracellularly multiplying bacterial pathogen of European cockchafers, Melolontha melolontha (Linnaeus, 1758) and Melolontha hippocastani (Fabricius, 1801) (Coleoptera: Scarabaeidae). We report the first determination of nucleotide sequences from this organism, i.e. the 16S rRNA encoding rrs gene, the chaperonin encoding groEL gene and the mucZ gene encoding the orthologue of a capsule synthesis-inducing factor of Coxiella burnetii. Within the genus Rickettsiella, the pathotype 'Rickettsiella melolonthae' is currently classified as a synonym of the nomenclatural type species Rickettsiella popilliae. Previous sequencing of a 16S rRNA gene from a different species, Rickettsiella grylli, has motivated the transfer of the entire genus from the alphaproteobacterial order Rickettsiales to the gammaproteobacterial order Legionellales, family Coxiellaceae. We investigated the validity of this taxonomic reorganization beyond the species Rickettsiella grylli by reconstructing the organismal phylogeny from comparisons of 16S rRNA gene and GroEL and MucZ protein sequences from a selected set of alpha- and gammaproteobacteria as well as bacterial pathogens from the order Chlamydiales. Our analysis strongly supported the transfer of the genus Rickettsiella to the order Legionellales, but not its classification in one of the recognized families present in this order. Furthermore, our results substantiated inconsistencies in the internal organization of the genus. In particular, the currently accepted delineation of Rickettsiella species and the claimed synonymy of 'Rickettsiella melolonthae' with Rickettsiella popilliae are not simultaneously consistent with our findings.

  15. Molecular analysis of the 18S rRNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam.

    PubMed

    Gatei, Wangeci; Greensill, Julie; Ashford, Richard W; Cuevas, Luis E; Parry, Christopher M; Cunliffe, Nigel A; Beeching, Nicholas J; Hart, C Anthony

    2003-04-01

    An 840-bp fragment of the 18S rRNA gene was used to identify Cryptosporidium spp. recovered from human immunodeficiency virus (HIV)-infected and -uninfected patients from Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. Initial identification was by Ziehl-Neelsen acid-fast staining. Confirmation was by nested PCR, targeting the most polymorphic region of the 18S rRNA gene. Genotyping was by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing. Among 63 isolates analyzed, four genotypes of Cryptosporidium were identified; 75% of the isolates were of the C. parvum human genotype, while the potentially zoonotic species were of the C. parvum bovine genotype (21.7%), the C. meleagridis genotype (1.6% [one isolate]), and the C. muris genotype (1.6% [one case]). HIV-infected individuals were more likely to have zoonotic genotypes than the HIV-uninfected individuals. Among the C. parvum group, strains clustered distinctly into either human or bovine genotypes regardless of the geographical origin, age, or HIV status of the patients. The intragenotypic variation observed in the C. parvum human genotype was extensive compared to that within the C. parvum bovine genotype group. The variation within genotypes was conserved in all geographical regions regardless of the patients' HIV status. The extensive diversity within genotypes at the 18S rRNA gene locus may limit its application to phylogenetic analyses.

  16. Fouling assemblages on offshore wind power plants and adjacent substrata

    NASA Astrophysics Data System (ADS)

    Wilhelmsson, Dan; Malm, Torleif

    2008-09-01

    A significant expansion of offshore wind power is expected in the near future, with thousands of turbines in coastal waters, and various aspects of how this may influence the coastal ecology including disturbance effects from noise, shadows, electromagnetic fields, and changed hydrological conditions are accordingly of concern. Further, wind power plants constitute habitats for a number of organisms, and may locally alter assemblage composition and biomass of invertebrates, algae and fish. In this study, fouling assemblages on offshore wind turbines were compared to adjacent hard substrate. Influences of the structures on the seabed were also investigated. The turbines differed significantly from adjacent boulders in terms of assemblage composition of epibiota and motile invertebrates. Species number and Shannon-Wiener diversity were, also, significantly lower on the wind power plants. It was also indicated that the turbines might have affected assemblages of invertebrates and algae on adjacent boulders. Off shore wind power plant offer atypical substrates for fouling assemblages in terms of orientation, depth range, structure, and surface texture. Some potential ecological implications of the addition of these non-natural habitats for coastal ecology are discussed.

  17. Divergent viral presentation among human tumors and adjacent normal tissues

    PubMed Central

    Cao, Song; Wendl, Michael C.; Wyczalkowski, Matthew A.; Wylie, Kristine; Ye, Kai; Jayasinghe, Reyka; Xie, Mingchao; Wu, Song; Niu, Beifang; Grubb, Robert; Johnson, Kimberly J.; Gay, Hiram; Chen, Ken; Rader, Janet S.; Dipersio, John F.; Chen, Feng; Ding, Li

    2016-01-01

    We applied a newly developed bioinformatics system called VirusScan to investigate the viral basis of 6,813 human tumors and 559 adjacent normal samples across 23 cancer types and identified 505 virus positive samples with distinctive, organ system- and cancer type-specific distributions. We found that herpes viruses (e.g., subtypes HHV4, HHV5, and HHV6) that are highly prevalent across cancers of the digestive tract showed significantly higher abundances in tumor versus adjacent normal samples, supporting their association with these cancers. We also found three HPV16-positive samples in brain lower grade glioma (LGG). Further, recurrent HBV integration at the KMT2B locus is present in three liver tumors, but absent in their matched adjacent normal samples, indicating that viral integration induced host driver genetic alterations are required on top of viral oncogene expression for initiation and progression of liver hepatocellular carcinoma. Notably, viral integrations were found in many genes, including novel recurrent HPV integrations at PTPN13 in cervical cancer. Finally, we observed a set of HHV4 and HBV variants strongly associated with ethnic groups, likely due to viral sequence evolution under environmental influences. These findings provide important new insights into viral roles of tumor initiation and progression and potential new therapeutic targets. PMID:27339696

  18. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    PubMed

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  19. Nucleotide Sequences and Modifications That Determine RIG-I/RNA Binding and Signaling Activities ▿

    PubMed Central

    Uzri, Dina; Gehrke, Lee

    2009-01-01

    Cytoplasmic viral RNAs with 5′ triphosphates (5′ppp) are detected by the RNA helicase RIG-I, initiating downstream signaling and alpha/beta interferon (IFN-α/β) expression that establish an antiviral state. We demonstrate here that the hepatitis C virus (HCV) 3′ untranslated region (UTR) RNA has greater activity as an immune stimulator than several flavivirus UTR RNAs. We confirmed that the HCV 3′-UTR poly(U/UC) region is the determinant for robust activation of RIG-I-mediated innate immune signaling and that its antisense sequence, poly(AG/A), is an equivalent RIG-I activator. The poly(U/UC) region of the fulminant HCV JFH-1 strain was a relatively weak activator, while the antisense JFH-1 strain poly(AG/A) RNA was very potent. Poly(U/UC) activity does not require primary nucleotide sequence adjacency to the 5′ppp, suggesting that RIG-I recognizes two independent RNA domains. Whereas poly(U) 50-nt or poly(A) 50-nt sequences were minimally active, inserting a single C or G nucleotide, respectively, into these RNAs increased IFN-β expression. Poly(U/UC) RNAs transcribed in vitro using modified uridine 2′ fluoro or pseudouridine ribonucleotides lacked signaling activity while functioning as competitive inhibitors of RIG-I binding and IFN-β expression. Nucleotide base and ribose modifications that convert activator RNAs into competitive inhibitors of RIG-I signaling may be useful as modulators of RIG-I-mediated innate immune responses and as tools to dissect the RNA binding and conformational events associated with signaling. PMID:19224987

  20. Microbial metabolism of thiopurines: A method to measure thioguanine nucleotides.

    PubMed

    Movva, Ramya; Lobb, Michael; Ó Cuív, Páraic; Florin, Timothy H J; Duley, John A; Oancea, Iulia

    2016-09-01

    Thiopurines are anti-inflammatory prodrugs. We hypothesised that bacteria may contribute to conversion to active drug. Escherichia coli strain DH5α was evaluated to determine whether it could metabolise the thiopurine drugs, thioguanine or mercaptopurine, to thioguanine nucleotides. A rapid and reliable high performance liquid chromatography (ultraviolet detection) method was developed to quantify indirectly thioguanine nucleotides, by measuring thioguanine nucleoside. PMID:27444548

  1. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  2. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  3. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  4. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  5. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  7. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  8. From Single Nucleotide Polymorphism to Transcriptional Mechanism

    PubMed Central

    Martini, Sebastian; Nair, Viji; Patel, Sanjeevkumar R.; Eichinger, Felix; Nelson, Robert G.; Weil, E. Jennifer; Pezzolesi, Marcus G.; Krolewski, Andrzej S.; Randolph, Ann; Keller, Benjamin J.; Werner, Thomas; Kretzler, Matthias

    2013-01-01

    Genome-wide association studies have proven to be highly effective at defining relationships between single nucleotide polymorphisms (SNPs) and clinical phenotypes in complex diseases. Establishing a mechanistic link between a noncoding SNP and the clinical outcome is a significant hurdle in translating associations into biological insight. We demonstrate an approach to assess the functional context of a diabetic nephropathy (DN)-associated SNP located in the promoter region of the gene FRMD3. The approach integrates pathway analyses with transcriptional regulatory pattern-based promoter modeling and allows the identification of a transcriptional framework affected by the DN-associated SNP in the FRMD3 promoter. This framework provides a testable hypothesis for mechanisms of genomic variation and transcriptional regulation in the context of DN. Our model proposes a possible transcriptional link through which the polymorphism in the FRMD3 promoter could influence transcriptional regulation within the bone morphogenetic protein (BMP)-signaling pathway. These findings provide the rationale to interrogate the biological link between FRMD3 and the BMP pathway and serve as an example of functional genomics-based hypothesis generation. PMID:23434934

  9. Human molecular cytogenetics: From cells to nucleotides.

    PubMed

    Riegel, Mariluce

    2014-03-01

    The field of cytogenetics has focused on studying the number, structure, function and origin of chromosomal abnormalities and the evolution of chromosomes. The development of fluorescent molecules that either directly or via an intermediate molecule bind to DNA has led to the development of fluorescent in situ hybridization (FISH), a technology linking cytogenetics to molecular genetics. This technique has a wide range of applications that increased the dimension of chromosome analysis. The field of cytogenetics is particularly important for medical diagnostics and research as well as for gene ordering and mapping. Furthermore, the increased application of molecular biology techniques, such as array-based technologies, has led to improved resolution, extending the recognized range of microdeletion/microduplication syndromes and genomic disorders. In adopting these newly expanded methods, cytogeneticists have used a range of technologies to study the association between visible chromosome rearrangements and defects at the single nucleotide level. Overall, molecular cytogenetic techniques offer a remarkable number of potential applications, ranging from physical mapping to clinical and evolutionary studies, making a powerful and informative complement to other molecular and genomic approaches. This manuscript does not present a detailed history of the development of molecular cytogenetics; however, references to historical reviews and experiments have been provided whenever possible. Herein, the basic principles of molecular cytogenetics, the technologies used to identify chromosomal rearrangements and copy number changes, and the applications for cytogenetics in biomedical diagnosis and research are presented and discussed.

  10. Genetic epidemiology of single-nucleotide polymorphisms.

    PubMed

    Collins, A; Lonjou, C; Morton, N E

    1999-12-21

    On the causal hypothesis, most genetic determinants of disease are single-nucleotide polymorphisms (SNPs) that are likely to be selected as markers for positional cloning. On the proximity hypothesis, most disease determinants will not be included among markers but may be detected through linkage disequilibrium with other SNPs. In that event, allelic association among SNPs is an essential factor in positional cloning. Recent simulation based on monotonic population expansion suggests that useful association does not usually extend beyond 3 kb. This is contradicted by significant disequilibrium at much greater distances, with corresponding reduction in the number of SNPs required for a cost-effective genome scan. A plausible explanation is that cyclical expansions follow population bottlenecks that establish new disequilibria. Data on more than 1,000 locus pairs indicate that most disequilibria trace to the Neolithic, with no apparent difference between haplotypes that are random or selected through a major disease gene. Short duration may be characteristic of alleles contributing to disease susceptibility and haplotypes characteristic of particular ethnic groups. Alleles that are highly polymorphic in all ethnic groups may be older, neutral, or advantageous, in weak disequilibrium with nearby markers, and therefore less useful for positional cloning of disease genes. Significant disequilibrium at large distance makes the number of suitably chosen SNPs required for genome screening as small as 30,000, or 1 per 100 kb, with greater density (including less common SNPs) reserved for candidate regions.

  11. Nucleotide Excision Repair in Caenorhabditis elegans

    PubMed Central

    Lans, Hannes; Vermeulen, Wim

    2011-01-01

    Nucleotide excision repair (NER) plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR) mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage. PMID:22091407

  12. Adenine nucleotide transporters in organelles: novel genes and functions.

    PubMed

    Traba, Javier; Satrústegui, Jorgina; del Arco, Araceli

    2011-04-01

    In eukaryotes, cellular energy in the form of ATP is produced in the cytosol via glycolysis or in the mitochondria via oxidative phosphorylation and, in photosynthetic organisms, in the chloroplast via photophosphorylation. Transport of adenine nucleotides among cell compartments is essential and is performed mainly by members of the mitochondrial carrier family, among which the ADP/ATP carriers are the best known. This work reviews the carriers that transport adenine nucleotides into the organelles of eukaryotic cells together with their possible functions. We focus on novel mechanisms of adenine nucleotide transport, including mitochondrial carriers found in organelles such as peroxisomes, plastids, or endoplasmic reticulum and also mitochondrial carriers found in the mitochondrial remnants of many eukaryotic parasites of interest. The extensive repertoire of adenine nucleotide carriers highlights an amazing variety of new possible functions of adenine nucleotide transport across eukaryotic organelles.

  13. Exploring the Diversity of Gardnerella vaginalis in the Genitourinary Tract Microbiota of Monogamous Couples Through Subtle Nucleotide Variation

    PubMed Central

    Eren, A. Murat; Zozaya, Marcela; Taylor, Christopher M.; Dowd, Scot E.; Martin, David H.; Ferris, Michael J.

    2011-01-01

    Background Bacterial vaginosis (BV) is an enigmatic disease of unknown origin that affects a large percentage of women. The vaginal microbiota of women with BV is associated with serious sequelae, including abnormal pregnancies. The etiology of BV is not fully understood, however, it has been suggested that it is transmissible, and that G. vaginalis may be an etiological agent. Studies using enzymatic assays to define G. vaginalis biotypes, as well as more recent genomic comparisons of G. vaginalis isolates from symptomatic and asymptomatic women, suggest that particular G. vaginalis strains may play a key role in the pathogenesis of BV. Methodology/Principal Findings To explore G. vaginalis diversity, distribution and sexual transmission, we developed a Shannon entropy-based method to analyze low-level sequence variation in 65,710 G. vaginalis 16S rRNA gene segments that were PCR-amplified from vaginal samples of 53 monogamous women and from urethral and penile skin samples of their male partners. We observed a high degree of low-level diversity among G. vaginalis sequences with a total of 46 unique sequence variants (oligotypes), and also found strong correlations of these oligotypes between sexual partners. Even though Gram stain-defined normal and some Gram stain-defined intermediate oligotype profiles clustered together in UniFrac analysis, no single G. vaginalis oligotype was found to be specific to BV or normal vaginal samples. Conclusions This study describes a novel method for investigating G. vaginalis diversity at a low level of taxonomic discrimination. The findings support cultivation-based studies that indicate sexual partners harbor the same strains of G. vaginalis. This study also highlights the fact that a few, reproducible nucleotide variations within the 16S rRNA gene can reveal clinical or epidemiological associations that would be missed by genus-level or species-level categorization of 16S rRNA data. PMID:22046340

  14. Polymerase chain reaction using 16S rRNA gene sequences distinguishes the two biovars of Ureaplasma urealyticum.

    PubMed Central

    Robertson, J A; Vekris, A; Bebear, C; Stemke, G W

    1993-01-01

    Several fundamental phenotypic and genotypic differences have separated strains of the genital mycoplasma Ureaplasma urealyticum into two clusters or biovars. However, the lack of an easily performed and unambiguous test to discriminate between them has hampered investigation of the relationship between these biovars and disease. We determined the 16S rRNA nucleotide sequence of U. urealyticum 27, the serovar 3 standard and representative of the parvo biovar (serovars 1, 3, 6, and 14). This sequence was compared with the published sequence of U. urealyticum T960, which is the type strain and the serovar 8 standard and is representative of the T960 biovar which is composed of the 10 intervening serovars. Homology between the two sequences was 98.8%; differences were exploited to provide primers for biovar-specific polymerase chain reactions (PCRs). The results of these reactions placed all 14 serovar standard strains into the correct biovar. The PCRs were also applied to 10 cloned and 8 noncloned isolates that had been serotyped earlier. For 16 of them, we deduced their biovars from the serotyping data and then confirmed them by PCR. One unpredictable isolate and one nonserotypeable isolate were also classified as to biovar. Thus, we have developed a method for biotyping U. urealyticum that is applicable to both laboratory-adapted strains and wild-type isolates and that is appropriate for testing large numbers of clinical isolates. The amplification by the T960 biovar PCR protocol of DNAs from ureaplasmas of animals and certain Mycoplasma species suggested that the parvo biovar has diverged from the mainstream of the evolution of this clade. Images PMID:7681846

  15. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  16. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  17. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  18. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  19. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  20. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  1. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  2. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  3. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  4. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  5. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  6. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  7. Repair of adjacent single-strand breaks is often accompanied by the formation of tandem sequence duplications in plant genomes.

    PubMed

    Schiml, Simon; Fauser, Friedrich; Puchta, Holger

    2016-06-28

    Duplication of existing sequences is a major mechanism of genome evolution. It has been previously shown that duplications can occur by replication slippage, unequal sister chromatid exchange, homologous recombination, and aberrant double-strand break-induced synthesis-dependent strand annealing reactions. In a recent study, the abundant presence of short direct repeats was documented by comparative bioinformatics analysis of different rice genomes, and the hypothesis was put forward that such duplications might arise due to the concerted repair of adjacent single-strand breaks (SSBs). Applying the CRISPR/Cas9 technology, we were able to test this hypothesis experimentally in the model plant Arabidopsis thaliana Using a Cas9 nickase to induce adjacent genomic SSBs in different regions of the genome (genic, intergenic, and heterochromatic) and at different distances (∼20, 50, and 100 bps), we analyzed the repair outcomes by deep sequencing. In addition to deletions, we regularly detected the formation of direct repeats close to the break sites, independent of the genomic context. The formation of these duplications as well as deletions may be associated with the presence of microhomologies. Most interestingly, we found that even the induction of two SSBs on the same DNA strand can cause genome alterations, albeit at a much lower level. Because such a scenario reflects a natural step during nucleotide excision repair, and given that the germline is set aside only late during development in plants, the repair of adjacent SSBs indeed seems to have an important influence on the shaping of plant genomes during evolution. PMID:27307441

  8. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    SciTech Connect

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin . E-mail: min-xin.guan@chmcc.org

    2006-04-21

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations.

  9. Oxidative DNA Damage and Nucleotide Excision Repair

    PubMed Central

    Melis, Joost P.M.; Luijten, Mirjam

    2013-01-01

    Abstract Significance: Oxidative DNA damage is repaired by multiple, overlapping DNA repair pathways. Accumulating evidence supports the hypothesis that nucleotide excision repair (NER), besides base excision repair (BER), is also involved in neutralizing oxidative DNA damage. Recent Advances: NER includes two distinct sub-pathways: transcription-coupled NER (TC-NER) and global genome repair (GG-NER). The CSA and CSB proteins initiate the onset of TC-NER. Recent findings show that not only CSB, but also CSA is involved in the repair of oxidative DNA lesions, in the nucleus as well as in mitochondria. The XPG protein is also of importance for the removal of oxidative DNA lesions, as it may enhance the initial step of BER. Substantial evidence exists that support a role for XPC in NER and BER. XPC deficiency not only results in decreased repair of oxidative lesions, but has also been linked to disturbed redox homeostasis. Critical Issues: The role of NER proteins in the regulation of the cellular response to oxidative (mitochondrial and nuclear) DNA damage may be the underlying mechanism of the pathology of accelerated aging in Cockayne syndrome patients, a driving force for internal cancer development in XP-A and XP-C patients, and a contributor to the mixed exhibited phenotypes of XP-G patients. Future Directions: Accumulating evidence indicates that DNA repair factors can be involved in multiple DNA repair pathways. However, the distinct detailed mechanism and consequences of these additional functions remain to be elucidated and can possibly shine a light on clinically related issues. Antioxid. Redox Signal. 18, 2409–2419. PMID:23216312

  10. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    PubMed Central

    Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

  11. Adjacent channel interference degradation with minimum shift keyed modulation

    NASA Technical Reports Server (NTRS)

    Ziemer, R. E.

    1981-01-01

    Computer simulation results for degradation in signal-to-noise ratio for various values of bit error probability are given for minimum shift-keyed-type signaling in the presence of adjacent channel interference. A serial modulator structure which utilizes spectral shaping is characterized in terms of envelope deviation and bandwidth efficiency. This serial generation technique is convenient for implementation at high data rates and results in signal spectra with lower sidelobe levels than conventional minimum shift-keyed modulation at the expense of moderate envelope deviation. Because of the lower sidelobe levels, the resulting spectra allow denser channel packing than does ideal MSK.

  12. Synthesis of a Molecule with Four Different Adjacent Pnictogens.

    PubMed

    Hinz, Alexander; Schulz, Axel; Villinger, Alexander

    2016-08-22

    The synthesis of a molecule containing four adjacent different pnictogens was attempted by conversion of a Group 15 allyl analogue anion [Mes*NAsPMes*](-) (Mes*=2,4,6-tri-tert-butylphenyl) with antimony(III) chloride. A suitable precursor is Mes*N(H)AsPMes* (1) for which several syntheses were investigated. The anions afforded by deprotonation of Mes*N(H)AsPMes* were found to be labile and, therefore, salts could not be isolated. However, the in situ generated anions could be quenched with SbCl3 , yielding Mes*N(SbCl2 )AsPMes* (4). PMID:27377437

  13. CLOUD PEAK PRIMITIVE AREA AND ADJACENT AREAS, WYOMING.

    USGS Publications Warehouse

    Kiilsgaard, Thor H.; Patten, Lowell L.

    1984-01-01

    The results of a mineral survey of the Cloud Peak Primitive Area and adjacent areas in Wyoming indicated little promise for the occurrence of mineral resources. There are some prospect workings, particularly in the northern part of the area, but in none of them were there indications that ore had been mined. Samples from the workings, from nearby rocks and sediments from streams that drain the area did not yield any metal values of significance. The crystalline rocks that underlie the area do not contain oil and gas or coal, products that are extracted from the younger rocks that underlie basins on both sides of the study area.

  14. Interaction of Cracks Between Two Adjacent Indents in Glass

    NASA Technical Reports Server (NTRS)

    Choi, S. R.; Salem, J. A.

    1993-01-01

    Experimental observations of the interaction behavior of cracks between two adjacent indents were made using an indentation technique in soda-lime glass. It was specifically demonstrated how one indent crack initiates and propagates in the vicinity of another indent crack. Several types of crack interactions were examined by changing the orientation and distance of one indent relative to the other. It was found that the residual stress field produced by elastic/plastic indentation has a significant influence on controlling the mode of crack interaction. The interaction of an indent crack with a free surface was also investigated for glass and ceramic specimens.

  15. Retroperitoneal multilocular bronchogenic cyst adjacent to adrenal gland.

    PubMed

    Yang, S W; Linton, J A; Ryu, S J; Shin, D H; Park, C S

    1999-10-01

    Bronchogenic cysts are generally found in the mediastinum, particularly posterior to the carina, but they rarely occur in such unusual sites as the skin, subcutaneous tissue, pericardium, and even the retroperitoneum. A 30-year-old Korean man underwent surgery to remove a cystic adrenal mass incidentally discovered during routine physical checkup. At surgery, it proved to be a multilocular cyst located in the retroperitoneum adjacent to the left adrenal gland. Microscopically, the cyst was lined by respiratory epithelium over connective tissue with submucous glands, cartilage and smooth muscle, thereby histologically confirming bronchogenic cyst. This is the first reported case of retroperitoneal bronchogenic cyst in an adult without other congenital anomalies in Korea.

  16. The role of dietary nucleotides in single-stomached animals.

    PubMed

    Sauer, Nadja; Mosenthin, Rainer; Bauer, Eva

    2011-06-01

    The transition from liquid to solid feed during weaning results in morphological, histological and microbial changes in the young animal's intestinal tract and often is associated with diarrhoea. The ban of in-feed antibiotics in pig production in the European Union has led to increasing interest in alternatives to overcome weaning-associated problems. Among others, nucleotides may have the potential to alleviate health impairments due to weaning. Nucleotides are natural components of the non-protein fraction of milk and have important effects on the maintenance of health in young animals. Nucleotides and their related metabolic products play key roles in many biological processes and become essential dietary components when endogenous supply is insufficient for normal function. The present review summarises nucleotide composition of milk from different species, the biology of nucleotides and possible effects of dietary nucleotides on intestinal morphology and function, intestinal microbiota, immune function, nutrient metabolism, hepatic morphology and function as well as growth performance. Special attention is given to data available for pigs, and suggestions are made for inclusion of nucleotides in the diet to benefit piglets' health and reduce the consequences accompanying early weaning. PMID:21226977

  17. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  18. Nucleic acid analysis using terminal-phosphate-labeled nucleotides

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-04-22

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  19. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  20. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  1. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  2. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  3. Identifying 2'-O-methylationation sites by integrating nucleotide chemical properties and nucleotide compositions.

    PubMed

    Chen, Wei; Feng, Pengmian; Tang, Hua; Ding, Hui; Lin, Hao

    2016-06-01

    2'-O-methylationation is an important post-transcriptional modification and plays important roles in many biological processes. Although experimental technologies have been proposed to detect 2'-O-methylationation sites, they are cost-ineffective. As complements to experimental techniques, computational methods will facilitate the identification of 2'-O-methylationation sites. In the present study, we proposed a support vector machine-based method to identify 2'-O-methylationation sites. In this method, RNA sequences were formulated by nucleotide chemical properties and nucleotide compositions. In the jackknife cross-validation test, the proposed method obtained an accuracy of 95.58% for identifying 2'-O-methylationation sites in the human genome. Moreover, the model was also validated by identifying 2'-O-methylation sites in the Mus musculus and Saccharomyces cerevisiae genomes, and the obtained accuracies are also satisfactory. These results indicate that the proposed method will become a useful tool for the research on 2'-O-methylation.

  4. Identifying 2'-O-methylationation sites by integrating nucleotide chemical properties and nucleotide compositions.

    PubMed

    Chen, Wei; Feng, Pengmian; Tang, Hua; Ding, Hui; Lin, Hao

    2016-06-01

    2'-O-methylationation is an important post-transcriptional modification and plays important roles in many biological processes. Although experimental technologies have been proposed to detect 2'-O-methylationation sites, they are cost-ineffective. As complements to experimental techniques, computational methods will facilitate the identification of 2'-O-methylationation sites. In the present study, we proposed a support vector machine-based method to identify 2'-O-methylationation sites. In this method, RNA sequences were formulated by nucleotide chemical properties and nucleotide compositions. In the jackknife cross-validation test, the proposed method obtained an accuracy of 95.58% for identifying 2'-O-methylationation sites in the human genome. Moreover, the model was also validated by identifying 2'-O-methylation sites in the Mus musculus and Saccharomyces cerevisiae genomes, and the obtained accuracies are also satisfactory. These results indicate that the proposed method will become a useful tool for the research on 2'-O-methylation. PMID:27191866

  5. Five pseudoknots are present at the 204 nucleotides long 3' noncoding region of tobacco mosaic virus RNA.

    PubMed Central

    van Belkum, A; Abrahams, J P; Pleij, C W; Bosch, L

    1985-01-01

    The 104 nucleotides long 3' terminal region of TMV RNA was shown previously to contain two pseudoknotted structures (Rietveld et al. (1984), EMBO J. 3, 2613-2619). We here present evidence for the occurrence, within the 204 nucleotides long 3' noncoding region, of another highly structured domain located immediately adjacent to the tRNA-like structure of 95 nucleotides (Joshi et al. (1985) Nucleic Acids Res. 13, 347-354). A model for the three-dimensional folding of this region, containing three more pseudoknots, is proposed on the basis of chemical modification and enzymatic digestion. The existence of these three consecutive pseudoknots was supported by sequence comparisons with the RNA from the related tobamoviruses TMV-L, CcTMV and CGMMV. Coaxial stacking of the six double helical segments involved gives rise to the formation of a 25 basepair long quasi-continuous double helix. The results show that the three-dimensional folding of the 3' non-translated region of tobamoviral RNAs is largely maintained by the formation of five pseudoknots. The organisation of this region in the RNA of the tobamovirus CcTMV suggests that recombinational events among aminoacylatable plant viral RNAs have to be considered. Images PMID:3934645

  6. Nucleotide-binding sites of the heterodimeric LmrCD ABC-multidrug transporter of Lactococcus lactis are asymmetric.

    PubMed

    Lubelski, Jacek; van Merkerk, Ronald; Konings, Wil N; Driessen, Arnold J M

    2006-01-17

    LmrCD is a lactococcal, heterodimeric multidrug transporter, which belongs to the ABC superfamily. It consists of two half-transporters, LmrC and LmrD, that are necessary and sufficient for drug extrusion and ATP hydrolysis. LmrCD is asymmetric in terms of the conservation of the functional motifs of the nucleotide-binding domains (NBDs). Important residues of the nucleotide-binding site of LmrC and the C loop of LmrD are not conserved. To investigate the functional importance of the LmrC and LmrD subunits, the putative catalytic base residue adjacent to the Walker B motif of both NBDs were substituted for the respective carboxamides. Our data demonstrate that Glu587 of LmrD is essential for both drug transport and ATPase activity of the LmrCD heterodimer, whereas mutation of Asp495 of LmrC has a less severe effect on the activity of the complex. Structural and/or functional asymmetry is further demonstrated by differential labeling of both subunits by 8-azido-[alpha-32P]ATP, which, at 4 degrees C, occurs predominantly at LmrC, while aluminiumfluoride (AlF(x))-induced trapping of the hydrolyzed nucleotide at 30 degrees C results in an almost exclusive labeling of LmrD. It is concluded that the LmrCD heterodimer contains two structurally and functionally distinct NBDs. PMID:16401093

  7. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  8. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  9. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  10. Historical volcanoes of Armenia and adjacent areas: What is revisited?

    NASA Astrophysics Data System (ADS)

    Karakhanian, A.; Jrbashyan, R.; Trifonov, V.; Philip, H.; Arakelian, S.; Avagyan, A.; Baghdassaryan, H.; Davtian, V.

    2006-07-01

    The validity of some data in Karakhanian et al. [Karakhanian, A., Djrbashian, R., Trifonov V., Philip H., Arakelian S., Avagian, A., 2002. Holocene-historical volcanism and active faults as natural risk factor for Armenia and adjacent countries. Journal of Volcanology and Geothermal Research, 113, 1, 319-344; Karakhanian, A., Jrbashyan, R., Trifonov, V., Philip, H., Arakelian, S., Avagyan, A., Baghdassaryan, H., Davtian, V., Ghoukassyan, Yu., 2003. Volcanic hazards in the region of the Armenian nuclear power plant. Journal of Volcanology and Geothermal Research, 126/1-2, 31-62] that are revisited by R. Haroutiunian is considered. A conclusion is made that the revisions suggested by Haroutiunian concern unessential parts of the content of work by Karakhanian et al. [Karakhanian, A., Djrbashian, R., Trifonov V., Philip H., Arakelian S., Avagian, A., 2002. Holocene-historical volcanism and active faults as natural risk factor for Armenia and adjacent countries. Journal of Volcanology and Geothermal Research, 113, 1, 319-344; Karakhanian, A., Jrbashyan, R., Trifonov, V., Philip, H., Arakelian, S., Avagyan, A., Baghdassaryan, H., Davtian, V., Ghoukassyan, Yu., 2003. Volcanic hazards in the region of the Armenian nuclear power plant. Journal of Volcanology and Geothermal Research, 126/1-2, 31-62]. This article presents new evidence and re-proves the earlier conclusions that are disputed or revised by R. Haroutiunian.

  11. Stress Wave Interaction Between Two Adjacent Blast Holes

    NASA Astrophysics Data System (ADS)

    Yi, Changping; Johansson, Daniel; Nyberg, Ulf; Beyglou, Ali

    2016-05-01

    Rock fragmentation by blasting is determined by the level and state of stress in the rock mass subjected to blasting. With the application of electronic detonators, some researchers stated that it is possible to achieve improved fragmentation through stress wave superposition with very short delay times. This hypothesis was studied through theoretical analysis in the paper. First, the stress in rock mass induced by a single-hole shot was analyzed with the assumptions of infinite velocity of detonation and infinite charge length. Based on the stress analysis of a single-hole shot, the stress history and tensile stress distribution between two adjacent holes were presented for cases of simultaneous initiation and 1 ms delayed initiation via stress superposition. The results indicated that the stress wave interaction is local around the collision point. Then, the tensile stress distribution at the extended line of two adjacent blast holes was analyzed for a case of 2 ms delay. The analytical results showed that the tensile stress on the extended line increases due to the stress wave superposition under the assumption that the influence of neighboring blast hole on the stress wave propagation can be neglected. However, the numerical results indicated that this assumption is unreasonable and yields contrary results. The feasibility of improving fragmentation via stress wave interaction with precise initiation was also discussed. The analysis in this paper does not support that the interaction of stress waves improves the fragmentation.

  12. Adjacent flaps for lower lip reconstruction after mucocele resection.

    PubMed

    Ying, Binbin

    2012-03-01

    Mucocele forms because of salivary gland mucous extravasation or retention and is usually related to trauma in the area of the lower lip. It is a common benign lesion in the oral region. Although there are many conservative treatments such as the creation of a pouch (marsupialization), freezing (cryosurgery), micromarsupialization, and CO2 laser vaporization, surgical resection is the most commonly used means. Generally speaking, an elliptic incision was made to fully enucleate the lesion along with the overlying mucosa and the affected glands, then direct suturing is adequate. However, in some cases, direct suturing could cause lower lip deformity, and adjacent flaps for lower lip reconstruction after mucocele resection might be quite necessary. Based on our experience, adjacent mucosal flaps could be used when lesions were close to or even break through the vermilion border or their diameters were much more than 1 cm. A-T advancement flaps and transposition flaps were the mostly applied ones. Follow-up showed that all patients realized primary healing after 1 week postoperatively with satisfactory lower lip appearance, and there was no sign of increasing incidence of relapse. PMID:22421867

  13. Bacterial community structure in the Sulu Sea and adjacent areas

    NASA Astrophysics Data System (ADS)

    Yoshida, Akihiro; Nishimura, Masahiko; Kogure, Kazuhiro

    2007-01-01

    The deep waters of the Sulu Sea are characterized by relatively high and constant water temperatures and low oxygen concentrations. To examine the effect of these characteristics on the bacterial community structure, the culture-independent molecular method was applied to samples from the Sulu Sea and the adjacent areas. DNA was extracted from environmental samples, and the analysis was carried out on PCR-amplified 16S rDNA; fragments were analyzed by denaturing gradient gel electrophoresis (DGGE) and nonmetric multidimensional scaling analysis. Stations in the Sulu Sea and the adjacent areas showed much more prominent vertical stratification of bacterial community structures than horizontal variation. As predominant sequences, cyanobacteria and α-proteobacteria at 10 m depth, δ-proteobacteria at 100 m depth, and green nonsulfur bacteria below 1000 m depth were detected in all sampling areas. High temperatures and low oxygen concentrations are thought to be minor factors in controlling community structure; the quantity and quality of organic materials supplied by the sinking particles, and hydrostatic pressure are believed to be important.

  14. The Torsin-family AAA+ Protein OOC-5 Contains a Critical Disulfide Adjacent to Sensor-II That Couples Redox State to Nucleotide Binding

    PubMed Central

    Zhu, Li; Wrabl, James O.; Hayashi, Adam P.; Rose, Lesilee S.

    2008-01-01

    A subgroup of the AAA+ proteins that reside in the endoplasmic reticulum and the nuclear envelope including human torsinA, a protein mutated in hereditary dystonia, is called the torsin family of AAA+ proteins. A multiple-sequence alignment of this family with Hsp100 proteins of known structure reveals a conserved cysteine in the C-terminus of torsin proteins within the Sensor-II motif. A structural model predicts this cysteine to be a part of an intramolecular disulfide bond, suggesting that it may function as a redox sensor to regulate ATPase activity. In vitro experiments with OOC-5, a torsinA homolog from Caenorhabditis elegans, demonstrate that redox changes that reduce this disulfide bond affect the binding of ATP and ADP and cause an attendant local conformational change detected by limited proteolysis. Transgenic worms expressing an ooc-5 gene with cysteine-to-serine mutations that disrupt the disulfide bond have a very low embryo hatch rate compared with wild-type controls, indicating these two cysteines are essential for OOC-5 function. We propose that the Sensor-II in torsin family proteins is a redox-regulated sensor. This regulatory mechanism may be central to the function of OOC-5 and human torsinA. PMID:18550799

  15. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  16. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  17. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  18. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    SciTech Connect

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  19. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  20. Nucleotide excision repair of DNA: The very early history.

    PubMed

    Friedberg, Errol C

    2011-07-15

    This article, taken largely from the book Correcting the Blueprint of Life: An Historical Account of the Discovery of DNA Repair Mechanisms, summarizes the very early history of the discovery of nucleotide excision repair.

  1. ATP-Releasing Nucleotides: Linking DNA Synthesis to Luciferase Signaling.

    PubMed

    Ji, Debin; Mohsen, Michael G; Harcourt, Emily M; Kool, Eric T

    2016-02-01

    A new strategy is reported for the production of luminescence signals from DNA synthesis through the use of chimeric nucleoside tetraphosphate dimers in which ATP, rather than pyrophosphate, is the leaving group. ATP-releasing nucleotides (ARNs) were synthesized as derivatives of the four canonical nucleotides. All four derivatives are good substrates for DNA polymerase, with Km values averaging 13-fold higher than those of natural dNTPs, and kcat values within 1.5-fold of those of native nucleotides. Importantly, ARNs were found to yield very little background signal with luciferase. DNA synthesis experiments show that the ATP byproduct can be harnessed to elicit a chemiluminescence signal in the presence of luciferase. When using a polymerase together with the chimeric nucleotides, target DNAs/RNAs trigger the release of stoichiometrically large quantities of ATP, thereby allowing sensitive isothermal luminescence detection of nucleic acids as diverse as phage DNAs and short miRNAs.

  2. Nucleotide sequences and mutations of the 5'-nontranslated region (5'NTR) of natural isolates of an epidemic echovirus 11' (prime).

    PubMed

    Szendrõi, A; El-Sageyer, M; Takács, M; Mezey, I; Berencsi, G

    2000-01-01

    An echovirus 11' (prime) virus caused an epidemic in Hungary in 1989. The leading clinical form of the diseases was myocarditis. Hemorrhagic hepatitis syndroms were also caused, however, with lethal outcome in 13 newborn babies. Altogether 386 children suffered from registered clinical disease. No accumulation of serous meningitis cases and intrauterine death were observed during the epidemic, and the monovalent oral poliovirus vaccination campaign has prevented the further circulation of the virus. The 5'-nontranslated region (5'-NTR) of 12 natural isolates were sequenced (nucleotides: 260-577). The 5'-NTR was found to be different from that of the prototype Gregory strain (X80059) of EV11 (less than 90% identity), but related to the swine vesicular disease virus (D16364) SVDV and EV9 (X92886) as indicated by the best fitting dendogram. The examination of the variable nucleotides in the internal ribosomal entry site (IRES) revealed, that the nucleotide sequence of a region of the epidemic 5'-NTR was identical to that of coxsackievirus B2. Five of the epidemic isolates were found to carry mutations. Seven EV11' IRES elements possessed identical sequences indicating, that the virus has evolved before its arrival to Hungary. The comparative examination of the suboptimal secondary structures revealed, that no one of the mutations affected the secondary structure of stem-loop structures IV and V in the IRES elements. Although it has been shown previously, that the echovirus group is genetically coherent and related to coxsackie B viruses the sequence differences in the epidemic isolates resulted in profound modification of the central stem (residues 477-529) of stem-loop structure No.V known to be affecting neurovirulence of polioviruses. Two alternate cloverleaf (stem-loop) structures were also recognised (nucleotides 376 to 460 and 540 to 565) which seem to mask both regions of the IRES element complementary to the 3'-end of the 18 S rRNA (460 to 466 and 561 to 570

  3. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  4. Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts

    DOEpatents

    Kao, C. Cheng

    2000-01-01

    Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

  5. Nucleotide diversity analysis highlights functionally important genomic regions

    PubMed Central

    Tatarinova, Tatiana V.; Chekalin, Evgeny; Nikolsky, Yuri; Bruskin, Sergey; Chebotarov, Dmitry; McNally, Kenneth L.; Alexandrov, Nickolai

    2016-01-01

    We analyzed functionality and relative distribution of genetic variants across the complete Oryza sativa genome, using the 40 million single nucleotide polymorphisms (SNPs) dataset from the 3,000 Rice Genomes Project (http://snp-seek.irri.org), the largest and highest density SNP collection for any higher plant. We have shown that the DNA-binding transcription factors (TFs) are the most conserved group of genes, whereas kinases and membrane-localized transporters are the most variable ones. TFs may be conserved because they belong to some of the most connected regulatory hubs that modulate transcription of vast downstream gene networks, whereas signaling kinases and transporters need to adapt rapidly to changing environmental conditions. In general, the observed profound patterns of nucleotide variability reveal functionally important genomic regions. As expected, nucleotide diversity is much higher in intergenic regions than within gene bodies (regions spanning gene models), and protein-coding sequences are more conserved than untranslated gene regions. We have observed a sharp decline in nucleotide diversity that begins at about 250 nucleotides upstream of the transcription start and reaches minimal diversity exactly at the transcription start. We found the transcription termination sites to have remarkably symmetrical patterns of SNP density, implying presence of functional sites near transcription termination. Also, nucleotide diversity was significantly lower near 3′ UTRs, the area rich with regulatory regions. PMID:27774999

  6. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  7. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  8. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  9. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  10. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  11. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  12. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  13. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  14. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  15. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  16. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  17. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  18. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  19. Laser ablation of human atherosclerotic plaque without adjacent tissue injury

    NASA Technical Reports Server (NTRS)

    Grundfest, W. S.; Litvack, F.; Forrester, J. S.; Goldenberg, T.; Swan, H. J. C.

    1985-01-01

    Seventy samples of human cadaver atherosclerotic aorta were irradiated in vitro using a 308 nm xenon chloride excimer laser. Energy per pulse, pulse duration and frequency were varied. For comparison, 60 segments were also irradiated with an argon ion and an Nd:YAG laser operated in the continuous mode. Tissue was fixed in formalin, sectioned and examined microscopically. The Nd:YAG and argon ion-irradiated tissue exhibited a central crater with irregular edges and concentric zones of thermal and blast injury. In contrast, the excimer laser-irradiated tissue had narrow deep incisions with minimal or no thermal injury. These preliminary experiments indicate that the excimer laser vaporizes tissue in a manner different from that of the continuous wave Nd:YAG or argon ion laser. The sharp incision margins and minimal damage to adjacent normal tissue suggest that the excimer laser is more desirable for general surgical and intravascular uses than are the conventionally used medical lasers.

  20. GOAT ROCKS WILDERNESS AND ADJACENT ROADLESS AREAS, WASHINGTON.

    USGS Publications Warehouse

    Church, S.E.; Close, T.J.

    1984-01-01

    The Goat Rocks Wilderness and adjacent roadless areas are a rugged, highly forested, scenic area located on the crest of the Cascade Range in south-central Washington. Several mineral claims have been staked in the area. Mineral surveys were conducted. Geochemical, geophysical, and geologic investigations indicate that three areas have probable mineral-resource potential for base metals in porphyry-type deposits. Available data are not adequate to permit definition of the potential for oil and gas. There is little likelihood for the occurrence of other kinds of energy resources in the area. Evaluation of resource potential in the three areas identified as having probable mineral-resource potential could be improved by more detailed geochemical studies and geologic mapping.

  1. Scolopendromorpha of New Guinea and adjacent islands (Myriapoda, Chilopoda).

    PubMed

    Schileyko, Arkady A; Stoev, Pavel E

    2016-01-01

    The centipede fauna of the second largest island in the world, New Guinea, and its adjacent islands, is poorly known, with most information deriving from the first half of the 20th century. Here we present new data on the order Scolopendromorpha based on material collected in the area in the last 40 years, mainly by Bulgarian and Latvian zoologists. The collections comprise eleven species of six genera and three families. The diagnosis of Cryptops (Trigonocryptops) is emended in the light of the recent findings. The old and doubtful record of Scolopendra multidens Newport, 1844 from New Guinea is referred to S. subspinipes Leach, 1815 and the species is here excluded from the present day list of New Guinean scolopendromorphs. Cryptops nepalensis Lewis, 1999 is here recorded from New Guinea for the first time. An annotated list and an identification key to the scolopendromorphs of the studied region are presented. PMID:27515618

  2. Geomorphology of portions of western Kentucky and adjacent areas

    SciTech Connect

    Dilamarter, R.C.

    1982-07-01

    The geomorphology of portions of western Kentucky and adjacent areas in Indiana, Illinois and Tennessee is presented as a background for interpreters evaluating the present land surface using remotely sensed imagery. Eight physiographic units were analyzed and are briefly discussed with reference to topography and surface deposits. Great diversity was found to be characteristic of the region, the result of different structural influences and geomorphic processes. The landscape bears the marks of fluvial, glacial, eolian, lacustrine and karstic environments, so a regional geomorphic history was compiled from the literature as an aid to understanding the land surface. Three smaller zones in Kentucky were analyzed in greater detail regarding topography and geomorphic development because of their potential importance in subsurface exploration.

  3. Configuration optimization of dampers for adjacent buildings under seismic excitations

    NASA Astrophysics Data System (ADS)

    Bigdeli, Kasra; Hare, Warren; Tesfamariam, Solomon

    2012-12-01

    Passive coupling of adjacent structures is known to be an effective method to reduce undesirable vibrations and structural pounding effects. Past results have shown that reducing the number of dampers can considerably decrease the cost of implementation and does not significantly decrease the efficiency of the system. The main objective of this study was to find the optimal arrangement of a limited number of dampers to minimize interstorey drift. Five approaches to solving the resulting bi-level optimization problem are introduced and examined (exhaustive search, inserting dampers, inserting floors, locations of maximum relative velocity and a genetic algorithm) and the numerical efficiency of each method is examined. The results reveal that the inserting damper method is the most efficient and reliable method, particularly for tall structures. It was also found that increasing the number of dampers does not necessarily increase the efficiency of the system. In fact, increasing the number of dampers can exacerbate the dynamic response of the system.

  4. Reconnaissance geologic map of Kodiak Island and adjacent islands, Alaska

    USGS Publications Warehouse

    Wilson, Frederic H.

    2013-01-01

    Kodiak Island and its adjacent islands, located on the west side of the Gulf of Alaska, contain one of the largest areas of exposure of the flysch and melange of the Chugach terrane of southern Alaska. However, in the past 25 years, only detailed mapping covering small areas in the archipelago has been done. This map and its associated digital files (Wilson and others, 2005) present the best available mapping compiled in an integrated fashion. The map and associated digital files represent part of a systematic effort to release geologic map data for the United States in a uniform manner. The geologic data have been compiled from a wide variety of sources, ranging from state and regional geologic maps to large-scale field mapping. The map data are presented for use at a nominal scale of 1:500,000, although individual datasets (see Wilson and others, 2005) may contain data suitable for use at larger scales.

  5. 38. METAL WORKING TOOLS AND MACHINES ADJACENT TO THE CIRCA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    38. METAL WORKING TOOLS AND MACHINES ADJACENT TO THE CIRCA 1900 MICHIGAN MACHINERY MFG. CO. PUNCH PRESS NEAR THE CENTER OF THE FACTORY BUILDING. AT THE LEFT FOREGROUND IS A MOVABLE TIRE BENDER FOR SHAPING ELI WINDMILL WHEEL RIMS. AT THE CENTER IS A FLOOR-MOUNTED CIRCA 1900 SNAG GRINDER OF THE TYPE USED FOR SMOOTHING ROUGH CASTINGS. ON THE WHEELED WORK STATION IS A SUNNEN BUSHING GRINDER, BEHIND WHICH IS A TRIPOD CHAIN VICE. IN THE CENTER BACKGROUND IS A WOODEN CHEST OF DRAWERS WHICH CONTAINS A 'RAG DRAWER' STILL FILLED WITH CLOTH RAGS PLACED IN THE FACTORY BUILDING AT THE INSISTENCE OF LOUISE (MRS. ARTHUR) KREGEL FOR THE CONVENIENCE AND CLEANLINESS OF WORKERS. IN THE LEFT BACKGROUND IS A CIRCA 1900 CROSS-CUTOFF CIRCULAR SAW. - Kregel Windmill Company Factory, 1416 Central Avenue, Nebraska City, Otoe County, NE

  6. Air bubble-shock wave interaction adjacent to gelantine surface

    NASA Astrophysics Data System (ADS)

    Lush, P. A.; Tomita, Y.; Onodera, O.; Takayama, K.; Sanada, N.; Kuwahara, M.; Ioritani, N.; Kitayama, O.

    1990-07-01

    The interaction between a shock wave and an air bubble-adjacent to a gelatine surface is investigated in order to simulate human tissue damage resulting from extracorporeal shock wave lithotripsy. Using high speed cine photography it is found that a shock wave of strength 11 MPa causes 1-3 mm diameter bubbles to produce high velocity microjets with penetration rates of approximately 110 m/s and penetration depths approximately equal to twice the initial bubble diameter. Theoretical considerations for liquid impact on soft solid of similar density indicate that microjet velocities will be twice the penetration rate, i.e. 220 m/s in the present case. Such events are the probable cause of observed renal tissue damage.

  7. An engineered dimeric protein pore that spans adjacent lipid bilayers

    PubMed Central

    Mantri, Shiksha; Sapra, K. Tanuj; Cheley, Stephen; Sharp, Thomas H.; Bayley, Hagan

    2013-01-01

    The bottom-up construction of artificial tissues is an underexplored area of synthetic biology. An important challenge is communication between constituent compartments of the engineered tissue and between the engineered tissue and additional compartments, including extracellular fluids, further engineered tissue and living cells. Here we present a dimeric transmembrane pore that can span two adjacent lipid bilayers and thereby allow aqueous compartments to communicate. Two heptameric staphylococcal α-hemolysin (αHL) pores were covalently linked in an aligned cap-to-cap orientation. The structure of the dimer, (α7)2, was confirmed by biochemical analysis, transmission electron microscopy (TEM) and single-channel electrical recording. We show that one of two β barrels of (α7)2 can insert into the lipid bilayer of a small unilamellar vesicle, while the other spans a planar lipid bilayer. (α7)2 pores spanning two bilayers were also observed by TEM. PMID:23591892

  8. Single nucleotide polymorphisms in nucleotide excision repair genes, cancer treatment, and head and neck cancer survival

    PubMed Central

    Wyss, Annah B.; Weissler, Mark C.; Avery, Christy L.; Herring, Amy H.; Bensen, Jeannette T.; Barnholtz-Sloan, Jill S.; Funkhouser, William K.

    2014-01-01

    Purpose Head and neck cancers (HNC) are commonly treated with radiation and platinum-based chemotherapy, which produce bulky DNA adducts to eradicate cancerous cells. Because nucleotide excision repair (NER) enzymes remove adducts, variants in NER genes may be associated with survival among HNC cases both independently and jointly with treatment. Methods Cox proportional hazards models were used to estimate race-stratified (White, African American) hazard ratios (HRs) and 95 % confidence intervals for overall (OS) and disease-specific (DS) survival based on treatment (combinations of surgery, radiation, and chemotherapy) and 84 single nucleotide polymorphisms (SNPs) in 15 NER genes among 1,227 HNC cases from the Carolina Head and Neck Cancer Epidemiology Study. Results None of the NER variants evaluated were associated with survival at a Bonferroni-corrected alpha of 0.0006. However, rs3136038 [OS HR = 0.79 (0.65, 0.97), DS HR = 0.69 (0.51, 0.93)] and rs3136130 [OS HR = 0.78 (0.64, 0.96), DS HR = 0.68 (0.50, 0.92)] of ERCC4 and rs50871 [OS HR = 0.80 (0.64, 1.00), DS HR = 0.67 (0.48, 0.92)] of ERCC2 among Whites, and rs2607755 [OS HR = 0.62 (0.45, 0.86), DS HR = 0.51 (0.30, 0.86)] of XPC among African Americans were suggestively associated with survival at an uncorrected alpha of 0.05. Three SNP-treatment joint effects showed possible departures from additivity among Whites. Conclusions Our study, a large and extensive evaluation of SNPs in NER genes and HNC survival, identified mostly null associations, though a few variants were suggestively associated with survival and potentially interacted additively with treatment. PMID:24487794

  9. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  10. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  11. Effect of Fluoridated Sealants on Adjacent Tooth Surfaces

    PubMed Central

    Cagetti, M.G.; Carta, G.; Cocco, F.; Sale, S.; Congiu, G.; Mura, A.; Strohmenger, L.; Lingström, P.; Campus, G.

    2014-01-01

    A double-blind randomized clinical trial was performed in 6- to 7-yr-old schoolchildren to evaluate, in a 30-mo period, whether the caries increment on the distal surface of the second primary molars adjacent to permanent first molars sealed with fluoride release compounds would be lower with respect to those adjacent to permanent first molars sealed with a nonfluoridated sealant. In sum, 2,776 subjects were enrolled and randomly divided into 3 groups receiving sealants on sound first molars: high-viscosity glass ionomer cement (GIC group); resin-based sealant with fluoride (fluoride-RB group); and a resin-based sealant without fluoride (RB group). Caries (D1 – D3 level) was recorded on the distal surface of the second primary molar, considered the unit of analysis including only sound surfaces at the baseline. At baseline, no differences in caries prevalence were recorded in the 3 groups regarding the considered surfaces. At follow-up, the prevalence of an affected unit of analysis was statistically lower (p = .03) in the GIC and fluoride-RB groups (p = .04). In the GIC group, fewer new caries were observed in the unit of analysis respect to the other 2 groups. Incidence rate ratios (IRRs) were 0.70 (95% confidence interval: 0.50, 0.68; p < .01) for GIC vs. RB and 0.79 (95% confidence interval: 0.53, 1.04; p = .005) for fluoride-RB vs. RB. Caries incidence was significantly associated with low socioeconomic status (IRR = 1.18; 95% confidence interval: 1.10, 1.42; p = .05). Dental sealant high-viscosity GIC and fluoride-RB demonstrated protection against dental caries, and there was evidence that these materials afforded additional protection for the tooth nearest to the sealed tooth (clinical trial registration NCT01588210). PMID:24846910

  12. Subduction initiation adjacent to a relic island arc

    NASA Astrophysics Data System (ADS)

    Leng, W.; Gurnis, M.

    2013-12-01

    Although plate tectonics is well established, how subduction initiates over tectonic history has remained obscure. It has been proposed that passive margins may be a possible place for subduction initiation, but there is no obvious Cenozoic example of such a scenario, including along the passive margins of the Atlantic Ocean. With a computational method that follows the deformation of a visco-elasto-plastic medium, here we show that a favourable locale for subduction initiation is the juxtaposition of an old oceanic plate adjacent to a young, but relic arc. Significant density anomalies leading to subduction initiation arise from two major factors. One is the compositional difference between the relic arc crust and the oceanic lithospheric mantle; the other is the thermal difference due to the age offset between the two plates. With such a setup, we observe spontaneous subduction initiation if the oceanic crust is significantly weakened by pore fluid pressure. If the oceanic crust is relatively strong, a small amount of plate convergence is required to induce subduction. The evidence that Izu-Bonin-Mariana and Tonga-Kermedec subduction zones both initiate adjacent to a relic island arc support our conclusions. The initiation of both subduction zones at 51-52 Ma with commensurate compression on their respective overriding plates support a causal link between both subduction initiation events through a change in Pacific Plate motion. Our results provide an explanation for the rarity of subduction initiation at the passive margins. The continental lithosphere is typically old and cold. Consequently, the thermal effects cancel the compositional buoyancy contrast between the continental crust and the oceanic lithospheric mantle, making subduction initiation difficult at passive margins.

  13. Prevention of enamel demineralization adjacent to glass ionomer filling materials.

    PubMed

    Forss, H; Seppä, L

    1990-04-01

    In order to study the release of fluoride and prevention of enamel demineralization by different filling materials, standardized cavities were prepared in 80 extracted human molars. The cavities were filled as follows: 1. Fuji II F; 2. Ketac-Fil; 3. Ketac-Silver; 4. Silar. Twenty molars were used as controls (no filling). Enamel slabs with the fillings were subjected to 9 days of demineralization (30 min daily) and remineralization (artificial saliva, replaced daily). Fluoride release in the saliva was determined on days 1, 3, 5, and 9. Enamel fluoride content adjacent to the cavities was determined initially and after the de-remineralization using the acid etch technique. On day 1, the largest amount of fluoride in the saliva was released by Fuji, but on day 9 the largest amount was released by Ketac-Fil. Ketac-Silver released significantly less fluoride than Fuji and Ketac-Fil. The average initial fluoride content of enamel was 2200 ppm. After the test period, fluoride contents adjusted for biopsy depth were 1822, 1690, 1693, 1337, and 888 ppm in groups 1-5, respectively. The amounts of phosphorus dissolved by the second acid etch were 28.9 (SE 2.6), 30.2 (2.0), 34.4 (2.8), 44.1 (2.7), and 42.2 (2.4) micrograms, respectively. Softening of surface enamel during the test period was clearly reduced in teeth filled with Fuji and Ketac-Fil. The results show that glass ionomer materials release considerable amounts of fluoride and prevent demineralization of the adjacent enamel in vitro. Fuji and Ketac-Fil seem to be more effective than Ketac-Silver.

  14. 33 CFR 110.140 - Buzzards Bay, Nantucket Sound, and adjacent waters, Mass.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., and adjacent waters, Mass. 110.140 Section 110.140 Navigation and Navigable Waters COAST GUARD..., Nantucket Sound, and adjacent waters, Mass. Link to an amendment published at 76 FR 35744, June 20, 2011. (a... adjacent waters, Mass. (a) * * * (2) Anchorage B. All waters bounded by a line beginning at 41°36′42.3″...

  15. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  16. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  17. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  18. A molecular phylogeny of dinoflagellate protists (pyrrhophyta) inferred from the sequence of 24S rRNA divergent domains D1 and D8.

    PubMed

    Lenaers, G; Scholin, C; Bhaud, Y; Saint-Hilaire, D; Herzog, M

    1991-01-01

    The sequence of two divergent domains (D1 and D8) from dinoflagellate 24S large subunit rRNA was determined by primer extension using total RNA as template. Nucleotide sequence alignments over 401 bases have been analyzed in order to investigate phylogenetic relationships within this highly divergent and taxonomically controversial group of protists of the division Pyrrhophyta. Data are provided confirming that dinoflagellates represent a monophyletic group. For 11 out of the 13 investigated laboratory grown species, an additional domain (D2) could not be completely sequenced by reverse transcription because of a hidden break located near its 3'-terminus. Two sets of sequence alignments were used to infer dinoflagellate phylogeny. The first [199 nucleotides (nt)] included conservative sequences flanking the D1 and D8 divergent domains. It was used to reconstruct a broad evolutionary tree for the dinoflagellates, which was rooted using Tetrahymena thermophila as the outgroup. To confirm the tree topology, and mainly the branchings leading to closely related species, a second alignment (401 nt) was considered, which included the D1 and D8 variable sequences in addition to the more conserved flanking regions. Species that showed sequence similarities with other species lower than 60% on average (Knuc values higher than 0.550) were removed from this analysis. A coherent and convincing evolutionary pattern was obtained for the dinoflagellates, also confirmed by the position of the hidden break within the D2 domain, which appears to be group specific. The reconstructed phylogeny indicates that the early emergence of Oxyrrhis marina preceded that of most Peridiniales, a large order of thecate species, whereas the unarmored Gymnodiniales appeared more recently, along with members of the Prorocentrales characterized by two thecal plates. In addition, the emergence of heterotrophic species preceded that of photosynthetic species. These results provide new perspectives on

  19. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  20. How semantic biases in simple adjacencies affect learning a complex structure with non-adjacencies in AGL: a statistical account

    PubMed Central

    Poletiek, Fenna H.; Lai, Jun

    2012-01-01

    A major theoretical debate in language acquisition research regards the learnability of hierarchical structures. The artificial grammar learning methodology is increasingly influential in approaching this question. Studies using an artificial centre-embedded AnBn grammar without semantics draw conflicting conclusions. This study investigates the facilitating effect of distributional biases in simple AB adjacencies in the input sample—caused in natural languages, among others, by semantic biases—on learning a centre-embedded structure. A mathematical simulation of the linguistic input and the learning, comparing various distributional biases in AB pairs, suggests that strong distributional biases might help us to grasp the complex AnBn hierarchical structure in a later stage. This theoretical investigation might contribute to our understanding of how distributional features of the input—including those caused by semantic variation—help learning complex structures in natural languages. PMID:22688639

  1. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    NASA Astrophysics Data System (ADS)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  2. Prolonged nonhydrolytic interaction of nucleotide with CFTR's NH2-terminal nucleotide binding domain and its role in channel gating.

    PubMed

    Basso, Claudia; Vergani, Paola; Nairn, Angus C; Gadsby, David C

    2003-09-01

    CFTR, the protein defective in cystic fibrosis, functions as a Cl- channel regulated by cAMP-dependent protein kinase (PKA). CFTR is also an ATPase, comprising two nucleotide-binding domains (NBDs) thought to bind and hydrolyze ATP. In hydrolyzable nucleoside triphosphates, PKA-phosphorylated CFTR channels open into bursts, lasting on the order of a second, from closed (interburst) intervals of a second or more. To investigate nucleotide interactions underlying channel gating, we examined photolabeling by [alpha32P]8-N3ATP or [gamma32P]8-N3ATP of intact CFTR channels expressed in HEK293T cells or Xenopus oocytes. We also exploited split CFTR channels to distinguish photolabeling at NBD1 from that at NBD2. To examine simple binding of nucleotide in the absence of hydrolysis and gating reactions, we photolabeled after incubation at 0 degrees C with no washing. Nucleotide interactions under gating conditions were probed by photolabeling after incubation at 30 degrees C, with extensive washing, also at 30 degrees C. Phosphorylation of CFTR by PKA only slightly influenced photolabeling after either protocol. Strikingly, at 30 degrees C nucleotide remained tightly bound at NBD1 for many minutes, in the form of nonhydrolyzed nucleoside triphosphate. As nucleotide-dependent gating of CFTR channels occurred on the time scale of seconds under comparable conditions, this suggests that the nucleotide interactions, including hydrolysis, that time CFTR channel opening and closing occur predominantly at NBD2. Vanadate also appeared to act at NBD2, presumably interrupting its hydrolytic cycle, and markedly delayed termination of channel open bursts. Vanadate somewhat increased the magnitude, but did not alter the rate, of the slow loss of nucleotide tightly bound at NBD1. Kinetic analysis of channel gating in Mg8-N3ATP or MgATP reveals that the rate-limiting step for CFTR channel opening at saturating [nucleotide] follows nucleotide binding to both NBDs. We propose that ATP

  3. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  4. Moss Phylogeny Reconstruction Using Nucleotide Pangenome of Complete Mitogenome Sequences.

    PubMed

    Goryunov, D V; Nagaev, B E; Nikolaev, M Yu; Alexeevski, A V; Troitsky, A V

    2015-11-01

    Stability of composition and sequence of genes was shown earlier in 13 mitochondrial genomes of mosses (Rensing, S. A., et al. (2008) Science, 319, 64-69). It is of interest to study the evolution of mitochondrial genomes not only at the gene level, but also on the level of nucleotide sequences. To do this, we have constructed a "nucleotide pangenome" for mitochondrial genomes of 24 moss species. The nucleotide pangenome is a set of aligned nucleotide sequences of orthologous genome fragments covering the totality of all genomes. The nucleotide pangenome was constructed using specially developed new software, NPG-explorer (NPGe). The stable part of the mitochondrial genome (232 stable blocks) is shown to be, on average, 45% of its length. In the joint alignment of stable blocks, 82% of positions are conserved. The phylogenetic tree constructed with the NPGe program is in good correlation with other phylogenetic reconstructions. With the NPGe program, 30 blocks have been identified with repeats no shorter than 50 bp. The maximal length of a block with repeats is 140 bp. Duplications in the mitochondrial genomes of mosses are rare. On average, the genome contains about 500 bp in large duplications. The total length of insertions and deletions was determined in each genome. The losses and gains of DNA regions are rather active in mitochondrial genomes of mosses, and such rearrangements presumably can be used as additional markers in the reconstruction of phylogeny. PMID:26615445

  5. Seismic responses of two adjacent buildings. I. Data and analyses

    USGS Publications Warehouse

    Celebi, Mehmet

    1993-01-01

    In this two-part paper, responses of two, adjacent, seven-story buildings in Norwalk, California, to the Whittier-Narrows, Calif, earthquake of Oct. 1, 1987 are studied. Building A, instrumented according to code recommendations, and building B, extensively instrumented, are offset by 16.3 m from one another. The data set includes motions from the superstructure of both buildings, from a downhole below the foundation of building B, and from three free-field sites. Part I of the paper includes descriptions of the buildings, site, instrumentation, and analysis of the data of each building. System identification and spectral analysis techniques are employed in part I. Building A has identical first-mode frequencies of 0.65 Hz for both building axes. The strong-motion response characteristics of building A are considerably different than those determined from low-amplitude tests. Building B has fundamental modes at 0.76 Hz and 0.83 Hz in the major and minor axes, respectively. Torsional and diaphragm effects in building B are negligible.

  6. Snow Distribution Patterns in Clearings and Adjacent Forest

    NASA Astrophysics Data System (ADS)

    Golding, Douglas L.; Swanson, Robert H.

    1986-12-01

    Snow accumulation patterns were determined for clearings and adjacent forest at Marmot Creek experimental watershed and James River, Alberta. At maximum accumulation snow water equivalent (SWE) was greater in clearings than in forest whether clearings were large, as in 8- to 13-ha blocks where SWE averaged 20% more than in the forest, or small as in the ¼ to 6-H (height) diameter circular clearings where SWE was 13-45% greater than in the forest. SWE was 42 to 52% less in north than in south sectors of 2-6 H clearings. These differences increased with clearing size and time since beginning of accumulation period and are caused by snow ablation (melt and evaporation), a function of direct solar radiation reaching the snowpack. In such situations the snow that has accumulated on the ground cannot be considered a measure of the snow that has actually fallen there. For water balances and hydrologic modeling, snow measurements in partially cleared watersheds must be adjusted for temporal and spatial factors specific to the watershed.

  7. Seismic responses of two adjacent buildings. II. Interaction

    USGS Publications Warehouse

    Celebi, Mehmet

    1993-01-01

    Presented in this part of the two-part paper is a study of the relations between earthquake motions recorded from two, adjacent, seven-story buildings, from a downhole below the foundation of one of the buildings and from three free-field sites, all within one city block. This unique data set was obtained during the Whittier-Narrows, Calif. earthquake of Oct. 1, 1987, Part I includes background information on the two buildings, the site, and the data set. Building response characteristics of a code-type instrumented building (A) and an extensively instrumented building (B) are also studied. In this part, spectral analysis techniques are used to study the relationships between the motions of the roofs and basements, the downhole and the free-field sites. It is asserted that there is building-soil-building interaction between the two buildings at a frequency of 2.35 Hz. Furthermore, the free-field motions are shown to be influenced by the presence of the buildings.

  8. Particulate Matter Levels in Ambient Air Adjacent to Industrial Area

    NASA Astrophysics Data System (ADS)

    Mohamed, R. M. S. R.; Nizam, N. M. S.; Al-Gheethi, A. A.; Lajis, A.; Kassim, A. H. M.

    2016-07-01

    Air quality in the residential areas adjacent to the industrial regions is of great concern due to the association with human health risks. In this work, the concentrations of particulate matter (PM10) in the ambient air of UTHM campus was investigated tostudy the air qualityand their compliance to the Malaysian Ambient Air Quality Guidelines (AAQG). The PM10 samples were taken over 24 hours from the most significant area at UTHM including Stadium, KolejKediamanTunDr. Ismail (KKTDI) and MakmalBahan. The meteorological parameters; temperature, relative humidity, wind speed and wind direction as well as particulate matterwere estimated by using E-Sampler Particulate Matter (PM10) Collector. The highest concentrations of PM10 (55.56 µg/m3) was recorded at MakmalBahan during the working and weekend days. However, these concentrations are less than 150 pg/m3. It can be concluded that although UTHM is surrounded by the industrial area, the air quality in the campus still within the standards limits.

  9. Repeated adjacent-segment degeneration after posterior lumbar interbody fusion.

    PubMed

    Okuda, Shinya; Oda, Takenori; Yamasaki, Ryoji; Maeno, Takafumi; Iwasaki, Motoki

    2014-05-01

    One of the most important sequelae affecting long-term results is adjacent-segment degeneration (ASD) after posterior lumbar interbody fusion (PLIF). Although several reports have described the incidence rate, there have been no reports of repeated ASD. The purpose of this report was to describe 1 case of repeated ASD after PLIF. A 62-year-old woman with L-4 degenerative spondylolisthesis underwent PLIF at L4-5. At the second operation, L3-4 PLIF was performed for L-3 degenerative spondylolisthesis 6 years after the primary operation. At the third operation, L2-3 PLIF was performed for L-2 degenerative spondylolisthesis 1.5 years after the primary operation. Vertebral collapse of L-1 was detected 1 year after the third operation, and the collapse had progressed. At the fourth operation, 3 years after the third operation, vertebral column resection of L-1 and replacement of titanium mesh cages with pedicle screw fixation between T-4 and L-5 was performed. Although the patient's symptoms resolved after each operation, the time between surgeries shortened. The sacral slope decreased gradually although each PLIF achieved local lordosis at the fused segment.

  10. Herbicide interchange between a stream and the adjacent alluvial aquifer

    USGS Publications Warehouse

    Wang, W.; Squillace, P.

    1994-01-01

    Herbicide interchange between a stream and the adjacent alluvial aquifer and quantification of herbicide bank storage during high streamflow were investigated at a research site on the Cedar River flood plain, 10 km southeast of Cedar Rapids, Iowa. During high streamflow in March 1990, alachlor, atrazine, and metolachlor were detected at concentrations above background in water from wells as distant as 20, 50, and 10 m from the river's edge, respectively. During high streamflow in May 1990, alachlor, atrazine, cyanazine, and metolachlor were detected at concentrations above background as distant as 20, 50, 10, and 20 m from the river's edge, respectively. Herbicide bank storage took place during high streamflow when hydraulic gradients were from the river to the alluvial aquifer and the laterally infiltrating river water contained herbicide concentrations larger than background concentrations in the aquifer. The herbicide bank storage can be quantified by multiplying herbicide concentration by the "effective area" that a well represented and an assumed porosity of 0.25. During March 1990, herbicide bank storage values were calculated to be 1.7,79, and 4.0 mg/m for alachlor, atrazine, and metolachlor, respectively. During May 1990, values were 7.1, 54, 11, and 19 mg/m for alachlor, atrazine, cyanazine, and metolachlor, respectively. ?? 1994 American Chemical Society.

  11. Preparation and properties of adjacency crosslinked polyurethane-urea elastomers

    NASA Astrophysics Data System (ADS)

    Wu, Yuan; Cao, Yu-Yang; Wu, Shou-Peng; Li, Zai-Feng

    2012-12-01

    Adjacency crosslinked polyurethane-urea (PUU) elastomers with different crosslinking density were prepared by using hydroxyl-terminated liquid butadiene-nitrile (HTBN), toluene diisocyanate (TDI) and chain extender 3,5-dimethyl thio-toluene diamine (DMTDA) as raw materials, dicumyl peroxide (DCP) as initiator, and N,N'-m-phenylene dimaleimide (HVA-2) as the crosslinking agent. The influences of the crosslinking density and temperature on the structure and properties of such elastomers were investigated. The crosslinking density of PUU elastomer was tested by the NMR method. It is found that when the content of HVA-2 is 1.5%, the mechanical properties of polyurethane elastomer achieve optimal performance. By testing thermal performance of PUU, compared with linear PUU, the thermal stability of the elastomers has a marked improvement. With the addition of HVA-2, the loss factor tan δ decreases. FT-IR spectral studies of PUU elastomer at various temperatures were performed. From this study, heat-resistance polyurethane could be prepared, and the properties of PUU at high temperature could be improved obviously.

  12. The Current Tectonics of the Yukon and Adjacent Area

    NASA Astrophysics Data System (ADS)

    Hyndman, R. D.; Leonard, L. J.

    2014-12-01

    The current tectonics across the Yukon and adjacent areas of western Northwest Territories (NWT) and northern British Columbia appear to be driven primarily by the Yakutat Terrane collision, an "indenter" in the corner of the Gulf of Alaska. GPS data show 1-10 mm/yr northward and eastward, decreasing inland. The rates from earthquake statistics are similar although there are important discrepancies. The eastern Cordillera earthquake mechanisms are mainly thrust in the Mackenzie Mountains of southwestern NWT where the Cordillera upper crust is overthrusting the craton. To the north, the mechanisms are mainly strike-slip in the Richardson Mountains that appear to lie along the edge of the craton. The deformation appears to be limited to the hot and weak Cordillera with the strong craton providing an irregular eastern boundary. For example, there is an eastward bow in the craton edge and the deformation in the Mackenzie Mountains. On the Beaufort Sea margin in the region of the Mackenzie Delta there appears to be a type of "subduction zone" with the continent very slowly overthrusting the oceanic plate, a process that has continued since at least the Cretaceous. A northward moving continental margin block is bounded by left lateral faulting in the west (Canning Displacement Zone of eastern Alaska) and right lateral faulting in the east (Richardson Mountains in eastern Yukon). There is almost no seismicity on this thrust belt but as for some other subduction zones such as Cascadia there is the potential for very infrequent great earthquakes.

  13. Adjacent level spondylodiscitis after anterior cervical decompression and fusion.

    PubMed

    Basu, Saumyajit; Sreeramalingam, Rathinavelu

    2012-05-01

    Postoperative spondylodiscitis after anterior cervical decompression and fusion (ACDF) is rare, but the same occurring at adjacent levels without disturbing the operated level is very rare. We report a case, with 5 year followup, who underwent ACDF from C5 to C7 for cervical spondylotic myelopathy. He showed neurological improvement after surgery but developed discharging sinus after 2 weeks, which healed with antibiotics. He improved on his preoperative symptoms well for the first 2 months. He started developing progressive neck pain and myelopathy after 3 months and investigations revealed spondylodiscitis at C3 and C4 with erosion, collapse, and kyphosis, without any evidence of implant failure or graft rejection at the operated level. He underwent reexploration and implant removal at the operated level (there was good fusion from C5 to C7) followed by debridement/decompression at C3, C4 along with iliac crest bone grafting and stabilization with plate and screws after maximum correction of kyphosis. The biopsy specimen grew Pseudomonas aeruginosa and appropriate sensitive antibiotics (gentamycin and ciprofloxacin) were given for 6 weeks. He was under regular followup for 5 years his myelopathy resolved completely and he is back to work. Complete decompression of the cord and fusion from C2 to C7 was demonstrable on postoperative imaging studies without any evidence of implant loosening or C1/C2 instability at the last followup. PMID:22719127

  14. The Thermomagnetic Instability in Superconducting Films with Adjacent Metal Layer

    NASA Astrophysics Data System (ADS)

    Vestgården, J. I.; Galperin, Y. M.; Johansen, T. H.

    2013-12-01

    Dendritic flux avalanches is a frequently encountered consequence of the thermomagnetic instability in type-II superconducting films. The avalanches, which are potentially harmful for superconductor-based devices, can be suppressed by an adjacent normal metal layer, even when the two layers are not in thermal contact. The suppression of the avalanches in this case is due to so-called magnetic braking, caused by eddy currents generated in the metal layer by propagating magnetic flux. We develop a theory of magnetic braking by analyzing coupled electrodynamics and heat flow in a superconductor-normal metal bilayer. The equations are solved by linearization and by numerical simulation of the avalanche dynamics. We find that in an uncoated superconductor, even a uniform thermomagnetic instability can develop into a dendritic flux avalanche. The mechanism is that a small non-uniformity caused by the electromagnetic non-locality induces a flux-flow hot spot at a random position. The hot spot quickly develops into a finger, which at high speeds penetrates into the superconductor, forming a branching structure. Magnetic braking slows the avalanches, and if the normal metal conductivity is sufficiently high, it can suppress the formation of the dendritic structure. During avalanches, the braking by the normal metal layer prevents the temperature from exceeding the transition temperature of the superconductor. Analytical criteria for the instability threshold are developed using the linear stability analysis. The criteria are found to match quantitatively the instability onsets obtained in simulations.

  15. Macrobenthos of Yenisei Bay and the adjacent Kara Sea shelf

    NASA Astrophysics Data System (ADS)

    Galkin, S. V.; Vedenin, A. A.

    2015-07-01

    Trawl samples were collected in the northern region of Yenisei Bay and adjacent parts of the Kara Sea shelf. A total of eight stations were taken. We found more than 200 species of benthic organisms. A consecutive replacement of benthic communities is observed when going to the north from the Ob and Yenisei estuaries to the open parts of the sea. We could distinguish four different species complexes in the investigated area: a brackish-water complex where Saduria entomon is dominant; an intermediate complex where S. sibirica, S. sabini and Portlandia aestuariorum are dominant; a transitional complex with P. arctica as a dominant species and with a small amount of Ophiocten sericeum; a marine complex where O. sericeum is dominant. When salinity increased, some brackish-water species were replaced by related euryhaline species. One such example was the replacement of brackish-water Saduria entomon isopods by two euryhaline species: S. sibirica and S. sabini. The consecutive replacement of benthic communities showed a break near Sverdrup Island. In this area the marine complex was replaced by a transitional complex with P. arctica.

  16. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  17. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  18. Thinking beside the box: Should we care about the non-coding strand of the 16S rRNA gene?

    PubMed

    Garcia-Mazcorro, Jose F; Barcenas-Walls, Jose R

    2016-08-01

    The 16S rRNA gene (16S rDNA) codes for RNA that plays a fundamental role during translation in the ribosome and is used extensively as a marker gene to establish relationships among bacteria. However, the complementary non-coding 16S rDNA (nc16S rDNA) has been ignored. An idea emerged in the course of analyzing bacterial 16S rDNA sequences in search for nucleotide composition and substitution patterns: Does the nc16S rDNA code? If so, what does it code for? More importantly: Does 16S rDNA evolution reflect its own evolution or the evolution of its counterpart nc16S rDNA? The objective of this minireview is to discuss these thoughts. nc strands often encode small RNAs (sRNAs), ancient components of gene regulation. nc16S rDNA sequences from different bacterial groups were used to search for possible matches in the Bacterial Small Regulatory RNA Database. Intriguingly, the sequence of one published sRNA obtained from Legionella pneumophila (GenBank: AE0173541) showed high non-random similarity with nc16S rDNA corresponding in part to the V5 region especially from Legionella and relatives. While the target(s) of this sRNA is unclear at the moment, its mere existence might open up a new chapter in the use of the 16S rDNA to study relationships among bacteria. PMID:27412167

  19. Thinking beside the box: Should we care about the non-coding strand of the 16S rRNA gene?

    PubMed

    Garcia-Mazcorro, Jose F; Barcenas-Walls, Jose R

    2016-08-01

    The 16S rRNA gene (16S rDNA) codes for RNA that plays a fundamental role during translation in the ribosome and is used extensively as a marker gene to establish relationships among bacteria. However, the complementary non-coding 16S rDNA (nc16S rDNA) has been ignored. An idea emerged in the course of analyzing bacterial 16S rDNA sequences in search for nucleotide composition and substitution patterns: Does the nc16S rDNA code? If so, what does it code for? More importantly: Does 16S rDNA evolution reflect its own evolution or the evolution of its counterpart nc16S rDNA? The objective of this minireview is to discuss these thoughts. nc strands often encode small RNAs (sRNAs), ancient components of gene regulation. nc16S rDNA sequences from different bacterial groups were used to search for possible matches in the Bacterial Small Regulatory RNA Database. Intriguingly, the sequence of one published sRNA obtained from Legionella pneumophila (GenBank: AE0173541) showed high non-random similarity with nc16S rDNA corresponding in part to the V5 region especially from Legionella and relatives. While the target(s) of this sRNA is unclear at the moment, its mere existence might open up a new chapter in the use of the 16S rDNA to study relationships among bacteria.

  20. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  1. Getting it Right: How DNA Polymerases Select the Right Nucleotide.

    PubMed

    Ludmann, Samra; Marx, Andreas

    2016-01-01

    All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.

  2. Determinants of nucleotide sugar recognition in an archaeon DNA polymerase.

    PubMed

    Gardner, A F; Jack, W E

    1999-06-15

    Vent DNA polymerase normally discriminates strongly against incorporation of ribonucleotides, 3'-deoxyribonucleotides (such as cordycepin) and 2',3'-dideoxyribonucleotides. To explore the basis for this discrimination we have generated a family of variants with point mutations of residues in conserved Regions II and III and assayed incorporation of nucleo-tides with modified sugars by these variants, all of which were created in an exonuclease-deficient form of the enzyme. A Y412V variant incorporates ribonucleotides at least 200-fold more efficiently than the wild-type enzyme, consistent with Y412 acting as a 'steric gate' to specifically exclude ribonucleotides. The most striking variants tested involved changes to A488, a residue predicted to be facing away from the nucleotide binding site. The pattern of relaxed specificity at this position roughly correlates with the size of the substituted amino acid sidechain and affects a variety of modified nucleotide sugars. PMID:10352184

  3. Palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides.

    PubMed

    Shaughnessy, Kevin H

    2015-05-22

    Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  4. Petabyte-scale innovations at the European Nucleotide Archive.

    PubMed

    Cochrane, Guy; Akhtar, Ruth; Bonfield, James; Bower, Lawrence; Demiralp, Fehmi; Faruque, Nadeem; Gibson, Richard; Hoad, Gemma; Hubbard, Tim; Hunter, Christopher; Jang, Mikyung; Juhos, Szilveszter; Leinonen, Rasko; Leonard, Steven; Lin, Quan; Lopez, Rodrigo; Lorenc, Dariusz; McWilliam, Hamish; Mukherjee, Gaurab; Plaister, Sheila; Radhakrishnan, Rajesh; Robinson, Stephen; Sobhany, Siamak; Hoopen, Petra Ten; Vaughan, Robert; Zalunin, Vadim; Birney, Ewan

    2009-01-01

    Dramatic increases in the throughput of nucleotide sequencing machines, and the promise of ever greater performance, have thrust bioinformatics into the era of petabyte-scale data sets. Sequence repositories, which provide the feed for these data sets into the worldwide computational infrastructure, are challenged by the impact of these data volumes. The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/embl), comprising the EMBL Nucleotide Sequence Database and the Ensembl Trace Archive, has identified challenges in the storage, movement, analysis, interpretation and visualization of petabyte-scale data sets. We present here our new repository for next generation sequence data, a brief summary of contents of the ENA and provide details of major developments to submission pipelines, high-throughput rule-based validation infrastructure and data integration approaches.

  5. Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

    PubMed Central

    2015-01-01

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

  6. Coupled nucleotide covariations reveal dynamic RNA interaction patterns.

    PubMed Central

    Gultyaev, A P; Franch, T; Gerdes, K

    2000-01-01

    Evolutionarily conserved structures in related RNA molecules contain coordinated variations (covariations) of paired nucleotides. Analysis of covariations is a very powerful approach to deduce phylogenetically conserved (i.e., functional) conformations, including tertiary interactions. Here we discuss conserved RNA folding pathways that are revealed by covariation patterns. In such pathways, structural requirements for alternative pairings cause some nucleotides to covary with two different partners. Such "coupled" covariations between three or more nucleotides were found in various types of RNAs. The analysis of coupled covariations can unravel important features of RNA folding dynamics and improve phylogeny reconstruction in some cases. Importantly, it is necessary to distinguish between multiple covariations determined by mutually exclusive structures and those determined by tertiary contacts. PMID:11105748

  7. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  8. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  9. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  10. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  11. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  12. Characterization of Nucleotide Misincorporation Patterns in the Iceman's Mitochondrial DNA

    PubMed Central

    Olivieri, Cristina; Ermini, Luca; Rizzi, Ermanno; Corti, Giorgio; Bonnal, Raoul; Luciani, Stefania; Marota, Isolina; De Bellis, Gianluca; Rollo, Franco

    2010-01-01

    Background The degradation of DNA represents one of the main issues in the genetic analysis of archeological specimens. In the recent years, a particular kind of post-mortem DNA modification giving rise to nucleotide misincorporation (“miscoding lesions”) has been the object of extensive investigations. Methodology/Principal Findings To improve our knowledge regarding the nature and incidence of ancient DNA nucleotide misincorporations, we have utilized 6,859 (629,975 bp) mitochondrial (mt) DNA sequences obtained from the 5,350–5,100-years-old, freeze-desiccated human mummy popularly known as the Tyrolean Iceman or Ötzi. To generate the sequences, we have applied a mixed PCR/pyrosequencing procedure allowing one to obtain a particularly high sequence coverage. As a control, we have produced further 8,982 (805,155 bp) mtDNA sequences from a contemporary specimen using the same system and starting from the same template copy number of the ancient sample. From the analysis of the nucleotide misincorporation rate in ancient, modern, and putative contaminant sequences, we observed that the rate of misincorporation is significantly lower in modern and putative contaminant sequence datasets than in ancient sequences. In contrast, type 2 transitions represent the vast majority (85%) of the observed nucleotide misincorporations in ancient sequences. Conclusions/Significance This study provides a further contribution to the knowledge of nucleotide misincorporation patterns in DNA sequences obtained from freeze-preserved archeological specimens. In the Iceman system, ancient sequences can be clearly distinguished from contaminants on the basis of nucleotide misincorporation rates. This observation confirms a previous identification of the ancient mummy sequences made on a purely phylogenetical basis. The present investigation provides further indication that the majority of ancient DNA damage is reflected by type 2 (cytosine→thymine/guanine→adenine) transitions and

  13. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  14. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  15. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  16. Polyamine stimulation of eEF1A synthesis based on the unusual position of a complementary sequence to 18S rRNA in eEF1A mRNA.

    PubMed

    Terui, Yusuke; Sakamoto, Akihiko; Yoshida, Taketo; Kasahara, Takuma; Tomitori, Hideyuki; Higashi, Kyohei; Igarashi, Kazuei; Kashiwagi, Keiko

    2015-02-01

    It is thought that Shine-Dalgarno-like sequences, which exhibit complementarity to the nucleotide sequences at the 3'-end of 18S rRNA, are not present in eukaryotic mRNAs. However, complementary sequences consisting of more than 5 nucleotides to the 3'-end of 18S rRNA, i.e., a CR sequence, are present at -17 to -32 upstream from the initiation codon AUG in 18 mRNAs involved in protein synthesis except eEF1A mRNA. Thus, effects of the CR sequence in mRNAs and polyamines on protein synthesis were examined using control and polyamine-reduced FM3A and NIH3T3 cells. Polyamines did not stimulate protein synthesis encoded by 18 mRNAs possessing a normal CR sequence. When the CR sequence was deleted, protein synthetic activities decreased to less than 70% of intact mRNAs. In eEF1A mRNA, the CR sequence was located at -33 to -39 upstream from the initiation codon AUG, and polyamines stimulated eEF1A synthesis about threefold. When the CR sequence was shifted to -22 to -28 upstream from the AUG, eEF1A synthesis increased in polyamine-reduced cells and the degree of polyamine stimulation decreased greatly. The results indicate that the CR sequence exists in many eukaryotic mRNAs, and the location of a CR sequence in mRNAs influences polyamine stimulation of protein synthesis.

  17. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gjerde, Bjørn

    2013-10-01

    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  18. Toward Electronic Conductance Characterization of DNA Nucleotide Bases

    SciTech Connect

    Krstic, Predrag S; Wells, Jack C; Fuentes-Cabrera, Miguel A; Xu, Dong; Lee, James Weifu

    2007-03-01

    We calculate electron-transport properties within equilibrium, linear transport theory through the DNA nucleotide bases spanning two gold nanowires. Our quantum mechanical calculations show that single configurations of DNA bases A, C, T, and G have significantly different charge conductance characteristics. This result is consistent with the notion that it is possible to read the nucleotide base sequence on an individual DNA heteropolymer which is moving through a gap between electrically biased nanoelectrodes by measuring the changes in the electron-transport conductance.

  19. Toward Electronic Conductance Characterization of DNA Nucleotide Bases

    SciTech Connect

    Lee, James Weifu; Krstic, Predrag S; Wells, Jack C; Fuentes-Cabrera, Miguel A; Xu, Dong

    2007-01-01

    We calculate electron-transport properties within equilibrium, linear transport theory through the DNA nucleotide bases spanning two gold nanowires. Our quantum mechanical calculations show that single configurations of DNA bases A, C, T, and G have significantly different charge conductance characteristics. This result is consistent with the notion that it is possible to read the nucleotide base sequence on an individual DNA heteropolymer which is moving through a gap between electrically biased nanoelectrodes by measuring the changes in the electron-transport conductance.

  20. Biocuration of functional annotation at the European nucleotide archive

    PubMed Central

    Gibson, Richard; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Goodgame, Neil; ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Pallreddy, Swapna; Pakseresht, Nima; Rajan, Jeena; Rosselló, Marc; Silvester, Nicole; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2016-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is a repository for the submission, maintenance and presentation of nucleotide sequence data and related sample and experimental information. In this article we report on ENA in 2015 regarding general activity, notable published data sets and major achievements. This is followed by a focus on sustainable biocuration of functional annotation, an area which has particularly felt the pressure of sequencing growth. The importance of functional annotation, how it can be submitted and the shifting role of the biocurator in the context of increasing volumes of data are all discussed. PMID:26615190

  1. Content discovery and retrieval services at the European Nucleotide Archive

    PubMed Central

    Silvester, Nicole; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Gibson, Richard; Goodgame, Neil; ten Hoopen, Petra; Kay, Simon; Leinonen, Rasko; Li, Weizhong; Liu, Xin; Lopez, Rodrigo; Pakseresht, Nima; Pallreddy, Swapna; Plaister, Sheila; Radhakrishnan, Rajesh; Rossello, Marc; Senf, Alexander; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2015-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is Europe's primary resource for nucleotide sequence information. With the growing volume and diversity of public sequencing data comes the need for increased sophistication in data organisation, presentation and search services so as to maximise its discoverability and usability. In response to this, ENA has been introducing and improving checklists for use during submission and expanding its search facilities to provide targeted search results. Here, we give a brief update on ENA content and some major developments undertaken in data submission services during 2014. We then describe in more detail the services we offer for data discovery and retrieval. PMID:25404130

  2. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  3. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  4. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  5. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C

    1994-01-01

    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  6. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  7. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    PubMed

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  8. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  9. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  10. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    PubMed

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  11. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  12. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  13. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  14. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    PubMed

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  15. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    PubMed

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ. PMID:26976590

  16. Genetic Diversity of Bacillus thuringiensis from Different Geo-Ecological Regions of Ukraine by Analyzing the 16S rRNA and gyrB Genes and by AP-PCR and saAFLP

    PubMed Central

    Punina, N. V.; Zotov, V. S.; Parkhomenko, A. L.; Parkhomenko, T. U.; Topunov, A. F.

    2013-01-01

    The Bacillus cereus group consists of closely related species of bacteria and is of interest to researchers due to its importance in industry and medicine. However, it remains difficult to distinguish these bacteria at the intra- and inter-species level. Bacillus thuringiensis (Bt) is a member of the B. cereus group. In this work, we studied the inter-species structure of five entomopathogenic strains and 20 isolates of Bt, which were collected from different geo-ecological regions of Ukraine, using various methods: physiological and biochemical analyses, analysis of the nucleotide sequences of the 16S rRNA and gyrB genes, by AP-PCR (BOX and ERIC), and by saAFLP. The analysis of the 16S rRNA and gyrB genes revealed the existence of six subgroups within theB.cereus group: B anthracis, B. cereus I and II, Bt I and II, and Bt III, and confirmed that these isolates belong to the genus Bacillus. All strains were subdivided into 3 groups. Seventeen strains belong to the group Bt II of commercial, industrial strains. The AP-PCR (BOX and ERIC) and saAFLP results were in good agreement and with the results obtained for the 16S rRNA and gyrB genes. Based on the derived patterns, all strains were reliably combined into 5 groups. Interestingly, a specific pattern was revealed by the saAFLP analysis for the industrial strain Bt 0376 р.о., which is used to produce the entomopathogenic preparation “STAR-t”. PMID:23556134

  17. Genetic structure of three fosmid-fragments encoding 16S rRNA genes of the Miscellaneous Crenarchaeotic Group (MCG): implications for physiology and evolution of marine sedimentary archaea.

    PubMed

    Li, Ping-Yi; Xie, Bin-Bin; Zhang, Xi-Ying; Qin, Qi-Long; Dang, Hong-Yue; Wang, Xu-Min; Chen, Xiu-Lan; Yu, Jun; Zhang, Yu-Zhong

    2012-02-01

    Archaea of the Miscellaneous Crenarchaeotic Group (MCG) exist widely in soil, freshwater and marine sediments of both surface and subsurface. However, current knowledge about this group is limited to its phylogenetic diversity. An archaeal 16S library was constructed from a sediment sample from the South China Sea, which was dominated by MCG and Marine Group I (MG-I). A metagenomic library was constructed from the same sediment sample, and three MCG fosmids (E6-3G, E37-7F and E48-1C) containing 16S rRNA genes were screened. Annotation showed that the three genomic fragments encode a variety of open reading frames (ORFs) that are potentially homologous to important functional genes related to lipid biosynthesis, energy metabolism, and resistance to oxidants. No colinear regions were found between MCG fosmids and reported archaeal genomic fragments or genomes, suggesting that the MCG archaea are quite different from the sequenced archaea in gene arrangement. Analyses of both the phylogenies of 16S rRNA genes and several informational processing genes and nucleotide frequencies showed that MCG archaea are distinct from MG-I plus relatives. In addition, tetranucleotide frequency analysis in combination with phylogenetic analysis suggested that some fragments in the MCG fosmids are probably derived from non-MCG or non-archaeal genomes.

  18. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  19. Tidally influenced alongshore circulation at an inlet-adjacent shoreline

    USGS Publications Warehouse

    Hansen, Jeff E.; Elias, Edwin P.L.; List, Jeffrey H.; Erikson, Li H.; Barnard, Patrick L.

    2013-01-01

    The contribution of tidal forcing to alongshore circulation inside the surfzone is investigated at a 7 km long sandy beach adjacent to a large tidal inlet. Ocean Beach in San Francisco, CA (USA) is onshore of a ∼150 km2 ebb-tidal delta and directly south of the Golden Gate, the sole entrance to San Francisco Bay. Using a coupled flow-wave numerical model, we find that the tides modulate, and in some cases can reverse the direction of, surfzone alongshore flows through two separate mechanisms. First, tidal flow through the inlet results in a barotropic tidal pressure gradient that, when integrated across the surfzone, represents an important contribution to the surfzone alongshore force balance. Even during energetic wave conditions, the tidal pressure gradient can account for more than 30% of the total alongshore pressure gradient (wave and tidal components) and up to 55% during small waves. The wave driven component of the alongshore pressure gradient results from alongshore wave height and corresponding setup gradients induced by refraction over the ebb-tidal delta. Second, wave refraction patterns over the inner shelf are tidally modulated as a result of both tidal water depth changes and strong tidal flows (∼1 m/s), with the effect from currents being larger. These tidally induced changes in wave refraction result in corresponding variability of the alongshore radiation stress and pressure gradients within the surfzone. Our results indicate that tidal contributions to the surfzone force balance can be significant and important in determining the direction and magnitude of alongshore flow.

  20. Seismotectonics of Northeastern United States and adjacent Canada

    SciTech Connect

    Yang, J.; Aggarwal, Y.P.

    1981-06-10

    Data for local earthquakes recorded by a network of stations in northeastern United States and adjacent Canada were analyzed to study the seismicity, the relationship between earthquakes and known faults, the state of stress, and crustal and upper mantle velocity structure. In addition, portable seismographs were deployed in the field to study aftershocks. As a result, accurate locations for about 364 local earthquakes (2< or =m/sub b/< or =5) and 22 focal mechanism solutions were determined. A comparison of the spatial distribution of these events (1970--1979) with historical earthquakes (1534--1959) reveals that seismic activity in the northeast is relatively stationary in space: those areas that have had little or no seismicity historically are relatively aseismic today, whereas the historically active areas are also active today. The instrumental locations, historical seismicity, and focal mechanism solutions show an internal consistency that help us distinguish two distinct seismogenic provinces. (1) The Adirondack-western Quebec province is a northwesterly trending zone of seismic activity, about 200 km wide and at least 500 km long, extending from the SE Adirondacks into western Quebec, Canada. Thrust faulting on planes striking NNW to NW appears to predominate, and the inferred axis of maximum horizontal compression is largely uniform and trends WSW, nearly parallel to the calculated absolute plate motion of North America. Little or no seismicity is found where anorthosite outcrops at the surface. Correlations between gravity anomalies and earthquake locations suggest that seismic activity in this zone is localized to regions of steep NE or SW gradient in Bouguer anomalies. This zone does not appear to extend southeastward to Boston, as proposed by some workers. (2) The Appalachian province is a northeasterly trending zone of seismic activity extending from northern Virginia to New Brunswick, Canada.