Science.gov

Sample records for admixing sufficient molybdate-reagent

  1. Match probabilities in racially admixed populations.

    PubMed Central

    Lange, K

    1993-01-01

    The calculation of match probabilities is the most contentious issue dividing prosecution and defense experts in the forensic applications of DNA fingerprinting. In particular, defense experts question the applicability of the population genetic laws of Hardy-Weinberg and linkage equilibrium to racially admixed American populations. Linkage equilibrium justifies the product rule for computing match probabilities across loci. The present paper suggests a method of bounding match probabilities that depends on modeling gene descent from ancestral populations to contemporary populations under the assumptions of Hardy-Weinberg and linkage equilibrium only in the ancestral populations. Although these bounds are conservative from the defendant's perspective, they should be small enough in practice to satisfy prosecutors. PMID:8430693

  2. Mapping asthma-associated variants in admixed populations

    PubMed Central

    Mersha, Tesfaye B.

    2015-01-01

    Admixed populations arise when two or more previously isolated populations interbreed. Mapping asthma susceptibility loci in an admixed population using admixture mapping (AM) involves screening the genome of individuals of mixed ancestry for chromosomal regions that have a higher frequency of alleles from a parental population with higher asthma risk as compared with parental population with lower asthma risk. AM takes advantage of the admixture created in populations of mixed ancestry to identify genomic regions where an association exists between genetic ancestry and asthma (in contrast to between the genotype of the marker and asthma). The theory behind AM is that chromosomal segments of affected individuals contain a significantly higher-than-average proportion of alleles from the high-risk parental population and thus are more likely to harbor disease–associated loci. Criteria to evaluate the applicability of AM as a gene mapping approach include: (1) the prevalence of the disease differences in ancestral populations from which the admixed population was formed; (2) a measurable difference in disease-causing alleles between the parental populations; (3) reduced linkage disequilibrium (LD) between unlinked loci across chromosomes and strong LD between neighboring loci; (4) a set of markers with noticeable allele-frequency differences between parental populations that contributes to the admixed population (single nucleotide polymorphisms (SNPs) are the markers of choice because they are abundant, stable, relatively cheap to genotype, and informative with regard to the LD structure of chromosomal segments); and (5) there is an understanding of the extent of segmental chromosomal admixtures and their interactions with environmental factors. Although genome-wide association studies have contributed greatly to our understanding of the genetic components of asthma, the large and increasing degree of admixture in populations across the world create many challenges

  3. Unravelling the hidden ancestry of American admixed populations

    PubMed Central

    Montinaro, Francesco; Busby, George B.J.; Pascali, Vincenzo L.; Myers, Simon; Hellenthal, Garrett; Capelli, Cristian

    2015-01-01

    The movement of people into the Americas has brought different populations into contact, and contemporary American genomes are the product of a range of complex admixture events. Here we apply a haplotype-based ancestry identification approach to a large set of genome-wide SNP data from a variety of American, European and African populations to determine the contributions of different ancestral populations to the Americas. Our results provide a fine-scale characterization of the source populations, identify a series of novel, previously unreported contributions from Africa and Europe and highlight geohistorical structure in the ancestry of American admixed populations. PMID:25803618

  4. Unravelling the hidden ancestry of American admixed populations.

    PubMed

    Montinaro, Francesco; Busby, George B J; Pascali, Vincenzo L; Myers, Simon; Hellenthal, Garrett; Capelli, Cristian

    2015-03-24

    The movement of people into the Americas has brought different populations into contact, and contemporary American genomes are the product of a range of complex admixture events. Here we apply a haplotype-based ancestry identification approach to a large set of genome-wide SNP data from a variety of American, European and African populations to determine the contributions of different ancestral populations to the Americas. Our results provide a fine-scale characterization of the source populations, identify a series of novel, previously unreported contributions from Africa and Europe and highlight geohistorical structure in the ancestry of American admixed populations.

  5. Accurate inference of local phased ancestry of modern admixed populations.

    PubMed

    Ma, Yamin; Zhao, Jian; Wong, Jian-Syuan; Ma, Li; Li, Wenzhi; Fu, Guoxing; Xu, Wei; Zhang, Kui; Kittles, Rick A; Li, Yun; Song, Qing

    2014-07-23

    Population stratification is a growing concern in genetic-association studies. Averaged ancestry at the genome level (global ancestry) is insufficient for detecting the population substructures and correcting population stratifications in association studies. Local and phase stratification are needed for human genetic studies, but current technologies cannot be applied on the entire genome data due to various technical caveats. Here we developed a novel approach (aMAP, ancestry of Modern Admixed Populations) for inferring local phased ancestry. It took about 3 seconds on a desktop computer to finish a local ancestry analysis for each human genome with 1.4-million SNPs. This method also exhibits the scalability to larger datasets with respect to the number of SNPs, the number of samples, and the size of reference panels. It can detect the lack of the proxy of reference panels. The accuracy was 99.4%. The aMAP software has a capacity for analyzing 6-way admixed individuals. As the biomedical community continues to expand its efforts to increase the representation of diverse populations, and as the number of large whole-genome sequence datasets continues to grow rapidly, there is an increasing demand on rapid and accurate local ancestry analysis in genetics, pharmacogenomics, population genetics, and clinical diagnosis.

  6. Safety of refrigerated storage of admixed parenteral fluids.

    PubMed Central

    Weil, D C; Arnow, P M

    1988-01-01

    Many hospital pharmacies are reluctant to store admixed parenteral fluids longer than 24 to 48 h because of concern about possible microbial contamination. We evaluated the safety of prolonged refrigerated storage of admixtures by culturing mixtures in 471 bags prepared routinely in a hospital pharmacy and stored at 4 degrees C for up to 15 days. Low-level contamination (1 CFU per bag) was found in 3 of 253 solutions of saline and/or glucose into which nonantibiotic additives had been injected. None of 171 saline and/or glucose solutions with antibiotic additives or 47 parenteral nutrition fluids was culture positive. The risk of contamination did not increase with duration of storage, and none of 107 bags stored greater than or equal to 5 days was culture positive. Laboratory studies to measure growth of bacteria and fungi in glucose infusate and parenteral nutrition solutions confirmed that storage at 4 degrees C suppresses growth. Eight of twelve bacterial isolates grew in glucose solutions at 25 degrees C, while none grew at 4 degrees C. Of 13 species of bacteria and fungi inoculated in parenteral nutrition fluids, 8 proliferated at 25 degrees C and none proliferated at 4 degrees C. We conclude that refrigerated storage of parenteral fluids for up to 1 week following admixture, as permitted by Centers for Disease Control guidelines, does not appear to increase the risk of microbial contamination when standard aseptic procedures for admixing and storage are followed. PMID:3183025

  7. Mathematical properties of Fst between admixed populations and their parental source populations.

    PubMed

    Boca, Simina M; Rosenberg, Noah A

    2011-11-01

    We consider the properties of the F(st) measure of genetic divergence between an admixed population and its parental source populations. Among all possible populations admixed among an arbitrary set of parental populations, we show that the value of F(st) between an admixed population and a specific source population is maximized when the admixed population is simply the most distant of the other source populations. For the case with only two parental populations, as a function of the admixture fraction, we further demonstrate that this F(st) value is monotonic and convex, so that F(st) is informative about the admixture fraction. We illustrate our results using example human population-genetic data, showing how they provide a framework in which to interpret the features of F(st) in admixed populations.

  8. Negatively charged liposomes show potent adjuvant activity when simply admixed with protein antigens

    PubMed Central

    Yanasarn, Nijaporn; Sloat, Brian R.; Cui, Zhengrong

    2011-01-01

    Liposomes have been investigated extensively as a vaccine delivery system. Herein the adjuvant activities of liposomes with different net surface charges (neutral, positive, or negative) were evaluated when admixed with protein antigens, ovalbumin (OVA, pI = 4.7), Bacillus anthracis protective antigen protein (PA, pI = 5.6), or cationized OVA (cOVA). Mice immunized subcutaneously with OVA admixed with different liposomes generated different antibody responses. Interestingly, OVA admixed with net negatively charged liposomes prepared with DOPA was as immunogenic as OVA admixed with positively charged liposomes prepared with DOTAP. Immunization of mice with the anthrax PA protein admixed with the net negatively charged DOPA liposomes also induced a strong and functional anti-PA antibody response. When the cationized OVA was used as a model antigen, liposomes with net neutral, negative, or positive charges showed comparable adjuvant activities. Immunization of mice with the OVA admixed with DOPA liposomes also induced OVA-specific CD8+ cytotoxic T lymphocyte responses and significantly delayed the growth of OVA-expressing B16-OVA tumors in mice. However, not all net negatively charged liposomes showed a strong adjuvant activity. The adjuvant activity of the negatively charged liposomes may be related to the liposome’s ability (i) to up-regulate the expression of molecules related to the activation and maturation of antigen-presenting cells and (ii) to slightly facilitate the uptake of the antigens by antigen-presenting cells. Simply admixing certain negatively charged liposomes with certain protein antigens of interest may represent a novel platform for vaccine development. PMID:21615153

  9. Exploring iris colour prediction and ancestry inference in admixed populations of South America.

    PubMed

    Freire-Aradas, A; Ruiz, Y; Phillips, C; Maroñas, O; Söchtig, J; Tato, A Gómez; Dios, J Álvarez; de Cal, M Casares; Silbiger, V N; Luchessi, A D; Luchessi, A D; Chiurillo, M A; Carracedo, Á; Lareu, M V

    2014-11-01

    New DNA-based predictive tests for physical characteristics and inference of ancestry are highly informative tools that are being increasingly used in forensic genetic analysis. Two eye colour prediction models: a Bayesian classifier - Snipper and a multinomial logistic regression (MLR) system for the Irisplex assay, have been described for the analysis of unadmixed European populations. Since multiple SNPs in combination contribute in varying degrees to eye colour predictability in Europeans, it is likely that these predictive tests will perform in different ways amongst admixed populations that have European co-ancestry, compared to unadmixed Europeans. In this study we examined 99 individuals from two admixed South American populations comparing eye colour versus ancestry in order to reveal a direct correlation of light eye colour phenotypes with European co-ancestry in admixed individuals. Additionally, eye colour prediction following six prediction models, using varying numbers of SNPs and based on Snipper and MLR, were applied to the study populations. Furthermore, patterns of eye colour prediction have been inferred for a set of publicly available admixed and globally distributed populations from the HGDP-CEPH panel and 1000 Genomes databases with a special emphasis on admixed American populations similar to those of the study samples.

  10. TNF promoter SNP variation in Amerindians and white-admixed women from Misiones, Argentina.

    PubMed

    Badano, I; Schurr, T G; Stietz, S M; Dulik, M C; Mampaey, M; Quintero, I M; Zinovich, J B; Campos, R H; Liotta, D J

    2013-06-01

    The aim of this study is to describe genetic variation in the TNF promoter in the ethnically diverse population of Misiones, north-eastern Argentina. We analysed 210 women including 66 Amerindians of the Mbya-Guarani ethnic group and 144 white-admixed individuals from urban and rural areas of Misiones. Their DNA samples were surveyed for TNF polymorphisms -376 A/G, -308 A/G -244 A/G and -238 A/G by PCR amplification and direct sequencing and for the Amerindian marker -857 C/T by real-time PCR. Our main findings are as follows:(i) a distinctive pattern of Single Nucleotide Polymorphism (SNP) distribution among these groups, (ii) genetic differentiation between the Mbya-Guarani and the white-admixed populations (P < 0.05), (iii) lower gene diversity (~0.05) in Mbya-Guarani compared with the white-admixed group (~0.21); and (iv) linkage disequilibrium between the -376A and -238A SNPs in white-admixed populations. These data highlight the principal role of population history in establishing present-day genetic variation at the TNF locus and provide a framework for undertaking ethnographic and disease association studies in Misiones.

  11. Nucleotide variability of HV-I in admixed population of the Brazilian Amazon Region.

    PubMed

    Feio-Dos-Santos, Ana Cecília; Carvalho, Bruno Maia; Batista dos Santos, Sidney Emanuel; Ribeiro-dos-Santos, Andrea Kely Campos

    2006-12-20

    The analysis of genetic variation in the nucleotide sequences of mitochondrial DNA has been used as a tool in the study of history of different human populations, as Amerindians, Afro-descendents populations and furthermore admixed populations. In this study, the mitochondrial DNA was analyzed in 158 unrelated individuals in an admixed population of the Amazonian Region: Santarém-PA-Brazil. The polymorphisms were detected using both levels, analysis of restriction enzyme and direct sequencing. We observed a total of 49 different haplotypes were found determined by 46 variable nucleotides. The more frequent haplotypes (Hap03) was shared by five samples and 43 sequences were unique. The genetic diversity was estimated to 0.989+/-0.0067 and the probability of two random individuals showed identical mitochondrial DNA (mtDNA) haplotypes were 2.8%.

  12. A Continuous Correlated Beta Process Model for Genetic Ancestry in Admixed Populations

    PubMed Central

    Gompert, Zachariah

    2016-01-01

    Admixture and recombination create populations and genomes with genetic ancestry from multiple source populations. Analyses of genetic ancestry in admixed populations are relevant for trait and disease mapping, studies of speciation, and conservation efforts. Consequently, many methods have been developed to infer genome-average ancestry and to deconvolute ancestry into continuous local ancestry blocks or tracts within individuals. Current methods for local ancestry inference perform well when admixture occurred recently or hybridization is ongoing, or when admixture occurred in the distant past such that local ancestry blocks have fixed in the admixed population. However, methods to infer local ancestry frequencies in isolated admixed populations still segregating for ancestry do not exist. In the current paper, I develop and test a continuous correlated beta process model to fill this analytical gap. The method explicitly models autocorrelations in ancestry frequencies at the population-level and uses discriminant analysis of SNP windows to take advantage of ancestry blocks within individuals. Analyses of simulated data sets show that the method is generally accurate such that ancestry frequency estimates exhibited low root-mean-square error and were highly correlated with the true values, particularly when large (±10 or ±20) SNP windows were used. Along these lines, the proposed method outperformed post hoc inference of ancestry frequencies from a traditional hidden Markov model (i.e., the linkage model in structure), particularly when admixture occurred more distantly in the past with little on-going gene flow or was followed by natural selection. The reliability and utility of the method was further assessed by analyzing genetic ancestry in an admixed human population (Uyghur) and three populations from a hybrid zone between Mus domesticus and M. musculus. Considerable variation in ancestry frequencies was detected within and among chromosomes in the Uyghur

  13. A Continuous Correlated Beta Process Model for Genetic Ancestry in Admixed Populations.

    PubMed

    Gompert, Zachariah

    2016-01-01

    Admixture and recombination create populations and genomes with genetic ancestry from multiple source populations. Analyses of genetic ancestry in admixed populations are relevant for trait and disease mapping, studies of speciation, and conservation efforts. Consequently, many methods have been developed to infer genome-average ancestry and to deconvolute ancestry into continuous local ancestry blocks or tracts within individuals. Current methods for local ancestry inference perform well when admixture occurred recently or hybridization is ongoing, or when admixture occurred in the distant past such that local ancestry blocks have fixed in the admixed population. However, methods to infer local ancestry frequencies in isolated admixed populations still segregating for ancestry do not exist. In the current paper, I develop and test a continuous correlated beta process model to fill this analytical gap. The method explicitly models autocorrelations in ancestry frequencies at the population-level and uses discriminant analysis of SNP windows to take advantage of ancestry blocks within individuals. Analyses of simulated data sets show that the method is generally accurate such that ancestry frequency estimates exhibited low root-mean-square error and were highly correlated with the true values, particularly when large (±10 or ±20) SNP windows were used. Along these lines, the proposed method outperformed post hoc inference of ancestry frequencies from a traditional hidden Markov model (i.e., the linkage model in structure), particularly when admixture occurred more distantly in the past with little on-going gene flow or was followed by natural selection. The reliability and utility of the method was further assessed by analyzing genetic ancestry in an admixed human population (Uyghur) and three populations from a hybrid zone between Mus domesticus and M. musculus. Considerable variation in ancestry frequencies was detected within and among chromosomes in the Uyghur

  14. A melting pot of multicontinental mtDNA lineages in admixed Venezuelans.

    PubMed

    Gómez-Carballa, Alberto; Ignacio-Veiga, Ana; Alvarez-Iglesias, Vanesa; Pastoriza-Mourelle, Ana; Ruíz, Yarimar; Pineda, Lennie; Carracedo, Angel; Salas, Antonio

    2012-01-01

    The arrival of Europeans in Colonial and post-Colonial times coupled with the forced introduction of sub-Saharan Africans have dramatically changed the genetic background of Venezuela. The main aim of the present study was to evaluate, through the study of mitochondrial DNA (mtDNA) variation, the extent of admixture and the characterization of the most likely continental ancestral sources of present-day urban Venezuelans. We analyzed two admixed populations that have experienced different demographic histories, namely, Caracas (n = 131) and Pueblo Llano (n = 219). The native American component of admixed Venezuelans accounted for 80% (46% haplogroup [hg] A2, 7% hg B2, 21% hg C1, and 6% hg D1) of all mtDNAs; while the sub-Saharan and European contributions made up ∼10% each, indicating that Trans-Atlantic immigrants have only partially erased the native American nature of Venezuelans. A Bayesian-based model allowed the different contributions of European countries to admixed Venezuelans to be disentangled (Spain: ∼38.4%, Portugal: ∼35.5%, Italy: ∼27.0%), in good agreement with the documented history. Seventeen entire mtDNA genomes were sequenced, which allowed five new native American branches to be discovered. B2j and B2k, are supported by two different haplotypes and control region data, and their coalescence ages are 3.9 k.y. (95% C.I. 0-7.8) and 2.6 k.y. (95% C.I. 0.1-5.2), respectively. The other clades were exclusively observed in Pueblo Llano and they show the fingerprint of strong recent genetic drift coupled with severe historical consanguinity episodes that might explain the high prevalence of certain Mendelian and complex multi-factorial diseases in this region.

  15. Identification of a novel locus associated with skin colour in African-admixed populations

    PubMed Central

    Hernandez-Pacheco, Natalia; Flores, Carlos; Alonso, Santos; Eng, Celeste; Mak, Angel C. Y.; Hunstman, Scott; Hu, Donglei; White, Marquitta J.; Oh, Sam S.; Meade, Kelley; Farber, Harold J.; Avila, Pedro C.; Serebrisky, Denise; Thyne, Shannon M.; Brigino-Buenaventura, Emerita; Rodriguez-Cintron, William; Sen, Saunak; Kumar, Rajesh; Lenoir, Michael; Rodriguez-Santana, Jose R.; Burchard, Esteban G.; Pino-Yanes, Maria

    2017-01-01

    Skin pigmentation is a complex trait that varies largely among populations. Most genome-wide association studies of this trait have been performed in Europeans and Asians. We aimed to uncover genes influencing skin colour in African-admixed individuals. We performed a genome-wide association study of melanin levels in 285 Hispanic/Latino individuals from Puerto Rico, analyzing 14 million genetic variants. A total of 82 variants with p-value ≤1 × 10−5 were followed up in 373 African Americans. Fourteen single nucleotide polymorphisms were replicated, of which nine were associated with skin colour at genome-wide significance in a meta-analysis across the two studies. These results validated the association of two previously known skin pigmentation genes, SLC24A5 (minimum p = 2.62 × 10−14, rs1426654) and SLC45A2 (minimum p = 9.71 × 10−10, rs16891982), and revealed the intergenic region of BEND7 and PRPF18 as a novel locus associated with this trait (minimum p = 4.58 × 10−9, rs6602666). The most significant variant within this region is common among African-descent populations but not among Europeans or Native Americans. Our findings support the advantages of analyzing African-admixed populations to discover new genes influencing skin pigmentation. PMID:28300201

  16. Physical stability of asphalt emulsion admix seal radon barrier for uranium mill tailings

    SciTech Connect

    Gates, T.E.

    1983-09-01

    Pacific Northwest Laboratory, is investigating the use of an asphalt emulsion admix seal to reduce the release of radon from uranium mill tailings. A key requirement of any cover system is its long-term stability; the cover must withstand failure over very long periods of time. An important determinant of overall cover system stability is the integrity of the 6.35-cm (2.5-in.) thick asphalt admix seal. Therefore, the physical stability of this seal was examined. The investigation considered the mechanical interaction between the tailings pile and cover. The potential effect of differential settlement of the tailings pile on the integrity of the seal system was also examined. Results indicate that the minimum span length the seal could withstand without failing is 0.34 m (1.1 ft). This assumes a differential settlement of 4.92 cm (1.94 in.) at the center resulting from the application of a 0.76-m (2.5-ft) cover. At spans greater than 0.60 m (1.97 ft), no tensile strain would develop.

  17. Gravel admix, vegetation, and soil water interactions in protective barriers: Experimental design, construction, and initial conditions

    SciTech Connect

    Waugh, W.J.

    1989-05-01

    The purpose of this study is to measure the interactive effects of gravel admix and greater precipitation on soil water storage and plant abundance. The study is one of many tasks in the Protective Barrier Development Program for the disposal of Hanford defense waste. A factorial field-plot experiment was set up at the site selected as the borrow area for barrier topsoil. Gravel admix, vegetation, and enhanced precipitation treatments were randomly assigned to the plots using a split-split plot design structure. Changes in soil water storage and plant cover were monitored using neutron probe and point intercept methods, respectively. The first-year results suggest that water extraction by plants will offset gravel-caused increases in soil water storage. Near-surface soil water contents were much lower in graveled plots with plants than in nongraveled plots without plants. Large inherent variability in deep soil water storage masked any effects gravel may have had on water content below the root zone. In the future, this source of variation will be removed by differencing monthly data series and testing for changes in soil water storage. Tests of the effects of greater precipitation on soil water storage were inconclusive. A telling test will be possible in the spring of 1988, following the first wet season during which normal precipitation is doubled. 26 refs., 9 figs., 9 tabs.

  18. Characterizations of linear sufficient statistics

    NASA Technical Reports Server (NTRS)

    Peters, B. C., Jr.; Reoner, R.; Decell, H. P., Jr.

    1977-01-01

    A surjective bounded linear operator T from a Banach space X to a Banach space Y must be a sufficient statistic for a dominated family of probability measures defined on the Borel sets of X. These results were applied, so that they characterize linear sufficient statistics for families of the exponential type, including as special cases the Wishart and multivariate normal distributions. The latter result was used to establish precisely which procedures for sampling from a normal population had the property that the sample mean was a sufficient statistic.

  19. Genetic Variants of TSLP and Asthma in an Admixed Urban Population

    PubMed Central

    Liu, Mengling; Rogers, Linda; Cheng, Qinyi; Shao, Yongzhao; Fernandez-Beros, Maria Elena; Hirschhorn, Joel N.; Lyon, Helen N.; Gajdos, Zofia K. Z.; Vedantam, Sailaja; Gregersen, Peter; Seldin, Michael F.; Bleck, Bertram; Ramasamy, Adaikalavan; Hartikainen, Anna-Liisa; Jarvelin, Marjo-Riitta; Kuokkanen, Mikko; Laitinen, Tarja; Eriksson, Johan; Lehtimäki, Terho; Raitakari, Olli T.; Reibman, Joan

    2011-01-01

    Background Thymic stromal lymphopoietin (TSLP), an IL7-like cytokine produced by bronchial epithelial cells is upregulated in asthma and induces dendritic cell maturation supporting a Th2 response. Environmental pollutants, including tobacco smoke and diesel exhaust particles upregulate TSLP suggesting that TSLP may be an interface between environmental pollution and immune responses in asthma. Since asthma is prevalent in urban communities, variants in the TSLP gene may be important in asthma susceptibility in these populations. Objectives To determine whether genetic variants in TSLP are associated with asthma in an urban admixed population. Methodology and Main Results Ten tag-SNPs in the TSLP gene were analyzed for association with asthma using 387 clinically diagnosed asthmatic cases and 212 healthy controls from an urban admixed population. One SNP (rs1898671) showed nominally significant association with asthma (odds ratio (OR) = 1.50; 95% confidence interval (95% CI): 1.09–2.05, p = 0.01) after adjusting for age, BMI, income, education and population stratification. Association results were consistent using two different approaches to adjust for population stratification. When stratified by smoking status, the same SNP showed a significantly increased risk associated with asthma in ex-smokers (OR = 2.00, 95% CI: 1.04–3.83, p = 0.04) but not significant in never-smokers (OR = 1.34; 95% CI: 0.93–1.94, p = 0.11). Haplotype-specific score test indicated that an elevated risk for asthma was associated with a specific haplotype of TSLP involving SNP rs1898671 (OR = 1.58, 95% CI: 1.10–2.27, p = 0.01). Association of this SNP with asthma was confirmed in an independent large population-based cohort consortium study (OR = 1.15, 95% CI: 1.07–1.23, p = 0.0003) and the results stratified by smoking status were also validated (ex-smokers: OR = 1.21, 95% CI: 1.08–1.34, p = 0.003; never-smokers: OR = 1.06, 95

  20. Genomic prediction in an admixed population of Atlantic salmon (Salmo salar)

    PubMed Central

    Ødegård, Jørgen; Moen, Thomas; Santi, Nina; Korsvoll, Sven A.; Kjøglum, Sissel; Meuwissen, Theo H. E.

    2014-01-01

    Reliability of genomic selection (GS) models was tested in an admixed population of Atlantic salmon, originating from crossing of several wild subpopulations. The models included ordinary genomic BLUP models (GBLUP), using genome-wide SNP markers of varying densities (1–220 k), a genomic identity-by-descent model (IBD-GS), using linkage analysis of sparse genome-wide markers, as well as a classical pedigree-based model. Reliabilities of the models were compared through 5-fold cross-validation. The traits studied were salmon lice (Lepeophtheirus salmonis) resistance (LR), measured as (log) density on the skin and fillet color (FC), with respective estimated heritabilities of 0.14 and 0.43. All genomic models outperformed the classical pedigree-based model, for both traits and at all marker densities. However, the relative improvement differed considerably between traits, models and marker densities. For the highly heritable FC, the IBD-GS had similar reliability as GBLUP at high marker densities (>22 k). In contrast, for the lowly heritable LR, IBD-GS was clearly inferior to GBLUP, irrespective of marker density. Hence, GBLUP was robust to marker density for the lowly heritable LR, but sensitive to marker density for the highly heritable FC. We hypothesize that this phenomenon may be explained by historical admixture of different founder populations, expected to reduce short-range lice density (LD) and induce long-range LD. The relative importance of LD/relationship information is expected to decrease/increase with increasing heritability of the trait. Still, using the ordinary GBLUP, the typical long-range LD of an admixed population may be effectively captured by sparse markers, while efficient utilization of relationship information may require denser markers (e.g., 22 k or more). PMID:25484890

  1. Working toward Self-Sufficiency.

    ERIC Educational Resources Information Center

    Caplan, Nathan

    1985-01-01

    Upon arrival in the United States, the Southeast Asian "Boat People" faced a multitude of problems that would seem to have hindered their achieving economic self-sufficiency. Nonetheless, by the time of a 1982 research study which interviewed nearly 1,400 refugee households, 25 percent of all the households in the sample had achieved…

  2. Genetic structure of a unique admixed population: implications for medical research.

    PubMed

    Patterson, Nick; Petersen, Desiree C; van der Ross, Richard E; Sudoyo, Herawati; Glashoff, Richard H; Marzuki, Sangkot; Reich, David; Hayes, Vanessa M

    2010-02-01

    STATEMENT: In naming population groups, we think a chief aim is to use terms that the group members use themselves, or find familiar and comfortable. The terms used in this manuscript to describe populations are as historically correct as possible and are chosen so as not to offend any population group. Two of the authors (DCP and REvdR) belong to the Coloured population, with one of the authors (REvdR) having contributed extensively to current literature on the history of the Coloured people of South Africa and served as Vice-President of the South African Institute of Race Relations. According to the 2001 South African census (http://www.statssa.gov.za/census01/HTML/CInBrief/CIB2001.pdf), "Statistics South Africa continues to classify people by population group, in order to monitor progress in moving away from the apartheid-based discrimination of the past. However, membership of a population group is now based on self-perception and self-classification, not on a legal definition. Five options were provided on the questionnaire, Black African, Coloured, Indian or Asian, White and Other. Responses in the category 'Other' were very few and were therefore imputed". We have elected to use the term Bushmen rather than San to refer to the hunter-gatherer people of Southern Africa. Although they have no collective name for themselves, this decision was based on the term Bushmen (or Bossiesman) being the more familiar to the communities themselves, while the term San is the more accepted academic classification. Understanding human genetic structure has fundamental implications for understanding the evolution and impact of human diseases. In this study, we describe the complex genetic substructure of a unique and recently admixed population arising approximately 350 years ago as a direct result of European settlement in South Africa. Analysis was performed using over 900 000 genome-wide single nucleotide polymorphisms in 20 unrelated ancestry-informative marker selected

  3. Compatibility and Stability of Rolapitant Injectable Emulsion Admixed with Dexamethasone Sodium Phosphate.

    PubMed

    Wu, George; Yeung, Stanley; Chen, Frank

    2017-01-01

    Neurokinin-1 receptor antagonist, 5-hydroxytryptamine-3 receptor antagonist, and dexamethasone combination therapy is the standard of care for the prevention of chemotherapy-induced nausea and vomiting. Herein, we describe the physical and chemical stability of an injectable emulsion of the Neurokinin-1 receptor antagonist rolapitant 185 mg in 92.5 mL (free base, 166.5 mg in 92.5 mL) admixed with either 2.5 mL of dexamethasone sodium phosphate (10 mg) or 5 mL of dexamethasone sodium phosphate (20 mg). Admixtures were prepared and stored in two types of container closures (glass and Crystal Zenith plastic bottles) and four types of intravenous administration tubing sets (or intravenous tubing sets). The assessment of the physical and chemical stability was conducted on admixtures packaged in bottled samples stored at room temperature (20°C to 25°C under fluorescent light) and evaluated at 0, 1, and 6 hours. For admixtures in intravenous tubing sets, the assessment of physicochemical stability was performed after 0 and 7 hours of storage at 20°C to 25°C, and then after 20 hours (total 27 hours) under refrigeration (2°C to 8°C) and protected from light. Physical stability was assessed by visually examining the bottle contents under normal room light and measuring turbidity and particulate matter. Chemical stability was assessed by measuring the pH of the admixture and determining drug concentrations through high-performance liquid chromatographic analysis. Results showed that all samples were physically compatible throughout the duration of the study. The admixtures stayed within narrow and acceptable ranges in pH, turbidity, and particulate matter. Admixtures of rolapitant and dexamethasone were chemically stable when stored in glass and Crystal Zenith bottles for at least 6 hours at room temperature, as well as in the four selected intravenous tubing sets for 7 hours at 20°C to 25°C and then for 20 (total 27 hours) hours at 2°C to 8°C. No loss of potency

  4. Extensive Copy Number Variations in Admixed Indian Population of African Ancestry: Potential Involvement in Adaptation

    PubMed Central

    Dash, Debasis; Mukerji, Mitali

    2014-01-01

    Admixture mapping has been enormously resourceful in identifying genetic variations linked to phenotypes, adaptation, and diseases. In this study through analysis of copy number variable regions (CNVRs), we report extensive restructuring in the genomes of the recently admixed African-Indian population (OG-W-IP) that inhabits a highly saline environment in Western India. The study included subjects from OG-W-IP (OG), five different Indian and three HapMap populations that were genotyped using Affymetrix version 6.0 arrays. Copy number variations (CNVs) detected using Birdsuite were used to define CNVRs. Population structure with respect to CNVRs was delineated using random forest approach. OG genomes have a surprising excess of CNVs in comparison to other studied populations. Individual ancestry proportions computed using STRUCTURE also reveals a unique genetic component in OGs. Population structure analysis with CNV genotypes indicates OG to be distant from both the African and Indian ancestral populations. Interestingly, it shows genetic proximity with respect to CNVs to only one Indian population IE-W-LP4, which also happens to reside in the same geographical region. We also observe a significant enrichment of molecular processes related to ion binding and receptor activity in genes encompassing OG-specific CNVRs. Our results suggest that retention of CNVRs from ancestral natives and de novo acquisition of CNVRs could accelerate the process of adaptation especially in an extreme environment. Additionally, this population would be enormously useful for dissecting genes and delineating the involvement of CNVs in salt adaptation. PMID:25398783

  5. Butyrylcholinesterase polymorphisms (BCHE and CHE2 loci) in Brazilian Indian and admixed populations.

    PubMed

    Alcântara, V M; De Lourenço, M A; Salzano, F M; Petzl-Erler, M L; Coimbra, C E; Santos, R V; Chautard-Freire-Maia, E A

    1995-10-01

    The genetic variability of butyrylcholinesterase, determined by the BCHE and CHE2 loci, was examined in nine Brazilian Indian groups. In addition, a search for the presence of the BCHE*F allele was also performed in eight other Brazilian Indian samples and in five admixed (black-Indian-white) rural Amazonian communities previously studied for the CHE2 locus and the BCHE*A allele. In the Indian populations the frequency of the BCHE*F allele varied from 0 to 7.1% +/- 3.4 and the frequency of the CHE2 C5+ phenotype ranged from 1.4% +/- 1.4 to 45.9% +/- 3.8. This study seems to be the first to report the presence of the BCHE*F allele in native Americans. The BCHE*A allele appeared in one Indian group (1.4% +/- 1.0), and we suggest that its existence in this tribe and in other native Americans can be explained by gene flow from white populations. Gene flow may also be the reason for the occurrence of the BCHE*F allele in Brazilian Indians, whereas the CHE2*C5+ allele may have been present in the paleo-Indians. The distributions of both the BCHE*F allele and the CHE2 C5+ phenotype in Brazilian Indians seem to be the result of the action of random genetic drift.

  6. Genetic architecture of skin and eye color in an African-European admixed population.

    PubMed

    Beleza, Sandra; Johnson, Nicholas A; Candille, Sophie I; Absher, Devin M; Coram, Marc A; Lopes, Jailson; Campos, Joana; Araújo, Isabel Inês; Anderson, Tovi M; Vilhjálmsson, Bjarni J; Nordborg, Magnus; Correia E Silva, António; Shriver, Mark D; Rocha, Jorge; Barsh, Gregory S; Tang, Hua

    2013-03-01

    Variation in human skin and eye color is substantial and especially apparent in admixed populations, yet the underlying genetic architecture is poorly understood because most genome-wide studies are based on individuals of European ancestry. We study pigmentary variation in 699 individuals from Cape Verde, where extensive West African/European admixture has given rise to a broad range in trait values and genomic ancestry proportions. We develop and apply a new approach for measuring eye color, and identify two major loci (HERC2[OCA2] P = 2.3 × 10(-62), SLC24A5 P = 9.6 × 10(-9)) that account for both blue versus brown eye color and varying intensities of brown eye color. We identify four major loci (SLC24A5 P = 5.4 × 10(-27), TYR P = 1.1 × 10(-9), APBA2[OCA2] P = 1.5 × 10(-8), SLC45A2 P = 6 × 10(-9)) for skin color that together account for 35% of the total variance, but the genetic component with the largest effect (~44%) is average genomic ancestry. Our results suggest that adjacent cis-acting regulatory loci for OCA2 explain the relationship between skin and eye color, and point to an underlying genetic architecture in which several genes of moderate effect act together with many genes of small effect to explain ~70% of the estimated heritability.

  7. mStruct: inference of population structure in light of both genetic admixing and allele mutations.

    PubMed

    Shringarpure, Suyash; Xing, Eric P

    2009-06-01

    Traditional methods for analyzing population structure, such as the Structure program, ignore the influence of the effect of allele mutations between the ancestral and current alleles of genetic markers, which can dramatically influence the accuracy of the structural estimation of current populations. Studying these effects can also reveal additional information about population evolution such as the divergence time and migration history of admixed populations. We propose mStruct, an admixture of population-specific mixtures of inheritance models that addresses the task of structure inference and mutation estimation jointly through a hierarchical Bayesian framework, and a variational algorithm for inference. We validated our method on synthetic data and used it to analyze the Human Genome Diversity Project-Centre d'Etude du Polymorphisme Humain (HGDP-CEPH) cell line panel of microsatellites and HGDP single-nucleotide polymorphism (SNP) data. A comparison of the structural maps of world populations estimated by mStruct and Structure is presented, and we also report potentially interesting mutation patterns in world populations estimated by mStruct.

  8. Enhanced Statistical Tests for GWAS in Admixed Populations: Assessment using African Americans from CARe and a Breast Cancer Consortium

    PubMed Central

    Pasaniuc, Bogdan; Zaitlen, Noah; Lettre, Guillaume; Chen, Gary K.; Tandon, Arti; Kao, W. H. Linda; Ruczinski, Ingo; Fornage, Myriam; Siscovick, David S.; Zhu, Xiaofeng; Larkin, Emma; Lange, Leslie A.; Cupples, L. Adrienne; Yang, Qiong; Akylbekova, Ermeg L.; Musani, Solomon K.; Divers, Jasmin; Mychaleckyj, Joe; Li, Mingyao; Papanicolaou, George J.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah J.; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Chanock, Stephen J.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Palmer, Cameron D.; Buxbaum, Sarah; Ekunwe, Lynette; Hirschhorn, Joel N.; Henderson, Brian E.; Myers, Simon; Haiman, Christopher A.; Reich, David; Patterson, Nick; Wilson, James G.; Price, Alkes L.

    2011-01-01

    While genome-wide association studies (GWAS) have primarily examined populations of European ancestry, more recent studies often involve additional populations, including admixed populations such as African Americans and Latinos. In admixed populations, linkage disequilibrium (LD) exists both at a fine scale in ancestral populations and at a coarse scale (admixture-LD) due to chromosomal segments of distinct ancestry. Disease association statistics in admixed populations have previously considered SNP association (LD mapping) or admixture association (mapping by admixture-LD), but not both. Here, we introduce a new statistical framework for combining SNP and admixture association in case-control studies, as well as methods for local ancestry-aware imputation. We illustrate the gain in statistical power achieved by these methods by analyzing data of 6,209 unrelated African Americans from the CARe project genotyped on the Affymetrix 6.0 chip, in conjunction with both simulated and real phenotypes, as well as by analyzing the FGFR2 locus using breast cancer GWAS data from 5,761 African-American women. We show that, at typed SNPs, our method yields an 8% increase in statistical power for finding disease risk loci compared to the power achieved by standard methods in case-control studies. At imputed SNPs, we observe an 11% increase in statistical power for mapping disease loci when our local ancestry-aware imputation framework and the new scoring statistic are jointly employed. Finally, we show that our method increases statistical power in regions harboring the causal SNP in the case when the causal SNP is untyped and cannot be imputed. Our methods and our publicly available software are broadly applicable to GWAS in admixed populations. PMID:21541012

  9. Distribution of genetic polymorphisms associated with hepatitis C virus (HCV) antiviral response in a multiethnic and admixed population.

    PubMed

    Trinks, J; Hulaniuk, M L; Caputo, M; Pratx, L Burgos; Ré, V; Fortuny, L; Pontoriero, A; Frías, A; Torres, O; Nuñez, F; Gadano, A; Corach, D; Flichman, D

    2014-12-01

    The prevalence of genetic polymorphisms identified as predictors of therapeutic-induced hepatitis C virus (HCV) clearance differs among ethnic groups. However, there is a paucity of information about their prevalence in South American populations, whose genetic background is highly admixed. Hence, single-nucleotide polymorphisms rs12979860, rs1127354 and rs7270101 were characterized in 1350 healthy individuals, and ethnicity was assessed in 259 randomly selected samples. The frequency of rs12979860CC, associated to HCV treatment response, and rs1127354nonCC, related to protection against hemolytic anemia, were significantly higher among individuals with maternal and paternal Non-native American haplogroups (64.5% and 24.2%), intermediate among admixed samples (44.1% and 20.4%) and the lowest for individuals with Native American ancestry (30.4% and 6.5%). This is the first systematic study focused on analyzing HCV predictors of antiviral response and ethnicity in South American populations. The characterization of these variants is critical to evaluate the risk-benefit of antiviral treatment according to the patient ancestry in admixed populations.

  10. The Study of Local Effect of Manganese on Microstructure Development of Admixed Fe-Mn-C Sintered Steels

    NASA Astrophysics Data System (ADS)

    Bidulský, Róbert; Hryha, Eduard; Bidulská, Jana

    2016-10-01

    The present paper is focused on the effect of manganese on microstructure development of admixed Fe-Mn-C sintered steels along with diffusion characteristics of manganese in the iron matrix. Admixed systems were prepared on the base of sponge iron powder, with addition of 0.3% C and 3% Mn added as ferromanganese. Sintering at 1,023, 1,173, 1,323, 1,423 and 1,473 K for 180 s was carried out in laboratory tube furnace in an atmosphere of pure gases mixture 25% N2+75% H2 with the dew point of 243 K. The results show that admixed sintered manganese steels exhibit heterogeneity of microstructure due to the local chemical heterogeneities of these materials, in particular for those areas with a high manganese concentration. On the basis of calculation of manganese apparent diffusion coefficient and penetration depth, results reveal that diffusion-induced grain boundary migration (DIGM) is the dominant alloying mechanism in sintered manganese steels.

  11. Energy Strategic Planning & Sufficiency Project

    SciTech Connect

    Retziaff, Greg

    2005-03-30

    This report provides information regarding options available, their advantages and disadvantages, and the costs for pursuing activities to advance Smith River Rancheria toward an energy program that reduces their energy costs, allows greater self-sufficiency and stimulates economic development and employment opportunities within and around the reservation. The primary subjects addressed in this report are as follows: (1) Baseline Assessment of Current Energy Costs--An evaluation of the historical energy costs for Smith River was conducted to identify the costs for each component of their energy supply to better assess changes that can be considered for energy cost reductions. (2) Research Viable Energy Options--This includes a general description of many power generation technologies and identification of their relative costs, advantages and disadvantages. Through this research the generation technology options that are most suited for this application were identified. (3) Project Development Considerations--The basic steps and associated challenges of developing a generation project utilizing the selected technologies are identified and discussed. This included items like selling to third parties, wheeling, electrical interconnections, fuel supply, permitting, standby power, and transmission studies. (4) Energy Conservation--The myriad of federal, state and utility programs offered for low-income weatherization and utility bill payment assistance are identified, their qualification requirements discussed, and the subsequent benefits outlined. (5) Establishing an Energy Organization--The report includes a high level discussion of formation of a utility to serve the Tribal membership. The value or advantages of such action is discussed along with some of the challenges. (6) Training--Training opportunities available to the Tribal membership are identified.

  12. A rapid screening of ancestry for genetic association studies in an admixed population from Pernambuco, Brazil.

    PubMed

    Coelho, A V C; Moura, R R; Cavalcanti, C A J; Guimarães, R L; Sandrin-Garcia, P; Crovella, S; Brandão, L A C

    2015-03-31

    Genetic association studies determine how genes influence traits. However, non-detected population substructure may bias the analysis, resulting in spurious results. One method to detect substructure is to genotype ancestry informative markers (AIMs) besides the candidate variants, quantifying how much ancestral populations contribute to the samples' genetic background. The present study aimed to use a minimum quantity of markers, while retaining full potential to estimate ancestries. We tested the feasibility of a subset of the 12 most informative markers from a previously established study to estimate influence from three ancestral populations: European, African and Amerindian. The results showed that in a sample with a diverse ethnicity (N = 822) derived from 1000 Genomes database, the 12 AIMs had the same capacity to estimate ancestries when compared to the original set of 128 AIMs, since estimates from the two panels were closely correlated. Thus, these 12 SNPs were used to estimate ancestry in a new sample (N = 192) from an admixed population in Recife, Northeast Brazil. The ancestry estimates from Recife subjects were in accordance with previous studies, showing that Northeastern Brazilian populations show great influence from European ancestry (59.7%), followed by African (23.0%) and Amerindian (17.3%) ancestries. Ethnicity self-classification according to skin-color was confirmed to be a poor indicator of population substructure in Brazilians, since ancestry estimates overlapped between classifications. Thus, our streamlined panel of 12 markers may substitute panels with more markers, while retaining the capacity to control for population substructure and admixture, thereby reducing sample processing time.

  13. Genotyping approach for non-invasive foetal RHD detection in an admixed population

    PubMed Central

    Boggione, Carolina Trucco; Luján Brajovich, Melina E.; Mattaloni, Stella M.; Di Mónaco, René A.; García Borrás, Silvia E.; Biondi, Claudia S.; Cotorruelo, Carlos M.

    2017-01-01

    Background Non-invasive foetal RHD genotyping can predict haemolytic disease of the foetus and the newborn in pregnancies with anti-D alloantibodies and also avoid antenatal anti-D prophylaxis in pregnant women carrying an RHD negative foetus. Considering that the Argentine genetic background is the result of generations of intermixing between several ethnic groups, we evaluated the diagnostic performance of a non-invasive foetal RHD determination strategy to guide targeted antenatal RhD immunoprophylaxis. This algorithm is based on the analysis of four regions of the RHD gene in cell-free foetal DNA in maternal plasma and maternal and paternal RHD genotyping. Materials and methods DNA from 298 serologically D negative pregnant women between 19–28 weeks gestation were RHD genotyped. Foetal RHD status was determined by real-time PCR in 296 maternal plasma samples. In particular cases, RHDΨ and RHD-CE-Ds alleles were investigated in paternal DNA. Umbilical cord blood was collected at birth, and serological and molecular studies were performed. Results Of the 298 maternal samples, 288 were D−/RHD− and 10 D−/RHD+ (2 RHD*DAR; 5 RHD-CE-Ds; 3 RHDΨ). Plasma from RHD*DAR carriers was not analysed. Real-time PCR showed 210 RHD+ and 78 RHD− foetuses and 8 inconclusive results. In this latter group, paternal molecular studies were useful to report a RHD negative status in 5 foetuses while only 3 remained inconclusive. All the results, except one false positive due to a silent allele (RHD[581insG]), agreed with the neonatal typing performed in cord blood. Discussion The protocol used for non-invasive prenatal RHD genotyping proved to be suitable to determine foetal RHD status in our admixed population. The knowledge of the genetic background of the population under study and maternal and paternal molecular analysis can reduce the number of inconclusive results when investigating foetal RHD status. PMID:27136427

  14. The role of ancestry in TB susceptibility of an admixed South African population.

    PubMed

    Daya, Michelle; van der Merwe, Lize; van Helden, Paul D; Möller, Marlo; Hoal, Eileen G

    2014-07-01

    Genetic susceptibility to tuberculosis (TB) has been well established and this, taken together with variation in susceptibility observed between different geographic and ethnic populations, implies that susceptibility to TB may in part be affected by ethnicity. In a previous genome-wide TB case-control study (642 cases and 91 controls) of the admixed South African Coloured (SAC) population, we found a positive correlation between African San ancestry and TB susceptibility, and negative correlations with European and Asian ancestries. Since genome-wide data was available for only a small number of controls in the previous study, we endeavored to validate this finding by genotyping a panel of ancestry informative markers (AIMs) in additional individuals, yielding a data set of 918 cases and 507 controls. Ancestry proportions were estimated using the AIMs for each of the source populations of the SAC (African San, African non-San, European, South Asian and East Asian). Using logistic regression models to test for association between TB and ancestry, we confirmed the substantial effect of ancestry on TB susceptibility. We also investigated the effect of adjusting for ancestry in candidate gene TB association studies of the SAC. We report a polymorphism that is no longer significantly associated with TB after adjustment for ancestry, a polymorphism that is significantly associated with TB only after adjustment for ancestry, and a polymorphism where the association significance remains unchanged. By comparing the allele frequencies of these polymorphisms in the source populations of the SAC, we demonstrate that association results are likely to be affected by adjustment for ancestry if allele frequencies differ markedly in the source populations of the SAC.

  15. High specific activity silicon-32

    DOEpatents

    Phillips, Dennis R.; Brzezinski, Mark A.

    1996-01-01

    A process for preparation of silicon-32 is provided and includes contacting an irradiated potassium chloride target, including spallation products from a prior irradiation, with sufficient water, hydrochloric acid or potassium hydroxide to form a solution, filtering the solution, adjusting pH of the solution to from about 5.5 to about 7.5, admixing sufficient molybdate-reagent to the solution to adjust the pH of the solution to about 1.5 and to form a silicon-molybdate complex, contacting the solution including the silicon-molybdate complex with a dextran-based material, washing the dextran-based material to remove residual contaminants such as sodium-22, separating the silicon-molybdate complex from the dextran-based material as another solution, adding sufficient hydrochloric acid and hydrogen peroxide to the solution to prevent reformation of the silicon-molybdate complex and to yield an oxidization state of the molybdate adapted for subsequent separation by an anion exchange material, contacting the solution with an anion exchange material whereby the molybdate is retained by the anion exchange material and the silicon remains in solution, and optionally adding sufficient alkali metal hydroxide to adjust the pH of the solution to about 12 to 13. Additionally, a high specific activity silicon-32 product having a high purity is provided.

  16. Production of high specific activity silicon-32

    DOEpatents

    Phillips, Dennis R.; Brzezinski, Mark A.

    1994-01-01

    A process for preparation of silicon-32 is provide and includes contacting an irradiated potassium chloride target, including spallation products from a prior irradiation, with sufficient water, hydrochloric acid or potassium hydroxide to form a solution, filtering the solution, adjusting pH of the solution to from about 5.5 to about 7.5, admixing sufficient molybdate-reagent to the solution to adjust the pH of the solution to about 1.5 and to form a silicon-molybdate complex, contacting the solution including the silicon-molybdate complex with a dextran-based material, washing the dextran-based material to remove residual contaminants such as sodium-22, separating the silicon-molybdate complex from the dextran-based material as another solution, adding sufficient hydrochloric acid and hydrogen peroxide to the solution to prevent reformation of the silicon-molybdate complex and to yield an oxidization state of the molybdate adapted for subsequent separation by an anion exchange material, contacting the solution with an anion exchange material whereby the molybdate is retained by the anion exchange material and the silicon remains in solution, and optionally adding sufficient alkali metal hydroxide to adjust the pH of the solution to about 12 to 13. Additionally, a high specific activity silicon-32 product having a high purity is provided.

  17. High specific activity silicon-32

    DOEpatents

    Phillips, D.R.; Brzezinski, M.A.

    1996-06-11

    A process for preparation of silicon-32 is provided and includes contacting an irradiated potassium chloride target, including spallation products from a prior irradiation, with sufficient water, hydrochloric acid or potassium hydroxide to form a solution, filtering the solution, adjusting pH of the solution from about 5.5 to about 7.5, admixing sufficient molybdate-reagent to the solution to adjust the pH of the solution to about 1.5 and to form a silicon-molybdate complex, contacting the solution including the silicon-molybdate complex with a dextran-based material, washing the dextran-based material to remove residual contaminants such as sodium-22, separating the silicon-molybdate complex from the dextran-based material as another solution, adding sufficient hydrochloric acid and hydrogen peroxide to the solution to prevent reformation of the silicon-molybdate complex and to yield an oxidation state of the molybdate adapted for subsequent separation by an anion exchange material, contacting the solution with an anion exchange material whereby the molybdate is retained by the anion exchange material and the silicon remains in solution, and optionally adding sufficient alkali metal hydroxide to adjust the pH of the solution to about 12 to 13. Additionally, a high specific activity silicon-32 product having a high purity is provided.

  18. Exome Sequencing in an Admixed Isolated Population Indicates NFXL1 Variants Confer a Risk for Specific Language Impairment

    PubMed Central

    Villanueva, Pía; Nudel, Ron; Hoischen, Alexander; Fernández, María Angélica; Simpson, Nuala H.; Gilissen, Christian; Reader, Rose H.; Jara, Lillian; Echeverry, Maria Magdalena; Francks, Clyde; Baird, Gillian; Conti-Ramsden, Gina; O’Hare, Anne; Bolton, Patrick F.; Hennessy, Elizabeth R.; Palomino, Hernán; Carvajal-Carmona, Luis; Veltman, Joris A.; Cazier, Jean-Baptiste; De Barbieri, Zulema

    2015-01-01

    Children affected by Specific Language Impairment (SLI) fail to acquire age appropriate language skills despite adequate intelligence and opportunity. SLI is highly heritable, but the understanding of underlying genetic mechanisms has proved challenging. In this study, we use molecular genetic techniques to investigate an admixed isolated founder population from the Robinson Crusoe Island (Chile), who are affected by a high incidence of SLI, increasing the power to discover contributory genetic factors. We utilize exome sequencing in selected individuals from this population to identify eight coding variants that are of putative significance. We then apply association analyses across the wider population to highlight a single rare coding variant (rs144169475, Minor Allele Frequency of 4.1% in admixed South American populations) in the NFXL1 gene that confers a nonsynonymous change (N150K) and is significantly associated with language impairment in the Robinson Crusoe population (p = 2.04 × 10–4, 8 variants tested). Subsequent sequencing of NFXL1 in 117 UK SLI cases identified four individuals with heterozygous variants predicted to be of functional consequence. We conclude that coding variants within NFXL1 confer an increased risk of SLI within a complex genetic model. PMID:25781923

  19. Exome sequencing in an admixed isolated population indicates NFXL1 variants confer a risk for specific language impairment.

    PubMed

    Villanueva, Pía; Nudel, Ron; Hoischen, Alexander; Fernández, María Angélica; Simpson, Nuala H; Gilissen, Christian; Reader, Rose H; Jara, Lillian; Echeverry, María Magdalena; Echeverry, Maria Magdalena; Francks, Clyde; Baird, Gillian; Conti-Ramsden, Gina; O'Hare, Anne; Bolton, Patrick F; Hennessy, Elizabeth R; Palomino, Hernán; Carvajal-Carmona, Luis; Veltman, Joris A; Cazier, Jean-Baptiste; De Barbieri, Zulema; Fisher, Simon E; Newbury, Dianne F

    2015-03-01

    Children affected by Specific Language Impairment (SLI) fail to acquire age appropriate language skills despite adequate intelligence and opportunity. SLI is highly heritable, but the understanding of underlying genetic mechanisms has proved challenging. In this study, we use molecular genetic techniques to investigate an admixed isolated founder population from the Robinson Crusoe Island (Chile), who are affected by a high incidence of SLI, increasing the power to discover contributory genetic factors. We utilize exome sequencing in selected individuals from this population to identify eight coding variants that are of putative significance. We then apply association analyses across the wider population to highlight a single rare coding variant (rs144169475, Minor Allele Frequency of 4.1% in admixed South American populations) in the NFXL1 gene that confers a nonsynonymous change (N150K) and is significantly associated with language impairment in the Robinson Crusoe population (p = 2.04 × 10-4, 8 variants tested). Subsequent sequencing of NFXL1 in 117 UK SLI cases identified four individuals with heterozygous variants predicted to be of functional consequence. We conclude that coding variants within NFXL1 confer an increased risk of SLI within a complex genetic model.

  20. Forensic performance of Investigator DIPplex indels genotyping kit in native, immigrant, and admixed populations in South Africa.

    PubMed

    Hefke, Gwynneth; Davison, Sean; D'Amato, Maria Eugenia

    2015-12-01

    The utilization of binary markers in human individual identification is gaining ground in forensic genetics. We analyzed the polymorphisms from the first commercial indel kit Investigator DIPplex (Qiagen) in 512 individuals from Afrikaner, Indian, admixed Cape Colored, and the native Bantu Xhosa and Zulu origin in South Africa and evaluated forensic and population genetics parameters for their forensic application in South Africa. The levels of genetic diversity in population and forensic parameters in South Africa are similar to other published data, with lower diversity values for the native Bantu. Departures from Hardy-Weinberg expectations were observed in HLD97 in Indians, Admixed and Bantus, along with 6.83% null homozygotes in the Bantu populations. Sequencing of the flanking regions showed a previously reported transition G>A in rs17245568. Strong population structure was detected with Fst, AMOVA, and the Bayesian unsupervised clustering method in STRUCTURE. Therefore we evaluated the efficiency of individual assignments to population groups using the ancestral membership proportions from STRUCTURE and the Bayesian classification algorithm in Snipper App Suite. Both methods showed low cross-assignment error (0-4%) between Bantus and either Afrikaners or Indians. The differentiation between populations seems to be driven by four loci under positive selection pressure. Based on these results, we draw recommendations for the application of this kit in SA.

  1. Some existence and sufficient conditions of optimality

    NASA Technical Reports Server (NTRS)

    Assefi, T.

    1976-01-01

    The role of the existence and sufficiency conditions in the field of optimal control was briefly described. The existence theorems are discussed for general nonlinear systems. However, the sufficiency conditions pertain to "nearly" linear systems with integral convex costs. Moreover, a brief discussion of linear systems with multiple-cost functions is presented.

  2. Hypoplastic model for simulation of compressibility characteristics of cement-admixed Bangkok soft clay at high water content

    NASA Astrophysics Data System (ADS)

    Chattonjai, Piyachat

    2016-06-01

    The developed hypoplastic model for simulation of compressibility characteristics of cement-admixed Bangkok soft clay at high water content was proposed in this paper. By using unique equation, the model is able to predict the relationship between void ratio and vertical effective stress of different water and cement content of soil cement. For practically convenient utilization and understanding, the parameters of Q1 which represented to initial cement bonding of soil (the initial value of structure tensor at time = 0) and C2 which effected to the model stiffness on isotropic consolidation direction, at 45° for loading and 225° for unloading of stress response envelope, were proposed as the function of cement and water content by comparing with dry weight of soil. By numerical integration that satisfied one-dimensional settlement, the simulation results were directly compared with fifteen experimental results to verify the accuracy of the proposed model.

  3. Several different lactase persistence associated alleles and high diversity of the lactase gene in the admixed Brazilian population.

    PubMed

    Friedrich, Deise C; Santos, Sidney E B; Ribeiro-dos-Santos, Ândrea K C; Hutz, Mara H

    2012-01-01

    Adult-type hypolactasia is a common phenotype caused by the lactase enzyme deficiency. The -13910 C>T polymorphism, located 14 Kb upstream of the lactase gene (LCT) in the MCM6 gene was associated with lactase persistence (LP) in Europeans. This polymorphism is rare in Africa but several other variants associated with lactase persistence were observed in Africans. The aims of this study were to identify polymorphisms in the MCM6 region associated with the lactase persistence phenotype and to determine the distribution of LCT gene haplotypes in 981 individuals from North, Northeast and South Brazil. These polymorphisms were genotyped by PCR based methods and sequencing. The -13779*C,-13910*T, -13937*A, -14010*C, -14011*T LP alleles previously described in the MCM6 gene region that acts as an enhancer for the LCT gene were identified in Brazilians. The most common LP allele was -13910*T. Its frequency was highly correlated with European ancestry in the Brazilian populations investigated. The -13910*T was higher (0.295) in southern Brazilians of European ancestry and lower (0.175) in the Northern admixed population. LCT haplotypes were derived from the 10 LCT SNPs genotyped. Overall twenty six haplotypes previously described were identified in the four Brazilian populations studied. The Multidimensional Scaling analysis showed that Belém, in the north, was closer to Amerindians. Northeastern and southern Afro-descendants were more related with Bantu-speaking South Africans whereas the Southern population with European ancestry grouped with Southern and Northern Europeans. This study shows a high variability considering the number of LCT haplotypes observed. Due to the highly admixed nature of the Brazilian populations, the diagnosis of hypolactasia in Brazil, based only in the investigation of the -13910*T allele is an oversimplification.

  4. Redundant causation from a sufficient cause perspective.

    PubMed

    Gatto, Nicolle M; Campbell, Ulka B

    2010-08-02

    Sufficient causes of disease are redundant when an individual acquires the components of two or more sufficient causes. In this circumstance, the individual still would have become diseased even if one of the sufficient causes had not been acquired. In the context of a study, when any individuals acquire components of more than one sufficient cause over the observation period, the etiologic effect of the exposure (defined as the absolute or relative difference between the proportion of the exposed who develop the disease by the end of the study period and the proportion of those individuals who would have developed the disease at the moment they did even in the absence of the exposure) may be underestimated. Even in the absence of confounding and bias, the observed effect estimate represents only a subset of the etiologic effect. This underestimation occurs regardless of the measure of effect used.To some extent, redundancy of sufficient causes is always present, and under some circumstances, it may make a true cause of disease appear to be not causal. This problem is particularly relevant when the researcher's goal is to characterize the universe of sufficient causes of the disease, identify risk factors for targeted interventions, or construct causal diagrams. In this paper, we use the sufficient component cause model and the disease response type framework to show how redundant causation arises and the factors that determine the extent of its impact on epidemiologic effect measures.

  5. Energy self-sufficiency for Hawaii

    SciTech Connect

    Shupe, J.W.

    1982-06-11

    Currently, Hawaii is almost totally dependent for energy on imported oil. The island state has a wide variety of renewable energy resources, however, and for the past decade has supported the development of these resources as substitutes for seaborne petroleum. Sufficient progress has been made to date in commercializing a number of these alternative energy sources to give cause for optimism that Hawaii will be able to achieve energy self-sufficiency with its indigenous renewable resources.

  6. Development of SNP markers identifying European wildcats, domestic cats, and their admixed progeny.

    PubMed

    Nussberger, B; Greminger, M P; Grossen, C; Keller, L F; Wandeler, P

    2013-05-01

    Introgression can be an important evolutionary force but it can also lead to species extinction and as such is a crucial issue for species conservation. However, introgression is difficult to detect, morphologically as well as genetically. Hybridization with domestic cats (Felis silvestris catus) is a major concern for the conservation of European wildcats (Felis s. silvestris). The available morphologic and genetic markers for the two Felis subspecies are not sufficient to reliably detect hybrids beyond first generation. Here we present a single nucleotide polymorphism (SNP) based approach that allows the identification of introgressed individuals. Using high-throughput sequencing of reduced representation libraries we developed a diagnostic marker set containing 48 SNPs (Fst > 0.8) which allows the identification of wildcats, domestic cats, their hybrids and backcrosses. This allows assessing introgression rate in natural wildcat populations and is key for a better understanding of hybridization processes.

  7. Exploring the applicability of analysing X chromosome STRs in Brazilian admixed population.

    PubMed

    Auler-Bittencourt, Eloisa; Iwamura, Edna Sadayo Miazato; Lima, Maria Jenny Mitraud; da Silva, Ismael Dale Cotrim Guerreiro; dos Santos, Sidney Emannuel Batista

    2015-09-01

    Kinship and parentage analyses always involve one sample being compared to another sample or a few samples with a specific relationship question in mind. In most cases, the analysis of autosomal STR markers is sufficient to determine the genetic kinship. However, when genetic profiles are reconstructed from supposed relatives, for whom the family configuration available for analysis is deficient, the examination may be inconclusive. This study reports practical examples of actual cases analysing the efficiency of the chromosome X STR (STR-ChrX) markers. Three cases with different degrees of efficiency and impact were selected as follows: the identification of two charred bodies in a traffic accident, in which the family setting available was not complete, and one filiation analysis resulting from rape. This is the first paper reporting the use of the multiplex STR 12 ChrX in actual cases using the software Familias 1.8 and Brazilian regional frequency data. Our study clarifies the complex analysis using this powerful tool for professionals in the forensic science community, for both civil and criminal justice. We also discuss state-of-the-art ChrX STR markers and its implications and applications for legal procedures. The data presented here should be used in other studies of complex cases to improve the progress of the current justice system.

  8. Evaluation of the imputation performance of the program IMPUTE in an admixed sample from Mexico City using several model designs

    PubMed Central

    2012-01-01

    Background We explored the imputation performance of the program IMPUTE in an admixed sample from Mexico City. The following issues were evaluated: (a) the impact of different reference panels (HapMap vs. 1000 Genomes) on imputation; (b) potential differences in imputation performance between single-step vs. two-step (phasing and imputation) approaches; (c) the effect of different INFO score thresholds on imputation performance and (d) imputation performance in common vs. rare markers. Methods The sample from Mexico City comprised 1,310 individuals genotyped with the Affymetrix 5.0 array. We randomly masked 5% of the markers directly genotyped on chromosome 12 (n = 1,046) and compared the imputed genotypes with the microarray genotype calls. Imputation was carried out with the program IMPUTE. The concordance rates between the imputed and observed genotypes were used as a measure of imputation accuracy and the proportion of non-missing genotypes as a measure of imputation efficacy. Results The single-step imputation approach produced slightly higher concordance rates than the two-step strategy (99.1% vs. 98.4% when using the HapMap phase II combined panel), but at the expense of a lower proportion of non-missing genotypes (85.5% vs. 90.1%). The 1,000 Genomes reference sample produced similar concordance rates to the HapMap phase II panel (98.4% for both datasets, using the two-step strategy). However, the 1000 Genomes reference sample increased substantially the proportion of non-missing genotypes (94.7% vs. 90.1%). Rare variants (<1%) had lower imputation accuracy and efficacy than common markers. Conclusions The program IMPUTE had an excellent imputation performance for common alleles in an admixed sample from Mexico City, which has primarily Native American (62%) and European (33%) contributions. Genotype concordances were higher than 98.4% using all the imputation strategies, in spite of the fact that no Native American samples are present in the HapMap and

  9. Autologous glioma cell vaccine admixed with interleukin-4 gene transfected fibroblasts in the treatment of patients with malignant gliomas

    PubMed Central

    Okada, Hideho; Lieberman, Frank S; Walter, Kevin A; Lunsford, L Dade; Kondziolka, Douglas S; Bejjani, Ghassan K; Hamilton, Ronald L; Torres-Trejo, Alejandro; Kalinski, Pawel; Cai, Quan; Mabold, Jennifer L; Edington, Howard D; Butterfield, Lisa H; Whiteside, Theresa L; Potter, Douglas M; Schold, S Clifford; Pollack, Ian F

    2007-01-01

    Background The prognosis for malignant gliomas remains dismal. We addressed the safety, feasibility and preliminary clinical activity of the vaccinations using autologous glioma cells and interleukin (IL)-4 gene transfected fibroblasts. Methods In University of Pittsburgh Cancer Institute (UPCI) protocol 95-033, adult participants with recurrent glioblastoma multiforme (GBM) or anaplastic astrocytoma (AA) received gross total resection (GTR) of the recurrent tumors, followed by two vaccinations with autologous fibroblasts retrovirally transfected with TFG-IL4-Neo-TK vector admixed with irradiated autologous glioma cells. In UPCI 99-111, adult participants with newly diagnosed GBM or AA, following GTR and radiation therapy, received two intradermal vaccinations with the TFG-IL4-Neo-TK-transfected fibroblasts admixed with type-1 dendritic cells (DC) loaded with autologous tumor lysate. The participants were evaluated for occurrence of adverse events, immune response, and clinical response by radiological imaging. Results and Discussion In UPCI 95-033, only 2 of 6 participants received the vaccinations. Four other participants were withdrawn from the trial because of tumor progression prior to production of the cellular vaccine. However, both participants who received two vaccinations demonstrated encouraging immunological and clinical responses. Biopsies from the local vaccine sites from one participant displayed IL-4 dose-dependent infiltration of CD4+ as well as CD8+ T cells. Interferon (IFN)-γ Enzyme-Linked Immuno-SPOT (ELISPOT) assay in another human leukocyte antigen (HLA)-A2+ participant demonstrated systemic T-cell responses against an HLA-A2-restricted glioma-associated antigen (GAA) epitope EphA2883–891. Moreover, both participants demonstrated clinical and radiological improvement with no evidence of allergic encephalitis, although both participants eventually succumbed with the tumor recurrence. In 99-111, 5 of 6 enrolled participants received scheduled

  10. ON A SUFFICIENT CONDITION FOR ABSOLUTE CONTINUITY.

    DTIC Science & Technology

    The formulation of a condition which yields absolute continuity when combined with continuity and bounded variation is the problem considered in the...Briefly, the formulation is achieved through a discussion which develops a proof by contradiction of a sufficiently theorem for absolute continuity which uses in its hypothesis the condition of continuity and bounded variation .

  11. Professional Development for Professionals: Beyond Sufficiency Learning

    ERIC Educational Resources Information Center

    Murphy, Gerald A.; Calway, Bruce A.

    2008-01-01

    We question the current role of professional associations in developing a culture of learning beyond a sufficiency or competency level. This brings into question the underlying philosophy of Professional Standards legislation. This legislation mandates continuing professional development for professionals without stating what should be achieved…

  12. Energy self-sufficiency for the UK

    SciTech Connect

    Cornell, M.; Belgrave, R.

    1985-01-01

    This book calls for more public debate about the criteria against which government and state industries take decisions on energy matters. It argues that there is a case for seeking to maintain levels of between 50% and 80% self sufficiency in energy.

  13. Self-sufficiency, free trade and safety.

    PubMed

    Rautonen, Jukka

    2010-01-01

    The relationship between free trade, self-sufficiency and safety of blood and blood components has been a perennial discussion topic in the blood service community. Traditionally, national self-sufficiency has been perceived as the ultimate goal that would also maximize safety. However, very few countries are, or can be, truly self-sufficient when self-sufficiency is understood correctly to encompass the whole value chain from the blood donor to the finished product. This is most striking when plasma derived medicines are considered. Free trade of blood products, or competition, as such can have a negative or positive effect on blood safety. Further, free trade of equipment and reagents and several plasma medicines is actually necessary to meet the domestic demand for blood and blood derivatives in most countries. Opposing free trade due to dogmatic reasons is not in the best interest of any country and will be especially harmful for the developing world. Competition between blood services in the USA has been present for decades. The more than threefold differences in blood product prices between European blood services indicate that competition is long overdue in Europe, too. This competition should be welcomed but carefully and proactively regulated to avoid putting safe and secure blood supply at risk.

  14. Tat peptide-admixed elastic liposomal formulation of hirsutenone for the treatment of atopic dermatitis in NC/Nga mice

    PubMed Central

    Kang, Myung Joo; Eum, Jae Yoon; Jeong, Mi Sook; Park, Sang Han; Moon, Ki Young; Kang, Mean Hyung; Kim, Min Soo; Choi, Sun Eun; Lee, Min Won; Lee, Do Ik; Bang, Hyoweon; Lee, Chung Soo; Joo, Seong Soo; Li, Kapsok; Lee, Mi-Kyung; Seo, Seong Jun; Choi, Young Wook

    2011-01-01

    Background The aim of the present study was to enhance a topical delivery of hirsutenone (HST), a naturally occuring immunomodulator, employing Tat peptide-admixed elastic liposomes (EL/T). Methods HST-loaded EL, consisting of phosphatidylcholine and Tween 80 (85:15 w/w%), were prepared using thin film hydration method. By adding Tat peptide to EL (0.16 w/w%), EL/T were formulated. The in vitro skin permeation of HST was examined using a Franz diffusion cell mounted with depilated mouse skin. Lesions for atopic dermatitis (AD) were induced by a topical application of diphenylcyclopropenone to NC/Nga mice. Therapeutic improvements of AD were evaluated by clinical skin severity scores. Immunological analyses on inducible nitric oxide synthase and cyclooxygenase-2 levels in the skin and interleukin (IL)-4, IL-13, immunoglobulin E, and eosinophil levels in the blood were also performed. Results EL systems were superior to conventional cream, revealing greater flux values in a permeation study. The addition of Tat peptide further increased the skin permeation of HST. In an efficacy study with AD-induced NC/Nga mice, an HST-containing EL/T formulation brought a significant improvement in both skin severity score and immune-related responses for the levels of nitric oxide synthase, cyclooxygenase-2, IL-4, IL-13, immunoglobulin E, and eosinophils. Conclusion A novel EL/T formulation was successfully developed for topical delivery of HST to treat AD. PMID:22072881

  15. Photoluminescence, white light emitting properties and related aspects of ZnO nanoparticles admixed with graphene and GaN

    NASA Astrophysics Data System (ADS)

    Kumar, Prashant; Panchakarla, L. S.; Venkataprasad Bhat, S.; Maitra, Urmimala; Subrahmanyam, K. S.; Rao, C. N. R.

    2010-09-01

    ZnO nanoparticles exhibit a broad band centred around 530 nm in the photoluminescence (PL) spectrum due to the presence of oxygen vacancies. Composites of ZnO nanoparticles with graphenes show marked changes in the PL spectrum with broad bands covering the entire visible region, making them candidates for solid state lighting, while graphene prepared by arc discharge of graphite in a hydrogen atmosphere (HG) containing 2-3 layers as well as boron-doped (BHG) and nitrogen-doped (NHG) samples of HG give white light when admixed with ZnO nanoparticles; excellent results are obtained with the addition of just 7 wt% of BHG to the ZnO nanoparticles. Mixtures of ZnO and GaN nanoparticles also exhibit white light emission. The quantum yields of these ZnO nanoparticle based white light sources are in the 4-6% range. Photoconductivity characteristics of ZnO nanoparticles are affected by the addition of even a small amount of graphene (<0.5 wt%).

  16. Amerindian (but not African or European) ancestry is significantly associated with diurnal preference within an admixed Brazilian population.

    PubMed

    Egan, Kieren J; Campos Santos, Hadassa; Beijamini, Felipe; Duarte, Núbia E; Horimoto, Andréa R V R; Taporoski, Tâmara P; Vallada, Homero; Negrão, André B; Krieger, José E; Pedrazzoli, Mário; Knutson, Kristen L; Pereira, Alexandre C; von Schantz, Malcolm

    2017-01-01

    Significant questions remain unanswered regarding the genetic versus environmental contributions to racial/ethnic differences in sleep and circadian rhythms. We addressed this question by investigating the association between diurnal preference, using the morningness-eveningness questionnaire (MEQ), and genetic ancestry within the Baependi Heart Study cohort, a highly admixed Brazilian population based in a rural town. Analysis was performed using measures of ancestry, using the Admixture program, and MEQ from 1,453 individuals. We found an association between the degree of Amerindian (but not European of African) ancestry and morningness, equating to 0.16 units for each additional percent of Amerindian ancestry, after adjustment for age, sex, education, and residential zone. To our knowledge, this is the first published report identifying an association between genetic ancestry and MEQ, and above all, the first one based on ancestral contributions within individuals living in the same community. This previously unknown ancestral dimension of diurnal preference suggests a stratification between racial/ethnic groups in an as yet unknown number of genetic polymorphisms.

  17. Prediction of permeability of cement-admixed soft clay using resistivity and time-domain IP measurements

    NASA Astrophysics Data System (ADS)

    Latt, Khin M. M.; Giao, P. H.

    2017-02-01

    Permeability is one of the most important petrophysical parameters, which unfortunately is quite difficult to be tested and estimated, particularly for the fine-grained soils and mixed soils. Prediction of permeability based on geophysical measurements is currently one of the most challenging issues in petrophysics. There have been recently reported some empirical relationships between permeability, resistivity and spectral induced polarization (SIP) parameters for a porous medium. However, the disadvantage of this approach is the very scarcity of SIP data as most of practical measurements are time-domain IP. In this study, a detailed overview of permeability prediction models using resistivity and spectral IP data was made. More than that, an innovative approach using resistivity and time-domain IP measurements to predict permeability of cement-admixed Bangkok clay was proposed and successfully applied for tested samples based on measurements of resistivity and time-domain IP data. A good amount of geotechnical and geophysical tests was conducted to investigate the time-dependent development of strength, porosity, and permeability of cement-mixed Bangkok soft clay samples during a 28-day curing process. The permeability predicted by resistivity and chargeability model matched well with permeability measured by consolidation testing. In addition, a series of correlations between unconfined compressive strength, porosity and permeability as measured by geotechnical testing and resistivity and chargeability as measured by geophysical testing were found.

  18. HLA Class I and Class II Conserved Extended Haplotypes and Their Fragments or Blocks in Mexicans: Implications for the Study of Genetic Diversity in Admixed Populations

    PubMed Central

    Ohashi, Marina; Lebedeva, Tatiana; Acuña-Alonzo, Víctor; Yunis, María; Granados-Montiel, Julio; Cruz-Lagunas, Alfredo; Vargas-Alarcón, Gilberto; Rodríguez-Reyna, Tatiana S.; Fernandez-Viña, Marcelo; Granados, Julio; Yunis, Edmond J.

    2013-01-01

    Major histocompatibility complex (MHC) genes are highly polymorphic and informative in disease association, transplantation, and population genetics studies with particular importance in the understanding of human population diversity and evolution. The aim of this study was to describe the HLA diversity in Mexican admixed individuals. We studied the polymorphism of MHC class I (HLA-A, -B, -C), and class II (HLA-DRB1, -DQB1) genes using high-resolution sequence based typing (SBT) method and we structured the blocks and conserved extended haplotypes (CEHs) in 234 non-related admixed Mexican individuals (468 haplotypes) by a maximum likelihood method. We found that HLA blocks and CEHs are primarily from Amerindian and Caucasian origin, with smaller participation of African and recent Asian ancestry, demonstrating a great diversity of HLA blocks and CEHs in Mexicans from the central area of Mexico. We also analyzed the degree of admixture in this group using short tandem repeats (STRs) and HLA-B that correlated with the frequency of most probable ancestral HLA-C/−B and -DRB1/−DQB1 blocks and CEHs. Our results contribute to the analysis of the diversity and ancestral contribution of HLA class I and HLA class II alleles and haplotypes of Mexican admixed individuals from Mexico City. This work will help as a reference to improve future studies in Mexicans regarding allotransplantation, immune responses and disease associations. PMID:24086347

  19. Socioeconomic and Nutritional Factors Account for the Association of Gastric Cancer with Amerindian Ancestry in a Latin American Admixed Population

    PubMed Central

    Pereira, Latife; Zamudio, Roxana; Soares-Souza, Giordano; Herrera, Phabiola; Cabrera, Lilia; Hooper, Catherine C.; Cok, Jaime; Combe, Juan M.; Vargas, Gloria; Prado, William A.; Schneider, Silvana; Kehdy, Fernanda; Rodrigues, Maira R.; Chanock, Stephen J.; Berg, Douglas E.; Gilman, Robert H.; Tarazona-Santos, Eduardo

    2012-01-01

    Gastric cancer is one of the most lethal types of cancer and its incidence varies worldwide, with the Andean region of South America showing high incidence rates. We evaluated the genetic structure of the population from Lima (Peru) and performed a case-control genetic association study to test the contribution of African, European, or Native American ancestry to risk for gastric cancer, controlling for the effect of non-genetic factors. A wide set of socioeconomic, dietary, and clinic information was collected for each participant in the study and ancestry was estimated based on 103 ancestry informative markers. Although the urban population from Lima is usually considered as mestizo (i.e., admixed from Africans, Europeans, and Native Americans), we observed a high fraction of Native American ancestry (78.4% for the cases and 74.6% for the controls) and a very low African ancestry (<5%). We determined that higher Native American individual ancestry is associated with gastric cancer, but socioeconomic factors associated both with gastric cancer and Native American ethnicity account for this association. Therefore, the high incidence of gastric cancer in Peru does not seem to be related to susceptibility alleles common in this population. Instead, our result suggests a predominant role for ethnic-associated socioeconomic factors and disparities in access to health services. Since Native Americans are a neglected group in genomic studies, we suggest that the population from Lima and other large cities from Western South America with high Native American ancestry background may be convenient targets for epidemiological studies focused on this ethnic group. PMID:22870209

  20. HLA-DRB1*14 is a protective allele for multiple sclerosis in an admixed Colombian population

    PubMed Central

    Cuellar-Giraldo, David; Díaz-Cruz, Camilo; Burbano, Lisseth-Estefania; Guío, Claudia-Marcela; Reyes, Saúl; Cortes, Fabián; Cárdenas-Robledo, Simón; Narváez, Diana M.; Cárdenas, Wilmer; Porras, Alexandra; Lattig, María-Claudia; Groot de Restrepo, Helena

    2015-01-01

    Objective: The aim of this study was to determine ancestry informative markers, mitochondrial DNA haplogroups, and the association between HLA-DRB1 alleles and multiple sclerosis (MS) in a group of patients from Bogotá, Colombia. Methods: In this case-control study, genomic DNA was isolated and purified from blood samples. HLA-DRB1 allele genotyping was done using PCR. Mitochondrial hypervariable region 1 was amplified and haplogroups were determined using HaploGrep software. Genomic ancestry was estimated by genotyping a panel of ancestry informative markers. To test the association of HLA polymorphisms and MS, we ran separate multivariate logistic regression models. Bonferroni correction was used to account for multiple regression tests. Results: A total of 100 patients with MS (mean age 40.4 ± 12 years; 70% females) and 200 healthy controls (mean age 37.6 ± 11 years; 83.5% females) were included in the analysis. Ancestry proportions and haplogroup frequencies did not differ between patients and controls. HLA-DRB1*15 was present in 31% of cases and 13.5% of controls, whereas HLA-DRB1*14 was present in 5% of cases and 15.5% of controls. In the multivariate model, HLA-DRB1*15 was significantly associated with MS (odds ratio [OR] = 3.05, p < 0.001), whereas HLA-DRB1*14 was confirmed as a protective factor in our population (OR = 0.16, p = 0.001). Conclusions: This study provides evidence indicating that HLA-DRB1*15 allele confers susceptibility to MS and HLA-DRB1*14 allele exerts resistance to MS in a highly admixed population. This latter finding could partially explain the low prevalence of MS in Bogotá, Colombia. PMID:26740965

  1. Socioeconomic and nutritional factors account for the association of gastric cancer with Amerindian ancestry in a Latin American admixed population.

    PubMed

    Pereira, Latife; Zamudio, Roxana; Soares-Souza, Giordano; Herrera, Phabiola; Cabrera, Lilia; Hooper, Catherine C; Cok, Jaime; Combe, Juan M; Vargas, Gloria; Prado, William A; Schneider, Silvana; Kehdy, Fernanda; Rodrigues, Maira R; Chanock, Stephen J; Berg, Douglas E; Gilman, Robert H; Tarazona-Santos, Eduardo

    2012-01-01

    Gastric cancer is one of the most lethal types of cancer and its incidence varies worldwide, with the Andean region of South America showing high incidence rates. We evaluated the genetic structure of the population from Lima (Peru) and performed a case-control genetic association study to test the contribution of African, European, or Native American ancestry to risk for gastric cancer, controlling for the effect of non-genetic factors. A wide set of socioeconomic, dietary, and clinic information was collected for each participant in the study and ancestry was estimated based on 103 ancestry informative markers. Although the urban population from Lima is usually considered as mestizo (i.e., admixed from Africans, Europeans, and Native Americans), we observed a high fraction of Native American ancestry (78.4% for the cases and 74.6% for the controls) and a very low African ancestry (<5%). We determined that higher Native American individual ancestry is associated with gastric cancer, but socioeconomic factors associated both with gastric cancer and Native American ethnicity account for this association. Therefore, the high incidence of gastric cancer in Peru does not seem to be related to susceptibility alleles common in this population. Instead, our result suggests a predominant role for ethnic-associated socioeconomic factors and disparities in access to health services. Since Native Americans are a neglected group in genomic studies, we suggest that the population from Lima and other large cities from Western South America with high Native American ancestry background may be convenient targets for epidemiological studies focused on this ethnic group.

  2. OSBPL10, RXRA and lipid metabolism confer African-ancestry protection against dengue haemorrhagic fever in admixed Cubans

    PubMed Central

    Soares, Pedro; Garcia, Gissel; Perez, Ana B.; Aguirre, Eglys; Cavadas, Bruno; Regnault, Béatrice; Alvarez, Mayling; Ruiz, Didye; Guzman, Maria G.

    2017-01-01

    Ethnic groups can display differential genetic susceptibility to infectious diseases. The arthropod-born viral dengue disease is one such disease, with empirical and limited genetic evidence showing that African ancestry may be protective against the haemorrhagic phenotype. Global ancestry analysis based on high-throughput genotyping in admixed populations can be used to test this hypothesis, while admixture mapping can map candidate protective genes. A Cuban dengue fever cohort was genotyped using a 2.5 million SNP chip. Global ancestry was ascertained through ADMIXTURE and used in a fine-matched corrected association study, while local ancestry was inferred by the RFMix algorithm. The expression of candidate genes was evaluated by RT-PCR in a Cuban dengue patient cohort and gene set enrichment analysis was performed in a Thai dengue transcriptome. OSBPL10 and RXRA candidate genes were identified, with most significant SNPs placed in inferred weak enhancers, promoters and lncRNAs. OSBPL10 had significantly lower expression in Africans than Europeans, while for RXRA several SNPs may differentially regulate its transcription between Africans and Europeans. Their expression was confirmed to change through dengue disease progression in Cuban patients and to vary with disease severity in a Thai transcriptome dataset. These genes interact in the LXR/RXR activation pathway that integrates lipid metabolism and immune functions, being a key player in dengue virus entrance into cells, its replication therein and in cytokine production. Knockdown of OSBPL10 expression in THP-1 cells by two shRNAs followed by DENV2 infection tests led to a significant reduction in DENV replication, being a direct functional proof that the lower OSBPL10 expression profile in Africans protects this ancestry against dengue disease. PMID:28241052

  3. Study of Dark-matter Admixed Neutron Stars Using the Equation of State from the Rotational Curves of Galaxies

    NASA Astrophysics Data System (ADS)

    Rezaei, Z.

    2017-01-01

    In this work, we employ the dark matter equations of state (DMEOSs) obtained from the rotational curves of galaxies as well as the fermionic DMEOS with m=1.0 {GeV} to study the structure of dark-matter admixed neutron stars (DMANSs). Applying the equation of state in the Skyrme framework for the neutron matter (NM), we calculate the mass–radius relation for different DMANSs with various DMEOSs and central pressure of dark matter (DM) to NM ratios. Our results show that for some DMEOSs, the mass–radius relations are in agreement with new observations, e.g., EXO 1745-248, 4U 1608-52, and 4U 1820-30, which are inconsistent with normal neutron stars. We conclude that both DMEOSs and central pressure ratios of DM to NM affect the slope of the mass–radius relation of DMANSs. This is because of the interaction between DM and NM, which leads to gravitationally or self-bound DMANSs. We study the radius of the NM sphere as well as the radius of the DM halo for different DMANSs. The results confirm that, in some cases, a NM sphere with a small radius is surrounded by a halo of DM with a larger radius. Our calculations verify that, due to the different degrees of DM domination in DMANSs, with a value of the visible radius of a star two possible DMANSs with different masses can exist. The gravitational redshift is also calculated for DMANSs with different DMEOSs and central pressure ratios. The results explain that the existence of DM in a DMANS leads to higher values of gravitational redshift of the star.

  4. Studies on the de/re-hydrogenation characteristics of nanocrystalline MgH2 admixed with carbon nanofibres

    NASA Astrophysics Data System (ADS)

    Shahi, Rohit R.; Raghubanshi, Himanshu; Shaz, M. A.; Srivastava, O. N.

    2012-09-01

    In the present investigation, we have synthesized different morphologies of carbon nanofibres (CNFs) to investigate their catalytic effect on the hydrogenation characteristics of 25 h ball-milled MgH2 (nano MgH2). The TEM analysis reveals that 25 h of ball-milling leads to the formation of nanocrystalline particles with size ranging between 10 and 20 nm. Different morphologies of CNFs were synthesized by catalytic thermal decomposition of acetylene (C2H2) gas over LaNi5 alloy. Helical carbon nanofibers (HCNFs) were formed at a temperature 650 °C. By increasing the synthesis temperature to 750 °C, planar carbon nanofibres were formed. In order to explore the effectiveness of CNFs towards lowering the decomposition temperature, TPD experiments (at heating rate 5 °C/min) were performed for nano MgH2 with and without CNFs. It was found that the decomposition temperature is reduced to ~334 and ~300 °C from 367 °C for the PCNF and HCNF catalysed nano MgH2. It is also found that HCNF admixed nano MgH2 absorbs ~5.25 wt% within 10 min as compared with pristine nano MgH2, which absorbs only ~4.2 % within the same time and same condition of temperature and pressure. Thus the HCNF possesses better catalytic activity than PCNF. These different levels of improvement in hydrogenation properties of HCNF catalysed nano MgH2 is attributed to the morphology of the CNFs.

  5. Sufficient trial size to inform clinical practice

    PubMed Central

    Manski, Charles F.; Tetenov, Aleksey

    2016-01-01

    Medical research has evolved conventions for choosing sample size in randomized clinical trials that rest on the theory of hypothesis testing. Bayesian statisticians have argued that trials should be designed to maximize subjective expected utility in settings of clinical interest. This perspective is compelling given a credible prior distribution on treatment response, but there is rarely consensus on what the subjective prior beliefs should be. We use Wald’s frequentist statistical decision theory to study design of trials under ambiguity. We show that ε-optimal rules exist when trials have large enough sample size. An ε-optimal rule has expected welfare within ε of the welfare of the best treatment in every state of nature. Equivalently, it has maximum regret no larger than ε. We consider trials that draw predetermined numbers of subjects at random within groups stratified by covariates and treatments. We report exact results for the special case of two treatments and binary outcomes. We give simple sufficient conditions on sample sizes that ensure existence of ε-optimal treatment rules when there are multiple treatments and outcomes are bounded. These conditions are obtained by application of Hoeffding large deviations inequalities to evaluate the performance of empirical success rules. PMID:27601679

  6. Sufficient symmetry conditions for Topological Quantum Order.

    PubMed

    Nussinov, Zohar; Ortiz, Gerardo

    2009-10-06

    We prove sufficient conditions for Topological Quantum Order at zero and finite temperatures. The crux of the proof hinges on the existence of low-dimensional Gauge-Like Symmetries, thus providing a unifying framework based on a symmetry principle. These symmetries may be actual invariances of the system, or may emerge in the low-energy sector. Prominent examples of Topological Quantum Order display Gauge-Like Symmetries. New systems exhibiting such symmetries include Hamiltonians depicting orbital-dependent spin exchange and Jahn-Teller effects in transition metal orbital compounds, short-range frustrated Klein spin models, and p+ip superconducting arrays. We analyze the physical consequences of Gauge-Like Symmetries (including topological terms and charges) and show the insufficiency of the energy spectrum, topological entanglement entropy, maximal string correlators, and fractionalization in establishing Topological Quantum Order. General symmetry considerations illustrate that not withstanding spectral gaps, thermal fluctuations may impose restrictions on suggested quantum computing schemes. Our results allow us to go beyond standard topological field theories and engineer systems with Topological Quantum Order.

  7. Energy Strategic Planning & Self-Sufficiency Project

    SciTech Connect

    Greg Retzlaff

    2005-03-30

    This report provides information regarding options available, their advantages and disadvantages, and the costs for pursuing activities to advance Smith River Rancheria toward an energy program that reduces their energy costs, allows greater self-sufficiency and stimulates economic development and employment opportunities within and around the reservation. The primary subjects addressed in this report are as follow: (1) Baseline Assessment of Current Energy Costs--An evaluation of the historical energy costs for Smith River was conducted to identify the costs for each component of their energy supply to better assess changes that can be considered for energy cost reductions. (2) Research Viable Energy Options--This includes a general description of many power generation technologies and identification of their relative costs, advantages and disadvantages. Through this research the generation technology options that are most suited for this application were identified. (3) Project Development Considerations--The basic steps and associated challenges of developing a generation project utilizing the selected technologies are identified and discussed. This included items like selling to third parties, wheeling, electrical interconnections, fuel supply, permitting, standby power, and transmission studies. (4) Energy Conservation--The myriad of federal, state and utility programs offered for low-income weatherization and utility bill payment assistance are identified, their qualification requirements discussed, and the subsequent benefits outlined. (5) Establishing an Energy Organization--The report includes a high level discussion of formation of a utility to serve the Tribal membership. The value or advantages of such action is discussed along with some of the challenges. (6) Training--Training opportunities available to the Tribal membership are identified.

  8. "Sufficient health" as perceived by Thai villagers: A qualitative study.

    PubMed

    Arpanantikul, Manee; Phuphaibul, Rutja; Khuwatsumrit, Kusuma

    2017-01-05

    Globalization has led to the rapid modernization of Thai villagers' traditional lifestyle, with significant consequential changes in health. The integration of the sufficiency economy philosophy with health - a concept known as "sufficient health" - can improve health and wellbeing; however, little is known of the actual meaning of "sufficient health." This qualitative study explored the meaning of sufficient health as perceived by Thai villagers. Data were collected from 122 villagers living in a rural Thai community and analyzed using content analysis. The findings revealed five themes reflecting the meaning of sufficient health: being healthy and not having an illness, having regular health check-ups, performing self-care, living sufficiently, and avoiding risks. Understanding the meaning attributed to sufficient health can help nurses provide appropriate health care for villagers while retaining concern and respect for their cultural backgrounds. Importantly, providing opportunities to villagers to participate in health activities could help them recognize and sustain sufficient health.

  9. Recovery of Native Genetic Background in Admixed Populations Using Haplotypes, Phenotypes, and Pedigree Information – Using Cika Cattle as a Case Breed

    PubMed Central

    Simčič, Mojca; Smetko, Anamarija; Sölkner, Johann; Seichter, Doris; Gorjanc, Gregor; Kompan, Dragomir; Medugorac, Ivica

    2015-01-01

    The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP) Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which potentially have had

  10. Molecular analysis of the GYPB gene to infer S, s, and U phenotypes in an admixed population of Minas Gerais, Brazil

    PubMed Central

    Faria, Marina Alves; Martins, Marina Lobato; Schmidt, Luciana Cayres; Malta, Maria Clara Fernandes da Silva

    2012-01-01

    Objective To implement genotyping for S, s and U antigens of the MNS blood group system at the Fundação Hemominas and to evaluate the occurrence of GYPB gene polymorphisms associated with the U- and U+var phenotypes and deletion of the GYPB gene for the first time in an admixed population of Minas Gerais, Brazil. The S, s and U antigens can cause transfusion reactions and perinatal hemolytic disease. Genotyping is a useful tool in immunohematology, especially when phenotyping cannot be performed. Methods Ninety-six samples from blood donors and patients with sickle cell disease previously phenotyped for the S, s and U antigens were selected. Allele-specific primer polymerase chain reaction (ASP-PCR) and polymerase chain reaction -restriction fragment length polymorphism (PCR-RFLP) assays were employed to identify the GYPB*S and GYPB*s alleles and the GYPB(P2) and GYPB(NY) variants, as well as deletion of the GYPB gene. Results The results of allele-specific genotyping (GYPB*S and GYPB*s) were totally in agreement with the phenotyping of S+ (n = 56), s+ (n = 60) and s- (n = 35) samples. However, the GYPB*S allele, in association with the GYPB(P2) variant, was detected in 17.5% of the S- samples (n = 40), which shows the importance of assessing this variant in the Brazilian population. Of the S-s- samples (n = 10), 60% had the deletion of the GYPB gene and 40% were homozygous or hemizygous for the GYPB(P2) variant. Conclusion Genotyping was an effective strategy to infer the S, s, and U phenotypes in the admixed population from Minas Gerais (Brazil) and may contribute to transfusion safety. PMID:23049422

  11. Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa.

    PubMed

    Du Plessis, Morne; Pearce, Brendon; Jacobs, Clifford; Hoosain, Nisreen; Benjeddou, Mongi

    2015-03-01

    Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

  12. Recovery of native genetic background in admixed populations using haplotypes, phenotypes, and pedigree information--using Cika cattle as a case breed.

    PubMed

    Simčič, Mojca; Smetko, Anamarija; Sölkner, Johann; Seichter, Doris; Gorjanc, Gregor; Kompan, Dragomir; Medugorac, Ivica

    2015-01-01

    The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP) Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which potentially have had

  13. Improving the Perception of Self-Sufficiency towards Creative Drama

    ERIC Educational Resources Information Center

    Pekdogan, Serpil; Korkmaz, Halil Ibrahim

    2016-01-01

    The purpose of this study is to investigate the effects of a Creative Drama Based Perception of Self-sufficiency Skills Training Program on 2nd grade bachelor degree students' (who are attending a preschool teacher training program) perception of self-sufficiency. This is a quasi-experimental study. Totally 50 students were equally divided into…

  14. 27 CFR 25.174 - Bond not sufficient.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Bond not sufficient. 25.174 Section 25.174 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL BEER Tax on Beer Prepayment of Tax § 25.174 Bond not sufficient. When...

  15. 27 CFR 25.174 - Bond not sufficient.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Bond not sufficient. 25.174 Section 25.174 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.174 Bond not sufficient. When...

  16. 27 CFR 25.174 - Bond not sufficient.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Bond not sufficient. 25.174 Section 25.174 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL BEER Tax on Beer Prepayment of Tax § 25.174 Bond not sufficient. When...

  17. 27 CFR 25.174 - Bond not sufficient.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Bond not sufficient. 25.174 Section 25.174 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.174 Bond not sufficient. When...

  18. 27 CFR 25.174 - Bond not sufficient.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bond not sufficient. 25.174 Section 25.174 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.174 Bond not sufficient. When...

  19. Treatment surfaces with atomic oxygen excited in dielectric barrier discharge plasma of O{sub 2} admixed to N{sub 2}

    SciTech Connect

    Shun'ko, E. V.; Belkin, V. S.

    2012-06-15

    This paper describes the increase in surface energy of substrates by their treatment with gas composition generated in plasmas of DBD (Dielectric Barrier Discharge) in O2 admixed with N2. Operating gas dissociation and excitation was occurred in plasmas developed in two types of reactors of capacitively-coupled dielectric barrier configurations: coaxial cylindrical, and flat rectangular. The coaxial cylindrical type comprised an inner cylindrical electrode encapsulated in a ceramic sheath installed coaxially inside a cylindrical ceramic (quartz) tube passing through an annular outer electrode. Components of the flat rectangular type were a flat ceramic tube of a narrow rectangular cross section supplied with two flat electrodes mounted against one another outside of the long parallel walls of this tube. The operating gas, mixture of N{sub 2} and O{sub 2}, was flowing in a completely insulated discharge gap formed between insulated electrodes of the devices with an average velocity of gas inlet of about 7 to 9 m/s. Dielectric barrier discharge plasma was excited in the operating gaps with a bipolar pulse voltage of about 6 kV for 2 ms at 50 kHz repetition rate applied to the electrodes of the coaxial device, and of about 14 kV for 7 ms at 30 kHz repetition rate for the flat linear device. A lifetime of excited to the 2s{sup 2}2p{sup 4}({sup 1}S{sub 0}) state in DBD plasma and streaming to the surfaces with a gas flow atomic oxygen, responsible presumably for treating surfaces, exceeded 10 ms in certain cases, that simplified its separation from DBD plasma and delivery to substrates. As it was found in particular, surfaces of glass and some of polymers revealed significant enhancement in wettability after treatment.

  20. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population.

    PubMed

    Pappas, Derek James; Gourraud, Pierre-Antoine; Le Gall, Caroline; Laurent, Julie; Trounson, Alan; DeWitt, Natalie; Talib, Sohel

    2015-05-01

    The development of a California-based induced pluripotent stem cell (iPSC) bank based on human leukocyte antigen (HLA) haplotype matching represents a significant challenge and a valuable opportunity for the advancement of regenerative medicine. However, previously published models of iPSC banks have neither addressed the admixed nature of populations like that of California nor evaluated the benefit to the population as a whole. We developed a new model for evaluating an iPSC haplobank based on demographic and immunogenetic characteristics reflecting California. The model evaluates haplolines or cell lines from donors homozygous for a single HLA-A, HLA-B, HLA-DRB1 haplotype. We generated estimates of the percentage of the population matched under various combinations of haplolines derived from six ancestries (black/African American, American Indian, Asian/Pacific Islander, Hispanic, and white/not Hispanic) and data available from the U.S. Census Bureau, the California Institute for Regenerative Medicine, and the National Marrow Donor Program. The model included both cis (haplotype-level) and trans (genotype-level) matching between a modeled iPSC haplobank and the recipient population following resampling simulations. We showed that serving a majority (>50%) of a simulated California population through cis matching would require the creation, redundant storage, and maintenance of almost 207 different haplolines representing the top 60 most frequent haplotypes from each ancestry group. Allowances for trans matching reduced the haplobank to fewer than 141 haplolines found among the top 40 most frequent haplotypes. Finally, we showed that a model optimized, custom haplobank was able to serve a majority of the California population with fewer than 80 haplolines.

  1. Genetic variants in interleukin genes are associated with breast cancer risk and survival in a genetically admixed population: the Breast Cancer Health Disparities Study

    PubMed Central

    Slattery, Martha L.; Herrick, Jennifer S.; Torres-Mejia, Gabriella; John, Esther M.; Giuliano, Anna R.; Hines, Lisa M.; Stern, Mariana C.; Baumgartner, Kathy B.; Presson, Angela P.; Wolff, Roger K.

    2014-01-01

    Interleukins (ILs) are key regulators of immune response. Genetic variation in IL genes may influence breast cancer risk and mortality given their role in cell growth, angiogenesis and regulation of inflammatory process. We examined 16 IL genes with breast cancer risk and mortality in an admixed population of Hispanic/Native American (NA) (2111 cases and 2597 controls) and non-Hispanic white (NHW) (1481 cases and 1585 controls) women. Adaptive Rank Truncated Product (ARTP) analysis was conducted to determine gene significance and lasso (least absolute shrinkage and selection operator) was used to identify potential gene by gene and gene by lifestyle interactions. The pathway was statistically significant for breast cancer risk overall (P ARTP = 0.0006), for women with low NA ancestry (P ARTP = 0.01), for premenopausal women (P ARTP = 0.02), for estrogen receptor (ER)+/progesterone receptor (PR)+ tumors (P ARTP = 0.03) and ER−/PR− tumors (P ARTP = 0.02). Eight of the 16 genes evaluated were associated with breast cancer risk (IL1A, IL1B, IL1RN, IL2, IL2RA, IL4, IL6 and IL10); four genes were associated with breast cancer risk among women with low NA ancestry (IL1B, IL6, IL6R and IL10), two were associated with breast cancer risk among women with high NA ancestry (IL2 and IL2RA) and four genes were associated with premenopausal breast cancer risk (IL1A, IL1B, IL2 and IL3). IL4, IL6R, IL8 and IL17A were associated with breast cancer-specific mortality. We confirmed associations with several functional polymorphisms previously associated with breast cancer risk and provide support that their combined effect influences the carcinogenic process. PMID:24670917

  2. Genetic variants in interleukin genes are associated with breast cancer risk and survival in a genetically admixed population: the Breast Cancer Health Disparities Study.

    PubMed

    Slattery, Martha L; Herrick, Jennifer S; Torres-Mejia, Gabriella; John, Esther M; Giuliano, Anna R; Hines, Lisa M; Stern, Mariana C; Baumgartner, Kathy B; Presson, Angela P; Wolff, Roger K

    2014-08-01

    Interleukins (ILs) are key regulators of immune response. Genetic variation in IL genes may influence breast cancer risk and mortality given their role in cell growth, angiogenesis and regulation of inflammatory process. We examined 16 IL genes with breast cancer risk and mortality in an admixed population of Hispanic/Native American (NA) (2111 cases and 2597 controls) and non-Hispanic white (NHW) (1481 cases and 1585 controls) women. Adaptive Rank Truncated Product (ARTP) analysis was conducted to determine gene significance and lasso (least absolute shrinkage and selection operator) was used to identify potential gene by gene and gene by lifestyle interactions. The pathway was statistically significant for breast cancer risk overall (P ARTP = 0.0006), for women with low NA ancestry (P(ARTP) = 0.01), for premenopausal women (P(ARTP) = 0.02), for estrogen receptor (ER)+/progesterone receptor (PR)+ tumors (P(ARTP) = 0.03) and ER-/PR- tumors (P(ARTP) = 0.02). Eight of the 16 genes evaluated were associated with breast cancer risk (IL1A, IL1B, IL1RN, IL2, IL2RA, IL4, IL6 and IL10); four genes were associated with breast cancer risk among women with low NA ancestry (IL1B, IL6, IL6R and IL10), two were associated with breast cancer risk among women with high NA ancestry (IL2 and IL2RA) and four genes were associated with premenopausal breast cancer risk (IL1A, IL1B, IL2 and IL3). IL4, IL6R, IL8 and IL17A were associated with breast cancer-specific mortality. We confirmed associations with several functional polymorphisms previously associated with breast cancer risk and provide support that their combined effect influences the carcinogenic process.

  3. Quantification is Neither Necessary Nor Sufficient for Measurement

    NASA Astrophysics Data System (ADS)

    Mari, Luca; Maul, Andrew; Torres Irribarra, David; Wilson, Mark

    2013-09-01

    Being an infrastructural, widespread activity, measurement is laden with stereotypes. Some of these concern the role of measurement in the relation between quality and quantity. In particular, it is sometimes argued or assumed that quantification is necessary for measurement; it is also sometimes argued or assumed that quantification is sufficient for or synonymous with measurement. To assess the validity of these positions the concepts of measurement and quantitative evaluation should be independently defined and their relationship analyzed. We contend that the defining characteristic of measurement should be the structure of the process, not a feature of its results. Under this perspective, quantitative evaluation is neither sufficient nor necessary for measurement.

  4. Test-Taking Strategies and the Self-Sufficient Learner.

    ERIC Educational Resources Information Center

    Annis, Linda Ferrill

    This paper outlines recommended test-taking strategies for the self-sufficient learner based on research in cognitive psychology. The theoretical model used is the information-processing approach involving the three essential steps of paying attention, encoding, and framing associative linkages for the new material. Preparing for examinations is…

  5. Online Learning in Higher Education: Necessary and Sufficient Conditions

    ERIC Educational Resources Information Center

    Lim, Cher Ping

    2005-01-01

    The spectacular development of information and communication technologies through the Internet has provided opportunities for students to explore the virtual world of information. In this article, the author discusses the necessary and sufficient conditions for successful online learning in educational institutions. The necessary conditions…

  6. Increasing urban water self-sufficiency: new era, new challenges.

    PubMed

    Rygaard, Martin; Binning, Philip J; Albrechtsen, Hans-Jørgen

    2011-01-01

    Urban water supplies are traditionally based on limited freshwater resources located outside the cities. However, a range of concepts and techniques to exploit alternative water resources has gained ground as water demands begin to exceed the freshwater available to cities. Based on 113 cases and 15 in-depth case studies, solutions used to increase water self-sufficiency in urban areas are analyzed. The main drivers for increased self-sufficiency were identified to be direct and indirect lack of water, constrained infrastructure, high quality water demands and commercial and institutional pressures. Case studies demonstrate increases in self-sufficiency ratios to as much as 80% with contributions from recycled water, seawater desalination and rainwater collection. The introduction of alternative water resources raises several challenges: energy requirements vary by more than a factor of ten amongst the alternative techniques, wastewater reclamation can lead to the appearance of trace contaminants in drinking water, and changes to the drinking water system can meet tough resistance from the public. Public water-supply managers aim to achieve a high level of reliability and stability. We conclude that despite the challenges, self-sufficiency concepts in combination with conventional water resources are already helping to reach this goal.

  7. Necessary and sufficient elastic stability conditions in various crystal systems

    NASA Astrophysics Data System (ADS)

    Mouhat, Félix; Coudert, François-Xavier

    2014-12-01

    While the Born elastic stability criteria are well known for cubic crystals, there is some confusion in the literature about the form they should take for lower-symmetry crystal classes. Here we present closed form necessary and sufficient conditions for elastic stability in all crystal classes, as a concise and pedagogical reference to stability criteria in noncubic materials.

  8. Leadership, the Logic of Sufficiency and the Sustainability of Education

    ERIC Educational Resources Information Center

    Bottery, Mike

    2012-01-01

    The notion of sufficiency has not yet entered mainstream educational thinking, and it still has to make its mark upon educational leadership. However, a number of related concepts--particularly those of sustainability and complexity theory--are beginning to be noticed. This article examines these two concepts and uses them to critique the…

  9. 19 CFR 351.203 - Determination of sufficiency of petition.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 3 2011-04-01 2011-04-01 false Determination of sufficiency of petition. 351.203 Section 351.203 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND... the Act, unless such domestic producer demonstrates to the Secretary's satisfaction that its...

  10. Sufficient observables for large-scale structure in galaxy surveys

    NASA Astrophysics Data System (ADS)

    Carron, J.; Szapudi, I.

    2014-03-01

    Beyond the linear regime, the power spectrum and higher order moments of the matter field no longer capture all cosmological information encoded in density fluctuations. While non-linear transforms have been proposed to extract this information lost to traditional methods, up to now, the way to generalize these techniques to discrete processes was unclear; ad hoc extensions had some success. We pointed out in Carron and Szapudi's paper that the logarithmic transform approximates extremely well the optimal `sufficient statistics', observables that extract all information from the (continuous) matter field. Building on these results, we generalize optimal transforms to discrete galaxy fields. We focus our calculations on the Poisson sampling of an underlying lognormal density field. We solve and test the one-point case in detail, and sketch out the sufficient observables for the multipoint case. Moreover, we present an accurate approximation to the sufficient observables in terms of the mean and spectrum of a non-linearly transformed field. We find that the corresponding optimal non-linear transformation is directly related to the maximum a posteriori Bayesian reconstruction of the underlying continuous field with a lognormal prior as put forward in the paper of Kitaura et al.. Thus, simple recipes for realizing the sufficient observables can be built on previously proposed algorithms that have been successfully implemented and tested in simulations.

  11. Intellectual Freedom and Economic Sufficiency as Educational Entitlements.

    ERIC Educational Resources Information Center

    Morse, Jane Fowler

    2001-01-01

    Using the theories of John Stuart Mill and Karl Marx, this article supports the educational entitlements of intellectual freedom and economic sufficiency. Explores these issues in reference to their implications for teaching, the teaching profession and its training. Concludes that ideas cannot be controlled by the interests of the dominant class.…

  12. The Indochinese in America: Progress Towards Self Sufficiency.

    ERIC Educational Resources Information Center

    Finck, John

    Despite suspicion in some quarters that refugee resettlement has been unduly expensive, evidence indicates that the Indochinese have made steady progress toward self-sufficiency. The majority of Hmong refugees in Providence, Rhode Island, for example, which has been "heavily impacted" by the large number of Indochinese who have become…

  13. Efficiency, sufficiency, and recent change in Newfoundland subsistence horticulture

    SciTech Connect

    Omohundro, J.T.

    1986-09-01

    Traditional Newfoundland horticulture has been a subordinate and compensatory element of the subsistence sphere in a plural economy centered on fishing. Criticized as inefficient and ruinous to the land, this tuber-rootbrassica gardening has in fact been a valuable contribution to diet, is relatively efficient, and compensates for the inadequacies of land and weather. Field data from the Great Northern Peninsula, where some traditional practices persist, demonstrate that the practices conserve time and labor, and substitute massive applications of materials to assure a yield sufficient for household needs. The inefficiency in the tradition may be understood as a response to the constraints upon household labor and follows a kind of Leibig's law of the minimum. Recent changes in gardening practices reveal the dynamics of horticulture in the household's mixed economic strategy. As cash and land have become more common, they have been used to further reduce time while maintaining sufficiency.

  14. Entrepreneurship by any other name: self-sufficiency versus innovation.

    PubMed

    Parker Harris, Sarah; Caldwell, Kate; Renko, Maija

    2014-01-01

    Entrepreneurship has been promoted as an innovative strategy to address the employment of people with disabilities. Research has predominantly focused on the self-sufficiency aspect without fully integrating entrepreneurship literature in the areas of theory, systems change, and demonstration projects. Subsequently there are gaps in services, policies, and research in this field that, in turn, have limited our understanding of the support needs and barriers or facilitators of entrepreneurs with disabilities. A thorough analysis of the literature in these areas led to the development of two core concepts that need to be addressed in integrating entrepreneurship into disability employment research and policy: clarity in operational definitions and better disability statistics and outcome measures. This article interrogates existing research and policy efforts in this regard to argue for a necessary shift in the field from focusing on entrepreneurship as self-sufficiency to understanding entrepreneurship as innovation.

  15. Retinal flow is sufficient for steering during observer rotation

    NASA Technical Reports Server (NTRS)

    Li, Li; Warren, William H Jr

    2002-01-01

    How do people control locomotion while their eyes are simultaneously rotating? A previous study found that during simulated rotation, they can perceive a straight path of self-motion from the retinal flow pattern, despite conflicting extraretinal information, on the basis of dense motion parallax and reference objects. Here we report that the same information is sufficient for active control ofjoystick steering. Participants steered toward a target in displays that simulated a pursuit eye movement. Steering was highly inaccurate with a textured ground plane (motion parallax alone), but quite accurate when an array of posts was added (motion parallax plus reference objects). This result is consistent with the theory that instantaneous heading is determined from motion parallax, and the path of self-motion is determined by updating heading relative to environmental objects. Retinal flow is thus sufficient for both perceiving self-motion and controlling self-motion with a joystick; extraretinal and positional information can also contribute, but are not necessary.

  16. Mapping SLCO1B1 Genetic Variation for Global Precision Medicine in Understudied Regions in Africa: A Focus on Zulu and Cape Admixed Populations.

    PubMed

    Hoosain, Nisreen; Pearce, Brendon; Jacobs, Clifford; Benjeddou, Mongi

    2016-09-01

    The U.S. President Barack Obama has announced, in his State of the Union address on January 20, 2015, the Precision Medicine Initiative, a US$215-million program. For global precision medicine to become a reality, however, biological and environmental "variome" in previously understudied populations ought to be mapped and catalogued. Chief among the molecular targets that warrant global mapping is the organic anion-transporting polypeptide 1B1 (OATP1B1), encoded by solute carrier organic anion transporter family member 1B1 (SLCO1B1), a hepatic uptake transporter predominantly expressed in the basolateral side of hepatocytes. Human OATP1B1 plays a crucial role in the transport of a wide variety of substrates. This includes endogenous compounds such as bile salts as well as medicines, including benzylpenicillin, methotrexate, pravastatin, and rifampicin, and natural toxins microcystin and phalloidin. Genetic variations observed in the SLCO1B1 gene have been associated with altered in vitro and in vivo OATP1B1 transport activity, and consequently influencing patients' response to medicines, toxins, and susceptibility to common complex diseases. Well-characterized haplotypes, *5 (RS4149056C) and *15 (RS4149056T), have been associated with a strikingly reduced uptake of multiple OATP1B1 substrates, including estrone-3-sulfate, estradiol-17β-d-glucuronide, atorvastatin, cerivastatin, pravastatin, and rifampicin. In particular, RS4149056C is observed in 60% of the Cape admixed (CA) population and is associated with increased plasma concentrations of many statins as well as fexofenadine and repaglinide. We designed and optimized a SNaPshot minisequencing panel to characterize the variants of relevance for precision medicine in the clinic. We report here the first study on allele and genotype frequencies for 10 nonsynonymous, 4 synonymous, and 6 intronic single-nucleotide polymorphisms of SLCO1B1 in the Zulu and CA populations of South Africa. These variants are further

  17. Reassessing Rogers' necessary and sufficient conditions of change.

    PubMed

    Watson, Jeanne C

    2007-09-01

    This article reviews the impact of Carl Rogers' postulate about the necessary and sufficient conditions of therapeutic change on the field of psychotherapy. It is proposed that his article (see record 2007-14630-002) made an impact in two ways; first, by acting as a spur to researchers to identify the active ingredients of therapeutic change; and, second, by providing guidelines for therapeutic practice. The role of the necessary and sufficient conditions in process-experiential therapy, an emotion-focused therapy for individuals, and their limitations in terms of research and practice are discussed. It is proposed that although the conditions are necessary and important in promoting clients' affect regulation, they do not take sufficient account of other moderating variables that affect clients' response to treatment and may need to be balanced with more structured interventions. Notwithstanding, Rogers highlighted a way of interacting with clients that is generally acknowledged as essential to effective psychotherapy practice. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  18. Sufficient dimension reduction via squared-loss mutual information estimation.

    PubMed

    Suzuki, Taiji; Sugiyama, Masashi

    2013-03-01

    The goal of sufficient dimension reduction in supervised learning is to find the low-dimensional subspace of input features that contains all of the information about the output values that the input features possess. In this letter, we propose a novel sufficient dimension-reduction method using a squared-loss variant of mutual information as a dependency measure. We apply a density-ratio estimator for approximating squared-loss mutual information that is formulated as a minimum contrast estimator on parametric or nonparametric models. Since cross-validation is available for choosing an appropriate model, our method does not require any prespecified structure on the underlying distributions. We elucidate the asymptotic bias of our estimator on parametric models and the asymptotic convergence rate on nonparametric models. The convergence analysis utilizes the uniform tail-bound of a U-process, and the convergence rate is characterized by the bracketing entropy of the model. We then develop a natural gradient algorithm on the Grassmann manifold for sufficient subspace search. The analytic formula of our estimator allows us to compute the gradient efficiently. Numerical experiments show that the proposed method compares favorably with existing dimension-reduction approaches on artificial and benchmark data sets.

  19. Predictive sufficiency and the use of stored internal state

    NASA Technical Reports Server (NTRS)

    Musliner, David J.; Durfee, Edmund H.; Shin, Kang G.

    1994-01-01

    In all embedded computing systems, some delay exists between sensing and acting. By choosing an action based on sensed data, a system is essentially predicting that there will be no significant changes in the world during this delay. However, the dynamic and uncertain nature of the real world can make these predictions incorrect, and thus, a system may execute inappropriate actions. Making systems more reactive by decreasing the gap between sensing and action leaves less time for predictions to err, but still provides no principled assurance that they will be correct. Using the concept of predictive sufficiency described in this paper, a system can prove that its predictions are valid, and that it will never execute inappropriate actions. In the context of our CIRCA system, we also show how predictive sufficiency allows a system to guarantee worst-case response times to changes in its environment. Using predictive sufficiency, CIRCA is able to build real-time reactive control plans which provide a sound basis for performance guarantees that are unavailable with other reactive systems.

  20. AOP: An R Package For Sufficient Causal Analysis in Pathway ...

    EPA Pesticide Factsheets

    Summary: How can I quickly find the key events in a pathway that I need to monitor to predict that a/an beneficial/adverse event/outcome will occur? This is a key question when using signaling pathways for drug/chemical screening in pharma-cology, toxicology and risk assessment. By identifying these sufficient causal key events, we have fewer events to monitor for a pathway, thereby decreasing assay costs and time, while maximizing the value of the information. I have developed the “aop” package which uses backdoor analysis of causal net-works to identify these minimal sets of key events that are suf-ficient for making causal predictions. Availability and Implementation: The source and binary are available online through the Bioconductor project (http://www.bioconductor.org/) as an R package titled “aop”. The R/Bioconductor package runs within the R statistical envi-ronment. The package has functions that can take pathways (as directed graphs) formatted as a Cytoscape JSON file as input, or pathways can be represented as directed graphs us-ing the R/Bioconductor “graph” package. The “aop” package has functions that can perform backdoor analysis to identify the minimal set of key events for making causal predictions.Contact: burgoon.lyle@epa.gov This paper describes an R/Bioconductor package that was developed to facilitate the identification of key events within an AOP that are the minimal set of sufficient key events that need to be tested/monit

  1. Geometric derivations of minimal sets of sufficient multiview constraints

    USGS Publications Warehouse

    Thomas, Orrin H.; Oshel, Edward R.

    2012-01-01

    Geometric interpretations of four of the most common determinant formulations of multiview constraints are given, showing that they all enforce the same geometry and that all of the forms commonly in use in the machine vision community are a subset of a more general form. Generalising the work of Yi Ma yields a new general 2 x 2 determinant trilinear and 3 x 3 determinant quadlinear. Geometric descriptions of degenerate multiview constraints are given, showing that it is necessary, but insufficient, that the determinant equals zero. Understanding the degeneracies leads naturally into proofs for minimum sufficient sets of bilinear, trilinear and quadlinear constraints for arbitrary numbers of conjugate observations.

  2. Sufficient conditions for a memory-kernel master equation

    NASA Astrophysics Data System (ADS)

    Chruściński, Dariusz; Kossakowski, Andrzej

    2016-08-01

    We derive sufficient conditions for the memory-kernel governing nonlocal master equation which guarantee a legitimate (completely positive and trace-preserving) dynamical map. It turns out that these conditions provide natural parametrizations of the dynamical map being a generalization of the Markovian semigroup. This parametrization is defined by the so-called legitimate pair—monotonic quantum operation and completely positive map—and it is shown that such a class of maps covers almost all known examples from the Markovian semigroup, the semi-Markov evolution, up to collision models and their generalization.

  3. Technology for human self-sufficiency in space

    NASA Technical Reports Server (NTRS)

    Anderson, John L.

    1988-01-01

    A proposed Pathfinder program would determine the critical human and technology requirements for human self-sufficiency and productivity on manned and long-duration missions to the moon and Mars. Human health would require countermeasures against weightlessness, protection from space radiation and habitats conducive to psychological well-being. Life support systems would need regeneration of expendable resources, power systems for plant life support and processing; and microbial contaminant control. Operational performance requirements include extravehicular activities suit, interactive systems for shared control between humans and computers, and human-centered semi-autonomous systems.

  4. Sufficient conditions for thermal rectification in general graded materials.

    PubMed

    Pereira, Emmanuel

    2011-03-01

    We address a fundamental problem for the advance of phononics: the search of a feasible thermal diode. We establish sufficient conditions for the existence of thermal rectification in general graded materials. By starting from simple assumptions satisfied by the usual anharmonic models that describe heat conduction in solids, we derive an expression for the rectification. The analytical formula shows how to increase the rectification, and the conditions to avoid its decay with the system size, a problem present in the recurrent model of diodes given by the sequential coupling of two or three different parts. Moreover, for these graded systems, we show that the regimes of nondecaying rectification and of normal conductivity do not overlap. Our results indicate the graded systems as optimal materials for a thermal diode, the basic component of several devices of phononics.

  5. Hindbrain ghrelin receptor signaling is sufficient to maintain fasting glucose.

    PubMed

    Scott, Michael M; Perello, Mario; Chuang, Jen-Chieh; Sakata, Ichiro; Gautron, Laurent; Lee, Charlotte E; Lauzon, Danielle; Elmquist, Joel K; Zigman, Jeffrey M

    2012-01-01

    The neuronal coordination of metabolic homeostasis requires the integration of hormonal signals with multiple interrelated central neuronal circuits to produce appropriate levels of food intake, energy expenditure and fuel availability. Ghrelin, a peripherally produced peptide hormone, circulates at high concentrations during nutrient scarcity. Ghrelin promotes food intake, an action lost in ghrelin receptor null mice and also helps maintain fasting blood glucose levels, ensuring an adequate supply of nutrients to the central nervous system. To better understand mechanisms of ghrelin action, we have examined the roles of ghrelin receptor (GHSR) expression in the mouse hindbrain. Notably, selective hindbrain ghrelin receptor expression was not sufficient to restore ghrelin-stimulated food intake. In contrast, the lowered fasting blood glucose levels observed in ghrelin receptor-deficient mice were returned to wild-type levels by selective re-expression of the ghrelin receptor in the hindbrain. Our results demonstrate the distributed nature of the neurons mediating ghrelin action.

  6. Variational necessary and sufficient stability conditions for inviscid shear flow

    PubMed Central

    Hirota, M.; Morrison, P. J.; Hattori, Y.

    2014-01-01

    A necessary and sufficient condition for linear stability of inviscid parallel shear flow is formulated by developing a novel variational principle, where the velocity profile is assumed to be monotonic and analytic. It is shown that unstable eigenvalues of Rayleigh's equation (which is a non-self-adjoint eigenvalue problem) can be associated with positive eigenvalues of a certain self-adjoint operator. The stability is therefore determined by maximizing a quadratic form, which is theoretically and numerically more tractable than directly solving Rayleigh's equation. This variational stability criterion is based on the understanding of Kreĭn signature for continuous spectra and is applicable to other stability problems of infinite-dimensional Hamiltonian systems. PMID:25484600

  7. Centrosome Amplification Is Sufficient to Promote Spontaneous Tumorigenesis in Mammals.

    PubMed

    Levine, Michelle S; Bakker, Bjorn; Boeckx, Bram; Moyett, Julia; Lu, James; Vitre, Benjamin; Spierings, Diana C; Lansdorp, Peter M; Cleveland, Don W; Lambrechts, Diether; Foijer, Floris; Holland, Andrew J

    2017-02-06

    Centrosome amplification is a common feature of human tumors, but whether this is a cause or a consequence of cancer remains unclear. Here, we test the consequence of centrosome amplification by creating mice in which centrosome number can be chronically increased in the absence of additional genetic defects. We show that increasing centrosome number elevated tumor initiation in a mouse model of intestinal neoplasia. Most importantly, we demonstrate that supernumerary centrosomes are sufficient to drive aneuploidy and the development of spontaneous tumors in multiple tissues. Tumors arising from centrosome amplification exhibit frequent mitotic errors and possess complex karyotypes, recapitulating a common feature of human cancer. Together, our data support a direct causal relationship among centrosome amplification, genomic instability, and tumor development.

  8. [Vitamin-antioxidant sufficiency of winter sports athletes].

    PubMed

    Beketova, N A; Kosheleva, O V; Pereverzeva, O G; Vrzhesinskaia, O A; Kodentsova, V M; Solntseva, T N; Khanfer'ian, R A

    2013-01-01

    The sufficiency of 169 athletes (six disciplines: bullet shooting, biathlon, bobsleigh, skeleton, freestyle skiing, snowboarding) with vitamins A, E, C, B2, and beta-carotene has been investigated in April-September 2013. All athletes (102 juniors, mean age--18.5 +/- 0.3 years, and 67 adult high-performance athletes, mean age--26.8 +/- 0.7 years) were sufficiently supplied with vitamin A (70.7 +/- 1.7 mcg/dl). Mean blood serum retinol level was 15% higher the upper limit of the norm (80 mcg/dl) in biathletes while median reached 90.9 mcg/dl. Blood serum level of tocopherols (1.22 +/- 0.03 mg/dl), ascorbic acid (1.06 +/- 0.03 mg/dl), riboflavin (7.1 +/- 0.4 ng/ml), and beta-carotene (25.1 +/- 1.7 mcg/dl) was in within normal range, but the incidence of insufficiency of vitamins E, C, B2, and carotenoid among athletes varied in the range of 0-25, 0-17, 15-67 and 42-75%, respectively. 95% of adults and 80% of younger athletes were sufficiently provided with vitamin E. Vitamin E level in blood serum of juniors involved in skeleton and biathlon was lower by 51 and 72% (p < 0.05), than this parameter in adult athletes. Vitamin A, C and B2, and beta-carotene blood serum level did not significantly differ in junior and adult athletes. Women were better supplied with vitamins C, B2, and beta-carotene: a reduced blood serum level of these micronutrients in women was detected 2-3 fold rare (p < 0.10) than among men. Blood serum concentration of vitamin C (1.20 +/- 0.05 mg/dl) and beta-carotene (32.0 +/- 3.9 mcg/dl) in women was greater by 15 and 54% (p < 0.05) than in men. In general, the biathletes were better provided with vitamins compared with other athletes. The vast majority (80%) were optimally provided by all three antioxidants (beta-carotene and vitamins E and C). In other sports, the relative quantity of athletes sufficiently supplied with these essential nutrients did not exceed 56%. The quota of supplied with all antioxidants among bullet shooters (31.1%) and

  9. Sufficient penetration of peracetic acid into drilled human femoral heads.

    PubMed

    Brosig, H; Jacker, H-J; Borchert, H-H; Kalus, U; Dörner, T; von Versen, R; Pruss, A

    2005-01-01

    Chemical sterilisation methods for musculoskeletal transplants have the problem of penetration into all tissue strata. The present study examined if a peracetic acid/ethanol solution penetrated to a sufficient extent into specifically prepared femoral heads. To this effect, 10 femoral heads have been provided with drillings (diameter 2 mm, depth 10 mm) at a distance of 15 mm (series B) and placed in a diffusion chamber with sterilisation solution. From an additional central drilling at the femoral neck junction, the sample drawing was made after 30 min each over a period of 4 h for the iodometric determination of peracetic acid (PAA) concentration. Ten femoral heads, which did contain only the central drilling, served as controls (series A). In 9 of the examined femoral heads of series A the defined minimum concentration of PAA of 0.2% (inactivation of bacteria, spores, fungi) has been clearly exceeded over the complete period of measurement. About 0.8% PAA (inactivation of viruses) was achieved within 4 h only with six femoral heads. Nine out of the 10 examined femoral heads in series B show a clearly improved penetration behaviour which was expressed in smaller standard deviations, a faster increase in concentration, as well as in higher starting and final concentrations (approx. 0.9%) of PAA. Previous drying in air leads to a faster penetration into the centre of the bone. Standardised drilling of de-cartilaged femoral heads creates favourable conditions for the penetration of the PAA sterilisation solution into the whole tissue and guarantees a sufficient inactivation of microorganisms.

  10. Using scientifically and statistically sufficient statistics in comparing image segmentations.

    PubMed

    Chi, Yueh-Yun; Muller, Keith E

    2010-01-01

    Automatic computer segmentation in three dimensions creates opportunity to reduce the cost of three-dimensional treatment planning of radiotherapy for cancer treatment. Comparisons between human and computer accuracy in segmenting kidneys in CT scans generate distance values far larger in number than the number of CT scans. Such high dimension, low sample size (HDLSS) data present a grand challenge to statisticians: how do we find good estimates and make credible inference? We recommend discovering and using scientifically and statistically sufficient statistics as an additional strategy for overcoming the curse of dimensionality. First, we reduced the three-dimensional array of distances for each image comparison to a histogram to be modeled individually. Second, we used non-parametric kernel density estimation to explore distributional patterns and assess multi-modality. Third, a systematic exploratory search for parametric distributions and truncated variations led to choosing a Gaussian form as approximating the distribution of a cube root transformation of distance. Fourth, representing each histogram by an individually estimated distribution eliminated the HDLSS problem by reducing on average 26,000 distances per histogram to just 2 parameter estimates. In the fifth and final step we used classical statistical methods to demonstrate that the two human observers disagreed significantly less with each other than with the computer segmentation. Nevertheless, the size of all disagreements was clinically unimportant relative to the size of a kidney. The hierarchal modeling approach to object-oriented data created response variables deemed sufficient by both the scientists and statisticians. We believe the same strategy provides a useful addition to the imaging toolkit and will succeed with many other high throughput technologies in genetics, metabolomics and chemical analysis.

  11. India's baseline plan for nuclear energy self-sufficiency.

    SciTech Connect

    Bucher, R .G.; Nuclear Engineering Division

    2009-01-01

    India's nuclear energy strategy has traditionally strived for energy self-sufficiency, driven largely by necessity following trade restrictions imposed by the Nuclear Suppliers Group (NSG) following India's 'peaceful nuclear explosion' of 1974. On September 6, 2008, the NSG agreed to create an exception opening nuclear trade with India, which may create opportunities for India to modify its baseline strategy. The purpose of this document is to describe India's 'baseline plan,' which was developed under constrained trade conditions, as a basis for understanding changes in India's path as a result of the opening of nuclear commerce. Note that this treatise is based upon publicly available information. No attempt is made to judge whether India can meet specified goals either in scope or schedule. In fact, the reader is warned a priori that India's delivery of stated goals has often fallen short or taken a significantly longer period to accomplish. It has been evident since the early days of nuclear power that India's natural resources would determine the direction of its civil nuclear power program. It's modest uranium but vast thorium reserves dictated that the country's primary objective would be thorium utilization. Estimates of India's natural deposits vary appreciably, but its uranium reserves are known to be extremely limited, totaling approximately 80,000 tons, on the order of 1% of the world's deposits; and nominally one-third of this ore is of very low uranium concentration. However, India's roughly 300,000 tons of thorium reserves account for approximately 30% of the world's total. Confronted with this reality, the future of India's nuclear power industry is strongly dependent on the development of a thorium-based nuclear fuel cycle as the only way to insure a stable, sustainable, and autonomous program. The path to India's nuclear energy self-sufficiency was first outlined in a seminal paper by Drs. H. J. Bhabha and N. B. Prasad presented at the Second

  12. On necessity and sufficiency in counseling and psychotherapy (revisited).

    PubMed

    Lazarus, Arnold A

    2007-09-01

    It seems to me that Carl Rogers (see record 2007-14639-002) was far too ambitious in trying to specify general conditions of necessity and sufficiency that would be relevant to the entire spectrum of problems and the diverse expectancies and personalities of the people who seek our help. Rogers' position and orientation almost totally overlook the array of problems under the rubric of "response deficits" that stem from misinformation and missing information and call for active correction, training, and retraining. Rogers also paid scant attention to problems with significant biological determinants. Nevertheless, as exemplified by his seminal 1957 article and many other articles and books, Rogers made major contributions within the domain of the therapeutic alliance. Today, the scientific emphasis looks at accountability, the need to establish various treatments of choice, and the need to understand their presumed mechanisms. Treatment efficacy and generalizability across different methodologies are now considered key issues. The efficacy narrowing and clinically self-limiting consequences of adhering to one particular school of thought are now self-evident to most. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  13. Abundant Inverse Regression using Sufficient Reduction and its Applications

    PubMed Central

    Kim, Hyunwoo J.; Smith, Brandon M.; Adluru, Nagesh; Dyer, Charles R.; Johnson, Sterling C.; Singh, Vikas

    2016-01-01

    Statistical models such as linear regression drive numerous applications in computer vision and machine learning. The landscape of practical deployments of these formulations is dominated by forward regression models that estimate the parameters of a function mapping a set of p covariates, x, to a response variable, y. The less known alternative, Inverse Regression, offers various benefits that are much less explored in vision problems. The goal of this paper is to show how Inverse Regression in the “abundant” feature setting (i.e., many subsets of features are associated with the target label or response, as is the case for images), together with a statistical construction called Sufficient Reduction, yields highly flexible models that are a natural fit for model estimation tasks in vision. Specifically, we obtain formulations that provide relevance of individual covariates used in prediction, at the level of specific examples/samples — in a sense, explaining why a particular prediction was made. With no compromise in performance relative to other methods, an ability to interpret why a learning algorithm is behaving in a specific way for each prediction, adds significant value in numerous applications. We illustrate these properties and the benefits of Abundant Inverse Regression (AIR) on three distinct applications. PMID:27796010

  14. Stochasticity, spikes and decoding: sufficiency and utility of order statistics.

    PubMed

    Richmond, Barry J

    2009-06-01

    For over 75 years it has been clear that the number of spikes in a neural response is an important part of the neuronal code. Starting as early as the 1950's with MacKay and McCullough, there has been speculation over whether each spike and its exact time of occurrence carry information. Although it is obvious that the firing rate carries information it has been less clear as to whether there is information in exactly timed patterns, when they arise from the dynamics of the neurons and networks, as opposed to when they represent some strong external drive that entrains them. One strong null hypothesis that can be applied is that spike trains arise from stochastic sampling of an underlying deterministic temporally modulated rate function, that is, there is a time-varying rate function. In this view, order statistics seem to provide a sufficient theoretical construct to both generate simulated spike trains that are indistinguishable from those observed experimentally, and to evaluate (decode) the data recovered from experiments. It remains to learn whether there are physiologically important signals that are not described by such a null hypothesis.

  15. Mammary hypoplasia: not every breast can produce sufficient milk.

    PubMed

    Arbour, Megan W; Kessler, Julia Lange

    2013-01-01

    Breast milk is considered the optimal form of nutrition for newborn infants. Current recommendations are to breastfeed for 6 months. Not all women are able to breastfeed. Mammary hypoplasia is a primary cause of failed lactogenesis II, whereby the mother is unable to produce an adequate milk volume. Women with mammary hypoplasia often have normal hormone levels and innervation but lack sufficient glandular tissue to produce an adequate milk supply to sustain their infant. The etiology of this rare condition is unclear, although there are theories that refer to genetic predisposition and estrogenic environmental exposures in select agricultural environments. Women with mammary hypoplasia may not exhibit the typical breast changes associated with pregnancy and may fail to lactate postpartum. Breasts of women with mammary hypoplasia may be widely spaced (1.5 inches or greater), asymmetric, or tuberous in nature. Awareness of the history and clinical signs of mammary hypoplasia during the prenatal period and immediate postpartum increases the likelihood that women will receive the needed education and physical and emotional support and encouragement. Several medications and herbs demonstrate some efficacy in increasing breast milk production in women with mammary hypoplasia.

  16. The Generalized Asymptotic Equipartition Property: Necessary and Sufficient Conditions

    PubMed Central

    Harrison, Matthew T.

    2011-01-01

    Suppose a string X1n=(X1,X2,…,Xn) generated by a memoryless source (Xn)n≥1 with distribution P is to be compressed with distortion no greater than D ≥ 0, using a memoryless random codebook with distribution Q. The compression performance is determined by the “generalized asymptotic equipartition property” (AEP), which states that the probability of finding a D-close match between X1n and any given codeword Y1n, is approximately 2−nR(P, Q, D), where the rate function R(P, Q, D) can be expressed as an infimum of relative entropies. The main purpose here is to remove various restrictive assumptions on the validity of this result that have appeared in the recent literature. Necessary and sufficient conditions for the generalized AEP are provided in the general setting of abstract alphabets and unbounded distortion measures. All possible distortion levels D ≥ 0 are considered; the source (Xn)n≥1 can be stationary and ergodic; and the codebook distribution can have memory. Moreover, the behavior of the matching probability is precisely characterized, even when the generalized AEP is not valid. Natural characterizations of the rate function R(P, Q, D) are established under equally general conditions. PMID:21614133

  17. Increasing adult hippocampal neurogenesis is sufficient to improve pattern separation.

    PubMed

    Sahay, Amar; Scobie, Kimberly N; Hill, Alexis S; O'Carroll, Colin M; Kheirbek, Mazen A; Burghardt, Nesha S; Fenton, André A; Dranovsky, Alex; Hen, René

    2011-04-28

    Adult hippocampal neurogenesis is a unique form of neural circuit plasticity that results in the generation of new neurons in the dentate gyrus throughout life. Neurons that arise in adults (adult-born neurons) show heightened synaptic plasticity during their maturation and can account for up to ten per cent of the entire granule cell population. Moreover, levels of adult hippocampal neurogenesis are increased by interventions that are associated with beneficial effects on cognition and mood, such as learning, environmental enrichment, exercise and chronic treatment with antidepressants. Together, these properties of adult neurogenesis indicate that this process could be harnessed to improve hippocampal functions. However, despite a substantial number of studies demonstrating that adult-born neurons are necessary for mediating specific cognitive functions, as well as some of the behavioural effects of antidepressants, it is unknown whether an increase in adult hippocampal neurogenesis is sufficient to improve cognition and mood. Here we show that inducible genetic expansion of the population of adult-born neurons through enhancing their survival improves performance in a specific cognitive task in which two similar contexts need to be distinguished. Mice with increased adult hippocampal neurogenesis show normal object recognition, spatial learning, contextual fear conditioning and extinction learning but are more efficient in differentiating between overlapping contextual representations, which is indicative of enhanced pattern separation. Furthermore, stimulation of adult hippocampal neurogenesis, when combined with an intervention such as voluntary exercise, produces a robust increase in exploratory behaviour. However, increasing adult hippocampal neurogenesis alone does not produce a behavioural response like that induced by anxiolytic agents or antidepressants. Together, our findings suggest that strategies that are designed to increase adult hippocampal

  18. Greater learnability is not sufficient to produce cultural universals.

    PubMed

    Rafferty, Anna N; Griffiths, Thomas L; Ettlinger, Marc

    2013-10-01

    Looking across human societies reveals regularities in the languages that people speak and the concepts that they use. One explanation that has been proposed for these "cultural universals" is differences in the ease with which people learn particular languages and concepts. A difference in learnability means that languages and concepts possessing a particular property are more likely to be accurately transmitted from one generation of learners to the next. Intuitively, this difference could allow languages and concepts that are more learnable to become more prevalent after multiple generations of cultural transmission. If this is the case, the prevalence of languages and concepts with particular properties can be explained simply by demonstrating empirically that they are more learnable. We evaluate this argument using mathematical analysis and behavioral experiments. Specifically, we provide two counter-examples that show how greater learnability need not result in a property becoming prevalent. First, more learnable languages and concepts can nonetheless be less likely to be produced spontaneously as a result of transmission failures. We simulated cultural transmission in the laboratory to show that this can occur for memory of distinctive items: these items are more likely to be remembered, but not generated spontaneously once they have been forgotten. Second, when there are many languages or concepts that lack the more learnable property, sheer numbers can swamp the benefit produced by greater learnability. We demonstrate this using a second series of experiments involving artificial language learning. Both of these counter-examples show that simply finding a learnability bias experimentally is not sufficient to explain why a particular property is prevalent in the languages or concepts used in human societies: explanations for cultural universals based on cultural transmission need to consider the full set of hypotheses a learner could entertain and all of

  19. Statistical estimation of resin composite polymerization sufficiency using microhardness.

    PubMed

    Cohen, Mark E; Leonard, Daniel L; Charlton, David G; Roberts, Howard W; Ragain, James C

    2004-02-01

    With respect to determining sub-surface resin polymerization sufficiency, this study compared a traditional method of applying linear regression to bottom- to top-surface Knoop hardness ratios to an alternative method based on nonlinear regression. Inverse linear regression on ratios was used to estimate the exposure duration required for 80% bottom-surface hardness with respect to the top, in six light-by-material groups. Alternatively, a one-phase, two-parameter, exponential association of the form Y=Y(max)(1-e(-kt)) (where Y(max) is maximum hardness, k is a rate constant, and t is exposure duration), was used to model hardness. Inverse nonlinear regression estimated, for each condition, the exposure duration required for the bottom surface to achieve 80% of corresponding condition (light and material) top-surface Y(max). Mathematically, analysis of ratios was demonstrated to yield potentially less precise and biased estimates. Nonlinear regression yielded better statistical fit and provided easily accessible tests for differences in k across light-system groups. Another recently proposed nonlinear model for polymerization, Y=Y(max)kt(n)/(1+kt(n)), was also considered. While this new model has substantially greater phenomenological and mechanistic justification, we found that the model-fitting process was more sensitive to initial parameter values and sometimes yielded untenable results when applied to our data. However, we believe that these problems would not occur if sample points are well distributed across a wide range of exposure durations, and that the model, Y=Y(max)kt(n)/(1+kt(n)), should be considered for such data sets.

  20. [Effect of vitamin sufficiency on adaptation syndrome in growing rats].

    PubMed

    Sidorova, Iu S; Beketova, N A; Vrzhesinskaia, O A; Kodentsova, V M; Kosheleva, O V; Zorin, S N; Selifanov, A V; Mazo, V K

    2014-01-01

    The influence of vitamin supply of growing male -Wistar rats (n=21) with an initial body weight 53,5±0,9 g on their resistance to a single distress induced by the electric shock has been investigated. Control rats within 21 days received a complete semisynthetic diet,providingadequate amounts of vitamins. Combined vitamin deficiency in experimental rats was caused by 5-fold decrease of vitamin mixture amount in the feed and the total vitamin E exclusion from the mixture. On the 21st day, one day before the end of the experiment, both groups of rats were subjected to stress impact (electrocutaneous irritation on paws, 0,4 mA for 8 sec) and then animals were placed in metabolic cages to collect urine. By the end of the experiment, the animals with the combined vitamin deficiency lag behind in growth. Vitamin B2, A, B1 and E liver content decreased in experimental rats by 1,6, 2,3, 4,4 and 15 fold accordingly. Retinol plasma concentration was significantly reduced by 18%, α-tocopherol level - by 5 fold, urinary excretionof riboflavin and 4-pyridoxic acid (vitamin B6 metabolite) was significantly reduced by 6,5 and 2,46 times accordingly. MDA blood plasma concentration and the urinary ratio of oxidized and not oxidized form of 8-hydroxy-2'-deoxy-guanosine did not differ in both groups of rats. Urinary excretion of stress biomarker corticosterone in rats with combined vitamin deficit was 2,5-fold higher than in control rats. Thus, reducing of vitamins supply resulted in an increase of urine corticosterone in stressed rats, that characterized the intensity of general adaptation syndrome. This fact shows the importance of optimal sufficiency with vitamins in nonspecific (general) resistance to stress.

  1. Working memory maintenance is sufficient to reduce state anxiety.

    PubMed

    Balderston, Nicholas L; Quispe-Escudero, David; Hale, Elizabeth; Davis, Andrew; O'Connell, Katherine; Ernst, Monique; Grillon, Christian

    2016-11-01

    According to the attentional control theory (ACT) proposed by Eysenck and colleagues, anxiety interferes with cognitive processing by prioritizing bottom-up attentional processes over top-down attentional processes, leading to competition for access to limited resources in working memory, particularly the central executive (Eysenck, Derakshan, Santos, & Calvo, ). However, previous research using the n-back working memory task suggests that working memory load also reduces state anxiety. Assuming that similar mechanisms underlie the effect of anxiety on cognition, and the effect of cognition on anxiety, one possible implication of the ACT would suggest that the reduction of state anxiety with increasing working memory load is driven by activation of central executive attentional control processes. We tested this hypothesis using the Sternberg working memory paradigm, where maintenance processes can be isolated from central executive processes (Altamura et al., ; Sternberg, ). Consistent with the n-back results, subjects showed decreased state anxiety during the maintenance period of high-load trials relative to low-load trials, suggesting that maintenance processes alone are sufficient to achieve this state anxiety reduction. Given that the Sternberg task does not require central executive engagement, these results are not consistent with an implication of the ACT where the cognition/anxiety relationship and anxiety/cognition relationship are mediated by similar central executive mechanisms. Instead, we propose an extension of the ACT such that engaging working memory maintenance suppresses state anxiety in a load-dependent manner. Furthermore, we hypothesize that the efficacy of this effect may moderate the effect of trait anxiety on cognition.

  2. [Food self-sufficiency and the population problem in Rwanda].

    PubMed

    Tallon, F

    1988-12-01

    Food self-sufficiency is a central element of Rwanda's development policy and planning. The goal of providing each individual with at least 2100 calories per day will require increased agricultural productivity and more moderate population growth. The actions required to achieve a better balance between food production and population growth will be very difficult to achieve in Rwanda. In the past, famines resulting from war, rainfall irregularities, or other natural disasters regularly decimated the population. The last famine, in 1943-44, may have killed 1 million inhabitants of Rwanda-Urundi. Between 1966-83, the population grew from 3.3 to 5.9 million, an increase of 78%, while food production increased from 2.3 to 4.7 million tons, or 104%. The increase was due to a doubling of cultivated land, from 308,000 to 615,000 hectares, achieved by utilizing marginal lands, pastures, and forests, and by shortening fallow periods. By 1983, under pressure of population growth, the average family plot had fallen to .88 hectare. The current nutritional status of the population is in precarious balance, with adequate calorie production overall, but women and children suffer endemic malnutrition in some population sectors, leaving them vulnerable to disease and death. If population increases as projected to over 10 million in the year 2000, the average family plot may decline to scarcely 1/2 hectare. Innovations such as improved seed selection, more productive crops, use of fertilizers, and crop rotation will be required to avoid drastic declines in productivity due to soil exhaustion and erosion. Rwanda's annual population growth rate of 3.7% is the 2nd highest in the world. Fertility reduction will clearly be necessary but difficult to achieve because of the pronatalist attitudes of the population and widespread inability to envision a different future. The 1983 fertility survey indicated that 31% of married women wanted to use contraception, but despite availability of

  3. Cellular contractility changes are sufficient to drive epithelial scattering.

    PubMed

    Hoj, Jacob P; Davis, John A; Fullmer, Kendra E; Morrell, David J; Saguibo, Nicholas E; Schuler, Jeffrey T; Tuttle, Kevin J; Hansen, Marc D H

    2014-08-15

    inhibition of cell scattering following HGF treatment. Interestingly, restoration of myosin-based contractility in blebbistatin-treated cells results in cell scattering, including global actin rearrangements. Scattering is reminiscent of HGF-induced epithelial scattering without a concomitant increase in cell migration or decrease in adhesion strength. This scattering is dependent on RhoA, as blebbistatin-induced scattering is reduced in cells expressing dominant-negative RhoA mutants. This suggests that induction of myosin-based cellular contractility may be sufficient for cell-cell detachment during epithelial scattering.

  4. Sufficiency of Longitudinal Moment of Inertia for Haptic Cylinder Length Judgments

    ERIC Educational Resources Information Center

    Cabe, Patrick A.

    2010-01-01

    Many studies invoke moment of inertia (I[subscript ii]) as necessary and sufficient information to perceive cylinder length via wielding, yet some assert that I[subscript ii] is neither necessary (weight, "m", or static moment, M, are sufficient) nor sufficient for length judgments ("m" or M is necessary). Mathematical expressions for I[subscript…

  5. Minimal sufficient positive-operator valued measure on a separable Hilbert space

    SciTech Connect

    Kuramochi, Yui

    2015-10-15

    We introduce a concept of a minimal sufficient positive-operator valued measure (POVM), which is the least redundant POVM among the POVMs that have the equivalent information about the measured quantum system. Assuming the system Hilbert space to be separable, we show that for a given POVM, a sufficient statistic called a Lehmann-Scheffé-Bahadur statistic induces a minimal sufficient POVM. We also show that every POVM has an equivalent minimal sufficient POVM and that such a minimal sufficient POVM is unique up to relabeling neglecting null sets. We apply these results to discrete POVMs and information conservation conditions proposed by the author.

  6. GENERAL THEORY FOR INTERACTIONS IN SUFFICIENT CAUSE MODELS WITH DICHOTOMOUS EXPOSURES

    PubMed Central

    VanderWeele, Tyler J.; Richardson, Thomas S.

    2014-01-01

    The sufficient-component cause framework assumes the existence of sets of sufficient causes that bring about an event. For a binary outcome and an arbitrary number of binary causes any set of potential outcomes can be replicated by positing a set of sufficient causes; typically this representation is not unique. A sufficient cause interaction is said to be present if within all representations there exists a sufficient cause in which two or more particular causes are all present. A singular interaction is said to be present if for some subset of individuals there is a unique minimal sufficient cause. Empirical and counterfactual conditions are given for sufficient cause interactions and singular interactions between an arbitrary number of causes. Conditions are given for cases in which none, some or all of a given set of causes affect the outcome monotonically. The relations between these results, interactions in linear statistical models and Pearl’s probability of causation are discussed. PMID:25552780

  7. EFFICIENCY OF PREPARED BAITS OF LONE OR/AND ADMIXED FOUR BOTANICAL OILS ON THE VIABILITY OF SUCCESSIVE RAISED GENERATIONS OF AGROTIS IPSILON (HUFNAGEL) (INSECTA: LEPIDOPTERA: NOCTUIDAE) AFTER TREATING THE PARENT ONES.

    PubMed

    Mesbah, H A; El-Sayed, Nagda A; El-Kady, Magda B; Tayeb, E H; Mourad, A K; Kordy, A M; Henaidy, Zeinab M

    2014-01-01

    The present study is initiated to determine the toxic and delayed effects of four botanical oils on the greasy cutworm A. ipsilon, aiming to attain an alternative environmentally safe and effective phytochemicals against the insect-pest. Four botanical oils (camphor, red basil, menthol and rose oil) were added at rates of 0.5 and 1.0% (v/w). The tested oils were added alone, and/or admixed at proportional rate of 1:1 in the prepared baits against the exposed 4th instar till the 6th instar larvae of the insect. The study was run under the laboratory higrothermic conditions of 25±2°C and 65±5% R.H. The results showed that the tested baits of camphor, red basil and menthol oils at concentration rates of 0.5 and 1.0% (v/w) adversely affected the inspected parameters of fitness components of the treated individuals of parent (p) generation. They gave more or less fewer numbers of weak unviable adult-moths, which were either sterile or they laid few numbers of infertile eggs and died before the induction of (F1) progeny. That failure could be elucidated by the rapid occurrence of drastic effects on the biological performance of both the influenced sexes of adult-moths along the period of parent's development. Finally it ended by the inhibited induction of (F1) progeny. A delayed effect of the prepared baits of rose oil at 0.5 and 1.0% (v/w), was assessed on the following raised F1, F2, F3 and F4 generations after parent's treatment. The delayed effect was detected as less efficient latent effect on each of these consequently raised generations; characterized by the gradual decrease of the number of alive immatures and adult-moths. The effect was recorded as gradual increase of dead and malformed individuals and adult-moths. In addition to the gradual decrease of deposited and/or hatched eggs up to the 4th generation, which ended by the complete failure of the development. That failure could be also attributed to the cumulated effects of the induced recessive lethal

  8. Necessary and Sufficient Conditions of Solution Uniqueness in l(sub 1) Minimization (Preprint)

    DTIC Science & Technology

    2012-08-01

    optimality conditions for problems (1a)–(1d), the following theorems give the necessary and sufficient conditions of unique optimality ...the optimality of x∗, Condition 1 is the necessary and sufficient condition for the uniqueness of x∗. Remark 1 For problems (1b)–(1d), the uniqueness of...Noname manuscript No. (will be inserted by the editor) Necessary and sufficient conditions of solution uniqueness in `1 minimization Hui

  9. Genomic Ancestry, Self-Rated Health and Its Association with Mortality in an Admixed Population: 10 Year Follow-Up of the Bambui-Epigen (Brazil) Cohort Study of Ageing

    PubMed Central

    Lima-Costa, M. Fernanda; Macinko, James; Mambrini, Juliana Vaz de Melo; Cesar, Cibele C.; Peixoto, Sérgio V.; Magalhães, Wagner C. S.; Horta, Bernardo L.; Barreto, Mauricio; Castro-Costa, Erico; Firmo, Josélia O. A.; Proietti, Fernando A.; Leal, Thiago Peixoto; Rodrigues, Maira R.; Pereira, Alexandre; Tarazona-Santos, Eduardo

    2015-01-01

    Background Self-rated health (SRH) has strong predictive value for mortality in different contexts and cultures, but there is inconsistent evidence on ethnoracial disparities in SRH in Latin America, possibly due to the complexity surrounding ethnoracial self-classification. Materials/Methods We used 370,539 Single Nucleotide Polymorphisms (SNPs) to examine the association between individual genomic proportions of African, European and Native American ancestry, and ethnoracial self-classification, with baseline and 10-year SRH trajectories in 1,311 community dwelling older Brazilians. We also examined whether genomic ancestry and ethnoracial self-classification affect the predictive value of SRH for subsequent mortality. Results European ancestry predominated among participants, followed by African and Native American (median = 84.0%, 9.6% and 5.3%, respectively); the prevalence of Non-White (Mixed and Black) was 39.8%. Persons at higher levels of African and Native American genomic ancestry, and those self-identified as Non-White, were more likely to report poor health than other groups, even after controlling for socioeconomic conditions and an array of self-reported and objective physical health measures. Increased risks for mortality associated with worse SRH trajectories were strong and remarkably similar (hazard ratio ~3) across all genomic ancestry and ethno-racial groups. Conclusions Our results demonstrated for the first time that higher levels of African and Native American genomic ancestry—and the inverse for European ancestry—were strongly correlated with worse SRH in a Latin American admixed population. Both genomic ancestry and ethnoracial self-classification did not modify the strong association between baseline SRH or SRH trajectory, and subsequent mortality. PMID:26680774

  10. 33 CFR 115.30 - Sufficiency of State authority for bridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... for bridges. 115.30 Section 115.30 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES BRIDGE LOCATIONS AND CLEARANCES; ADMINISTRATIVE PROCEDURES § 115.30 Sufficiency of State authority for bridges. An opinion of the attorney general of the State as to the sufficiency of...

  11. 33 CFR 115.30 - Sufficiency of State authority for bridges.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... for bridges. 115.30 Section 115.30 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES BRIDGE LOCATIONS AND CLEARANCES; ADMINISTRATIVE PROCEDURES § 115.30 Sufficiency of State authority for bridges. An opinion of the attorney general of the State as to the sufficiency of...

  12. 33 CFR 115.30 - Sufficiency of State authority for bridges.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... for bridges. 115.30 Section 115.30 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES BRIDGE LOCATIONS AND CLEARANCES; ADMINISTRATIVE PROCEDURES § 115.30 Sufficiency of State authority for bridges. An opinion of the attorney general of the State as to the sufficiency of...

  13. 33 CFR 115.30 - Sufficiency of State authority for bridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... for bridges. 115.30 Section 115.30 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES BRIDGE LOCATIONS AND CLEARANCES; ADMINISTRATIVE PROCEDURES § 115.30 Sufficiency of State authority for bridges. An opinion of the attorney general of the State as to the sufficiency of...

  14. 33 CFR 115.30 - Sufficiency of State authority for bridges.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... for bridges. 115.30 Section 115.30 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES BRIDGE LOCATIONS AND CLEARANCES; ADMINISTRATIVE PROCEDURES § 115.30 Sufficiency of State authority for bridges. An opinion of the attorney general of the State as to the sufficiency of...

  15. Estimating the proportion of disease due to classes of sufficient causes.

    PubMed

    Hoffmann, Kurt; Heidemann, Christin; Weikert, Cornelia; Schulze, Matthias B; Boeing, Heiner

    2006-01-01

    Disease can be caused by different mechanisms. A possible causal model proposed by Rothman is a complete causal mechanism or a so-called "sufficient cause" consisting of a set of component causes that can be illustrated in a pie chart. However, this model does not allow finding out what sufficient causes produce the majority of cases. The authors' objective was to extend Rothman's work by quantifying the proportion of disease that can be attributed to a class of sufficient causes. The underlying idea was to consider all combinations of a given set of known risk factors and to assign each combination to a class of sufficient causes. This assignment makes it possible to evaluate a class of sufficient causes by the population attributable fraction of the corresponding combination of risk factors. The approach presented was applied to sufficient causes of myocardial infarction by use of data on participants recruited between 1994 and 1998 into the European Prospective Investigation into Cancer and Nutrition-Potsdam Study. As a result, 51.8% of cases were attributed to only four different classes of sufficient causes. In conclusion, the statistical method described in the paper may be beneficial for quantifying the importance of different sufficient causes and for improving the efficiency of public health programs.

  16. 29 CFR 4041.47 - PBGC determination of plan sufficiency/insufficiency.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false PBGC determination of plan sufficiency/insufficiency. 4041... CORPORATION PLAN TERMINATIONS TERMINATION OF SINGLE-EMPLOYER PLANS Distress Termination Process § 4041.47 PBGC determination of plan sufficiency/insufficiency. (a) General. Upon receipt of participant and...

  17. 29 CFR 780.513 - What employment in growing and harvesting is sufficient.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... qualifying for this exemption even if in some past season he was employed in growing and harvesting such... 29 Labor 3 2011-07-01 2011-07-01 false What employment in growing and harvesting is sufficient....513 What employment in growing and harvesting is sufficient. To qualify for exemption the...

  18. Dorsal Hippocampal CREB Is Both Necessary and Sufficient for Spatial Memory

    ERIC Educational Resources Information Center

    Sekeres, Melanie J.; Neve, Rachael L.; Frankland, Paul W.; Josselyn, Sheena A.

    2010-01-01

    Although the transcription factor CREB has been widely implicated in memory, whether it is sufficient to produce spatial memory under conditions that do not normally support memory formation in mammals is unknown. We found that locally and acutely increasing CREB levels in the dorsal hippocampus using viral vectors is sufficient to induce robust…

  19. Sufficiency and Conditional Estimation of Person Parameters in the Polytomous Rasch Model

    ERIC Educational Resources Information Center

    Andrich, David

    2010-01-01

    Rasch models are characterised by sufficient statistics for all parameters. In the Rasch unidimensional model for two ordered categories, the parameterisation of the person and item is symmetrical and it is readily established that the total scores of a person and item are sufficient statistics for their respective parameters. In contrast, in the…

  20. Role of sufficient phosphorus in biodiesel production from diatom Phaeodactylum tricornutum.

    PubMed

    Yu, Shi-Jin; Shen, Xiao-Fei; Ge, Huo-Qing; Zheng, Hang; Chu, Fei-Fei; Hu, Hao; Zeng, Raymond J

    2016-08-01

    In order to study the role of sufficient phosphorus (P) in biodiesel production by microalgae, Phaeodactylum tricornutum were cultivated in six different media treatments with combination of nitrogen (N) sufficiency/deprivation and phosphorus sufficiency/limitation/deprivation. Profiles of N and P, biomass, and fatty acids (FAs) content and compositions were measured during a 7-day cultivation period. The results showed that the FA content in microalgae biomass was promoted by P deprivation. However, statistical analysis showed that FA productivity had no significant difference (p = 0.63, >0.05) under the treatments of N deprivation with P sufficiency (N-P) and N deprivation with P deprivation (N-P-), indicating P sufficiency in N deprivation medium has little effect on increasing biodiesel productivity from P. triornutum. It was also found that the P absorption in N-P medium was 1.41 times higher than that in N sufficiency and P sufficiency (NP) medium. N deprivation with P limitation (N-P-l) was the optimal treatment for producing biodiesel from P. triornutum because of both the highest FA productivity and good biodiesel quality.

  1. DARK MATTER ADMIXED TYPE Ia SUPERNOVAE

    SciTech Connect

    Leung, S.-C.; Chu, M.-C.; Lin, L.-M. E-mail: mcchu@phy.cuhk.edu.hk

    2015-10-20

    We perform two-dimensional hydrodynamic simulations for the thermonuclear explosion of Chandrasekhar-mass white dwarfs with dark matter (DM) cores in Newtonian gravity. We include a 19-isotope nuclear reaction network and make use of the pure turbulent deflagration model as the explosion mechanism in our simulations. Our numerical results show that the general properties of the explosion depend quite sensitively on the mass of the DM core M {sub DM}: a larger M {sub DM} generally leads to a weaker explosion and a lower mass of synthesized iron-peaked elements. In particular, the total mass of produced can drop from about 0.3 to 0.03 M {sub ⊙} as M {sub DM} increases from 0.01 to 0.03 M {sub ⊙}. We have also constructed the bolometric light curves obtained from our simulations and found that our results match well with the observational data of sub-luminous Type Ia supernovae.

  2. Dark matter admixed Type Ia supernovae

    NASA Astrophysics Data System (ADS)

    Leung, Shing Chi; Chu, Ming Chung; Lin, Lap Ming

    2015-04-01

    We perform two-dimensional hydrodynamic simulations for the thermonuclear explosion of Chandrasekhar-mass white dwarfs with dark matter (DM) cores in Newtonian gravity. We include a detailed nuclear reaction network and make use of the pure turbulent deflagration model as the explosion mechanism in our simulations. Our numerical results show that the general properties of the explosion depend quite sensitively on the mass of the DM core MDM. A larger MDM generally leads to a weaker explosion and a lower mass of synthesized iron-peaked elements. In particular, the total mass of 56 Ni produced can drop from about 0.3 to 0.03 Msun as MDM increases from 0.01 to 0.03 Msun. We have also constructed the bolometric light curves obtained from our simulations and found that our results match well with the observational data of sub-luminous type Ia supernovae. This work is partially supported by a grant from the Research Grant Council of the Hong Kong Special Administrative Region, China (Project No. 400910).

  3. Dark-matter admixed white dwarfs

    NASA Astrophysics Data System (ADS)

    Leung, Shing Chi; Chu, Ming Chung; Lin, Lap Ming; Wong, Ka Wing

    2014-03-01

    We study the equilibrium structures of white dwarfs (WD) with dark matter cores formed by non-self-annihilating dark matter (DM) particles with masses ranging from 1 GeV to 100 GeV, assuming in form of an ideal degenerate Fermi gas inside the stars. For DM particles of mass 10 GeV and 100 GeV, we find that stable stellar models exist only if the mass of the DM core inside the star is less than O and -3)Msun , respectively. The global properties of these stars, and the corresponding Chandrasekhar mass (CM) limits, are essentially the same as those of traditional WD models without DM. Nevertheless, in the 10 GeV case, the gravitational attraction of the DM core is strong enough to squeeze the normal matter in the core region to densities above neutron drip. For the 1 GeV case, the DM core inside the star can be as massive as O and affects the global structure of the star significantly. The radius of a stellar model with DM can be about two times smaller than that of a traditional WD. Furthermore, the CM limit can be decreased by as much as 40%. Our results may have implications on the extent to which type Ia supernovae can be regarded as standard candles. This work is partially supported by a grant from the Research Grant Council of the Hong Kong Special Administrative Region, China (Project No. 400910).

  4. Impact of Market Behavior, Fleet Composition, and Ancillary Services on Revenue Sufficiency

    SciTech Connect

    Frew, Bethany

    2016-04-26

    This presentation provides an overview of new and ongoing NREL research that aims to improve our understanding of reliability and revenue sufficiency challenges through modeling tools within a markets framework.

  5. Assessing sufficiency of thermal riverscapes for resilient salmon and steelhead populations

    EPA Science Inventory

    Resilient salmon populations require river networks that provide water temperature regimes sufficient to support a diversity of salmonid life histories across space and time. Efforts to protect, enhance and restore watershed thermal regimes for salmon may target specific location...

  6. Some sufficient conditions for the asymptotic stabilizability of three dimensional homogeneous polynomial systems

    NASA Technical Reports Server (NTRS)

    Dayawansa, W. P.; Martin, C. F.

    1989-01-01

    Consideration is given to three-dimensional homogeneous polynomial systems, and some sufficient conditions for their asymptotic stability are derived by using homogeneous feedback. The tests given are geometric in nature.

  7. Necessary and sufficient conditions for self-focusing of short ultraintense laser pulse in underdense plasma

    SciTech Connect

    Chen, X.L.; Sudan, R.N. )

    1993-04-05

    We analyze the propagation of a short intense laser pulse in underdense cold plasma. When no electron cavitation is present, a global invariant [ital H] is obtained, and its relation with self-focusing is studied. For relativistic self-focusing, [ital H][lt]0 is a sufficient and necessary condition. For relativistic and ponderomotive self-focusing, [ital H][lt]0 is sufficient but not necessary. Numerical simulations are performed to confirm the above points.

  8. Necessary and sufficient conditions for the existence of time-dependent global attractor and application

    NASA Astrophysics Data System (ADS)

    Meng, Fengjuan; Liu, Cuncai

    2017-03-01

    In this paper, we are concerned with infinite dimensional dynamical systems in time-dependent space. First, we characterize some necessary and sufficient conditions for the existence of the time-dependent global attractor by using a measure of noncompactness. Then, we give a new method to verify the sufficient condition. As a simple application, we prove the existence of the time-dependent global attractor for the damped equation in strong topological space.

  9. An empirical approach to sufficient similarity: combining exposure data and mixtures toxicology data.

    PubMed

    Marshall, Scott; Gennings, Chris; Teuschler, Linda K; Stork, Leanna G; Tornero-Velez, Rogelio; Crofton, Kevin M; Rice, Glenn E

    2013-09-01

    When assessing risks posed by environmental chemical mixtures, whole mixture approaches are preferred to component approaches. When toxicological data on whole mixtures as they occur in the environment are not available, Environmental Protection Agency guidance states that toxicity data from a mixture considered "sufficiently similar" to the environmental mixture can serve as a surrogate. We propose a novel method to examine whether mixtures are sufficiently similar, when exposure data and mixture toxicity study data from at least one representative mixture are available. We define sufficient similarity using equivalence testing methodology comparing the distance between benchmark dose estimates for mixtures in both data-rich and data-poor cases. We construct a "similar mixtures risk indicator"(SMRI) (analogous to the hazard index) on sufficiently similar mixtures linking exposure data with mixtures toxicology data. The methods are illustrated using pyrethroid mixtures occurrence data collected in child care centers (CCC) and dose-response data examining acute neurobehavioral effects of pyrethroid mixtures in rats. Our method shows that the mixtures from 90% of the CCCs were sufficiently similar to the dose-response study mixture. Using exposure estimates for a hypothetical child, the 95th percentile of the (weighted) SMRI for these sufficiently similar mixtures was 0.20 (i.e., where SMRI <1, less concern; >1, more concern).

  10. Correlation, necessity, and sufficiency: Common errors in the scientific reasoning of undergraduate students for interpreting experiments.

    PubMed

    Coleman, Aaron B; Lam, Diane P; Soowal, Lara N

    2015-01-01

    Gaining an understanding of how science works is central to an undergraduate education in biology and biochemistry. The reasoning required to design or interpret experiments that ask specific questions does not come naturally, and is an essential part of the science process skills that must be learned for an understanding of how scientists conduct research. Gaps in these reasoning skills make it difficult for students to become proficient in reading primary scientific literature. In this study, we assessed the ability of students in an upper-division biochemistry laboratory class to use the concepts of correlation, necessity, and sufficiency in interpreting experiments presented in a format and context that is similar to what they would encounter when reading a journal article. The students were assessed before and after completion of a laboratory module where necessary vs. sufficient reasoning was used to design and interpret experiments. The assessment identified two types of errors that were commonly committed by students when interpreting experimental data. When presented with an experiment that only establishes a correlation between a potential intermediate and a known effect, students frequently interpreted the intermediate as being sufficient (causative) for the effect. Also, when presented with an experiment that tests only necessity for an intermediate, they frequently made unsupported conclusions about sufficiency, and vice versa. Completion of the laboratory module and instruction in necessary vs. sufficient reasoning showed some promise for addressing these common errors.

  11. The integrin-binding domain of invasin is sufficient to allow bacterial entry into mammalian cells.

    PubMed Central

    Rankin, S; Isberg, R R; Leong, J M

    1992-01-01

    Yersinia pseudotuberculosis is able to enter normally nonphagocytic host cells by multiple pathways, the most efficient of which is mediated by invasin, a 986-amino-acid bacterial outer membrane protein. It has previously been shown that the C-terminal 192 amino acids of invasin are sufficient to bind mammalian cells. To determine if additional regions of the invasin protein are necessary to promote entry, we developed a novel assay that tests the ability of various invasin derivatives to confer on Staphylococcus aureus the ability to enter animal cells. We determined that the 192-amino-acid cell-binding region of invasin, when used to coat the bacterial cell surface, was also sufficient to promote cellular penetration. These results suggest that the simple binding of invasin to its receptors is sufficient to mediate entry and that the bacterium plays a largely passive role in the entry process. Images PMID:1500198

  12. Predictability of the appearance of anomalous waves at sufficiently small Benjamin-Feir indices

    NASA Astrophysics Data System (ADS)

    Ruban, V. P.

    2016-05-01

    The numerical simulation of the nonlinear dynamics of random sea waves at sufficiently small Benjamin-Feir indices and its comparison with the linear dynamics (at the coincidence of spatial Fourier harmonics near a spectral peak at a certain time t p) indicate that the appearance of a rogue wave can be predicted in advance. If the linear approximation shows the presence of a sufficiently extensive and/or high group of waves in the near future after t p, an anomalous wave is almost necessarily formed in the nonlinear model. The interval of reliable forecasting covers several hundred wave periods, which can be quite sufficient in practice for, e.g., avoiding the meeting of a ship with a giant wave.

  13. Biseparability of 3-qubits density matrices using Hilbert-Schmidt decompositions: Sufficient conditions and explicit expressions

    NASA Astrophysics Data System (ADS)

    Ben-Aryeh, Y.; Mann, A.

    2016-11-01

    Hilbert-Schmidt (HS) decompositions and Frobenius norms are used to analyze biseparability of 3-qubit systems, with particular emphasis on density matrices with maximally disordered subsystems (MDS) and on the W state mixed with white noise. The biseparable form of a MDS density matrix is obtained by using the Bell states of a 2-qubit subsystem, multiplied by density matrices of the third qubit, which include the relevant HS parameters. Using our methods, a sufficient condition and explicit biseparability of the W state mixed with white noise are given. They are compared with the sufficient condition for explicit full separability given in a previous work.

  14. The proof of sufficient descent condition for a new type of conjugate gradient methods

    NASA Astrophysics Data System (ADS)

    Abashar, Abdelrhaman; Mamat, Mustafa; Rivaie, Mohd; Mohd, Ismail; Omer, Osman

    2014-06-01

    Conjugate gradient methods are effective in solving linear equations and solving non-linear optimization. In this work we compare our new conjugate gradient coefficient βk with classical formula under strong Wolfe line search; our method contains sufficient descent condition. Numerical results have shown that the new βk performs better than classical formula.

  15. Conjugate gradient methods with sufficient descent condition for large-scale unconstrained optimization

    NASA Astrophysics Data System (ADS)

    Ling, Mei Mei; Leong, Wah June

    2014-12-01

    In this paper, we make a modification to the standard conjugate gradient method so that its search direction satisfies the sufficient descent condition. We prove that the modified conjugate gradient method is globally convergent under Armijo line search. Numerical results show that the proposed conjugate gradient method is efficient compared to some of its standard counterparts for large-scale unconstrained optimization.

  16. 42 CFR 110.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 1 2012-10-01 2012-10-01 false Sufficient documentation for eligibility and benefits determinations. 110.72 Section 110.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES COUNTERMEASURES INJURY COMPENSATION PROGRAM Secretarial...

  17. 42 CFR 102.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 1 2013-10-01 2013-10-01 false Sufficient documentation for eligibility and benefits determinations. 102.72 Section 102.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES SMALLPOX COMPENSATION PROGRAM Secretarial Determinations §...

  18. 42 CFR 110.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 1 2011-10-01 2011-10-01 false Sufficient documentation for eligibility and benefits determinations. 110.72 Section 110.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES COUNTERMEASURES INJURY COMPENSATION PROGRAM Secretarial...

  19. 42 CFR 110.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Sufficient documentation for eligibility and benefits determinations. 110.72 Section 110.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES COUNTERMEASURES INJURY COMPENSATION PROGRAM Secretarial...

  20. 42 CFR 110.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 1 2013-10-01 2013-10-01 false Sufficient documentation for eligibility and benefits determinations. 110.72 Section 110.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES COUNTERMEASURES INJURY COMPENSATION PROGRAM Secretarial...

  1. 42 CFR 102.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 1 2012-10-01 2012-10-01 false Sufficient documentation for eligibility and benefits determinations. 102.72 Section 102.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES SMALLPOX COMPENSATION PROGRAM Secretarial Determinations §...

  2. 42 CFR 102.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Sufficient documentation for eligibility and benefits determinations. 102.72 Section 102.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES SMALLPOX COMPENSATION PROGRAM Secretarial Determinations §...

  3. 42 CFR 102.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 1 2011-10-01 2011-10-01 false Sufficient documentation for eligibility and benefits determinations. 102.72 Section 102.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES SMALLPOX COMPENSATION PROGRAM Secretarial Determinations §...

  4. 42 CFR 102.72 - Sufficient documentation for eligibility and benefits determinations.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Sufficient documentation for eligibility and benefits determinations. 102.72 Section 102.72 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES VACCINES SMALLPOX COMPENSATION PROGRAM Secretarial Determinations §...

  5. Constitutional Court of South Africa overturns lower court's decision on the right to "sufficient water".

    PubMed

    2009-12-01

    On 8 October 2009, the Constitutional Court of South Africa overturned the judgment of the Supreme Court of Appeal, which addressed the proper interpretation of Section 27(1)(b) of the Constitution of South Africa (Constitution)--namely, everyone's right to have access to sufficient water.

  6. Social Work's Response to Poverty: From Benefits Dependence to Economic Self-Sufficiency

    ERIC Educational Resources Information Center

    Gates, Lauren B.; Koza, Jennifer; Akabas, Sheila H.

    2017-01-01

    Welfare reform in the 1990s represented a fundamental policy shift in the United States' response to poverty from supporting benefits dependency to promoting economic self-sufficiency. Social work's capacity to integrate this policy shift into practice is central to meeting its mission to alleviate poverty. This study looked at the preparation of…

  7. Faculty Sufficiency and AACSB Accreditation Compliance within a Global University: A Mathematical Modeling Approach

    ERIC Educational Resources Information Center

    Boronico, Jess; Murdy, Jim; Kong, Xinlu

    2014-01-01

    This manuscript proposes a mathematical model to address faculty sufficiency requirements towards assuring overall high quality management education at a global university. Constraining elements include full-time faculty coverage by discipline, location, and program, across multiple campus locations subject to stated service quality standards of…

  8. On sufficient statistics of least-squares superposition of vector sets.

    PubMed

    Konagurthu, Arun S; Kasarapu, Parthan; Allison, Lloyd; Collier, James H; Lesk, Arthur M

    2015-06-01

    The problem of superposition of two corresponding vector sets by minimizing their sum-of-squares error under orthogonal transformation is a fundamental task in many areas of science, notably structural molecular biology. This problem can be solved exactly using an algorithm whose time complexity grows linearly with the number of correspondences. This efficient solution has facilitated the widespread use of the superposition task, particularly in studies involving macromolecular structures. This article formally derives a set of sufficient statistics for the least-squares superposition problem. These statistics are additive. This permits a highly efficient (constant time) computation of superpositions (and sufficient statistics) of vector sets that are composed from its constituent vector sets under addition or deletion operation, where the sufficient statistics of the constituent sets are already known (that is, the constituent vector sets have been previously superposed). This results in a drastic improvement in the run time of the methods that commonly superpose vector sets under addition or deletion operations, where previously these operations were carried out ab initio (ignoring the sufficient statistics). We experimentally demonstrate the improvement our work offers in the context of protein structural alignment programs that assemble a reliable structural alignment from well-fitting (substructural) fragment pairs. A C++ library for this task is available online under an open-source license.

  9. Pathway to Self-Sufficiency: Social and Economic Development Strategies of Native American Communities.

    ERIC Educational Resources Information Center

    Office of Human Development Services (DHHS), Washington, DC.

    In fiscal year (FY) 1984 the Administration for Native Americans awarded 227 grants for social and economic development strategies (SEDS) which would help Native American communities move toward self-sufficiency. More than half the grants were primarily for economic development; approximately one-third were for improving tribal governments, and…

  10. Investigation of Professional Self Sufficiency Levels of Physical Education and Sports Teachers

    ERIC Educational Resources Information Center

    Saracaoglu, Asuman Seda; Ozsaker, Murat; Varol, Rana

    2012-01-01

    The present research aimed at detecting professional self sufficiency levels of physical education and sports teachers who worked in Izmir Province and at investigating them in terms of some variables. For data collection, Teacher's Sense of Efficacy Scale-developed by Moran and Woolfolk-Hoy (2001) and Turkish validity and reliability studies…

  11. Public and Private Incentives for Investment in Higher Education: Are They Sufficient, Especially for Black Males?

    ERIC Educational Resources Information Center

    Appiah, Elizabeth N.

    2013-01-01

    The institutional costs of higher education have been rising. With diminishing public support per student, tuition and fees private costs have also been rising. But so have the real earnings of college graduates. Are there still sufficient incentives on efficiency grounds for additional public investment in higher education? And in particular,…

  12. Georg Rasch and Benjamin Wright's Struggle with the Unidimensional Polytomous Model with Sufficient Statistics

    ERIC Educational Resources Information Center

    Andrich, David

    2016-01-01

    This article reproduces correspondence between Georg Rasch of The University of Copenhagen and Benjamin Wright of The University of Chicago in the period from January 1966 to July 1967. This correspondence reveals their struggle to operationalize a unidimensional measurement model with sufficient statistics for responses in a set of ordered…

  13. 29 CFR 4041.49 - Verification of plan sufficiency prior to closeout.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Verification of plan sufficiency prior to closeout. 4041.49 Section 4041.49 Labor Regulations Relating to Labor (Continued) PENSION BENEFIT GUARANTY CORPORATION PLAN TERMINATIONS TERMINATION OF SINGLE-EMPLOYER PLANS Distress Termination Process § 4041.49 Verification of...

  14. Community Service and University Roles: An Action Research Based on the Philosophy of Sufficiency Economy

    ERIC Educational Resources Information Center

    Nuangchalerm, Prasart; Chansirisira, Pacharawit

    2012-01-01

    This study employs action research to develop community service through university roles by applying the philosophy of sufficiency economy of His Majesty the King Bhumibol Adulyadej to fulfill villagers' way of life. Participatory learning, seminar, field trip and supervision were employed for strategic plan. Data were collected by participatory…

  15. Mating motives are neither necessary nor sufficient to create the beauty premium.

    PubMed

    Hafenbrädl, Sebastian; Dana, Jason

    2017-01-01

    Mating motives lead decision makers to favor attractive people, but this favoritism is not sufficient to create a beauty premium in competitive settings. Further, economic approaches to discrimination, when correctly characterized, could neatly accommodate the experimental and field evidence of a beauty premium. Connecting labor economics and evolutionary psychology is laudable, but mating motives do not explain the beauty premium.

  16. Analyzing a Work Incentive: The Plan for Achieving Self Sufficiency and School-To-Work Transition.

    ERIC Educational Resources Information Center

    Berry, Hugh; And Others

    This paper examines utilization of the Plan for Achieving Self-Sufficiency (PASS), a work incentive available for persons receiving Supplemental Security Income (SSI), designed to parallel the Individuals with Disabilities Education Act transition plan requirement. The PASS program allows persons receiving SSI cash assistance to set aside income…

  17. Programs To Create Economic Self-Sufficiency for Women in Public Housing.

    ERIC Educational Resources Information Center

    Smith, Cynthia; DeTardo-Bora, Kimberly; Durbin, Latrisha

    The Wheeling Housing Authority in Wheeling, West Virginia, conducted two residential programs to help women living in public housing develop economic self-sufficiency. The Learning Independence from Employment (LIFE) program was an intensive 3-week program designed to accomplish the following objectives: improve participants' communication skills…

  18. Designing and Managing Public Housing Self-Sufficiency Programs: The Youngs Lake Commons Program

    ERIC Educational Resources Information Center

    Kleit, Rachel Garshick

    2004-01-01

    This article evaluates an experimental public housing self-sufficiency program that encourages home ownership among low-income families. A quasi-experimental design, in combination with focus groups, records review, and key informant interviews, provides data to focus on four questions: (a) Do these programs simply accelerate move-outs for those…

  19. ADC Mothers Reach Self-Sufficiency through Comprehensive Support and Family Development Services Program.

    ERIC Educational Resources Information Center

    Randolph, Gayle C., II; McCarthy, Karen V.

    Families whose primary or sole means of financial support is derived from the welfare system are attempting to meet immediate survival needs in the same manner as families outside of the system. Project Self-Sufficiency is a program which dedicates time to building trusting relationships based on mutual respect and the belief that, with support,…

  20. 75 FR 39035 - Housing Choice Voucher (HCV) Family Self-Sufficiency (FSS) Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-07

    ... URBAN DEVELOPMENT Housing Choice Voucher (HCV) Family Self-Sufficiency (FSS) Program AGENCY: Office of... Voucher Program) with public and private resources to enable eligible families to achieve economic...; enter into a Contract of Participation with each eligible family that opts to participate in the...

  1. A Classroom Note on a Sufficient, but Unsatisfied, Condition for Goldbach's Conjecture to Be True

    ERIC Educational Resources Information Center

    Skurnick, Ronald

    2011-01-01

    This classroom note is presented as a suggested exercise--not to have the class prove or disprove Goldbach's Conjecture, but to stimulate student discussions in the classroom regarding proof, as well as necessary, sufficient, satisfied, and unsatisfied conditions. Goldbach's Conjecture is one of the oldest unsolved problems in the field of number…

  2. Validation of the Employment Hope Scale: Measuring Psychological Self-Sufficiency among Low-Income Jobseekers

    ERIC Educational Resources Information Center

    Hong, Philip Young P.; Polanin, Joshua R.; Pigott, Therese D.

    2012-01-01

    Objectives: The Employment Hope scale (EHS) was designed to measure the empowerment-based self-sufficiency (SS) outcome among low-income job-seeking clients. This measure captures the psychological SS dimension as opposed to the more commonly used economic SS in workforce development and employment support practice. The study validates the EHS and…

  3. Complementary Log Regression for Sufficient-Cause Modeling of Epidemiologic Data.

    PubMed

    Lin, Jui-Hsiang; Lee, Wen-Chung

    2016-12-13

    The logistic regression model is the workhorse of epidemiological data analysis. The model helps to clarify the relationship between multiple exposures and a binary outcome. Logistic regression analysis is readily implemented using existing statistical software, and this has contributed to it becoming a routine procedure for epidemiologists. In this paper, the authors focus on a causal model which has recently received much attention from the epidemiologic community, namely, the sufficient-component cause model (causal-pie model). The authors show that the sufficient-component cause model is associated with a particular 'link' function: the complementary log link. In a complementary log regression, the exponentiated coefficient of a main-effect term corresponds to an adjusted 'peril ratio', and the coefficient of a cross-product term can be used directly to test for causal mechanistic interaction (sufficient-cause interaction). The authors provide detailed instructions on how to perform a complementary log regression using existing statistical software and use three datasets to illustrate the methodology. Complementary log regression is the model of choice for sufficient-cause analysis of binary outcomes. Its implementation is as easy as conventional logistic regression.

  4. Role of input self-sufficiency in the economic and environmental sustainability of specialised dairy farms.

    PubMed

    Lebacq, T; Baret, P V; Stilmant, D

    2015-03-01

    Increasing input self-sufficiency is often viewed as a target to improve sustainability of dairy farms. However, few studies have specifically analysed input self-sufficiency, by including several technical inputs and without only focussing on animal feeding, in order to explore its impact on farm sustainability. To address this gap, our work has three objectives as follows: (1) identifying the structural characteristics required by specialised dairy farms located in the grassland area to be self-sufficient; (2) analysing the relationships between input self-sufficiency, environmental and economic sustainability; and (3) studying how the farms react to a decrease in milk price according to their self-sufficiency degree. Based on farm accounting databases, we categorised 335 Walloon specialised conventional dairy farms into four classes according to their level of input self-sufficiency. To this end, we used as proxy the indicator of economic autonomy - that is, the ratio between costs of inputs related to animal production, crop production and energy use and the total gross product. Classes were then compared using multiple comparison tests and canonical discriminant analysis. A total of 30 organic farms - among which 63% had a high level of economic autonomy - were considered separately and compared with the most autonomous class. We showed that a high degree of economic autonomy is associated, in conventional farms, with a high proportion of permanent grassland in the agricultural area. The most autonomous farms used less input - especially animal feeding - for a same output level, and therefore combined good environmental and economic performances. Our results also underlined that, in a situation of decrease in milk price, the least autonomous farms had more latitude to decrease their input-related costs without decreasing milk production. Their incomes per work unit were, therefore, less impacted by falling prices, but remained lower than those of more

  5. 43 CFR 3281.10 - How will BLM determine that I have sufficient control of the proposed unit area?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... sufficient control of the proposed unit area? 3281.10 Section 3281.10 Public Lands: Interior Regulations... § 3281.10 How will BLM determine that I have sufficient control of the proposed unit area? (a) BLM will determine whether: (1) A unit operator has sufficient control of the proposed unit area by reviewing...

  6. Portfolio of Research in Welfare and Family Self-Sufficiency: FY 2014. OPRE Report 2015-15

    ERIC Educational Resources Information Center

    Administration for Children & Families, 2015

    2015-01-01

    The Division of Economic Independence within the Office of Planning, Research and Evaluation (OPRE) has primary responsibility for welfare and family self-sufficiency research. OPRE's research in the area of welfare and family self-sufficiency is designed to expand knowledge about effective programs to promote employment, self-sufficiency, and…

  7. A new conjugate gradient method with sufficient descent without any line search for unconstrained optimization

    NASA Astrophysics Data System (ADS)

    Omer, Osman; Rivaie, Mohd; Mamat, Mustafa; Amani, Zahrahtul

    2015-02-01

    Conjugate gradient methods are one of the most used methods for solving nonlinear unconstrained optimization problems, especially of large scale. Their wide applications are due to their simplicity and low memory requirement. The sufficient descent property is an important issue in the analyses and implementations of conjugate gradient methods. In this paper, a new conjugate gradient method is proposed for unconstrained optimization problems. The theoretical analysis shows that the directions generated by the new method are always satisfy the sufficient descent property, and this property is independent of the line search used. Furthermore, a numerical experiment based on comparing the new method with other known conjugate gradient methods shows that the new is efficient for some unconstrained optimization problems.

  8. The necessary and sufficient conditions of therapeutic personality change: Reactions to Rogers' 1957 article.

    PubMed

    Samstag, Lisa Wallner

    2007-09-01

    Carl Rogers' article (see record 2007-14639-002) on the necessary and sufficient conditions for personality change has had a significant impact on the field of psychotherapy and psychotherapy research. He emphasized the client as arbiter of his or her own subjective experience and tested his hypothesized therapist-offered conditions of change using recorded sessions. This aided in demystifying the therapeutic process and led to a radical shift in the listening stance of the therapist. I briefly outline my views regarding the influence of the ideas presented in this work, describe the intellectual and cultural context of the times, and discuss a number of ways in which the therapist-offered conditions for psychological transformation are neither necessary nor sufficient. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  9. Linear stable unity-feedback system - Necessary and sufficient conditions for stability under nonlinear plant perturbations

    NASA Technical Reports Server (NTRS)

    Desoer, C. A.; Kabuli, M. G.

    1989-01-01

    The authors consider a linear (not necessarily time-invariant) stable unity-feedback system, where the plant and the compensator have normalized right-coprime factorizations. They study two cases of nonlinear plant perturbations (additive and feedback), with four subcases resulting from: (1) allowing exogenous input to Delta P or not; 2) allowing the observation of the output of Delta P or not. The plant perturbation Delta P is not required to be stable. Using the factorization approach, the authors obtain necessary and sufficient conditions for all cases in terms of two pairs of nonlinear pseudostate maps. Simple physical considerations explain the form of these necessary and sufficient conditions. Finally, the authors obtain the characterization of all perturbations Delta P for which the perturbed system remains stable.

  10. Methods for obtaining sufficient conditions for the stability of autonomous conservative systems

    NASA Astrophysics Data System (ADS)

    Novikov, M. A.

    2016-11-01

    A computational method for obtaining sufficient conditions for the stability of the stationary solution of autonomous conservative systems is proposed in the paper. This method is adapted to linear autonomous gyroscopic systems with three degrees of freedom. It is based on the positive definiteness of a parametric quadratic form composed of the gyroscopic force matrices and the potential function. The control parameters for the stability of the zero solution of the gyroscopic system are the entries of the gyroscopic force matrix. The algorithm of the computational method includes estimating one gyroscopic force parameter in the equation constructed from a necessary stability condition. A special example is used to demonstrate the application of this algorithm. Comparison is performed with some well-known methods for obtaining sufficient conditions on the basis of an incomplete set of first integrals of motion. It is shown that the positive definiteness of the modified potential energy may result in stable as well as unstable motions.

  11. Sufficiency of Mesolimbic Dopamine Neuron Stimulation for the Progression to Addiction.

    PubMed

    Pascoli, Vincent; Terrier, Jean; Hiver, Agnès; Lüscher, Christian

    2015-12-02

    The factors causing the transition from recreational drug consumption to addiction remain largely unknown. It has not been tested whether dopamine (DA) is sufficient to trigger this process. Here we use optogenetic self-stimulation of DA neurons of the ventral tegmental area (VTA) to selectively mimic the defining commonality of addictive drugs. All mice readily acquired self-stimulation. After weeks of abstinence, cue-induced relapse was observed in parallel with a potentiation of excitatory afferents onto D1 receptor-expressing neurons of the nucleus accumbens (NAc). When the mice had to endure a mild electric foot shock to obtain a stimulation, some stopped while others persevered. The resistance to punishment was associated with enhanced neural activity in the orbitofrontal cortex (OFC) while chemogenetic inhibition of the OFC reduced compulsivity. Together, these results show that stimulating VTA DA neurons induces behavioral and cellular hallmarks of addiction, indicating sufficiency for the induction and progression of the disease.

  12. Stable dynamics in forced systems with sufficiently high/low forcing frequency.

    PubMed

    Bartuccelli, M; Gentile, G; Wright, J A

    2016-08-01

    We consider parametrically forced Hamiltonian systems with one-and-a-half degrees of freedom and study the stability of the dynamics when the frequency of the forcing is relatively high or low. We show that, provided the frequency is sufficiently high, Kolmogorov-Arnold-Moser (KAM) theorem may be applied even when the forcing amplitude is far away from the perturbation regime. A similar result is obtained for sufficiently low frequency, but in that case we need the amplitude of the forcing to be not too large; however, we are still able to consider amplitudes which are outside of the perturbation regime. In addition, we find numerically that the dynamics may be stable even when the forcing amplitude is very large, well beyond the range of validity of the analytical results, provided the frequency of the forcing is taken correspondingly low.

  13. Necessary and sufficient conditions under which an H2 optimal control problem has a unique solution

    NASA Technical Reports Server (NTRS)

    Chen, Ben M.; Saberi, Ali

    1993-01-01

    A set of necessary and sufficient conditions under which a general H2-optimal control problem has a unique solution is derived. It is shown that the solution for an H2-optimal control problem, if it exists, is unique if and only if (1) the transfer function from the control input to the controlled output is left invertible, and (2) the transfer function from the disturbance to the measurement output is right invertible.

  14. Getting to necessary and sufficient-developing accident scenarios for risk assessment

    SciTech Connect

    Mahn, J.A.

    1996-05-01

    This paper presents a simple, systematic approach for developing accident scenarios using generic accident types. Result is a necessary and sufficient set of accident scenarios that can be used to establish the safety envelope for a facility or operation. Us of this approach along with the methodology of SAND95-0320 will yield more consistent accident analyses between facilities and provide a sound basis for allocating limited risk reduction resources.

  15. Energy Self-Sufficiency for Air Force Logistics Command (AFLC) Bases: An Initial Investigation.

    DTIC Science & Technology

    1980-06-01

    appropriate. Structure of the Report The first four chapters form the background of the current energy situation. Chapter V deals with the defini...relied upon more heavily if the country is to regain some degree of energy self-sufficiency. Petroleum is the first resource to be discussed. Status of...one hundred years to withdraw the first one hundred billion barrels from the U.S. resource on a growth curve of approximately 4% per year. The next

  16. Assessing the Impact of Reasonable Sufficiency on the Structure and Missions of the Former Soviet Navy

    DTIC Science & Technology

    1992-06-01

    would provide the deterrent necessary to prevent such a strike from even ever occurring. Contrarily, Dotsenko believed it necessary to preempt any...refuted in the Dotsenko article as well. Dotsenko provides a matrix in which he identifies the five progressive stages of naval mission development...AD-A256 658 NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA ’•R A DI) Pý THESIS ASSESSING THE IMPACT OF "REASONABLE SUFFICIENCY" ON THE STRUCTURE AND

  17. Necessary and sufficient conditions for stabilizability of discrete-time systems via delayed feedback control

    NASA Astrophysics Data System (ADS)

    Zhu, Jiandong; Tian, Yu-Ping

    2005-08-01

    In this Letter, the stabilizability problem for single-input chaotic discrete-time systems under delayed feedback control (DFC) is completely solved. Necessary and sufficient conditions for stabilizability via DFC are obtained, which reveal the limitation of DFC more exactly than the odd number limitation. A nonlinear DFC is analytically designed for stabilizing a class of discrete-time systems at an unknown fixed point.

  18. Maximizing Health or Sufficient Capability in Economic Evaluation? A Methodological Experiment of Treatment for Drug Addiction.

    PubMed

    Goranitis, Ilias; Coast, Joanna; Day, Ed; Copello, Alex; Freemantle, Nick; Frew, Emma

    2016-11-17

    Conventional practice within the United Kingdom and beyond is to conduct economic evaluations with "health" as evaluative space and "health maximization" as the decision-making rule. However, there is increasing recognition that this evaluative framework may not always be appropriate, and this is particularly the case within public health and social care contexts. This article presents a methodological case study designed to explore the impact of changing the evaluative space within an economic evaluation from health to capability well-being and the decision-making rule from health maximization to the maximization of sufficient capability. Capability well-being is an evaluative space grounded on Amartya Sen's capability approach and assesses well-being based on individuals' ability to do and be the things they value in life. Sufficient capability is an egalitarian approach to decision making that aims to ensure everyone in society achieves a normatively sufficient level of capability well-being. The case study is treatment for drug addiction, and the cost-effectiveness of 2 psychological interventions relative to usual care is assessed using data from a pilot trial. Analyses are undertaken from a health care and a government perspective. For the purpose of the study, quality-adjusted life years (measured using the EQ-5D-5L) and years of full capability equivalent and years of sufficient capability equivalent (both measured using the ICECAP-A [ICEpop CAPability measure for Adults]) are estimated. The study concludes that different evaluative spaces and decision-making rules have the potential to offer opposing treatment recommendations. The implications for policy makers are discussed.

  19. Retrocausal Effects as a Consequence of Quantum Mechanics Refined to Accommodate the Principle of Sufficient Reason

    SciTech Connect

    Stapp, Henry P.

    2011-05-10

    The principle of sufficient reason asserts that anything that happens does so for a reason: no definite state of affairs can come into being unless there is a sufficient reason why that particular thing should happen. This principle is usually attributed to Leibniz, although the first recorded Western philosopher to use it was Anaximander of Miletus. The demand that nature be rational, in the sense that it be compatible with the principle of sufficient reason, conflicts with a basic feature of contemporary orthodox physical theory, namely the notion that nature's response to the probing action of an observer is determined by pure chance, and hence on the basis of absolutely no reason at all. This appeal to pure chance can be deemed to have no rational fundamental place in reason-based Western science. It is argued here, on the basis of the other basic principles of quantum physics, that in a world that conforms to the principle of sufficient reason, the usual quantum statistical rules will naturally emerge at the pragmatic level, in cases where the reason behind nature's choice of response is unknown, but that the usual statistics can become biased in an empirically manifest way when the reason for the choice is empirically identifiable. It is shown here that if the statistical laws of quantum mechanics were to be biased in this way then the basically forward-in-time unfolding of empirical reality described by orthodox quantum mechanics would generate the appearances of backward-time-effects of the kind that have been reported in the scientific literature.

  20. Resource Utilization and Site Selection for a Self-Sufficient Martian Outpost

    NASA Technical Reports Server (NTRS)

    Barker, Donald; Chamitoff, Gregory; James, George

    1998-01-01

    As a planet with striking similarities to Earth, Mars is an important focus for scientific research aimed at understanding the processes of planetary evolution and the formation of our solar system. Fortunately, Mars is also a planet with abundant natural resources, including assessible materials that can be used to support human life and to sustain a self-sufficient martian outpost. Resources required include water, breathable air, food, shelter, energy, and fuel. Through a mission design based on in situ resource development, we can establish a permanent outpost on Mars beginning with the first manned mission. This paper examines the potential for supporting the first manned mission with the objective of achieving self-sufficiency through well-understood resource development and a program of rigorous scientific research aimed at extending that capability. We examine the potential for initially extracting critical resources from the martian environment, and discuss the scientific investigations required to identify additional resources in the atmosphere, on the surface, and within the subsurface. We also discuss our current state of knowledge of Mars, technical considerations of resource utilization, and using unmanned missions' data for selecting an optimal site. The primary goal of achieving self-sufficiency on Mars would accelerate the development of human colonization beyond Earth, while providing a robust and permanent martian base from which humans can explore and conduct long-term research on planetary evolution, the solar system, and life itself.

  1. MSEBAG: a dynamic classifier ensemble generation based on `minimum-sufficient ensemble' and bagging

    NASA Astrophysics Data System (ADS)

    Chen, Lei; Kamel, Mohamed S.

    2016-01-01

    In this paper, we propose a dynamic classifier system, MSEBAG, which is characterised by searching for the 'minimum-sufficient ensemble' and bagging at the ensemble level. It adopts an 'over-generation and selection' strategy and aims to achieve a good bias-variance trade-off. In the training phase, MSEBAG first searches for the 'minimum-sufficient ensemble', which maximises the in-sample fitness with the minimal number of base classifiers. Then, starting from the 'minimum-sufficient ensemble', a backward stepwise algorithm is employed to generate a collection of ensembles. The objective is to create a collection of ensembles with a descending fitness on the data, as well as a descending complexity in the structure. MSEBAG dynamically selects the ensembles from the collection for the decision aggregation. The extended adaptive aggregation (EAA) approach, a bagging-style algorithm performed at the ensemble level, is employed for this task. EAA searches for the competent ensembles using a score function, which takes into consideration both the in-sample fitness and the confidence of the statistical inference, and averages the decisions of the selected ensembles to label the test pattern. The experimental results show that the proposed MSEBAG outperforms the benchmarks on average.

  2. Redox self-sufficient whole cell biotransformation for amination of alcohols.

    PubMed

    Klatte, Stephanie; Wendisch, Volker F

    2014-10-15

    Whole cell biotransformation is an upcoming tool to replace common chemical routes for functionalization and modification of desired molecules. In the approach presented here the production of various non-natural (di)amines was realized using the designed whole cell biocatalyst Escherichia coli W3110/pTrc99A-ald-adh-ta with plasmid-borne overexpression of genes for an l-alanine dehydrogenase, an alcohol dehydrogenase and a transaminase. Cascading alcohol oxidation with l-alanine dependent transamination and l-alanine dehydrogenase allowed for redox self-sufficient conversion of alcohols to the corresponding amines. The supplementation of the corresponding (di)alcohol precursors as well as amino group donor l-alanine and ammonium chloride were sufficient for amination and redox cofactor recycling in a resting buffer system. The addition of the transaminase cofactor pyridoxal-phosphate and the alcohol dehydrogenase cofactor NAD(+) was not necessary to obtain complete conversion. Secondary and cyclic alcohols, for example, 2-hexanol and cyclohexanol were not aminated. However, efficient redox self-sufficient amination of aliphatic and aromatic (di)alcohols in vivo was achieved with 1-hexanol, 1,10-decanediol and benzylalcohol being aminated best.

  3. Are changes in MAPK/ERK necessary or sufficient for entrainment in chick pineal cells?

    PubMed

    Yadav, Geetha; Straume, Martin; Heath, James; Zatz, Martin

    2003-11-05

    Chick pineal cells in culture display a circadian rhythm of melatonin release. Light pulses can entrain (phase shift) the rhythm. One candidate for the photoentrainment pathway uses a mitogen-activated protein kinase (MAPK), also known as extracellular signal-regulated kinase (ERK). We tested the hypothesis that activation of ERK (by phosphorylation to p-ERK) is necessary and/or sufficient for entrainment by measuring the ability of several drugs, light, and other perturbations to change levels of p-ERK and to induce phase shifts in the melatonin rhythm. If changes in the levels of p-ERK are sufficient for photoentrainment, then all perturbations that reduce its level must induce light-like phase shifts, and all those that increase its level must induce dark-like phase shifts. If such changes are necessary for photoentrainment, then light pulses must reduce p-ERK levels, and the duration of the light pulse, the magnitude and duration of the change in p-ERK, and the size of the phase shift must correlate. We found five perturbations that reduced p-ERK levels. Of these, two induced light-like phase shifts (PD 98059 and caffeine), one induced dark-like phase shifts (SB203580), and two did not induce phase shifts at all (U0126 and omitting a medium change). Serum increased p-ERK levels without inducing any phase shifts. Finally, light pulses did not elicit changes in p-ERK, nor was there a diurnal rhythm in p-ERK levels, nor could rapid changes in p-ERK levels have accounted for duration effects of light pulses on phase shifts. Taken together, these results argue strongly against the hypothesis that reduction (or increases) in MAPK/ERK activation is necessary or sufficient for entrainment in chick pineal cells.

  4. Purified TMEM16A is sufficient to form Ca2+-activated Cl− channels

    PubMed Central

    Terashima, Hiroyuki; Picollo, Alessandra; Accardi, Alessio

    2013-01-01

    Ca2+-activated Cl− channels (CaCCs) are key regulators of numerous physiological functions, ranging from electrolyte secretion in airway epithelia to cellular excitability in sensory neurons and muscle fibers. Recently, TMEM16A (ANO1) and -B were shown to be critical components of CaCCs. It is still unknown whether they are also sufficient to form functional CaCCs, or whether association with other subunits is required. Recent reports suggest that the Ca2+ sensitivity of TMEM16A is mediated by its association with calmodulin, suggesting that functional CaCCs are heteromultimers. To test whether TMEM16A is necessary and sufficient to form functional CaCCs, we expressed, purified, and reconstituted human TMEM16A. The purified protein mediates Ca2+-dependent Cl− transport with submicromolar sensitivity to Ca2+, consistent with what is seen in patch–clamp experiments. The channel is synergistically gated by Ca2+ and voltage, so that opening is promoted by depolarizing potentials. Mutating two conserved glutamates in the TM6-7 intracellular loop selectively abolishes the Ca2+ dependence of reconstituted TMEM16A, in a manner similar to what was reported for the heterologously expressed channel. Well-characterized CaCC blockers inhibit Cl− transport with Kis comparable to those measured for native and heterologously expressed CaCCs. Finally, direct physical interactions between calmodulin and TMEM16A could not be detected in copurification experiments or in functional assays. Our results demonstrate that purified TMEM16A is necessary and sufficient to recapitulate the biophysical and pharmacological properties of native and heterologously expressed CaCCs. Our results also show that association of TMEM16A with other proteins, such as calmodulin, is not required for function. PMID:24167264

  5. On the role of budget sufficiency, cost efficiency, and uncertainty in species management

    USGS Publications Warehouse

    van der Burg, Max Post; Bly, Bartholomew B.; Vercauteren, Tammy; Grand, James B.; Tyre, Andrew J.

    2014-01-01

    Many conservation planning frameworks rely on the assumption that one should prioritize locations for management actions based on the highest predicted conservation value (i.e., abundance, occupancy). This strategy may underperform relative to the expected outcome if one is working with a limited budget or the predicted responses are uncertain. Yet, cost and tolerance to uncertainty rarely become part of species management plans. We used field data and predictive models to simulate a decision problem involving western burrowing owls (Athene cunicularia hypugaea) using prairie dog colonies (Cynomys ludovicianus) in western Nebraska. We considered 2 species management strategies: one maximized abundance and the other maximized abundance in a cost-efficient way. We then used heuristic decision algorithms to compare the 2 strategies in terms of how well they met a hypothetical conservation objective. Finally, we performed an info-gap decision analysis to determine how these strategies performed under different budget constraints and uncertainty about owl response. Our results suggested that when budgets were sufficient to manage all sites, the maximizing strategy was optimal and suggested investing more in expensive actions. This pattern persisted for restricted budgets up to approximately 50% of the sufficient budget. Below this budget, the cost-efficient strategy was optimal and suggested investing in cheaper actions. When uncertainty in the expected responses was introduced, the strategy that maximized abundance remained robust under a sufficient budget. Reducing the budget induced a slight trade-off between expected performance and robustness, which suggested that the most robust strategy depended both on one's budget and tolerance to uncertainty. Our results suggest that wildlife managers should explicitly account for budget limitations and be realistic about their expected levels of performance.

  6. Virtual water and water self-sufficiency in agricultural and livestock products in Brazil.

    PubMed

    da Silva, Vicente de Paulo R; de Oliveira, Sonaly D; Braga, Célia C; Brito, José Ivaldo B; de Sousa, Francisco de Assis S; de Holanda, Romildo M; Campos, João Hugo B C; de Souza, Enio P; Braga, Armando César R; Rodrigues Almeida, Rafaela S; de Araújo, Lincoln E

    2016-12-15

    Virtual water trade is often considered a solution for restricted water availability in many regions of the world. Brazil is the world leader in the production and export of various agricultural and livestock products. The country is either a strong net importer or a strong net exporter of these products. The objective of this study is to determine the volume of virtual water contained in agricultural and livestock products imported/exported by Brazil from 1997 to 2012, and to define the water self-sufficiency index of agricultural and livestock products in Brazil. The indexes of water scarcity (WSI), water dependency (WDI) and water self-sufficiency (WSSI) were calculated for each Brazilian state. These indexes and the virtual water balance were calculated following the methodology developed by Chapagain and Hoekstra (2008) and Hoekstra and Hung (2005). The total water exports and imports embedded in agricultural and livestock products were 5.28 × 10(10) and 1.22 × 10(10) Gm(3) yr(-1), respectively, which results in positive virtual water balance of 4.05 × 10(10) Gm(3) yr(-1). Brazil is either a strong net importer or a strong net exporter of agricultural and livestock products among the Mercosur countries. Brazil has a positive virtual water balance of 1.85 × 10(10) Gm(3) yr(-1). The indexes used in this study reveal that Brazil is self-sufficient in food production, except for a few products such as wheat and rice. Horticultural products (tomato, onion, potato, cassava and garlic) make up a unique product group with negative virtual water balance in Brazil.

  7. Aging, primary care, and self-sufficiency: health care workforce challenges ahead.

    PubMed

    Mullan, Fitzhugh; Frehywot, Seble; Jolley, Laura J

    2008-01-01

    A combination of "environmental factors" in the U.S. has led to an increased demand for health care professionals. However, there has been a significant decrease in the number of U.S. medical graduates selecting careers in family medicine and general internal medicine, thus driving demand for international medical graduates. At the heart of our national workforce policy needs to be good domestic and foreign policies, such as self-sufficiency approaches that include strategies to incentivize rural and underserved practice for U.S. medical graduates.

  8. Impact of Market Behavior, Fleet Composition, and Ancillary Services on Revenue Sufficiency

    SciTech Connect

    Frew, Bethany; Gallo, Giulia; Brinkman, Gregory; Milligan, Michael; Clark, Kara; Bloom, Aaron

    2016-06-01

    Revenue insufficiency, or the missing money problem, occurs when the revenues that generators earn from the market are not sufficient to cover both fixed and variable costs to remain in the market and/or justify investments in new capacity, which may be needed for reliability. The near-zero marginal cost of variable renewable generators further exacerbates these revenue challenges. Estimating the extent of the missing money problem in current electricity markets is an important, nontrivial task that requires representing both how the power system operates and how market participants behave. This paper explores the missing money problem using a production cost model that represented a simplified version of the Electric Reliability Council of Texas (ERCOT) energy-only market for the years 2012-2014. We evaluate how various market structures -- including market behavior, ancillary services, and changing fleet compositions -- affect net revenues in this ERCOT-like system. In most production cost modeling exercises, resources are assumed to offer their marginal capabilities at marginal costs. Although this assumption is reasonable for feasibility studies and long-term planning, it does not adequately consider the market behaviors that impact revenue sufficiency. In this work, we simulate a limited set of market participant strategic bidding behaviors by means of different sets of markups; these markups are applied to the true production costs of all gas generators, which are the most prominent generators in ERCOT. Results show that markups can help generators increase their net revenues overall, although net revenues may increase or decrease depending on the technology and the year under study. Results also confirm that conventional, variable-cost-based production cost simulations do not capture prices accurately, and this particular feature calls for proxies for strategic behaviors (e.g., markups) and more accurate representations of how electricity markets work. The

  9. Analyzing the Impacts of Increased Wind Power on Generation Revenue Sufficiency: Preprint

    SciTech Connect

    Wang, Qin; Wu, Hongyu; Tan, Jin; Hodge, Bri-Mathias; Li, Wanning; Luo, Cheng

    2016-08-01

    The Revenue Sufficiency Guarantee (RSG), as part of make-whole (or uplift) payments in electricity markets, is designed to recover the generation resources' offer-based production costs that are not otherwise covered by their market revenues. Increased penetrations of wind power will bring significant impacts to the RSG payments in the markets. However, literature related to this topic is sparse. This paper first reviews the industrial practices of implementing RSG in major U.S. independent system operators (ISOs) and regional transmission operators (RTOs) and then develops a general RSG calculation method. Finally, an 18-bus test system is adopted to demonstrate the impacts of increased wind power on RSG payments.

  10. Necessary and sufficient conditions for local unitary equivalence of multiqubit states

    NASA Astrophysics Data System (ADS)

    Martins, A. M.

    2015-04-01

    We derive the necessary and sufficient conditions for the local unitary (LU) equivalence of two general (pure or mixed) n -qubit states and determine the local unitary operators connecting them. Almost all relevant information is contained in the one-qubit reduced matrices of the multiqubit states under investigation. Our technique relies on identifying ab initio all local symmetries and the corresponding local cyclic unitary operators. To derive the above conditions we use the reference forms of the multiqubit states whose definition requires the diagonalization of the one-qubit reduced matrices. Based on those conditions, we propose a straightforward protocol to decide whether or not two n -qubit states are LU equivalent.

  11. Analyzing the Impacts of Increased Wind Power on Generation Revenue Sufficiency

    SciTech Connect

    Wang, Qin; Wu, Hongyu; Tan, Jin; Hodge, Bri-Mathias; Li, Wanning; Luo, Cheng

    2016-11-14

    The Revenue Sufficiency Guarantee (RSG), as part of make-whole (or uplift) payments in electricity markets, is designed to recover the generation resources' offer-based production costs that are not otherwise covered by their market revenues. Increased penetrations of wind power will bring significant impacts to the RSG payments in the markets. However, literature related to this topic is sparse. This paper first reviews the industrial practices of implementing RSG in major U.S. independent system operators (ISOs) and regional transmission operators (RTOs) and then develops a general RSG calculation method. Finally, an 18-bus test system is adopted to demonstrate the impacts of increased wind power on RSG payments.

  12. Sufficient conditions for rate-independent hysteresis in autoregressive identified models

    NASA Astrophysics Data System (ADS)

    Martins, Samir Angelo Milani; Aguirre, Luis Antonio

    2016-06-01

    This paper shows how hysteresis can be described using polynomial models and what are the sufficient conditions to be met by the model in order to have hysteresis. Such conditions are related to the model equilibria, to the forcing function and to certain term clusters in the polynomial models. The main results of the paper are used in the identification and analysis of nonlinear models estimated from data produced by a magneto-rheological damper (MRD) model with Bouc-Wen rate-independent hysteresis. A striking feature of the identified model is its simplicity and this could turn out to be a key factor in controller design.

  13. Stability boundaries and sufficient stability conditions for stably stratified, monotonic shear flows

    NASA Astrophysics Data System (ADS)

    Hirota, Makoto; Morrison, Philip J.

    2016-05-01

    Linear stability of inviscid, parallel, and stably stratified shear flow is studied under the assumption of smooth strictly monotonic profiles of shear flow and density, so that the local Richardson number is positive everywhere. The marginally unstable modes are systematically found by solving a one-parameter family of regular Sturm-Liouville problems, which can determine the stability boundaries more efficiently than solving the Taylor-Goldstein equation directly. By arguing for the non-existence of a marginally unstable mode, we derive new sufficient conditions for stability, which generalize the Rayleigh-Fjørtoft criterion for unstratified shear flows.

  14. The Autonomous House: A Bio-Hydrogen Based Energy Self-Sufficient Approach

    PubMed Central

    Chen, Shang-Yuan; Chu, Chen-Yeon; Cheng, Ming-jen; Lin, Chiu-Yue

    2009-01-01

    In the wake of the greenhouse effect and global energy crisis, finding sources of clean, alternative energy and developing everyday life applications have become urgent tasks. This study proposes the development of an “autonomous house” emphasizing the use of modern green energy technology to reduce environmental load, achieve energy autonomy and use energy intelligently in order to create a sustainable, comfortable living environment. The houses’ two attributes are: (1) a self-sufficient energy cycle and (2) autonomous energy control to maintain environmental comfort. The autonomous house thus combines energy-conserving, carbon emission-reducing passive design with active elements needed to maintain a comfortable environment. PMID:19440531

  15. The autonomous house: a bio-hydrogen based energy self-sufficient approach.

    PubMed

    Chen, Shang-Yuan; Chu, Chen-Yeon; Cheng, Ming-Jen; Lin, Chiu-Yue

    2009-04-01

    In the wake of the greenhouse effect and global energy crisis, finding sources of clean, alternative energy and developing everyday life applications have become urgent tasks. This study proposes the development of an "autonomous house" emphasizing the use of modern green energy technology to reduce environmental load, achieve energy autonomy and use energy intelligently in order to create a sustainable, comfortable living environment. The houses' two attributes are: (1) a self-sufficient energy cycle and (2) autonomous energy control to maintain environmental comfort. The autonomous house thus combines energy-conserving, carbon emission-reducing passive design with active elements needed to maintain a comfortable environment.

  16. Necessary and Sufficient Process leading to Work Smart Standards. Final report

    SciTech Connect

    1996-11-01

    The Necessary and Sufficient Process leading to Work Smart Standards is a Department of Energy initiative to assure adequate protection for workers, the public, and the environment. The Work Smart Standards initiative directs the Laboratory to develop a set of ES and H standards based on the work performed at the Laboratory and the hazards associated with the work. Berkeley Lab`s set of Work Smart Standards includes required Federal, State and local laws and, additionally, national and international standards which represent the highest operating standards of industrial and commercial institutions.

  17. Sufficient oxygen for animal respiration 1,400 million years ago.

    PubMed

    Zhang, Shuichang; Wang, Xiaomei; Wang, Huajian; Bjerrum, Christian J; Hammarlund, Emma U; Costa, M Mafalda; Connelly, James N; Zhang, Baomin; Su, Jin; Canfield, Donald E

    2016-02-16

    The Mesoproterozoic Eon [1,600-1,000 million years ago (Ma)] is emerging as a key interval in Earth history, with a unique geochemical history that might have influenced the course of biological evolution on Earth. Indeed, although this time interval is rather poorly understood, recent chromium isotope results suggest that atmospheric oxygen levels were <0.1% of present levels, sufficiently low to have inhibited the evolution of animal life. In contrast, using a different approach, we explore the distribution and enrichments of redox-sensitive trace metals in the 1,400 Ma sediments of Unit 3 of the Xiamaling Formation, North China Block. Patterns of trace metal enrichments reveal oxygenated bottom waters during deposition of the sediments, and biomarker results demonstrate the presence of green sulfur bacteria in the water column. Thus, we document an ancient oxygen minimum zone. We develop a simple, yet comprehensive, model of marine carbon-oxygen cycle dynamics to show that our geochemical results are consistent with atmospheric oxygen levels >4% of present-day levels. Therefore, in contrast to previous suggestions, we show that there was sufficient oxygen to fuel animal respiration long before the evolution of animals themselves.

  18. Plasma membrane restricted RhoGEF activity is sufficient for RhoA-mediated actin polymerization

    PubMed Central

    van Unen, Jakobus; Reinhard, Nathalie R.; Yin, Taofei; Wu, Yi I.; Postma, Marten; Gadella, Theodorus W.J.; Goedhart, Joachim

    2015-01-01

    The small GTPase RhoA is involved in cell morphology and migration. RhoA activity is tightly regulated in time and space and depends on guanine exchange factors (GEFs). However, the kinetics and subcellular localization of GEF activity towards RhoA are poorly defined. To study the mechanism underlying the spatiotemporal control of RhoA activity by GEFs, we performed single cell imaging with an improved FRET sensor reporting on the nucleotide loading state of RhoA. By employing the FRET sensor we show that a plasma membrane located RhoGEF, p63RhoGEF, can rapidly activate RhoA through endogenous GPCRs and that localized RhoA activity at the cell periphery correlates with actin polymerization. Moreover, synthetic recruitment of the catalytic domain derived from p63RhoGEF to the plasma membrane, but not to the Golgi apparatus, is sufficient to activate RhoA. The synthetic system enables local activation of endogenous RhoA and effectively induces actin polymerization and changes in cellular morphology. Together, our data demonstrate that GEF activity at the plasma membrane is sufficient for actin polymerization via local RhoA signaling. PMID:26435194

  19. Application of nitrogen sufficiency conversion strategy for microalgae-based ammonium-rich wastewater treatment.

    PubMed

    Wang, Jinghan; Zhou, Wenguang; Yang, Haizhen; Ruan, Roger

    2016-10-01

    Ammonium ([Formula: see text]-N)-rich wastewater, a main cause for eutrophication, can serve as a promising medium for fast microalgae cultivation with efficient [Formula: see text]-N removal. To achieve this goal, a well-controlled three-stage treatment process was developed. Two trophic modes (mixotrophy and heterotrophy) in Stage 1 and Stage 2, with two nitrogen availability conditions (N sufficient and N deprived) in Stage 2, and different [Formula: see text]-N concentrations in Stage 3 were compared to investigate the effects of nitrogen sufficiency conversion on indigenous strain UMN266 for [Formula: see text]-N removal. Results showed that mixotrophic cultures in the first two stages with N deprivation in Stage 2 was the optimum treatment strategy, and higher [Formula: see text]-N concentration in Stage 3 facilitated both microalgal growth and [Formula: see text]-N removal, with average and maximum biomass productivity of 55.3 and 161.0 mg L(-1) d(-1), and corresponding removal rates of 4.2 and 15.0 mg L(-1) d(-1), respectively, superior to previously published results. Observations of intracellular compositions confirmed the optimum treatment strategy, discovering excellent starch accumulating property of strain UMN266 as well. Combination of bioethanol production with the proposed three-stage process using various real wastewater streams at corresponding stages was suggested for future application.

  20. Nitric oxide is neither necessary nor sufficient for resolution of Plasmodium chabaudi malaria in mice.

    PubMed

    van der Heyde, H C; Gu, Y; Zhang, Q; Sun, G; Grisham, M B

    2000-09-15

    Malaria is a life-threatening re-emerging disease, yet it is still not clear how bloodstage malarial parasites are killed. Nitric oxide (NO), which has potent anti-microbial activity, may represent an important killing mechanism. The production of NO during descending Plasmodium chabaudi parasitemia, a period when parasites are killed by the immune response, supports this concept. However, NOS20/0 and NOS30/0 mice as well as mice treated with NO synthase 2 (NOS2) inhibitors do not develop exacerbated malaria, indicating that NO production is not necessary for the suppression of P. chabaudi parasitemia. It is possible due to the plasticity in the immune response during malaria that Ab-mediated immunity is enhanced in the absence of NO, thereby explaining the lack of exacerbated malaria in NOS-deficient mice even though NO may function in protection. However, NOS2- and B cell-deficient mice, which cannot use Ab-mediated immunity, suppress their parasitemia with a similar time course as B cell-deficient controls. C57BL/6 mice treated with Propionibacterium acnes to elicit high levels of macrophage-derived NO have a similar time course of P. chabaudi parasitemia as P. acnes-treated NOS20/0 mice, which do not produce NO; this indicates that NO is not sufficient for parasite killing. Collectively, these results indicate that NO is not necessary or sufficient to resolve P. chabaudi malaria.

  1. Necessary and sufficient liveness condition of GS3PR Petri nets

    NASA Astrophysics Data System (ADS)

    Liu, GaiYun; Barkaoui, Kamel

    2015-05-01

    Structural analysis is one of the most important and efficient methods to investigate the behaviour of Petri nets. Liveness is a significant behavioural property of Petri nets. Siphons, as structural objects of a Petri net, are closely related to its liveness. Many deadlock control policies for flexible manufacturing systems (FMS) modelled by Petri nets are implemented via siphon control. Most of the existing methods design liveness-enforcing supervisors by adding control places for siphons based on their controllability conditions. To compute a liveness-enforcing supervisor with as much as permissive behaviour, it is both theoretically and practically significant to find an exact controllability condition for siphons. However, the existing conditions, max, max‧, and max″-controllability of siphons are all overly restrictive and generally sufficient only. This paper develops a new condition called max*-controllability of the siphons in generalised systems of simple sequential processes with resources (GS3PR), which are a net subclass that can model many real-world automated manufacturing systems. We show that a GS3PR is live if all its strict minimal siphons (SMS) are max*-controlled. Compared with the existing conditions, i.e., max-, max‧-, and max″-controllability of siphons, max*-controllability of the SMS is not only sufficient but also necessary. An example is used to illustrate the proposed method.

  2. Knowledge of response location alone is not sufficient to generate social inhibition of return.

    PubMed

    Welsh, Timothy N; Manzone, Joseph; McDougall, Laura

    2014-11-01

    Previous research has revealed that the inhibition of return (IOR) effect emerges when individuals respond to a target at the same location as their own previous response or the previous response of a co-actor. The latter social IOR effect is thought to occur because the observation of co-actor's response evokes a representation of that action in the observer and that the observation-evoked response code subsequently activates the inhibitory mechanisms underlying IOR. The present study was conducted to determine if knowledge of the co-actor's response alone is sufficient to evoke social IOR. Pairs of participants completed responses to targets that appeared at different button locations. Button contact generated location-contingent auditory stimuli (high and low tones in Experiment 1 and colour words in Experiment 2). In the Full condition, the observer saw the response and heard the auditory stimuli. In the Auditory Only condition, the observer did not see the co-actor's response, but heard the auditory stimuli generated via button contact to indicate response endpoint. It was found that, although significant individual and social IOR effects emerged in the Full conditions, there were no social IOR effects in the Auditory Only conditions. These findings suggest that knowledge of the co-actor's response alone via auditory information is not sufficient to activate the inhibitory processes leading to IOR. The activation of the mechanisms that lead to social IOR seems to be dependent on processing channels that code the spatial characteristics of action.

  3. Revenue Sufficiency and Reliability in a Zero Marginal Cost Future: Preprint

    SciTech Connect

    Frew, Bethany A.; Milligan, Michael; Brinkman, Greg; Bloom, Aaron; Clark, Kara; Denholm, Paul

    2016-12-01

    Features of existing wholesale electricity markets, such as administrative pricing rules and policy-based reliability standards, can distort market incentives from allowing generators sufficient opportunities to recover both fixed and variable costs. Moreover, these challenges can be amplified by other factors, including (1) inelastic demand resulting from a lack of price signal clarity, (2) low- or near-zero marginal cost generation, particularly arising from low natural gas fuel prices and variable generation (VG), such as wind and solar, and (3) the variability and uncertainty of this VG. As power systems begin to incorporate higher shares of VG, many questions arise about the suitability of the existing marginal-cost-based price formation, primarily within an energy-only market structure, to ensure the economic viability of resources that might be needed to provide system reliability. This article discusses these questions and provides a summary of completed and ongoing modelling-based work at the National Renewable Energy Laboratory to better understand the impacts of evolving power systems on reliability and revenue sufficiency.

  4. The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

    PubMed

    Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

    2011-01-01

    The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.

  5. Comparison of methods for calculating conditional expectations of sufficient statistics for continuous time Markov chains

    PubMed Central

    2011-01-01

    Background Continuous time Markov chains (CTMCs) is a widely used model for describing the evolution of DNA sequences on the nucleotide, amino acid or codon level. The sufficient statistics for CTMCs are the time spent in a state and the number of changes between any two states. In applications past evolutionary events (exact times and types of changes) are unaccessible and the past must be inferred from DNA sequence data observed in the present. Results We describe and implement three algorithms for computing linear combinations of expected values of the sufficient statistics, conditioned on the end-points of the chain, and compare their performance with respect to accuracy and running time. The first algorithm is based on an eigenvalue decomposition of the rate matrix (EVD), the second on uniformization (UNI), and the third on integrals of matrix exponentials (EXPM). The implementation in R of the algorithms is available at http://www.birc.au.dk/~paula/. Conclusions We use two different models to analyze the accuracy and eight experiments to investigate the speed of the three algorithms. We find that they have similar accuracy and that EXPM is the slowest method. Furthermore we find that UNI is usually faster than EVD. PMID:22142146

  6. Neurite beading is sufficient to decrease the apparent diffusion coefficient after ischemic stroke.

    PubMed

    Budde, Matthew D; Frank, Joseph A

    2010-08-10

    Diffusion-weighted MRI (DWI) is a sensitive and reliable marker of cerebral ischemia. Within minutes of an ischemic event in the brain, the microscopic motion of water molecules measured with DWI, termed the apparent diffusion coefficient (ADC), decreases within the infarcted region. However, although the change is related to cell swelling, the precise pathological mechanism remains elusive. We show that focal enlargement and constriction, or beading, in axons and dendrites are sufficient to substantially decrease ADC. We first derived a biophysical model of neurite beading, and we show that the beaded morphology allows a larger volume to be encompassed within an equivalent surface area and is, therefore, a consequence of osmotic imbalance after ischemia. The DWI experiment simulated within the model revealed that intracellular ADC decreased by 79% in beaded neurites compared with the unbeaded form. To validate the model experimentally, excised rat sciatic nerves were subjected to stretching, which induced beading but did not cause a bulk shift of water into the axon (i.e., swelling). Beading-induced changes in cell-membrane morphology were sufficient to significantly hinder water mobility and thereby decrease ADC, and the experimental measurements were in excellent agreement with the simulated values. This is a demonstration that neurite beading accurately captures the diffusion changes measured in vivo. The results significantly advance the specificity of DWI in ischemia and other acute neurological injuries and will greatly aid the development of treatment strategies to monitor and repair damaged brain in both clinical and experimental settings.

  7. Measuring what latent fingerprint examiners consider sufficient information for individualization determinations.

    PubMed

    Ulery, Bradford T; Hicklin, R Austin; Roberts, Maria Antonia; Buscaglia, JoAnn

    2014-01-01

    Latent print examiners use their expertise to determine whether the information present in a comparison of two fingerprints (or palmprints) is sufficient to conclude that the prints were from the same source (individualization). When fingerprint evidence is presented in court, it is the examiner's determination--not an objective metric--that is presented. This study was designed to ascertain the factors that explain examiners' determinations of sufficiency for individualization. Volunteer latent print examiners (n = 170) were each assigned 22 pairs of latent and exemplar prints for examination, and annotated features, correspondence of features, and clarity. The 320 image pairs were selected specifically to control clarity and quantity of features. The predominant factor differentiating annotations associated with individualization and inconclusive determinations is the count of corresponding minutiae; other factors such as clarity provided minimal additional discriminative value. Examiners' counts of corresponding minutiae were strongly associated with their own determinations; however, due to substantial variation of both annotations and determinations among examiners, one examiner's annotation and determination on a given comparison is a relatively weak predictor of whether another examiner would individualize. The extensive variability in annotations also means that we must treat any individual examiner's minutia counts as interpretations of the (unknowable) information content of the prints: saying "the prints had N corresponding minutiae marked" is not the same as "the prints had N corresponding minutiae." More consistency in annotations, which could be achieved through standardization and training, should lead to process improvements and provide greater transparency in casework.

  8. Sufficient oxygen for animal respiration 1,400 million years ago

    PubMed Central

    Zhang, Shuichang; Wang, Xiaomei; Wang, Huajian; Bjerrum, Christian J.; Hammarlund, Emma U.; Costa, M. Mafalda; Connelly, James N.; Zhang, Baomin; Su, Jin; Canfield, Donald E.

    2016-01-01

    The Mesoproterozoic Eon [1,600–1,000 million years ago (Ma)] is emerging as a key interval in Earth history, with a unique geochemical history that might have influenced the course of biological evolution on Earth. Indeed, although this time interval is rather poorly understood, recent chromium isotope results suggest that atmospheric oxygen levels were <0.1% of present levels, sufficiently low to have inhibited the evolution of animal life. In contrast, using a different approach, we explore the distribution and enrichments of redox-sensitive trace metals in the 1,400 Ma sediments of Unit 3 of the Xiamaling Formation, North China Block. Patterns of trace metal enrichments reveal oxygenated bottom waters during deposition of the sediments, and biomarker results demonstrate the presence of green sulfur bacteria in the water column. Thus, we document an ancient oxygen minimum zone. We develop a simple, yet comprehensive, model of marine carbon−oxygen cycle dynamics to show that our geochemical results are consistent with atmospheric oxygen levels >4% of present-day levels. Therefore, in contrast to previous suggestions, we show that there was sufficient oxygen to fuel animal respiration long before the evolution of animals themselves. PMID:26729865

  9. Necessary and sufficient conditions for multipartite Bell violations with only one trusted device

    NASA Astrophysics Data System (ADS)

    Taddei, M. M.; Nery, R. V.; Aolita, L.

    2016-09-01

    We study multipartite Bell nonlocality in a framework native of multipartite Einstein-Podolsky-Rosen (EPR) steering scenarios with a single trusted measurement device. We derive a closed-form necessary and sufficient criterion for systems composed of a qubit and N -1 untrusted black-box measurement devices to violate, under general dichotomic measurements on the qubit, a generic Bell inequality from a broad family of linear inequalities with arbitrarily many outputs for the N -1 untrusted devices and inputs for all N parties. The optimal quantum measurements for maximal violation are also obtained. For two users and two inputs and two outputs per user, our criterion becomes necessary and sufficient for Bell nonlocality. Furthermore, in that setting, its form generalizes recently obtained steering inequalities, which allows us to provide useful feedback from nonlocality to the detection of steering. Our findings constitute a practical tool for the study of the interplay between EPR steering and Bell nonlocality, with potential applications in multipartite information processing.

  10. Pulmonary lesions induced by Pasteurella haemolytica in neutrophil sufficient and neutrophil deficient calves.

    PubMed Central

    Breider, M A; Walker, R D; Hopkins, F M; Schultz, T W; Bowersock, T L

    1988-01-01

    The role of neutrophils in the development of peracute lung lesions of bovine pneumonic pasteurellosis was investigated. Eight calves were divided into two groups of four calves each. Group I was treated with intravenous phosphate-buffered saline and served as the neutrophil sufficient calves. Group II was treated with intravenous hydroxyurea which produced a state of neutropenia. When peripheral blood neutrophil numbers dropped below 300 cells/microL in group II, all calves were challenged with an intrabronchial bolus of Pasteurella haemolytica in the log phase of growth. An acute inflammatory process occurred in both groups of calves indicated by a rise in body temperature. While pulmonary lesions occurred in both groups by six hours postinoculation, they varied in pathological characteristics. Pulmonary lesions in the neutrophil sufficient calves consisted of fibrinopurulent alveolitis-bronchiolitis with associated alveolar septal necrosis, interlobular edema, and intravascular thrombi. The neutrophil deficient calves had extensive intra-alveolar edema, interlobular edema, intraalveolar hemorrhage, atelectasis, and focal areas of alveolar septal necrosis. These results show that P. haemolytica can induce severe pulmonary tissue damage through both neutrophil dependent and neutrophil independent mechanisms. Images Fig. 1. Fig. 2. PMID:3370555

  11. Human papillomavirus causes an angiogenic switch in keratinocytes which is sufficient to alter endothelial cell behavior

    SciTech Connect

    Chen, W.; Li, F.; Mead, L.; White, H.; Walker, J.; Ingram, D.A.; Roman, A.

    2007-10-10

    One of the requirements for tumor growth is the ability to recruit a blood supply, a process known as angiogenesis. Angiogenesis begins early in the progression of cervical disease from mild to severe dysplasia and on to invasive cancer. We have previously reported that expression of human papillomavirus type 16 E6 and E7 (HPV16 E6E7) proteins in primary foreskin keratinocytes (HFKs) decreases expression of two inhibitors and increases expression of two angiogenic inducers [Toussaint-Smith, E., Donner, D.B., Roman, A., 2004. Expression of human papillomavirus type 16 E6 and E7 oncoproteins in primary foreskin keratinocytes is sufficient to alter the expression of angiogenic factors. Oncogene 23, 2988-2995]. Here we report that HPV-induced early changes in the keratinocyte phenotype are sufficient to alter endothelial cell behavior both in vitro and in vivo. Conditioned media from HPV16 E6E7 expressing HFKs as well as from human cervical keratinocytes containing the intact HPV16 were able to stimulate proliferation and migration of human microvascular endothelial cells. In addition, introduction of the conditioned media into immunocompetent mice using a Matrigel plug model resulted in a clear angiogenic response. These novel data support the hypothesis that HPV proteins contribute not only to the uncontrolled keratinocyte growth seen following HPV infection but also to the angiogenic response needed for tumor formation.

  12. Hydrodynamic property of the cytoplasm is sufficient to mediate cytoplasmic streaming in the Caenorhabditis elegans embryo.

    PubMed

    Niwayama, Ritsuya; Shinohara, Kyosuke; Kimura, Akatsuki

    2011-07-19

    Cytoplasmic streaming is a type of intracellular transport widely seen in nature. Cytoplasmic streaming in Caenorhabditis elegans at the one-cell stage is bidirectional; the flow near the cortex ("cortical flow") is oriented toward the anterior, whereas the flow in the central region ("cytoplasmic flow") is oriented toward the posterior. Both cortical flow and cytoplasmic flow depend on non-muscle-myosin II (NMY-2), which primarily localizes in the cortex. The manner in which NMY-2 proteins drive cytoplasmic flow in the opposite direction from remote locations has not been fully understood. In this study, we demonstrated that the hydrodynamic properties of the cytoplasm are sufficient to mediate the forces generated by the cortical myosin to drive bidirectional streaming throughout the cytoplasm. We quantified the flow velocities of cytoplasmic streaming using particle image velocimetry (PIV) and conducted a three-dimensional hydrodynamic simulation using the moving particle semiimplicit method. Our simulation quantitatively reconstructed the quantified flow velocity distribution resolved through PIV analysis. Furthermore, our PIV analyses detected microtubule-dependent flows during the pronuclear migration stage. These flows were reproduced via hydrodynamic interactions between moving pronuclei and the cytoplasm. The agreement of flow dynamics in vivo and in simulation indicates that the hydrodynamic properties of the cytoplasm are sufficient to mediate cytoplasmic streaming in C. elegans embryos.

  13. Eyes only? Perceiving eye contact is neither sufficient nor necessary for attentional capture by face direction.

    PubMed

    Böckler, Anne; van der Wel, Robrecht P R D; Welsh, Timothy N

    2015-09-01

    Direct eye contact and motion onset both constitute powerful cues that capture attention. Recent research suggests that (social) gaze and (non-social) motion onset influence information processing in parallel, even when combined as sudden onset direct gaze cues (i.e., faces suddenly establishing eye contact). The present study investigated the role of eye visibility for attention capture by these sudden onset face cues. To this end, face direction was manipulated (away or towards onlooker) while faces had closed eyes (eliminating visibility of eyes, Experiment 1), wore sunglasses (eliminating visible eyes, but allowing for the expectation of eyes to be open, Experiment 2), and were inverted with visible eyes (disrupting the integration of eyes and faces, Experiment 3). Participants classified targets appearing on one of four faces. Initially, two faces were oriented towards participants and two faces were oriented away from participants. Simultaneous to target presentation, one averted face became directed and one directed face became averted. Attention capture by face direction (i.e., facilitation for faces directed towards participants) was absent when eyes were closed, but present when faces wore sunglasses. Sudden onset direct faces can, hence, induce attentional capture, even when lacking eye cues. Inverted faces, by contrast, did not elicit attentional capture. Thus, when eyes cannot be integrated into a holistic face representation they are not sufficient to capture attention. Overall, the results suggest that visibility of eyes is neither necessary nor sufficient for the sudden direct face effect.

  14. Sufficient and necessary conditions for discrete-time nonlinear switched systems with uniform local exponential stability

    NASA Astrophysics Data System (ADS)

    Lu, Junjie; She, Zhikun

    2016-11-01

    In this paper, we investigate sufficient and necessary conditions of uniform local exponential stability (ULES) for the discrete-time nonlinear switched system (DTNSS). We start with the definition of T-step common Lyapunov functions (CLFs), which is a relaxation of traditional CLFs. Then, for a time-varying DTNSS, by constructing such a T-step CLF, a necessary and sufficient condition for its ULES is provided. Afterwards, we strengthen it based on a T-step Lipschitz continuous CLF. Especially, when the system is time-invariant, by the smooth approximation theorem, the Lipschitz continuity condition of T-step CLFs can further be replaced by continuous differentiability; and when the system is time-invariant and homogeneous, due to the extension of Weierstrass approximation theorem, T-step continuously differentiable CLFs can even be strengthened to be T-step polynomial CLFs. Furthermore, three illustrative examples are additionally used to explain our main contribution. In the end, an equivalence between time-varying DTNSSs and their corresponding linearisations is discussed.

  15. Increasing Adult Hippocampal Neurogenesis is Sufficient to Reduce Anxiety and Depression-Like Behaviors.

    PubMed

    Hill, Alexis S; Sahay, Amar; Hen, René

    2015-09-01

    Adult hippocampal neurogenesis is increased by antidepressants, and is required for some of their behavioral effects. However, it remains unclear whether expanding the population of adult-born neurons is sufficient to affect anxiety and depression-related behavior. Here, we use an inducible transgenic mouse model in which the pro-apoptotic gene Bax is deleted from neural stem cells and their progeny in the adult brain, and thereby increases adult neurogenesis. We find no effects on baseline anxiety and depression-related behavior; however, we find that increasing adult neurogenesis is sufficient to reduce anxiety and depression-related behaviors in mice treated chronically with corticosterone (CORT), a mouse model of stress. Thus, neurogenesis differentially affects behavior under baseline conditions and in a model of chronic stress. Moreover, we find no effect of increased adult hippocampal neurogenesis on hypothalamic-pituitary-adrenal (HPA) axis regulation, either at baseline or following chronic CORT administration, suggesting that increasing adult hippocampal neurogenesis can affect anxiety and depression-related behavior through a mechanism independent of the HPA axis. The use of future techniques to specifically inhibit BAX in the hippocampus could be used to augment adult neurogenesis, and may therefore represent a novel strategy to promote antidepressant-like behavioral effects.

  16. PT symmetry and necessary and sufficient conditions for the reality of energy eigenvalues

    NASA Astrophysics Data System (ADS)

    Bender, Carl M.; Mannheim, Philip D.

    2010-04-01

    The mathematical requirement that a Hamiltonian H be Hermitian is sufficient to guarantee the reality of its eigenvalues, but it is not necessary. By establishing three theorems, this Letter gives conditions that are both necessary and sufficient. First, it is shown that if the secular equation is real, the Hamiltonian is necessarily PT symmetric. Second, the set of all operators C that nontrivially obey the two equations [C,H]=0 and C=1 is introduced. For a diagonalizable PT-symmetric Hamiltonian it is shown that the set is nonempty and that the energy eigenvalues of H are all real only if every such C commutes with PT. There is at least one complex-conjugate pair of eigenvalues whenever at least one such C does not commute with PT. Third, the eigenvalues of any nondiagonalizable Jordan-block matrix that possesses just one eigenvector are all real if the block is PT symmetric, and are all complex if it is not. These theorems hold for matrix Hamiltonians of any finite dimensionality.

  17. Manipulation of BK channel expression is sufficient to alter auditory hair cell thresholds in larval zebrafish

    PubMed Central

    Rohmann, Kevin N.; Tripp, Joel A.; Genova, Rachel M.; Bass, Andrew H.

    2014-01-01

    Non-mammalian vertebrates rely on electrical resonance for frequency tuning in auditory hair cells. A key component of the resonance exhibited by these cells is an outward calcium-activated potassium current that flows through large-conductance calcium-activated potassium (BK) channels. Previous work in midshipman fish (Porichthys notatus) has shown that BK expression correlates with seasonal changes in hearing sensitivity and that pharmacologically blocking these channels replicates the natural decreases in sensitivity during the winter non-reproductive season. To test the hypothesis that reducing BK channel function is sufficient to change auditory thresholds in fish, morpholino oligonucleotides (MOs) were used in larval zebrafish (Danio rerio) to alter expression of slo1a and slo1b, duplicate genes coding for the pore-forming α-subunits of BK channels. Following MO injection, microphonic potentials were recorded from the inner ear of larvae. Quantitative real-time PCR was then used to determine the MO effect on slo1a and slo1b expression in these same fish. Knockdown of either slo1a or slo1b resulted in disrupted gene expression and increased auditory thresholds across the same range of frequencies of natural auditory plasticity observed in midshipman. We conclude that interference with the normal expression of individual slo1 genes is sufficient to increase auditory thresholds in zebrafish larvae and that changes in BK channel expression are a direct mechanism for regulation of peripheral hearing sensitivity among fishes. PMID:24803460

  18. Food Self-Sufficiency across scales: How local can we go?

    NASA Astrophysics Data System (ADS)

    Pradhan, Prajal; Lüdeke, Matthias K. B.; Reusser, Dominik E.; Kropp, Jürgen P.

    2013-04-01

    "Think global, act local" is a phrase often used in sustainability debates. Here, we explore the potential of regions to go for local supply in context of sustainable food consumption considering both the present state and the plausible future scenarios. We analyze data on the gridded crop calories production, the gridded livestock calories production, the gridded feed calories use and the gridded food calories consumption in 5' resolution. We derived these gridded data from various sources: Global Agro-ecological Zone (GAEZ v3.0), Gridded Livestock of the World (GLW), FAOSTAT, and Global Rural-Urban Mapping Project (GRUMP). For scenarios analysis, we considered changes in population, dietary patterns and possibility of obtaining the maximum potential yield. We investigate the food self-sufficiency multiple spatial scales. We start from the 5' resolution (i.e. around 10 km x 10 km in the equator) and look at 8 levels of aggregation ranging from the plausible lowest administrative level to the continental level. Results for the different spatial scales show that about 1.9 billion people live in the area of 5' resolution where enough calories can be produced to sustain their food consumption and the feed used. On the country level, about 4.4 billion population can be sustained without international food trade. For about 1 billion population from Asia and Africa, there is a need for cross-continental food trade. However, if we were able to achieve the maximum potential crop yield, about 2.6 billion population can be sustained within their living area of 5' resolution. Furthermore, Africa and Asia could be food self-sufficient by achieving their maximum potential crop yield and only round 630 million populations would be dependent on the international food trade. However, the food self-sufficiency status might differ under consideration of the future change in population, dietary patterns and climatic conditions. We provide an initial approach for investigating the

  19. Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila

    NASA Technical Reports Server (NTRS)

    Nolo, R.; Abbott, L. A.; Bellen, H. J.

    2000-01-01

    The senseless (sens) gene is required for proper development of most cell types of the embryonic and adult peripheral nervous system (PNS) of Drosophila. Sens is a nuclear protein with four Zn fingers that is expressed and required in the sensory organ precursors (SOP) for proper proneural gene expression. Ectopic expression of Sens in many ectodermal cells causes induction of PNS external sensory organ formation and is able to recreate an ectopic proneural field. Hence, sens is both necessary and sufficient for PNS development. Our data indicate that proneural genes activate sens expression. Sens is then in turn required to further activate and maintain proneural gene expression. This feedback mechanism is essential for selective enhancement and maintenance of proneural gene expression in the SOPs.

  20. Children's sleep needs: is there sufficient evidence to recommend optimal sleep for children?

    PubMed

    Matricciani, Lisa; Blunden, Sarah; Rigney, Gabrielle; Williams, Marie T; Olds, Tim S

    2013-04-01

    It is widely recognized that sleep is important for children's health and well-being and that short sleep duration is associated with a wide range of negative health outcomes. Recently, there has been much interest in whether or not there are sufficient data to support the specific recommendations made for how much sleep children need. In this article we explore concepts related to children's sleep need, discuss the theory, rationale, and empirical evidence for contemporary sleep recommendations, and outline future research directions for sleep recommendations. If sleep is to be treated as a therapeutic intervention, then consensus guidelines, statements, and evidence-based best-practice documents are needed to underpin sleep recommendations for children.

  1. [Pharmacovigilance idea should be introduced sufficiently into the safety monitoring and evaluation process of Chinese drugs].

    PubMed

    Zhang, Li; Yang, Xiao-Hui

    2009-09-01

    Along with the general improving of public consciousness on drugs' safety and the increasing of new Chinese drugs' manufacture and application, the safety of Chinese drugs has become a more prominent concern and a focus of attention. The scientific identification, analysis and evaluation of this affairs greatly impacts the scientific decision-making for ensuring the public use of drugs in security, also influences the healthy development of Chinese medicine industry. In this paper, the different meanings of "adverse reaction" and "adverse events" of Chinese drugs were introduced from pharmacovigilance idealistic view, and the influencing factors on safety of Chinese drugs were analyzed from the perspective of pharmacovigilance. The authors proposed that "Chinese medicine safety monitoring and evaluation" is a much more practical concept in consistency with the current situation. They pointed out that introducing sufficiently the concept of pharmaco vigilance idea into the safety monitoring and evaluation process is the basis for overall evaluation and effective risk controlling of Chinese drugs.

  2. From necessity to sufficiency in memory research: when sleep helps to understand wake experiences.

    PubMed

    Lacroix, Marie Masako; De Lavilléon, Gaetan; Benchenane, Karim

    2015-12-01

    Memory is the ability to adapt our behavior by using the stored information, previously encoded. The first investigations of the neuronal bases of the memory trace concerned its properties (location, cellular and molecular mechanisms, among others). However, to understand how this is achieved at the scale of neurons, we must provide evidence about the necessity of a neuronal subpopulation to support the memory trace, but also its sufficiency. Here, we will present past and recent studies that provide information about the neuronal nature of memories. We will show that research on sleep, when cells assembly supposedly carrying information from the past are replayed, could also provide valuable information about the memory processes at stake during wake.

  3. Necessary and sufficient quantum information characterization of Einstein-Podolsky-Rosen steering.

    PubMed

    Piani, Marco; Watrous, John

    2015-02-13

    Steering is the entanglement-based quantum effect that embodies the "spooky action at a distance" disliked by Einstein and scrutinized by Einstein, Podolsky, and Rosen. Here we provide a necessary and sufficient characterization of steering, based on a quantum information processing task: the discrimination of branches in a quantum evolution, which we dub subchannel discrimination. We prove that, for any bipartite steerable state, there are instances of the quantum subchannel discrimination problem for which this state allows a correct discrimination with strictly higher probability than in the absence of entanglement, even when measurements are restricted to local measurements aided by one-way communication. On the other hand, unsteerable states are useless in such conditions, even when entangled. We also prove that the above steering advantage can be exactly quantified in terms of the steering robustness, which is a natural measure of the steerability exhibited by the state.

  4. Necessary and Sufficient Quantum Information Characterization of Einstein-Podolsky-Rosen Steering

    NASA Astrophysics Data System (ADS)

    Piani, Marco; Watrous, John

    2015-02-01

    Steering is the entanglement-based quantum effect that embodies the "spooky action at a distance" disliked by Einstein and scrutinized by Einstein, Podolsky, and Rosen. Here we provide a necessary and sufficient characterization of steering, based on a quantum information processing task: the discrimination of branches in a quantum evolution, which we dub subchannel discrimination. We prove that, for any bipartite steerable state, there are instances of the quantum subchannel discrimination problem for which this state allows a correct discrimination with strictly higher probability than in the absence of entanglement, even when measurements are restricted to local measurements aided by one-way communication. On the other hand, unsteerable states are useless in such conditions, even when entangled. We also prove that the above steering advantage can be exactly quantified in terms of the steering robustness, which is a natural measure of the steerability exhibited by the state.

  5. Self-Monitoring Artificial Red Cells with Sufficient Oxygen Supply for Enhanced Photodynamic Therapy

    NASA Astrophysics Data System (ADS)

    Luo, Zhenyu; Zheng, Mingbin; Zhao, Pengfei; Chen, Ze; Siu, Fungming; Gong, Ping; Gao, Guanhui; Sheng, Zonghai; Zheng, Cuifang; Ma, Yifan; Cai, Lintao

    2016-03-01

    Photodynamic therapy has been increasingly applied in clinical cancer treatments. However, native hypoxic tumoural microenvironment and lacking oxygen supply are the major barriers hindering photodynamic reactions. To solve this problem, we have developed biomimetic artificial red cells by loading complexes of oxygen-carrier (hemoglobin) and photosensitizer (indocyanine green) for boosted photodynamic strategy. Such nanosystem provides a coupling structure with stable self-oxygen supply and acting as an ideal fluorescent/photoacoustic imaging probe, dynamically monitoring the nanoparticle biodistribution and the treatment of PDT. Upon exposure to near-infrared laser, the remote-triggered photosensitizer generates massive cytotoxic reactive oxygen species (ROS) with sufficient oxygen supply. Importantly, hemoglobin is simultaneously oxidized into the more active and resident ferryl-hemoglobin leading to persistent cytotoxicity. ROS and ferryl-hemoglobin synergistically trigger the oxidative damage of xenograft tumour resulting in complete suppression. The artificial red cells with self-monitoring and boosted photodynamic efficacy could serve as a versatile theranostic platform.

  6. Design of Fracture Fixation Plate for Necessary and Sufficient Bone Stress Shielding

    NASA Astrophysics Data System (ADS)

    Ramakrishna, Kotlanka; Sridhar, Idapalapati; Sivashanker, Sathiamoorthy; Khong, Kok Sun; Ghista, Dhanjoo N.

    The objective of treating the fractured bone is to achieve painless functioning of the bone and undisturbed healing at the fracture. Internal fixation by stiff bone-plate is one of the standard methods to achieve these objectives. Recently, there is considerable interest in the usage of compliant plates to enhance bone healing with reduced stress shielding. Herein, first an analytical solution is developed to determine screw forces in the bone-plate assembly that conforms the plate and the bone under bending load. Based on the analytical calculations, an optimal fixator plate selection criterion for necessary and sufficient stress shielding is proposed. Second, effectiveness of employing a non-homogeneous stiffness graded (SG) plate rather than a homogeneous stainless steel (SS) plate for stress shielding is investigated using a finite element method. It is found that stress shielding on bone by SG plate is less compared to SS plate.

  7. Co‐immobilized Phosphorylated Cofactors and Enzymes as Self‐Sufficient Heterogeneous Biocatalysts for Chemical Processes

    PubMed Central

    Velasco‐Lozano, Susana; Benítez‐Mateos, Ana I.

    2016-01-01

    Abstract Enzyme cofactors play a major role in biocatalysis, as many enzymes require them to catalyze highly valuable reactions in organic synthesis. However, the cofactor recycling is often a hurdle to implement enzymes at the industrial level. The fabrication of heterogeneous biocatalysts co‐immobilizing phosphorylated cofactors (PLP, FAD+, and NAD+) and enzymes onto the same solid material is reported to perform chemical reactions without exogeneous addition of cofactors in aqueous media. In these self‐sufficient heterogeneous biocatalysts, the immobilized enzymes are catalytically active and the immobilized cofactors catalytically available and retained into the solid phase for several reaction cycles. Finally, we have applied a NAD+‐dependent heterogeneous biocatalyst to continuous flow asymmetric reduction of prochiral ketones, thus demonstrating the robustness of this approach for large scale biotransformations. PMID:28000978

  8. Dopamine transients are sufficient and necessary for acquisition of model-based associations.

    PubMed

    Sharpe, Melissa J; Chang, Chun Yun; Liu, Melissa A; Batchelor, Hannah M; Mueller, Lauren E; Jones, Joshua L; Niv, Yael; Schoenbaum, Geoffrey

    2017-04-03

    Associative learning is driven by prediction errors. Dopamine transients correlate with these errors, which current interpretations limit to endowing cues with a scalar quantity reflecting the value of future rewards. We tested whether dopamine might act more broadly to support learning of an associative model of the environment. Using sensory preconditioning, we show that prediction errors underlying stimulus-stimulus learning can be blocked behaviorally and reinstated by optogenetically activating dopamine neurons. We further show that suppressing the firing of these neurons across the transition prevents normal stimulus-stimulus learning. These results establish that the acquisition of model-based information about transitions between nonrewarding events is also driven by prediction errors and that, contrary to existing canon, dopamine transients are both sufficient and necessary to support this type of learning. Our findings open new possibilities for how these biological signals might support associative learning in the mammalian brain in these and other contexts.

  9. Combustion of available fossil fuel resources sufficient to eliminate the Antarctic Ice Sheet.

    PubMed

    Winkelmann, Ricarda; Levermann, Anders; Ridgwell, Andy; Caldeira, Ken

    2015-09-01

    The Antarctic Ice Sheet stores water equivalent to 58 m in global sea-level rise. We show in simulations using the Parallel Ice Sheet Model that burning the currently attainable fossil fuel resources is sufficient to eliminate the ice sheet. With cumulative fossil fuel emissions of 10,000 gigatonnes of carbon (GtC), Antarctica is projected to become almost ice-free with an average contribution to sea-level rise exceeding 3 m per century during the first millennium. Consistent with recent observations and simulations, the West Antarctic Ice Sheet becomes unstable with 600 to 800 GtC of additional carbon emissions. Beyond this additional carbon release, the destabilization of ice basins in both West and East Antarctica results in a threshold increase in global sea level. Unabated carbon emissions thus threaten the Antarctic Ice Sheet in its entirety with associated sea-level rise that far exceeds that of all other possible sources.

  10. Necessary and sufficient conditions of stationary average consensus for second-order multi-agent systems

    NASA Astrophysics Data System (ADS)

    Pei, Yongquan; Sun, Jitao

    2016-11-01

    This paper investigates the stationary average consensus problem for second-order discrete-time multi-agent systems (SDMAS). A stationary consensus problem is to find a control algorithm that brings the state of a group of agents to a common constant value which is called the collective decision. We introduce the concept of stationary average consensus of SDMAS and propose a consensus algorithm. Based on the polynomial stability and the graph theory, we obtain two necessary and sufficient conditions of stationary average consensus of SDMAS. The last theorem provides an algebraic criterion of stationary average consensus, and can help us to determine the parameters in the consensus algorithm. Furthermore, in this consensus algorithm, only the states of the agents are transferred among the agents. Therefore, this algorithm can not only solve the stationary average consensus problem but also reduce the amount of transferred data. A numerical example is provided to illustrate the efficiency of our results.

  11. Sufficient and Necessary Open-Loop Stackelberg Strategy for Two-Player Game With Time Delay.

    PubMed

    Xu, Juanjuan; Zhang, Huanshui

    2016-02-01

    This paper is concerned with both difference and differential leader-follower games with time delay. The problem remains challenging although the leader-follower game for delay-free system has been well studied in the past decades. The main obstacle encountered is the noncausality of strategy design caused by the delay. The key technique developed to overcome the difficulty is the introduction of the new co-states which capture the future information of the control and the new state which contains the past effects. The novel contributions of this paper are as follows. First, the sufficient and necessary solvability condition is given to ensure the existence of a unique open-loop Stackelberg strategy for the difference game. Second, the open-loop strategy is explicitly obtained in terms of decoupled and symmetric Riccati equations. Last but not least, a unique strategy for continuous time systems is also given by applying the techniques developed in this paper.

  12. Sufficient condition for the existence of interface states in some two-dimensional photonic crystals

    NASA Astrophysics Data System (ADS)

    Huang, Xueqin; Xiao, Meng; Zhang, Zhao-Qing; Chan, C. T.

    2014-08-01

    There is no assurance that interface states can be found at the boundary separating two materials. While a strong perturbation typically favors wave localization, we show on the contrary that in some two-dimensional photonic crystals (PCs) possessing a Dirac-like cone at k = 0 derived from monopole and dipoles excitation, a small perturbation is sufficient to create interface states. The conical dispersion together with the flat band at the zone center generates the existence of gaps in the projected band structure and the existence of single mode interface states inside the projected band gaps stems from the geometric phases of the bulk bands. The underlying physics for the existence of an interface state is related to the sign change of the surface impedance in the gaps above and below the flat band. The established results are applicable for long wavelength regimes where there is only one propagating diffraction order for an interlayer scattering.

  13. [Is the successful eradication of Helicobacter pylori sufficient for the healing of peptic ulcer?].

    PubMed

    Pregun, István; Herszényi, László; Juhász, Márk; Miheller, Pál; Tulassay, Zsolt

    2006-03-12

    Helicobacter pylori has a major role in the pathogenesis of peptic ulcer disease. Cure of the infection is essential in ulcer healing, but an additional PPI therapy after completing eradication treatment is widespread in clinical practice. In the present work clinical studies evaluating peptic ulcer healing followed or not by PPI treatment after eradication therapy were analyzed. The results of these trials are concordant that only a minority of patients with duodenal ulcer would benefit from prolonged acid suppressive treatment, a successful eradication therapy (that counts for a large proportion) is sufficient. There are less data available concerning gastric ulcer: successful eradication is also essential to ulcer healing and to avoid relapse, however it seems that post-eradication PPI therapy might be beneficial.

  14. [Giant thrombus in the left atrium after mitral bioprosthesis implantation: is standard oral anticoagulation always sufficient?].

    PubMed

    Tomaszuk-Kazberuk, Anna; Lisowska, Anna; Sobkowicz, Bożena; Młodawska, Elżbieta; Łopatowska, Paulina; Kosacka, Urszula; Krajewska, Agnieszka; Musiał, Włodzimierz J

    2013-01-01

    We present a case of 70-year old male after coronary by-pass surgery and mitral bioprosthesis implantation due to infective endocarditis, with continuous atrial fibrillation, who was admitted to the hospital due to the worsening of the heart failure. He was on oral antivitamine K agents with therapeutic value of INR. On echocardiography we found enlargement of all cavities with extremely big left atrium (9.5 cm) and poor contractile left ventricular function (EF 25%). An enormously big old thrombus was found in the left atrium. The patient was disqualified from surgical treatment. Treatment with unfractionated heparin was unsuccessful. We discuss if standard antithrombotic treatment is always sufficient in such unusual cases.

  15. Retesting of bone donors 2 months after donation guarantees sufficient safety of bone allografts.

    PubMed

    Hirn, M Y; Krusius, T

    1998-12-01

    Both allogeneic bone grafting and blood transfusion may transmit infections from the donor to the recipient. The most effective means to reduce the risk of infection is careful donor selection and screening of donors for markers of infection. The risk of blood transfusion-transmitted HIV infection in Finland, calculated with the incidence/window period model, is approximately 1:3,300,000. The calculated risk for hepatitis B (HBV) and C (HCV) is 1:217,000 and 1:147,000 donations, respectively. In bone banking we can further reduce the risks by retesting the living donors. Retesting 2 months after donation seems to be sufficient, at least in countries with a low incidence of transplantation-transmitted infections.

  16. Pakistan oil, gas reforms tied to bid for energy self-sufficiency by 2000

    SciTech Connect

    Not Available

    1991-12-09

    This paper reports on oil and gas exploration and development which is accelerating in Pakistan as it seeks to achieve energy self-sufficiency by 2000. In addition to backing out some domestic oil use with burgeoning natural gas supplies and cutting refined products imports by boosting refining capacity, Pakistan is targeting a sharp increase in oil production. Ultimately, industry officials in Pakistan would like to see it become a significant net exporter of oil, perhaps qualifying it for eventual membership in the Organization of Petroleum Exporting Countries. And foreign investment will play a key role in that effort as the government takes steps to sweeten incentives for foreign oil and gas companies. Consequently, drilling activity and the number of foreign operated concessions are at record levels in Pakistan. Meantime, state owned Oil and Gas Development Corp. has embarked on an ambitious program of exploration in underexplored basins while seeking foreign assistance in hiking oil recovery rates in existing fields.

  17. Co-immobilized Phosphorylated Cofactors and Enzymes as Self-Sufficient Heterogeneous Biocatalysts for Chemical Processes.

    PubMed

    Velasco-Lozano, Susana; Benítez-Mateos, Ana I; López-Gallego, Fernando

    2017-01-16

    Enzyme cofactors play a major role in biocatalysis, as many enzymes require them to catalyze highly valuable reactions in organic synthesis. However, the cofactor recycling is often a hurdle to implement enzymes at the industrial level. The fabrication of heterogeneous biocatalysts co-immobilizing phosphorylated cofactors (PLP, FAD(+) , and NAD(+) ) and enzymes onto the same solid material is reported to perform chemical reactions without exogeneous addition of cofactors in aqueous media. In these self-sufficient heterogeneous biocatalysts, the immobilized enzymes are catalytically active and the immobilized cofactors catalytically available and retained into the solid phase for several reaction cycles. Finally, we have applied a NAD(+) -dependent heterogeneous biocatalyst to continuous flow asymmetric reduction of prochiral ketones, thus demonstrating the robustness of this approach for large scale biotransformations.

  18. Measuring What Latent Fingerprint Examiners Consider Sufficient Information for Individualization Determinations

    PubMed Central

    Ulery, Bradford T.; Hicklin, R. Austin; Roberts, Maria Antonia; Buscaglia, JoAnn

    2014-01-01

    Latent print examiners use their expertise to determine whether the information present in a comparison of two fingerprints (or palmprints) is sufficient to conclude that the prints were from the same source (individualization). When fingerprint evidence is presented in court, it is the examiner's determination—not an objective metric—that is presented. This study was designed to ascertain the factors that explain examiners' determinations of sufficiency for individualization. Volunteer latent print examiners (n = 170) were each assigned 22 pairs of latent and exemplar prints for examination, and annotated features, correspondence of features, and clarity. The 320 image pairs were selected specifically to control clarity and quantity of features. The predominant factor differentiating annotations associated with individualization and inconclusive determinations is the count of corresponding minutiae; other factors such as clarity provided minimal additional discriminative value. Examiners' counts of corresponding minutiae were strongly associated with their own determinations; however, due to substantial variation of both annotations and determinations among examiners, one examiner's annotation and determination on a given comparison is a relatively weak predictor of whether another examiner would individualize. The extensive variability in annotations also means that we must treat any individual examiner's minutia counts as interpretations of the (unknowable) information content of the prints: saying “the prints had N corresponding minutiae marked” is not the same as “the prints had N corresponding minutiae.” More consistency in annotations, which could be achieved through standardization and training, should lead to process improvements and provide greater transparency in casework. PMID:25372036

  19. Overexpression of ERβ is sufficient to inhibit hypoxia-inducible factor-1 transactivation

    SciTech Connect

    Park, Choa; Lee, YoungJoo

    2014-07-18

    Highlights: • We examined the effect of ERβ specific ligand on HIF-1 inhibition. • DPN down-regulates the ARNT protein levels in PC3 cells. • DPN did not show additional effect in ERβ transfected MCF-7 cells. • Our study shows that unliganded ERβ is sufficient to inhibit HIF-1 in systems of overexpression. - Abstract: Estrogen receptor (ER) β is predicted to play an important role in the prevention of breast cancer development and progression. We have previously shown that ERβ suppresses hypoxia inducible factor (HIF)-1-mediated transcription through aryl hydrocarbon receptor nuclear translocator (ARNT) degradation via ubiquitination processes. In this study, we attempted to examine the effect of ERβ specific ligand on HIF-1 inhibition in ERβ positive PC3 cells and ERβ transfected MCF-7 cells. ERβ specific agonist diarylpropionitrile (DPN) stimulated estrogen response element (ERE)-luciferase activity in a similar fashion to estradiol in PC3 cells. We observed that DPN down-regulates the ARNT protein levels leading to an attenuation of hypoxia-induced hypoxia response element (HRE)-driven luciferase reporter gene activation in PC3 cells. Treatment of DPN reduced vascular endothelial growth factor (VEGF) expression and co-treatment with ERβ specific antagonist PHTPP abrogated the effect in PC3 cells. We then examined the effect of DPN in ERβ transfected MCF-7 cells. HIF-1 transcriptional activity repression by ERβ was not further reduced by DPN, as examined by HRE-driven luciferase assays. Expression of ERβ significantly decreased VEGF secretion and ARNT expression under hypoxic conditions. However, DPN did not additionally affect this suppression in MCF-7 cells transfected with ERβ. This result shows that unliganded ERβ is sufficient to inhibit HIF-1 in systems of overexpression.

  20. What is sufficient evidence for the reliability and validity of patient-reported outcome measures?

    PubMed

    Frost, Marlene H; Reeve, Bryce B; Liepa, Astra M; Stauffer, Joseph W; Hays, Ron D

    2007-01-01

    This article focuses on the necessary psychometric properties of a patient-reported outcomes (PROs) measure. Topics include the importance of reliability and validity, psychometric approaches used to provide reliability and validity estimates, the kinds of evidence needed to indicate that a PRO has a sufficient level of reliability and validity, contexts that may affect psychometric properties, methods available to evaluate PRO instruments when the context varies, and types of reliability and validity testing that are appropriate during different phases of clinical trials. Points discussed include the perspective that the psychometric properties of reliability and validity are on a continuum in which the more evidence one has, the greater confidence there is in the value of the PRO data. Construct validity is the type of validity most frequently used with PRO instruments as few "gold standards" exist to allow the use of criterion validity and content validity by itself only provides beginning evidence of validity. Several guidelines are recommended for establishing sufficient evidence of reliability and validity. For clinical trials, a minimum reliability threshold of 0.70 is recommended. Sample sizes for testing should include at least 200 cases and results should be replicated in at least one additional sample. At least one full report on the development of the instrument and one on the use of the instrument are deemed necessary to evaluate the PRO psychometric properties. Psychometric testing ideally occurs before the initiation of Phase III trials. When testing does not occur prior to a Phase III trial, considerable risk is posed in relation to the ability to substantiate the use of the PRO data. Various qualitative (e.g., focus groups, behavioral coding, cognitive interviews) and quantitative approaches (e.g., differential item functioning testing) are useful in evaluating the reliability and validity of PRO instruments.

  1. Dexamethasone and rosiglitazone are sufficient and necessary for producing functional adipocytes from mesenchymal stem cells.

    PubMed

    Contador, David; Ezquer, Fernando; Espinosa, Maximiliano; Arango-Rodriguez, Martha; Puebla, Carlos; Sobrevia, Luis; Conget, Paulette

    2015-09-01

    The final product of adipogenesis is a functional adipocyte. This mature cell acquires the necessary machinery for lipid metabolism, loses its proliferation potential, increases its insulin sensitivity, and secretes adipokines. Multipotent mesechymal stromal cells have been recognized as a source of adipocytes both in vivo and in vitro. The in vitro adipogenic differentiation of human MSC (hMSC) has been induced up to now by using a complex stimulus which includes dexamethasone, 3-isobutyl-1-methylxanthine, indomethacin, and insulin (a classical cocktail) and evaluated according to morphological changes. The present work was aimed at demonstrating that the simultaneous activation of dexamethasone's canonical signaling pathways, through the glucocorticoid receptor and CCAAT-enhancer-binding proteins (C/EBPs) and rosiglitazone through peroxisome proliferator-activated receptor gamma (PPAR-gamma) is sufficient yet necessary for inducing hMSC adipogenic differentiation. It was also ascertained that hMSC exposed just to dexamethasone and rosiglitazone (D&R) differentiated into cells which accumulated neutral lipid droplets, expressed C/EBP-alpha, PPAR-gamma, aP2, lipoprotein lipase, acyl-CoA synthetase, phosphoenolpyruvate carboxykinase, adiponectin, and leptin genes but did not proliferate. Glucose uptake was dose dependent on insulin stimulus and high levels of adipokines were secreted (i.e. displaying not only the morphology but also expressing mature adipocytes' specific genes and functional characteristics). This work has demonstrated that (i) the activating C/EBPs and PPAR-gamma signaling pathways were sufficient to induce adipogenic differentiation from hMSC, (ii) D&R producing functional adipocytes from hMSC, (iii) D&R induce adipogenic differentiation from mammalian MSC (including those which are refractory to classical adipogenic differentiation stimuli). D&R would thus seem to be a useful tool for MSC characterization, studying adipogenesis pathways and

  2. Darwin's passionate environmentalism or the dangerous fallacy of the 'All-sufficiency of natural selection' theory.

    PubMed

    Marsh, David

    2012-01-01

    Following his last edition of the Origin of Species in 1872, Darwin spent much of the rest of his life searching for possible mechanisms, such as the pangenes in the blood, which would communicate information from the environment to the genome. In each of his six editions of the 'Origin', he stated that there were two forces in evolution - natural selection and conditions of existence. Of the two, he claims that the latter is the more powerful. In so doing, he recognized that natural selection could only operate within the bounds of possibility, that is the environment. August Weismann claimed that conditions of existence had no place in evolution. His publication, the 'All-sufficiency of natural selection', was based on mutilation (cutting tails of rodents and watching the next generation grow tails), which has nothing to do with Darwin's concept of conditions of existence. Nonetheless, evolutionary biologists in general followed the line of the 'all sufficiency' theory and ignored Darwin's conditions of existence, which in other words means the environment. Natural selection has a weak predictive power as it is based on random events. However, the conditions of existence have, by contrast, strong predictive powers that can be tested. The environmental views of two of the greatest evolutionists, Lamarck and Darwin, have been consistently ignored by most evolution theorists who came after them, continuing for over 200 years. Looking at the fossil record through the eyes of Darwin's conditions of existence, not to mention the recent changes in height and shape over the last century, it is possible to draw important conclusions about the past and predictions of the future. With new knowledge of epigenetics, it is perhaps time that Darwin's conditions of existence were given a second hearing.

  3. Optically-Induced Neuronal Activity Is Sufficient to Promote Functional Motor Axon Regeneration In Vivo

    PubMed Central

    Ward, Patricia J.; Jones, Laura N.; Mulligan, Amanda; Goolsby, William; Wilhelm, Jennifer C.; English, Arthur W.

    2016-01-01

    Peripheral nerve injuries are common, and functional recovery is very poor. Beyond surgical repair of the nerve, there are currently no treatment options for these patients. In experimental models of nerve injury, interventions (such as exercise and electrical stimulation) that increase neuronal activity of the injured neurons effectively enhance axon regeneration. Here, we utilized optogenetics to determine whether increased activity alone is sufficient to promote motor axon regeneration. In thy-1-ChR2/YFP transgenic mice in which a subset of motoneurons express the light-sensitive cation channel, channelrhodopsin (ChR2), we activated axons in the sciatic nerve using blue light immediately prior to transection and surgical repair of the sciatic nerve. At four weeks post-injury, direct muscle EMG responses evoked with both optical and electrical stimuli as well as the ratio of these optical/electrical evoked EMG responses were significantly greater in mice that received optical treatment. Thus, significantly more ChR2+ axons successfully re-innervated the gastrocnemius muscle in mice that received optical treatment. Sections of the gastrocnemius muscles were reacted with antibodies to Synaptic Vesicle Protein 2 (SV2) to quantify the number of re-occupied motor endplates. The number of SV2+ endplates was greater in mice that received optical treatment. The number of retrogradely-labeled motoneurons following intramuscular injection of cholera toxin subunit B (conjugated to Alexa Fluor 555) was greater in mice that received optical treatment. Thus, the acute (1 hour), one-time optical treatment resulted in robust, long-lasting effects compared to untreated animals as well as untreated axons (ChR2-). We conclude that neuronal activation is sufficient to promote motor axon regeneration, and this regenerative effect is specific to the activated neurons. PMID:27152611

  4. Assisting Young, Unmarried Mothers to Become Self-Sufficient: The Effects of Different Types of Early Economic Support.

    ERIC Educational Resources Information Center

    Sandfort, Jodi R.; Hill, Martha S.

    1996-01-01

    Considers how different types of economic support, received soon after the birth of a first child, contribute to the later self-sufficiency of young, unmarried mothers. Findings suggest that certain economic supports assist these mothers and that life choices they make after their child's birth are important to self-sufficiency. (RJM)

  5. The Development of University Students' Self-Sufficiency Based on Interactive Technologies by Their Immersion in the Professional Activity

    ERIC Educational Resources Information Center

    Ljubimova, Elena Mikhaelovna; Galimullina, Elvira Zufarovna; Ibatullin, Rinat Rivkatovich

    2015-01-01

    The article discusses the problems of using web technologies in the development of self-sufficiency of University students. We hypothesize that real professional situations in which he/she is obliged to work independently on the basis of web technologies contribute to the development of students' self-sufficiency. It is shown that the activity…

  6. Adenosine A2A receptors are necessary and sufficient to trigger memory impairment in adult mice

    PubMed Central

    Pagnussat, N; Almeida, A S; Marques, D M; Nunes, F; Chenet, G C; Botton, P H S; Mioranzza, S; Loss, C M; Cunha, R A; Porciúncula, L O

    2015-01-01

    Background and Purpose Caffeine (a non-selective adenosine receptor antagonist) prevents memory deficits in aging and Alzheimer’s disease, an effect mimicked by adenosine A2A receptor, but not A1 receptor, antagonists. Hence, we investigated the effects of adenosine receptor agonists and antagonists on memory performance and scopolamine-induced memory impairment in mice. Experimental Approach We determined whether A2A receptors are necessary for the emergence of memory impairments induced by scopolamine and whether A2A receptor activation triggers memory deficits in naïve mice, using three tests to assess short-term memory, namely the object recognition task, inhibitory avoidance and modified Y-maze. Key Results Scopolamine (1.0 mg·kg−1, i.p.) impaired short-term memory performance in all three tests and this scopolamine-induced amnesia was prevented by the A2A receptor antagonist (SCH 58261, 0.1–1.0 mg·kg−1, i.p.) and by the A1 receptor antagonist (DPCPX, 0.2–5.0 mg·kg−1, i.p.), except in the modified Y-maze where only SCH58261 was effective. Both antagonists were devoid of effects on memory or locomotion in naïve rats. Notably, the activation of A2A receptors with CGS 21680 (0.1–0.5 mg·kg−1, i.p.) before the training session was sufficient to trigger memory impairment in the three tests in naïve mice, and this effect was prevented by SCH 58261 (1.0 mg·kg−1, i.p.). Furthermore, i.c.v. administration of CGS 21680 (50 nmol) also impaired recognition memory in the object recognition task. Conclusions and Implications These results show that A2A receptors are necessary and sufficient to trigger memory impairment and further suggest that A1 receptors might also be selectively engaged to control the cholinergic-driven memory impairment. PMID:25939452

  7. A brief intervention is sufficient for many adolescents seeking help from low threshold adolescent psychiatric services

    PubMed Central

    2010-01-01

    Background There has been a considerable increase in the need for psychiatric services for adolescents. Primary health care practitioners have a major role in detecting, screening and helping these adolescents. An intervention entitled SCREEN is described in this article. The SCREEN intervention was developed to help practitioners to detect and screen adolescent needs, to care for adolescents at the primary health care level and to facilitate the referral of adolescents to secondary care services in collaboration between primary and secondary health care. Secondly, the article presents the background and clinical characteristics of youths seeking help from the SCREEN services, and compares the background factors and clinical characteristics of those patients referred and not referred to secondary care services. Methods The SCREEN intervention consisted of 1 to 5 sessions, including assessment by a semi-structured anamnesis interview, the structured Global Assessment Scale, and by a structured priority rating scale, as well as a brief intervention for each adolescent's chosen problem. Parents took part in the assessment in 39% of cases involving girls and 50% involving boys. During 34 months, 2071 adolescents (69% females) entered the intervention and 70% completed it. The mean age was 17.1 years for boys and 17.3 years for girls. Results For 69% of adolescents, this was the first contact with psychiatric services. The most common reasons for seeking services were depressive symptoms (31%). Self-harming behaviour had occurred in 25% of girls and 16% of boys. The intervention was sufficient for 37% of those who completed it. Psychosocial functioning improved during the intervention. Factors associated with referral for further treatment were female gender, anxiety as the main complaint, previous psychiatric treatment, self-harming behaviour, a previous need for child welfare services, poor psychosocial functioning and a high score in the priority rating scale

  8. Membrane alteration is necessary but not sufficient for effective glutamate secretion in Corynebacterium glutamicum.

    PubMed Central

    Hoischen, C; Krämer, R

    1990-01-01

    We showed recently that secretion of glutamate in biotin-limited cells of Corynebacterium glutamicum is mediated by carrier systems in the plasma membrane (C. Hoischen and R. Krämer, Arch. Microbiol. 151:342-347, 1989). In view of the generally accepted hypothesis that glutamate efflux is directly caused by alterations of the membrane, it was necessary to examine the kind of correlation between changes in lipid content and composition of the bacterial membrane and glutamate secretion activity. Two new experimental approaches were used. (i) Changes in lipid content and composition were analyzed in glutamate-producing cells which were forced to switch to nonproducers by addition of biotin in a short-term fermentation. (ii) The time courses of both the fatty acid or phospholipid composition and the efflux activity were analyzed within the first minutes of the switch from high to low secretion activity. The following results were obtained. (i) The time course of the change in fatty acid or phospholipid content and composition was not related to the change in secretion behavior. (ii) There was no specific fatty acid or phospholipid compound which regulated glutamate efflux. (iii) High efflux activity could only be induced when the total lipid content of the membrane was reduced. (iv) Although consistently correlated to high secretion activity, membrane alteration was never a sufficient prerequisite for glutamate efflux in C. glutamicum. PMID:1971623

  9. Identifying Pathways for Improving Household Food Self-Sufficiency Outcomes in the Hills of Nepal

    PubMed Central

    Karki, Tika B.; Sah, Shrawan K.; Thapa, Resam B.; McDonald, Andrew J.; Davis, Adam S.

    2015-01-01

    Maintaining and improving household food self-sufficiency (FSS) in mountain regions is an ongoing challenge. There are many facets to the issue, including comparatively high levels of land fragmentation, challenging terrain and transportation bottlenecks, declining labor availability due to out-migration, and low technical knowledge, among others. Using a nonparametric multivariate approach, we quantified primary associations underlying current levels of FSS in the mid-hills of Nepal. A needs assessment survey was administered to 77 households in Lungaun (Baglung District), Pang (Parbat District), and Pathlekhet (Myagdi District), with a total of 80 variables covering five performance areas; resulting data were analyzed using Classification and Regression Trees. The most parsimonious statistical model for household FSS highlighted associations with agronomic management, including yields of maize and fingermillet within a relay cropping system and adoption of improved crop cultivars. Secondary analyses of the variables retained in the first model again focused primarily on crop and livestock management. It thus appears that continued emphasis on technical agricultural improvements is warranted, independent of factors such as land holding size that, in any case, are very difficult to change through development interventions. Initiatives to increase household FSS in the mid-hills of Nepal will benefit from placing a primary focus on methods of agricultural intensification to improve crop yields and effective technology transfer to increase adoption of these methods. PMID:26047508

  10. Cyclic AMP is sufficient for triggering the exocytic recruitment of aquaporin-2 in renal epithelial cells

    PubMed Central

    Lorenz, Dorothea; Krylov, Andrey; Hahm, Daniel; Hagen, Volker; Rosenthal, Walter; Pohl, Peter; Maric, Kenan

    2003-01-01

    The initial response of renal epithelial cells to the antidiuretic hormone arginine vasopressin (AVP) is an increase in cyclic AMP. By applying immunofluorescence, cell membrane capacitance and transepithelial water flux measurements we show that cAMP alone is sufficient to elicit the antidiuretic cellular response in primary cultured epithelial cells from renal inner medulla, namely the transport of aquaporin-2 (AQP2)-bearing vesicles to, and their subsequent fusion with, the plasma membrane (AQP2 shuttle). The AQP2 shuttle is evoked neither by AVP-independent Ca2+ increases nor by AVP-induced Ca2+ increases. However, clamping cytosolic Ca2+ concentrations below resting levels at 25 nM inhibited exocytosis. Exocytosis was confined to a slow monophasic response, and readily releasable vesicles were missing. Analysis of endocytic capacitance steps revealed that cAMP does not decelerate the retrieval of AQP2 from the plasma membrane. Our data suggest that cAMP initiates an early step, namely the transport of AQP2-bearing vesicles towards the plasma membrane, and do not support a regulatory function for Ca2+ in the AQP2 shuttle. PMID:12524527

  11. On the enduring and substantial influence of Carl Rogers' not-quite necessary nor sufficient conditions.

    PubMed

    Farber, Barry A

    2007-09-01

    Carl Rogers' 1957 paper (see record 2007-14639-002) is arguably the most successful of his many attempts to clarify and render testable the ideas behind client-centered therapy. While each of the conditions that Rogers postulated has been linked to positive therapeutic outcome, taken together they have never been conclusively proved (nor disproved) to be either necessary or sufficient for positive outcome. Nevertheless, the overriding "take-home" message in this classic paper--that the therapist's attitude and caring presence is critical for therapeutic success--is one that has had virtually unparalleled influence in every segment of the psychotherapeutic community. Clinical and theoretical innovations in the psychoanalytic community serve as examples of the following proposition: that Rogers' concepts, while accepted more than ever by a remarkably wide variety of psychotherapists, remain essentially unacknowledged as originating with him or in the tradition of humanistic and client-centered therapy. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  12. Strategies for regeneration of nicotinamide coenzymes emphasizing self-sufficient closed-loop recycling systems.

    PubMed

    Hummel, Werner; Gröger, Harald

    2014-12-10

    Biocatalytic reduction reactions depending on nicotinamide coenzymes require an additional reaction to regenerate the consumed cofactor. For preparative application the preferred method is the simultaneous coupling of an in situ regeneration reaction. There are different strategically advantageous routes to achieve this goal. The standard method uses a second enzyme and a second co-substrate, for example formate and formate dehydrogenase or glucose and glucose dehydrogenase. Alternatively, a second substrate is employed which is converted by the same enzyme used for the primary reaction. For example, alcohol dehydrogenase catalyzed reactions are often coupled with excess 2-propanol which is oxidized to acetone during the regeneration of NAD(P)H. A third method utilizes a reaction-internal sequence by the direct coupling of an oxidizing and a reducing enzyme reaction. Neither an additional substrate nor a further regenerating enzyme are required for the recycling reaction. This kind of "closed-loop" or "self-sufficient" redox process for cofactor regeneration has been used rarely so far. Its most intriguing advantage is that even redox reactions with unstable precursors can be realized provided that this compound is produced in situ by an opposite redox reaction. This elegant method is applicable in special cases only but increasing numbers of examples have been published during the last years.

  13. TEGs as self-sufficient power supply for sensors and microelectromechanical systems

    NASA Astrophysics Data System (ADS)

    Schönhoff, M.; Hilleringmann, U.

    2016-02-01

    Thermoelectric generators (TEGs) can be used as robust and maintenance-free power supplies. The power density of currently available TEGs is about 1 W/cm² and sufficient for many low power sensor/microelectromechanical systems. By changing the sintering atmosphere and using a special set-up a standard industry process used for insulating or metallic materials was transferred to thermoelectric FeSi2-, Mg2Si- and SiGe-material. Thereby, separated compact- and sintering steps allows a mass producible process in contrast to the almost exclusively used SPS- and FAST-processes. All three materials have been further processed to functional TEG-modules by sawing, bonding and electrically contacting with TiSi2. Thereby, the mechanical bond as well as the electrical contacts are thermally stable up to 800 °C. The general functionality and the characteristics of the final TEG-modules were confirmed by analysis in a measurement setup that simulates an application in a realistic environment.

  14. The Translocation Domain in Trimeric Autotransporter Adhesins Is Necessary and Sufficient for Trimerization and Autotransportation

    PubMed Central

    Mikula, Kornelia M.; Leo, Jack C.; Łyskowski, Andrzej; Kedracka-Krok, Sylwia; Pirog, Artur

    2012-01-01

    Trimeric autotransporter adhesins (TAAs) comprise one of the secretion pathways of the type V secretion system. The mechanism of their translocation across the outer membrane remains unclear, but it most probably occurs by the formation of a hairpin inside the β-barrel translocation unit, leading to transportation of the passenger domain from the C terminus to the N terminus through the lumen of the β-barrel. We further investigated the phenomenon of autotransportation and the rules that govern it. We showed by coexpressing different Escherichia coli immunoglobulin-binding (Eib) proteins that highly similar TAAs could form stochastically mixed structures (heterotrimers). We further investigated this phenomenon by coexpressing two more distantly related TAAs, EibA and YadA. These, however, did not form heterotrimers; indeed, coexpression was lethal to the cells, leading to elimination of one or another of the genes. However, substituting in either protein the barrel of the other one so that the barrels were identical led to formation of heterotrimers as for Eibs. Our work shows that trimerization of the β-barrel, but not the passenger domain, is necessary and sufficient for TAA secretion while the passenger domain is not. PMID:22155776

  15. Sufficient conditions for the avoidance of spectral dispersion in optical prisms.

    PubMed

    Lin, Psang Dain

    2016-07-01

    Prisms are common optical elements consisting of only flat boundary surfaces. Two conditions need to be fulfilled to avoid chromatic aberration for a prism, namely, no mutual image tilt and no mutual image shift for different wavelengths. Mutual image tilt occurs when the unit directional vector of the exit ray varies as a function of the prism's refractive index, resulting in spectral dispersion. In a previous study by the present group [Appl. Opt.45, 3951 (2006)APOPAI0003-693510.1364/AO.45.003951], it was shown that when the rays enter and exit a prism perpendicularly, image reorientation is achieved without spectral dispersion. The present study derives a further sufficient condition to avoid spectral dispersion caused by refraction. The condition explains the ability of Dove prisms and solid glass corner cubes to produce the required image orientation even when the entrance and exit rays are not normal to the respective boundary surfaces. In general, the proposed condition provides a useful analytical guideline for avoiding spectral dispersion in a wide variety of optical systems.

  16. Loss of Desmoglein Binding Is Not Sufficient for Keratinocyte Dissociation in Pemphigus.

    PubMed

    Vielmuth, Franziska; Waschke, Jens; Spindler, Volker

    2015-12-01

    Pemphigus vulgaris (PV) is a severe autoimmune disease in which autoantibodies against the desmosomal cell adhesion molecules desmoglein (Dsg) 1 and Dsg3 cause intraepidermal blister formation. Mechanistically, the fundamental question is still unresolved whether loss of cell cohesion is a result of (1) direct inhibition of Dsg interaction by autoantibodies or (2) intracellular signaling events, which are altered in response to antibody binding and finally cause desmosome destabilization. We used atomic force microscopy (AFM) to perform Dsg3 adhesion measurements on living keratinocytes to investigate the contributions of direct inhibition and signaling to loss of cell cohesion after autoantibody treatment. Dsg3 binding was rapidly blocked following antibody exposure under conditions where no depletion of surface Dsg3 was detectable, demonstrating direct inhibition of Dsg3 interaction. Inhibition of p38MAPK, a central signaling molecule in PV pathogenesis, abrogated loss of cell cohesion, but had a minor effect on loss of Dsg3 binding. Similarly, the cholesterol-depleting agent methyl-β-cyclodextrin (β-MCD) fully blocked cell dissociation, but did not restore Dsg3 interactions or prevent the activation of p38MAPK. These results demonstrate that inhibition of Dsg3 binding is not sufficient to cause loss of cell cohesion, but rather alters signaling events which, in lipid raft-dependent manner, induce cell dissociation.

  17. Protein Kinase-A Inhibition Is Sufficient to Support Human Neural Stem Cells Self-Renewal.

    PubMed

    Georges, Pauline; Boissart, Claire; Poulet, Aurélie; Peschanski, Marc; Benchoua, Alexandra

    2015-12-01

    Human pluripotent stem cell-derived neural stem cells offer unprecedented opportunities for producing specific types of neurons for several biomedical applications. However, to achieve it, protocols of production and amplification of human neural stem cells need to be standardized, cost effective, and safe. This means that small molecules should progressively replace the use of media containing cocktails of protein-based growth factors. Here we have conducted a phenotypical screening to identify pathways involved in the regulation of hNSC self-renewal. We analyzed 80 small molecules acting as kinase inhibitors and identified compounds of the 5-isoquinolinesulfonamide family, described as protein kinase A (PKA) and protein kinase G inhibitors, as candidates to support hNSC self-renewal. Investigating the mode of action of these compounds, we found that modulation of PKA activity was central in controlling the choice between self-renewal or terminal neuronal differentiation of hNSC. We finally demonstrated that the pharmacological inhibition of PKA using the small molecule HA1004 was sufficient to support the full derivation, propagation, and long-term maintenance of stable hNSC in absence of any other extrinsic signals. Our results indicated that tuning of PKA activity is a core mechanism regulating hNSC self-renewal and differentiation and delineate the minimal culture media requirement to maintain undifferentiated hNSC in vitro.

  18. Seeing vs. believing: Is believing sufficient to activate the processes of response co-representation?

    PubMed

    Welsh, Timothy N; Higgins, Laura; Ray, Matthew; Weeks, Daniel J

    2007-12-01

    It has been suggested that the observation of another person's action affects the behavior of the observer because the observation of action leads to the excitation of similar response codes in the observer. It is unknown, however, if one must witness the action or if it is sufficient for one to believe that the other agent is responding for response co-representation to occur. To this end, participants in the present study performed a joint spatial-compatibility task with a confederate when: (1) the confederate sat beside the participant; and, (2) the confederate left the room and told the participant that they would continue to perform their component of the task on a networked computer in another room. Even though participants believed that the confederate performed the task in another room, joint spatial-compatibility was only observed when the confederate was present. These results reveal that the actions of another person may only be represented by the observer when the observer is able to witness a portion of the action.

  19. Limited sufficiency of antigen presentation by dendritic cells in models of central nervous system autoimmunity.

    PubMed

    Wu, Gregory F; Shindler, Kenneth S; Allenspach, Eric J; Stephen, Tom L; Thomas, Hannah L; Mikesell, Robert J; Cross, Anne H; Laufer, Terri M

    2011-02-01

    Experimental autoimmune encephalomyelitis (EAE), a model for the human disease multiple sclerosis (MS), is dependent upon the activation and effector functions of autoreactive CD4 T cells. Multiple interactions between CD4 T cells and major histocompatibility class II (MHCII)+ antigen presenting cells (APCs) must occur in both the periphery and central nervous system (CNS) to elicit autoimmunity. The identity of the MHCII+ APCs involved throughout this process remains in question. We investigated which APC in the periphery and CNS mediates disease using transgenic mice with MHCII expression restricted to dendritic cells (DCs). MHCII expression restricted to DCs results in normal susceptibility to peptide-mediated EAE. Indeed, radiation-sensitive bone marrow-derived DCs were sufficient for all APC functions during peptide-induced disease. However, DCs alone were inefficient at promoting disease after immunization with the myelin protein myelin oligodendrocyte glycoprotein (MOG), even in the presence of MHCII-deficient B cells. Consistent with a defect in disease induction following protein immunization, antigen presentation by DCs alone was incapable of mediating spontaneous optic neuritis. These results indicate that DCs are capable of perpetuating CNS-targeted autoimmunity when antigens are readily available, but other APCs are required to efficiently initiate pathogenic cognate CD4 T cell responses.

  20. Are typical human serum BPA concentrations measurable and sufficient to be estrogenic in the general population?

    PubMed

    Teeguarden, Justin; Hanson-Drury, Sesha; Fisher, Jeffrey W; Doerge, Daniel R

    2013-12-01

    Mammalian estrogen receptors modulate many physiological processes. Chemicals with structural features similar to estrogens can interact with estrogen receptors to produce biological effects similar to those caused by endogenous estrogens in the body. Bisphenol A (BPA) is a structural analogue of estrogen that binds to estrogen receptors. Exposure to BPA in humans is virtually ubiquitous in industrialized societies, but BPA is rapidly detoxified by metabolism and does not accumulate in the body. Whether or not serum concentrations of BPA in humans are sufficiently high to disrupt normal estrogen-related biology is the subject of intense political and scientific debate. Here we show a convergence of robust methods for measuring or calculating serum concentrations of BPA in humans from 93 published studies of more than 30,000 individuals in 19 countries across all life stages. Typical serum BPA concentrations are orders of magnitude lower than levels measurable by modern analytical methods and below concentrations required to occupy more than 0.0009% of Type II Estrogen Binding Sites, GPR30, ERα or ERβ receptors. Occupancies would be higher, but ≤0.04%, for the highest affinity receptor, ERRγ. Our results show limited or no potential for estrogenicity in humans, and question reports of measurable BPA in human serum.

  1. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata.

    PubMed

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomíra; Gase, Klaus; Baldwin, Ian T; Meldau, Stefan

    2017-01-01

    Plant defense metabolites are well known to be regulated developmentally. The optimal defense (OD) theory posits that a tssue's fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness value to the plant, and therefore their defense allocations should be higher when compared with older leaves. The mechanisms that coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins (CKs) modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf CK levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different CK classes by using senescence- and chemically inducible expression of CK biosynthesis genes. Genetically modifying the levels of different CKs in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include CKs plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants.

  2. Two synaptobrevin molecules are sufficient for vesicle fusion in central nervous system synapses.

    PubMed

    Sinha, Raunak; Ahmed, Saheeb; Jahn, Reinhard; Klingauf, Jurgen

    2011-08-23

    Exocytosis of synaptic vesicles (SVs) during fast synaptic transmission is mediated by soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex assembly formed by the coil-coiling of three members of this protein family: vesicle SNARE protein, synaptobrevin 2 (syb2), and the presynaptic membrane SNAREs syntaxin-1A and SNAP-25. However, it is controversially debated how many SNARE complexes are minimally needed for SV priming and fusion. To quantify this effective number, we measured the fluorescence responses from single fusing vesicles expressing pHluorin (pHl), a pH-sensitive variant of GFP, fused to the luminal domain of the vesicular SNARE syb2 (spH) in cultured hippocampal neurons lacking endogenous syb2. Fluorescence responses were quantal, with the unitary signals precisely corresponding to single pHluorin molecules. Using this approach we found that two copies of spH per SV fully rescued evoked fusion whereas SVs expressing only one spH were unable to rapidly fuse upon stimulation. Thus, two syb2 molecules and likely two SNARE complexes are necessary and sufficient for SV fusion during fast synaptic transmission.

  3. An EB1-kinesin complex is sufficient to steer microtubule growth in vitro

    PubMed Central

    Chen, Yalei; Rolls, Melissa M.; Hancock, William O.

    2013-01-01

    Summary Proper microtubule polarity underlies overall neuronal polarity, but mechanisms for maintaining microtubule polarity are not well understood. Previous live imaging in Drosophila dendritic arborization (da) neurons showed that, while microtubules are uniformly plus-end out in axons, dendrites possess uniformly minus-end-out microtubules [1]. Thus, maintaining uniform microtubule polarity in dendrites requires that growing microtubule plus-ends entering branch points must be actively directed towards the cell body. A model was proposed in which EB1 tracks the plus-ends of microtubules growing into a branches and an associated kinesin-2 motor walks along a static microtubule to steer the plus-end toward the cell body. However, the fast plus-end binding dynamics of EB1 [2–5] appear at odds with this proposed mechanical function. To test this model in vitro, we reconstituted the system by artificially dimerizing EB1 to kinesin, growing microtubules from immobilized seeds, and imaging encounters between growing microtubule plus-ends and static microtubules. Consistent with in vivo observations, the EB1-kinesin complex actively steered growing microtubules. Thus EB1 kinetics and mechanics are sufficient to bend microtubules for several seconds. Other kinesins also demonstrated this activity, suggesting this is a general mechanism for organizing and maintaining proper microtubule polarity in cells. PMID:24462004

  4. Root morphological and proteomic responses to growth restriction in maize plants supplied with sufficient N.

    PubMed

    Yan, Huifeng; Li, Ke; Ding, Hong; Liao, Chengsong; Li, Xuexian; Yuan, Lixing; Li, Chunjian

    2011-07-01

    The primary objective of this study was to better understand how root morphological alteration stimulates N uptake in maize plants after root growth restriction, by investigating the changes in length and number of lateral roots, (15)NO(3)(-) influx, the expression level of the low-affinity Nitrate transporter ZmNrt1.1, and proteomic composition of primary roots. Maize seedlings were hydroponically cultured with three different types of root systems: an intact root system, embryonic roots only, or primary roots only. In spite of sufficient N supply, root growth restriction stimulated compensatory growth of remaining roots, as indicated by the increased lateral root number and root density. On the other hand, there was no significant difference in (15)NO(3)(-) influx between control and primary root plants; neither in ZmNrt1.1 expression levels in primary roots of different treatments. Our data suggested that increased N uptake by maize seedlings experiencing root growth restriction is attributed to root morphological adaptation, rather than explained by the variation in N uptake activity. Eight proteins were differentially accumulated in embryonic and primary root plants compared to control plants. These differentially accumulated proteins were closely related to signal transduction and increased root growth.

  5. Maternal and Pediatric Health Outcomes in relation to Gestational Vitamin D Sufficiency

    PubMed Central

    Genuis, Stephen J.

    2015-01-01

    Juxtaposed with monumental improvement in maternal-fetal outcomes over the last century, there has been the recent emergence of rising rates of gestational complications including preterm birth, operative delivery, and gestational diabetes. At the same time, there has been a burgeoning problem with widespread vitamin D deficiency among populations of many developed nations. This paper provides a brief review of potential health outcomes recently linked to gestational vitamin D deficiency, including preterm birth, cesarean delivery, and gestational diabetes. Although immediate costs for obstetric complications related to gestational vitamin D insufficiency may be modest, the short- and long-term costs for pediatric healthcare resulting from such gestational complications may be enormous and present an enduring burden on healthcare systems. With increasing evidence pointing to fetal origins of some later life disease, securing vitamin D sufficiency in pregnancy appears to be a simple, safe, and cost-effective measure that can be incorporated into routine preconception and prenatal care in the offices of primary care clinicians. Education on gestational nutritional requirements should be a fundamental part of medical education and residency training, instruction that has been sorely lacking to date. PMID:26770200

  6. Necessary and Sufficient Standards Closure Process pilot: F- and H-Area groundwater remediation

    SciTech Connect

    Bullington, M.

    1995-09-25

    The DOE Standards Committee`s Necessary and Sufficient (N and S) Standards Closure Process was piloted at SRS on the F- and H- Area Seepage Basins Groundwater Remediation Project. For this existing Environmental Restoration project, the set of N and S standards for design and safety documentation were identified, independently confirmed and approved. Implementation of these standards on the project can lead to a $2.8 Million cost savings on the design, construction/installation, and safety documentation scope of $18 Million. These savings were primarily from site design of power distribution and piping for the water treatment units. Also contributing to the savings were a more appropriate level of safety documentation and the alternate ``commercial`` bids made by vendors in response to a request for proposals for water treatment units. The use of the N and S Process on an ER activity, details on the cost savings, lessons learned and recommendations for broader implementation of the N and S Process are described herein.

  7. Morphology in conjunction with immunohistochemistry is sufficient for the diagnosis of mammary analogue secretory carcinoma.

    PubMed

    Shah, Akeesha A; Wenig, Bruce M; LeGallo, Robin D; Mills, Stacey E; Stelow, Edward B

    2015-03-01

    The recently described mammary analogue secretory carcinoma (MASC) is a low-grade salivary gland malignancy that harbors the recurrent cytogenetic abnormality t(12;15) (p13;q25) ETV6-NTRK3. Confirmation of this is currently considered the gold standard for diagnosis. Some have postulated that morphology together with supporting immunohistochemistry is sufficient to diagnose MASC. In this study we retrospectively review a series of 19 MASCs diagnosed based on histology in conjunction with immunohistochemistry; subsequently we performed in situ hybridization using an ETV6 break-apart probe. Immunohistochemistry for S100 protein and mammaglobin as well as fluorescence in situ hybridization using the Vysis ETV6 Dual Color Break-Apart FISH Probe Kit were performed on all cases. The 19 cases were from 12 females and 7 males with ages ranging from 16 to 76 years (mean = 45 years). Sixteen cases were from the parotid gland, 1 case was from a periparotid lymph node and 2 cases were from the submandibular gland. All 19 cases demonstrated moderate to strong expression of S100 protein. Eighteen cases demonstrated strong, diffuse expression of mammaglobin, while one case had only rare tumor cells that strongly expressed mammaglobin. Eighteen of 19 cases (95 %) demonstrated the ETV6 rearrangement by fluorescence in situ hybridization. Given that morphology together with immunohistochemistry is highly correlated with the ETV6 gene rearrangement, we conclude that molecular confirmation is not required to diagnose MASC.

  8. Spirituality, hope, and self-sufficiency among low-income job seekers.

    PubMed

    2015-04-01

    Self-sufficiency (SS) is an important social welfare policy goal in the United States, yet little is known about the process that leads to SS. To address this gap in the literature, this study examined the relationship between spirituality, hope, and SS among a sample of low-income job seekers (N = 116). It was hypothesized that spirituality would be related to hope, and that hope, in turn, would be related to SS. Using survey data from two workforce development agencies, this hypothesis was confirmed-hope fully mediated the relationship between spirituality and SS. Of the two factors through which hope is commonly operationalized-agency and pathways-supplemental analysis suggested that spirituality only affects SS through the agency channel. To help foster hope in direct practice settings, it is suggested that social workers might employ spiritually modified cognitive-behavioral therapy protocols. Macrostructural interventions that block the pathway component of hope are also suggested to help reverse exclusion from labor market entry. As such, hope needs to be addressed comprehensively-intrapsychically and macrostructurally-to effect bottom-up change for SS. Engendering hope may assist clients overcome some of the many challenges they encounter on the journey to SS.

  9. OVER-EXPRESSION OF THE SODIUM CHLORIDE COTRANSPORTER IS NOT SUFFICIENT TO CAUSE FAMILIAL HYPERKALEMIC HYPERTENSION

    PubMed Central

    McCormick, James A.; Nelson, Joshua H.; Yang, Chao-Ling; Curry, Joshua N.; Ellison, David H.

    2011-01-01

    The sodium chloride co-transporter (NCC) is the primary target of thiazides diuretics, drugs used commonly for long-term hypertension therapy. Thiazides also completely reverse the signs of Familial Hyperkalemic Hypertension (FHHt), suggesting that the primary defect in FHHt is increased NCC activity. To test whether increased NCC abundance alone is sufficient to generate the FHHt phenotype, we generated NCC transgenic mice; surprisingly, these mice did not display an FHHt-like phenotype. Systolic blood pressures of NCC transgenic mice did not differ from those of wild type mice, even after dietary salt-loading. NCC transgenic mice also did not display hyperkalemia or hypercalciuria, even when challenged with dietary electrolyte manipulation. Administration of fludrocortisone to NCC transgenic mice, to stimulate NCC, resulted in an increase in systolic blood pressure equivalent to that of wild type mice (approximately 20 mmHg). Although total NCC abundance was increased in the transgenic animals, phosphorylated (activated) NCC was not, suggesting that the defect in FHHt involves either activation of ion transport pathways other than NCC, or else direct activation of NCC, in addition to an increase in NCC abundance. PMID:21896937

  10. Kinetochore–microtubule attachment is sufficient to satisfy the human spindle assembly checkpoint

    PubMed Central

    Etemad, Banafsheh; Kuijt, Timo E. F.; Kops, Geert J. P. L.

    2015-01-01

    The spindle assembly checkpoint (SAC) is a genome surveillance mechanism that protects against aneuploidization. Despite profound progress on understanding mechanisms of its activation, it remains unknown what aspect of chromosome–spindle interactions is monitored by the SAC: kinetochore–microtubule attachment or the force generated by dynamic microtubules that signals stable biorientation of chromosomes? To answer this, we uncoupled these two processes by expressing a non-phosphorylatable version of the main microtubule-binding protein at kinetochores (HEC1-9A), causing stabilization of incorrect kinetochore–microtubule attachments despite persistent activity of the error-correction machinery. The SAC is fully functional in HEC1-9A-expressing cells, yet cells in which chromosomes cannot biorient but are stably attached to microtubules satisfy the SAC and exit mitosis. SAC satisfaction requires neither intra-kinetochore stretching nor dynamic microtubules. Our findings support the hypothesis that in human cells the end-on interactions of microtubules with kinetochores are sufficient to satisfy the SAC without the need for microtubule-based pulling forces. PMID:26621779

  11. Safety Sufficiency for NextGen: Assessment of Selected Existing Safety Methods, Tools, Processes, and Regulations

    NASA Technical Reports Server (NTRS)

    Xu, Xidong; Ulrey, Mike L.; Brown, John A.; Mast, James; Lapis, Mary B.

    2013-01-01

    NextGen is a complex socio-technical system and, in many ways, it is expected to be more complex than the current system. It is vital to assess the safety impact of the NextGen elements (technologies, systems, and procedures) in a rigorous and systematic way and to ensure that they do not compromise safety. In this study, the NextGen elements in the form of Operational Improvements (OIs), Enablers, Research Activities, Development Activities, and Policy Issues were identified. The overall hazard situation in NextGen was outlined; a high-level hazard analysis was conducted with respect to multiple elements in a representative NextGen OI known as OI-0349 (Automation Support for Separation Management); and the hazards resulting from the highly dynamic complexity involved in an OI-0349 scenario were illustrated. A selected but representative set of the existing safety methods, tools, processes, and regulations was then reviewed and analyzed regarding whether they are sufficient to assess safety in the elements of that OI and ensure that safety will not be compromised and whether they might incur intolerably high costs.

  12. Transcriptional Activation by Oct4 Is Sufficient for the Maintenance and Induction of Pluripotency

    PubMed Central

    Hammachi, Fella; Morrison, Gillian M.; Sharov, Alexei A.; Livigni, Alessandra; Narayan, Santosh; Papapetrou, Eirini P.; O'Malley, James; Kaji, Keisuke; Ko, Minoru S.H.; Ptashne, Mark; Brickman, Joshua M.

    2012-01-01

    Summary Oct4 is an essential regulator of pluripotency in vivo and in vitro in embryonic stem cells, as well as a key mediator of the reprogramming of somatic cells into induced pluripotent stem cells. It is not known whether activation and/or repression of specific genes by Oct4 is relevant to these functions. Here, we show that fusion proteins containing the coding sequence of Oct4 or Xlpou91 (the Xenopus homolog of Oct4) fused to activating regions, but not those fused to repressing regions, behave as Oct4, suppressing differentiation and promoting maintenance of undifferentiated phenotypes in vivo and in vitro. An Oct4 activation domain fusion supported embryonic stem cell self-renewal in vitro at lower concentrations than that required for Oct4 while alleviating the ordinary requirement for the cytokine LIF. At still lower levels of the fusion, LIF dependence was restored. We conclude that the necessary and sufficient function of Oct4 in promoting pluripotency is to activate specific target genes. PMID:22832160

  13. Low Oxygen Tension During Incubation Periods of Chondrocyte Expansion Is Sufficient to Enhance Postexpansion Chondrogenesis

    PubMed Central

    Ginley, Nell M.; Caplan, Arnold I.; Niyibizi, Christopher; Dennis, James E.

    2010-01-01

    To determine whether low oxygen (O2) tension during expansion affects the matrix density, as well as quantity, of cartilage formed, and to determine whether application of low O2 tension during incubation periods alone is sufficient to modulate chondrogenic expression, rabbit chondrocytes expanded at either 21% O2 or 5% O2 were analyzed for glycosaminoglycan (GAG) and DNA content, total collagen, and gene expression during expansion and postexpansion aggregate cultures. When cultured as aggregates at 21% O2, chondrocytes expanded at 5% O2 produced cartilage aggregates that contained more total GAG, GAG per wet weight, GAG per DNA, and total collagen than chondrocytes expanded at 21% O2. Less of an effect on GAG and collagen content was observed when aggregate culture was performed at 5% O2. Real-time polymerase chain reaction analysis of COL2A1 expression showed upregulated levels of type IIA (an early marker) and IIB (a late marker) during expansion and elevated levels of type IIB during aggregate culture in chondrocytes expanded in low O2. The application of low O2 tension during incubation periods of chondrocyte expansion enhances the ultimate cartilage matrix density and quantity, and this enhancement can be achieved through the use of an O2 control incubator. PMID:19958052

  14. Infant photometry: are mean adult isoluminance values a sufficient approximation to individual infant values?

    PubMed

    Pereverzeva, Maria; Hui-Lin Chien, Sarina; Palmer, John; Teller, Davida Y

    2002-06-01

    Individual differences in isoluminance values were studied in infants and adults using a motion nulling paradigm. Two luminance-modulated sinusoidal grating components (spatial frequency=0.25 cpd, temporal frequency=5.6 Hz, speed=22.4 deg/s) were superimposed and moved in opposite directions across a color video screen. The contrasts of the two components were traded off to determine motion nulls. Two conditions were used: red/black vs. green/black, and red/black vs. blue/black grating components. An eye movement based response measure was used for infant subjects, and an average of 308 trials per infant were obtained. As observed in earlier studies, the mean motion null values for infants and adults were highly similar in each condition. The standard errors of motion null values for individual subjects were very small. Individual differences among infants were also small, and were clearly measurable only in the red/black vs. blue/black condition. The close similarity of mean null values, combined with the small individual differences among infants, supports the idea that under the right circumstances mean adult isoluminance values can be used as a sufficient approximation to individual infant isoluminance values in studies of infant color vision. These circumstances are discussed and evaluated in detail.

  15. Dorsal hippocampus is necessary for novel learning but sufficient for subsequent similar learning.

    PubMed

    Wang, Szu-Han; Finnie, Peter S B; Hardt, Oliver; Nader, Karim

    2012-11-01

    Our current understanding of brain mechanisms involved in learning and memory has been derived largely from studies using experimentally naïve animals. However, it is becoming increasingly clear that not all identified mechanisms may generalize to subsequent learning. For example, N-methyl-D-aspartate glutamate (NMDA) receptors in the dorsal hippocampus are required for contextual fear conditioning in naïve animals but not in animals previously trained in a similar task. Here we investigated how animals learn contextual fear conditioning for a second time-a response which is not due to habituation or generalization. We found that dorsal hippocampus infusions of voltage-dependent calcium channel blockers or the inhibitory neurotransmitter gamma-aminobutyric acid (GABA) agonist impaired the first, not the second contextual learning. Only manipulations of the entire hippocampus led to an impairment in second learning. Specifically, inactivation of either the dorsal or ventral hippocampus caused the remaining portion of the hippocampus to acquire and consolidate the second learning. Thus, dorsal hippocampus seems necessary for initial contextual fear conditioning, but either the dorsal or ventral hippocampus is sufficient for subsequent conditioning in a different context. Together, these findings suggest that prior training experiences can change how the hippocampus processes subsequent similar learning.

  16. Benthic impacts of intertidal oyster culture, with consideration of taxonomic sufficiency.

    PubMed

    Forrest, Barrie M; Creese, Robert G

    2006-01-01

    An investigation of the impacts from elevated intertidal Pacific oyster culture in a New Zealand estuary showed enhanced sedimentation beneath culture racks compared with other sites. Seabed elevation beneath racks was generally lower than between them, suggesting that topographic patterns more likely result from a local effect of rack structures on hydrodynamic processes than from enhanced deposition. Compared with control sites, seabed sediments within the farm had a greater silt/clay and organic content, and a lower redox potential and shear strength. While a marked trend in macrofaunal species richness was not evident, species composition and dominance patterns were consistent with a disturbance gradient, with farm effects not evident 35 m from the perimeter of the racks. Of the environmental variables measured, sediment shear strength was most closely associated with the distribution and density of macrofauna, suggesting that human-induced disturbance from farming operations may have contributed to the biological patterns. To evaluate the taxonomic sufficiency needed to document impacts, aggregation to the family level based on Linnean classification was compared with an aggregation scheme based on ;general groups' identifiable with limited taxonomic expertise. Compared with species-level analyses, spatial patterns of impact were equally discernible at both aggregation levels used, provided density rather than presence/absence data were used. Once baseline conditions are established and the efficacy of taxonomic aggregation demonstrated, a ;general group' scheme provides an appropriate and increasingly relevant tool for routine monitoring.

  17. Orexin 2 Receptor Antagonism is Sufficient to Promote NREM and REM Sleep from Mouse to Man

    PubMed Central

    Gotter, Anthony L.; Forman, Mark S.; Harrell, Charles M.; Stevens, Joanne; Svetnik, Vladimir; Yee, Ka Lai; Li, Xiaodong; Roecker, Anthony J.; Fox, Steven V.; Tannenbaum, Pamela L.; Garson, Susan L.; Lepeleire, Inge De; Calder, Nicole; Rosen, Laura; Struyk, Arie; Coleman, Paul J.; Herring, W. Joseph; Renger, John J.; Winrow, Christopher J.

    2016-01-01

    Orexin neuropeptides regulate sleep/wake through orexin receptors (OX1R, OX2R); OX2R is the predominant mediator of arousal promotion. The potential for single OX2R antagonism to effectively promote sleep has yet to be demonstrated in humans. MK-1064 is an OX2R-single antagonist. Preclinically, MK-1064 promotes sleep and increases both rapid eye movement (REM) and non-REM (NREM) sleep in rats at OX2R occupancies higher than the range observed for dual orexin receptor antagonists. Similar to dual antagonists, MK-1064 increases NREM and REM sleep in dogs without inducing cataplexy. Two Phase I studies in healthy human subjects evaluated safety, tolerability, pharmacokinetics and sleep-promoting effects of MK-1064, and demonstrated dose-dependent increases in subjective somnolence (via Karolinska Sleepiness Scale and Visual Analogue Scale measures) and sleep (via polysomnography), including increased REM and NREM sleep. Thus, selective OX2R antagonism is sufficient to promote REM and NREM sleep across species, similarly to that seen with dual orexin receptor antagonism. PMID:27256922

  18. B cell antigen presentation is sufficient to drive neuroinflammation in an animal model of multiple sclerosis.

    PubMed

    Parker Harp, Chelsea R; Archambault, Angela S; Sim, Julia; Ferris, Stephen T; Mikesell, Robert J; Koni, Pandelakis A; Shimoda, Michiko; Linington, Christopher; Russell, John H; Wu, Gregory F

    2015-06-01

    B cells are increasingly regarded as integral to the pathogenesis of multiple sclerosis, in part as a result of the success of B cell-depletion therapy. Multiple B cell-dependent mechanisms contributing to inflammatory demyelination of the CNS have been explored using experimental autoimmune encephalomyelitis (EAE), a CD4 T cell-dependent animal model for multiple sclerosis. Although B cell Ag presentation was suggested to regulate CNS inflammation during EAE, direct evidence that B cells can independently support Ag-specific autoimmune responses by CD4 T cells in EAE is lacking. Using a newly developed murine model of in vivo conditional expression of MHC class II, we reported previously that encephalitogenic CD4 T cells are incapable of inducing EAE when B cells are the sole APC. In this study, we find that B cells cooperate with dendritic cells to enhance EAE severity resulting from myelin oligodendrocyte glycoprotein (MOG) immunization. Further, increasing the precursor frequency of MOG-specific B cells, but not the addition of soluble MOG-specific Ab, is sufficient to drive EAE in mice expressing MHCII by B cells alone. These data support a model in which expansion of Ag-specific B cells during CNS autoimmunity amplifies cognate interactions between B and CD4 T cells and have the capacity to independently drive neuroinflammation at later stages of disease.

  19. Chronic lower limb ischemia and advanced renal failure. Do we possess sufficient therapeutic knowledge?

    PubMed

    Gacka, M; Adamiec, R

    2013-08-01

    Chronic lower limb ischemia diminishes the quality of life and is associated with a higher risk of limb amputation and cardiovascular mortality. Coexisting chronic renal disease can modulate the response to pharmacotherapy and revascularization, and thus influence prognosis. This paper reviews current literary evidence regarding therapeutic problems observed in patients with obliterative atherosclerosis and renal failure. We reviewed articles from peer-reviewed medical journals which were published between 2000 and 2011. The poorer clinical response in the discussed patients is not only connected with the direct failure of surgical and endovascular procedures, but first of all with the high mortality of the patients. There is still a lack of sufficient evidence on the effectiveness of currently used anti-atherosclerotic agents in patients with end-stage renal failure. A certain priority is the search for an effective therapeutic strategy that would reduce mortality associated with cardiovascular conditions in this particular group of patients. Identifying patients who can benefit most from costly endovascular procedures is another vital issue.

  20. Activation of Pim Kinases Is Sufficient to Promote Resistance to MET Small Molecule Inhibitors

    PubMed Central

    An, Ningfei; Xiong, Ying; LaRue, Amanda C.; Kraft, Andrew S.; Cen, Bo

    2015-01-01

    MET blockade offers a new targeted therapy particularly in those cancers with MET amplification. However, the efficacy and the duration of the response to MET inhibitors are limited by the emergence of drug resistance. Here we report that resistance to small molecule inhibitors of MET can arise from increased expression of the pro-survival Pim protein kinases. This resistance mechanism was documented in non-small cell lung cancer and gastric cancer cells with MET amplification. Inhibition of Pim kinases enhanced cell death triggered by short-term treatment with MET inhibitors. Pim kinases control the translation of anti-apoptotic protein Bcl-2 at an internal ribosome entry site and this mechanism was identified as the basis for Pim-mediated resistance to MET inhibitors. Protein synthesis was increased in drug-resistant cells, secondary to a Pim-mediated increase in cap-independent translation. In cells rendered drug resistant by chronic treatment with MET inhibitors, genetic or pharmacological inhibition of Pim kinases was sufficient to restore sensitivity in vitro and in vivo. Taken together, our results rationalize Pim inhibition as a strategy to augment responses and blunt acquired resistance to MET inhibitors in cancer. PMID:26670562

  1. Sufficient production of geranylgeraniol is required to maintain endotoxin tolerance in macrophages.

    PubMed

    Kim, Jinyong; Lee, Joon No; Ye, James; Hao, Rosy; Debose-Boyd, Russell; Ye, Jin

    2013-12-01

    Endotoxin tolerance allows macrophages to produce large quantities of proinflammatory cytokines immediately after their contact with lipopolysaccharides (LPSs), but prevents their further production after repeated exposure to LPSs. While this response is known to prevent overproduction of proinflammatory cytokines, the mechanism through which endotoxin tolerance is established has not been identified. In the current study, we demonstrate that sufficient production of geranylgeraniol (GGOH) in macrophages is required to maintain endotoxin tolerance. We show that increased synthesis of 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCR) protein following LPS treatment is required to produce enough GGOH to inhibit expression of Malt1, a protein known to stimulate expression of proinflammatory cytokines, in macrophages repeatedly exposed to LPSs. Depletion of GGOH caused by inhibition of HMGCR led to increased Malt1 expression in macrophages subjected to repeated exposure to LPSs. Consequently, endotoxin tolerance was impaired, and production of interleukin 1-β and other proinflammatory cytokines was markedly elevated in these cells. These results suggest that insufficient production of GGOH in macrophages may cause autoinflammatory diseases.

  2. Is the structural diversity of tripeptides sufficient for developing functional food additives with satisfactory multiple bioactivities?

    NASA Astrophysics Data System (ADS)

    Wang, Jian-Hui; Liu, Yong-Le; Ning, Jing-Heng; Yu, Jian; Li, Xiang-Hong; Wang, Fa-Xiang

    2013-05-01

    Multifunctional peptides have attracted increasing attention in the food science community because of their therapeutic potential, low toxicity and rapid intestinal absorption. However, previous study demonstrated that the limited structural variations make it difficult to optimize dipeptide molecules in a good balance between desirable and undesirable properties (F. Tian, P. Zhou, F. Lv, R. Song, Z. Li, J. Pept. Sci. 13 (2007) 549-566). In the present work, we attempt to answer whether the structural diversity is sufficient for a tripeptide to have satisfactory multiple bioactivities. Statistical test, structural examination and energetic analysis confirm that peptides of three amino acids long can bind tightly to human angiotensin converting enzyme (ACE) and thus exert significant antihypertensive efficacy. Further quantitative structure-activity relationship (QSAR) modeling and prediction of all 8000 possible tripeptides reveal that their ACE-inhibitory potency exhibits a good (positive) relationship to antioxidative activity, but has only a quite modest correlation with bitterness. This means that it is possible to find certain tripeptide entities possessing the optimal combination of strong ACE-inhibitory potency, high antioxidative activity and weak bitter taste, which are the promising candidates for developing multifunctional food additives with satisfactory multiple bioactivities. The marked difference between dipeptide and tripeptide can be attributed to the fact that the structural diversity of peptides increases dramatically with a slight change in sequence length.

  3. The ubiquitous octamer-binding protein(s) is sufficient for transcription of immunoglobulin genes.

    PubMed Central

    Johnson, D G; Carayannopoulos, L; Capra, J D; Tucker, P W; Hanke, J H

    1990-01-01

    All immunoglobulin genes contain a conserved octanucleotide promoter element, ATGCAAAT, which has been shown to be required for their normal B-cell-specific transcription. Proteins that bind this octamer have been purified, and cDNAs encoding octamer-binding proteins have been cloned. Some of these proteins (referred to as OTF-2) are lymphoid specific, whereas at least one other, and possibly more (referred to as OTF-1), is found ubiquitously in all cell types. The exact role of these different proteins in directing the tissue-specific expression of immunoglobulin genes is unclear. We have identified two human pre-B-cell lines that contain extremely low levels of OTF-2 yet still express high levels of steady-state immunoglobulin heavy-chain mRNA in vivo and efficiently transcribe an immunoglobulin gene in vitro. Addition of a highly enriched preparation of OTF-1 made from one of these pre-B cells or from HeLa cells specifically stimulated in vitro transcription of an immunoglobulin gene. Furthermore, OFT-1 appeared to have approximately the same transactivation ability as OTF-2 when normalized for binding activity. These results suggest that OTF-1, without OTF-2, is sufficient for transcription of immunoglobulin genes and that OTF-2 alone is not responsible for the B-cell-specific regulation of immunoglobulin gene expression. Images PMID:2304473

  4. Restriction of dopamine signaling to the dorsolateral striatum is sufficient for many cognitive behaviors

    PubMed Central

    Darvas, Martin; Palmiter, Richard D.

    2009-01-01

    The striatum is a vital substrate for performance, procedural memory, and learning. The ventral and medial striatum are thought to be critical for acquisition of tasks while the dorsolateral striatum is important for performance and habitual enactment of skills. Evidence based on cortical, thalamic, and amygdaloid inputs to the striatum suggests a medio-lateral zonation imposed on the classical dorso-ventral distinction. We therefore investigated the functional significance of dopaminergic signaling in cognitive tasks by studying dopamine-deficient (DD) mice and mice with dopamine signaling restored to only the dorsolateral (DL) striatum by viral rescue (vrDD-DL mice). Whereas DD mice failed in all of the tasks examined here, vrDD-DL mice displayed intact discriminatory learning, object recognition, visuospatial learning and spatial memory. Acquisition of operant behavior for food rewards was delayed in vrDD-DL mice and their motivation in a progressive ratio experiments was reduced. Therefore, dopaminergic signaling in the dorsolateral striatum is sufficient for mice to learn several different cognitive tasks although the rate of learning some of them was reduced. These results indicate that dopaminergic signaling in the ventromedial striatum is not absolutely necessary for mastery of these behaviors, but may facilitate them. PMID:19667174

  5. A dual inhibitory mechanism sufficient to maintain cell cycle restricted CENP-A assembly

    PubMed Central

    Stankovic, Ana; Guo, Lucie Y.; Mata, João F.; Bodor, Dani L.; Cao, Xing-Jun; Bailey, Aaron O.; Shabanowitz, Jeffrey; Hunt, Donald F.; Garcia, Benjamin A.; Black, Ben E.; Jansen, Lars E.T

    2017-01-01

    Summary Chromatin featuring the H3 variant CENP-A at the centromere is critical for its mitotic function and epigenetic maintenance. Assembly of centromeric chromatin is restricted to G1 phase through inhibitory action of Cdk1/2 kinases in other phases of the cell cycle. Here, we identify the two key targets sufficient to maintain cell cycle control of CENP-A assembly. We uncovered a single phosphorylation site in the licensing factor M18BP1 and a cyclin A binding site in the CENP-A chaperone, HJURP, mediating specific inhibitory phosphorylation. Simultaneous expression of mutant proteins lacking these residues, results in complete uncoupling from the cell cycle. Consequently, CENP-A assembly is fully recapitulated under high Cdk activities, indistinguishable from G1 assembly. We find that Cdk-mediated inhibition is exerted by sequestering active factors away from the centromere. Finally, we show that displacement of M18BP1 from the centromere is critical for the assembly mechanism of CENP-A. PMID:28017591

  6. The case for neuropsychoanalysis: Why a dialogue with neuroscience is necessary but not sufficient for psychoanalysis.

    PubMed

    Yovell, Yoram; Solms, Mark; Fotopoulou, Aikaterini

    2015-12-01

    Recent advances in the cognitive, affective and social neurosciences have enabled these fields to study aspects of the mind that are central to psychoanalysis. These developments raise a number of possibilities for psychoanalysis. Can it engage the neurosciences in a productive and mutually enriching dialogue without compromising its own integrity and unique perspective? While many analysts welcome interdisciplinary exchanges with the neurosciences, termed neuropsychoanalysis, some have voiced concerns about their potentially deleterious effects on psychoanalytic theory and practice. In this paper we outline the development and aims of neuropsychoanalysis, and consider its reception in psychoanalysis and in the neurosciences. We then discuss some of the concerns raised within psychoanalysis, with particular emphasis on the epistemological foundations of neuropsychoanalysis. While this paper does not attempt to fully address the clinical applications of neuropsychoanalysis, we offer and discuss a brief case illustration in order to demonstrate that neuroscientific research findings can be used to enrich our models of the mind in ways that, in turn, may influence how analysts work with their patients. We will conclude that neuropsychoanalysis is grounded in the history of psychoanalysis, that it is part of the psychoanalytic worldview, and that it is necessary, albeit not sufficient, for the future viability of psychoanalysis.

  7. Construction and engineering of a thermostable self-sufficient cytochrome P450

    SciTech Connect

    Mandai, Takao; Fujiwara, Shinsuke; Imaoka, Susumu

    2009-06-19

    CYP175A1 is a thermophilic cytochrome P450 and hydroxylates {beta}-carotene. We previously identified a native electron transport system for CYP175A1. In this report, we constructed two fusion proteins consisting of CYP175A1, ferredoxin (Fdx), and ferredoxin-NADP{sup +} reductase (FNR): H{sub 2}N-CYP175A1-Fdx-FNR-COOH (175FR) and H{sub 2}N-CYP175A1-FNR-Fdx-COOH (175RF). Both 175FR and 175RF were expressed in Escherichia coli and purified. The V{sub max} value for {beta}-carotene hydroxylation was 25 times higher with 175RF than 175FR and 9 times higher with 175RF than CYP175A1 (non-fused protein), although the k{sub m} values of these enzymes were similar. 175RF retained 50% residual activity even at 80 {sup o}C. Furthermore, several mutants of the CYP175A1 domain of 175RF were prepared and one mutant (Q67G/Y68I) catalyzed the hydroxylation of an unnatural substrate, testosterone. Thus, this is the first report of a thermostable self-sufficient cytochrome P450 and the engineering of a thermophilic cytochrome P450 for the oxidation of an unnatural substrate.

  8. Protein arginine deiminase 4 inhibition is sufficient for the amelioration of collagen-induced arthritis.

    PubMed

    Willis, V C; Banda, N K; Cordova, K N; Chandra, P E; Robinson, W H; Cooper, D C; Lugo, D; Mehta, G; Taylor, S; Tak, P P; Prinjha, R K; Lewis, H D; Holers, V M

    2017-01-27

    Citrullination of joint proteins by the protein arginine deiminase (PAD) family of enzymes is recognized increasingly as a key process in the pathogenesis of rheumatoid arthritis. This present study was undertaken to explore the efficacy of a novel PAD4-selective inhibitor, GSK199, in the murine collagen-induced arthritis model of rheumatoid arthritis. Mice were dosed daily from the time of collagen immunization with GSK199. Efficacy was assessed against a wide range of end-points, including clinical disease scores, joint histology and immunohistochemistry, serum and joint citrulline levels and quantification of synovial autoantibodies using a proteomic array containing joint peptides. Administration of GSK199 at 30 mg/kg led to significant effects on arthritis, assessed both by global clinical disease activity and by histological analyses of synovial inflammation, pannus formation and damage to cartilage and bone. In addition, significant decreases in complement C3 deposition in both synovium and cartilage were observed robustly with GSK199 at 10 mg/kg. Neither the total levels of citrulline measurable in joint and serum, nor levels of circulating collagen antibodies, were affected significantly by treatment with GSK199 at any dose level. In contrast, a subset of serum antibodies reactive against citrullinated and non-citrullinated joint peptides were reduced with GSK199 treatment. These data extend our previous demonstration of efficacy with the pan-PAD inhibitor Cl-amidine and demonstrate robustly that PAD4 inhibition alone is sufficient to block murine arthritis clinical and histopathological end-points.

  9. Decontamination procedures for drugs of abuse in hair: are they sufficient?

    PubMed

    Blank, D L; Kidwell, D A

    1995-01-05

    This paper reviews the methods for decontaminating hair exposed to external solutions of drugs of abuse. Exposure of hair to cocaine at 1 microgram/ml for 5 min is sufficient to contaminate hair, yet decontamination is a very slow process. Using externally contaminated hair, a number of decontamination procedures were attempted, and none removed all the contamination. The percentage of external contamination removed depended on the hair type, with thick black hair being the most resistant to decontamination. Hair treated by dying incorporated externally applied drugs differently, depending on the hair type. Thick black hair became more absorbent whereas thin brown hair became less absorbent. Kinetic wash criteria are evaluated for their ability/inability to determine if hair has been contaminated from external sources. A theoretical framework for the incorporation and removal of drugs from hair is discussed, and the hypothesis that inaccessible domains exist in hair which trap drugs is critically examined. The results presented in this paper strongly suggest that much more information on the decontamination of hair and the differentiation of exogenously and endogenously incorporated drugs is needed before hair analysis can be employed in most forensic applications. We propose that the radioactive tracer methods discussed herein are well suited for evaluating any new decontamination or extraction technique.

  10. Identifying Pathways for Improving Household Food Self-Sufficiency Outcomes in the Hills of Nepal.

    PubMed

    Karki, Tika B; Sah, Shrawan K; Thapa, Resam B; McDonald, Andrew J; Davis, Adam S

    2015-01-01

    Maintaining and improving household food self-sufficiency (FSS) in mountain regions is an ongoing challenge. There are many facets to the issue, including comparatively high levels of land fragmentation, challenging terrain and transportation bottlenecks, declining labor availability due to out-migration, and low technical knowledge, among others. Using a nonparametric multivariate approach, we quantified primary associations underlying current levels of FSS in the mid-hills of Nepal. A needs assessment survey was administered to 77 households in Lungaun (Baglung District), Pang (Parbat District), and Pathlekhet (Myagdi District), with a total of 80 variables covering five performance areas; resulting data were analyzed using Classification and Regression Trees. The most parsimonious statistical model for household FSS highlighted associations with agronomic management, including yields of maize and fingermillet within a relay cropping system and adoption of improved crop cultivars. Secondary analyses of the variables retained in the first model again focused primarily on crop and livestock management. It thus appears that continued emphasis on technical agricultural improvements is warranted, independent of factors such as land holding size that, in any case, are very difficult to change through development interventions. Initiatives to increase household FSS in the mid-hills of Nepal will benefit from placing a primary focus on methods of agricultural intensification to improve crop yields and effective technology transfer to increase adoption of these methods.

  11. Endogenously released GLP-1 is not sufficient to alter postprandial glucose regulation in the dog

    PubMed Central

    Farmer, Tiffany; Schurr, Kathleen; Donahue, E. Patrick; Farmer, Ben; Neal, Doss; Cherrington, Alan D.

    2017-01-01

    Glucagon-like peptide-1 (GLP-1) is secreted from the L cell of the gut in response to oral nutrient delivery. To determine if endogenously released GLP-1 contributes to the incretin effect and postprandial glucose regulation, conscious dogs (n = 8) underwent an acclimation period (t = −60 to −20 min), followed by a basal sampling period (t = −20 to 0 min) and an experimental period (t = 0–320 min). At the beginning of the experimental period, t = 0 min, a peripheral infusion of either saline or GLP-1 receptor (GLP-1R) antagonist, exendin (9–39) (Ex-9, 500 pmol/kg/min), was started. At t = 30 min, animals consumed a liquid mixed meal, spiked with acetaminophen. All animals were studied twice (± Ex-9) in random fashion, and the experiments were separated by a 1–2-week washout period. Antagonism of the GLP-1R did not have an effect, as indicated by repeated-measures MANOVA analysis of the Δ AUC from t = 45–320 min of arterial plasma glucose, GLP-1, insulin, glucagon, and acetaminophen levels. Therefore, endogenous GLP-1 is not sufficient to alter postprandial glucose regulation in the dog. PMID:21547512

  12. Entropic inequalities as a necessary and sufficient condition to noncontextuality and locality

    NASA Astrophysics Data System (ADS)

    Chaves, Rafael

    2013-02-01

    The assumption of local realism, in a Bell locality scenario, imposes nontrivial conditions on the Shannon entropies of the associated probability distributions, expressed by linear entropic Bell inequalities. In principle, these entropic inequalities provide necessary but not sufficient criteria for the existence of a local hidden variable model reproducing the correlations, as, for example, the paradigmatic nonlocal Popescu-Rohrlich (PR) box is entropically not different from a classically correlated box. In this paper we show that for the n-cycle scenario, entropic inequalities completely characterize the set of local correlations. In particular, every nonsignaling box which violates the Clauser-Horne-Shimony-Holt (CHSH) inequality—including the PR box—can be locally modified so that it also violates the entropic version of CHSH inequality. As we show, any nonlocal probabilistic model when appropriately mixed with a local model, violates an entropic inequality, thus evidencing a very peculiar kind of nonlocality. As the n-cycle captures equally well both the notion of local realism introduced by Bell and that of noncontextuality presented by the Kochen-Specker theorem, the results are also valid for noncontextuality scenarios.

  13. Dietary Iodine Sufficiency and Moderate Insufficiency in the Lactating Mother and Nursing Infant: A Computational Perspective

    PubMed Central

    Fisher, W.; Wang, Jian; George, Nysia I.; Gearhart, Jeffery M.; McLanahan, Eva D.

    2016-01-01

    The Institute of Medicine recommends that lactating women ingest 290 μg iodide/d and a nursing infant, less than two years of age, 110 μg/d. The World Health Organization, United Nations Children’s Fund, and International Council for the Control of Iodine Deficiency Disorders recommend population maternal and infant urinary iodide concentrations ≥ 100 μg/L to ensure iodide sufficiency. For breast milk, researchers have proposed an iodide concentration range of 150–180 μg/L indicates iodide sufficiency for the mother and infant, however no national or international guidelines exist for breast milk iodine concentration. For the first time, a lactating woman and nursing infant biologically based model, from delivery to 90 days postpartum, was constructed to predict maternal and infant urinary iodide concentration, breast milk iodide concentration, the amount of iodide transferred in breast milk to the nursing infant each day and maternal and infant serum thyroid hormone kinetics. The maternal and infant models each consisted of three sub-models, iodide, thyroxine (T4), and triiodothyronine (T3). Using our model to simulate a maternal intake of 290 μg iodide/d, the average daily amount of iodide ingested by the nursing infant, after 4 days of life, gradually increased from 50 to 101 μg/day over 90 days postpartum. The predicted average lactating mother and infant urinary iodide concentrations were both in excess of 100 μg/L and the predicted average breast milk iodide concentration, 157 μg/L. The predicted serum thyroid hormones (T4, free T4 (fT4), and T3) in both the nursing infant and lactating mother were indicative of euthyroidism. The model was calibrated using serum thyroid hormone concentrations for lactating women from the United States and was successful in predicting serum T4 and fT4 levels (within a factor of two) for lactating women in other countries. T3 levels were adequately predicted. Infant serum thyroid hormone levels were adequately

  14. Sunlight exposure increases vitamin D sufficiency in growing pigs fed a diet formulated to exceed requirements.

    PubMed

    Alexander, B M; Ingold, B C; Young, J L; Fensterseifer, S R; Wechsler, P J; Austin, K J; Larson-Meyer, D E

    2017-04-01

    Traditional confinement practices limit exposure to sunlight and vitamin D synthesis, and vitamin insufficiency occurs even with dietary supplementation. The aim of this study was to determine the effect of limited sun exposure on serum concentration of vitamin D and the expression of vitamin D synthesizing enzymes in the liver and kidney of pigs on a vitamin D sufficient diet. White-pigmented grower pigs (29.7 ± 2.3 kg) fed 15% CP diet ad libitum providing >1,200 IU vitamin D3/kg of feed were exposed to sunlight for 1 h each day at solar noon for 14 d at the spring equinox (March pigs, n = 10) or summer solstice (June pigs, n = 5) and again before slaughter in June (March pigs) and September (June pigs). Blood for the analysis of 25(OH)D was collected before and after sunlight exposure. Traditionally housed pigs served as controls. After initial sun exposure, blood samples were collected from June pigs daily for 5 d and weekly for 8 wk to determine vitamin D3 and 25(OH)D decay, respectively. Kidney and liver samples were collected from the June pigs at slaughter after sun exposure for analysis of messenger RNA expression of vitamin D binding protein and synthesizing/degrading enzymes. Average daily gain (ADG) was not influenced (P > 0.5) by sunlight exposure. June pigs had fewer days on feed, lower (P = 0.003) ADG and were slaughtered at a lighter (P < 0.001) weight. Exposure to sunlight increased (P < 0.001) 25(OH) vitamin D for all pigs. March pigs, obtained from a Midwest producer, had lower (P < 0.001) concentration of 25(OH)D than June pigs born on-farm. Initial sunlight exposure increased serum concentration of 25(OH)D in March pigs by 200% and June pigs by 67%. Serum concentration of vitamin D3 was decreased (P < 0.05) by 72 h with 25(OH)D decreased (P < 0.05) by wk 4 after exposure. Expression of vitamin D binding protein, vitamin D synthesizing CYP2R1, CYP27A1, CYP2D25, or degrading enzyme CYP24A1 were not influenced (P ≥ 0.19) by sunlight

  15. Dietary Iodine Sufficiency and Moderate Insufficiency in the Lactating Mother and Nursing Infant: A Computational Perspective.

    PubMed

    Fisher, W; Wang, Jian; George, Nysia I; Gearhart, Jeffery M; McLanahan, Eva D

    2016-01-01

    The Institute of Medicine recommends that lactating women ingest 290 μg iodide/d and a nursing infant, less than two years of age, 110 μg/d. The World Health Organization, United Nations Children's Fund, and International Council for the Control of Iodine Deficiency Disorders recommend population maternal and infant urinary iodide concentrations ≥ 100 μg/L to ensure iodide sufficiency. For breast milk, researchers have proposed an iodide concentration range of 150-180 μg/L indicates iodide sufficiency for the mother and infant, however no national or international guidelines exist for breast milk iodine concentration. For the first time, a lactating woman and nursing infant biologically based model, from delivery to 90 days postpartum, was constructed to predict maternal and infant urinary iodide concentration, breast milk iodide concentration, the amount of iodide transferred in breast milk to the nursing infant each day and maternal and infant serum thyroid hormone kinetics. The maternal and infant models each consisted of three sub-models, iodide, thyroxine (T4), and triiodothyronine (T3). Using our model to simulate a maternal intake of 290 μg iodide/d, the average daily amount of iodide ingested by the nursing infant, after 4 days of life, gradually increased from 50 to 101 μg/day over 90 days postpartum. The predicted average lactating mother and infant urinary iodide concentrations were both in excess of 100 μg/L and the predicted average breast milk iodide concentration, 157 μg/L. The predicted serum thyroid hormones (T4, free T4 (fT4), and T3) in both the nursing infant and lactating mother were indicative of euthyroidism. The model was calibrated using serum thyroid hormone concentrations for lactating women from the United States and was successful in predicting serum T4 and fT4 levels (within a factor of two) for lactating women in other countries. T3 levels were adequately predicted. Infant serum thyroid hormone levels were adequately

  16. A single heterologously expressed plant cellulose synthase isoform is sufficient for cellulose microfibril formation in vitro

    PubMed Central

    Purushotham, Pallinti; Cho, Sung Hyun; Díaz-Moreno, Sara M.; Kumar, Manish; Nixon, B. Tracy; Bulone, Vincent; Zimmer, Jochen

    2016-01-01

    Plant cell walls are a composite material of polysaccharides, proteins, and other noncarbohydrate polymers. In the majority of plant tissues, the most abundant polysaccharide is cellulose, a linear polymer of glucose molecules. As the load-bearing component of the cell wall, individual cellulose chains are frequently bundled into micro and macrofibrils and are wrapped around the cell. Cellulose is synthesized by membrane-integrated and processive glycosyltransferases that polymerize UDP-activated glucose and secrete the nascent polymer through a channel formed by their own transmembrane regions. Plants express several different cellulose synthase isoforms during primary and secondary cell wall formation; however, so far, none has been functionally reconstituted in vitro for detailed biochemical analyses. Here we report the heterologous expression, purification, and functional reconstitution of Populus tremula x tremuloides CesA8 (PttCesA8), implicated in secondary cell wall formation. The recombinant enzyme polymerizes UDP-activated glucose to cellulose, as determined by enzyme degradation, permethylation glycosyl linkage analysis, electron microscopy, and mutagenesis studies. Catalytic activity is dependent on the presence of a lipid bilayer environment and divalent manganese cations. Further, electron microscopy analyses reveal that PttCesA8 produces cellulose fibers several micrometers long that occasionally are capped by globular particles, likely representing PttCesA8 complexes. Deletion of the enzyme’s N-terminal RING-finger domain almost completely abolishes fiber formation but not cellulose biosynthetic activity. Our results demonstrate that reconstituted PttCesA8 is not only sufficient for cellulose biosynthesis in vitro but also suffices to bundle individual glucan chains into cellulose microfibrils. PMID:27647898

  17. IS COMPTON COOLING SUFFICIENT TO EXPLAIN EVOLUTION OF OBSERVED QUASI-PERIODIC OSCILLATIONS IN OUTBURST SOURCES?

    SciTech Connect

    Mondal, Santanu; Chakrabarti, Sandip K.; Debnath, Dipak E-mail: chakraba@bose.res.in

    2015-01-01

    In outburst sources, quasi-periodic oscillation (QPO) frequency is known to evolve in a certain way: in the rising phase, it monotonically goes up until a soft intermediate state is achieved. In the propagating oscillatory shock model, oscillation of the Compton cloud is thought to cause QPOs. Thus, in order to increase QPO frequency, the Compton cloud must collapse steadily in the rising phase. In decline phases, the exact opposite should be true. We investigate cause of this evolution of the Compton cloud. The same viscosity parameter that increases the Keplerian disk rate also moves the inner edge of the Keplerian component, thereby reducing the size of the Compton cloud and reducing the cooling timescale. We show that cooling of the Compton cloud by inverse Comptonization is enough for it to collapse sufficiently so as to explain the QPO evolution. In the two-component advective flow configuration of Chakrabarti-Titarchuk, centrifugal force-induced shock represents the boundary of the Compton cloud. We take the rising phase of 2010 outburst of Galactic black hole candidate H 1743-322 and find an estimation of variation of the α parameter of the sub-Keplerian flow to be monotonically rising from 0.0001 to 0.02, well within the range suggested by magnetorotational instability. We also estimate the inward velocity of the Compton cloud to be a few meters per second, which is comparable to what is found in several earlier studies of our group by empirically fitting the shock locations with the time of observations.

  18. Is reduction of tumor burden sufficient for the 21st century?

    PubMed

    Nahas, George; Bliss, Sarah A; Sinha, Garima; Ganta, Teja; Greco, Steven J; Rameshwar, Pranela

    2015-01-28

    Currently, animal models are used to test the efficacy of tumor treatment. A significant reduction of tumor mass is lauded as great improvement. As we begin the 21st century, one wonders if this is sufficient and acceptable for cancer treatment. Although the presence of cancer stem cell (CSCs) is not a new phenomenon, their role in the initiation of the tumor for clinical resurgence is mostly ignored when testing drugs. The current treatment then poses a major limitation to aggressively target the cells most responsible for tumor initiation and resurgence. The review does not trivialize the problem since it is acknowledged that the tumors and cells within the tissue microenvironment would interact through complex mechanisms. It is quite possible that the interaction by CSCs and the microenvironment will vary, depending on the tissue, e.g., bone marrow versus brain. Research studies are needed to investigate if CSCs from the same organ differ after migrating to other tissues. If so, this will pose an economic dilemma for targeted drug development. It will not be feasible to develop drugs for each organ. Besides, the cost, there could be problems to effectively deliver the drugs to all organs, problems to assess drug distribution to particular tissues and toxicity for specific drugs. If multiple drugs are required to eradicate CSCs in different tissues, there is a problem of possible untoward effect for the simultaneous delivery of multiple drugs to a single cancer patient. As new drugs are developed, the investigators will need to pay attention for dedifferentiation of non-CSCs to CSCs. The metabolic pathways will have to be given equal attention as the stem cells genes since their pathways might show major differences rather than the stem cells genes, which are shared by the normal stem cells.

  19. Smoking Lung Cancer Patients and Tobacco Cessation - Is the Current Treatment in Germany Sufficient?

    PubMed

    Vitzthum, K; Thielke, L; Deter, A; Riemer, T; Eggeling, S; Pankow, W; Mache, S

    2015-11-01

    Lung cancer is the most preventable neoplastic disease for men and women. The incidence rate per year is 14.000 in Germany. Smoking is the main risk factor for the onset of lung cancer and for a share of 90% of cases, lung cancer is associated with smoking. Recent studies have shown that the time slot of diagnosing lung cancer is a teachable moment for tobacco cessation interventions. The therapy that was rated most effective was a combination of cognitive behavioral therapy and pharmacotherapy (e. g. NRT, Bupropion, Varenicline). We examined the smoking status of all patients undergoing lung cancer surgery in 2011, 2012 and 2013 in this study. A retrospective semi structured interview via telephone was conducted regarding smoking habits and current quality of life. 131 patients (36.6% female, average age of 68.7 years) of an urban German hospital were included.Results showed a relapse rate of 22.3%, while 86.2% used to be highly addicted smokers; A multivariate analysis of covariance (MANCOVA) indicated a significant overall impact of smoking status on quality of life with a medium effect size, controlled for age, gender, living conditions, tumor stage, duration of smoking abstinence, type of cancer therapy, type of resection method, and the time period between the date of surgery and of the survey. Two thirds of all smokers did not see an association between their habit and their disease.So far motivation to quit and long term abstinence rates are not sufficiently established even among seriously sick patients in Germany; further initiatives should focus on new and more intense interventions and educational strategies.

  20. Retrieval per se is not sufficient to trigger reconsolidation of human fear memory.

    PubMed

    Sevenster, Dieuwke; Beckers, Tom; Kindt, Merel

    2012-03-01

    necessarily affect the cognitive component and vice versa. Second, mere retrieval of the fear memory is not sufficient to induce its labilization and reconsolidation.

  1. Ten minutes of dynamic stretching is sufficient to potentiate vertical jump performance characteristics.

    PubMed

    Turki, Olfa; Chaouachi, Anis; Drinkwater, Eric J; Chtara, Moktar; Chamari, Karim; Amri, Mohamed; Behm, David G

    2011-09-01

    The current literature recommends dynamic rather than static stretching for the athletic warm-up. Dynamic stretching and various conditioning stimuli are used to induce potentiation in subsequent athletic performance. However, it is unknown as to which type of activity in conjunction with dynamic stretching within a warm-up provides the optimal potentiation of vertical jump performance. It was the objective of the study to examine the possible potentiating effect of various types of conditioning stimuli with dynamic stretching. Twenty athletes participated in 6 protocols. All the experimental protocols included 10 minutes of dynamic stretching. After the dynamic stretching, the subjects performed a (a) concentric (DS/CON): 3 sets of 3 repetition maximum deadlift exercise; (b) isometric (DS/ISOM): 3 sets of 3-second maximum voluntary contraction back squats; (c) plyometric (DS/PLYO): 3 sets of 3 tuck jumps; (d) eccentric (DS/ECC): 3 modified drop jumps; (e) dynamic stretching only (DS), and (f) control protocol (CON). Before the intervention and at recovery periods of 15 seconds, 4, 8, 12, 16, and 20 minutes, the participants performed 1-2 maximal countermovement jumps. The DS and DS/CON protocols generally had a 95-99% likelihood of exceeding the smallest worthwhile change for vertical jump height, peak power, velocity and force. However, the addition of the deadlift to the DS did not augment the potentiating effect. Time-to-peak potentiation was variable between individuals but was most consistent between 3 and 5 minutes. Thus, the volume and the intensity associated with 10 minutes of dynamic stretching were sufficient to provide the potentiation of vertical jump characteristics. Additional conditioning activities may promote fatigue processes, which do not permit further potentiation.

  2. [Effectiveness of the use of iodized milk protein to improve girls' sufficiency with iodine].

    PubMed

    Bol'shakova, L S; Lisitsin, A B; Chernukha, I M; Zubtsov, Iu N; Litvinova, E V

    2014-01-01

    The work presents the results of the research capabilities of the use of iodized milk protein as a component of food supplement and enriched food product for the correction of iodine sufficiency in girls. Milk iodinated protein was produced by the enzyme-effective iodization of amino acid residues of cow's milk whey proteins. The study involved 30 girls, whose average age was 19.9 +/- 1.4 years. Participants of observation were divided into three groups, for 10 people each. The first group received daily serving of meat cutlets (50g), enriched with dairy iodinated protein. Iodine content in the finished minced was 100 mcg. The second group received iodinated milk protein in the form of food supplement with iodine content of 100 mcg. The third group was a control one. The duration of observations was 30 days. To assess the effectiveness of measures the concentration of iodine in urine, blood levels of thyroid-stimulating hormone and free thyroxine have been determined, changes in cognitive processes (memory and attention) with the use of psychological tests have been evaluated. Studies have shown the effectiveness of using of iodized milk protein for the correction of iodine deficiency in girls. The use of iodized protein, as part of the enriched product and in the form of food supplement increased urinary iodine level and had a positive influence on the state of the hypophysial-thyroid system. In addition, the use of iodized milk protein helped to improve the cognitive functions of the students, which can be considered as an additional positive effect of correction of iodine deficiency.

  3. Listeriolysin O Is Necessary and Sufficient to Induce Autophagy during Listeria monocytogenes Infection

    PubMed Central

    Meyer-Morse, Nicole; Robbins, Jennifer R.; Rae, Chris S.; Mochegova, Sofia N.; Swanson, Michele S.; Zhao, Zijiang; Virgin, Herbert W.; Portnoy, Daniel

    2010-01-01

    Background Recent studies have suggested that autophagy is utilized by cells as a protective mechanism against Listeria monocytogenes infection. Methodology/Principal Findings However we find autophagy has no measurable role in vacuolar escape and intracellular growth in primary cultured bone marrow derived macrophages (BMDMs) deficient for autophagy (atg5−/−). Nevertheless, we provide evidence that the pore forming activity of the cholesterol-dependent cytolysin listeriolysin O (LLO) can induce autophagy subsequent to infection by L. monocytogenes. Infection of BMDMs with L. monocytogenes induced microtubule-associated protein light chain 3 (LC3) lipidation, consistent with autophagy activation, whereas a mutant lacking LLO did not. Infection of BMDMs that express LC3-GFP demonstrated that wild-type L. monocytogenes was encapsulated by LC3-GFP, consistent with autophagy activation, whereas a mutant lacking LLO was not. Bacillus subtilis expressing either LLO or a related cytolysin, perfringolysin O (PFO), induced LC3 colocalization and LC3 lipidation. Further, LLO-containing liposomes also recruited LC3-GFP, indicating that LLO was sufficient to induce targeted autophagy in the absence of infection. The role of autophagy had variable effects depending on the cell type assayed. In atg5−/− mouse embryonic fibroblasts, L. monocytogenes had a primary vacuole escape defect. However, the bacteria escaped and grew normally in atg5−/− BMDMs. Conclusions/Significance We propose that membrane damage, such as that caused by LLO, triggers bacterial-targeted autophagy, although autophagy does not affect the fate of wild-type intracellular L. monocytogenes in primary BMDMs. PMID:20062534

  4. Peroral Estradiol Is Sufficient to Induce Carcinogen-Induced Mammary Tumorigenesis in Ovariectomized Rats without Progesterone

    PubMed Central

    Stires, Hillary; Saboya, Mariana; Globerman, Samantha P.; Cohick, Wendie S.

    2016-01-01

    A role for estrogens in breast cancer is widely accepted, however, recent evidence highlights that timing and exposure levels are important in determining whether they elicit harmful versus beneficial effects. The rat chemical carcinogen model has been widely used to study the effects of estrogens but conclusions on the levels that lead to tumor development and an absolute requirement for progesterone (P4) are lacking. A newer method of hormone administration mixes hormones with nut butter for peroral consumption allowing for a less stressful method of long-term administration with lower spikes in serum estradiol (E2) levels. The present study was designed to determine if estrogens alone at a physiological dose can drive carcinogen-induced tumors in ovariectomized (OVX) rats or if P4 is also required using this method of hormone administration. Short-term studies were conducted to determine the dose of estrogen (E) that would lead to increased uterine weight following OVX. Subsequently, rats were OVX on postnatal day (PND) 40 then treated daily with E (600 μg/kg/day), P4 (15 mg/kg/day), or the combination. On PND 50, all rats were injected with nitrosomethylurea to induce mammary tumors. Uterine weights, body weights, and serum E2 levels were measured to demonstrate the efficacy of the method for increasing E2 levels during long-term treatment. After 26 weeks, tumor incidence was similar in Sham, E, and E + P4 animals indicating that E was sufficient to induce tumorigenesis when hormone levels were normalized by this method. This study demonstrates peroral administration can be used in long-term studies to elucidate relationships between different types and levels of steroid hormones. PMID:27611094

  5. Recurrent Ischemic Stroke Characteristics and Assessment of Sufficiency of Secondary Stroke Prevention

    PubMed Central

    KOCAMAN, Gülşen; DÜRÜYEN, Hümeyra; KOÇER, Abdulkadir; ASİL, Talip

    2015-01-01

    Introduction Disabilities due to stroke lead to a serious individual and socioeconomic burden. In this presented hospital-based study, we aimed to evaluate recurrent ischemic stroke (RIS) characteristics and the sufficiency of secondary prevention regarding the most common modifiable risk factors. Methods The records of patients with a diagnosis of ischemic stroke between November 2009 and November 2011 in our unit were retrospectively investigated. Results Ninety-one (18%) out of 500 patients with ischemic stroke had RIS. Hypertension, diabetes mellitus, ischemic heart disease, hyperlipidemia, atrial fibrillation, and smoking were found in 88%, 43%, 36%, 30%, 11%, and 14% of the patients, respectively. Thirty-eight percent of the patients had more than two risk factors. While 14% of the hypertensive patients did not use antihypertensive medications, antihypertensive treatment was insufficient in 39% of those who already used antihypertensive medications. Twenty-three percent of the patients received no prophylactic agents. Sixty percent of the patients with a history of atrial fibrillation were on oral anticoagulant therapy (warfarin), and the international normalized ratio was <2.0 in 73% of them. Of the diabetic patients, 87% had an HgbA1C level above 6%. The LDL level was higher than 100 mg/dL in 72% of the patients. Conclusion The incidence of RIS and risk factors in our retrospective study was compatible with the results of those in literature. Secondary prophylactic treatment and modification of risk factors in the stroke patients were not satisfactory. The improvement of the patients’ adherence to treatment is also very important in addition to the optimal treatment and follow-up strategy for decreasing the incidence of RIS. A multidisciplinary outpatient model of stroke care may be beneficial for decreasing the incidence of RIS.

  6. Disparate British Breast Reconstruction Utilization: Is Universal Coverage Sufficient to Ensure Expanded Care?

    PubMed Central

    Offodile, Anaeze C.

    2016-01-01

    Summary: Our intent is to improve the understanding of the ability of healthcare providers to deliver high-quality care as we approach an era of universal coverage. We adopted 2 unique vantage points in this article: (1) the mandated coverage for immediate breast reconstruction (IBR) surgery as a microcosmic surrogate for universal coverage overall and (2) we then scrutinized the respective IBR utilization rates in a contemporaneous system of 2 healthcare delivery models in the United Kingdom, that is, the public National Health Service trust versus private-sector hospitals. A literature review was performed for IBR rates across public trust and private-sector hospitals in the United Kingdom. The IBR rate among public trust hospitals was 17% compared with 43% in the private sector. In the trust hospital setting, the enactment of 2 government mandates, intended to increase the access to cancer care, seemed to fall short in maximizing the ability of surgical practitioners to deliver quality care to patients. Among women who did not receive IBR, 65% felt that they had received the sufficient amount of information to appropriately inform their decision. In addition, only 46% of this same cohort reported a consultation with a reconstructive surgeon preoperatively. Private-sector hospitals delivered better IBR care because of the likely presence of infrastructure and financial incentives for physicians. These results serve as a call for a better alignment between policy initiatives designed to expand care access and the perogatives of physicians to ensure an optimized delivery of the expanded care such policy mandates. PMID:27482486

  7. Maternal Obesity and Vitamin D Sufficiency Are Associated with Cord Blood Vitamin D Insufficiency

    PubMed Central

    Feinglass, Joseph; Rademaker, Alfred W.; Metzger, Boyd E.; Zeiss, Dinah M.; Price, Heather E.; Langman, Craig B.

    2013-01-01

    Context: An inverse relationship between total serum 25-hydroxyvitamin D (25-OH D) and increased adiposity has been established in children, adolescents, and adults. However, the relationship between neonatal adiposity and vitamin D status has not been reported. Both maternal obesity and vitamin D deficiency in pregnancy are common and are associated with adverse pregnancy outcomes. Objective: The aim of the study was to determine the relationship between vitamin D levels in mothers and newborns, as influenced by maternal obesity, and evaluate these associations with neonatal adiposity. Design, Setting, and Patients: Sixty-one maternal-neonatal pairs participated in this cross-sectional study at an academic medical center. Mothers had a prepregnancy body mass index that was normal or obese. Outcome Measures: Maternal and cord blood sera were assayed for 25-OH D, and neonatal body composition was measured by air displacement plethysmography. Results: Mothers had similar and sufficient levels of 25-OH D when measured at 36–38 wk gestation, irrespective of body mass index category (normal weight, 46.05, vs. obese, 49.84 ng/ml; P = not significant). However, cord blood 25-OH D was higher in neonates of normal-weight mothers compared to neonates of obese mothers (27.45 vs. 20.81 ng/ml; P = 0.02). The variance in cord blood 25-OH D was explained by four factors: maternal 25-OH D level, the presence of maternal obesity, maternal age, and neonatal adiposity (r2 = 0.66). Conclusion: Obese women transfer less 25-OH D to offspring than normal-weight women, despite similar serum levels. Cord blood 25-OH D levels directly correlate to neonatal percentage body fat. These novel findings underscore the evolving relationships between maternal obesity, vitamin D nutritional status, and adiposity in the neonatal period that may influence subsequent childhood and adulthood vitamin D-dependent processes. PMID:23144468

  8. Mouse Sperm Membrane Potential Hyperpolarization Is Necessary and Sufficient to Prepare Sperm for the Acrosome Reaction*

    PubMed Central

    De La Vega-Beltran, Jose Luis; Sánchez-Cárdenas, Claudia; Krapf, Darío; Hernandez-González, Enrique O.; Wertheimer, Eva; Treviño, Claudia L.; Visconti, Pablo E.; Darszon, Alberto

    2012-01-01

    Mammalian sperm are unable to fertilize the egg immediately after ejaculation; they acquire this capacity during migration in the female reproductive tract. This maturational process is called capacitation and in mouse sperm it involves a plasma membrane reorganization, extensive changes in the state of protein phosphorylation, increases in intracellular pH (pHi) and Ca2+ ([Ca2+]i), and the appearance of hyperactivated motility. In addition, mouse sperm capacitation is associated with the hyperpolarization of the cell membrane potential. However, the functional role of this process is not known. In this work, to dissect the role of this membrane potential change, hyperpolarization was induced in noncapacitated sperm using either the ENaC inhibitor amiloride, the CFTR agonist genistein or the K+ ionophore valinomycin. In this experimental setting, other capacitation-associated processes such as activation of a cAMP-dependent pathway and the consequent increase in protein tyrosine phosphorylation were not observed. However, hyperpolarization was sufficient to prepare sperm for the acrosome reaction induced either by depolarization with high K+ or by addition of solubilized zona pellucida (sZP). Moreover, K+ and sZP were also able to increase [Ca2+]i in non-capacitated sperm treated with these hyperpolarizing agents but not in untreated cells. On the other hand, in conditions that support capacitation-associated processes blocking hyperpolarization by adding valinomycin and increasing K+ concentrations inhibited the agonist-induced acrosome reaction as well as the increase in [Ca2+]i. Altogether, these results suggest that sperm hyperpolarization by itself is key to enabling mice sperm to undergo the acrosome reaction. PMID:23095755

  9. Cytoplasmic inositol hexakisphosphate production is sufficient for mediating the Gle1-mRNA export pathway.

    PubMed

    Miller, Aimee L; Suntharalingam, Mythili; Johnson, Sylvia L; Audhya, Anjon; Emr, Scott D; Wente, Susan R

    2004-12-03

    Production of inositol hexakisphosphate (IP6) by Ipk1, the inositol-1,3,4,5,6-pentakisphosphate 2-kinase, is required for Gle1-mediated mRNA export in Saccharomyces cerevisiae cells. To examine the network of interactions that require IP6 production, an analysis of fitness defects was conducted in mutants harboring both an ipk1 null allele and a mutant allele in genes encoding nucleoporins or transport factors. Enhanced lethality was observed with a specific subset of mutants, including nup42, nup116, nup159, dbp5, and gle2, all of which had been previously connected to Gle1 function. Complementation of the nup116Deltaipk1Delta and nup42Deltaipk1Delta double mutants did not require the Phe-Gly repeat domains in the respective nucleoporins, suggesting that IP6 was acting subsequent to heterogeneous nuclear ribonucleoprotein targeting to the nuclear pore complex. With Nup42 and Nup159 localized exclusively to the nuclear pore complex cytoplasmic side, we speculated that IP6 may regulate a cytoplasmic step in mRNA export. To test this prediction, the spatial requirements for the production of IP6 were investigated. Restriction of Ipk1 to the cytoplasm did not block IP6 production. Moreover, coincident sequestering of both Ipk1 and Mss4 (an enzyme required for phosphatidylinositol 4,5-bisphosphate production) to the cytoplasm also did not block IP6 production. Given that the kinase required for inositol 1,3,4,5,6-pentakisphosphate production (Ipk2) is localized in the nucleus, these results indicated that soluble inositides were diffusing between the nucleus and the cytoplasm. Additionally, the cytoplasmic production of IP6 by plasma membrane-anchored Ipk1 rescued a gle1-2 ipk1-4 synthetic lethal mutant. Thus, cytoplasmic IP6 production is sufficient for mediating the Gle1-mRNA export pathway.

  10. Linear noise approximation is valid over limited times for any chemical system that is sufficiently large.

    PubMed

    Wallace, E W J; Gillespie, D T; Sanft, K R; Petzold, L R

    2012-08-01

    The linear noise approximation (LNA) is a way of approximating the stochastic time evolution of a well-stirred chemically reacting system. It can be obtained either as the lowest order correction to the deterministic chemical reaction rate equation (RRE) in van Kampen's system-size expansion of the chemical master equation (CME), or by linearising the two-term-truncated chemical Kramers-Moyal equation. However, neither of those derivations sheds much light on the validity of the LNA. The problematic character of the system-size expansion of the CME for some chemical systems, the arbitrariness of truncating the chemical Kramers-Moyal equation at two terms, and the sometimes poor agreement of the LNA with the solution of the CME, have all raised concerns about the validity and usefulness of the LNA. Here, the authors argue that these concerns can be resolved by viewing the LNA as an approximation of the chemical Langevin equation (CLE). This view is already implicit in Gardiner's derivation of the LNA from the truncated Kramers-Moyal equation, as that equation is mathematically equivalent to the CLE. However, the CLE can be more convincingly derived in a way that does not involve either the truncated Kramers-Moyal equation or the system-size expansion. This derivation shows that the CLE will be valid, at least for a limited span of time, for any system that is sufficiently close to the thermodynamic (large-system) limit. The relatively easy derivation of the LNA from the CLE shows that the LNA shares the CLE's conditions of validity, and it also suggests that what the LNA really gives us is a description of the initial departure of the CLE from the RRE as we back away from the thermodynamic limit to a large but finite system. The authors show that this approach to the LNA simplifies its derivation, clarifies its limitations, and affords an easier path to its solution.

  11. Human cerebrospinal fluid monoclonal N-methyl-D-aspartate receptor autoantibodies are sufficient for encephalitis pathogenesis.

    PubMed

    Kreye, Jakob; Wenke, Nina K; Chayka, Mariya; Leubner, Jonas; Murugan, Rajagopal; Maier, Nikolaus; Jurek, Betty; Ly, Lam-Thanh; Brandl, Doreen; Rost, Benjamin R; Stumpf, Alexander; Schulz, Paulina; Radbruch, Helena; Hauser, Anja E; Pache, Florence; Meisel, Andreas; Harms, Lutz; Paul, Friedemann; Dirnagl, Ulrich; Garner, Craig; Schmitz, Dietmar; Wardemann, Hedda; Prüss, Harald

    2016-10-01

    SEE ZEKERIDOU AND LENNON DOI101093/AWW213 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis is a recently discovered autoimmune syndrome associated with psychosis, dyskinesias, and seizures. Little is known about the cerebrospinal fluid autoantibody repertoire. Antibodies against the NR1 subunit of the NMDAR are thought to be pathogenic; however, direct proof is lacking as previous experiments could not distinguish the contribution of further anti-neuronal antibodies. Using single cell cloning of full-length immunoglobulin heavy and light chain genes, we generated a panel of recombinant monoclonal NR1 antibodies from cerebrospinal fluid memory B cells and antibody secreting cells of NMDAR encephalitis patients. Cells typically carried somatically mutated immunoglobulin genes and had undergone class-switching to immunoglobulin G, clonally expanded cells carried identical somatic hypermutation patterns. A fraction of NR1 antibodies were non-mutated, thus resembling 'naturally occurring antibodies' and indicating that tolerance induction against NMDAR was incomplete and somatic hypermutation not essential for functional antibodies. However, only a small percentage of cerebrospinal fluid-derived antibodies reacted against NR1. Instead, nearly all further antibodies bound specifically to diverse brain-expressed epitopes including neuronal surfaces, suggesting that a broad repertoire of antibody-secreting cells enrich in the central nervous system during encephalitis. Our functional data using primary hippocampal neurons indicate that human cerebrospinal fluid-derived monoclonal NR1 antibodies alone are sufficient to cause neuronal surface receptor downregulation and subsequent impairment of NMDAR-mediated currents, thus providing ultimate proof of antibody pathogenicity. The observed formation of immunological memory might be relevant for clinical relapses.

  12. Is polychaete family-level sufficient to assess impact on tropical estuarine gradients?

    NASA Astrophysics Data System (ADS)

    Nóbrega-Silva, Climélia; Patrício, Joana; Marques, João Carlos; Olímpio, Monalisa dos Santos; Farias, Jéssica Natyelle Barros; Molozzi, Joseline

    2016-11-01

    Regular, robust monitoring programs set up to assess the environmental conditions of aquatic systems often target different biological groups. And, of these, macroinvertebrate communities and particularly the class Polychaeta are frequently used. Identifying these organisms takes time, money and specialized expertise to ensure correct identification to the lowest possible taxonomic level. Identification errors can lead to an erroneous assessment. The concept of taxonomic sufficiency has been proposed both to minimize errors and to save time and money. This study tested the usefulness of this concept in tropical estuaries in northeast Brazil. We selected two transitional systems with different degrees of human impact due to different land uses and different conservation systems: the Mamanguape estuary, which is in an environmental conservation unit for sustainable use, and the highly impacted, urban Paraíba do Norte estuary. The results clearly showed that nutrient concentrations were markedly higher in the Paraíba do Norte estuary in the dry season and that the composition of the polychaete assemblages differed between the two estuaries as well as along the spatial gradient of each estuary. The use of either genus or family level led to equivalent representation in each system in terms of taxon richness and both the Margalef and Shannon-Wiener diversity indices. Both taxonomic levels described similar changes in the polychaete assemblage along the estuarine gradients. Based on our findings, the use of a coarser taxonomic level (i.e., family) is a good option when the aim is to implement a monitoring program in tropical estuaries with the polychaete assemblages as one of the target groups. This time-efficient taxonomic resolution can help improve sampling designs and allow long-term monitoring studies without losing much vital information.

  13. The biostatistical theory versus the harmful dysfunction analysis, part 1: is part-dysfunction a sufficient condition for medical disorder?

    PubMed

    Wakefield, Jerome C

    2014-12-01

    Christopher Boorse's biostatistical theory of medical disorder claims that biological part-dysfunction (i.e., failure of an internal mechanism to perform its biological function), a factual criterion, is both necessary and sufficient for disorder. Jerome Wakefield's harmful dysfunction analysis of medical disorder agrees that part-dysfunction is necessary but rejects the sufficiency claim, maintaining that disorder also requires that the part-dysfunction causes harm to the individual, a value criterion. In this paper, I present two considerations against the sufficiency claim. First, I analyze Boorse's central argument for the sufficiency claim, the "pathologist argument," which takes pathologists' intuitions about pathology as determinative of medical disorder and conclude that it begs the question and fails to support the sufficiency claim. Second, I present four counterexamples from the medical literature in which salient part-dysfunctions are considered nondisorders, including healthy disease carriers, HIV-positive status, benign mutations, and situs inversus totalis, thus falsifying the sufficiency claim and supporting the harm criterion.

  14. Reliability-based structural optimization using response surface approximations and probabilistic sufficiency factor

    NASA Astrophysics Data System (ADS)

    Qu, Xueyong

    Uncertainties exist practically everywhere from structural design to manufacturing, product lifetime service, and maintenance. Uncertainties can be introduced by errors in modeling and simulation; by manufacturing imperfections (such as variability in material properties and structural geometric dimensions); and by variability in loading. Structural design by safety factors using nominal values without considering uncertainties may lead to designs that are either unsafe, or too conservative and thus not efficient. The focus of this dissertation is reliability-based design optimization (RBDO) of composite structures. Uncertainties are modeled by the probabilistic distributions of random variables. Structural reliability is evaluated in term of the probability of failure. RBDO minimizes cost such as structural weight subject to reliability constraints. Since engineering structures usually have multiple failure modes, Monte Carlo simulation (MCS) was used employed to calculate the system probability of failure. Response surface (RS) approximation techniques were used to solve the difficulties associated with MCS. The high computational cost of a large number of MCS samples was alleviated by analysis RS, and numerical noise in the results of MCS was filtered out by design RS. RBDO of composite laminates is investigated for use in hydrogen tanks in cryogenic environments. The major challenge is to reduce the large residual strains developed due to thermal mismatch between matrix and fibers while maintaining the load carrying capacity. RBDO is performed to provide laminate designs, quantify the effects of uncertainties on the optimum weight, and identify those parameters that have the largest influence on optimum design. Studies of weight and reliability tradeoffs indicate that the most cost-effective measure for reducing weight and increasing reliability is quality control. A probabilistic sufficiency factor (PSF) approach was developed to improve the computational

  15. Are single odorous components of a predator sufficient to elicit defensive behaviors in prey species?

    PubMed

    Apfelbach, Raimund; Parsons, Michael H; Soini, Helena A; Novotny, Milos V

    2015-01-01

    When exposed to the odor of a sympatric predator, prey animals typically display escape or defensive responses. These phenomena have been well-documented, especially in rodents, when exposed to the odor of a cat, ferret, or fox. As a result of these experiments new discussions center on the following questions: (1) is a single volatile compound such as a major or a minor mixture constituent in urine or feces, emitted by the predator sufficient to cause defensive reactions in a potential prey species or (2) is a whole array of odors required to elicit a response and (3) will the relative size or escapability of the prey as compared to the predator influence responsiveness. Most predator-prey studies on this topic have been performed in the laboratory or under semi-natural conditions. Field studies could help to find answers to these questions. Australian mammals are completely naïve toward the introduced placental carnivores. That offers ideal opportunities to analyze in the field the responses of potential prey species to unknown predator odors. During the last decades researchers have accumulated an enormous amount of data exploring the effects of eutherian predator odors on native marsupial mammals. In this review, we will give a survey about the development of olfactory research, chemical signals and their influence on the behavior and-in some cases-physiology of prey species. In addition, we report on the effects of predator odor experiments performed under natural conditions in Australia. When studying all these literature we learned that data gained under controlled laboratory conditions elucidate the role of individual odors on brain structures and ultimately on a comparatively narrow range behaviors. In contrast to single odors odor arrays mimic much more the situation prey animals are confronted to in nature. Therefore, a broad range of methodology-from chemistry to ecology including anatomy, physiology, and behavior-is needed to understand all the

  16. Procalcitonin is not sufficiently reliable to be the sole marker of neonatal sepsis of nosocomial origin

    PubMed Central

    López Sastre, José B; Pérez Solís, David; Roqués Serradilla, Vicente; Fernández Colomer, Belén; Coto Cotallo, Gil D; Krauel Vidal, Xavier; Narbona López, Eduardo; García del Río, Manuel; Sánchez Luna, Manuel; Belaustegui Cueto, Antonio; Moro Serrano, Manuel; Urbón Artero, Alfonso; Álvaro Iglesias, Emilio; Cotero Lavín, Ángel; Martínez Vilalta, Eduardo; Jiménez Cobos, Bartolomé

    2006-01-01

    Background It has recently been suggested that serum procalcitonin (PCT) is of value in the diagnosis of neonatal sepsis, with varying results. The aim of this prospective multicenter study was to assess the usefulness of PCT as a marker of neonatal sepsis of nosocomial origin. Methods One hundred infants aged between 4 and 28 days of life admitted to the Neonatology Services of 13 acute-care teaching hospitals in Spain over 1-year with clinical suspicion of neonatal sepsis of nosocomial origin were included in the study. Serum PCT concentrations were determined by a specific immunoluminometric assay. The reliability of PCT for the diagnosis of nosocomial neonatal sepsis at the time of suspicion of infection and at 12–24 h and 36–48 h after the onset of symptoms was calculated by receiver-operating characteristics (ROC) curves. The Youden's index (sensitivity + specificity - 1) was used for determination of optimal cutoff values of the diagnostic tests in the different postnatal periods. Sensitivity, specificity, and the likelihood ratio of a positive and negative result with the 95% confidence interval (CI) were calculated. Results The diagnosis of nosocomial sepsis was confirmed in 61 neonates. Serum PCT concentrations were significantly higher at initial suspicion and at 12–24 h and 36–48 h after the onset of symptoms in neonates with confirmed sepsis than in neonates with clinically suspected but not confirmed sepsis. Optimal PCT thresholds according to ROC curves were 0.59 ng/mL at the time of suspicion of sepsis (sensitivity 81.4%, specificity 80.6%); 1.34 ng/mL within 12–24 h of birth (sensitivity 73.7%, specificity 80.6%), and 0.69 ng/mL within 36–48 h of birth (sensitivity 86.5%, specificity 72.7%). Conclusion Serum PCT concentrations showed a moderate diagnostic reliability for the detection of nosocomial neonatal sepsis from the time of suspicion of infection. PCT is not sufficiently reliable to be the sole marker of sepsis, but would be

  17. A single alcohol drinking session is sufficient to enable subsequent aversion-resistant consumption in mice.

    PubMed

    Lei, Kelly; Wegner, Scott A; Yu, Ji-Hwan; Simms, Jeffrey A; Hopf, F Woodward

    2016-09-01

    Addiction is mediated in large part by pathological motivation for rewarding, addictive substances, and alcohol-use disorders (AUDs) continue to extract a very high physical and economic toll on society. Compulsive alcohol drinking, where intake continues despite negative consequences, is considered a particular obstacle during treatment of AUDs. Aversion-resistant drives for alcohol have been modeled in rodents, where animals continue to consume even when alcohol is adulterated with the bitter tastant quinine, or is paired with another aversive consequence. Here, we describe a two-bottle choice paradigm where C57BL/6 mice first had 24-h access to 15% alcohol or water. Afterward, they drank quinine-free alcohol (alcohol-only) or alcohol with quinine (100 μM), in a limited daily access (LDA) two-bottle-choice paradigm (2 h/day, 5 days/week, starting 3 h into the dark cycle), and achieved nearly binge-level blood alcohol concentrations. Interestingly, a single, initial 24-h experience with alcohol-only enhanced subsequent quinine-resistant drinking. In contrast, mice that drank alcohol-quinine in the 24-h session showed significantly reduced alcohol-quinine intake and preference during the subsequent LDA sessions, relative to mice that drank alcohol-only in the initial 24-h session and alcohol-quinine in LDA sessions. Thus, mice could find the concentration of quinine we used aversive, but were able to disregard the quinine after a single alcohol-only drinking session. Finally, mice had low intake and preference for quinine in water, both before and after weeks of alcohol-drinking sessions, suggesting that quinine resistance was not a consequence of increased quinine preference after weeks of drinking of alcohol-quinine. Together, we demonstrate that a single alcohol-only session was sufficient to enable subsequent aversion-resistant consumption in C57BL/6 mice, which did not reflect changes in quinine taste palatability. Given the rapid development of quinine

  18. Genotypic Variation for N2-FIXATION in Voandzou (vigna Subterranea) Under P Deficiency and P Sufficiency

    NASA Astrophysics Data System (ADS)

    Andry, A.; Mahamadou, M.; Lilia, R.; Laurie, A.; Hélène, V.; Dominique, M.; Christian, M.; Jean-Jacques, D.

    2011-12-01

    Genetic variation associated with N2 fixation exists in numerous legume species (Graham, 2004). High symbiotic N2 fixation under P deficiency is related closely to nodulation which was used in legume selection for N2 fixation (Herridge and Rose, 2000). Until now, study of genetic potential of neglected crops like Vigna subterranea (bambara groundnut or voandzou) is often limited while its agronomic properties is interesting for the farmers of Africa. In order to assess the genotypic variation of voandzou for tolerance to phosphorus deficiency, a physiological approach of cultivar selection was performed with 54 cultivars from Madagascar, Niger and Mali in hydroponic culture under P deficiency and P sufficiency and inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756. The results of nodulation and plant biomass, which are closely related, showed a large dispersion between cultivars (0.05-0.43 g nodule dry weight per plant and 0.50-5.51 g shoot dry weight per plant). The cultivars which presented the maximum growth during the experiment presented a high efficiency in use of the rhizobial symbiosis calculated as the slope of plant biomass regression as a function of nodulation. A large increase in nodulated-root O2 consumption under P deficiency was observed for the two most tolerant cultivars. The microscopic analysis with in situ RT-PCR of the nodule sections showed an increase of a phytase gene expression with tolerance of cultivars to P deficiency. From two most contrasting cultivars, an isotopic exchange method 32P was carried out on rhizosphere soil in rhizotron culture in order to assess the direct effect induced by the roots in terms of phosphorus mobilization. The rhizospheric effect was observed under P deficiency marked by a strong re-supplying capacity of soil solution in the diffusive phosphate ion between solid phase and soil solution leading to great phosphorus nutrition. These results highlight the genotypic variability among voandzou

  19. U.S. Nurse Labor Market Dynamics Are Key to Global Nurse Sufficiency

    PubMed Central

    Aiken, Linda H

    2007-01-01

    Objectives To review estimates of U.S. nurse supply and demand, document trends in nurse immigration to the United States and their impact on nursing shortage, and consider strategies for resolving the shortage of nurses in the United States without adversely affecting health care in lower-income countries. Principal Findings Production capacity of nursing schools is lagging current and estimated future needs, suggesting a worsening shortage and creating a demand for foreign-educated nurses. About 8 percent of U.S. registered nurses (RNs), numbering around 219,000, are estimated to be foreign educated. Eighty percent are from lower-income countries. The Philippines is the major source country, accounting for more than 30 percent of U.S. foreign-educated nurses. Nurse immigration to the United States has tripled since 1994, to close to 15,000 entrants annually. Foreign-educated nurses are located primarily in urban areas, most likely to be employed by hospitals, and somewhat more likely to have a baccalaureate degree than native-born nurses. There is little evidence that foreign-educated nurses locate in areas of medical need in any greater proportion than native-born nurses. Although foreign-educated nurses are ethnically more diverse than native-born nurses, relatively small proportions are black or Hispanic. Job growth for RNs in the United States is producing mounting pressure by commercial recruiters and employers to ease restrictions on nurse immigration at the same time that American nursing schools are turning away large numbers of native applicants because of capacity limitations. Conclusions Increased reliance on immigration may adversely affect health care in lower-income countries without solving the U.S. shortage. The current focus on facilitating nurse immigration detracts from the need for the United States to move toward greater self-sufficiency in its nurse workforce. Expanding nursing school capacity to accommodate qualified native applicants and

  20. Are single odorous components of a predator sufficient to elicit defensive behaviors in prey species?

    PubMed Central

    Apfelbach, Raimund; Parsons, Michael H.; Soini, Helena A.; Novotny, Milos V.

    2015-01-01

    When exposed to the odor of a sympatric predator, prey animals typically display escape or defensive responses. These phenomena have been well-documented, especially in rodents, when exposed to the odor of a cat, ferret, or fox. As a result of these experiments new discussions center on the following questions: (1) is a single volatile compound such as a major or a minor mixture constituent in urine or feces, emitted by the predator sufficient to cause defensive reactions in a potential prey species or (2) is a whole array of odors required to elicit a response and (3) will the relative size or escapability of the prey as compared to the predator influence responsiveness. Most predator-prey studies on this topic have been performed in the laboratory or under semi-natural conditions. Field studies could help to find answers to these questions. Australian mammals are completely naïve toward the introduced placental carnivores. That offers ideal opportunities to analyze in the field the responses of potential prey species to unknown predator odors. During the last decades researchers have accumulated an enormous amount of data exploring the effects of eutherian predator odors on native marsupial mammals. In this review, we will give a survey about the development of olfactory research, chemical signals and their influence on the behavior and—in some cases—physiology of prey species. In addition, we report on the effects of predator odor experiments performed under natural conditions in Australia. When studying all these literature we learned that data gained under controlled laboratory conditions elucidate the role of individual odors on brain structures and ultimately on a comparatively narrow range behaviors. In contrast to single odors odor arrays mimic much more the situation prey animals are confronted to in nature. Therefore, a broad range of methodology—from chemistry to ecology including anatomy, physiology, and behavior—is needed to understand all

  1. Interferon-α2a is sufficient for promoting dendritic cell immunogenicity

    PubMed Central

    Tamir, A; Jordan, W J; Ritter, M; Habib, N; Lechler, R I; Foster, G R; Lombardi, G

    2005-01-01

    Type I interferons (IFNs) are widely used therapeutically. IFN-α2a in particular is used as an antiviral agent, but its immunomodulatory properties are poorly understood. Dendritic cells (DCs) are the only antigen-presenting cells able to prime naive T cells and therefore play a crucial role in initiating the adaptive phase of the immune response. We studied the effects of IFN-α2a on DC maturation and its role in determining Th1/Th2 equilibrium. We found that IFN-α2a induced phenotypic maturation of DCs and increased their allostimulatory capacity. When dendritic cells were stimulated simultaneously by CD40 ligation and IFN-α2a, the production of interleukin (IL)-10 and IL-12 was increased. In contrast, lipopolysaccharide (LPS) stimulation in the presence of IFN-α2a mainly induced IL-10 release. The production of IFN-γ and IL-5 by the responder naive T cells was also amplified in response to IFN-α2a-treated DCs. Furthermore, IL-12 production by IFN-α2a-treated DCs was enhanced further in the presence of anti-IL-10 antibody. Different results were obtained when DCs were treated simultaneously with IFN-α2a and other maturation factors, in particular LPS, and then stimulated by CD40 ligation 36 h later. Under these circumstances, IFN-α2a did not modify the DC phenotype, and the production of IL-10/IL-12 and IFN-γ/IL-5 by DCs and by DC-stimulated naive T cells, respectively, was inhibited compared to the effects on DCs treated with maturation factors alone. Altogether, this work suggests that IFN-α2a in isolation is sufficient to promote DC activation, however, other concomitant events, such as exposure to LPS during a bacterial infection, can inhibit its effects. These results clarify some of the in vivo findings obtained with IFN-α2a and have direct implications for the design of IFN-α-based vaccines for immunotherapy. PMID:16297159

  2. Thyroid function parameters in normal pregnancies in an iodine sufficient population

    PubMed Central

    Moncayo, Roy; Zanon, Birgit; Heim, Kurt; Ortner, Karina; Moncayo, Helga

    2015-01-01

    Background The aim of this retrospective observational study was to describe thyroid function parameters (fT3, fT4 and TSH) in the course of normal pregnancies. Methods Data were obtained between 2006 and 2007 at the University Hospital in Innsbruck, Austria. The starting point was the identification of women who had had a normal birth as recorded in the birth registry of Tyrol. Thyroid function parameters were determined using methods implemented at the Department of Nuclear Medicine in Innsbruck. Results The fT3 and fT4 values were normally distributed. Grouping the results by trimester revealed the following values: 4.93 ± 0.59, 4.54 ± 0.48, and 4.27 ± 0.45 pmol/l for fT3; and 15.23 ± 2.43, 13.79 ± 1.99, and 13.32 ± 0.2.01 pmol/l for fT4, respectively. The values corresponding to the 10th-percentile were 3.9 pmol/l for fT3 and 11.3 pmol/l for fT4, respectively. TSH values showed a typical left skewed distribution, thus the mean values were calculated after log transformation of the data. The corresponding mean trimestral values for TSH were 1.46 ± 1.29, 1.68 ± 1.23, and 1.70 ± 2.22 mIU/l, respectively. Conclusion In an iodine sufficient population, thyroid function parameters in normal pregnancies do not differ from those in non-pregnant women. Our previously defined reference range for TSH of 0.3 to 3.5 mIU/l is equally valid for normal pregnancies. General significance The question of cognition and IQ development of children has been proposed to be associated with thyroid function. The addition of data regarding normal thyroid function during pregnancy will contribute to this research. PMID:26674060

  3. The transcension hypothesis: Sufficiently advanced civilizations invariably leave our universe, and implications for METI and SETI

    NASA Astrophysics Data System (ADS)

    Smart, John M.

    2012-09-01

    The emerging science of evolutionary developmental ("evo devo") biology can aid us in thinking about our universe as both an evolutionary system, where most processes are unpredictable and creative, and a developmental system, where a special few processes are predictable and constrained to produce far-future-specific emergent order, just as we see in the common developmental processes in two stars of an identical population type, or in two genetically identical twins in biology. The transcension hypothesis proposes that a universal process of evolutionary development guides all sufficiently advanced civilizations into what may be called "inner space," a computationally optimal domain of increasingly dense, productive, miniaturized, and efficient scales of space, time, energy, and matter, and eventually, to a black-hole-like destination. Transcension as a developmental destiny might also contribute to the solution to the Fermi paradox, the question of why we have not seen evidence of or received beacons from intelligent civilizations. A few potential evolutionary, developmental, and information theoretic reasons, mechanisms, and models for constrained transcension of advanced intelligence are briefly considered. In particular, we introduce arguments that black holes may be a developmental destiny and standard attractor for all higher intelligence, as they appear to some to be ideal computing, learning, forward time travel, energy harvesting, civilization merger, natural selection, and universe replication devices. In the transcension hypothesis, simpler civilizations that succeed in resisting transcension by staying in outer (normal) space would be developmental failures, which are statistically very rare late in the life cycle of any biological developing system. If transcension is a developmental process, we may expect brief broadcasts or subtle forms of galactic engineering to occur in small portions of a few galaxies, the handiwork of young and immature

  4. The buoyancy of large siliceous magma chambers is sufficient to initiate supereruptions

    NASA Astrophysics Data System (ADS)

    Malfait, W.; Sanchez-Valle, C.; Seifert, R.; Petitgirard, S.; Perrillat, J.; Ota, T.; Nakamura, E.; Lerch, P.; Mezouar, M.

    2012-12-01

    The geological record shows abundant evidence for rare, but extremely large caldera-forming eruptions of siliceous magmas that dwarf all historical volcanic episodes in erupted volume [1] and environmental impact [2, 3]. Because of the large size of the magma chambers that feed these eruptions, the overpressure generated by magma recharge is insufficient to fracture the cap rock and trigger an eruption [4]. For these thick magma chambers, the buoyancy of the magma potentially creates a sufficient overpressure capable of fracturing the cap rock, but the lack of data on the density of rhyolite melts precludes the appropriate estimation of the overpressure and the role of buoyancy in initiating supervolcano eruptions. The density of rhyolite melts has not been determined at super-liquidus temperatures or elevated pressures because traditional techniques, including Archimedean methods, sink/float experiments and acoustic measurements, are limited by the high melt viscosity. Here, we measured the density of rhyolitic/granitic melts with 0, 4.5 and 7.7 wt% of dissolved water at geologically relevant conditions: 0.9 to 3.6 GPa, 1270 to 1950 K. High pressure and temperature conditions were generated in a Paris-Edinburgh large volume press. Before and after each density measurement, the molten state of the sample was verified by X-ray diffraction. The density of the melt (ρPT) was determined from the X-ray attenuation coefficient of the sample, determined in situ (μPT) and at room conditions (μ0), and the density at room conditions (ρ0): ρPT=ρ0.(μPT/μ0). The acquired data were combined with available ambient pressure data on super-cooled liquids [5, 6] to derive a third order Birch-Murnaghan equation of state that accurately predicts the density of rhyolite melts as a function of pressure, temperature and water content, and the partial molar volume of dissolved water. Application of the melt equation of state to calculate the overpressure at the roof of supervolcano

  5. Is Transducer Hygiene sufficient when Vaginal Probes are used in the Clinical Routine?

    PubMed

    Merz, E

    2016-04-01

    probe, after removal of the cover, must undergo disinfection measures providing bactericidal, fungicidal and virucidal effects. Since the transducer handle also poses a significant risk of transmission of germs, this component must likewise be sufficiently disinfected. In the event of perforation or rupture of the latex cover, thus resulting in the probe coming into contact with vaginal secretions or blood, the probe must be not only cleaned, but effectively disinfected with a virucide as well. It should also be noted that infection by bacteria and viruses can be caused not only by a contaminated probe, but by the ultrasound gel as well. According to studies by Heeg and Gauer 15, Buescher et al. as well as Ryndock et al., the fully automatic HLD system operated with hydrogen peroxide is currently the only validated system proven to provide HLD of ultrasound probes in a 7-minute cycle, thus suitable for application in the daily routine. Likewise it can also be presumed that this procedure also offers good material compatibility.

  6. Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency

    PubMed Central

    Sebro, R; Levy, H; Schneck, K; Dimmock, D; Raby, BA; Cannon, CL; Broeckel, U; Risch, NJ

    2014-01-01

    Cystic fibrosis (CF) is a monogenetic disease with a complex phenotype. Over 1500 mutations in the CFTR gene have been identified; however, the p.F508del mutation is most common. There has been limited correlation between the CFTR mutation genotype and the disease phenotypes. We evaluated the non-p.F508del mutation of 108 p.F508del compound heterozygotes using the biological classification method, Grantham and Sorting Intolerant from Tolerant (SIFT) scores to assess whether these scoring systems correlated with sweat chloride levels, pancreatic sufficiency, predicted FEV1, and risk of infection with Pseudomonas aeruginosa in the last year. Mutations predicted to be ‘mild’ by the biological classification method are associated with more normal sweat chloride levels (p < 0.001), pancreatic sufficiency (p < 0.001) and decreased risk of infection with Pseudomonas in the last year (p = 0.014). Lower Grantham scores are associated with more normal sweat chloride levels (p < 0.001), and pancreatic sufficiency (p = 0.014). Higher SIFT scores are associated with more normal sweat chloride levels (p < 0.001) and pancreatic sufficiency (p = 0.011). There was no association between pulmonary function measured by predicted FEV1 and the biological classification (p = 0.98), Grantham (p = 0.28) or SIFT scores (p = 0.62), which suggests the pulmonary disease related to CF may involve other modifier genes and environmental factors. PMID:22035343

  7. The Adequacy of the Information that Students Utilize when Choosing a College: An Attribute Importance and Information Sufficiency Approach

    ERIC Educational Resources Information Center

    Dolinsky, Arthur L.

    2010-01-01

    This study employed a college student sample to retrospectively assess the adequacy of the college-related attribute information they received when deciding to attend college. The assessment separately considered males and females in the study's information sufficiency-importance framework with resulting strategies. The results suggest that when…

  8. An empirical approach to sufficient similarity in dose-responsiveness: Utilization of statistical distance as a similarity measure.

    EPA Science Inventory

    Using statistical equivalence testing logic and mixed model theory an approach has been developed, that extends the work of Stork et al (JABES,2008), to define sufficient similarity in dose-response for chemical mixtures containing the same chemicals with different ratios ...

  9. Empirical evaluation of sufficient similarity in dose-response for environmental risk assessment of a mixture of 11 pyrethroids.

    EPA Science Inventory

    Chemical mixtures in the environment are often the result of a dynamic process. When dose-response data are available on random samples throughout the process, equivalence testing can be used to determine whether the mixtures are sufficiently similar based on a pre-specified biol...

  10. The Self-Sufficiency Project at 36 Months: Effects of a Financial Work Incentive on Employment and Income.

    ERIC Educational Resources Information Center

    Michalopoulos, Charles; Card, David; Gennetian, Lisa A.; Harknett, Kristen; Robins, Philip K.

    This report previews the Self-Sufficiency Project's (SSP's) longer-term effects by looking at these four related issues: wage progression, job retention, marital status, and attitudes toward work. A companion report, available separately, examines SSP's effects on children. Chapter 1 discusses the SSP research and demonstration project that…

  11. 24 CFR 1710.508 - Effect of suspension of certification granted under § 1710.501(b): Sufficient protection...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 24 Housing and Urban Development 5 2012-04-01 2012-04-01 false Effect of suspension of certification granted under § 1710.501(b): Sufficient protection requirement. 1710.508 Section 1710.508 Housing... Law § 1710.508 Effect of suspension of certification granted under § 1710.501(b):...

  12. 24 CFR 1710.508 - Effect of suspension of certification granted under § 1710.501(b): Sufficient protection...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 24 Housing and Urban Development 5 2013-04-01 2013-04-01 false Effect of suspension of certification granted under § 1710.501(b): Sufficient protection requirement. 1710.508 Section 1710.508 Housing... Law § 1710.508 Effect of suspension of certification granted under § 1710.501(b):...

  13. 24 CFR 1710.508 - Effect of suspension of certification granted under § 1710.501(b): Sufficient protection...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 5 2011-04-01 2011-04-01 false Effect of suspension of certification granted under § 1710.501(b): Sufficient protection requirement. 1710.508 Section 1710.508 Housing... Law § 1710.508 Effect of suspension of certification granted under § 1710.501(b):...

  14. 12 CFR 1010.508 - Effect of suspension of certification granted under § 1010.501(b): Sufficient protection...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 8 2012-01-01 2012-01-01 false Effect of suspension of certification granted under § 1010.501(b): Sufficient protection requirement. 1010.508 Section 1010.508 Banks and Banking... Equivalent State Law § 1010.508 Effect of suspension of certification granted under § 1010.501(b):...

  15. Necessary and Sufficient Conditions for Consensus of Second-Order Multiagent Systems Under Directed Topologies Without Global Gain Dependency.

    PubMed

    Liu, Kaien; Ji, Zhijian; Ren, Wei

    2016-10-21

    The consensus problem for second-order multiagent systems with absolute velocity damping under directed topologies is investigated. In contrast to the existing results, which rely on a sufficiently large common absolute velocity damping gain above a lower bound dependent on global information, this paper focuses on novel algorithms to overcome this limitation. A novel consensus algorithm, where different agents use different absolute velocity damping gains, is first proposed. In the absence of delays, based on a system transformation method, the consensus problem for second-order multiagent systems is converted into that for first-order multiagent systems with the agent number doubled. Necessary and sufficient conditions are then derived under directed topologies by relating the topologies associated with the doubled number of agents and the original team of agents. In the presence of multiple constant delays, based on a further system transformation method, the consensus problem for second-order multiagent systems is converted into the stability problem for corresponding systems. Necessary and sufficient conditions are presented to guarantee consensus under a directed fixed topology. For systems with a uniform constant delay, more concrete necessary and sufficient conditions on how large the delay can be to guarantee consensus is given. Numerical simulations are provided to illustrate the effectiveness of the obtained theoretical results.

  16. Prevalence and determinants of sufficient fruit and vegetable consumption among primary school children in Nakhon Pathom, Thailand

    PubMed Central

    Piaseu, Noppawan

    2017-01-01

    BACKGROUND/OBJECTIVES Low consumption of fruit and vegetable is frequently viewed as an important contributor to obesity risk. With increasing childhood obesity and relatively low fruit and vegetable consumption among Thai children, there is a need to identify the determinants of the intake to promote fruit and vegetable consumption effectively. SUBJECTS/METHODS This cross-sectional study was conducted at two conveniently selected primary schools in Nakhon Pathom. A total of 609 students (grade 4-6) completed questionnaires on personal and environmental factors. Adequate fruit and vegetable intakes were defined as a minimum of three servings of fruit or vegetable daily, and adequate total intake as at least 6 serves of fruit and vegetable daily. Data were analyzed using descriptive statistics, the chi-square test, and multiple logistic regression. RESULTS The proportion of children with a sufficient fruit and/or vegetable intakes was low. Covariates of child's personal and environmental factors showed significant associations with sufficient intakes of fruit and/or vegetable (P < 0.05). Logistic regression analyses showed that the following factors were positively related to sufficient intake of vegetable; lower grade, a positive attitude toward vegetable, and fruit availability at home; and that greater maternal education, a positive child's attitude toward vegetable, and fruit availability at home were significantly associated with sufficient consumption of fruits and total fruit and vegetable intake. CONCLUSIONS The present study showed that personal factors like attitude toward vegetables and socio-environmental factors, such as, greater availability of fruits were significantly associated with sufficient fruit and vegetable consumption. The importance of environmental and personal factors to successful nutrition highlights the importance of involving parents and schools. PMID:28386386

  17. 49 CFR 40.265 - What happens when an employee is unable to provide a sufficient amount of breath for an alcohol...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... a sufficient amount of breath for an alcohol test? 40.265 Section 40.265 Transportation Office of... sufficient amount of breath for an alcohol test? (a) If an employee does not provide a sufficient amount of breath to permit a valid breath test, you must take the steps listed in this section. (b) As the BAT...

  18. 49 CFR 40.265 - What happens when an employee is unable to provide a sufficient amount of breath for an alcohol...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... a sufficient amount of breath for an alcohol test? 40.265 Section 40.265 Transportation Office of... sufficient amount of breath for an alcohol test? (a) If an employee does not provide a sufficient amount of breath to permit a valid breath test, you must take the steps listed in this section. (b) As the BAT...

  19. 49 CFR 40.265 - What happens when an employee is unable to provide a sufficient amount of breath for an alcohol...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... a sufficient amount of breath for an alcohol test? 40.265 Section 40.265 Transportation Office of... sufficient amount of breath for an alcohol test? (a) If an employee does not provide a sufficient amount of breath to permit a valid breath test, you must take the steps listed in this section. (b) As the BAT...

  20. 49 CFR 40.265 - What happens when an employee is unable to provide a sufficient amount of breath for an alcohol...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... a sufficient amount of breath for an alcohol test? 40.265 Section 40.265 Transportation Office of... sufficient amount of breath for an alcohol test? (a) If an employee does not provide a sufficient amount of breath to permit a valid breath test, you must take the steps listed in this section. (b) As the BAT...

  1. 49 CFR 40.265 - What happens when an employee is unable to provide a sufficient amount of breath for an alcohol...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... a sufficient amount of breath for an alcohol test? 40.265 Section 40.265 Transportation Office of... sufficient amount of breath for an alcohol test? (a) If an employee does not provide a sufficient amount of breath to permit a valid breath test, you must take the steps listed in this section. (b) As the BAT...

  2. 49 CFR 40.263 - What happens when an employee is unable to provide a sufficient amount of saliva for an alcohol...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... a sufficient amount of saliva for an alcohol screening test? 40.263 Section 40.263 Transportation... sufficient amount of saliva for an alcohol screening test? (a) As the STT, you must take the following steps if an employee is unable to provide sufficient saliva to complete a test on a saliva screening...

  3. 49 CFR 40.263 - What happens when an employee is unable to provide a sufficient amount of saliva for an alcohol...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... a sufficient amount of saliva for an alcohol screening test? 40.263 Section 40.263 Transportation... sufficient amount of saliva for an alcohol screening test? (a) As the STT, you must take the following steps if an employee is unable to provide sufficient saliva to complete a test on a saliva screening...

  4. A combined system of microbial fuel cell and intermittently aerated biological filter for energy self-sufficient wastewater treatment

    PubMed Central

    Dong, Yue; Feng, Yujie; Qu, Youpeng; Du, Yue; Zhou, Xiangtong; Liu, Jia

    2015-01-01

    Energy self-sufficiency is a highly desirable goal of sustainable wastewater treatment. Herein, a combined system of a microbial fuel cell and an intermittently aerated biological filter (MFC-IABF) was designed and operated in an energy self-sufficient manner. The system was fed with synthetic wastewater (COD = 1000 mg L−1) in continuous mode for more than 3 months at room temperature (~25 °C). Voltage output was increased to 5 ± 0.4 V using a capacitor-based circuit. The MFC produced electricity to power the pumping and aeration systems in IABF, concomitantly removing COD. The IABF operating under an intermittent aeration mode (aeration rate 1000 ± 80 mL h−1) removed the residual nutrients and improved the water quality at HRT = 7.2 h. This two-stage combined system obtained 93.9% SCOD removal and 91.7% TCOD removal (effluent SCOD = 61 mg L−1, TCOD = 82.8 mg L−1). Energy analysis indicated that the MFC unit produced sufficient energy (0.27 kWh m−3) to support the pumping system (0.014 kWh m−3) and aeration system (0.22 kWh m−3). These results demonstrated that the combined MFC-IABF system could be operated in an energy self-sufficient manner, resulting to high-quality effluent. PMID:26666392

  5. Using Paraffin PCM to Make Optical Communication Type of Payloads Thermally Self-Sufficient for Operation in Orion Crew Module

    NASA Technical Reports Server (NTRS)

    Choi, Michael K.

    2016-01-01

    An innovative concept of using paraffin phase change material with a melting point of 28 C to make Optical Communication type of payload thermally self-sufficient for operation in the Orion Crew Module is presented. It stores the waste heat of the payload and permits it to operate for about one hour by maintaining its temperature within the maximum operating limit. It overcomes the problem of relying on the availability of cold plate heat sink in the Orion Crew Module.

  6. A necessary and sufficient condition for convergence of the Lax-Oleinik semigroup for reversible Hamiltonians on Rn

    NASA Astrophysics Data System (ADS)

    Liu, Qihuai; Wang, Kaizhi; Wang, Lin; Yan, Jun

    2016-11-01

    This paper is devoted to the study of the convergence of the Lax-Oleinik semigroup associated with reversible Hamiltonians H (x , p) on Rn. We provide a necessary and sufficient condition for the convergence of the semigroup. We also give an example to show that for irreversible Hamiltonians on Rn, even if the Hamiltonian is integrable and the initial data is Lipschitz continuous and bounded, the corresponding Lax-Oleinik semigroup may not converge.

  7. A combined system of microbial fuel cell and intermittently aerated biological filter for energy self-sufficient wastewater treatment.

    PubMed

    Dong, Yue; Feng, Yujie; Qu, Youpeng; Du, Yue; Zhou, Xiangtong; Liu, Jia

    2015-12-15

    Energy self-sufficiency is a highly desirable goal of sustainable wastewater treatment. Herein, a combined system of a microbial fuel cell and an intermittently aerated biological filter (MFC-IABF) was designed and operated in an energy self-sufficient manner. The system was fed with synthetic wastewater (COD = 1000 mg L(-1)) in continuous mode for more than 3 months at room temperature (~25 °C). Voltage output was increased to 5 ± 0.4 V using a capacitor-based circuit. The MFC produced electricity to power the pumping and aeration systems in IABF, concomitantly removing COD. The IABF operating under an intermittent aeration mode (aeration rate 1000 ± 80 mL h(-1)) removed the residual nutrients and improved the water quality at HRT = 7.2 h. This two-stage combined system obtained 93.9% SCOD removal and 91.7% TCOD removal (effluent SCOD = 61 mg L(-1), TCOD = 82.8 mg L(-1)). Energy analysis indicated that the MFC unit produced sufficient energy (0.27 kWh m(-3)) to support the pumping system (0.014 kWh m(-3)) and aeration system (0.22 kWh m(-3)). These results demonstrated that the combined MFC-IABF system could be operated in an energy self-sufficient manner, resulting to high-quality effluent.

  8. Sampling sufficiency for analyzing taxonomic relatedness of periphytic ciliate communities using an artificial substratum in coastal waters

    NASA Astrophysics Data System (ADS)

    Xu, Henglong; Zhang, Wei; Jiang, Yong; Zhu, Mingzhuang; Al-Rasheid, Khaled A. S.

    2012-08-01

    Taxonomic relatedness measures of ciliated protozoan communities have successively been used as useful indicators for assessing water quality in marine ecosystems with a number of desirable properties. Sampling sufficiency for analyzing taxonomic relatedness indices of periphytic ciliate communities was studied in coastal waters of the Yellow Sea, northern China, from May to June, 2010. Samples were collected at two depths of 1 m and 3 m using an artificial substratum (glass slides), and were analyzed based on different sampling strategies (slide replicates). For achieving a dissimilarity of < 10%, more slide replicates were required with shortening community ages: 3-10 slide replicates were sufficient for the young (1-7 days) communities while 2-4 slide replicates were for the mature (10-28 days). The standard errors of four taxonomic relatedness indices due to the sample sizes were increased only in the young communities with shortening colonization times. For achieving a standard error of < 10%, 1 slide replicate was generally sufficient for the mature communities, whereas 4-10 were required for the young. These findings suggested that low slide replicates were required for measuring taxonomic relatedness indices compared to analyzing the community patterns, and that these indices were more sensitive to the sample sizes of a young community than a mature one of periphytic ciliates in marine ecosystems.

  9. A Sufficient Condition for the Harmonicity of Functions of Two Variables That Satisfy a Difference Laplace Equation

    NASA Astrophysics Data System (ADS)

    Telyakovskii, D. S.

    2017-01-01

    In this paper we weaken the sufficient conditions of harmonicity for functions of two variables. I.I. Privalov had shown that a continuous function that satisfies the Laplace equation in each point of the domain is harmonic. For function of two variables the Privalov’s condition on continuity can be weakened. G.P. Tolstov replaced the continuity condition by the boundness condition, later the author had shown that summability is sufficient. At the same time summability condition can not be weakened substantially. In this paper, while we keep the summability condition, we provide the sufficient condition for harmonicity of the functions, that satisfy less restricted condition than the Laplace equation in all points of the domain. We assume that arbitrary close to any point ζ there exists a collection of four nodes for which a difference relation of Schwartz type for the Laplace equation can be made arbitrary small by the absolute value. Nodes are the ends of two mutually perpendicular segments, that intersect at point ζ. We need to impose a certain weakened continuous assumption on function itself, in case of function that satisfy the traditional Laplace condition this continuity condition follows from the existence of the partial derivatives.

  10. Microbial fuel cells for energy self-sufficient domestic wastewater treatment-a review and discussion from energetic consideration.

    PubMed

    Lefebvre, Olivier; Uzabiaga, Arnaud; Chang, In Seop; Kim, Byung-Hong; Ng, How Yong

    2011-01-01

    As the microbial fuel cell (MFC) technology is getting nearer to practical applications such as wastewater treatment, it is crucial to consider the different aspects that will make this technology viable in the future. In this paper, we provide information about the specifications of an energy self-sufficient MFC system as a basis to extrapolate on the potential benefits and limits of a future MFC-based wastewater treatment plant. We particularly emphasize on the importance of two crucial parameters that characterize an MFC: its electromotive force (E (emf)) and its internal resistance (R (int)). A numerical projection using state-of-art values (E (emf) = 0.8 V and R (int) = 5 Ω) emphasized on the difficulty at this moment to reach self-sufficiency using a reasonable number of MFCs at the laboratory scale. We found that a realistic number of MFCs to provide enough voltage (=5 V) at a sufficient current (=0.8 A) to power a pump requiring 4 W would be of 13 MFCs in series and 10 stacks of MFCs in parallel, resulting in a total number of 130 MFCs. That would result in a treatment capacity of 144 L of domestic wastewater (0.5 g-COD L(-1)) per day. The total MFC system would be characterized by an internal resistance of 6.5 Ω.

  11. Melanocortin-3 receptors expressed in Nkx2.1(+ve) neurons are sufficient for controlling appetitive responses to hypocaloric conditioning

    PubMed Central

    Girardet, Clémence; Mavrikaki, Maria M.; Stevens, Joseph R.; Miller, Courtney A.; Marks, Daniel L.; Butler, Andrew A.

    2017-01-01

    Melanocortin-3 receptors (MC3R) have a contextual role in appetite control that is amplified with hypocaloric conditioning. C57BL/6J (B6) mice subjected to hypocaloric feeding schedules (HFS) exhibit compulsive behavioral responses involving food anticipatory activity (FAA) and caloric loading following food access. These homeostatic responses to calorie-poor environs are attenuated in B6 mice in which Mc3r transcription is suppressed by a lox-stop-lox sequence in the 5’UTR (Mc3rTB/TB). Here, we report that optimization of caloric loading in B6 mice subject to HFS, characterized by increased meal size and duration, is not observed in Mc3rTB/TB mice. Analysis of hypothalamic and neuroendocrine responses to HFS throughout the light-dark cycle suggests uncoupling of hypothalamic responses involving appetite-stimulating fasting-responsive hypothalamic neurons expressing agouti-related peptide (AgRP) and neuropeptide Y (Npy). Rescuing Mc3rs expression in Nkx2.1(+ve) neurons is sufficient to restore normal hypothalamic responses to negative energy balance. In addition, Mc3rs expressed in Nkx2.1(+ve) neurons are also sufficient to restore FAA and caloric loading of B6 mice subjected to HFS. In summary, MC3Rs expressed in Nkx2.1(+ve) neurons are sufficient to coordinate hypothalamic response and expression of compulsive behavioral responses involving meal anticipation and consumption of large meals during situations of prolonged negative energy balance. PMID:28294152

  12. Is Nativism Sufficient?

    ERIC Educational Resources Information Center

    Braine, Martin D. S.

    1994-01-01

    Provides a brief history of the empiricism-nativism issue, considering present-day intellectual roots of nativist and empiricist inclinations. A schema is proposed for explaining the ontogenetic origin of an innate attribute or principle relevant to language. An attempt is made to explain the origin of primitives as derived by learning. (Contains…

  13. Self sufficient world

    ERIC Educational Resources Information Center

    George, Lynn

    1974-01-01

    Described the efforts of Sietze Leeflang, a Dutch scientific journalist, and his group of young scientists to take a practical stand on environmental pollution by working their small farm in innovative fashion. (RK)

  14. Outlining the Ancestry Landscape of Colombian Admixed Populations.

    PubMed

    Ossa, Humberto; Aquino, Juliana; Pereira, Rui; Ibarra, Adriana; Ossa, Rafael H; Pérez, Luz Adriana; Granda, Juan David; Lattig, Maria Claudia; Groot, Helena; Fagundes de Carvalho, Elizeu; Gusmão, Leonor

    2016-01-01

    The ancestry of the Colombian population comprises a large number of well differentiated Native communities belonging to diverse linguistic groups. In the late fifteenth century, a process of admixture was initiated with the arrival of the Europeans, and several years later, Africans also became part of the Colombian population. Therefore, the genepool of the current Colombian population results from the admixture of Native Americans, Europeans and Africans. This admixture occurred differently in each region of the country, producing a clearly stratified population. Considering the importance of population substructure in both clinical and forensic genetics, we sought to investigate and compare patterns of genetic ancestry in Colombia by studying samples from Native and non-Native populations living in its 5 continental regions: the Andes, Caribe, Amazonia, Orinoquía, and Pacific regions. For this purpose, 46 AIM-Indels were genotyped in 761 non-related individuals from current populations. Previously published genotype data from 214 Colombian Natives from five communities were used for population comparisons. Significant differences were observed between Native and non-Native populations, among non-Native populations from different regions and among Native populations from different ethnic groups. The Pacific was the region with the highest African ancestry, Amazonia harboured the highest Native ancestry and the Andean and Orinoquían regions showed the highest proportion of European ancestry. The Andean region was further sub-divided into 6 sub-regions: North East, Central West, Central East, West, South West and South East. Among these regions, the South West region showed a significantly lower European admixture than the other regions. Hardy-Weinberg equilibrium and variance values of ancestry among individuals within populations showed a potential stratification of the Pacific population.

  15. Outlining the Ancestry Landscape of Colombian Admixed Populations

    PubMed Central

    Ossa, Humberto; Aquino, Juliana; Pereira, Rui; Ibarra, Adriana; Ossa, Rafael H; Pérez, Luz Adriana; Granda, Juan David; Lattig, Maria Claudia; Groot, Helena; Fagundes de Carvalho, Elizeu; Gusmão, Leonor

    2016-01-01

    The ancestry of the Colombian population comprises a large number of well differentiated Native communities belonging to diverse linguistic groups. In the late fifteenth century, a process of admixture was initiated with the arrival of the Europeans, and several years later, Africans also became part of the Colombian population. Therefore, the genepool of the current Colombian population results from the admixture of Native Americans, Europeans and Africans. This admixture occurred differently in each region of the country, producing a clearly stratified population. Considering the importance of population substructure in both clinical and forensic genetics, we sought to investigate and compare patterns of genetic ancestry in Colombia by studying samples from Native and non-Native populations living in its 5 continental regions: the Andes, Caribe, Amazonia, Orinoquía, and Pacific regions. For this purpose, 46 AIM-Indels were genotyped in 761 non-related individuals from current populations. Previously published genotype data from 214 Colombian Natives from five communities were used for population comparisons. Significant differences were observed between Native and non-Native populations, among non-Native populations from different regions and among Native populations from different ethnic groups. The Pacific was the region with the highest African ancestry, Amazonia harboured the highest Native ancestry and the Andean and Orinoquían regions showed the highest proportion of European ancestry. The Andean region was further sub-divided into 6 sub-regions: North East, Central West, Central East, West, South West and South East. Among these regions, the South West region showed a significantly lower European admixture than the other regions. Hardy-Weinberg equilibrium and variance values of ancestry among individuals within populations showed a potential stratification of the Pacific population. PMID:27736937

  16. Neuronal overexpression of Glo1 or amygdalar microinjection of methylglyoxal is sufficient to regulate anxiety-like behavior in mice.

    PubMed

    McMurray, K M J; Du, X; Brownlee, M; Palmer, A A

    2016-03-15

    GLO1 (Glyoxalase1) is a ubiquitous cellular enzyme that detoxifies methylglyoxal (MG), which is a byproduct of glycolysis. Previously, we showed that ubiquitous overexpression of Glo1 reduced concentrations of MG and increased anxiety-like behavior, whereas systemic injection of MG reduced anxiety-like behavior. We further showed that MG is a competitive partial agonist at GABA-A receptors. Based on those data we hypothesized that modulation of GABAergic signaling by MG underlies Glo1 and MG's effects on anxiety-like behavior. As previous studies used ubiquitous overexpression, we sought to determine whether neuronal Glo1 overexpression was sufficient to increase anxiety-like behavior. We generated ROSA26 knock-in mice with a floxed-stop codon upstream from human Glo1 (FLOXGlo1KI) and bred them with mice expressing CRE recombinase under the direction of the Synapsin 1 promoter (Syn-CRE) to limit overexpression of Glo1 specifically to neurons. Furthermore, since previous administration of MG had been systemic, we sought to determine if direct microinjection of MG into the basolateral amygdala (BLA) was sufficient to reduce anxiety-like behavior. Thus, we performed bilateral microinjections of saline, MG (12μM or 24μM), or the positive control midazolam (4mM) directly into the BLA. FLOXGlo1KIxSyn-CRE mice showed significantly increased anxiety-like behavior compared to their FLOXGLO1xWT littermates. In addition, bilateral microinjection of MG and midazolam significantly decreased anxiety-like behavior compared to saline treated mice. These studies suggest that anatomically specific manipulations of Glo1 and MG are sufficient to induce changes in anxiety-like behavior.

  17. Local Production of the Alternative Pathway Component Factor B Is Sufficient to Promote Laser-Induced Choroidal Neovascularization

    PubMed Central

    Schnabolk, Gloriane; Coughlin, Beth; Joseph, Kusumam; Kunchithapautham, Kannan; Bandyopadhyay, Mausumi; O'Quinn, Elizabeth C.; Nowling, Tamara; Rohrer, Bärbel

    2015-01-01

    Purpose. Complement factor B (CFB) is a required component of the alternative pathway (AP) of complement, and CFB polymorphisms are associated with age-related macular degeneration (AMD) risk. Complement factor B is made in the liver, but expression has also been detected in retina and retinal pigment epithelium (RPE)-choroid. We investigated whether production of CFB by the RPE can promote AP activation in mouse choroidal neovascularization (CNV). Methods. Transgenic mice expressing CFB under the RPE65 promoter were generated and crossed onto factor B-deficient (CFB-KO) mice. Biological activity was determined in vitro using RPE monolayers and in vivo using laser-induced CNV. Contribution of systemic CFB was investigated using CFB-KO reconstituted with CFB-sufficient serum. Results. Transgenic mice (CFB-tg) expressed CFB in RPE-choroid; no CFB was detected in serum. Cultured CFB-tg RPE monolayers secreted CFB apically and basally upon exposure to oxidative stress that was biologically active. Choroidal neovascularization sizes were comparable between wild-type and CFB-tg mice, but significantly increased when compared to lesions in CFB-KO mice. Injections of CFB-sufficient serum into CFB-KO mice resulted in partial reconstitution of systemic AP activity and significantly increased CNV size. Conclusions. Mouse RPE cells express and secrete CFB sufficient to promote RPE damage and CNV. This further supports that local complement production may regulate disease processes; however, the reconstitution experiments suggest that additional components may be sequestered from the bloodstream. Understanding the process of ocular complement production and regulation will further our understanding of the AMD disease process and the requirements of a complement-based therapeutic. PMID:25593023

  18. Play It, Learn It, Make It Last: Developing an Online Game to Create Self-Sufficient Library Information Users.

    PubMed

    Boyce, Lindsay M

    2016-01-01

    Library orientation at an academic health sciences library consisted of a five-minute overview within new student orientation. Past experience indicated this brief presentation was insufficient for students to learn about library resources. In 2014, an effort was made to supplement orientation by developing an online game aimed at enabling students to become self-sufficient through hands-on learning. A gaming model was chosen with expectations that competition and rewards would motivate students. Although the pilots suffered from low participation rates, the experience merits further research into the potential of a broader model of online library instruction in the health sciences environment.

  19. An outboard shield design for TIBER-II with potential for tritium self-sufficiency: Appendix A-1

    SciTech Connect

    Sawan, M.E.; Sviatoslavsky, I.N.

    1987-01-01

    The outboard breeding shield design for TIBER-II is described. The design allows for tritium self-sufficiency without compromising magnet protection, design simplicity, and the testing mission of the device. The shield consists of a beryllium pebble front zone backed by a steel pebble zone. The shield is cooled by an aqueous solution containing 16 g LiNO/sub 3/ per 100 cm/sup 3/. A double first wall is used to insure uniform cooling and minimize pressure. The design pressure for the outboard shield is 0.19 MPa and the coolant temperature is less than 75/sup 0/C. 6 refs., 5 figs., 3 tabs.

  20. Giving Economically Disadvantaged, Minority Food Pantry Patrons' a Voice: Implications for Equitable Access to Sufficient, Nutritious Food.

    PubMed

    Greer, Anna E; Cross-Denny, Bronwyn; McCabe, Michelle; Castrogivanni, Brianna

    2016-01-01

    This study provides economically disadvantaged, minority food pantry patrons (hereafter, patrons) a meaning-ful voice by examining their experiences trying to obtain sufficient, nutritious food. Five focus groups were conducted using a semistructured discussion guide. Atlast.ti software was used to manage and analyze the data. Patrons reported that pantry staff who preserved their dignity by showing compassion were highly valued. Stigma and shame associated with pantry use were major concerns. Patrons suggested environmental and policy changes to improve their food acquisition experiences. These findings suggest that multilevel interventions addressing food access, food distribution policies, and patron-staff interactions are warranted.

  1. Demonstration of sufficient control for two rounds of quantum error correction in a solid state ensemble quantum information processor.

    PubMed

    Moussa, Osama; Baugh, Jonathan; Ryan, Colm A; Laflamme, Raymond

    2011-10-14

    We report the implementation of a 3-qubit quantum error-correction code on a quantum information processor realized by the magnetic resonance of carbon nuclei in a single crystal of malonic acid. The code corrects for phase errors induced on the qubits due to imperfect decoupling of the magnetic environment represented by nearby spins, as well as unwanted evolution under the internal Hamiltonian. We also experimentally demonstrate sufficiently high-fidelity control to implement two rounds of quantum error correction. This is a demonstration of state-of-the-art control in solid state nuclear magnetic resonance, a leading test bed for the implementation of quantum algorithms.

  2. Linear and ponderal growth trajectories in well-nourished, iron-sufficient infants are unimpaired by iron supplementation.

    PubMed

    Gahagan, Sheila; Yu, Sunkyung; Kaciroti, Niko; Castillo, Marcela; Lozoff, Betsy

    2009-11-01

    Iron deficiency remains the most common nutritional deficiency worldwide and supplementation is recommended during periods of high risk, including infancy. However, questions have been raised about possible adverse effects of iron on growth in iron-sufficient (IS) infants and the advisability of across-the-board iron supplementation. This study examined whether short- or long-term growth was impaired in IS infants who received iron supplementation. From a longitudinal study of healthy, breast-fed, low- to middle-income Chilean infants randomly assigned to iron supplementation or usual nutrition at 6 or 12 mo, we retrospectively identified infants meeting criteria for iron sufficiency at the time of random assignment (n = 273). Using multilevel analysis, ponderal and linear growth were modeled before, during, and after iron supplementation up to 10 y in 3 comparisons: 1) iron supplementation compared with usual nutrition from 6 to 12 mo; 2) iron supplementation compared with usual nutrition from 12 to 18 mo; and 3) 15 mg/d of iron as drops compared with iron-fortified formula (12 mg/L). Growth trajectories did not differ during or after supplementation indicating no adverse effect of iron in any comparison. These results suggest that, at least in some environments, iron does not impair growth in IS infants.

  3. Establishing the cost-effectiveness of new pharmaceuticals under conditions of uncertainty--when is there sufficient evidence?

    PubMed

    Sculpher, Mark; Claxton, Karl

    2005-01-01

    Decisions about which health-care interventions represent adequate value to collectively funded health-care systems are as widespread as they are unavoidable. In the case of new pharmaceuticals, many countries now require formal cost-effectiveness analysis to inform this decision-making process. This requires evidence on parameters associated with health-related utilities, treatment effects, resource use, and costs, for which data from available regulatory trials are invariably absent or highly uncertain. This uncertainty results from a number of factors including the predominance of intermediate end points in the clinical evidence-base and the limited period of follow-up of patients in clinical studies. Despite these imperfections in the evidence base, decisions about whether new pharmaceuticals are sufficiently cost-effective for reimbursement cannot be side-stepped. Data limitations do, however, require the use of rigorous analytical methods to support decision making. Probabilistic decision models and value of information analysis offer a means of structuring decision problems, synthesizing all available data, characterizing the uncertainty in the decision, quantifying the cost of uncertainty, and establishing the expected value of perfect information. This analytical framework is important because it addresses two fundamental questions about new pharmaceuticals. First, is the product expected to be cost-effective on the basis of existing evidence? Second, is additional research concerning the product itself cost-effective? In addressing these questions, the analytical framework can establish when sufficient evidence exists to sustain a claim for a new pharmaceutical to be cost-effective.

  4. Engineering of daidzein 3’-hydroxylase P450 enzyme into catalytically self-sufficient cytochrome P450

    PubMed Central

    2012-01-01

    A cytochrome P450 (CYP) enzyme, 3’-daidzein hydroxylase, CYP105D7 (3’-DH), responsible for daidzein hydroxylation at the 3’-position, was recently reported. CYP105D7 (3’-DH) is a class I type of CYP that requires electrons provided through electron transfer proteins such as ferredoxin and ferredoxin reductase. Presently, we constructed an artificial CYP in order to develop a reaction host for the production of a hydroxylated product. Fusion-mediated construction with the reductase domain from self-sufficient CYP102D1 was done to increase electron transfer efficiency and coupling with the oxidative process. An artificial self-sufficient daidzein hydroxylase (3’-ASDH) displayed distinct spectral properties of both flavoprotein and CYP. The fusion enzyme catalyzed hydroxylation of daidzein more efficiently, with a kcat/Km value of 16.8 μM-1 min-1, which was about 24-fold higher than that of the 3’-DH-camA/B reconstituted enzyme. Finally, a recombinant Streptomyces avermitilis host for the expression of 3’-ASDH and production of the hydroxylated product was developed. The conversion that was attained (34.6%) was 5.2-fold higher than that of the wild-type. PMID:22697884

  5. Optogenetic Mimicry of the Transient Activation of Dopamine Neurons by Natural Reward Is Sufficient for Operant Reinforcement

    PubMed Central

    Kim, Kyung Man; Baratta, Michael V.; Yang, Aimei; Lee, Doheon; Boyden, Edward S.; Fiorillo, Christopher D.

    2012-01-01

    Activation of dopamine receptors in forebrain regions, for minutes or longer, is known to be sufficient for positive reinforcement of stimuli and actions. However, the firing rate of dopamine neurons is increased for only about 200 milliseconds following natural reward events that are better than expected, a response which has been described as a “reward prediction error” (RPE). Although RPE drives reinforcement learning (RL) in computational models, it has not been possible to directly test whether the transient dopamine signal actually drives RL. Here we have performed optical stimulation of genetically targeted ventral tegmental area (VTA) dopamine neurons expressing Channelrhodopsin-2 (ChR2) in mice. We mimicked the transient activation of dopamine neurons that occurs in response to natural reward by applying a light pulse of 200 ms in VTA. When a single light pulse followed each self-initiated nose poke, it was sufficient in itself to cause operant reinforcement. Furthermore, when optical stimulation was delivered in separate sessions according to a predetermined pattern, it increased locomotion and contralateral rotations, behaviors that are known to result from activation of dopamine neurons. All three of the optically induced operant and locomotor behaviors were tightly correlated with the number of VTA dopamine neurons that expressed ChR2, providing additional evidence that the behavioral responses were caused by activation of dopamine neurons. These results provide strong evidence that the transient activation of dopamine neurons provides a functional reward signal that drives learning, in support of RL theories of dopamine function. PMID:22506004

  6. The estrogen receptor-α is required and sufficient to maintain physiological glucose uptake in the mouse heart.

    PubMed

    Arias-Loza, Paula-Anahi; Kreissl, Michael C; Kneitz, Susanne; Kaiser, Franz R; Israel, Ina; Hu, Kai; Frantz, Stefan; Bayer, Barbara; Fritzemeier, Karl-Heinz; Korach, Kenneth S; Pelzer, Theo

    2012-10-01

    Estrogens attenuate cardiac hypertrophy and increase cardiac contractility via their cognate estrogen receptors (ERs) ERα and ERβ. Because female sex hormones enhance global glucose use and because myocardial function and mass are tightly linked to cardiac glucose metabolism, we tested the hypothesis that expression and activation of the ERα might be required and sufficient to maintain physiological cardiac glucose uptake in the murine heart. Cardiac glucose uptake quantified in vivo by 18F-fluorodeoxyglucose positron emission tomography was strongly impaired in ovariectomized compared with gonadal intact female C57BL/6JO mice. The selective ERα agonist 16α-LE2 and the nonselective ERα and ERβ agonist 17β-estradiol completely restored cardiac glucose uptake in ovariectomized mice. Cardiac 18F-fluorodeoxyglucose uptake was strongly decreased in female ERα knockout mice compared with wild-type littermates. Analysis of cardiac mRNA accumulation by quantitative RT-PCR revealed an upregulation of genes involved in glycolisis and tricarboxylic acid cycle by ERα treatment. In conclusion, systemic activation of ERα is sufficient, and its expression is required to maintain physiological glucose uptake in the murine heart, which is likely to contribute to known cardioprotective estrogen effects.

  7. The Estrogen Receptor-α Is Required and Sufficient to Maintain Physiological Glucose Uptake in the Mouse Heart

    PubMed Central

    Arias-Loza, Paula-Anahi; Kreissl, Michael C.; Kneitz, Susanne; Kaiser, Franz R.; Israel, Ina; Hu, Kai; Frantz, Stefan; Bayer, Barbara; Fritzemeier, Karl-Heinz; Korach, Kenneth S.; Pelzer, Theo

    2016-01-01

    Estrogens attenuate cardiac hypertrophy and increase cardiac contractility via their cognate estrogen receptors (ERs) ERα and ERβ. Because female sex hormones enhance global glucose use and because myocardial function and mass are tightly linked to cardiac glucose metabolism, we tested the hypothesis that expression and activation of the ERα might be required and sufficient to maintain physiological cardiac glucose uptake in the murine heart. Cardiac glucose uptake quantified in vivo by 18F-fluorodeoxyglucose positron emission tomography was strongly impaired in ovariectomized compared with gonadal intact female C57BL/6JO mice. The selective ERα agonist 16α-LE2 and the nonselective ERα and ERβ agonist 17β-estradiol completely restored cardiac glucose uptake in ovariectomized mice. Cardiac 18F-fluorodeoxyglucose uptake was strongly decreased in female ERα knockout mice compared with wild-type littermates. Analysis of cardiac mRNA accumulation by quantitative RT-PCR revealed an upregulation of genes involved in glycolisis and tricarboxylic acid cycle by ERα treatment. In conclusion, systemic activation of ERα is sufficient, and its expression is required to maintain physiological glucose uptake in the murine heart, which is likely to contribute to known cardioprotective estrogen effects. PMID:22892812

  8. Two transcription factors, Pou4f2 and Isl1, are sufficient to specify the retinal ganglion cell fate.

    PubMed

    Wu, Fuguo; Kaczynski, Tadeusz J; Sethuramanujam, Santhosh; Li, Renzhong; Jain, Varsha; Slaughter, Malcolm; Mu, Xiuqian

    2015-03-31

    As with other retinal cell types, retinal ganglion cells (RGCs) arise from multipotent retinal progenitor cells (RPCs), and their formation is regulated by a hierarchical gene-regulatory network (GRN). Within this GRN, three transcription factors--atonal homolog 7 (Atoh7), POU domain, class 4, transcription factor 2 (Pou4f2), and insulin gene enhancer protein 1 (Isl1)--occupy key node positions at two different stages of RGC development. Atoh7 is upstream and is required for RPCs to gain competence for an RGC fate, whereas Pou4f2 and Isl1 are downstream and regulate RGC differentiation. However, the genetic and molecular basis for the specification of the RGC fate, a key step in RGC development, remains unclear. Here we report that ectopic expression of Pou4f2 and Isl1 in the Atoh7-null retina using a binary knockin-transgenic system is sufficient for the specification of the RGC fate. The RGCs thus formed are largely normal in gene expression, survive to postnatal stages, and are physiologically functional. Our results indicate that Pou4f2 and Isl1 compose a minimally sufficient regulatory core for the RGC fate. We further conclude that during development a core group of limited transcription factors, including Pou4f2 and Isl1, function downstream of Atoh7 to determine the RGC fate and initiate RGC differentiation.

  9. Activation of InsP3 receptors is sufficient for inducing graded intrinsic plasticity in rat hippocampal pyramidal neurons

    PubMed Central

    Ashhad, Sufyan; Johnston, Daniel

    2014-01-01

    The synaptic plasticity literature has focused on establishing necessity and sufficiency as two essential and distinct features in causally relating a signaling molecule to plasticity induction, an approach that has been surprisingly lacking in the intrinsic plasticity literature. In this study, we complemented the recently established necessity of inositol trisphosphate (InsP3) receptors (InsP3R) in a form of intrinsic plasticity by asking if InsP3R activation was sufficient to induce intrinsic plasticity in hippocampal neurons. Specifically, incorporation of d-myo-InsP3 in the recording pipette reduced input resistance, maximal impedance amplitude, and temporal summation but increased resonance frequency, resonance strength, sag ratio, and impedance phase lead. Strikingly, the magnitude of plasticity in all these measurements was dependent on InsP3 concentration, emphasizing the graded dependence of such plasticity on InsP3R activation. Mechanistically, we found that this InsP3-induced plasticity depended on hyperpolarization-activated cyclic nucleotide-gated channels. Moreover, this calcium-dependent form of plasticity was critically reliant on the release of calcium through InsP3Rs, the influx of calcium through N-methyl-d-aspartate receptors and voltage-gated calcium channels, and on the protein kinase A pathway. Our results delineate a causal role for InsP3Rs in graded adaptation of neuronal response dynamics, revealing novel regulatory roles for the endoplasmic reticulum in neural coding and homeostasis. PMID:25552640

  10. Role of exponential type random invexities for asymptotically sufficient efficiency conditions in semi-infinite multi-objective fractional programming.

    PubMed

    Verma, Ram U; Seol, Youngsoo

    2016-01-01

    First a new notion of the random exponential Hanson-Antczak type [Formula: see text]-V-invexity is introduced, which generalizes most of the existing notions in the literature, second a random function [Formula: see text] of the second order is defined, and finally a class of asymptotically sufficient efficiency conditions in semi-infinite multi-objective fractional programming is established. Furthermore, several sets of asymptotic sufficiency results in which various generalized exponential type [Formula: see text]-V-invexity assumptions are imposed on certain vector functions whose components are the individual as well as some combinations of the problem functions are examined and proved. To the best of our knowledge, all the established results on the semi-infinite aspects of the multi-objective fractional programming are new, which is a significantly new emerging field of the interdisciplinary research in nature. We also observed that the investigated results can be modified and applied to several special classes of nonlinear programming problems.

  11. Minimal sufficient balance-a new strategy to balance baseline covariates and preserve randomness of treatment allocation.

    PubMed

    Zhao, Wenle; Hill, Michael D; Palesch, Yuko

    2015-12-01

    In many clinical trials, baseline covariates could affect the primary outcome. Commonly used strategies to balance baseline covariates include stratified constrained randomization and minimization. Stratification is limited to few categorical covariates. Minimization lacks the randomness of treatment allocation. Both apply only to categorical covariates. As a result, serious imbalances could occur in important baseline covariates not included in the randomization algorithm. Furthermore, randomness of treatment allocation could be significantly compromised because of the high proportion of deterministic assignments associated with stratified block randomization and minimization, potentially resulting in selection bias. Serious baseline covariate imbalances and selection biases often contribute to controversial interpretation of the trial results. The National Institute of Neurological Disorders and Stroke recombinant tissue plasminogen activator Stroke Trial and the Captopril Prevention Project are two examples. In this article, we propose a new randomization strategy, termed the minimal sufficient balance randomization, which will dually prevent serious imbalances in all important baseline covariates, including both categorical and continuous types, and preserve the randomness of treatment allocation. Computer simulations are conducted using the data from the National Institute of Neurological Disorders and Stroke recombinant tissue plasminogen activator Stroke Trial. Serious imbalances in four continuous and one categorical covariate are prevented with a small cost in treatment allocation randomness. A scenario of simultaneously balancing 11 baseline covariates is explored with similar promising results. The proposed minimal sufficient balance randomization algorithm can be easily implemented in computerized central randomization systems for large multicenter trials.

  12. Optogenetic mimicry of the transient activation of dopamine neurons by natural reward is sufficient for operant reinforcement.

    PubMed

    Kim, Kyung Man; Baratta, Michael V; Yang, Aimei; Lee, Doheon; Boyden, Edward S; Fiorillo, Christopher D

    2012-01-01

    Activation of dopamine receptors in forebrain regions, for minutes or longer, is known to be sufficient for positive reinforcement of stimuli and actions. However, the firing rate of dopamine neurons is increased for only about 200 milliseconds following natural reward events that are better than expected, a response which has been described as a "reward prediction error" (RPE). Although RPE drives reinforcement learning (RL) in computational models, it has not been possible to directly test whether the transient dopamine signal actually drives RL. Here we have performed optical stimulation of genetically targeted ventral tegmental area (VTA) dopamine neurons expressing Channelrhodopsin-2 (ChR2) in mice. We mimicked the transient activation of dopamine neurons that occurs in response to natural reward by applying a light pulse of 200 ms in VTA. When a single light pulse followed each self-initiated nose poke, it was sufficient in itself to cause operant reinforcement. Furthermore, when optical stimulation was delivered in separate sessions according to a predetermined pattern, it increased locomotion and contralateral rotations, behaviors that are known to result from activation of dopamine neurons. All three of the optically induced operant and locomotor behaviors were tightly correlated with the number of VTA dopamine neurons that expressed ChR2, providing additional evidence that the behavioral responses were caused by activation of dopamine neurons. These results provide strong evidence that the transient activation of dopamine neurons provides a functional reward signal that drives learning, in support of RL theories of dopamine function.

  13. Secretory phospholipase A{sub 2} mediates progression of acute liver injury in the absence of sufficient cyclooxygenase-2

    SciTech Connect

    Bhave, Vishakha S.; Donthamsetty, Shashikiran; Latendresse, John R.; Muskhelishvili, Levan; Mehendale, Harihara M.

    2008-04-15

    Previous studies have shown that injury initiated by toxicants progresses even after most of the toxicant is eliminated from the body. One mechanism of progression of injury is the extracellular appearance of hydrolytic enzymes following leakage or upon cell lyses. Under normal conditions, after exposure to low to moderate doses of toxicants, secretory phospholipase A{sub 2} (sPLA{sub 2}) and other hydrolytic enzymes are known to appear in the extracellular spaces in order to cleanup the post-necrotic debris in tissues. We tested the hypothesis that sPLA{sub 2} contributes to progression of toxicant-initiated liver injury because of hydrolysis of membrane phospholipids of hepatocytes in the perinecrotic areas in the absence of sufficient cyclooxygenase-2 (COX-2). Male Sprague-Dawley rats were administered either a moderately hepatotoxic dose (MD, 2 ml CCl{sub 4}/kg, ip) or a highly hepatotoxic dose (HD, 3 ml CCl{sub 4}/kg, ip) of CCl{sub 4}. After MD, liver sPLA{sub 2} and COX-2 were co-localized in the necrotic and perinecrotic areas and their activities in plasma and liver increased before decreasing in tandem with liver injury (ALT and histopathology) leading to 100% survival. In contrast, after the HD, high extracellular and hepatic sPLA{sub 2} activities were accompanied by minimal COX-2 activity and localization in the liver throughout the time course. This led to progression of liver injury and 70% mortality. These data suggested a destructive role of sPLA{sub 2} in the absence of sufficient COX-2. Time- and dose-dependent destruction of hepatocytes by sPLA{sub 2} in isolated hepatocyte incubations confirmed the destructive ability of sPLA{sub 2} when present extracellularly, suggesting its ability to spread injury in vivo. These findings suggest that sPLA{sub 2}, secreted for cleanup of necrotic debris upon initiation of hepatic necrosis, requires the co-presence of sufficiently induced COX-2 activity to prevent the run-away destructive action of sPLA{sub 2

  14. The Effect of Herbal Tea Containing Fenugreek Seed on the Signs of Breast Milk Sufficiency in Iranian Girl Infants

    PubMed Central

    Ghasemi, Vida; Kheirkhah, Masoomeh; Vahedi, Mohsen

    2015-01-01

    Background: One of the important reasons behind termination of breast-feeding in the first six months after childbirth is insufficient production of breast milk. Objectives: The aim of this study was to determine the effect of herbal tea containing fenugreek seed on the signs of breast milk sufficiency in Iranian girl infants aged 0 - 4 months, at the medical health centers of Tehran university of medical sciences. Patients and Methods: This study was a clinical trial with a control group. Seventy-eight girl infants, 0 - 4 months old that were exclusively breastfed by their mothers, were randomly assigned to the intervention group (received herbal tea containing 7.5 g fenugreek seed powder in addition to 3 g of black tea, three times a day) and the control group (received herbal tea containing 3 g of black tea powder, three times a day). Before and during the four weeks of study, the signs of breast milk sufficiency were evaluated through measurement of growth parameters and use of follow-up forms for measuring the number of wet diapers in one day, frequency of defecation and infant breast-feeding times in a day. Results: Before the intervention there was no significant difference between weight, height, head circumference, the number of wet diapers and frequency of defecation between the two groups (P > 0.05), yet the number of breast feeding times of the control group was more than the Fenugreek group. At the end of the fourth week in proportion to the pre-intervention conditions, the weight of the infants in the fenugreek group increased significantly from 5282.0513 ± 1021.51121 to 6383.0769 ± 952.06190, while head circumference increased from 38.3103 ± 1.62736 to 39.9256 ± 1.50660, number of wet diapers from 5.2821 ± 0.93044 to 8.1648 ± 1.20620, frequency of defecation from 1.8846 ± 1.08495 to 2.7326 ± 0.94771 and the number of breast feeding times from 9.1795 ± 1.39778 to 15.9597 ± 1.45056 (P < 0.001). However, there was no significant effect on

  15. IS PROTOSTELLAR HEATING SUFFICIENT TO HALT FRAGMENTATION? A CASE STUDY OF THE MASSIVE PROTOCLUSTER G8.68-0.37

    SciTech Connect

    Longmore, S. N.; Pillai, T.; Keto, E.; Zhang, Q.; Qiu, K.

    2011-01-10

    If star formation proceeds by thermal fragmentation and the subsequent gravitational collapse of the individual fragments, how is it possible to form fragments massive enough for O and B stars in a typical star-forming molecular cloud where the Jeans mass is about 1 M{sub sun} at the typical densities (10{sup 4} cm{sup -3}) and temperatures (10 K)? We test the hypothesis that a first generation of low-mass stars may heat the gas enough that subsequent thermal fragmentation results in fragments {>=}10 M{sub sun}, sufficient to form B stars. We combine ATCA and Submillimeter Array observations of the massive star-forming region G8.68-0.37 with radiative transfer modeling to derive the present-day conditions in the region and use this to infer the conditions in the past, at the time of core formation. Assuming that the current mass/separation of the observed cores equals the fragmentation Jeans mass/length and the region's average density has not changed requires the gas temperature to have been 100 K at the time of fragmentation. The postulated first generation of low-mass stars would still be around today, but the number required to heat the cloud exceeds the limits imposed by the observations. Several lines of evidence suggest the observed cores in the region should eventually form O stars yet none have sufficient raw material. Even if feedback may have suppressed fragmentation, it was not sufficient to halt it to this extent. To develop into O stars, the cores must obtain additional mass from outside their observationally defined boundaries. The observations suggest that they are currently fed via infall from the very massive reservoir ({approx}1500 M{sub sun}) of gas in the larger parsec scale cloud around the star-forming cores. This suggests that massive stars do not form in the collapse of individual massive fragments, but rather in smaller fragments that themselves continue to gain mass by accretion from larger scales.

  16. Tissue distribution of manganese in iron-sufficient or iron-deficient rats after stainless steel welding-fume exposure.

    PubMed

    Park, Jung-Duck; Kim, Ki-Young; Kim, Dong-Won; Choi, Seong-Jin; Choi, Byung-Sun; Chung, Yong Hyun; Han, Jeong Hee; Sung, Jae Hyuck; Kwon, Il Hoon; Mun, Je-Hyeok; Yu, Il Je

    2007-05-01

    Welders can be exposed to high levels of manganese through welding fumes. Although it has already been suggested that excessive manganese exposure causes neurotoxicity, called manganism, the pathway of manganese transport to the brain with welding-fume exposure remains unclear. Iron is an essential metal that maintains a homeostasis in the body. The divalent metal transporter 1 (DMT1) transports iron and other divalent metals, such as manganese, and the depletion of iron is known to upregulate DMT1 expression. Accordingly, this study investigated the tissue distribution of manganese in iron-sufficient and iron-deficient rats after welding-fume exposure. The feeding of an iron-deficient diet for 4 wk produced a depletion of body iron, such as decreased iron levels in the serum and tissues, and upregulated the DMT1 expression in the rat duodenum. The iron-sufficient and iron-deficient rats were then exposed to welding fumes generated from manual metal arc stainless steel at a concentration of 63.5 +/- 2.3 mg/m3 for 2 h per day over a 30-day period. Animals were sacrificed on days 1, 15, and 30. The level of body iron in the iron-deficient rats was restored to the control level after the welding-fume exposure. However, the tissue distributions of manganese after the welding-fume exposure showed similar patterns in both the iron-sufficient and iron-deficient groups. The concentration of manganese increased in the lungs and liver on days 15 and 30, and increased in the olfactory bulb on day 30. Slight and heterogeneous increases of manganese were observed in different brain regions. Consequently, these findings suggest that the presence of Fe in the inhaled welding fumes may not have a significant effect on the uptake of Mn into the brain. Thus, the condition of iron deficiency did not seem to have any apparent effect on the transport of Mn into the brain after the inhalation of welding fumes.

  17. Use of non-petroleum fuels to reduce military energy vulnerabilities: self-sufficient bases and new weapon propulsion systems

    SciTech Connect

    Freiwald, D.A.

    1980-01-01

    The US fossil synfuels program may not have significant impact on domestic fuel supplies until near the year 2000, resulting in a continuing mobility fuels vulnerability for the US military until then. But there are other mobility fuel options for both propulsion systems and stationary base-energy sources, for which the base technology is commercially available or at least demonstrated. For example, for surface propulsion systems, hydrogen-fuel-cell/battery-electric hybrids may be considered; for weapons systems these may offer some new flexibilities, standardization possibilities, and multiple military-controlled fuel-supply options. Hydrogen-fueled aircraft may provide interesting longer-term possibilities in terms of military energy self-sufficiency and multiple supply options, as well as performance specifications. These scenarios will be discussed, along with possibilities for demonstrations in the MX-system ground vehicles.

  18. Comparison of serum and plasma taurine values in Bengal tigers with values in taurine-sufficient and -deficient domestic cats.

    PubMed

    Pickett, J P; Chesney, R W; Beehler, B; Moore, C P; Lippincott, S; Sturman, J; Ketring, K L

    1990-01-15

    A white Bengal tiger was determined to have a central retinal lesion and a central visual defect. Because of the known association between feline central retinal degeneration (CRD) and taurine deficiency in domestic cats, plasma concentrations of taurine were measured in this tiger. Serum concentrations of taurine, methionine, and cystine also were measured in white Bengal tigers, orange Bengal tigers, taurine-sufficient domestic cats, and taurine-deprived and tissue-taurine-depleted visually impaired cats with CRD. Hepatic and brain enzymes responsible for taurine synthesis were identified in tissue specimens from an orange Bengal tiger. Serum taurine concentrations were lower in white vs orange tigers, but were not as low as those in cats with CRD. Thus, we concluded that taurine depletion did not account for the central retinal lesion in the white Bengal tiger.

  19. Boiling sheep liver or lung for 30 minutes is necessary and sufficient to kill Echinococcus granulosus protoscoleces in hydatid cysts

    PubMed Central

    Li, Jun; Wu, Chuanchuan; Wang, Hui; Liu, Huanyuan; Vuitton, Dominique A.; Wen, Hao; Zhang, Wenbao

    2014-01-01

    Proper disposal of carcasses and offal after home slaughter is difficult in poor and remote communities and therefore dogs readily have access to hydatid cysts containing offal from livestock, thus completing the parasite cycle of Echinococcus granulosus and putting communities at risk of cystic echinococcosis. Boiling livers and lungs which contain hydatid cysts could be a simple, efficient and energy- and time-saving way to kill the infectious protoscoleces. The aim of this study was to provide precise practical recommendations to livestock owners. Our results show that boiling the whole sheep liver and/or lung, with single or multiple hydatid cysts, for 30 min is necessary and sufficient to kill E. granulosus protoscoleces in hydatid cysts. Advertising on this simple rule in at-risk communities would be an efficient and cheap complement to other veterinary public health operations to control cystic echinococcosis. PMID:25456565

  20. TAK1 is activated in the myocardium after pressure overload and is sufficient to provoke heart failure in transgenic mice

    NASA Technical Reports Server (NTRS)

    Zhang, D.; Gaussin, V.; Taffet, G. E.; Belaguli, N. S.; Yamada, M.; Schwartz, R. J.; Michael, L. H.; Overbeek, P. A.; Schneider, M. D.

    2000-01-01

    The transforming-growth-factor-beta-activated kinase TAK1 is a member of the mitogen-activated protein kinase kinase kinase family, which couples extracellular stimuli to gene transcription. The in vivo function of TAK1 is not understood. Here, we investigated the potential involvement of TAK1 in cardiac hypertrophy. In adult mouse myocardium, TAK1 kinase activity was upregulated 7 days after aortic banding, a mechanical load that induces hypertrophy and expression of transforming growth factor beta. An activating mutation of TAK1 expressed in myocardium of transgenic mice was sufficient to produce p38 mitogen-activated protein kinase phosphorylation in vivo, cardiac hypertrophy, interstitial fibrosis, severe myocardial dysfunction, 'fetal' gene induction, apoptosis and early lethality. Thus, TAK1 activity is induced as a delayed response to mechanical stress, and can suffice to elicit myocardial hypertrophy and fulminant heart failure.

  1. An improved sufficient condition for stabilisation of unstable first-order processes by observer-state feedback

    NASA Astrophysics Data System (ADS)

    Francisco Marquez Rubio, Juan; del Muro Cuéllar, Basilio; Velasco Villa, Martín; de Jesús Álvarez Ramírez, José

    2015-02-01

    This work considers the stabilisation and control of unstable first-order linear systems subject to a relatively large I/O time delay. First, it is proposed an observer strategy to predict a specific internal signal in the process. The adequate prediction convergence is obtained and formally stated. Then, it is proposed an estimated state feedback control. Necessary and sufficient stability conditions with respect to time delay size and unstable time constant are provided. The proposed control strategy allows to address time delays as large as four times the unstable time constant of the open-loop system, in contrast with most of the reported related literature. Numerical examples are used for illustrating the parametric stabilisation region as a function of the time delay.

  2. Life cycle assessment of energy self-sufficiency systems based on agricultural residues for organic arable farms.

    PubMed

    Kimming, M; Sundberg, C; Nordberg, A; Baky, A; Bernesson, S; Norén, O; Hansson, P-A

    2011-01-01

    The agricultural industry today consumes large amounts of fossil fuels. This study used consequential life cycle assessment (LCA) to analyse two potential energy self-sufficient systems for organic arable farms, based on agricultural residues. The analysis focused on energy balance, resource use and greenhouse gas (GHG) emissions. A scenario based on straw was found to require straw harvest from 25% of the farm area; 45% of the total energy produced from the straw was required for energy carrier production and GHG emissions were reduced by 9% compared with a fossil fuel-based reference scenario. In a scenario based on anaerobic digestion of ley, the corresponding figures were 13%, 24% and 35%. The final result was sensitive to assumptions regarding, e.g., soil carbon content and handling of by-products.

  3. Difference between the maximum empirical and field measured peak Watt values of thermal power system under highly sufficient solar conditions

    NASA Astrophysics Data System (ADS)

    Elhussain, O. A.; Abdel-Magid, T. I. M.

    2016-08-01

    Mono-Crystalline solar cell module is experimentally conducted in Khartoum, Sudan to study the difference between maximum empirical value of peak Watt and maximum value of thermal power produced in field under highly sufficient solar conditions. Field measurements are recorded for incident solar radiation, produced voltage, current and temperature at several time intervals during sun shine period. The thermal power system has been calculated using fundamental principles of heat transfer. The study shows that solar power for considered module could not attain the empirical peak power irrespective to maximum value of direct incident solar radiation and maximum temperature gained. A loss of about 6% of power can be considered as the difference between field measurements and the manufacturer's indicated empirical value. Solar cell exhibits 94% efficiency in comparison with manufacturer's provided data, and is 3'% more efficient in thermal energy production than in electrical power extraction for hot-dry climate conditions.

  4. CD169+ macrophages are sufficient for priming of CTLs with specificities left out by cross-priming dendritic cells.

    PubMed

    Bernhard, Caroline A; Ried, Christine; Kochanek, Stefan; Brocker, Thomas

    2015-04-28

    Dendritic cells (DCs) are considered the most potent antigen-presenting cells (APCs), which directly prime or cross-prime MHC I-restricted cytotoxic T cells (CTLs). However, recent evidence suggests the existence of other, as-yet unidentified APCs also able to prime T cells. To identify those APCs, we used adenoviral (rAd) vectors, which do not infect DCs but selectively accumulate in CD169(+) macrophages (MPs). In mice that lack DCs, infection of CD169(+) MPs was sufficient to prime CTLs specific for all epitopes tested. In contrast, CTL responses relying exclusively on cross-presenting DCs were biased to selected strong MHC I-binding peptides only. When both DCs and MPs were absent, no CTL responses could be elicited. Therefore, CD169(+) MPs can be considered APCs that significantly contribute to CTL responses.

  5. Low-level deficits in beat perception: neither necessary nor sufficient for explaining developmental dyslexia in a consistent orthography.

    PubMed

    Papadopoulos, Timothy C; Georgiou, George K; Parrila, Rauno K

    2012-01-01

    This article reports two different studies examining the theoretical account of low-level deficits in beat perception as an alternative explanation of developmental dyslexia in Greek, an orthographically consistent language. Study I examined the relationship of amplitude rise time and frequency discrimination with measures of phonological processing, working memory, and reading fluency in a large unselected sample of Grade 4 children. Study II examined the presence of beat perception deficits in groups of Grade 2, 4, and 6 children with dyslexia and their chronological age controls. The results provided no evidence to support meaningful associations between beat perception tasks and reading or the theoretical account of beat perception deficits as a sufficient explanation or contributing factor to dyslexia. Implications on the importance of auditory processing in reading in orthographically consistent languages are discussed.

  6. Swift residue-screening identifies key N-glycosylated asparagines sufficient for surface expression of neuroglycoprotein Lingo-1.

    PubMed

    Zhong, Xiaotian; Pocas, Jennifer; Liu, Yan; Wu, Paul W; Mosyak, Lidia; Somers, Will; Kriz, Ron

    2009-03-18

    Advances in genomics and proteomics have generated the needs for the efficient identification of key residues for structure and function of target proteins. Here we report the utilization of a new residue-screening approach, which combines a mammalian high-throughput transient expression system with a PCR-based expression cassette, for the study of the post-translational modification. Applying this approach results in a quick identification of essential N-glycosylation sites of a heavily glycosylated neuroglycoprotein Lingo-1, which are sufficient for the support of its surface expression. These key N-glycosylated sites uniquely locate on the concave surface of the elongated arc-shape structure of the leucine-rich repeat domain. The swift residue-screening approach may provide a new strategy for structural and functional analysis.

  7. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  8. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    SciTech Connect

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-11-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same.

  9. Synaptic vesicle exocytosis and increased cytosolic calcium are both necessary but not sufficient for activity-dependent bulk endocytosis.

    PubMed

    Morton, Andrew; Marland, Jamie R K; Cousin, Michael A

    2015-08-01

    Activity-dependent bulk endocytosis (ADBE) is the dominant synaptic vesicle (SV) endocytosis mode in central nerve terminals during intense neuronal activity. By definition this mode is triggered by neuronal activity; however, key questions regarding its mechanism of activation remain unaddressed. To determine the basic requirements for ADBE triggering in central nerve terminals, we decoupled SV fusion events from activity-dependent calcium influx using either clostridial neurotoxins or buffering of intracellular calcium. ADBE was monitored both optically and morphologically by observing uptake of the fluid phase markers tetramethylrhodamine-dextran and horse radish peroxidase respectively. Ablation of SV fusion with tetanus toxin resulted in the arrest of ADBE, but had no effect on other calcium-dependent events such as activity-dependent dynamin I dephosphorylation, indicating that SV exocytosis is necessary for triggering. Furthermore, the calcium chelator EGTA abolished ADBE while leaving SV exocytosis intact, demonstrating that ADBE is triggered by intracellular free calcium increases outside the active zone. Activity-dependent dynamin I dephosphorylation was also arrested in EGTA-treated neurons, consistent with its proposed role in triggering ADBE. Thus, SV fusion and increased cytoplasmic free calcium are both necessary but not sufficient individually to trigger ADBE. Activity-dependent bulk endocytosis (ADBE) is the dominant synaptic vesicle (SV) endocytosis mode in central nerve terminals during intense neuronal activity. To determine the minimal requirements for ADBE triggering, we decoupled SV fusion events from activity-dependent calcium influx using either clostridial neurotoxins or buffering of intracellular calcium. We found that SV fusion and increased cytoplasmic free calcium are both necessary but not sufficient to trigger ADBE.

  10. A chemical biology approach demonstrates G protein βγ subunits are sufficient to mediate directional neutrophil chemotaxis.

    PubMed

    Surve, Chinmay R; Lehmann, David; Smrcka, Alan V

    2014-06-20

    Our laboratory has identified a number of small molecules that bind to G protein βγ subunits (Gβγ) by competing for peptide binding to the Gβγ "hot spot." M119/Gallein were identified as inhibitors of Gβγ subunit signaling. Here we examine the activity of another molecule identified in this screen, 12155, which we show that in contrast to M119/Gallein had no effect on Gβγ-mediated phospholipase C or phosphoinositide 3-kinase (PI3K) γ activation in vitro. Also in direct contrast to M119/Gallein, 12155 caused receptor-independent Ca(2+) release, and activated other downstream targets of Gβγ including extracellular signal regulated kinase (ERK), protein kinase B (Akt) in HL60 cells differentiated to neutrophils. We show that 12155 releases Gβγ in vitro from Gαi1β1γ2 heterotrimers by causing its dissociation from GαGDP without inducing nucleotide exchange in the Gα subunit. We used this novel probe to examine the hypothesis that Gβγ release is sufficient to direct chemotaxis of neutrophils in the absence of receptor or G protein α subunit activation. 12155 directed chemotaxis of HL60 cells and primary neutrophils in a transwell migration assay with responses similar to those seen for the natural chemotactic peptide n-formyl-Met-Leu-Phe. These data indicate that release of free Gβγ is sufficient to drive directional chemotaxis in a G protein-coupled receptor signaling-independent manner.

  11. ABA signaling is necessary but not sufficient for RD29B transcriptional memory during successive dehydration stresses in Arabidopsis thaliana.

    PubMed

    Virlouvet, Laetitia; Ding, Yong; Fujii, Hiroaki; Avramova, Zoya; Fromm, Michael

    2014-07-01

    Plants subjected to a prior dehydration stress were seen to have altered transcriptional responses during a subsequent dehydration stress for up to 5 days after the initial stress. The abscisic acid (ABA) inducible RD29B gene of Arabidopsis thaliana was strongly induced after the first stress and displayed transcriptional memory with transcript levels nine-fold higher during the second dehydration stress. These increased transcript levels were due to an increased rate of transcription and are associated with an altered chromatin template during the recovery interval between the dehydration stresses. Here we use a combination of promoter deletion/substitutions, mutants in the trans-acting transcription factors and their upstream protein kinases, and treatments with exogenous ABA or dehydration stress to advance our understanding of the features required for transcriptional memory of RD29B. ABA Response Elements (ABREs) are sufficient to confer transcriptional memory on a minimal promoter, although there is a context effect from flanking sequences. Different mutations in Snf1 Related Protein Kinase 2 (SnRK2) genes positively and negatively affected the response, suggesting that this effect is important for transcriptional memory. Although exogenous ABA treatments could prime transcriptional memory, a second ABA treatment was not sufficient to activate transcriptional memory. Therefore, we concluded that transcriptional memory requires ABA and an ABA-independent factor that is induced or activated by a subsequent dehydration stress and directly or indirectly results in a more active RD29B chromatin template. These results advance our knowledge of the cis- and trans-acting factors that are required for transcriptional memory of RD29B.

  12. Increased long-latency reflex activity as a sufficient explanation for childhood hypertonic dystonia: a neuromorphic emulation study

    NASA Astrophysics Data System (ADS)

    Sohn, Won J.; Niu, Chuanxin M.; Sanger, Terence D.

    2015-06-01

    Objective. Childhood dystonia is a movement disorder that interferes with daily movements and can have a devastating effect on quality of life for children and their families. Although injury to basal ganglia is associated with dystonia, the neurophysiological mechanisms leading to the clinical manifestations of dystonia are not understood. Previous work suggested that long-latency stretch reflex (LLSR) is hyperactive in children with hypertonia due to secondary dystonia. We hypothesize that abnormal activity in motor cortices may cause an increase in the LLSR leading to hypertonia. Approach. We modeled two possibilities of hyperactive LLSR by either creating a tonic involuntary drive to cortex, or increasing the synaptic gain in cortical neurons. Both models are emulated using programmable very-large-scale-integrated-circuit hardware to test their sufficiency for producing dystonic symptoms. The emulation includes a joint with two Hill-type muscles, realistic muscle spindles, and 2,304 Izhikevich-type spiking neurons. The muscles are regulated by a monosynaptic spinal pathway with 32 ms delay and a long-latency pathway with 64 ms loop-delay representing transcortical/supra-spinal connections. Main results. When the limb is passively stretched, both models produce involuntary resistance with increased antagonist EMG responses similar to human data; also the muscle relaxation is delayed similar to human data. Both models predict reduced range of motion in voluntary movements. Significance. Although our model is a highly simplified and limited representation of reflex pathways, it shows that increased activity of the LLSR is by itself sufficient to cause many of the features of hypertonic dystonia.

  13. The delta-opioid receptor is sufficient, but not necessary, for spinal opioid-adrenergic analgesic synergy.

    PubMed

    Chabot-Doré, Anne-Julie; Millecamps, Magali; Stone, Laura S

    2013-12-01

    Spinal administration of opioid and α2-adrenergic receptor (α2AR) agonists produces analgesia, and agonists interact synergistically when coadministered. The molecular mechanism underlying this synergy is largely unknown. Pharmacological studies have identified both the delta and the mu-opioid receptors (DOR and MOR) as candidate receptors capable of interacting synergistically with α2AR agonists. However, recent studies attribute the antinociceptive effect of DOR agonists to actions at the MOR, calling the role of DOR in opioid-adrenergic synergy into question. Other studies suggesting that DOR is implicated in morphine antinociception raise the possibility that DOR is nonetheless required for morphine synergy with α2AR agonists. This study aimed to determine whether DOR activation is sufficient and necessary to mediate opioid-adrenergic synergistic interactions in the spinal cord. The antinociceptive effects of clonidine, [D-Ala(2)]-deltorphin II (DeltII), morphine, and [D-Ala(2), N-Me-Phe(4), Gly-ol(5)]-enkephalin (DAMGO) were evaluated using the substance P (SP) behavioral assay in wild type (WT) and DOR-knockout (KO) mice. Opioid-adrenergic drug interactions were evaluated after spinal coadministration of clonidine with DeltII, morphine, or DAMGO. Isobolographic analyses of dose-response curves determined whether interactions were synergistic or additive. The absence of DeltII antinociceptive efficacy in DOR-KO confirmed its selectivity in the SP assay. Although DeltII+clonidine interacted synergistically in WT mice, no interaction with clonidine was observed in DOR-KO mice. Clonidine was synergistic with morphine in both mouse strains. DAMGO did not synergize with clonidine in either strain. These findings confirm that although other opioid receptors can interact synergistically with α2AR agonists, DOR is sufficient for spinal opioid-adrenergic interactions.

  14. Orbital apocenter is not a sufficient condition for HST/STIS detection of Europa’s water vapor aurora

    PubMed Central

    Retherford, Kurt D.; Saur, Joachim; Strobel, Darrell F.; Feldman, Paul D.; McGrath, Melissa A.; Nimmo, Francis

    2014-01-01

    We report far-ultraviolet observations of Jupiter’s moon Europa taken by Space Telescope Imaging Spectrograph (STIS) of the Hubble Space Telescope (HST) in January and February 2014 to test the hypothesis that the discovery of a water vapor aurora in December 2012 by local hydrogen (H) and oxygen (O) emissions with the STIS originated from plume activity possibly correlated with Europa’s distance from Jupiter through tidal stress variations. The 2014 observations were scheduled with Europa near the apocenter similar to the orbital position of its previous detection. Tensile stresses on south polar fractures are expected to be highest in this orbital phase, potentially maximizing the probability for plume activity. No local H and O emissions were detected in the new STIS images. In the south polar region where the emission surpluses were observed in 2012, the brightnesses are sufficiently low in the 2014 images to be consistent with any H2O abundance from (0–5)×1015 cm−2. Large high-latitude plumes should have been detectable by the STIS, independent of the observing conditions and geometry. Because electron excitation of water vapor remains the only viable explanation for the 2012 detection, the new observations indicate that although the same orbital position of Europa for plume activity may be a necessary condition, it is not a sufficient condition. However, the December 2012 detection of coincident HI Lyman-α and OI 1304-Å emission surpluses in an ∼200-km high region well separated above Europa’s limb is a firm result and not invalidated by our 2014 STIS observations. PMID:25404343

  15. Protease-activated receptor 2 activation is sufficient to induce the transition to a chronic pain state.

    PubMed

    Tillu, Dipti V; Hassler, Shayne N; Burgos-Vega, Carolina C; Quinn, Tammie L; Sorge, Robert E; Dussor, Gregory; Boitano, Scott; Vagner, Josef; Price, Theodore J

    2015-05-01

    Protease-activated receptor type 2 (PAR2) is known to play an important role in inflammatory, visceral, and cancer-evoked pain based on studies using PAR2 knockout (PAR2(-/-)) mice. We have tested the hypothesis that specific activation of PAR2 is sufficient to induce a chronic pain state through extracellular signal-regulated kinase (ERK) signaling to protein synthesis machinery. We have further tested whether the maintenance of this chronic pain state involves a brain-derived neurotrophic factor (BDNF)/tropomyosin-related kinase B (trkB)/atypical protein kinase C (aPKC) signaling axis. We observed that intraplantar injection of the novel highly specific PAR2 agonist, 2-aminothiazol-4-yl-LIGRL-NH2 (2-at), evokes a long-lasting acute mechanical hypersensitivity (median effective dose ∼12 pmoles), facial grimacing, and causes robust hyperalgesic priming as revealed by a subsequent mechanical hypersensitivity and facial grimacing to prostaglandin E2 (PGE2) injection. The promechanical hypersensitivity effect of 2-at is completely absent in PAR2(-/-) mice as is hyperalgesic priming. Intraplantar injection of the upstream ERK inhibitor, U0126, and the eukaryotic initiation factor (eIF) 4F complex inhibitor, 4EGI-1, prevented the development of acute mechanical hypersensitivity and hyperalgesic priming after 2-at injection. Systemic injection of the trkB antagonist ANA-12 similarly inhibited PAR2-mediated mechanical hypersensitivity, grimacing, and hyperalgesic priming. Inhibition of aPKC (intrathecal delivery of ZIP) or trkB (systemic administration of ANA-12) after the resolution of 2-at-induced mechanical hypersensitivity reversed the maintenance of hyperalgesic priming. Hence, PAR2 activation is sufficient to induce neuronal plasticity leading to a chronic pain state, the maintenance of which is dependent on a BDNF/trkB/aPKC signaling axis.

  16. A Small Conserved Domain in the Yeast Spa2p Is Necessary and Sufficient for Its Polarized Localization

    PubMed Central

    Arkowitz, Robert A.; Lowe, Nick

    1997-01-01

    SPA2 encodes a yeast protein that is one of the first proteins to localize to sites of polarized growth, such as the shmoo tip and the incipient bud. The dynamics and requirements for Spa2p localization in living cells are examined using Spa2p green fluorescent protein fusions. Spa2p localizes to one edge of unbudded cells and subsequently is observable in the bud tip. Finally, during cytokinesis Spa2p is present as a ring at the mother–daughter bud neck. The bud emergence mutants bem1 and bem2 and mutants defective in the septins do not affect Spa2p localization to the bud tip. Strikingly, a small domain of Spa2p comprised of 150 amino acids is necessary and sufficient for localization to sites of polarized growth. This localization domain and the amino terminus of Spa2p are essential for its function in mating. Searching the yeast genome database revealed a previously uncharacterized protein which we name, Sph1p (Spa2p homolog), with significant homology to the localization domain and amino terminus of Spa2p. This protein also localizes to sites of polarized growth in budding and mating cells. SPH1, which is similar to SPA2, is required for bipolar budding and plays a role in shmoo formation. Overexpression of either Spa2p or Sph1p can block the localization of either protein fused to green fluorescent protein, suggesting that both Spa2p and Sph1p bind to and are localized by the same component. The identification of a 150–amino acid domain necessary and sufficient for localization of Spa2p to sites of polarized growth and the existence of this domain in another yeast protein Sph1p suggest that the early localization of these proteins may be mediated by a receptor that recognizes this small domain. PMID:9214378

  17. SU-E-J-245: Is Off-Line Adaptive Radiotherapy Sufficient for Head and Neck Cancer with IGRT?

    SciTech Connect

    Li, Z; Shang, Q; Liu, H; Greskovich, J; Koyfman, S; Xia, P

    2014-06-01

    Purpose: Radiation doses delivered to patients with head and neck cancer (HN) may deviate from the planned doses because of variations in patient setup and anatomy. This study was to evaluate whether off-line Adaptive Radiotherapy (ART) is sufficient. Methods: Ten HN patients, who received IMRT under daily imaging guidance using CT-on-rail/KV-CBCT, were randomly selected for this study. For each patient, the daily treatment setup was corrected with translational only directions. Sixty weekly verification CTs were retrospectively analyzed. On these weekly verification CTs, the tumor volumes and OAR contours were manually delineated by a physician. With the treatment iso-center placed on the verification CTs, according to the recorded clinical shifts, the treatment beams from the original IMRT plans were then applied to these CTs to calculate the delivered doses. The electron density of the planning CTs and weekly CTs were overridden to 1 g/cm3. Results: Among 60 fractions, D99 of the CTVs in 4 fractions decreased more than 5% of the planned doses. The maximum dose of the spinal cord exceeded 10% of the planned values in 2 fractions. A close examination indicated that the dose discrepancy in these 6 fractions was due to patient rotations, especially shoulder rotations. After registering these 6 CTs with the planning CT allowing six degree of freedoms, the maximum rotations around 3 axes were > 1.5° for these fractions. With rotation setup errors removed, 4 out of 10 patients still required off-line ART to accommodate anatomical changes. Conclusion: A significant shoulder rotations were observed in 10% fractions, requiring patient re-setup. Off-line ART alone is not sufficient to correct for random variations of patient position, although ART is effective to adapt to patients' gradual anatomic changes. Re-setup or on-line ART may be considered for patients with large deviations detected early by daily IGRT images. The study is supported in part by Siemens Medical

  18. A 48-amino-acid region of influenza A virus PB1 protein is sufficient for complex formation with PA.

    PubMed Central

    Pérez, D R; Donis, R O

    1995-01-01

    The concerted activity of four influenza virus proteins, PB1, PB2, PA, and NP is necessary and sufficient for transcription and replication of the viral genome in the nucleus of the cell. The three P proteins form a heterotrimeric complex in virions and the nuclei of infected cells. Biochemical analyses have shown specific interactions between PB1 and PA as well as PB1 and PB2, indicating that PB1 is the backbone of the complex. To identify domains of PB1 involved in binding PA, a two-hybrid system adapted for mammalian cells (CV-1) was implemented. First, we demonstrate the ability of PB1 and PA to interact efficiently and specifically in reciprocal combinations of two-hybrid reporter moieties, suggesting that transcription factor module fusion did not interfere sterically or allosterically with interaction between PB1 and PA. Subsequent analyses with a set of chimeric proteins with truncations of the PB1 C termini, N termini, or internal sequences led to the identification of a region at the N terminus of PB1 responsible for binding PA. Forty-eight amino acids at the N terminus of PB1 were sufficient for binding PA in vivo with the same efficiency as the complete PB1 protein. This region of PB1 responsible for binding PA does not overlap with other previously described PB1 functional domains involved in nuclear transport and RNA polymerization. We propose to name this region of interaction with PA domain alpha, to differentiate it from other functional domains described for PB1. PMID:7474111

  19. Orbital apocenter is not a sufficient condition for HST/STIS detection of Europa's water vapor aurora.

    PubMed

    Roth, Lorenz; Retherford, Kurt D; Saur, Joachim; Strobel, Darrell F; Feldman, Paul D; McGrath, Melissa A; Nimmo, Francis

    2014-12-02

    We report far-ultraviolet observations of Jupiter's moon Europa taken by Space Telescope Imaging Spectrograph (STIS) of the Hubble Space Telescope (HST) in January and February 2014 to test the hypothesis that the discovery of a water vapor aurora in December 2012 by local hydrogen (H) and oxygen (O) emissions with the STIS originated from plume activity possibly correlated with Europa's distance from Jupiter through tidal stress variations. The 2014 observations were scheduled with Europa near the apocenter similar to the orbital position of its previous detection. Tensile stresses on south polar fractures are expected to be highest in this orbital phase, potentially maximizing the probability for plume activity. No local H and O emissions were detected in the new STIS images. In the south polar region where the emission surpluses were observed in 2012, the brightnesses are sufficiently low in the 2014 images to be consistent with any H2O abundance from (0-5)×10(15) cm(-2). Large high-latitude plumes should have been detectable by the STIS, independent of the observing conditions and geometry. Because electron excitation of water vapor remains the only viable explanation for the 2012 detection, the new observations indicate that although the same orbital position of Europa for plume activity may be a necessary condition, it is not a sufficient condition. However, the December 2012 detection of coincident HI Lyman-α and OI 1304-Å emission surpluses in an ∼200-km high region well separated above Europa's limb is a firm result and not invalidated by our 2014 STIS observations.

  20. A Simple Negative Interaction in the Positive Transcriptional Feedback of a Single Gene Is Sufficient to Produce Reliable Oscillations

    PubMed Central

    Miró-Bueno, Jesús M.; Rodríguez-Patón, Alfonso

    2011-01-01

    Negative and positive transcriptional feedback loops are present in natural and synthetic genetic oscillators. A single gene with negative transcriptional feedback needs a time delay and sufficiently strong nonlinearity in the transmission of the feedback signal in order to produce biochemical rhythms. A single gene with only positive transcriptional feedback does not produce oscillations. Here, we demonstrate that this single-gene network in conjunction with a simple negative interaction can also easily produce rhythms. We examine a model comprised of two well-differentiated parts. The first is a positive feedback created by a protein that binds to the promoter of its own gene and activates the transcription. The second is a negative interaction in which a repressor molecule prevents this protein from binding to its promoter. A stochastic study shows that the system is robust to noise. A deterministic study identifies that the dynamics of the oscillator are mainly driven by two types of biomolecules: the protein, and the complex formed by the repressor and this protein. The main conclusion of this paper is that a simple and usual negative interaction, such as degradation, sequestration or inhibition, acting on the positive transcriptional feedback of a single gene is a sufficient condition to produce reliable oscillations. One gene is enough and the positive transcriptional feedback signal does not need to activate a second repressor gene. This means that at the genetic level an explicit negative feedback loop is not necessary. The model needs neither cooperative binding reactions nor the formation of protein multimers. Therefore, our findings could help to clarify the design principles of cellular clocks and constitute a new efficient tool for engineering synthetic genetic oscillators. PMID:22205920

  1. A simple negative interaction in the positive transcriptional feedback of a single gene is sufficient to produce reliable oscillations.

    PubMed

    Miró-Bueno, Jesús M; Rodríguez-Patón, Alfonso

    2011-01-01

    Negative and positive transcriptional feedback loops are present in natural and synthetic genetic oscillators. A single gene with negative transcriptional feedback needs a time delay and sufficiently strong nonlinearity in the transmission of the feedback signal in order to produce biochemical rhythms. A single gene with only positive transcriptional feedback does not produce oscillations. Here, we demonstrate that this single-gene network in conjunction with a simple negative interaction can also easily produce rhythms. We examine a model comprised of two well-differentiated parts. The first is a positive feedback created by a protein that binds to the promoter of its own gene and activates the transcription. The second is a negative interaction in which a repressor molecule prevents this protein from binding to its promoter. A stochastic study shows that the system is robust to noise. A deterministic study identifies that the dynamics of the oscillator are mainly driven by two types of biomolecules: the protein, and the complex formed by the repressor and this protein. The main conclusion of this paper is that a simple and usual negative interaction, such as degradation, sequestration or inhibition, acting on the positive transcriptional feedback of a single gene is a sufficient condition to produce reliable oscillations. One gene is enough and the positive transcriptional feedback signal does not need to activate a second repressor gene. This means that at the genetic level an explicit negative feedback loop is not necessary. The model needs neither cooperative binding reactions nor the formation of protein multimers. Therefore, our findings could help to clarify the design principles of cellular clocks and constitute a new efficient tool for engineering synthetic genetic oscillators.

  2. 49 CFR 40.193 - What happens when an employee does not provide a sufficient amount of urine for a drug test?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... sufficient amount of urine for a drug test? 40.193 Section 40.193 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Drug Tests § 40.193 What happens when an employee does not provide a sufficient amount of urine for a drug...

  3. 49 CFR 40.193 - What happens when an employee does not provide a sufficient amount of urine for a drug test?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... sufficient amount of urine for a drug test? 40.193 Section 40.193 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Drug Tests § 40.193 What happens when an employee does not provide a sufficient amount of urine for a drug...

  4. 49 CFR 40.193 - What happens when an employee does not provide a sufficient amount of urine for a drug test?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... sufficient amount of urine for a drug test? 40.193 Section 40.193 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Drug Tests § 40.193 What happens when an employee does not provide a sufficient amount of urine for a drug...

  5. 49 CFR 40.193 - What happens when an employee does not provide a sufficient amount of urine for a drug test?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... sufficient amount of urine for a drug test? 40.193 Section 40.193 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Drug Tests § 40.193 What happens when an employee does not provide a sufficient amount of urine for a drug...

  6. 49 CFR 40.193 - What happens when an employee does not provide a sufficient amount of urine for a drug test?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... sufficient amount of urine for a drug test? 40.193 Section 40.193 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Drug Tests § 40.193 What happens when an employee does not provide a sufficient amount of urine for a drug...

  7. 49 CFR 40.275 - What is the effect of procedural problems that are not sufficient to cancel an alcohol test?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... in Alcohol Testing § 40.275 What is the effect of procedural problems that are not sufficient to... 49 Transportation 1 2010-10-01 2010-10-01 false What is the effect of procedural problems that are not sufficient to cancel an alcohol test? 40.275 Section 40.275 Transportation Office of the...

  8. A simple, sufficient, and consistent method to score the status of threats and demography of imperiled species.

    PubMed

    Malcom, Jacob W; Webber, Whitney M; Li, Ya-Wei

    2016-01-01

    Managers of large, complex wildlife conservation programs need information on the conservation status of each of many species to help strategically allocate limited resources. Oversimplifying status data, however, runs the risk of missing information essential to strategic allocation. Conservation status consists of two components, the status of threats a species faces and the species' demographic status. Neither component alone is sufficient to characterize conservation status. Here we present a simple key for scoring threat and demographic changes for species using detailed information provided in free-form textual descriptions of conservation status. This key is easy to use (simple), captures the two components of conservation status without the cost of more detailed measures (sufficient), and can be applied by different personnel to any taxon (consistent). To evaluate the key's utility, we performed two analyses. First, we scored the threat and demographic status of 37 species recently recommended for reclassification under the Endangered Species Act (ESA) and 15 control species, then compared our scores to two metrics used for decision-making and reports to Congress. Second, we scored the threat and demographic status of all non-plant ESA-listed species from Florida (54 spp.), and evaluated scoring repeatability for a subset of those. While the metrics reported by the U.S. Fish and Wildlife Service (FWS) are often consistent with our scores in the first analysis, the results highlight two problems with the oversimplified metrics. First, we show that both metrics can mask underlying demographic declines or threat increases; for example, ∼40% of species not recommended for reclassification had changes in threats or demography. Second, we show that neither metric is consistent with either threats or demography alone, but conflates the two. The second analysis illustrates how the scoring key can be applied to a substantial set of species to understand overall

  9. A simple, sufficient, and consistent method to score the status of threats and demography of imperiled species

    PubMed Central

    Webber, Whitney M.; Li, Ya-Wei

    2016-01-01

    Managers of large, complex wildlife conservation programs need information on the conservation status of each of many species to help strategically allocate limited resources. Oversimplifying status data, however, runs the risk of missing information essential to strategic allocation. Conservation status consists of two components, the status of threats a species faces and the species’ demographic status. Neither component alone is sufficient to characterize conservation status. Here we present a simple key for scoring threat and demographic changes for species using detailed information provided in free-form textual descriptions of conservation status. This key is easy to use (simple), captures the two components of conservation status without the cost of more detailed measures (sufficient), and can be applied by different personnel to any taxon (consistent). To evaluate the key’s utility, we performed two analyses. First, we scored the threat and demographic status of 37 species recently recommended for reclassification under the Endangered Species Act (ESA) and 15 control species, then compared our scores to two metrics used for decision-making and reports to Congress. Second, we scored the threat and demographic status of all non-plant ESA-listed species from Florida (54 spp.), and evaluated scoring repeatability for a subset of those. While the metrics reported by the U.S. Fish and Wildlife Service (FWS) are often consistent with our scores in the first analysis, the results highlight two problems with the oversimplified metrics. First, we show that both metrics can mask underlying demographic declines or threat increases; for example, ∼40% of species not recommended for reclassification had changes in threats or demography. Second, we show that neither metric is consistent with either threats or demography alone, but conflates the two. The second analysis illustrates how the scoring key can be applied to a substantial set of species to understand

  10. An 11-kDa form of human immunodeficiency virus protease expressed in Escherichia coli is sufficient for enzymatic activity.

    PubMed Central

    Graves, M C; Lim, J J; Heimer, E P; Kramer, R A

    1988-01-01

    In order to define the protease domain of human immunodeficiency virus 1, various regions of the pol open reading frame were cloned and expressed in Escherichia coli. Antiserum directed against the conserved retroviral protease active site was used to identify pol precursor and processed species containing the presumed protease domain. The smallest product that accumulates is about 11 kDa as measured by NaDodSO4/PAGE. This size agrees with that predicted from the presence in this region of two Phe-Pro sequences, which is one of the cleavage sites recognized by HIV protease. DNA encoding only the predicted 11-kDa protein was cloned, bypassing the need for autoprocessing, and the protein was expressed to a high level in E. coli. This form is active as demonstrated by its ability to specifically cleave protease-deficient pol protein in vivo in E. coli. Extracts of E. coli containing the 11-kDa protease also process human immunodeficiency virus gag substrates in vitro. These results demonstrate that the 11-kDa protease is sufficient for enzymatic activity and are consistent with a major role for this form in virus maturation. Images PMID:3282230

  11. Is floral divergence sufficient to maintain species boundaries upon secondary contact in Mediterranean food-deceptive orchids?

    PubMed Central

    Zitari, A; Scopece, G; Helal, A N; Widmer, A; Cozzolino, S

    2012-01-01

    Analyzing the processes that determine whether species boundaries are maintained on secondary contact may shed light on the early phase of speciation. In Anacamptis morio and Anacamptis longicornu, two Mediterranean orchid sister-species, we used molecular and morphological analyses, together with estimates of pollination success and experimental crosses, to assess whether floral isolation can shelter the species' genomes from genetic admixture on secondary contact. We found substantial genetic and morphological homogenization in sympatric populations in combination with an apparent lack of postmating isolation. We further detected asymmetric introgression in the sympatric populations and an imbalance in cytotype representation, which may be due either to a difference in flowering phenology or else be a consequence of cytonuclear incompatibilities. Estimates of genetic clines for markers across sympatric zones revealed markers that significantly deviated from neutral expectations. We observed a significant correlation between spur length and reproductive success in sympatric populations, which may suggest that directional selection is the main cause of morphological differentiation in this species pair. Our results suggest that allopatric divergence has not led to the evolution of sufficient reproductive isolation to prevent genomic admixture on secondary contact in this orchid species pair. PMID:21792224

  12. CXCL12 N-terminal end is sufficient to induce chemotaxis and proliferation of neural stem/progenitor cells.

    PubMed

    Filippo, Thais R M; Galindo, Layla T; Barnabe, Gabriela F; Ariza, Carolina B; Mello, Luiz E; Juliano, Maria A; Juliano, Luiz; Porcionatto, Marimélia A

    2013-09-01

    Neural stem/progenitor cells (NSC) respond to injury after brain injuries secreting IL-1, IL-6, TNF-α, IL-4 and IL-10, as well as chemokine members of the CC and CXC ligand families. CXCL12 is one of the chemokines secreted at an injury site and is known to attract NSC-derived neuroblasts, cells that express CXCL12 receptor, CXCR4. Activation of CXCR4 by CXCL12 depends on two domains located at the N-terminal of the chemokine. In the present work we aimed to investigate if the N-terminal end of CXCL12, where CXCR4 binding and activation domains are located, was sufficient to induce NSC-derived neuroblast chemotaxis. Our data show that a synthetic peptide analogous to the first 21 amino acids of the N-terminal end of CXCL12, named PepC-C (KPVSLSYRCPCRFFESHIARA), is able to promote chemotaxis of neuroblasts in vivo, and stimulate chemotaxis and proliferation of CXCR4+ cells in vitro, without affecting NSC fate. We also show that PepC-C upregulates CXCL12 expression in vivo and in vitro. We suggest the N-terminal end of CXCL12 is responsible for a positive feedback loop to maintain a gradient of CXCL12 that attracts neuroblasts from the subventricular zone into an injury site.

  13. Having excess levels of PCSK9 is not sufficient to induce complex formation between PCSK9 and the LDL receptor.

    PubMed

    Wooten, Catherine J; Adcock, Audrey F; Agina-Obu, DaTonye I; Lopez, Dayami

    2014-03-01

    Proprotein convertase subtilisin/kexin-9 (PCSK9) acts mainly by forming complexes with the LDL receptor at the cell surface, which are then degraded in the lysosome. Studies were performed to determine whether excess levels of PCSK9 was sufficient to induce PCSK9/LDL receptor complex formation in human hepatocyte-like C3A cells. It was demonstrated using ELISA that instead of considering the overall levels of PCSK9 protein that is produced in response to certain treatment, what is critical is how much PCSK9 is actually capable of forming complexes. Despite the high levels, most of the PCSK9 produced as a result of incubating cells with a medium supplemented with BD™ MITO+ serum extender (MITO+ medium) appeared to be inhibited by a secreted factor. Having lower levels of PCSK9/LDL receptor complexes did not prevent an increase in the degradation rate of LDL receptors in MITO+ medium as compared to fetal bovine serum (FBS) containing medium (Regular medium), an effect that did not correlate with an increase in protein levels of the inducible degrader of LDL receptors (IDOL), as demonstrated using Western blotting analysis. Additional studies are required to determine the exact mechanism(s) for the degradation of the LDL receptor and/or to identify the secreted inhibitor of PCSK9.

  14. Identification of a subdomain of CENP-B that is necessary and sufficient for localization to the human centromere

    PubMed Central

    1992-01-01

    We have combined in vivo and in vitro approaches to investigate the function of CENP-B, a major protein of human centromeric heterochromatin. Expression of epitope-tagged deletion derivatives of CENP-B in HeLa cells revealed that a single domain less than 158 residues from the amino terminus of the protein is sufficient to localize CENP-B to centromeres. Centromere localization was abolished if as few as 28 amino acids were removed from the amino terminus of CENP-B. The centromere localization signal of CENP-B can function in an autonomous fashion, relocating a fused bacterial enzyme to centromeres. The centromere localization domain of CENP-B specifically binds in vitro to a subset of alpha-satellite DNA monomers. These results suggest that the primary mechanism for localization of CENP-B to centromeres involves the recognition of a DNA sequence found at centromeres. Analysis of the distribution of this sequence in alpha- satellite DNA suggests that CENP-B binding may have profound effects on chromatin structure at centromeres. PMID:1740467

  15. Mutant HSPB1 overexpression in neurons is sufficient to cause age-related motor neuronopathy in mice

    PubMed Central

    Srivastava, Amit K.; Renusch, Samantha R.; Naiman, Nicole E.; Gu, Shuping; Sneh, Amita; Arnold, W. David; Sahenk, Zarife; Kolb, Stephen J.

    2012-01-01

    The small heat shock protein HSPB1 is a multifunctional, α-crystallin-based protein that has been shown to be neuroprotective in animal models of motor neuron disease and peripheral nerve injury. Missense mutations in HSPB1 result in axonal Charcot-Marie-Tooth disease with minimal sensory involvement (CMT2F) and distal hereditary motor neuropathy type 2 (dHMN-II). These disorders are characterized by a selective loss of motor axons in peripheral nerve resulting in distal muscle weakness and often severe disability. To investigate the pathogenic mechanisms of HSPB1 mutations in motor neurons in vivo, we have developed and characterized transgenic PrP-HSPB1 and PrP-HSPB1(R136W) mice. These mice express the human HSPB1 protein throughout the nervous system including in axons of peripheral nerve. Although both mouse strains lacked obvious motor deficits, the PrP-HSPB1(R136W) mice developed an age-dependent motor axonopathy. Mutant mice showed axonal pathology in spinal cord and peripheral nerve with evidence of impaired neurofilament cytoskeleton, associated with organelle accumulation. Accompanying these findings, increases in the number of Schmidt-Lanterman incisures, as evidence of impaired axon-Schwann cell interactions, were present. These observations suggest that overexpression of HSPB1(R136W) in neurons is sufficient to cause pathological and electrophysiological changes in mice that are seen in patients with hereditary motor neuropathy. PMID:22521462

  16. Feasibility studies towards future self-sufficient supply of the 99Mo-99mTc isotopes with Japanese accelerators

    PubMed Central

    NAKAI, Kozi; TAKAHASHI, Naruto; HATAZAWA, Jun; SHINOHARA, Atsushi; HAYASHI, Yoshihiko; IKEDA, Hayato; KANAI, Yasukazu; WATABE, Tadashi; FUKUDA, Mitsuhiro; HATANAKA, Kichiji

    2014-01-01

    In order to establish a self-sufficient supply of 99mTc, we studied feasibilities to produce its parent nucleus, 99Mo, using Japanese accelerators. The daughter nucleus, 99mTc, is indispensable for medical diagnosis. 99Mo has so far been imported from abroad, which is separated from fission products generated in nuclear reactors using enriched 235U fuel. We investigated 99mTc production possibilities based on the following three scenarios: (1) 99Mo production by the (n, 2n) reaction by spallation neutrons at the J-PARC injector, LINAC; (2) 99Mo production by the (p, pn) reaction at Ep = 50–80 MeV proton at the RCNP cyclotron; (3) 99mTc direct production with a 20 MeV proton beam from the PET cyclotron. Among these three scenarios, scenario (1) is for a scheme on a global scale, scenario (2) works in a local area, and both cases take a long time for negotiations. Scenario (3) is attractive because we can use nearly 50 PET cyclotrons in Japan for 99mTc production. We here consider both the advantages and disadvantages among the three scenarios by taking account of the Japanese accelerator situation. PMID:25504230

  17. Administration of Recombinant Soluble Urokinase Receptor Per Se Is Not Sufficient to Induce Podocyte Alterations and Proteinuria in Mice

    PubMed Central

    Cathelin, Dominique; Placier, Sandrine; Ploug, Michael; Verpont, Marie-Christine; Vandermeersch, Sophie; Luque, Yosu; Hertig, Alexandre; Rondeau, Eric

    2014-01-01

    Circulating levels of soluble forms of urokinase-type plasminogen activator receptor (suPAR) are generally elevated in sera from children and adults with FSGS compared with levels in healthy persons or those with other types of kidney disease. In mice lacking the gene encoding uPAR, forced increases in suPAR concentration result in FSGS-like glomerular lesions and proteinuria. However, whether overexpression of suPAR, per se, contributes to the pathogenesis of FSGS in humans remains controversial. We conducted an independent set of animal experiments in which two different and well characterized forms of recombinant suPAR produced by eukaryotic cells were administered over the short or long term to wild-type (WT) mice. In accordance with the previous study, the delivered suPARs are deposited in the glomeruli. However, such deposition of either form of suPAR in the kidney did not result in increased glomerular proteinuria or altered podocyte architecture. Our findings suggest that glomerular deposits of suPAR caused by elevated plasma levels are not sufficient to engender albuminuria. PMID:24790179

  18. Sufficient utilization of natural fluctuating light intensity is an effective approach of promoting lipid productivity in oleaginous microalgal cultivation outdoors.

    PubMed

    He, Qiaoning; Yang, Haijian; Xu, Liangliang; Xia, Ling; Hu, Chunxiang

    2015-03-01

    The effects of fluctuating intensity of solar radiation on biomass and lipid in oleaginous microalgae are important. However, this topic has not been the subject of studies for a long time. In this study, four oleaginous microalgae from semi-arid areas were screened and cultivated outdoors under different fluctuating intensities. Results showed that the highest lipid productivities and neutral lipid (NL) contents occurred under high fluctuating intensity (HFI), in which 13-20% of the increased NL came from glycolipid transformation without phospholipid conversion. Chlorella sp. L1 and Monoraphidium dybowskii Y2 obtained from biological soil crusts in desert had the largest biomass (137.13, 106.61mgL(-1)d(-1)) and lipid yields (35.06, 32.45mgL(-1)d(-1)) under HFI. The highest areal lipid productivities of 9.06 and 8.95gm(-2)d(-1) and better biodiesel quality were observed under HFI. Accordingly, sufficiently adopting fluctuating light intensity outdoors to culture microalgae was an economic and effective approach.

  19. Approximate approach for optimization space flights with a low thrust on the basis of sufficient optimality conditions

    NASA Astrophysics Data System (ADS)

    Salmin, Vadim V.

    2017-01-01

    Flight mechanics with a low-thrust is a new chapter of mechanics of space flight, considered plurality of all problems trajectory optimization and movement control laws and the design parameters of spacecraft. Thus tasks associated with taking into account the additional factors in mathematical models of the motion of spacecraft becomes increasingly important, as well as additional restrictions on the possibilities of the thrust vector control. The complication of the mathematical models of controlled motion leads to difficulties in solving optimization problems. Author proposed methods of finding approximate optimal control and evaluating their optimality based on analytical solutions. These methods are based on the principle of extending the class of admissible states and controls and sufficient conditions for the absolute minimum. Developed procedures of the estimation enabling to determine how close to the optimal founded solution, and indicate ways to improve them. Authors describes procedures of estimate for approximately optimal control laws for space flight mechanics problems, in particular for optimization flight low-thrust between the circular non-coplanar orbits, optimization the control angle and trajectory movement of the spacecraft during interorbital flights, optimization flights with low-thrust between arbitrary elliptical orbits Earth satellites.

  20. Preventing the degradation of mps1 at centrosomes is sufficient to cause centrosome reduplication in human cells.

    PubMed

    Kasbek, Christopher; Yang, Ching-Hui; Yusof, Adlina Mohd; Chapman, Heather M; Winey, Mark; Fisk, Harold A

    2007-11-01

    Supernumerary centrosomes promote the assembly of abnormal mitotic spindles in many human tumors. In human cells, overexpression of the cyclin-dependent kinase (Cdk)2 partner cyclin A during a prolonged S phase produces extra centrosomes, called centrosome reduplication. Cdk2 activity protects the Mps1 protein kinase from proteasome-mediated degradation, and we demonstrate here that Mps1 mediates cyclin A-dependent centrosome reduplication. Overexpression of cyclin A or a brief proteasome inhibition increases the centrosomal levels of Mps1, whereas depletion of Cdk2 leads to the proteasome-dependent loss of Mps1 from centrosomes only. When a Cdk2 phosphorylation site within Mps1 (T468) is mutated to alanine, Mps1 cannot accumulate at centrosomes or participate in centrosome duplication. In contrast, phosphomimetic mutations at T468 or deletion of the region surrounding T468 prevent the proteasome-dependent removal of Mps1 from centrosomes in the absence of Cdk2 activity. Moreover, cyclin A-dependent centrosome reduplication requires Mps1, and these stabilizing Mps1 mutations cause centrosome reduplication, bypassing cyclin A. Together, our data demonstrate that the region surrounding T468 contains a motif that regulates the accumulation of Mps1 at centrosomes. We suggest that phosphorylation of T468 attenuates the degradation of Mps1 at centrosomes and that preventing this degradation is necessary and sufficient to cause centrosome reduplication in human cells.

  1. Necessary, but not sufficient: links between neurocognition, social cognition, and metacognition in schizophrenia are moderated by disorganized symptoms.

    PubMed

    Minor, Kyle S; Lysaker, Paul H

    2014-10-01

    Intact neurocognition has been posited as a necessary, but not sufficient prerequisite for efficient social cognition and metacognition in schizophrenia. Disorganized symptoms likely play a prominent role in these cognitive processes, given the detrimental effects of disorganization on one's ability to synthesize discrete information into an organized whole. However, the relationship between disorganized symptoms and cognitive processes remains unclear. In this study, we examined whether disorganized symptoms: 1) exhibited stronger inverse relationships with cognitive processes than other symptoms, and 2) moderated links between neurocognition and a) social cognition, and b) metacognition. Trained raters assessed psychotic symptoms, neurocognition, social cognition, and metacognition in patients with schizophrenia from a Midwestern VA Medical Center (n=68) using validated, clinician-rated instruments. We observed significantly greater inverse associations with cognitive processes for disorganized compared to reality distortion symptoms; inverse associations with neurocognition and social cognition were significantly greater for disorganized than negative symptoms. Our hypotheses that disorganized symptoms would moderate relationships between neurocognition and a) social cognition, and b) metacognition were also supported. These findings highlight the importance of disorganized symptoms in elucidating links between neurocognition and social cognitive and metacognitive abilities. Future work should assess whether similar findings occur across the schizophrenia-spectrum, and investigate if targeting disorganization can ameliorate social cognitive and metacognitive impairments in schizophrenia.

  2. Principal component analysis reveals the 1000 Genomes Project does not sufficiently cover the human genetic diversity in Asia

    PubMed Central

    Lu, Dongsheng; Xu, Shuhua

    2013-01-01

    The 1000 Genomes Project (1KG) aims to provide a comprehensive resource on human genetic variations. With an effort of sequencing 2,500 individuals, 1KG is expected to cover the majority of the human genetic diversities worldwide. In this study, using analysis of population structure based on genome-wide single nucleotide polymorphisms (SNPs) data, we examined and evaluated the coverage of genetic diversity of 1KG samples with the available genome-wide SNP data of 3,831 individuals representing 140 population samples worldwide. We developed a method to quantitatively measure and evaluate the genetic diversity revealed by population structure analysis. Our results showed that the 1KG does not have sufficient coverage of the human genetic diversity in Asia, especially in Southeast Asia. We suggested a good coverage of Southeast Asian populations be considered in 1KG or a regional effort be initialized to provide a more comprehensive characterization of the human genetic diversity in Asia, which is important for both evolutionary and medical studies in the future. PMID:23847652

  3. The single transmembrane segment of gp210 is sufficient for sorting to the pore membrane domain of the nuclear envelope

    PubMed Central

    1992-01-01

    The glycoprotein gp210 is located in the "pore membrane," a specialized domain of the nuclear envelope to which the nuclear pore complex (NPC) is anchored. gp210 contains a large cisternal domain, a single transmembrane segment (TM), and a COOH-terminal, 58-amino acid residue cytoplasmic tail (CT) (Wozniak, R. W., E. Bartnik, and G. Blobel. 1989. J. Cell Biol. 108:2083-2092; Greber, U. F., A. Senior, and L. Gerace. 1990. EMBO (Eur. Mol. Biol. Organ.) J. 9:1495-1502). To locate determinants for sorting of gp210 to the pore membrane, we constructed various cDNAs coding for wild-type, mutant, and chimeric gp210, and monitored localization of the expressed protein in 3T3 cells by immunofluorescence microscopy using appropriate antibodies. The large cisternal domain of gp210 (95% of its mass) did not reveal any sorting determinants. Surprisingly, the TM of gp210 is sufficient for sorting to the pore membrane. The CT also contains a sorting determinant, but it is weaker than that of the TM. We propose specific lateral association of the transmembrane helices of two proteins to yield either a gp210 homodimer or a heterodimer of gp210 and another protein. The cytoplasmically oriented tails of these dimers may bind cooperatively to the adjacent NPCs. In addition, we demonstrate that gp210 co-localizes with cytoplasmically dispersed nucleoporins, suggesting a cytoplasmic association of these components. PMID:1281815

  4. Murine and Human Tissue-Engineered Esophagus Form from Sufficient Stem/Progenitor Cells and Do Not Require Microdesigned Biomaterials

    PubMed Central

    Spurrier, Ryan Gregory; Speer, Allison L.; Hou, Xiaogang; El-Nachef, Wael N.

    2015-01-01

    Purpose: Tissue-engineered esophagus (TEE) may serve as a therapeutic replacement for absent foregut. Most prior esophagus studies have favored microdesigned biomaterials and yielded epithelial growth alone. None have generated human TEE with mesenchymal components. We hypothesized that sufficient progenitor cells might only require basic support for successful generation of murine and human TEE. Materials and Methods: Esophageal organoid units (EOUs) were isolated from murine or human esophagi and implanted on a polyglycolic acid/poly-l-lactic acid collagen-coated scaffold in adult allogeneic or immune-deficient mice. Alternatively, EOU were cultured for 10 days in vitro prior to implantation. Results: TEE recapitulated all key components of native esophagus with an epithelium and subjacent muscularis. Differentiated suprabasal and proliferative basal layers of esophageal epithelium, muscle, and nerve were identified. Lineage tracing demonstrated that multiple EOU could contribute to the epithelium and mesenchyme of a single TEE. Cultured murine EOU grew as an expanding sphere of proliferative basal cells on a neuromuscular network that demonstrated spontaneous peristalsis in culture. Subsequently, cultured EOU generated TEE. Conclusions: TEE forms after transplantation of mouse and human organ-specific stem/progenitor cells in vivo on a relatively simple biodegradable scaffold. This is a first step toward future human therapies. PMID:25298083

  5. The reductionist paradox: are the laws of chemistry and physics sufficient for the discovery of new drugs?

    NASA Astrophysics Data System (ADS)

    Maggiora, Gerald M.

    2011-08-01

    Reductionism is alive and well in drug-discovery research. In that tradition, we continually improve experimental and computational methods for studying smaller and smaller aspects of biological systems. Although significant improvements continue to be made, are our efforts too narrowly focused? Suppose all error could be removed from these methods, would we then understand biological systems sufficiently well to design effective drugs? Currently, almost all drug research focuses on single targets. Should the process be expanded to include multiple targets? Recent efforts in this direction have lead to the emerging field of polypharmacology. This appears to be a move in the right direction, but how much polypharmacology is enough? As the complexity of the processes underlying polypharmacology increase will we be able to understand them and their inter-relationships? Is "new" mathematics unfamiliar in much of physics and chemistry research needed to accomplish this task? A number of these questions will be addressed in this paper, which focuses on issues and questions not answers to the drug-discovery conundrum.

  6. Wholesale electricity market design with increasing levels of renewable generation: Revenue sufficiency and long-term reliability

    SciTech Connect

    Milligan, Michael; Frew, Bethany A.; Bloom, Aaron; Ela, Erik; Botterud, Audun; Townsend, Aaron; Levin, Todd

    2016-03-22

    This paper discusses challenges that relate to assessing and properly incentivizing the resources necessary to ensure a reliable electricity system with growing penetrations of variable generation (VG). The output of VG (primarily wind and solar generation) varies over time and cannot be predicted precisely. Therefore, the energy from VG is not always guaranteed to be available at times when it is most needed. This means that its contribution towards resource adequacy can be significantly less than the contribution from traditional resources. Variable renewable resources also have near-zero variable costs, and with production-based subsidies they may even have negative offer costs. Because variable costs drive the spot price of energy, this can lead to reduced prices, sales, and therefore revenue for all resources within the energy market. The characteristics of VG can also result in increased price volatility as well as the need for more flexibility in the resource fleet in order to maintain system reliability. Furthermore, we explore both traditional and evolving electricity market designs in the United States that aim to ensure resource adequacy and sufficient revenues to recover costs when those resources are needed for long-term reliability. We also investigate how reliability needs may be evolving and discuss how VG may affect future electricity market designs.

  7. Wholesale electricity market design with increasing levels of renewable generation: Revenue sufficiency and long-term reliability

    DOE PAGES

    Milligan, Michael; Frew, Bethany A.; Bloom, Aaron; ...

    2016-03-22

    This paper discusses challenges that relate to assessing and properly incentivizing the resources necessary to ensure a reliable electricity system with growing penetrations of variable generation (VG). The output of VG (primarily wind and solar generation) varies over time and cannot be predicted precisely. Therefore, the energy from VG is not always guaranteed to be available at times when it is most needed. This means that its contribution towards resource adequacy can be significantly less than the contribution from traditional resources. Variable renewable resources also have near-zero variable costs, and with production-based subsidies they may even have negative offer costs.more » Because variable costs drive the spot price of energy, this can lead to reduced prices, sales, and therefore revenue for all resources within the energy market. The characteristics of VG can also result in increased price volatility as well as the need for more flexibility in the resource fleet in order to maintain system reliability. Furthermore, we explore both traditional and evolving electricity market designs in the United States that aim to ensure resource adequacy and sufficient revenues to recover costs when those resources are needed for long-term reliability. We also investigate how reliability needs may be evolving and discuss how VG may affect future electricity market designs.« less

  8. Correlation between International Normalized Ratio values and sufficiency of two different local hemostatic measures in anticoagulated patients

    PubMed Central

    Amer, Mohamed Zaghlool; Mourad, Samah I.; Salem, Ahmed S.; Abdelfadil, Ehab

    2014-01-01

    Objectives: The management of patients receiving oral anticoagulant therapy (OAT) undergoing minor oral surgeries is controversial. This study was designed to evaluate the correlation between International Normalized Ratio (INR) values and the sufficiency of two different local hemostatic measures in controlling postextraction bleeding in anticoagulated patients. Materials and Methods: One hundred and sixty patients receiving Warfarin OAT were included in this study. Patients were selected so that 80 patients have INR values of ≤2, whereas the remaining patients have the INR values ranging from 2 to 3. Forty patients were then randomly selected from each category to form two equal groups. Forty-five patients who had never been on OAT were selected as a negative control group (group 1). Failure to achieve hemostasis using a pressure pack was managed using either tranexamic acid (group 2) or Ankaferd Blood Stopper (ABS) (group 3). Results: The INR values of patients included in group 2 and 3 ranged from 1.5 to 3, with a mean of 2.2. No significant difference was recorded between the use of either tranexamic acid or ABS in achieving hemostasis in anticoagulated patients with INR values ranging between 2 and 3 (P = 0.93). Conclusion: Based on our findings, ABS is a hemostatic agent of good efficacy. The effect of ABS in controlling post-extraction bleeding in anticoagulated patients with INR values ≤3 is comparable to tranexamic acid with no evidence to support the superiority of tranexamic acid over ABS. PMID:25512727

  9. The C-terminal half of UvrC protein is sufficient to reconstitute (A)BC excinuclease

    SciTech Connect

    Lin, J.J.; Sancar, A. )

    1991-08-01

    The UvrC protein is one of three subunits of the Escherichia coli repair enzyme (A)BC excinuclease. This subunit is thought to have at least one of the active sites for nucleophilic attack on the phosphodiester bonds of damaged DNA. To localize the active site, mutant UvrC proteins were constructed by linker-scanning and deletion mutagenesis. In vivo studies revealed that the C-terminal 314 amino acids of the 610-amino acid UvrC protein were sufficient to confer UV resistance to cells lacking the uvrC gene. The portion of the uvrC gene encoding the C-terminal half of the protein was fused to the 3{prime} end of the E. coli malE gene (which encodes maltose binding protein), and the fusion protein MBP-C314C was purified and characterized. The fusion protein, in combination with UvrA and UvrB subunits, reconstituted the excinuclease activity that incised the eighth phosphodiester bond 5{prime} and the fourth phosphodiester bond 3{prime} to a psoralen-thymine adduct. These results suggest that the C-terminal 314 amino acids of UvrC constitute a functional domain capable of interacting with the UvrB-damaged DNA complex and of inducing the two phosphodiester bond incisions characteristic of (A)BC excinuclease.

  10. Commentary: is totipotency of a human cell a sufficient reason to exclude its patentability under the European law?

    PubMed

    Vrtovec, Katja Triller; Vrtovec, Bojan

    2007-12-01

    This article argues that totipotent character of human totipotent cells--defined as the capacity of a cell "to differentiate into all somatic lineages (ectoderm, mesoderm, endoderm), the germ line and extra-embryonic tissues such as the placenta"--is not a sufficient reason to exclude their patentability on the basis of Article 5(1) of the Directive 98/44/EC on the Legal Protection of Biotechnological Inventions (Biopatent Directive), which maintains that "the human body, at the various stages of its formation and development, [...] cannot constitute patentable inventions." Since human totipotent cells have both the potential to generate an entire new organism or to generate only different tissues or organs of an organism, they simultaneously fit the definition of the unpatentable human body at the earliest stage of its formation as well as of an element of the human body, which "may constitute a patentable invention" pursuant to Article 5(2) of the Biopatent Directive, whether that element is isolated from the human body or otherwise produced by means of a technical process. Therefore, this article suggests that, when evaluating patentability of human totipotent cells, they should be further evaluated according to their location and their method of derivation (i.e., whether human totipotent cells are located in the human body, whether they are isolated from the human body, or whether they are produced otherwise by means of a technical process). Disclosure of potential conflicts of interest is found at the end of this article.

  11. Germ plasm localisation of the HELICc of Vasa in Drosophila: analysis of domain sufficiency and amino acids critical for localisation

    PubMed Central

    Wang, Szu-Chieh; Hsu, Hao-Jen; Lin, Gee-way; Wang, Ting-Fang; Chang, Chun-che; Lin, Ming-Der

    2015-01-01

    Formation of the germ plasm drives germline specification in Drosophila and some other insects such as aphids. Identification of the DEAD-box protein Vasa (Vas) as a conserved germline marker in flies and aphids suggests that they share common components for assembling the germ plasm. However, to which extent the assembly order is conserved and the correlation between functions and sequences of Vas remain unclear. Ectopic expression of the pea aphid Vas (ApVas1) in Drosophila did not drive its localisation to the germ plasm, but ApVas1 with a replaced C-terminal domain (HELICc) of Drosophila Vas (DmVas) became germ-plasm restricted. We found that HELICc itself, through the interaction with Oskar (Osk), was sufficient for germ-plasm localisation. Similarly, HELICc of the grasshopper Vas could be recruited to the germ plasm in Drosophila. Nonetheless, germ-plasm localisation was not seen in the Drosophila oocytes expressing HELICcs of Vas orthologues from aphids, crickets, and mice. We further identified that glutamine (Gln) 527 within HELICc of DmVas was critical for localisation, and its corresponding residue could also be detected in grasshopper Vas yet missing in the other three species. This suggests that Gln527 is a direct target of Osk or critical to the maintenance of HELICc conformation. PMID:26419889

  12. Principal component analysis reveals the 1000 Genomes Project does not sufficiently cover the human genetic diversity in Asia.

    PubMed

    Lu, Dongsheng; Xu, Shuhua

    2013-01-01

    The 1000 Genomes Project (1KG) aims to provide a comprehensive resource on human genetic variations. With an effort of sequencing 2,500 individuals, 1KG is expected to cover the majority of the human genetic diversities worldwide. In this study, using analysis of population structure based on genome-wide single nucleotide polymorphisms (SNPs) data, we examined and evaluated the coverage of genetic diversity of 1KG samples with the available genome-wide SNP data of 3,831 individuals representing 140 population samples worldwide. We developed a method to quantitatively measure and evaluate the genetic diversity revealed by population structure analysis. Our results showed that the 1KG does not have sufficient coverage of the human genetic diversity in Asia, especially in Southeast Asia. We suggested a good coverage of Southeast Asian populations be considered in 1KG or a regional effort be initialized to provide a more comprehensive characterization of the human genetic diversity in Asia, which is important for both evolutionary and medical studies in the future.

  13. Anaplerotic input is sufficient to induce time-dependent potentiation of insulin release in rat pancreatic islets.

    PubMed

    Gunawardana, Subhadra C; Liu, Yi-Jia; Macdonald, Michael J; Straub, Susanne G; Sharp, Geoffrey W G

    2004-11-01

    Nutrients that induce biphasic insulin release, such as glucose and leucine, provide acetyl-CoA and anaplerotic input in the beta-cell. The first phase of release requires increased ATP production leading to increased intracellular Ca(2+) concentration ([Ca(2+)](i)). The second phase requires increased [Ca(2+)](i) and anaplerosis. There is strong evidence to indicate that the second phase is due to augmentation of Ca(2+)-stimulated release via the K(ATP) channel-independent pathway. To test whether the phenomenon of time-dependent potentiation (TDP) has similar properties to the ATP-sensitive K(+) channel-independent pathway, we monitored the ability of different agents that provide acetyl-CoA and anaplerotic input or both of these inputs to induce TDP. The results show that anaplerotic input is sufficient to induce TDP. Interestingly, among the agents tested, the nonsecretagogue glutamine, the nonhydrolyzable analog of leucine aminobicyclo[2.2.1]heptane-2-carboxylic acid, and succinic acid methyl ester all induced TDP, and all significantly increased alpha-ketoglutarate levels in the islets. In conclusion, anaplerosis that enhances the supply and utilization of alpha-ketoglutarate in the tricarboxylic acid cycle appears to play an essential role in the generation of TDP.

  14. Germ plasm localisation of the HELICc of Vasa in Drosophila: analysis of domain sufficiency and amino acids critical for localisation

    NASA Astrophysics Data System (ADS)

    Wang, Szu-Chieh; Hsu, Hao-Jen; Lin, Gee-Way; Wang, Ting-Fang; Chang, Chun-Che; Lin, Ming-Der

    2015-09-01

    Formation of the germ plasm drives germline specification in Drosophila and some other insects such as aphids. Identification of the DEAD-box protein Vasa (Vas) as a conserved germline marker in flies and aphids suggests that they share common components for assembling the germ plasm. However, to which extent the assembly order is conserved and the correlation between functions and sequences of Vas remain unclear. Ectopic expression of the pea aphid Vas (ApVas1) in Drosophila did not drive its localisation to the germ plasm, but ApVas1 with a replaced C-terminal domain (HELICc) of Drosophila Vas (DmVas) became germ-plasm restricted. We found that HELICc itself, through the interaction with Oskar (Osk), was sufficient for germ-plasm localisation. Similarly, HELICc of the grasshopper Vas could be recruited to the germ plasm in Drosophila. Nonetheless, germ-plasm localisation was not seen in the Drosophila oocytes expressing HELICcs of Vas orthologues from aphids, crickets, and mice. We further identified that glutamine (Gln) 527 within HELICc of DmVas was critical for localisation, and its corresponding residue could also be detected in grasshopper Vas yet missing in the other three species. This suggests that Gln527 is a direct target of Osk or critical to the maintenance of HELICc conformation.

  15. A single qrr gene is necessary and sufficient for LuxO-mediated regulation in Vibrio fischeri

    PubMed Central

    Miyashiro, Tim; Wollenberg, Michael S.; Cao, Xiaodan; Oehlert, Dane; Ruby, Edward G.

    2010-01-01

    Summary All members of the Vibrionaceae harbor LuxO, a response regulator that integrates outputs from various signaling systems, ultimately controlling specific traits that are crucial to the distinct biology of each species. LuxO is phosphorylated in response to low cell density, activating the transcription of a family of small RNAs called Qrrs, which in turn, control the levels of a global regulatory protein conserved within the Vibrionaceae. Although the function of each Qrr is similar, the number of qrr genes varies among the different species. Using a bioinformatics approach, we have determined the number of qrr genes in fully-sequenced Vibrionaceae members. Phylogenetic analysis suggests the most recent common ancestor of all Vibrionaceae shared a single, ancestral qrr gene, which duplicated and diverged into multiple qrr genes in some present-day vibrio lineages. To demonstrate that a single qrr gene is sufficient to mediate repression of LitR, the global regulator in Vibrio fischeri, we have performed a series of genetic and phenotypic analyses of the LuxO pathway and its output. Our studies contribute to a better understanding of the ancestral state of these pathways in vibrios, as well as to the evolution and divergence of other sRNAs within different bacterial lineages. PMID:20662783

  16. Dissipation of proton motive force is not sufficient to induce the phage shock protein response in Escherichia coli.

    PubMed

    Engl, Christoph; Beek, Alex Ter; Bekker, Martijn; de Mattos, Joost Teixeira; Jovanovic, Goran; Buck, Martin

    2011-05-01

    Phage shock proteins (Psp) and their homologues are found in species from the three domains of life: Bacteria, Archaea and Eukarya (e.g. higher plants). In enterobacteria, the Psp response helps to maintain the proton motive force (PMF) of the cell when the inner membrane integrity is impaired. The presumed ability of ArcB to sense redox changes in the cellular quinone pool and the strong decrease of psp induction in ΔubiG or ΔarcAB backgrounds suggest a link between the Psp response and the quinone pool. The authors now provide evidence indicating that the physiological signal for inducing psp by secretin-induced stress is neither the quinone redox state nor a drop in PMF. Neither the loss of the H(+)-gradient nor the dissipation of the electrical potential alone is sufficient to induce the Psp response. A set of electron transport mutants differing in their redox states due to the lack of a NADH dehydrogenase and a quinol oxidase, but retaining a normal PMF displayed low levels of psp induction inversely related to oxidised ubiquinone levels under microaerobic growth and independent of PMF. In contrast, cells displaying higher secretin induced psp expression showed increased levels of ubiquinone. Taken together, this study suggests that not a single but likely multiple signals are needed to be integrated to induce the Psp response.

  17. Podocyte-Specific Overexpression of Wild Type or Mutant Trpc6 in Mice Is Sufficient to Cause Glomerular Disease

    PubMed Central

    Kairath, Pamela; Carmona-Mora, Paulina; Molina, Jessica; Carpio, J. Daniel; Ruiz, Phillip; Mezzano, Sergio A.; Li, Jing; Wei, Changli; Reiser, Jochen; Young, Juan I.; Walz, Katherina

    2010-01-01

    Mutations in the TRPC6 calcium channel (Transient receptor potential channel 6) gene have been associated with familiar forms of Focal and Segmental Glomerulosclerosis (FSGS) affecting children and adults. In addition, acquired glomerular diseases are associated with increased expression levels of TRPC6. However, the exact role of TRPC6 in the pathogenesis of FSGS remains to be elucidated. In this work we describe the generation and phenotypic characterization of three different transgenic mouse lines with podocyte-specific overexpression of the wild type or any of two mutant forms of Trpc6 (P111Q and E896K) previously related to FSGS. Consistent with the human phenotype a non-nephrotic range of albuminuria was detectable in almost all transgenic lines. The histological analysis demonstrated that the transgenic mice developed a kidney disease similar to human FSGS. Differences of 2–3 folds in the presence of glomerular lesions were found between the non transgenic and transgenic mice expressing Trpc6 in its wild type or mutant forms specifically in podocytes. Electron microscopy of glomerulus from transgenic mice showed extensive podocyte foot process effacement. We conclude that overexpression of Trpc6 (wild type or mutated) in podocytes is sufficient to cause a kidney disease consistent with FSGS. Our results contribute to reinforce the central role of podocytes in the etiology of FSGS. These mice constitute an important new model in which to study future therapies and outcomes of this complex disease. PMID:20877463

  18. Pattern of beverage intake and milk and dairy products sufficiency among high-school students in Kuwait.

    PubMed

    Nassar, M F; AbdelKader, A M; Al-Refaee, F A; Al-Dhafiri, S S

    2014-12-17

    High consumption of soft drinks has been associated with lower intakes of milk and calcium-rich foods and higher body mass index (BMI). This study aimed to explore the pattern of beverage intake among Kuwaiti high-school students. A questionnaire on knowledge, attitudes and practices concerning beverages and milk and dairy products intake was completed by 190 Kuwaiti students aged 16-18 years and BMI was calculated for 181 of them. Intake of sweetened carbonated beverages and to a lesser extent packaged fruit juices affected the sufficiency of milk and dairy products intake among the sample of high-school students in Kuwait. Although BMI was not related to milk and dairy insufficiency, more of the overweight and obese students displayed incorrect practices. Nutritional education of high-school students on the importance of milk and dairy products as well as the hazards of excess sweetened carbonated beverages and packaged juice is recommended to prevent the obesity epidemic prevailing in Kuwait.

  19. Plant growth responses to elevated atmospheric CO2 are increased by phosphorus sufficiency but not by arbuscular mycorrhizas.

    PubMed

    Jakobsen, Iver; Smith, Sally E; Smith, F Andrew; Watts-Williams, Stephanie J; Clausen, Signe S; Grønlund, Mette

    2016-11-01

    Capturing the full growth potential in crops under future elevated CO2 (eCO2) concentrations would be facilitated by improved understanding of eCO2 effects on uptake and use of mineral nutrients. This study investigates interactions of eCO2, soil phosphorus (P), and arbuscular mycorrhizal (AM) symbiosis in Medicago truncatula and Brachypodium distachyon grown under the same conditions. The focus was on eCO2 effects on vegetative growth, efficiency in acquisition and use of P, and expression of phosphate transporter (PT) genes. Growth responses to eCO2 were positive at P sufficiency, but under low-P conditions they ranged from non-significant in M. truncatula to highly significant in B. distachyon Growth of M. truncatula was increased by AM at low P conditions at both CO2 levels and eCO2×AM interactions were sparse. Elevated CO2 had small effects on P acquisition, but enhanced conversion of tissue P into biomass. Expression of PT genes was influenced by eCO2, but effects were inconsistent across genes and species. The ability of eCO2 to partly mitigate P limitation-induced growth reductions in B. distachyon was associated with enhanced P use efficiency, and requirements for P fertilizers may not increase in such species in future CO2-rich climates.

  20. Serotonin-1A autoreceptors are necessary and sufficient for the normal formation of circuits underlying innate anxiety

    PubMed Central

    Richardson-Jones, Jesse W; Craige, Caryne P; Nguyen, Thanh H; Kung, Hank F; Gardier, Alain M; Dranovsky, Alex; David, Denis J; Guiard, Bruno P; Beck, Sheryl G; Hen, René; Leonardo, E David

    2011-01-01

    Identifying factors contributing to the etiology of anxiety and depression is critical for the development of more efficacious therapies. Serotonin (5-HT) is intimately linked to both disorders. The inhibitory serotonin-1A (5-HT1A) receptor exists in two separate populations with distinct effects on serotonergic signaling: 1) an autoreceptor that limits 5-HT release throughout the brain, and 2) a heteroreceptor that mediates inhibitory responses to released 5-HT. Traditional pharmacologic and transgenic strategies have not addressed the distinct roles of these two receptor populations. Here we use a recently developed genetic mouse system to independently manipulate 5-HT1A auto and heteroreceptor receptor populations. We show that 5-HT1A autoreceptors act to affect anxiety-like behavior. In contrast, 5-HT1A heteroreceptors affect responses to forced swim stress, without effects on anxiety-like behavior. Together with our previously reported work, these results establish distinct roles for the two receptor populations, providing evidence that signaling through endogenous 5-HT1A autoreceptors is necessary and sufficient for the establishment of normal anxiety-like behavior. PMID:21508226

  1. 'Thinking ill of others without sufficient warrant?' Transcending the accuracy-inaccuracy dualism in prejudice and stereotyping research.

    PubMed

    Dixon, John

    2017-02-03

    Research on prejudice seeks to understand and transform inaccurate beliefs about others. Indeed, historically such research has offered a cautionary tale of the biased nature of human cognition. Recently, however, this view has been challenged by work defending the essential rationality of intergroup perception, a theme captured controversially in Jussim and colleagues' (2009) research on the 'unbearable accuracy of stereotyping'. The present paper argues that in its own terms the 'rationalist turn' in socio-cognitive research on stereotyping presents an important challenge to the prejudice tradition, raising troubling questions about its conceptual and empirical foundations. However, it also argues for the necessity of transcending those terms. By focusing on the correspondence between individual beliefs and the supposedly 'objective' characteristics of others, we neglect the historical and discursive practices through which the social realities that we 'perceive' are actively constructed and institutionalized. We mask their social origins, contested and perspectival nature, relativity, and relationship to wider structures of power. By implication, moving beyond the Allportian perspective that has dominated both the prejudice tradition and the emerging stereotype accuracy paradigm, we may now need to prioritize other kinds of questions. Reversing Allport's famous definition of prejudice, it may now be time to ask: How, and with what consequences, does 'thinking ill of others' become sufficiently warranted? How does such thinking become part of institutionalized relations of power and an accepted way of perceiving, evaluating and treating others? What should social psychologists be doing to challenge this state of affairs?

  2. Plant growth responses to elevated atmospheric CO2 are increased by phosphorus sufficiency but not by arbuscular mycorrhizas

    PubMed Central

    Jakobsen, Iver; Smith, Sally E.; Smith, F. Andrew; Watts-Williams, Stephanie J.; Clausen, Signe S.; Grønlund, Mette

    2016-01-01

    Capturing the full growth potential in crops under future elevated CO2 (eCO2) concentrations would be facilitated by improved understanding of eCO2 effects on uptake and use of mineral nutrients. This study investigates interactions of eCO2, soil phosphorus (P), and arbuscular mycorrhizal (AM) symbiosis in Medicago truncatula and Brachypodium distachyon grown under the same conditions. The focus was on eCO2 effects on vegetative growth, efficiency in acquisition and use of P, and expression of phosphate transporter (PT) genes. Growth responses to eCO2 were positive at P sufficiency, but under low-P conditions they ranged from non-significant in M. truncatula to highly significant in B. distachyon. Growth of M. truncatula was increased by AM at low P conditions at both CO2 levels and eCO2×AM interactions were sparse. Elevated CO2 had small effects on P acquisition, but enhanced conversion of tissue P into biomass. Expression of PT genes was influenced by eCO2, but effects were inconsistent across genes and species. The ability of eCO2 to partly mitigate P limitation-induced growth reductions in B. distachyon was associated with enhanced P use efficiency, and requirements for P fertilizers may not increase in such species in future CO2-rich climates. PMID:27811084

  3. Asparagine synthetase expression alone is sufficient to induce l-asparaginase resistance in MOLT-4 human leukaemia cells.

    PubMed Central

    Aslanian, A M; Fletcher, B S; Kilberg, M S

    2001-01-01

    Childhood acute lymphoblastic leukaemia (ALL) is treated by combination chemotherapy with a number of drugs, always including the enzyme L-asparaginase (ASNase). Although the initial remission rate is quite high, relapse and associated drug resistance are a significant problem. In vitro studies have demonstrated increased asparagine synthetase (AS) expression in ASNase-resistant cells, which has led to the hypothesis that elevated AS activity permits drug-resistant survival. The data presented show that not only is elevated AS expression a property of ASNase-resistant MOLT-4 human leukaemia cells, but that short-term (12 h) treatment of the cells with ASNase causes a relatively rapid induction of AS expression. The results also document that the elevated expression of AS in ASNase-resistant cells is not fully reversible, even 6 weeks after ASNase removal from the culture medium. Furthermore, ASNase resistance, assessed as both drug-insensitive cell growth rates and decreased drug-induced apoptosis, parallels this irreversible AS expression. Mimicking the elevated AS activity in ASNase-resistant cells by overexpression of the human AS protein by stable retroviral transformation of parental MOLT4 cells is sufficient to induce the ASNase-resistance phenotype. These data document that ASNase resistance in ALL cells is a consequence of elevated AS expression and that although other drug-induced metabolic changes occur, they are secondary to the increased asparagine biosynthetic rate. PMID:11415466

  4. An artificial self-sufficient cytochrome P450 directly nitrates fluorinated tryptophan analogs with a different regio-selectivity.

    PubMed

    Zuo, Ran; Zhang, Yi; Huguet-Tapia, Jose C; Mehta, Mishal; Dedic, Evelina; Bruner, Steven D; Loria, Rosemary; Ding, Yousong

    2016-05-01

    Aromatic nitration is an immensely important industrial process to produce chemicals for a variety of applications, but it often suffers from multiple unsolved challenges. Enzymes as biocatalysts have been increasingly used for organic chemistry synthesis due to their high selectivity and environmental friendliness, but nitration has benefited minimally from the development of biocatalysis. In this work, we aimed to develop TxtE as practical biocatalysts for aromatic nitration. TxtE is a unique class I cytochrome P450 enzyme that nitrates the indole of l-tryptophan. To develop cost-efficient nitration processes, we fused TxtE with the reductase domains of CYP102A1 (P450BM3) and of P450RhF to create class III self-sufficient biocatalysts. The best engineered fusion protein was comparable with wild type TxtE in terms of nitration performance and other key biochemical properties. To demonstrate the application potential of the fusion enzyme, we nitrated 4-F-dl-tryptophan and 5-F-l-tryptophan in large scale enzymatic reactions. Tandem MS/MS and NMR analyses of isolated products revealed altered nitration sites. To our knowledge, these studies represent the first practice in developing biological nitration approaches and lay a solid basis to the use of TxtE-based biocatalysts for the production of valuable nitroaromatics.

  5. The canonical Wingless signaling pathway is required but not sufficient for inflow tract formation in the Drosophila melanogaster heart.

    PubMed

    Trujillo, Gloriana V; Nodal, Dalea H; Lovato, Candice V; Hendren, Jill D; Helander, Lynda A; Lovato, TyAnna L; Bodmer, Rolf; Cripps, Richard M

    2016-05-01

    The inflow tracts of the embryonic Drosophila cardiac tube, termed ostia, arise in its posterior three segments from cardiac cells that co-express the homeotic transcription factor Abdominal-A (abdA), the orphan nuclear receptor Seven-up (Svp), and the signaling molecule Wingless (Wg). To define the roles of these factors in inflow tract development, we assessed their function in inflow tract formation. We demonstrate, using several criteria, that abdA, svp, and wg are each critical for normal inflow tract formation. We further show that Wg acts in an autocrine manner to impact ostia fate, and that it mediates this effect at least partially through the canonical Wg signaling pathway. By contrast, neither wg expression nor Wg signaling are sufficient for inflow tract formation when expressed in anterior Svp cells that do not normally form inflow tracts in the embryo. Instead, ectopic abd-A expression throughout the cardiac tube is required for the formation of ectopic inflow tracts, indicating that autocrine Wg signaling must be supplemented by additional Hox-dependent factors to effect inflow tract formation. Taken together, these studies define important cellular and molecular events that contribute to cardiac inflow tract development in Drosophila. Given the broad conservation of the cardiac regulatory network through evolution, our studies provide insight into mechanisms of cardiac development in higher animals.

  6. Transmembrane TNF-α is sufficient for articular inflammation and hypernociception in a mouse model of gout.

    PubMed

    Amaral, Flávio A; Bastos, Leandro F S; Oliveira, Thiago H C; Dias, Ana C F; Oliveira, Vívian L S; Tavares, Lívia D; Costa, Vivian V; Galvão, Izabela; Soriani, Frederico M; Szymkowski, David E; Ryffel, Bernhard; Souza, Danielle G; Teixeira, Mauro M

    2016-01-01

    Gout manifests as recurrent episodes of acute joint inflammation and pain due to the deposition of monosodium urate (MSU) crystals within the affected tissue in a process dependent on NLRP3 inflammasome activation. The synthesis, activation, and release of IL-1β are crucial for MSU-induced inflammation. The current study evaluated the mechanism by which TNF-α contributed to MSU-induced inflammation. Male C57BL/6J or transgenic mice were used in this study and inflammation was induced by the injection of MSU crystals into the joint. TNF-α was markedly increased in the joint after the injection of MSU. There was inhibition in the infiltration of neutrophils, production of CXCL1 and IL-1β, and decreased hypernociception in mice deficient for TNF-α or its receptors. Pharmacological blockade of TNF-α with Etanercept or pentoxyfylline produced similar results. Mechanistically, TNF-α blockade resulted in lower amounts of IL-1β protein and pro-IL-1β mRNA transcripts in joints. Gene-modified mice that express only transmembrane TNF-α had an inflammatory response similar to that of WT mice and blockade of soluble TNF-α (XPro™1595) did not decrease MSU-induced inflammation. In conclusion, TNF-α drives expression of pro-IL-1β mRNA and IL-1β protein in experimental gout and that its transmembrane form is sufficient to trigger MSU-induced inflammation in mice.

  7. Calcium mobilization is both required and sufficient for initiating chromatin decondensation during activation of peripheral T-cells

    PubMed Central

    Lee, Megan D.; Bingham, Kellie N.; Mitchell, Taylor Y.; Meredith, Jenna L.; Rawlings, Jason S.

    2014-01-01

    Antigen engagement of the T-cell receptor (TCR) induces a rapid and dramatic decondensation of chromatin that is necessary for T-cell activation. This decondensation makes T-cells competent to respond to Interleukin-2 providing a mechanism to ensure clonotypic proliferation during an immune response. Using murine T-cells, we investigated the mechanism by which TCR signaling can initiate chromatin decondensation, focusing on the role of calcium mobilization. During T-cell activation, calcium is first released from intracellular stores, followed by influx of extracellular calcium via store operated calcium entry. We show that mobilization of intracellular calcium is required for TCR-induced chromatin decondensation. However, the decondensation is not dependent on the activity of the downstream transcription factor NFAT. Furthermore, we show that the influx of extracellular calcium is dispensable for initiating chromatin decondensation. Finally, we show that mobilization of calcium from intracellular stores is sufficient to induce decondensation, independent of TCR engagement. Collectively, our data suggest that chromatin decondensation in peripheral T-cells is controlled by modulating intracellular calcium levels. PMID:25453467

  8. Interleukin-23 is sufficient to induce rapid de novo gut tumorigenesis, independent of carcinogens, through activation of innate lymphoid cells.

    PubMed

    Chan, I H; Jain, R; Tessmer, M S; Gorman, D; Mangadu, R; Sathe, M; Vives, F; Moon, C; Penaflor, E; Turner, S; Ayanoglu, G; Chang, C; Basham, B; Mumm, J B; Pierce, R H; Yearley, J H; McClanahan, T K; Phillips, J H; Cua, D J; Bowman, E P; Kastelein, R A; LaFace, D

    2014-07-01

    Chronic inflammation has been associated with increased risk for developing gastrointestinal cancer. Interleukin-23 (IL-23) receptor signaling has been correlated with inflammatory bowel disease pathogenesis, as well as promotion of tumor growth. However, little is known about the relative potential for IL-23-directed causality in gut tumorigenesis. We report that IL-23 transgene expression was sufficient to induce rapid (3-4 weeks) de novo development of intestinal adenomas with 100% incidence. Initiation of tumorigenesis was independent of exogenous carcinogens, Helicobacter colonization, or pre-existing tumor-suppressor gene mutations. Tumorigenesis was mediated by Thy1(+)IL-23R(+) innate lymphoid cells (ILC3), in part, through IL-17 responses as tumor development was inhibited in RAG(-/-) × IL-17(-/-) double knockout mice. Remarkably, IL-23 initiation of tumorigenesis by resident ILCs consistently occurred before recruitment of conspicuous inflammatory infiltrates. Our results reveal an explicit role for IL-23-mediated initiation of gut tumorigenesis and implicate a key role for IL-23R(+) ILC3 in the absence of overt cellular infiltrate recruitment.

  9. Characterization of the BM88 promoter and identification of an 88 bp fragment sufficient to drive neurone-specific expression.

    PubMed

    Papadodima, Olga; Sergaki, Maritina; Hurel, Catherine; Mamalaki, Avgi; Matsas, Rebecca

    2005-10-01

    BM88 is a neurone-specific protein implicated in cell cycle exit and differentiation of neuronal precursors. It is widely expressed in terminally differentiated neurones but also in neuronal progenitors, albeit in lower levels. Thus BM88 expression shows a tight correlation with the progression of progenitor cells towards neuronal differentiation. Here we report the genomic organization and proximal promoter characterization of the human and mouse BM88 genes. Both promoters lie in a CpG island, are TATA-less and have multiple transcription start sites. Deletion analysis performed on the human BM88 gene revealed an 88 bp minimal promoter fragment that is preferentially active in neural cells. Importantly, this minimal promoter is sufficient to confer specific transcriptional activity in primary neurones, but not in glial cells. Within the promoter region there are four functional Sp1-binding sites. Simultaneous mutations to all four Sp1 sites results in complete loss of promoter activity. Transactivation experiments revealed that Sp1 directly activates the BM88 promoter while activation also occurs in the presence of neurogenin-1. Characterization of the promoter elements that control neurone-specific and developmental expression of BM88 should contribute to the elucidation of the transcriptional networks that regulate the transition from a proliferative neural progenitor to a post-mitotic neurone.

  10. Sufficient condition for stabilization of linear time invariant fractional order switched systems and variable structure control stabilizers.

    PubMed

    Balochian, Saeed; Sedigh, Ali Khaki

    2012-01-01

    This paper presents the stabilization problem of a linear time invariant fractional order (LTI-FO) switched system with order 1sufficient condition for the stability of an LTI-FO switched system with order 1

  11. A 90-liter stackable baffled microbial fuel cell for brewery wastewater treatment based on energy self-sufficient mode.

    PubMed

    Dong, Yue; Qu, Youpeng; He, Weihua; Du, Yue; Liu, Jia; Han, Xiaoyu; Feng, Yujie

    2015-11-01

    A 90-liter stackable pilot microbial fuel cell was designed and proved to be capable for brewery wastewater treatment and simultaneous electricity harvested. The system was stacked by 5 easily-stackable modules, and operated in an energy self-sufficient manner for more than 6 months. Tests were conducted under two different influent strengths (diluted wastewater, stage 1; raw wastewater, stage 2). The COD, SS removal efficiencies were 84.7% and 81.7% at stage 1, 87.6% and 86.3% at stage 2. The system produced enough energy (0.056 kWh/m(3) at stage 1, 0.097 kWh/m(3) at stage 2) to power the pumping system (0.027 kWh/m(3) at both stages), net electrical energy of 0.021 kWh/m(3) and 0.034 kWh/m(3) were harvested. These results show that this pilot-scale system could be used to effectively treat real wastewater with zero energy input.

  12. The use of Jatropha curcas to achieve a self sufficient water distribution system: A case study in rural Senegal

    NASA Astrophysics Data System (ADS)

    Archer, Alexandra

    The use of Jatropha curcas as a source of oil for fueling water pumps holds promise for rural communities struggling to achieve water security in arid climates. The potential for use in developing communities as an affordable, sustainable fuel source has been highly recommended for many reasons: it is easily propagated, drought resistant, grows rapidly, and has high-oil-content seeds, as well as medicinal and economic potential. This study uses a rural community in Senegal, West Africa, and calculates at what level of Jatropha curcas production the village is able to be self-sufficient in fueling their water system to meet drinking, sanitation and irrigation requirements. The current water distribution system was modelled to represent irrigation requirements for nine different Jatropha curcas cultivation and processing schemes. It was found that a combination of using recycled greywater for irrigation and a mechanical press to maximize oil recovered from the seeds of mature Jatropha curcas trees, would be able to operate the water system with no diesel required.

  13. Suitability of DCPs with screw locking elements to allow sufficient interfragmentary motion to promote secondary bone healing of osteoporotic fractures.

    PubMed

    Cuadrado, A; Yánez, A; Carta, J A; Garcés, G

    2013-06-01

    This paper analyses the suitability of a system comprising a Dynamic Compression Plate (DCP) and Screw Locking Elements (SLEs) to allow sufficient interfragmentary motion to promote secondary bone healing in osteoporotic fractures. Four fixation systems were mounted on bone-simulating reinforced epoxy bars filled with solid rigid polyurethane foam. Group 1, used for comparison purposes, represents a system comprised of a Locking Compression Plate (LCP) and eight locking screws. Groups 2 and 3 represent a system comprised of a DCP plate with eight cortical screws and two SLEs placed on the screws furthest from (group 2) and nearest to (group 3) the fracture. Group 4 represents the system comprised of a DCP plate with SLEs placed on all eight cortical screws. Cyclic compression tests of up to 10,000 load cycles were performed in order to determine the parameters of interest, namely the stiffnesses and the interfragmentary motion of the various configurations under consideration. Tukey's multiple comparison test was used to analyse the existence or otherwise of significant differences between the means of the groups. At 10,000 cycles, interfragmentary motion at the far cortex for group 2 was 0.60±0.04 mm and for group 3 0.59±0.03 mm (there being no significant differences: p=0.995). The mean interfragmentary motion at the far cortex of the LCP construct was 70% less than that of the two groups with 2SLEs (there being significant differences: p=1.1×10(-8)). In the case of group 4 this figure was 45% less than in groups 2 and 3 (there being significant differences: p=5.6×10(-6)). At 10,000 cycles, interfragmentary motion at the near cortex for group 2 was 0.24±0.06 mm and for group 3 0.24±0.03 mm (there being no significant differences: p=1.000). The mean interfragmentary motion at the near cortex of the LCP construct was 70.8% less than that of the two groups with 2SLEs (there being significant differences: p=0.011). In the case of group 4 this figure was 66

  14. Metabolic hormone FGF21 is induced in ground squirrels during hibernation but its overexpression is not sufficient to cause torpor.

    PubMed

    Nelson, Bethany T; Ding, Xunshan; Boney-Montoya, Jamie; Gerard, Robert D; Kliewer, Steven A; Andrews, Matthew T

    2013-01-01

    Hibernation is a natural adaptation that allows certain mammals to survive physiological extremes that are lethal to humans. Near freezing body temperatures, heart rates of 3-10 beats per minute, absence of food consumption, and depressed metabolism are characteristic of hibernation torpor bouts that are periodically interrupted by brief interbout arousals (IBAs). The molecular basis of torpor induction is unknown, however starved mice overexpressing the metabolic hormone fibroblast growth factor 21 (FGF21) promote fat utilization, reduce body temperature, and readily enter torpor-all hallmarks of mammalian hibernation. In this study we cloned FGF21 from the naturally hibernating thirteen-lined ground squirrel (Ictidomys tridecemlineatus) and found that levels of FGF21 mRNA in liver and FGF21 protein in serum are elevated during hibernation torpor bouts and significantly elevated during IBAs compared to summer active animals. The effects of artificially elevating circulating FGF21 concentrations 50 to 100-fold via adenoviral-mediated overexpression were examined at three different times of the year. This is the first time that a transgenic approach has been used in a natural hibernator to examine mechanistic aspects of hibernation. Surgically implanted transmitters measured various metrics of the hibernation phenotype over a 7-day period including changes in motor activity, heart rate and core body temperature. In April fed-state animals, FGF21 overexpression decreased blood insulin and free fatty acid concentrations, effects similar to those seen in obese mice. However, elevated FGF21 concentrations did not cause torpor in these fed-state animals nor did they cause torpor or affect metabolic parameters in fasted-state animals in March/April, August or October. We conclude that FGF21 is strongly regulated during torpor and IBA but that its overexpression is not sufficient to cause torpor in naturally hibernating ground squirrels.

  15. Organic Fertilization and Sufficient Nutrient Status in Prehistoric Agriculture? – Indications from Multi-Proxy Analyses of Archaeological Topsoil Relicts

    PubMed Central

    Lauer, Franziska; Prost, Katharina; Gerlach, Renate; Pätzold, Stefan; Wolf, Mareike; Urmersbach, Sarah; Lehndorff, Eva; Eckmeier, Eileen; Amelung, Wulf

    2014-01-01

    Neolithic and Bronze Age topsoil relicts revealed enhanced extractable phosphorus (P) and plant available inorganic P fractions, thus raising the question whether there was targeted soil amelioration in prehistoric times. This study aimed (i) at assessing the overall nutrient status and the soil organic matter content of these arable topsoil relicts, and (ii) at tracing ancient soil fertilizing practices by respective stable isotope and biomarker analyses. Prehistoric arable topsoils were preserved in archaeological pit fillings, whereas adjacent subsoils served as controls. One Early Weichselian humic zone represented the soil status before the introduction of agriculture. Recent topsoils served as an additional reference. The applied multi-proxy approach comprised total P and micronutrient contents, stable N isotope ratios, amino acid, steroid, and black carbon analyses as well as soil color measurements. Total contents of P and selected micronutrients (I, Cu, Mn, Mo, Se, Zn) of the arable soil relicts were above the limits for which nutrient deficiencies could be assumed. All pit fillings exhibited elevated δ15N values close to those of recent topsoils (δ15N>6 to 7‰), giving first hints for prehistoric organic N-input. Ancient legume cultivation as a potential source for N input could not be verified by means of amino acid analysis. In contrast, bile acids as markers for faecal input exhibited larger concentrations in the pit fillings compared with the reference and control soils indicating faeces (i.e. manure) input to Neolithic arable topsoils. Also black carbon contents were elevated, amounting up to 38% of soil organic carbon, therewith explaining the dark soil color in the pit fillings and pointing to inputs of burned biomass. The combination of different geochemical analyses revealed a sufficient nutrient status of prehistoric arable soils, as well as signs of amelioration (inputs of organic material like charcoal and faeces-containing manure). PMID

  16. Knowledge of Native Protein-Protein Interfaces Is Sufficient To Construct Predictive Models for the Selection of Binding Candidates.

    PubMed

    Popov, Petr; Grudinin, Sergei

    2015-10-26

    Selection of putative binding poses is a challenging part of virtual screening for protein-protein interactions. Predictive models to filter out binding candidates with the highest binding affinities comprise scoring functions that assign a score to each binding pose. Existing scoring functions are typically deduced by collecting statistical information about interfaces of native conformations of protein complexes along with interfaces of a large generated set of non-native conformations. However, the obtained scoring functions become biased toward the method used to generate the non-native conformations, i.e., they may not recognize near-native interfaces generated with a different method. The present study demonstrates that knowledge of only native protein-protein interfaces is sufficient to construct well-discriminative predictive models for the selection of binding candidates. Here we introduce a new scoring method that comprises a knowledge-based potential called KSENIA deduced from structural information about the native interfaces of 844 crystallographic protein-protein complexes. We derive KSENIA using convex optimization with a training set composed of native protein complexes and their near-native conformations obtained using deformations along the low-frequency normal modes. As a result, our knowledge-based potential has only marginal bias toward a method used to generate putative binding poses. Furthermore, KSENIA is smooth by construction, which allows it to be used along with rigid-body optimization to refine the binding poses. Using several test benchmarks, we demonstrate that our method discriminates well native and near-native conformations of protein complexes from non-native ones. Our methodology can be easily adapted to the recognition of other types of molecular interactions, such as protein-ligand, protein-RNA, etc. KSENIA will be made publicly available as a part of the SAMSON software platform at https://team.inria.fr/nano-d/software .

  17. A 25-Amino Acid Sequence of the Arabidopsis TGD2 Protein Is Sufficient for Specific Binding of Phosphatidic Acid*

    PubMed Central

    Lu, Binbin; Benning, Christoph

    2009-01-01

    Genetic analysis suggests that the TGD2 protein of Arabidopsis is required for the biosynthesis of endoplasmic reticulum derived thylakoid lipids. TGD2 is proposed to be the substrate-binding protein of a presumed lipid transporter consisting of the TGD1 (permease) and TGD3 (ATPase) proteins. The TGD1, -2, and -3 proteins are localized in the inner chloroplast envelope membrane. TGD2 appears to be anchored with an N-terminal membrane-spanning domain into the inner envelope membrane, whereas the C-terminal domain faces the intermembrane space. It was previously shown that the C-terminal domain of TGD2 binds phosphatidic acid (PtdOH). To investigate the PtdOH binding site of TGD2 in detail, the C-terminal domain of the TGD2 sequence lacking the transit peptide and transmembrane sequences was fused to the C terminus of the Discosoma sp. red fluorescent protein (DR). This greatly improved the solubility of the resulting DR-TGD2C fusion protein following production in Escherichia coli. The DR-TGD2C protein bound PtdOH with high specificity, as demonstrated by membrane lipid-protein overlay and liposome association assays. Internal deletion and truncation mutagenesis identified a previously undescribed minimal 25-amino acid fragment in the C-terminal domain of TGD2 that is sufficient for PtdOH binding. Binding characteristics of this 25-mer were distinctly different from those of TGD2C, suggesting that additional sequences of TGD2 providing the proper context for this 25-mer are needed for wild type-like PtdOH binding. PMID:19416982

  18. One rhinophore probably provides sufficient sensory input for odour-based navigation by the nudibranch mollusc Tritonia diomedea.

    PubMed

    McCullagh, Gregory B; Bishop, Cory D; Wyeth, Russell C

    2014-12-01

    Tritonia diomedea (synonymous with Tritonia tetraquetra) navigates in turbulent odour plumes, crawling upstream towards prey and downstream to avoid predators. This is probably accomplished by odour-gated rheotaxis, but other possibilities have not been excluded. Our goal was to test whether T. diomedea uses odour-gated rheotaxis and to simultaneously determine which of the cephalic sensory organs (rhinophores and oral veil) are required for navigation. In a first experiment, slugs showed no coherent responses to streams of odour directed at single rhinophores. In a second experiment, navigation in prey and predator odour plumes was compared between animals with unilateral rhinophore lesions, denervated oral veils, or combined unilateral rhinophore lesions and denervated oral veils. In all treatments, animals navigated in a similar manner to that of control and sham-operated animals, indicating that a single rhinophore provides sufficient sensory input for navigation (assuming that a distributed flow measurement system would also be affected by the denervations). Amongst various potential navigational strategies, only odour-gated positive rheotaxis can produce the navigation tracks we observed in prey plumes while receiving input from a single sensor. Thus, we provide strong evidence that T. diomedea uses odour-gated rheotaxis in attractive odour plumes, with odours and flow detected by the rhinophores. In predator plumes, slugs turned downstream to varying degrees rather than orienting directly downstream for crawling, resulting in greater dispersion for negative rheotaxis in aversive plumes. These conclusions are the first explicit confirmation of odour-gated rheotaxis as a navigational strategy in gastropods and are also a foundation for exploring the neural circuits that mediate odour-gated rheotaxis.

  19. Occurrence of a barbiturate-inducible catalytically self-sufficient 119,000 dalton cytochrome P-450 monooxygenase in bacilli.

    PubMed

    Fulco, A J; Ruettinger, R T

    1987-05-04

    In a recent publication (Narhi, L.O. and Fulco, A.J.[1986] J. Biol. Chem. 261, 7160-7169) we described the characterization of a catalytically self-sufficient 119,000 Dalton cytochrome P-450 fatty acid monooxygenase (P-450BM-3) induced by barbiturates in Bacillus megaterium ATCC 14581. We have now examined cell-free preparations from 12 distinct strains of B. megaterium and from one or two strains each of B. alvei, B. brevis, B. cereus, B. licheniformis, B. macerans, B. pumilis and B. subtilis for the presence of this inducible enzyme. Using Western blot analyses in combination with assays for fatty acid hydroxylase activity and cytochrome P-450, we were able to show that 11 of the 12 B. megaterium strains contained not only a strongly pentobarbital-inducible fatty acid monooxygenase identical to or polymorphic with P-450BM-3 but also significant levels of two smaller P-450 cytochromes that were the same as or similar to cytochromes P-450BM-1 and P-450BM-2 originally found in ATCC 14581. Unlike the 119,000 Dalton P-450, however, the two smaller P-450s were generally easily detectable in cultures grown to stationary phase in the absence of barbiturates and, with some exceptions, were not strongly induced by pentobarbital. None of the non-megaterium species of Bacillus tested exhibited significant levels of either fatty acid monooxygenase activity or cytochrome P-450. The one strain of B. megaterium that lacked inducible P-450BM-3 was also negative for BM-1 and BM-2. However, this strain (ATCC 13368) did contain a small but significant level of another P-450 cytochrome that others have identified as the oxygenase component of a steroid 15-beta-hydroxylase system. Our evidence suggests that the BM series of P-450 cytochromes is encoded by chromosomal (rather than by plasmid) DNA.

  20. Aluminum Exposure at Human Dietary Levels for 60 Days Reaches a Threshold Sufficient to Promote Memory Impairment in Rats.

    PubMed

    Martinez, Caroline S; Alterman, Caroline D C; Peçanha, Franck M; Vassallo, Dalton V; Mello-Carpes, Pâmela B; Miguel, Marta; Wiggers, Giulia A

    2017-01-01

    Aluminum (Al) is a significant environmental contaminant. While a good deal of research has been conducted on the acute neurotoxic effects of Al, little is known about the effects of longer-term exposure at human dietary Al levels. Therefore, the purpose of this study was to investigate the effects of 60-day Al exposure at low doses for comparison with a model of exposure known to produce neurotoxicity in rats. Three-month-old male Wistar rats were divided into two major groups: (1) low aluminum levels, and (2) a high aluminum level. Group 1 rats were treated orally by drinking water for 60 days as follows: (a) control-received ultrapure drinking water; (b) aluminum at 1.5 mg/kg b.w., and (c) aluminum at 8.3 mg/kg b.w. Group 2 rats were treated through oral gavages for 42 days as follows: (a) control-received ultrapure water; (b) aluminum at 100 mg/kg b.w. We analyzed cognitive parameters, biomarkers of oxidative stress and acetylcholinesterase (AChE) activity in hippocampus and prefrontal cortex. Al treatment even at low doses promoted recognition memory impairment seen in object recognition memory testing. Moreover, Al increased hippocampal reactive oxygen species and lipid peroxidation, reduced antioxidant capacity, and decreased AChE activity. Our data demonstrate that 60-day subchronic exposure to low doses of Al from feed and added to the water, which reflect human dietary Al intake, reaches a threshold sufficient to promote memory impairment and neurotoxicity. The elevation of oxidative stress and cholinergic dysfunction highlight pathways of toxic actions for this metal.

  1. Ectodysplasin-A1 is sufficient to rescue both hair growth and sweat glands in Tabby mice.

    PubMed

    Srivastava, A K; Durmowicz, M C; Hartung, A J; Hudson, J; Ouzts, L V; Donovan, D M; Cui, C Y; Schlessinger, D

    2001-12-15

    Mutations in the human ectodysplasin-A (EDA) are responsible for the most common form of the ectodermal dysplasia and the defective orthologous gene in mice produces the tabby phenotype, suggesting its vital role in the development of hair, sweat glands and teeth. Among several EDA splice isoforms, the most common and the longest EDA splice isoforms, EDA-A1 and EDA-A2, differing by only two amino acids, activate NF-kappaB-promoted transcription by binding to distinct receptors, EDAR and XEDAR. The extent to which any particular isoform is sufficient for the formation of hair, sweat glands or teeth has remained unclear. Here we report that transgenic expression of the mouse EDA-A1 isoform in tabby (EDA-less) males rescued development of several skin appendages. The transgenic tabby mice showed almost complete restoration of hair growth, dermal ridges, sweat glands and molars. The number of hair follicles in the transgenic mice is the same as in wild-type; though the development of follicles and associated glands varies from indistinguishable from wild-type to smaller and/or only partially formed. These results suggest that the other EDA isoforms may not be absolutely required for skin appendage formation, but consistent with distinctive temporal and spatial expression of the EDA-A2 isoform, are likely required for appropriate timing and completeness of development. Our data provide the first direct physiological evidence that EDA-A1 is a key regulator of hair follicle and sweat gland initiation; its soluble ligand form could aid in deriving therapeutic reagents for conditions affecting hair and sweat gland formation.

  2. Visual Cues Given by Humans Are Not Sufficient for Asian Elephants (Elephas maximus) to Find Hidden Food

    PubMed Central

    Plotnik, Joshua M.; Pokorny, Jennifer J.; Keratimanochaya, Titiporn; Webb, Christine; Beronja, Hana F.; Hennessy, Alice; Hill, James; Hill, Virginia J.; Kiss, Rebecca; Maguire, Caitlin; Melville, Beckett L.; Morrison, Violet M. B.; Seecoomar, Dannah; Singer, Benjamin; Ukehaxhaj, Jehona; Vlahakis, Sophia K.; Ylli, Dora; Clayton, Nicola S.; Roberts, John; Fure, Emilie L.; Duchatelier, Alicia P.; Getz, David

    2013-01-01

    Recent research suggests that domesticated species – due to artificial selection by humans for specific, preferred behavioral traits – are better than wild animals at responding to visual cues given by humans about the location of hidden food. \\Although this seems to be supported by studies on a range of domesticated (including dogs, goats and horses) and wild (including wolves and chimpanzees) animals, there is also evidence that exposure to humans positively influences the ability of both wild and domesticated animals to follow these same cues. Here, we test the performance of Asian elephants (Elephas maximus) on an object choice task that provides them with visual-only cues given by humans about the location of hidden food. Captive elephants are interesting candidates for investigating how both domestication and human exposure may impact cue-following as they represent a non-domesticated species with almost constant human interaction. As a group, the elephants (n = 7) in our study were unable to follow pointing, body orientation or a combination of both as honest signals of food location. They were, however, able to follow vocal commands with which they were already familiar in a novel context, suggesting the elephants are able to follow cues if they are sufficiently salient. Although the elephants’ inability to follow the visual cues provides partial support for the domestication hypothesis, an alternative explanation is that elephants may rely more heavily on other sensory modalities, specifically olfaction and audition. Further research will be needed to rule out this alternative explanation. PMID:23613804

  3. Internal carbonic anhydrase activity in the tissue of scleractinian corals is sufficient to support proposed roles in photosynthesis and calcification.

    PubMed

    Hopkinson, Brian M; Tansik, Anna L; Fitt, William K

    2015-07-01

    Reef-building corals import inorganic carbon (Ci) to build their calcium carbonate skeletons and to support photosynthesis by the symbiotic algae that reside in their tissue. The internal pathways that deliver Ci for both photosynthesis and calcification are known to involve the enzyme carbonic anhydrase (CA), which interconverts CO2 and HCO3 (-). We have developed a method for absolute quantification of internal CA (iCA) activity in coral tissue based on the rate of (18)O-removal from labeled Ci. The method was applied to three Caribbean corals (Orbicella faveolata, Porites astreoides and Siderastrea radians) and showed that these species have similar iCA activities per unit surface area, but that S. radians has ∼10-fold higher iCA activity per unit tissue volume. A model of coral Ci processing shows that the measured iCA activity is sufficient to support the proposed roles for iCA in Ci transport for photosynthesis and calcification. This is the case even when iCA activity is homogeneously distributed throughout the coral, but the model indicates that it would be advantageous to concentrate iCA in the spaces where calcification (the calcifying fluid) and photosynthesis (the oral endoderm) take place. We argue that because the rates of photosynthesis and calcification per unit surface area are similar among the corals studied here, the areal iCA activity used to deliver Ci for these reactions should also be similar. The elevated iCA activity per unit volume of S. radians compared with that of the other species is probably due to the thinner effective tissue thickness in this species.

  4. β-Subunit Binding Is Sufficient for Ligands to Open the Integrin αIIbβ3 Headpiece.

    PubMed

    Lin, Fu-Yang; Zhu, Jianghai; Eng, Edward T; Hudson, Nathan E; Springer, Timothy A

    2016-02-26

    The platelet integrin αIIbβ3 binds to a KQAGDV motif at the fibrinogen γ-chain C terminus and to RGD motifs present in loops in many extracellular matrix proteins. These ligands bind in a groove between the integrin α and β-subunits; the basic Lys or Arg side chain hydrogen bonds to the αIIb-subunit, and the acidic Asp side chain coordinates to a metal ion held by the β3-subunit. Ligand binding induces headpiece opening, with conformational change in the β-subunit. During this opening, RGD slides in the ligand-binding pocket toward αIIb, with movement of the βI-domain β1-α1 loop toward αIIb, enabling formation of direct, charged hydrogen bonds between the Arg side chain and αIIb. Here we test whether ligand interactions with β3 suffice for stable ligand binding and headpiece opening. We find that the AGDV tetrapeptide from KQAGDV binds to the αIIbβ3 headpiece with affinity comparable with the RGDSP peptide from fibronectin. AGDV induced complete headpiece opening in solution as shown by increase in hydrodynamic radius. Soaking of AGDV into closed αIIbβ3 headpiece crystals induced intermediate states similarly to RGDSP. AGDV has very little contact with the α-subunit. Furthermore, as measured by epitope exposure, AGDV, like the fibrinogen γ C-terminal peptide and RGD, caused integrin extension on the cell surface. Thus, pushing by the β3-subunit on Asp is sufficient for headpiece opening and ligand sliding, and no pulling by the αIIb subunit on Arg is required.

  5. Activation of G-protein-coupled receptor 30 is sufficient to enhance spatial recognition memory in ovariectomized rats.

    PubMed

    Hawley, Wayne R; Grissom, Elin M; Moody, Nicole M; Dohanich, Gary P; Vasudevan, Nandini

    2014-04-01

    In ovariectomized rats, administration of estradiol, or selective estrogen receptor agonists that activate either the α or β isoforms, have been shown to enhance spatial cognition on a variety of learning and memory tasks, including those that capitalize on the preference of rats to seek out novelty. Although the effects of the putative estrogen G-protein-coupled receptor 30 (GPR30) on hippocampus-based tasks have been reported using food-motivated tasks, the effects of activation of GPR30 receptors on tasks that depend on the preference of rats to seek out spatial novelty remain to be determined. Therefore, the aim of the current study was to determine if short-term treatment of ovariectomized rats with G-1, an agonist for GPR30, would mimic the effects on spatial recognition memory observed following short-term estradiol treatment. In Experiment 1, ovariectomized rats treated with a low dose (1 μg) of estradiol 48 h and 24 h prior to the information trial of a Y-maze task exhibited a preference for the arm associated with the novel environment on the retention trial conducted 48 h later. In Experiment 2, treatment of ovariectomized rats with G-1 (25 μg) 48 h and 24 h prior to the information trial of a Y-maze task resulted in a greater preference for the arm associated with the novel environment on the retention trial. Collectively, the results indicated that short-term treatment of ovariectomized rats with a GPR30 agonist was sufficient to enhance spatial recognition memory, an effect that also occurred following short-term treatment with a low dose of estradiol.

  6. Organic fertilization and sufficient nutrient status in prehistoric agriculture?--Indications from multi-proxy analyses of archaeological topsoil relicts.

    PubMed

    Lauer, Franziska; Prost, Katharina; Gerlach, Renate; Pätzold, Stefan; Wolf, Mareike; Urmersbach, Sarah; Lehndorff, Eva; Eckmeier, Eileen; Amelung, Wulf

    2014-01-01

    Neolithic and Bronze Age topsoil relicts revealed enhanced extractable phosphorus (P) and plant available inorganic P fractions, thus raising the question whether there was targeted soil amelioration in prehistoric times. This study aimed (i) at assessing the overall nutrient status and the soil organic matter content of these arable topsoil relicts, and (ii) at tracing ancient soil fertilizing practices by respective stable isotope and biomarker analyses. Prehistoric arable topsoils were preserved in archaeological pit fillings, whereas adjacent subsoils served as controls. One Early Weichselian humic zone represented the soil status before the introduction of agriculture. Recent topsoils served as an additional reference. The applied multi-proxy approach comprised total P and micronutrient contents, stable N isotope ratios, amino acid, steroid, and black carbon analyses as well as soil color measurements. Total contents of P and selected micronutrients (I, Cu, Mn, Mo, Se, Zn) of the arable soil relicts were above the limits for which nutrient deficiencies could be assumed. All pit fillings exhibited elevated δ15N values close to those of recent topsoils (δ15N>6 to 7‰), giving first hints for prehistoric organic N-input. Ancient legume cultivation as a potential source for N input could not be verified by means of amino acid analysis. In contrast, bile acids as markers for faecal input exhibited larger concentrations in the pit fillings compared with the reference and control soils indicating faeces (i.e. manure) input to Neolithic arable topsoils. Also black carbon contents were elevated, amounting up to 38% of soil organic carbon, therewith explaining the dark soil color in the pit fillings and pointing to inputs of burned biomass. The combination of different geochemical analyses revealed a sufficient nutrient status of prehistoric arable soils, as well as signs of amelioration (inputs of organic material like charcoal and faeces-containing manure).

  7. Short-term treatment with nitrate is not sufficient to induce in vivo antithrombotic effects in rats and mice.

    PubMed

    Kramkowski, K; Leszczynska, A; Przyborowski, K; Proniewski, B; Marcinczyk, N; Rykaczewska, U; Jarmoc, D; Chabielska, E; Chlopicki, S

    2017-01-01

    In humans, short-term supplementation with nitrate is hypotensive and inhibits platelet aggregation via an nitric oxide (NO)-dependent mechanism. In the present work, we analyzed whether short-term treatment with nitrate induces antithrombotic effects in rats and mice. Arterial thrombosis was evoked electrically in a rat model in which renovascular hypertension was induced by partial ligation of the left renal artery. In mice expressing green fluorescent protein, laser-induced thrombosis was analyzed intravitally by using confocal microscope. Sodium nitrate (NaNO3) or sodium nitrite (NaNO2) was administered orally at a dose of 0.17 mmol/kg, twice per day for 3 days. Short-term nitrate treatment did not modify thrombus formation in either rats or mice, while nitrite administration led to pronounced antithrombotic activity. In hypertensive rats, nitrite treatment resulted in a significant decrease in thrombus weight (0.50 ± 0.08 mg vs. VEH 0.96 ± 0.09 mg; p < 0.01). In addition, nitrite inhibited ex vivo platelet aggregation and thromboxane B2 (TxB2) generation and prolonged prothrombin time. These effects were accompanied by significant increases in blood NOHb concentration and plasma nitrite concentration. In contrast, nitrate did not affect ex vivo platelet aggregation or prothrombin time and led to only slightly elevated nitrite plasma concentration. In mice, nitrate was also ineffective, while nitrite led to decreased platelet accumulation in the area of laser-induced endothelial injury. In conclusion, although nitrite induced profound NO-dependent antithrombotic effects in vivo, conversion of nitrates to nitrite in rats and mice over short-term 3-day treatment was not sufficient to elicit NO-dependent antiplatelet or antithrombotic effects.

  8. Oxidation of nanoscale zero-valent iron under sufficient and limited dissolved oxygen: Influences on aggregation behaviors.

    PubMed

    Jiang, Danlie; Hu, Xialin; Wang, Rui; Yin, Daqiang

    2015-03-01

    Oxidations of nanoscale zero-valent iron (nZVI) under aerobic (dissolved oxygen≈8mgL(-1)) and anaerobic (dissolved oxygen <3mgL(-1)) conditions were simulated, and their influences on aggregation behaviors of nZVI were investigated. The two oxidation products were noted as HO-nZVI (nZVI oxidized in highly oxygenated water) and LO-nZVI (nZVI oxidized in lowly oxygenated water) respectively. The metallic iron of the oxidized nZVI was almost exhausted (Fe(0)≈8±5%), thus magnetization mainly depended on magnetite content. Since sufficient dissolved oxygen led to the much less magnetite (∼15%) in HO-nZVI than that in LO-nZVI (>90%), HO-nZVI was far less magnetic (Ms=88kAm(-1)) than LO-nZVI (Ms=365kAm(-1)). Consequently, HO-nZVI formed small agglomerates (228±10nm), while LO-nZVI tended to form chain-like aggregations (>1μm) which precipitated rapidly. Based on the EDLVO theory, we suggested that dissolved oxygen level determined aggregation morphologies by controlling the degree of oxidation and the magnitude of magnetization. Then the chain-like alignment of LO-nZVI would promote further aggregation, but the agglomerate morphology of HO-nZVI would eliminate magnetic forces and inhibit the aggregation while HO-nZVI remained magnetic. Our results indicated the fine colloidal stability of HO-nZVI, which might lead to the great mobility in the environment.

  9. Increased classical endoplasmic reticulum stress is sufficient to reduce chondrocyte proliferation rate in the growth plate and decrease bone growth.

    PubMed

    Kung, Louise H W; Rajpar, M Helen; Preziosi, Richard; Briggs, Michael D; Boot-Handford, Raymond P

    2015-01-01

    Mutations in genes encoding cartilage oligomeric matrix protein and matrilin-3 cause a spectrum of chondrodysplasias called multiple epiphyseal dysplasia (MED) and pseudoachondroplasia (PSACH). The majority of these diseases feature classical endoplasmic reticulum (ER) stress and activation of the unfolded protein response (UPR) as a result of misfolding of the mutant protein. However, the importance and the pathological contribution of ER stress in the disease pathogenesis are unknown. The aim of this study was to investigate the generic role of ER stress and the UPR in the pathogenesis of these diseases. A transgenic mouse line (ColIITgcog) was generated using the collagen II promoter to drive expression of an ER stress-inducing protein (Tgcog) in chondrocytes. The skeletal and histological phenotypes of these ColIITgcog mice were characterised. The expression and intracellular retention of Tgcog induced ER stress and activated the UPR as characterised by increased BiP expression, phosphorylation of eIF2α and spliced Xbp1. ColIITgcog mice exhibited decreased long bone growth and decreased chondrocyte proliferation rate. However, there was no disruption of chondrocyte morphology or growth plate architecture and perturbations in apoptosis were not apparent. Our data demonstrate that the targeted induction of ER stress in chondrocytes was sufficient to reduce the rate of bone growth, a key clinical feature associated with MED and PSACH, in the absence of any growth plate dysplasia. This study establishes that classical ER stress is a pathogenic factor that contributes to the disease mechanism of MED and PSACH. However, not all the pathological features of MED and PSACH were recapitulated, suggesting that a combination of intra- and extra-cellular factors are likely to be responsible for the disease pathology as a whole.

  10. How Fast Is Your Body Motion? Determining a Sufficient Frame Rate for an Optical Motion Tracking System Using Passive Markers.

    PubMed

    Song, Min-Ho; Godøy, Rolf Inge

    2016-01-01

    This paper addresses how to determine a sufficient frame (sampling) rate for an optical motion tracking system using passive reflective markers. When using passive markers for the optical motion tracking, avoiding identity confusion between the markers becomes a problem as the speed of motion increases, necessitating a higher frame rate to avoid a failure of the motion tracking caused by marker confusions and/or dropouts. Initially, one might believe that the Nyquist-Shannon sampling rate estimated from the assumed maximal temporal variation of a motion (i.e. a sampling rate at least twice that of the maximum motion frequency) could be the complete solution to the problem. However, this paper shows that also the spatial distance between the markers should be taken into account in determining the suitable frame rate of an optical motion tracking with passive markers. In this paper, a frame rate criterion for the optical tracking using passive markers is theoretically derived and also experimentally verified using a high-quality optical motion tracking system. Both the theoretical and the experimental results showed that the minimum frame rate is proportional to the ratio between the maximum speed of the motion and the minimum spacing between markers, and may also be predicted precisely if the proportional constant is known in advance. The inverse of the proportional constant is here defined as the tracking efficiency constant and it can be easily determined with some test measurements. Moreover, this newly defined constant can provide a new way of evaluating the tracking algorithm performance of an optical tracking system.

  11. How Fast Is Your Body Motion? Determining a Sufficient Frame Rate for an Optical Motion Tracking System Using Passive Markers

    PubMed Central

    Song, Min-Ho; Godøy, Rolf Inge

    2016-01-01

    This paper addresses how to determine a sufficient frame (sampling) rate for an optical motion tracking system using passive reflective markers. When using passive markers for the optical motion tracking, avoiding identity confusion between the markers becomes a problem as the speed of motion increases, necessitating a higher frame rate to avoid a failure of the motion tracking caused by marker confusions and/or dropouts. Initially, one might believe that the Nyquist-Shannon sampling rate estimated from the assumed maximal temporal variation of a motion (i.e. a sampling rate at least twice that of the maximum motion frequency) could be the complete solution to the problem. However, this paper shows that also the spatial distance between the markers should be taken into account in determining the suitable frame rate of an optical motion tracking with passive markers. In this paper, a frame rate criterion for the optical tracking using passive markers is theoretically derived and also experimentally verified using a high-quality optical motion tracking system. Both the theoretical and the experimental results showed that the minimum frame rate is proportional to the ratio between the maximum speed of the motion and the minimum spacing between markers, and may also be predicted precisely if the proportional constant is known in advance. The inverse of the proportional constant is here defined as the tracking efficiency constant and it can be easily determined with some test measurements. Moreover, this newly defined constant can provide a new way of evaluating the tracking algorithm performance of an optical tracking system. PMID:26967900

  12. Duct Drainage Alone is Sufficient in the Operative Management of Pancreatic Pseudocyst in Patients With Chronic Pancreatitis

    PubMed Central

    Nealon, William H.; Walser, Eric

    2003-01-01

    Objective To test a hypothesis that definitive management of pseudocyst associated with chronic pancreatitis is predicated on addressing pancreatic ductal anatomy. Summary Background Data The authors have previously confirmed the impact of pancreatic ductal anatomic abnormalities on the success of percutaneous drainage of pancreatic pseudocyst. The authors have further defined a system to categorize the pancreatic ductal abnormalities that can be seen with pancreatic pseudocyst. The authors have published, as have others, the usefulness of defining ductal anatomy when managing pancreatic pseudocysts associated with chronic pancreatitis. Methods Beginning in 1985, all patients with pseudocyst who were candidates for intervention (operative, percutaneous, or endoscopic) have undergone endoscopic retrograde cholangiopancreatography (ERCP). An associated diagnosis of chronic pancreatitis was established by means of ERCP findings. Patients were candidates for longitudinal pancreaticojejunostomy (LPJ) if they had a pancreatic ductal diameter greater than 7 mm. In a nonrandomized fashion, patients were managed with either combined simultaneous LPJ and pseudocyst drainage or with LPJ alone. Results Two hundred fifty-three patients with pseudocyst have been evaluated. Among these there have been 103 patients with chronic pancreatitis and main pancreatic duct (MPD) dilatation (>7 mm). Among these 103 patients, 56 underwent combined LPJ/pseudocyst drainage and 47 had LPJ alone. Compared to combined LPJ/pseudocyst drainage, the patients undergoing LPJ alone had a shorter operative time, slightly less transfusion requirement, slightly reduced length of hospital stay, and slightly reduced complication rate. Long-term pain relief was achieved in 90%, and pseudocyst recurrence was less than 1%. Rates of each of these long-term outcomes were nearly incidental among the two groups. Conclusions Ductal drainage alone (LPJ) is sufficient in patients with chronic pancreatitis (MPD > 7

  13. Activation of the renin-angiotensin system, specifically in the subfornical organ is sufficient to induce fluid intake.

    PubMed

    Coble, Jeffrey P; Cassell, Martin D; Davis, Deborah R; Grobe, Justin L; Sigmund, Curt D

    2014-08-15

    Increased activity of the renin-angiotensin system within the brain elevates fluid intake, blood pressure, and resting metabolic rate. Renin and angiotensinogen are coexpressed within the same cells of the subfornical organ, and the production and action of ANG II through the ANG II type 1 receptor in the subfornical organ (SFO) are necessary for fluid intake due to increased activity of the brain renin-angiotensin system. We generated an inducible model of ANG II production by breeding transgenic mice expressing human renin in neurons controlled by the synapsin promoter with transgenic mice containing a Cre-recombinase-inducible human angiotensinogen construct. Adenoviral delivery of Cre-recombinase causes SFO-selective induction of human angiotensinogen expression. Selective production of ANG II in the SFO results in increased water intake but did not change blood pressure or resting metabolic rate. The increase in water intake was ANG II type 1 receptor-dependent. When given a choice between water and 0.15 M NaCl, these mice increased total fluid and sodium, but not water, because of an increased preference for NaCl. When provided a choice between water and 0.3 M NaCl, the mice exhibited increased fluid, water, and sodium intake, but no change in preference for NaCl. The increase in fluid intake was blocked by an inhibitor of PKC, but not ERK, and was correlated with increased phosphorylated cyclic AMP response element binding protein in the subfornical organ. Thus, increased production and action of ANG II specifically in the subfornical organ are sufficient on their own to mediate an increase in drinking through PKC.

  14. Electrocommunication signals alone are sufficient to increase neurogenesis in the brain of adult electric fish, Apteronotus leptorhynchus.

    PubMed

    Dunlap, Kent D; McCarthy, Elizabeth A; Jashari, Denisa

    2008-10-01

    Social interaction can have profound influences on the structure of the adult brain, but little is known about the precise stimulus feature found within social interaction that induces such brain plasticity. We examined the effects of social stimuli on cell addition and radial glial fiber formation in the brains of adult electric fish. These fish communicate primarily through weak, quasi-sinusoidal electric signals. Fish were housed in isolation, paired with another fish or exposed to only the electrocommunication signals of another fish for 7 days. After 3 days of exposure to these stimulus conditions, fish were injected with bromodeoxyuridine (BrdU) to mark newborn cells. We sacrificed the fish 4 days after BrdU injection and used immunohistochemistry to measure cell addition (BrdU+), the fraction of added cells that differentiated into neurons (BrdU+/NeuroTrace+) and the density of radial glia fibers (vimentin+) in the periventricular zone of the diencephalon. Fish that were exposed only to the electrocommunication signals of another fish and no other social stimuli had equivalent levels of cell addition and radial glial fiber density to fish that were housed with full social interaction and higher levels than fish housed in isolation. About 60% of the added cells differentiated into neurons; this fraction did not differ among treatment groups. Artificial sine wave electrical stimuli that mimicked electrocommunication signals were ineffective in increasing cell addition and glia fiber formation above those found in isolated fish. Thus, stimuli through a single modality are sufficient for inducing this brain plasticity, but the waveform or dynamic features of communication signals are crucial for the effect.

  15. Do Young Heroin Users in Madrid, Barcelona and Seville have Sufficient Knowledge of the Risk Factors for Unintentional Opioid Overdose?

    PubMed Central

    Barrio, Gregorio; Brugal, M. Teresa; de la Fuente, Luis; Ballesta, Rosario; Bravo, María J.; Silva, Teresa C.; Rodríguez-Martos, Alicia

    2006-01-01

    To identify the self-perceived reasons for unintentional opioid overdose of young heroin users in three Spanish cities and their agreement with objective risk factors for overdose. Computer-Assisted Personal Interviews (CAPI) were held with 991 street-recruited current heroin users aged 18–30. The general reasons for overdose and the reasons for the last overdose suffered were explored with open-ended (OEQs) and pre-coded questions (PCQs). Limited knowledge of overdose risk factors was defined as mention of fewer than two objective risk factors for unintentional overdose in the OEQ. Univariate, bivariate, and logistic regression methods were used. 77.8% (Seville), 64.9% (Madrid) and 57.2% (Barcelona) of participants have limited knowledge of overdose risk factors. Residence in Seville and not having attended courses or meetings on overdoses were significantly associated with limited knowledge, after adjusting for other factors. The most frequently identified general reasons in OEQ or PCQ were using heroin in large amounts (66.8%), together with tranquilizers (62.0%), adulterated (60.7%), or purer than usual (57.6%). Most reasons were selected more frequently in PCQ than in OEQ, especially rapid injection of the entire dose and using heroin shortly after using tranquilizers or alcohol, by injection, or after a period of abstinence. The results were similar for overdoses suffered by participants. Most young heroin users do not have sufficient knowledge of overdose risk factors, especially the use of heroin by injection, after a period of abstinence, or together with alcohol or methadone. Specific informational or educational programs adapted to the local context are critically needed. PMID:16739049

  16. Phosphorylation of I kappa B alpha precedes but is not sufficient for its dissociation from NF-kappa B.

    PubMed Central

    DiDonato, J A; Mercurio, F; Karin, M

    1995-01-01

    NF-kappa B is an important activator of immune and inflammatory response genes. NF-kappa B is sequestered in the cytoplasm of nonstimulated cells through interaction with the I kappa B inhibitors. These inactive complexes are dissociated in response to a variety of extracellular signals, thereby allowing free NF-kappa B dimers to translocate to the nucleus and active transcription of specific target genes. The current dogma is that phosphorylation of the I kappa Bs is responsible for dissociation of the inactive complexes, an event that is rendered irreversible by rapid I kappa B degradation. Here, we show that inducers of NF-kappa B activity stimulate the hyperphosphorylation of one of the I kappa Bs, I kappa B alpha. However, contrary to the present dogma the hyperphosphorylated form of I kappa B alpha remains associated with NF-kappa B components such as RelA (p65). Thus, phosphorylation of I kappa B alpha is not sufficient to cause dissociation of the inactive NF-kappa B:I kappa B alpha complex. However, that complex is disrupted through the selective degradation of phosphorylated I kappa B alpha in response to extracellular signals. Using a variety of protease inhibitors, some of which have specificity towards the multicatalytic proteinase complex, we demonstrate that degradation of I kappa B alpha is required for NF-kappa B activation. The results of these experiments are more consistent with a new model according to which phosphorylation of I kappa B alpha associated with NF-kappa B marks it for proteolytic degradation. I kappa B alpha is degraded while bound to NF-kappa B. The selective degradation of I kappa B alpha releases active NF-kappa B dimers which can translocate to the nucleus to activate specific target genes. PMID:7862124

  17. Formation of Nitric Oxide by Aldehyde Dehydrogenase-2 Is Necessary and Sufficient for Vascular Bioactivation of Nitroglycerin*

    PubMed Central

    Opelt, Marissa; Eroglu, Emrah; Waldeck-Weiermair, Markus; Russwurm, Michael; Koesling, Doris; Malli, Roland; Graier, Wolfgang F.; Fassett, John T.; Schrammel, Astrid; Mayer, Bernd

    2016-01-01

    Aldehyde dehydrogenase-2 (ALDH2) catalyzes vascular bioactivation of the antianginal drug nitroglycerin (GTN), resulting in activation of soluble guanylate cyclase (sGC) and cGMP-mediated vasodilation. We have previously shown that a minor reaction of ALDH2-catalyzed GTN bioconversion, accounting for about 5% of the main clearance-based turnover yielding inorganic nitrite, results in direct NO formation and concluded that this minor pathway could provide the link between vascular GTN metabolism and activation of sGC. However, lack of detectable NO at therapeutically relevant GTN concentrations (≤1 μm) in vascular tissue called into question the biological significance of NO formation by purified ALDH2. We addressed this issue and used a novel, highly sensitive genetically encoded fluorescent NO probe (geNOp) to visualize intracellular NO formation at low GTN concentrations (≤1 μm) in cultured vascular smooth muscle cells (VSMC) expressing an ALDH2 mutant that reduces GTN to NO but lacks clearance-based GTN denitration activity. NO formation was compared with GTN-induced activation of sGC. The addition of 1 μm GTN to VSMC expressing either wild-type or C301S/C303S ALDH2 resulted in pronounced intracellular NO elevation, with maximal concentrations of 7 and 17 nm, respectively. Formation of GTN-derived NO correlated well with activation of purified sGC in VSMC lysates and cGMP accumulation in intact porcine aortic endothelial cells infected with wild-type or mutant ALDH2. Formation of NO and cGMP accumulation were inhibited by ALDH inhibitors chloral hydrate and daidzin. The present study demonstrates that ALDH2-catalyzed NO formation is necessary and sufficient for GTN bioactivation in VSMC. PMID:27679490

  18. Glucocorticoid-induced leucine zipper enhanced expression in dendritic cells is sufficient to drive regulatory T cells expansion in vivo.

    PubMed

    Calmette, Joseph; Ellouze, Mehdi; Tran, Thi; Karaki, Soumaya; Ronin, Emilie; Capel, Francis; Pallardy, Marc; Bachelerie, Françoise; Krzysiek, Roman; Emilie, Dominique; Schlecht-Louf, Géraldine; Godot, Véronique

    2014-12-15

    Tolerance induction by dendritic cells (DCs) is, in part, mediated by the activation of regulatory T cells (Tregs). We have previously shown in vitro that human DCs treated with glucocorticoids (GCs), IL-10, or TGF-β upregulate the GC-Induced Leucine Zipper protein (GILZ). GILZ overexpression promotes DC differentiation into regulatory cells that generate IL-10-producing Ag-specific Tregs. To investigate whether these observations extend in vivo, we have generated CD11c-GILZ(hi) transgenic mice. DCs from these mice constitutively overexpress GILZ to levels observed in GC-treated wild-type DCs. In this article, we establish that GILZ(hi) DCs display an accumulation of Foxp3(+) Tregs in the spleens of young CD11c-GILZ(hi) mice. In addition, we show that GILZ(hi) DCs strongly increase the Treg pool in central and peripheral lymphoid organs of aged animals. Upon adoptive transfer to wild-type recipient mice, OVA-loaded GILZ(hi) bone marrow-derived DCs induce a reduced activation and proliferation of OVA-specific T cells as compared with control bone marrow-derived DCs, associated with an expansion of thymus-derived CD25(+)Foxp3(+) CD4 T cells. Transferred OVA-loaded GILZ(hi) DCs produce significantly higher levels of IL-10 and express reduced levels of MHC class II molecules as compared with OVA-loaded control DCs, emphasizing the regulatory phenotype of GILZ(hi) DCs in vivo. Thus, our work demonstrates in vivo that the GILZ overexpression alone is sufficient to promote a tolerogenic mode of function in DCs.

  19. Limited physical contact through a mesh barrier is sufficient for social reward-conditioned place preference in adolescent male rats.

    PubMed

    Peartree, Natalie A; Hood, Lauren E; Thiel, Kenneth J; Sanabria, Federico; Pentkowski, Nathan S; Chandler, Kayla N; Neisewander, Janet L

    2012-02-01

    Adolescence is a period of enhanced sensitivity to social influences and vulnerability to drug abuse. Social reward in adolescent rats has been demonstrated with the conditioned place preference (CPP) model, but it is not clear whether limited contact with another rat without play is sufficient to produce reward. We investigated this issue using an apparatus containing two main compartment, each with a wire mesh barrier that allowed rats placed on either side of the barrier to have limited physical contact. Adolescent male rats were given two conditioning sessions/day for 2 or 8 days following baseline preference tests. Rats were placed into their preferred side alone for one daily 10-min session and into their initially non-preferred side (i.e., CS) for the other session during which they either had restricted or unrestricted physical access to another rat (Rat/Mesh or Rat/Phys, respectively) or to a tennis ball (Ball/Mesh or Ball/Phys, respectively) unconditioned stimulus (US). Only the Rat/Phys group exhibited CPP after 2 CS-US pairings; however, after 8 CS-US pairings, the Rat/Mesh and Ball/Phys groups also exhibited CPP. During conditioning, the rat US elicited more robust approach and contact behavior compared to the ball, regardless of physical or restricted access. The incidence of contact and/or approach increased as the number of exposures increased. The results suggest that the rank order of US reward efficacy was physical contact with a rat>limited contact with a rat>physical contact with a ball, and that rough-and-tumble play is not necessary to establish social reward-CPP. The findings have important implications for emerging drug self-administration models in which two rats self-administering drug intravenously have limited physical contact via a mesh barrier shared between their respective operant conditioning chambers.

  20. Neuron specific reduction in CuZnSOD is not sufficient to initiate a full sarcopenia phenotype.

    PubMed

    Sataranatarajan, Kavithalakshmi; Qaisar, Rizwan; Davis, Carol; Sakellariou, Giorgos K; Vasilaki, Aphrodite; Zhang, Yiqiang; Liu, Yuhong; Bhaskaran, Shylesh; McArdle, Anne; Jackson, Malcolm; Brooks, Susan V; Richardson, Arlan; Van Remmen, Holly

    2015-08-01

    Our previous studies showed that adult (8 month) mice lacking CuZn-superoxide dismutase (CuZnSOD, Sod1KO mice) have neuromuscular changes resulting in dramatic accelerated muscle atrophy and weakness that mimics age-related sarcopenia. We have further shown that loss of CuZnSOD targeted to skeletal muscle alone results in only mild weakness and no muscle atrophy. In this study, we targeted deletion of CuZnSOD specifically to neurons (nSod1KO mice) and determined the effect on muscle mass and weakness. The nSod1KO mice show a significant loss of CuZnSOD activity and protein level in brain and spinal cord but not in muscle tissue. The masses of the gastrocnemius, tibialis anterior and extensor digitorum longus (EDL) muscles were not reduced in nSod1KO compared to wild type mice, even at 20 months of age, although the quadriceps and soleus muscles showed small but statistically significant reductions in mass in the nSod1KO mice. Maximum isometric specific force was reduced by 8-10% in the gastrocnemius and EDL muscle of nSod1KO mice, while soleus was not affected. Muscle mitochondrial ROS generation and oxidative stress measured by levels of reactive oxygen/nitrogen species (RONS) regulatory enzymes, protein nitration and F2-isoprostane levels were not increased in muscle from the nSod1KO mice. Although we did not find evidence of denervation in the nSod1KO mice, neuromuscular junction morphology was altered and the expression of genes associated with denervation acetylcholine receptor subunit alpha (AChRα), the transcription factor, Runx1 and GADD45α) was increased, supporting a role for neuronal loss of CuZnSOD initiating alterations at the neuromuscular junction. These results and our previous studies support the concept that CuZnSOD deficits in either the motor neuron or muscle alone are not sufficient to initiate a full sarcopenic phenotype and that deficits in both tissues are required to recapitulate the loss of muscle observed in Sod1KO mice.