Sample records for adrenal fasciculata cells

  1. Voltage-dependent currents and modulation of calcium channel expression in zona fasciculata cells from rat adrenal gland.

    PubMed Central

    Barbara, J G; Takeda, K


    1. Whole-cell voltage-activated currents from single zona fasciculata (ZF) cells from rat adrenal glands were studied. T- and L-type Ca2+ currents and a slowly inactivating A-type K+ current were the three major currents observed. 2. In freshly isolated cells, the A-type K+ current and the T-type Ca2+ current were predominant. The A-type current was activated at -50 mV and inhibited by 4-amino-pyridine with a half-maximal block (IC50) at 130 microM while the T-type current was activated at -70 mV and blocked by Cd2+, Ni2+ and amiloride with IC50 values of 24.1, 132.4 and 518.9 microM, respectively. 3. Under current clamp, depolarizing current pulses produced a single Ca2+ action potential with Cs+ in the pipette internal solution. Upon replacement of Cs+ by K+, the half-amplitude width of the action potential was shortened and membrane potential oscillations were seen after the spike. 4. In freshly isolated cells and during the first 24 h after plating, the T-type current was observed in all cells, with L-type current being observed in < 2% of cells, even in the presence of (+)SDZ 202,791, a dihydropyridine Ca2+ channel agonist. With time in culture, the T-type current disappeared, and a high-voltage-activated L-type current became increasingly apparent. In cells tested after > 2 days in culture, (+)SDZ 202,791 potentiated L-type current by 407 +/- 12% and the antagonist (-)SDZ 202,791 blocked this increase. The L-type current was activated between -30 and -20 mV and was sensitive to nitrendipine and omega-conotoxin GVIA. 5. Pre-incubation of cultured ZF cells with adrenocorticotrophic hormone (ACTH) or vasoactive intestinal peptide (VIP) for 3 days resulted in a high, sustained level of expression of T-type current, with a mean amplitude of 34.2 +/- 5.5 pA pF-1 for ACTH-treated cells compared with 3.4 +/- 1.8 pA pF-1 for untreated cells. Cycloheximide strongly inhibited this effect. Neither treatment affected L-type current expression. 6. The expression of both Ca

  2. Characterization of insulin-like growth factor I and insulin receptors on cultured bovine adrenal fasciculata cells. Role of these peptides on adrenal cell function

    SciTech Connect

    Penhoat, A.; Chatelain, P.G.; Jaillard, C.; Saez, J.M.


    We have characterized insulin-like growth factor I (IGF-I) and insulin receptors in cultured bovine adrenal cells by binding and cross-linking affinity experiments. At equilibrium the dissociation constant and the number of binding sites per cell for IGF-I were 1.4 +/- (SE) 0.3 x 10(-9) M and 19,200 +/- 2,100, respectively. Under reduction conditions, disuccinimidyl suberate cross-linked (/sup 125/I)iodo-IGF-I to one receptor complex with an Mr of 125,000. Adrenal cells also contain specific insulin receptors with an apparent dissociation constant (Kd) of 10(-9) M. Under reduction conditions (/sup 125/I)iodo-insulin binds to one band with an approximate Mr of 125,000. IGF-I and insulin at micromolar concentrations, but not at nanomolar concentrations, slightly stimulated DNA synthesis, but markedly potentiated the mitogenic action of fibroblast growth factor. Adrenal cells cultured in a serum-free medium containing transferrin, ascorbic acid, and insulin (5 micrograms/ml) maintained fairly constant angiotensin-II (A-II) receptor concentration per cell and increased cAMP release on response to ACTH and their steroidogenic response to both ACTH and A-II. When the cells were cultured in the same medium without insulin, the number of A-II receptors significantly decreased to 65% and the increased responsiveness was blunted. Treatment of such cells for 3 days with increasing concentrations of IGF-I (1-100 ng/ml) produced a 2- to 3-fold increase in A-II receptors and enhanced the cAMP response (3- to 4-fold) to ACTH and the steroidogenic response (4- to 6-fold) to ACTH and A-II. These effects were time and dose dependent (ED50 approximately equal to 10(-9) M). Insulin at micromolar concentrations produced an effect similar to that of IGF-I, but at nanomolar concentrations the effect was far less.

  3. Ca2+ and K+ channels of normal human adrenal zona fasciculata cells: Properties and modulation by ACTH and AngII

    PubMed Central

    Enyeart, Judith A.


    In whole cell patch clamp recordings, we found that normal human adrenal zona fasciculata (AZF) cells express voltage-gated, rapidly inactivating Ca2+ and K+ currents and a noninactivating, leak-type K+ current. Characterization of these currents with respect to voltage-dependent gating and kinetic properties, pharmacology, and modulation by the peptide hormones adrenocorticotropic hormone (ACTH) and AngII, in conjunction with Northern blot analysis, identified these channels as Cav3.2 (encoded by CACNA1H), Kv1.4 (KCNA4), and TREK-1 (KCNK2). In particular, the low voltage–activated, rapidly inactivating and slowly deactivating Ca2+ current (Cav3.2) was potently blocked by Ni2+ with an IC50 of 3 µM. The voltage-gated, rapidly inactivating K+ current (Kv1.4) was robustly expressed in nearly every cell, with a current density of 95.0 ± 7.2 pA/pF (n = 64). The noninactivating, outwardly rectifying K+ current (TREK-1) grew to a stable maximum over a period of minutes when recording at a holding potential of −80 mV. This noninactivating K+ current was markedly activated by cinnamyl 1-3,4-dihydroxy-α-cyanocinnamate (CDC) and arachidonic acid (AA) and inhibited almost completely by forskolin, properties which are specific to TREK-1 among the K2P family of K+ channels. The activation of TREK-1 by AA and inhibition by forskolin were closely linked to membrane hyperpolarization and depolarization, respectively. ACTH and AngII selectively inhibited the noninactivating K+ current in human AZF cells at concentrations that stimulated cortisol secretion. Accordingly, mibefradil and CDC at concentrations that, respectively, blocked Cav3.2 and activated TREK-1, each inhibited both ACTH- and AngII-stimulated cortisol secretion. These results characterize the major Ca2+ and K+ channels expressed by normal human AZF cells and identify TREK-1 as the primary leak-type channel involved in establishing the membrane potential. These findings also suggest a model for cortisol

  4. Transcriptome Profiling Reveals Differentially Expressed Transcripts Between the Human Adrenal Zona Fasciculata and Zona Reticularis

    PubMed Central

    Rege, Juilee; Nakamura, Yasuhiro; Wang, Tao; Merchen, Todd D.; Sasano, Hironobu


    Context: The human adrenal zona fasciculata (ZF) and zona reticularis (ZR) are responsible for the production of cortisol and 19-carbon steroids (often called adrenal androgens), respectively. However, the gene profiles and exact molecular mechanisms leading to the functional phenotype of the ZF and ZR are still not clearly defined. In the present study, we identified the transcripts that are differentially expressed in the ZF and ZR. Objective: The objective of the study was to compare the transcriptome profiles of ZF and ZR. Design and Methods: ZF and ZR were microdissected from 10 human adrenals. Total RNA was extracted from 10 ZF/ZR pairs and hybridized to Illumina microarray chips. The 10 most differentially expressed transcripts were studied with quantitative RT-PCR (qPCR). Immunohistochemistry was also performed on four zone-specific genes. Results: Microarray results demonstrated that only 347 transcripts of the 47 231 were significantly different by 2-fold or greater in the ZF and ZR. ZF had 195 transcripts with 2-fold or greater increase compared with its paired ZR, whereas ZR was found to have 152 transcripts with 2-fold or greater higher expression than in ZF. Microarray and qPCR analysis of transcripts encoding steroidogenic enzymes (n = 10) demonstrated that only 3β-hydroxysteroid dehydrogenase, steroid sulfotransferase, type 5 17β-hydroxysteroid dehydrogenase, and cytochrome b5 were significantly different. Immunohistochemistry and qPCR studies confirmed that the ZF had an increased expression of lymphoid enhancer-binding factor 1 and nephroblastoma overexpressed, whereas ZR showed an increased expression of solute carrier family 27 (fatty acid transporter) (SLC27A2), member 2 and TSPAN12 (tetraspanin 12) Conclusion: Microarray revealed several novel candidate genes for elucidating the molecular mechanisms governing the ZF and ZR, thereby increasing our understanding of the functional zonation of these two adrenocortical zones. PMID:24423296

  5. Interleukin 6 increases the in vitro expression of key proteins associated with steroidogenesis in the bovine adrenal zona fasciculata.


    McIlmoil, S; Strickland, J; Judd, A M


    In this study, the in vitro effects of interleukin 6 (IL-6) on the messenger RNAs (mRNAs) and proteins for key steroidogenic factors in the bovine adrenal zona fasciculata (ZF) were determined. Bovine adrenal glands were obtained from an abattoir, and the ZF was isolated. Strips of ZF were then exposed to different concentration of murine IL-6 and/or adrenocorticotropic hormone (ACTH) for various intervals, the protein and mRNA extracted, and the mRNA and protein expression determined by real-time polymerase chain reaction and Western blots. Exposure (1 h) to IL-6 increased in a concentration-dependent manner (10-pg IL-6/mL, P < 0.05 vs control; 100-pg IL-6/mL, P < 0.01 vs control) the relative expression of the mRNAs and proteins for steroidogenic acute regulatory protein (StAR), cholesterol side-chain cleavage enzyme (P450scc), 3β hydroxysteroid dehydrogenase type 2 (3β HSD), 17α-hydroxylase/17,20-lyase/17,20-desmolase (P450 17OH), steroid 21-hydroxylase (P450 21OH), steroid 11-β-hydroxylase type 1 (P450 11βOH), and steroidogenic factor 1 (SF-1), a nuclear factor that increases StAR and steroidogenic enzymes (SEs) expression. Similarly, IL-6 (10 pg/mL) increased the relative expression of proteins and mRNAs for StAR, P450scc, 3β HSD, P450 17OH, P450 21 OH, P450 11βOH, and SF-1 in a time-dependent manner (30 min, P < 0.05 vs control; 60, 120, and 240 min, P < 0.01 vs control). In contrast, IL-6 decreased in a concentration-dependent (P < 0.01 vs control for 1, 10, and 100 pg IL-6/mL) and time-dependent (P < 0.05 vs control for 30, 60,120, and 240 min of 10 pg IL-6/mL) manner the relative expression of the mRNA and protein for adrenal hypoplasia congenita-like protein (DAX-1), a nuclear factor that decreases expression of StAR and SEs. Incubation (1 h) of ZF with 100-nM ACTH increased (P < 0.05 vs control) the relative expression of StAR, P450scc, 3β HSD, P450 17OH, P450 21OH, P450 11βOH, and SF-1 and decreased (P < 0.01 vs control) the relative expression

  6. Adrenocorticotropin receptors in rat adrenal glomerulosa cells.


    Gallo-Payet, N; Escher, E


    The results presented here demonstrate, for the first time, the presence of ACTH receptors in the zona glomerulosa of adrenal glands. We obtained the surprising result that the glomerulosa cells carry a higher concentration of ACTH receptors than the fasciculata cells. The analog [Phe2,Nle4]ACTH was iodinated by the iodogen method and separated by HPLC; it was obtained carrier-free and has a specific activity of 600 muCi/micrograms, retaining full biological potency. After 30 min of incubation at 22 C for concentrations of 2 X 10(-11) M [125I]ACTH, specific binding values were 4.85 +/- 0.44% (n = 15) and 1.85 +/- 0.18% (n = 15), respectively, for 50,000 glomerulosa or fasciculata cells. For the glomerulosa, our results indicated a density of 6.5 X 10(4), receptors/cell of the high affinity type (Kd1 = 7.6 X 10(-11) M) and 1.0 X 10(6) receptors of the low affinity type (Kd2 = 1.2 X 10(-9) M). In the zona fasciculata, we found 7.2 X 10(3) receptors of high affinity (Kd1 = 1.1 X 10(-11) M) per cell and 6.3 X 10(5) of low affinity (Kd2 = 2.9 X 10(-9) M). The dissociation constant for the high affinity site of the glomerulosa cells was in excellent correlation with the half-maximal stimulation dose of ACTH for aldosterone and corticosterone (Kd1 = 7.6 X 10(-11) M vs. ED50 of 8 X 10(-11) and 3 X 10(-11) M). Results from primary cultures showed a decrease in binding capacity after 1 day in culture and then an increase to the initial value after 3 days in culture.

  7. Phenotype of proliferating cells stimulated during compensatory adrenal growth.


    Holzwarth, M A; Gomez-Sanchez, C E; Engeland, W C


    The phenotype of the proliferating cells during adrenocortical growth has remained controversial although glomerulosa, fasciculata and intermediate zone cells have all been considered possible candidates. This was due in part to the inability to identify specific adrenocortical cell types in comparing different types of growth. In the present studies, using immunocytochemical localization of cytochrome P450 aldosterone synthase (P450aldo) and cytochrome P450 11 beta-hydroxylase (P45011 beta) to identify adrenocortical cell phenotypes as well as Ki-67 to label proliferating cells, we have investigated the phenotype of the proliferating cells in the compensatory adrenal growth response to unilateral adrenalectomy. Between 24 and 96 hrs after unilateral adrenalectomy, most Ki-67(+) nuclei were found in the outermost region of the fasciculata, as defined by P45011 beta immunoreactive cells. Few Ki-67(+) nuclei were found in the glomerulosa, defined by P450aldo cells or in the z intermedia, identified by the absence of both P450aldo and P45011 beta. To test which cell type is activated by unilateral adrenalectomy, we altered the phenotypic configuration of the adrenal cortex; rats were placed on a low Na+ diet for three weeks, resulting in a marked expansion of the number of P450aldo(+) cells. An abundance of proliferating cells was identified primarily in the expanded glomerulosa, but not in the intermedia or fasciculata. In contrast, the proliferation associated with compensatory growth in these low Na+ rats, was localized primarily in the outer P45011 beta(+) zone. These findings suggest that the phenotype of the proliferating cell is specific to the growth promoting stimulus.

  8. Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms

    PubMed Central

    Walczak, Elisabeth M.; Kuick, Rork; Finco, Isabella; Bohin, Natacha; Hrycaj, Steven M.; Wellik, Deneen M.


    Wnt/β-catenin (βcat) signaling is critical for adrenal homeostasis. To elucidate how Wnt/βcat signaling elicits homeostatic maintenance of the adrenal cortex, we characterized the identity of the adrenocortical Wnt-responsive population. We find that Wnt-responsive cells consist of sonic hedgehog (Shh)-producing adrenocortical progenitors and differentiated, steroidogenic cells of the zona glomerulosa, but not the zona fasciculata and rarely cells that are actively proliferating. To determine potential direct inhibitory effects of βcat signaling on zona fasciculata-associated steroidogenesis, we used the mouse ATCL7 adrenocortical cell line that serves as a model system of glucocorticoid-producing fasciculata cells. Stimulation of βcat signaling caused decreased corticosterone release consistent with the observed reduced transcription of steroidogenic genes Cyp11a1, Cyp11b1, Star, and Mc2r. Decreased steroidogenic gene expression was correlated with diminished steroidogenic factor 1 (Sf1; Nr5a1) expression and occupancy on steroidogenic promoters. Additionally, βcat signaling suppressed the ability of Sf1 to transactivate steroidogenic promoters independent of changes in Sf1 expression level. To investigate Sf1-independent effects of βcat on steroidogenesis, we used Affymetrix gene expression profiling of Wnt-responsive cells in vivo and in vitro. One candidate gene identified, Ccdc80, encodes a secreted protein with unknown signaling mechanisms. We report that Ccdc80 is a novel βcat-regulated gene in adrenocortical cells. Treatment of adrenocortical cells with media containing secreted Ccdc80 partially phenocopies βcat-induced suppression of steroidogenesis, albeit through an Sf1-independent mechanism. This study reveals multiple mechanisms of βcat-mediated suppression of steroidogenesis and suggests that Wnt/βcat signaling may regulate adrenal homeostasis by inhibiting fasciculata differentiation and promoting the undifferentiated state of progenitor

  9. Cell cycle regulation of RPA1 transcript levels in the trypanosomatid Crithidia fasciculata.

    PubMed Central

    Brown, L M; Ray, D S


    Transcripts of both mitochondrial and nuclear DNA replication genes accumulate periodically during the cell cycle in Crithidia fasciculata. An octameric consensus sequence with a conserved hexameric core was found previously to be required for cycling of the TOP2 transcript, encoding the mitochondrial DNA topoisomerase. We show here that the rate of synthesis of the p51 protein, the large subunit of nuclear replication protein-A encoded by the RPA1 gene, varies during the cell cycle in parallel with RPA1 mRNA level. Plasmids expressing a truncated form of RPA1 (Delta RPA1 ) were used to identify cis elements required for cycling of the Delta RPA1 transcript. Sequences within the RPA1 5'-untranslated region (UTR) were found to be necessary for cycling of the Delta RPA1 transcript. These sequences also function when transposed 3'of the Delta RPA1 coding sequence. A 121 bp fragment of this sequence can confer cycling on a heterologous transcript, but is inactivated when two consensus octamers within the sequence are mutated. Mutation of these two octamers in the full-length 5'-UTR ofDelta RPA1 is insufficient to abolish cycling of the mRNA unless three additional octamers having single base changes within the hexameric core are also mutated. Thus, common octameric sequence elements are involved in periodic accumulation of both the TOP2 and RPA1 transcripts. PMID:9241242

  10. Cell cycle-dependent localization and properties of a second mitochondrial DNA ligase in Crithidia fasciculata.


    Sinha, Krishna Murari; Hines, Jane C; Ray, Dan S


    The mitochondrial DNA in kinetoplastid protozoa is contained in a single highly condensed structure consisting of thousands of minicircles and approximately 25 maxicircles. The disk-shaped structure is termed kinetoplast DNA (kDNA) and is located in the mitochondrial matrix near the basal body. We have previously identified a mitochondrial DNA ligase (LIG kbeta) in the trypanosomatid Crithidia fasciculata that localizes to antipodal sites flanking the kDNA disk where several other replication proteins are localized. We describe here a second mitochondrial DNA ligase (LIG kalpha). LIG kalpha localizes to the kinetoplast primarily in cells that have completed mitosis and contain either a dividing kinetoplast or two newly divided kinetoplasts. Essentially all dividing or newly divided kinetoplasts show localization of LIG kalpha. The ligase is present on both faces of the kDNA disk and at a high level in the kinetoflagellar zone of the mitochondrial matrix. Cells containing a single nucleus show localization of the LIG kalpha to the kDNA but at a much lower frequency. The mRNA level of LIG kalpha varies during the cell cycle out of phase with that of LIG kbeta. LIG kalpha transcript levels are maximal during the phase when cells contain two nuclei, whereas LIG kbeta transcript levels are maximal during S phase. The LIG kalpha protein decays with a half-life of 100 min in the absence of protein synthesis. The periodic expression of the LIG kalpha transcript and the instability of the LIG kalpha protein suggest a possible role of the ligase in regulating minicircle replication.

  11. A novel cell layer without corticosteroid-synthesizing enzymes in rat adrenal cortex: histochemical detection and possible physiological role.


    Mitani, F; Suzuki, H; Hata, J; Ogishima, T; Shimada, H; Ishimura, Y


    A stratum of cells that did not contain both aldosterone synthase cytochrome P450 (cytochrome P450aldo) and cytochrome P45011 beta was found immunohistochemically between the zona glomerulosa and the zona fasciculata of the rat adrenal cortex. As cytochromes P450aldo and P45011 beta are the enzymes responsible for the biosynthesis of aldosterone and corticosterone, respectively, the cells there are considered to be incapable of synthesizing both aldosterone and corticosterone. Furthermore, the cells are regarded as inert in producing adrenal androgens, because rat adrenal cortex is known to lack steroid 17 alpha-hydroxylase. Thus, the stratum is composed of cells that do not synthesize any of the major corticosteroids in significant quantities. It was 5-10 cells thick under normal feeding conditions, but diminished to 4-5 cells thick when animals were maintained under Na restriction, which is known to stimulate the secretion of angiotensin-II. When the distribution of 5-bromo-2'-deoxyuridine-labeled nuclei in the adrenocortex from BrdU-administered rats was examined, the stained nuclei were concentrated in and around the cell stratum. The pulse-chase experiments showed that the labeled cells migrated out of this layer and into the zonae fasciculata-reticularis. On the basis of these findings, we suggest that the newly discovered cell layer is the progenitor cell zone of the rat adrenal cortex.

  12. Primary bilateral adrenal intravascular large B-cell lymphoma associated with adrenal failure.


    Fukushima, Ayumi; Okada, Yosuke; Tanikawa, Takahisa; Onaka, Takashi; Tanaka, Aya; Higashi, Takehiro; Tsukada, Junichi; Tanaka, Yoshiya


    We report a rare case of bilateral primary adrenal non-Hodgkin's lymphoma with adrenal failure. A 66-year-old woman developed symptoms of adrenal failure. The cause of adrenal failure was suspected to be malignant lymphoma based on the high levels of serum soluble interleukin-2 receptor and LDH. Bilateral adrenalectomy was performed and pathological examination showed intravascular large B-cell lymphoma (IVL). Although complete remission was achieved, recurrence occurred three months later with brain metastases. IVL should be suspected in patients with bilateral adrenal tumors who present with rapidly progressive adrenal failure.

  13. Developmental aspects of the hypothalamic-pituitary-adrenal axis.


    Wintour, E M


    The ovine fetal adrenal cortex and pituitary are functional secretory organs by the end of the first third of gestation (term is 142-152 days). By half-way through gestation the zona glomerulosa is mature morphologically, more than 80% of the aldosterone in fetal blood is of fetal adrenal origin, but conventional stimuli, for example, increased plasma K+ or angiotensin II, do not increase aldosterone secretion until near term. The zona fasciculata is immature histologically, relatively unresponsive to ACTH, and contributes less than 10% of the cortisol in fetal blood between 100 and 120 days of gestation. After this time the zona fasciculata cells begin to mature, to respond to ACTH and to produce an increasing proportion of the cortisol in fetal blood. A functional relationship between hypothalamus-pituitary-adrenal cortex matures over the last fifth of gestation. It is hypothesized that cortisol exerts a local effect in maturation of fetal zona fasciculata cells, such that low concentrations of ACTH have increasingly larger effects on growth and secretion of the fasciculata and that the level of negative feedback by cortisol on the hypothalamic-pituitary axis is reset. The analogy is drawn between the changes in gonadotrophin and gonadal hormones which culminates in puberty in man and the changes in ACTH and cortisol which culminate in parturition in sheep.

  14. 3βHSD and CYB5A double positive adrenocortical cells during adrenal development/aging

    PubMed Central

    Nakamura, Yasuhiro; Fujishima, Fumiyoshi; Hui, Xiao-Gang; Felizola, Saulo J.A.; Shibahara, Yukiko; Akahira, Jun-ichi; McNamara, Keely M.; Rainey, William E.; Sasano, Hironobu


    Androstenedione is a common precursor of sex steroids produced and secreted in the human adrenal gland and produced by 3β-hydroxysteroid dehydrogenase (3βHSD), 17α-hydroxylase/17-20 lyase (CYP17) and cytochrome b5 (CYB5A). 3βHSD is expressed in the zona glomerulosa (ZG) and fasciculata (ZF), CYP17 in the ZF and zona reticularis (ZR) and CYB5A in the ZR, respectively. We previously demonstrated the presence of cortical parenchymal cells co-expressing 3βHSD and CYB5A with hybrid features of both ZF and ZR in human adrenal cortex and hypothesized that these cells may play an important role in androstenedione production in human adrenal gland. Age-related morphologic development of these hybrid cells has, however, not been studied. Therefore, in this study, 48 human adrenal specimens from various age groups were retrieved. Double-immunohistochemical analyses were used in order to study the correlation between this hybrid cell type and age. In both male and female adrenal cortex, the mean of total adrenocortical area, the area of CYB5A positive cells and the mean of its ratio reached highest peak in the 21–40 year-old (y.o.). The greatest overlap between 3βHSD and CYB5A in both total and relative area was present in the 13–20 y.o. group. For all of the markers above, statistically significant differences were detected among the different age groups examined (P<0.05). These findings all indicated that both area and ratio of 3βHSD and CYB5A double positive cells, which could represent the hybrid cells of ZF and ZR, are correlated with human adrenal development and could subsequently influence age-related serum androstenedione levels. PMID:24832628

  15. Electrical excitability of cultured adrenal chromaffin cells.

    PubMed Central

    Biales, B; Dichter, M; Tischler, A


    1. Adult human and gerbil adrenal medullary cells were maintained in dissociated cell culture and studied by micro-electrode penetration. 2. In the best recordings, chromaffin cell transmembrane potentials exceeded -50mV. 3. Chromaffin cells were capable of generating all-or-nothing over-shooting action potentials, similar to those generated by sympathetic neurones. 4. The action potentials were blocked by tetrodotoxin (TTX, 10(-6)g/ml.) but were not blocked by removal of Ca or by CoCl2 (10 mM). We conclude that the action potentials are probably generated by a Na mechanism. 5. Chromaffin cells are depolarized by the iontophoretic application of acetylcholine (ACh). This depolarization was accompanied by an increased membrane conductance and could trigger action potentials. 6. Action potentials were also found in cells in fresh slices of gerbil adrenal medullae. Images Plate 1 PMID:1034699

  16. [Adrenalitis].


    Saeger, W


    Inflammation of the adrenal glands is caused by autoimmunopathies or infections and can induce adrenal insufficiency. Autoimmune lymphocytic adrenalitis is often combined with other autoimmune diseases and the most frequent cause of Addison's disease; however, it only becomes clinically apparent when more than 90 % of the adrenal cortex has been destroyed. Histological features are characterized by lymphoplasmacytic inflammation leading to an increased destruction of adrenocortical tissue but less severe courses can also occur. The second most frequent form of adrenalitis is adrenal tuberculosis, showing typical granulomatous findings that are nearly always caused by spreading from a tuberculous pulmonary focus. Other bacterial as well as viral infections, such as Epstein-Barr virus (EBV), cytomegalovirus (CMV) and others, generally affect the adrenal glands only in patients with immunodeficiency disorders. In these infections, the adrenal cortex and medulla are frequently involved to roughly the same extent. Although surgical specimens from inflammatory adrenal lesions are extremely rare, the various forms of adrenalitis play an important role in the post-mortem examination of the adrenal glands for clarification of unclear causes of death (e.g. death during an Addisonian crisis). PMID:27099224

  17. POD-1/Tcf21 overexpression reduces endogenous SF-1 and StAR expression in rat adrenal cells

    PubMed Central

    França, M. M.; Abreu, N. P.; Vrechi, T. A. M.; Lotfi, C. F.


    During gonad and adrenal development, the POD-1/capsulin/TCF21transcription factor negatively regulates SF-1/NR5A1expression, with higher SF-1 levels being associated with increased adrenal cell proliferation and tumorigenesis. In adrenocortical tumor cells, POD-1 binds to the SF-1 E-box promoter region, decreasing SF-1 expression. However, the modulation of SF-1 expression by POD-1 has not previously been described in normal adrenal cells. Here, we analyzed the basal expression of Pod-1 and Sf-1 in primary cultures of glomerulosa (G) and fasciculata/reticularis (F/R) cells isolated from male Sprague-Dawley rats, and investigated whether POD-1 overexpression modulates the expression of endogenous Sf-1 and its target genes in these cells. POD-1 overexpression, following the transfection of pCMVMycPod-1, significantly decreased the endogenous levels of Sf-1 mRNA and protein in F/R cells, but not in G cells, and also decreased the expression of the SF-1 target StAR in F/R cells. In G cells overexpressing POD-1, no modulation of the expression of SF-1 targets, StAR and CYP11B2, was observed. Our data showing that G and F/R cells respond differently to ectopic POD-1 expression emphasize the functional differences between the outer and inner zones of the adrenal cortex, and support the hypothesis that SF-1 is regulated by POD-1/Tcf21 in normal adrenocortical cells lacking the alterations in cellular physiology found in tumor cells. PMID:26421867

  18. Modulation of adrenal gap junction expression.


    Murray, S A; Shah, U S


    To increase our knowledge of the role of peptide hormone stimulation in gap junction protein expression and adrenal cortical cell function, primary rat adrenal cortical cells were treated with adrenocorticotropin, and gap junction proteins were measured. Immunocytochemistry and western blot analysis were used to detect and characterize gap junction type and distribution. The gap junction protein, connexin 43 (alpha 1), was detected. Analysis of six connexin protein types did not reveal gap junction species other than alpha 1. Cells of the inner adrenal cortical zones, zonae fasciculata and reticularis, were demonstrated to have the highest number of gap junctions per cell in the adrenal gland. Adrenal cell cultures enriched for the two inner cortical adrenal zones were established and demonstrated also to express alpha 1 gap junction protein. Adrenocorticotropin (40 mUnits/ml) and dibutyryl cyclic adenosine monophosphate (1 mM) treatments increased alpha 1 gap junction protein levels and decreased cell proliferation rates in the cell cultures. The results are consistent with the hypothesis that gap junction expression can be regulated by adrenocorticotropin acting through the second messenger cyclic adenosine monophosphate. It can be suggested that gap junction expression in the adrenal gland may be under hormonal influence, and that gap junctions serve as passage for movement of molecules involved in control of cell proliferation. PMID:9694574

  19. Adrenal Nodular Hyperplasia in Hereditary Leiomyomatosis and Renal Cell Cancer

    PubMed Central

    Shuch, Brian; Ricketts, Christopher J.; Vocke, Cathy D.; Valera, Vladimir A.; Chen, Clara C.; Gautam, Rabi; Gupta, Gopal N.; Macias, Gabriela S. Gomez; Merino, Maria J.; Bratslavsky, Gennady; Linehan, W Marston


    Purpose Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is characterized by cutaneous leiomyomas, uterine fibroids, and aggressive papillary renal cell carcinoma (RCC). A number of our HLRCC patients were found to have atypical adrenal nodules and which were further evaluated to determine if these adrenal nodules were associated with HLRCC. Methods HLRCC patients underwent a comprehensive clinical and genetic evaluation. Clinical presentation, anatomic and functional imaging, endocrine evaluation, pathologic examination and the results from germline mutation testing were reviewed. Results Twenty of 255 HLRCC patients (7.8%) were found to have primary adrenal lesions. Among these, three were found to have bilateral adrenal lesions and four were found to have multiple nodules. Two patients had ACTH-independent hypercortisolism. A total of 27 adrenal lesions were evaluated. The imaging characteristics of five (18.5%) of these lesions were not consistent with adenoma by non-contrast CT criteria. PET imaging was positive in 7 of 10 cases (70%). Twelve nodules were surgically resected from ten adrenal glands. Pathologic examination revealed macronodular adrenal hyperplasia in all specimens. Conclusions Unilateral and bilateral adrenal nodular hyperplasia was detected in a subset of patients affected with HLRCC. A functional endocrine evaluation is recommended when an adrenal lesion is discovered. Imaging frequently demonstrates lesions that are not typical of adenomas and PET imaging may be positive. To date, no patient has been found to have adrenal malignancy and active surveillance of HLRCC adrenal nodules appears justified. PMID:22982371

  20. Expression of the beacon gene in the rat adrenal gland: direct inhibitory effect of beacon[47-73] on aldosterone secretion from dispersed adrenal zona glomerulosa cells.


    Ziolkowska, Agnieszka; Rucinski, Marcin; Neri, Giuliano; Di Liddo, Rosa; Nussdorfer, Gastone G; Malendowicz, Ludwik K


    Beacon gene was recently identified in the rat hypothalamus, and there is evidence that beacon may be involved in the functional regulation of neuroendocrine axes. Reverse transcription-polymerase chain reaction and immunocytochemistry showed the expression of beacon mRNA and protein in the rat adrenal gland, especially in the cortex. Beacon[47-73], at a concentration over 10(-7) M decreased basal aldosterone secretion from dispersed rat zona glomerulosa (ZG) cells, without affecting the ACTH-stimulated one. Basal and agonist-stimulated corticosterone secretion from dispersed zona fasciculata-reticularis cells and catecholamine release from adrenomedullary slices were unaffected by beacon[47-73]. The suppressive effect of beacon[47-73] on aldosterone secretion from ZG cells was abolished by either H-89 or calphostin-C, which are inhibitors of protein kinase A and C signaling cascades. Taken together, these findings allow us to suggest that beacon can be included in the group of regulatory peptides involved in the fine tuning of ZG secretory activity.

  1. [Mantle cell lymphoma markedly infiltrated into adrenal glands with adrenal insufficiency].


    Hashimoto, Ryo; Iwakiri, Rika; Tsutsumi, Hisashi; Ohta, Masatsugu; Mori, Mayumi


    A 66-year-old male was admitted to our hospital complaining of bilateral hypochondrial pain, back pain and loss of weight in May, 2002. Superficial lymph nodes were not palpable on admission. The leukocyte count was 3430/microl, hemoglobin concentration, 13.0g/dl, and platelet count, 174000/microl. LDH, soluble IL-2 receptor, ACTH and cortisol values were out of the normal range (LDH 1368IU/l, sIL-2R 2630U/ml, ACTH 132pg/ml, cortisol 7.4microg/dl). Abdominal CT scan showed bilateral adrenal masses, and abnormal uptake of Ga-scintigraphy was seen correspondent with the bilateral adrenal masses. The histological diagnosis of bilateral adrenal masses cannot be performed because of the bleeding tendency, but atypical cells were observed in the patient's bone marrow aspirate. Surface marker analysis of atypical cells showed CD5+, cyclin D1+, CD19+, CD20+ and HLA-DR+. From these results we diagnosed this case as a mantle cell lymphoma (stage IV B) markedly infiltrated into the adrenal glands with adrenal insufficiency. The bilateral adrenal masses dramatically reduced in size after CHOP chemotherapy with hydrocortisone supplementation. We report on the present case and summarize the reports of adrenal grand-infiltrating lymphomas. PMID:15359915

  2. Short-term effects of ACTH on protein synthesis in adrenal cortex cells of young rats.


    Magalhães, M C; Magalhães, M M; Cimbra, A


    Two units of ACTH were administered intraperitoneally to young 20 gm-rats which received an intravenous injection of L-leucine-3H thirteen min later. ACTH-injected rats, and control rats which received the isotope alone, were killed at 2-, 10-, 30- and 60-min intervals. Electron microscope autoradiographs in control animals showed strong amino-acid uptake at pulse time (2-min) in the cytoplasm of adrenal zona fasciculata cells. Label was shared between the endoplasmic reticulum (ER) and mitochondria, and a lower but still considerable uptake was seen in nucleoli. At first chase time interval (10-min) cytoplasmic labelling declined, while nuclear and nucleolar labelling increased, both changing little thereafter, and there was a 10-30 min Golgi peak. ACTH administration provoked an overall increase in amino-acid incorporation into cytoplasm, nucleus and nucleolus at pulse time, with no changes in the distribution of the reactions among organelles. Intensification of labelling was most evident over nucleoli, the grain density of which was four-times as high as in controls. The short-term increase in ER and mitochondrial protein synthesis observed after ACTH injections was considered to be consistent with the hypothesis that most newly-formed proteins in these cells may be involved in the regulation of steroidogenesis. The marked increase in nucleolar labelling suggested the presence of proteins involved in RNA synthesis.

  3. Isolated adrenal masses in nonsmall-cell bronchogenic carcinoma

    SciTech Connect

    Oliver, T.W. Jr.; Bernardino, M.E.; Miller, J.I.; Mansour, K.; Greene, D.; Davis, W.A.


    Computed tomography has become an important diagnostic modality in the preoperative staging of patients with bronchogenic carcinoma. The adrenal glands represent one of the most frequent sites of metastasis. Therefore, an isolated adrenal mass discovered on preoperative thoracoabdominal CT poses a diagnostic problem. Three hundred thirty patients with histologically proved nonsmall-cell bronchogenic carcinoma were evaluated. Thirty-two had adrenal masses without further evidence of disease in the abdomen, Eight of these 32 masses were metastases, 17 were proved adenomas, and 7 did not undergo biopsy. Thus an isolated adrenal mass is more likely benign than metastatic, and biopsy is advocated prior to withholding potentially curative surgery.

  4. Multi-Target Approach to Metastatic Adrenal Cell Carcinoma.


    Wahab, Norasyikin A; Zainudin, Suehazlyn; AbAziz, Aini; Mustafa, Norlaila; Sukor, Norlela; Kamaruddin, Nor Azmi


    Adrenal cell carcinoma is a rare tumor and more than 70% of patients present with advanced stages. Adrenal cell carcinoma is an aggressive tumor with a poor prognosis. Surgical intervention is the gold standard treatment and mitotane is the only drug approved for the treatment of adrenal cell carcinoma. Until recently in 2012, the etoposide, doxorubicin, cisplatin plus mitotane are approved as first-line therapy based on response rate and progression-free survival. This case illustrates a case of advanced adrenal cell carcinoma in a young girl who presented with huge adrenal mass with inferior vena cava thrombosis and pulmonary embolism. Multi-approach of therapy was used to control the tumor size and metastasis. Therefore, it may prolong her survival rate for up to 5 years and 4 months. PMID:27631184

  5. In vivo studies of the control of DNA synthesis in the rat adrenal cortex and medulla.


    McEwan, P E; Lindop, G B; Kenyon, C J


    The control of zonation in the adrenal cortex has been studied by measuring DNA synthesis using an analogue of thymidine, bromodeoxyuridine (BrDUrd). Groups of rats were infused with BrDUrd for 10-14 days whilst being treated with: high or low sodium diets; captopril; angiotensin II; dexamethasone; an inhibitor of nitric oxide synthesis, L-NAME. DNA synthesis in the zona glomerulosa was increased by low sodium food and angiotensin and was decreased by dexamethasone, captopril L-NAME and a high sodium diet. Dexamethasone, not manipulations of the renin-angiotensin system, affected DNA synthesis in the outer zona fasciculata. The BrDUrd index in the zona intermedia was unaffected by any of the treatments and was generally lower than in adjacent zona fasciculata and zona glomerulosa cells. Cells of the zona reticularis appeared to be regulated independent of the zona fasciculata. BrDUrd uptake in nuclei of the adrenal medulla was inversely related to blood pressure. We conclude that DNA synthesis in each adrenocortical zone is independently controlled. Migration of cells within zones after proliferation is likely.

  6. Acute adrenal insufficiency secondary to bilateral adrenal B-cell lymphoma: a case report and review of the literature

    PubMed Central

    De Miguel Sánchez, Carlos; Ruiz, Luis; González, Jose Luis; Hernández, Jose Luis


    Primary adrenal lymphoma is an extremely rare entity which constitutes less than 1% of extranodal lymphomas. Most cases present with bilateral adrenal masses and without extraadrenal involvement, which can lead to symptoms of adrenal insufficiency. The prognosis is usually poor and chemotherapy is the first-line treatment option. We report here on a 78-year-old man admitted to our Internal Medicine Department because of constitutional symptoms and high fever spikes. He was diagnosed with adrenal insufficiency and a CT-scan revealed bilateral adrenal masses of about 6 cm in diameter. A percutaneous biopsy was performed and the histological exam was consistent with diffuse large B cell lymphoma. A review of the literature of this unusual entity was also carried out. PMID:27170834

  7. GPCRs of adrenal chromaffin cells & catecholamines: The plot thickens.


    Lymperopoulos, Anastasios; Brill, Ava; McCrink, Katie A


    The circulating catecholamines (CAs) epinephrine (Epi) and norepinephrine (NE) derive from two major sources in the whole organism: the sympathetic nerve endings, which release NE on effector organs, and the chromaffin cells of the adrenal medulla, which are cells that synthesize, store and release Epi (mainly) and NE. All of the Epi in the body and a significant amount of circulating NE derive from the adrenal medulla. The secretion of CAs from adrenal chromaffin cells is regulated in a complex way by a variety of membrane receptors, the vast majority of which are G protein-coupled receptors (GPCRs), including adrenergic receptors (ARs), which act as "presynaptic autoreceptors" in this regard. There is a plethora of CA-secretagogue signals acting on these receptors but some of them, most notably the α2ARs, inhibit CA secretion. Over the past few years, however, a few new proteins present in chromaffin cells have been uncovered to participate in CA secretion regulation. Most prominent among these are GRK2 and β-arrestin1, which are known to interact with GPCRs regulating receptor signaling and function. The present review will discuss the molecular and signaling mechanisms by which adrenal chromaffin cell-residing GPCRs and their regulatory proteins modulate CA synthesis and secretion. Particular emphasis will be given to the newly discovered roles of GRK2 and β-arrestins in these processes and particular points of focus for future research will be highlighted, as well.

  8. Transgenic Expression of Ad4BP/SF-1 in Fetal Adrenal Progenitor Cells Leads to Ectopic Adrenal Formation

    PubMed Central

    Zubair, Mohamad; Oka, Sanae; Parker, Keith L.; Morohashi, Ken-ichirou


    Deficiency of adrenal 4 binding protein/steroidogenic factor 1 (Ad4BP/SF-1; NR5A1) impairs adrenal development in a dose-dependent manner, whereas overexpression of Ad4BP/SF-1 is associated with adrenocortical tumorigenesis. Despite its essential roles in adrenal development, the mechanism(s) by which Ad4BP/SF-1 regulates this process remain incompletely understood. We previously identified a fetal adrenal enhancer (FAdE) that stimulates Ad4BP/SF-1 expression in the fetal adrenal gland by a two-step mechanism in which homeobox proteins initiate Ad4BP/SF-1 expression, which then maintains FAdE activity in an autoregulatory loop. In the present study, we examined the effect of transgenic expression of Ad4BP/SF-1 controlled by FAdE on adrenal development. When Ad4BP/SF-1 was overexpressed using a FAdE-Ad4BP/SF-1 transgene, FAdE activity expanded outside of its normal field, resulting in increased adrenal size and the formation of ectopic adrenal tissue in the thorax. The increased size of the adrenal gland did not result from a corresponding increase in cell proliferation, suggesting rather that the increased levels of Ad4BP/SF-1 may divert uncommitted precursors to the steroidogenic lineage. The effects of FAdE-controlled Ad4BP/SF-1 overexpression in mice provide a novel model of ectopic adrenal formation that further supports the critical role of Ad4BP/SF-1 in the determination of steroidogenic cell fate in vivo. PMID:19628584

  9. Adenosine 5'-(gamma-thio) triphosphate (ATPgammaS) stimulates both P2Y receptors linked to inositol phosphates production and cAMP accumulation in bovine adrenocortical fasciculata cells.


    Nishi, Haruhisa; Hori, Seiji; Niitsu, Akiyoshi; Kawamura, Masahiro


    The study was aimed to investigate the existence of at least two kinds of P2Y receptors linked to steroidogenesis in bovine adrenocortical fasciculata cells (BAFCs). Extracellular nucleotides facilitated steroidogenesis in BAFCs. The potency order was UTP > adenosine 5'-(gamma-thio) triphosphate (ATPgammaS) > ATP > 2-methylthio ATP (2MeSATP) > adenosine 5'-(beta-thio) diphosphate (ADPbetaS) > alpha,beta-methylene ATP (alpha,beta-me-ATP), beta,gamma-methylene ATP (beta,gamma -me-ATP). ATPgammaS (10-100 microM) remarkably stimulated both total inositol phosphates (IPs) production and cyclic AMP (cAMP) accumulation. Competitive displacement experiments by using [35S]ATPgammaS as a radioactive ligand in BAFCs showed that the potency under these unlabelled ligands was ATPgammaS > ATP > ADPbetaS > 2MeSATP > UTP > alpha,beta-me-ATP, beta,gamma-me-ATP. These suggest that two different binding sites of [35S]ATPgammaS, namely P2Y receptors, exist in BAFCs, and that these receptors are linked to steroidogenesis via distinct second messenger systems in the cells.

  10. Expression of receptors for luteinizing hormone, gastric-inhibitory polypeptide, and vasopressin in normal adrenal glands and cortisol-secreting adrenocortical tumors in dogs.


    Galac, S; Kars, V J; Klarenbeek, S; Teerds, K J; Mol, J A; Kooistra, H S


    Hypercortisolism caused by an adrenocortical tumor (AT) results from adrenocorticotropic hormone (ACTH)-independent hypersecretion of glucocorticoids. Studies in humans demonstrate that steroidogenesis in ATs may be stimulated by ectopic or overexpressed eutopic G protein-coupled receptors. We report on a screening of 23 surgically removed, cortisol-secreting ATs for the expression of receptors for luteinizing hormone (LH), gastric-inhibitory polypeptide (GIP), and vasopressin (V(1a), V(1b), and V(2)). Normal adrenal glands served as control tissues. Abundance of mRNA for these receptors was quantified using quantitative polymerase chain reaction (QPCR), and the presence and localization of these receptors were determined by immunohistochemistry. In both normal adrenal glands and ATs, mRNA encoding for all receptors was present, although the expression abundance of the V(1b) receptor was very low. The mRNA expression abundance for GIP and V(2) receptors in ATs were significantly lower (0.03 and 0.01, respectively) than in normal adrenal glands. The zona fasciculata of normal adrenal glands stained immunonegative for the GIP receptor. In contrast, islands of GIP receptor-immunopositive cells were detected in about half of the ATs. The zona fasciculata of both normal adrenal glands and AT tissue were immunopositive for LH receptor; in ATs in a homogenous or heterogenous pattern. In normal adrenal glands, no immunolabeling for V(1b)R and V(2) receptor was present, but in ATs, V(2) receptor-immunopositive cells were detected. In conclusion, QPCR analysis did not reveal overexpression of LH, GIP, V(1a), V(1b), or V(2) receptors in the ATs. However, the ectopic expression of GIP and V(2) receptor proteins in tumorous zona fasciculata tissue may play a role in the pathogenesis of canine cortisol-secreting ATs.

  11. Renin knockout rat: control of adrenal aldosterone and corticosterone synthesis in vitro and adrenal gene expression

    PubMed Central

    Gehrand, Ashley; Bruder, Eric D.; Hoffman, Matthew J.; Engeland, William C.; Moreno, Carol


    The classic renin-angiotensin system is partly responsible for controlling aldosterone secretion from the adrenal cortex via the peptide angiotensin II (ANG II). In addition, there is a local adrenocortical renin-angiotensin system that may be involved in the control of aldosterone synthesis in the zona glomerulosa (ZG). To characterize the long-term control of adrenal steroidogenesis, we utilized adrenal glands from renin knockout (KO) rats and compared steroidogenesis in vitro and steroidogenic enzyme expression to wild-type (WT) controls (Dahl S rat). Adrenal capsules (ZG; aldosterone production) and subcapsules [zona reticularis/fasciculata (ZFR); corticosterone production] were separately dispersed and studied in vitro. Plasma renin activity and ANG II concentrations were extremely low in the KO rats. Basal and cAMP-stimulated aldosterone production was significantly reduced in renin KO ZG cells, whereas corticosterone production was not different between WT and KO ZFR cells. As expected, adrenal renin mRNA expression was lower in the renin KO compared with the WT rat. Real-time PCR and immunohistochemical analysis showed a significant decrease in P450aldo (Cyp11b2) mRNA and protein expression in the ZG from the renin KO rat. The reduction in aldosterone synthesis in the ZG of the renin KO adrenal seems to be accounted for by a specific decrease in P450aldo and may be due to the absence of chronic stimulation of the ZG by circulating ANG II or to a reduction in locally released ANG II within the adrenal gland. PMID:25394830

  12. GABA Signaling and Neuroactive Steroids in Adrenal Medullary Chromaffin Cells

    PubMed Central

    Harada, Keita; Matsuoka, Hidetada; Fujihara, Hiroaki; Ueta, Yoichi; Yanagawa, Yuchio; Inoue, Masumi


    Gamma-aminobutyric acid (GABA) is produced not only in the brain, but also in endocrine cells by the two isoforms of glutamic acid decarboxylase (GAD), GAD65 and GAD67. In rat adrenal medullary chromaffin cells only GAD67 is expressed, and GABA is stored in large dense core vesicles (LDCVs), but not synaptic-like microvesicles (SLMVs). The α3β2/3γ2 complex represents the majority of GABAA receptors expressed in rat and guinea pig chromaffin cells, whereas PC12 cells, an immortalized rat chromaffin cell line, express the α1 subunit as well as the α3. The expression of α3, but not α1, in PC12 cells is enhanced by glucocorticoid activity, which may be mediated by both the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). GABA has two actions mediated by GABAA receptors in chromaffin cells: it induces catecholamine secretion by itself and produces an inhibition of synaptically evoked secretion by a shunt effect. Allopregnanolone, a neuroactive steroid which is secreted from the adrenal cortex, produces a marked facilitation of GABAA receptor channel activity. Since there are no GABAergic nerve fibers in the adrenal medulla, GABA may function as a para/autocrine factor in the chromaffin cells. This function of GABA may be facilitated by expression of the immature isoforms of GAD and GABAA receptors and the lack of expression of plasma membrane GABA transporters (GATs). In this review, we will consider how the para/autocrine function of GABA is achieved, focusing on the structural and molecular mechanisms for GABA signaling. PMID:27147972

  13. Functional zonation of the rat adrenal cortex: the development and maintenance

    PubMed Central

    MITANI, Fumiko


    The adrenal cortex of mammals consists of three concentric zones, i.e., the zona glomerulosa (zG), the zona fasciculata (zF), and the zona reticularis (zR), which secrete mineralocorticoids, glucocorticoids, and adrenal androgens, respectively. In 1994, we identified immunohistochemically a new zone between zG and zF of the rat adrenal gland. The zone appeared to be devoid of any significant endocrine functions specific to adrenocortical zones, therefore, we designated the zone as “undifferentiated cell zone (zU)”. Further, BrdU (5-bromo-2′-deoxyuridine)-incorporating cells (cells in S-phase) were concentrated at the outer region and the inner region of zU, and these cells proliferated and migrated bidirectionally: toward zG centrifugally and toward zF centripetally. We proposed that cells in and around zU are stem/progenitor cells of the rat adrenal cortex, maintaining functional zonation of the adrenal cortex. The view is consistent with observations reported recently that Sonic hedgehog (Shh), an important factor in embryonic development and adult stem cell maintenance, exists in zU of the rat adrenal gland and the Shh-containing cells seem to migrate bidirectionally. PMID:24814991

  14. The effects of vasoactive intestinal peptide on adrenal steroid hormone secretion

    SciTech Connect

    Cunningham, L.A.


    Vasoactive intestinal peptide (VIP)-immunoreactive nerve fibers have been demonstrated in the rat adrenal cortex in close association with zona glomerulosa cells. We have studied the effects of VIP on steroid hormone secretion from the outer zones of the normal rat adrenal cortex. Intact capsule-glomerulosa preparations, consisting of the capsule, zona glomerulosa, and a small portion of the zona fasciculata were perifused in vitro. The secretory responsiveness was assessed by measuring aldosterone and corticosterone release following stimulation with the physiological secretagogues ACTH and angiotensin II. The distribution of adrenal VIP receptors was assessed by in vitro autoradiography of {sup 125}I-VIP binding. {sup 125}I-VIP (0.75 and 2.0 nM) binding was concentrated in the capsule and zone glomerulosa, coincident with the distribution of VIP nerve fibers which aborize extensively in this region. The specificity of this binding was demonstrated using unlabelled VIP, ACTH and angiotensin II.

  15. Stem cells in the development and differentiation of the human adrenal glands.


    Terada, Tadashi


    There are no studies on stem cells (SCs) and development and differentiation (DD) of the human adrenal glands. The SCs in DD of the adrenal glands were herein investigated histochemically and immunohistochemically in 18 human embryonic adrenal glands at gestational week (GW) 7-40. At 7 GW, the adrenal glands were present, and at 7 GW, numerous embryonic SCs (ESCs) are seen to create the adrenal cortex. The ESCs were composed exclusively of small cells with hyperchromatic nuclei without nucleoli. The ESCs were positive for neural cell adhesion molecule, KIT, neuron-specific enolase, platelet-derived growth factor receptor-α, synaptophysin, and MET. They were negative for other SC antigens, including chromogranin, ErbB2, and bcl-2. They were also negative for lineage antigens, including cytokeratin (CK)7, CK8, CK18, and CK19, carcinoembryonic antigen, carbohydrate antigen 19-9, epithelial membrane antigen, HepPar1, mucin core apoprotein (MUC)1, MUC2, MUC5AC, and MUC6, and cluster differentiation (CD)3, CD45, CD20, CD34, and CD31. The Ki-67 labeling index (LI) was high (Ki-67 LI = around 20%). α-Fetoprotein was positive in the ESCs and adrenal cells. The ESC was first seen in the periphery of the adrenal cortex at 7-10 GW. The ESC migrates into the inner part of the adrenal cortex. Huge islands of ESC were present near the adrenal, and they appeared to provide the ESC of the adrenal. At 16 GW, adrenal medulla appeared, and the adrenal ESCs were present in the periphery or the cortex, in the cortical parenchyma, corticomedullary junctions, and in the medulla. The adrenal essential architecture was established around 20 GW; however, there were still ESCs. At term, there are a few ESCs. These data suggest that the adrenal glands were created by ESCs.

  16. Adrenal Insufficiency Associated with Small Cell Lung Cancer: A Case Report and Literature Review.


    Noguchi, Shingo; Torii, Ryo; Shimabukuro, Ikuko; Yamasaki, Kei; Kido, Takashi; Yoshii, Chiharu; Mukae, Hiroshi; Yatera, Kazuhiro


    A 78-year-old Japanese man with fatigue, appetite loss, skin hyperpigmentation, hypotension and hypoglycemia, visited our hospital to evaluate an abnormal chest X-ray and adrenal gland swelling in echography in February 2015. Chest computed tomography showed a mass lesion in the right lower lobe and bilateral adrenal swellings, and small cell lung cancer (SCLC) with bilateral adrenal metastasis was diagnosed after bronchoscopy. According to low levels of serum cortisol, elevated adrenocorticotropic hormone (ACTH) and rapid ACTH test, the diagnosis of adrenal insufficiency associated with SCLC was made. Treatment with hydrocortisone (20 mg/day) was started in addition to systemic chemotherapy with carboplatin and etoposide. The patient's symptoms were slightly improved, however, systemic chemotherapy was discontinued according to the patient's request after 1 course of chemotherapy. Thereafter, he received only supportive care, and his general condition gradually worsened and he ultimately died in August 2015. Adrenal insufficiency associated with SCLC, which is caused by tissue destruction more than 90% of the adrenal glands, is rare although adrenal metastasis is not rare in patients with lung cancer. The findings such as general fatigue, appetite loss, hypotension, and hyponatremia are often got follow up as findings of advanced cancer, but appropriate therapy for adrenal insufficiency, supplement of the adrenal corticosteroid hormone, may lead to a significant improvement in the symptoms and quality of life in clinical practice of lung cancer. Therefore, physicians must consider potential adrenal insufficiency in lung cancer patients with bilateral adrenal metastasis. PMID:27302729

  17. Normal adrenal glands in small cell lung carcinoma: CT-guided biopsy

    SciTech Connect

    Pagani, J.J.


    Twenty-four small cell lung carcinoma patients with morphologically normal adrenal glands by computed tomographic (CT) criteria underwent percutaneous thin-needle biopsy of their adrenal glands. Of 43 glands biopsied, 29 had adequate cellular material for interpretation. Five (17%) of the 29 glands were positive for metastases; the rest had negative biopsies. This series indicates an approximate 17% false-negative diagnosis rate by CT when staging the adrenal glands in patients with small cell lung carcinoma. It also demonstrates the utility of percutaneous needle biopsy as an investigational tool to further evaluate normal-sized adrenal glands in the oncologic patient.

  18. Interleukin-6 inhibits adrenal androgen release from bovine adrenal zona reticularis cells by inhibiting the expression of steroidogenic proteins.


    McIlmoil, S; Call, G B; Barney, M; Strickland, J; Judd, A M


    Interleukin-6 (IL-6) is secreted by adrenocortical cells and modifies cortisol secretion. In this study, the effects of IL-6 on adrenal androgen release were investigated. The zona reticularis (ZR) was generally isolated from bovine adrenal glands by dissection. In select experiments, the intact adrenal cortex (ie, all 3 adrenocortical zones) was dissected from the adrenal glands. For androgen release experiments, ZR and intact adrenocortical cubes were dispersed into isolated cells, the cells cultured and exposed to IL-6 and/or adrenocorticotropic hormone (ACTH), and androgen release determined by radioimmunoassay. Basal and ACTH-stimulated androgen release from the ZR was inhibited by IL-6 in a concentration-dependent (10-1000 pg/mL) and time-dependent (4-24 h) manner (P < 0.01 by 1-way analysis of variance and the Bonferroni test). In contrast, IL-6 increased basal and ACTH-stimulated androgen release from mixed adrenocortical cells (P < 0.01). The mechanism of IL-6 inhibition of androgen release was investigated by exposing ZR strips to IL-6 and measuring the expression of the messenger RNA (mRNA) and protein of steroidogenic factors. Basal and ACTH-stimulated expression of the mRNA and protein for steroidogenic acute regulatory protein, cholesterol side chain cleavage enzyme, 3-β-hydroxysteroid dehydrogenase type 2, steroid 17-α-hydroxylase/17,20 lyase/17,20 desmolase, and the nuclear factor steroidogenic factor 1 (SF-1), that stimulates steroidogenesis, were decreased by IL-6 (P < 0.01). In contrast IL-6 increased the mRNA and protein for dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1 (DAX-1), a nuclear factor that inhibits steroidogenesis (P < 0.01). In summary, IL-6 decreased androgen release and the expression of steroidogenic factors in the ZR, and this decrease may be mediated in part through increasing DAX-1 and decreasing SF-1. PMID:26218834

  19. Primary bilateral adrenal B-cell lymphoma associated with EBV and JCV infection

    PubMed Central

    Barzon, Luisa; Trevisan, Marta; Marino, Filippo; Guzzardo, Vincenza; Palù, Giorgio


    Primary lymphoma of the adrenal gland is a rare and highly aggressive disease, with only a few reports in the literature. The pathogenesis is unknown, but detection of Epstein Barr virus (EBV) genome sequences and gene expression in some cases of primary adrenal lymphomas suggested the virus might be a causative agent of the malignancy. While investigating the presence of genome sequences of oncogenic viruses in a large series of adrenal tumors, both EBV and JC polyomavirus (JCV) DNA sequences were detected in a diffuse large primary bilateral B-cell non-Hodgkin lymphoma of the adrenal gland, which was diagnosed only at postmortem examination in a 77 year-old woman with incidentally discovered adrenal masses and primary adrenal insufficiency. The presence of both EBV and JCV genome sequences suggests the relevance of EBV and JCV coinfection in the pathogenesis of this rare form of B-cell lymphoma. PMID:19146683

  20. LGR5 Activates Noncanonical Wnt Signaling and Inhibits Aldosterone Production in the Human Adrenal

    PubMed Central

    Shaikh, Lalarukh Haris; Zhou, Junhua; Teo, Ada E. D.; Garg, Sumedha; Neogi, Sudeshna Guha; Figg, Nichola; Yeo, Giles S.; Yu, Haixiang; Maguire, Janet J.; Zhao, Wanfeng; Bennett, Martin R.; Azizan, Elena A. B.; Davenport, Anthony P.; McKenzie, Grahame


    Context: Aldosterone synthesis and cellularity in the human adrenal zona glomerulosa (ZG) is sparse and patchy, presumably due to salt excess. The frequency of somatic mutations causing aldosterone-producing adenomas (APAs) may be a consequence of protection from cell loss by constitutive aldosterone production. Objective: The objective of the study was to delineate a process in human ZG, which may regulate both aldosterone production and cell turnover. Design: This study included a comparison of 20 pairs of ZG and zona fasciculata transcriptomes from adrenals adjacent to an APA (n = 13) or a pheochromocytoma (n = 7). Interventions: Interventions included an overexpression of the top ZG gene (LGR5) or stimulation by its ligand (R-spondin-3). Main Outcome Measures: A transcriptome profile of ZG and zona fasciculata and aldosterone production, cell kinetic measurements, and Wnt signaling activity of LGR5 transfected or R-spondin-3-stimulated cells were measured. Results: LGR5 was the top gene up-regulated in ZG (25-fold). The gene for its cognate ligand R-spondin-3, RSPO3, was 5-fold up-regulated. In total, 18 genes associated with the Wnt pathway were greater than 2-fold up-regulated. ZG selectivity of LGR5, and its absence in most APAs, were confirmed by quantitative PCR and immunohistochemistry. Both R-spondin-3 stimulation and LGR5 transfection of human adrenal cells suppressed aldosterone production. There was reduced proliferation and increased apoptosis of transfected cells, and the noncanonical activator protein-1/Jun pathway was stimulated more than the canonical Wnt pathway (3-fold vs 1.3-fold). ZG of adrenal sections stained positive for apoptosis markers. Conclusion: LGR5 is the most selectively expressed gene in human ZG and reduces aldosterone production and cell number. Such conditions may favor cells whose somatic mutation reverses aldosterone inhibition and cell loss. PMID:25915569

  1. Probable effect of photoperiod on seasonal variation in the nuclear volume of the adrenal cortex of viscacha (Lagostomus maximus maximus).


    Ribes, A C; Mohamed, F; Dominguez, S; Delgado, M; Scardapane, L; Guzman, J; Piezzi, R


    The neuroendocrine system regulates several organic functions such as reproduction, metabolism and adaptation to the environment. This system shows seasonal changes linked to the environment. The experimental model used in the present study was Lagostomus maximus maximus (viscacha). The reproduction of males of this species is photoperiod dependent. Twenty-four adult male viscachas were captured in their habitat at different times during one year. The adrenal glands were processed for light microscopy. Serial cuts were stained with hematoxylin-eosin for the morphometric study, and 100 nuclei of each zone of the adrenal cortex were counted per animal. Data were analyzed statistically by ANOVA and the Tukey test. The cells of the glomerulosa zone are arranged in a tube-shaped structure. The fasciculata zone has large cells with central nuclei and clearly visible nucleoli and with a vacuolar cytoplasm. In the reticularis zone there are two of types of cells, one with a nucleus of fine chromatin and a clearly visible nucleolus and the other with nuclear pycnosis. Morphometric analysis showed maximum nuclear volumes during the February-March period with values of 133 +/- 7.3 microm3 for the glomerulosa, 286.4 +/- 14.72 microm3 for the fasciculata, and 126.3 +/- 9.49 microm3 for the reticularis. Minimum nuclear volumes were observed in August with values of 88.24 +/- 9.9 microm3 for the glomerulosa, 163.7 +/- 7.78 microm3 for the fasciculata and 64.58 +/- 4.53 microm3 for the reticularis. The short winter photoperiod to which viscacha is subjected could inhibit the adrenal cortex through a melatonin increase which reduces the nuclear volume as well as the cellular activity.

  2. Mineralocorticoid production of adrenal cortical adenomas.


    Gláz, E; Rácz, K; Varga, I; Kiss, R; Tóth, M; Fütö, L


    We studied in vitro and in vivo corticosteroid production as well as the presence of symptoms of an increased mineralocorticoid effect in patients with 'silent' adrenal cortical adenomas, and compared these results to those found in patients with classical mineralocorticoid excess syndromes. We found that under in vitro conditions, cells from 'silent' adrenal cortical adenomas (n = 19) produced substantial amounts of both zona glomerulosa and fasciculata steroids, although the production of steroids in these cells was lower compared to that in mineralocorticoid-producing adenoma cells (n = 26). Patients with aldosterone-producing and 'silent' adenomas had significantly increased plasma atrial natriuretic peptide levels, which remained non-suppressible after upright posture and furosemide administration. Of the 25 patients with 'silent' adenomas, 11 had low and non-stimulable plasma renin activity (PRA) before but, in most cases, not after adrenal surgery. When compared to those with normal PRA (n = 14), patients with low PRA 'silent' adenomas (n = 11) had higher blood pressure which was significantly reduced after surgery, and a mild hypokalemia before but not after surgery. Although basal plasma concentrations of aldosterone, 18-hydroxy-corticosterone, corticosterone, deoxycorticosterone, 18-hydroxy-DOC, cortisol,11-deoxycortisol and 17-hydroxy-progesterone (17-OH-P) were not increased in either groups of 'silent' adenomas, ACTH stimulation produced a hyperreactive response for all measured steroids, of which an extremely high 17-OH-P seemed to be one of the most intriguing findings. We consider that these observations in 'silent' adrenal cortical adenomas may justify surgical intervention, irrespective of the size and potential malignancy of these adenomas. PMID:8481352

  3. LCAT deficiency in mice is associated with a diminished adrenal glucocorticoid function.


    Hoekstra, Menno; Korporaal, Suzanne J A; van der Sluis, Ronald J; Hirsch-Reinshagen, Veronica; Bochem, Andrea E; Wellington, Cheryl L; Van Berkel, Theo J C; Kuivenhoven, Jan Albert; Van Eck, Miranda


    In vitro studies have suggested that HDL and apoB-containing lipoproteins can provide cholesterol for synthesis of glucocorticoids. Here we assessed adrenal glucocorticoid function in LCAT knockout (KO) mice to determine the specific contribution of HDL-cholesteryl esters to adrenal glucocorticoid output in vivo. LCAT KO mice exhibit an 8-fold higher plasma free cholesterol-to-cholesteryl ester ratio (P < 0.001) and complete HDL-cholesteryl ester deficiency. ApoB-containing lipoprotein and associated triglyceride levels are increased in LCAT KO mice as compared with C57BL/6 control mice (44%; P < 0.05). Glucocorticoid-producing adrenocortical cells within the zona fasciculata in LCAT KO mice are devoid of neutral lipids. However, adrenal weights and basal corticosterone levels are not significantly changed in LCAT KO mice. In contrast, adrenals of LCAT KO mice show compensatory up-regulation of genes involved in cholesterol synthesis (HMG-CoA reductase; 516%; P < 0.001) and acquisition (LDL receptor; 385%; P < 0.001) and a marked 40-50% lower glucocorticoid response to adrenocorticotropic hormone exposure, endotoxemia, or fasting (P < 0.001 for all). In conclusion, our studies show that HDL-cholesteryl ester deficiency in LCAT KO mice is associated with a 40-50% lower adrenal glucocorticoid output. These findings further highlight the important novel role for HDL as cholesterol donor for the synthesis of glucocorticoids by the adrenals. PMID:23178225

  4. Comparative CYP-dependent binding of the adrenocortical toxicants 3-methylsulfonyl-DDE and o,p'-DDD in Y-1 adrenal cells.


    Hermansson, Veronica; Asp, Vendela; Bergman, Ake; Bergström, Ulrika; Brandt, Ingvar


    The environmental pollutant 3-MeSO(2)-DDE [2-(3-methylsulfonyl-4-chlorophenyl)-2-(4-chlorophenyl)-1,1-dichloroethene] is an adrenocortical toxicant in mice, specifically in the glucocorticoid-producing zona fasciculata, due to a cytochrome P450 11B1 (CYP11B1)-catalysed bioactivation and formation of covalently bound protein adducts. o,p'-DDD [2-(2-chlorophenyl)-2-(4-chlorophenyl)-1,1-dichloroethane] is toxic and inhibits steroidogenesis in the human adrenal cortex after bioactivation by unidentified CYPs, but does not exert any toxic effects on the mouse adrenal. As a step towards determining in vitro/in vivo relationships for the CYP-catalysed binding and toxicity of 3-MeSO(2)-DDE and o,p'-DDD, we have investigated the irreversible protein binding of these two toxicants in the murine adrenocortical cell line Y-1. The irreversible binding of 3-MeSO(2)-DDE previously demonstrated in vivo was successfully reproduced and could be inhibited by the CYP-inhibitors etomidate, ketoconazole and metyrapone. Surprisingly, o,p'-DDD reached similar levels of binding as 3-MeSO(2)-DDE. The binding of o,p'-DDD was sensitive to etomidate and ketoconazole, but not to metyrapone. Moreover, GSH depletion increased the binding of 3-MeSO(2)-DDE, but not of o,p'-DDD, indicating an important role of GSH conjugation in the detoxification of the 3-MeSO(2)-DDE-derived reactive metabolite. In addition, the specificity of CYP11B1 in activating 3-MeSO(2)-DDE was investigated using structurally analogous compounds. None of the analogues produced histopathological lesions in the mouse adrenal in vivo following a single i.p. injection of 100 mg/kg body weight, but two of the compounds were able to decrease the irreversible binding of 3-MeSO(2)-DDE to Y-1 cells. These results indicate that the bioactivation of 3-MeSO(2)-DDE by CYP11B1 is highly structure-dependent. In conclusion, both 3-MeSO(2)-DDE and o,p'-DDD bind irreversibly to Y-1 cells despite differences in binding and adrenotoxicity in mice

  5. Preoperative CT evaluation of adrenal glands in non-small cell bronchogenic carcinoma

    SciTech Connect

    Nielsen, M.E. Jr.; Heaston, D.K.; Dunnick, N.R.; Korobkin, M.


    Preoperative chest computed tomographic (CT) scans in 84 patients with biopsy-proven non-small cell bronchogenic carcinoma were reviewed. At least one adrenal gland was visualized in 70 of these. Evidence of a solid adrenal mass was present in 18 (14.5%) glands in 15 (21.4%) patients. Percutaneous needle aspiration under CT guidance confirmed metastatic malignancy in the four patients who were biopsied. Because the documented presence of adrenal metastases in non-small cell lung cancer makes surgical resection or local irradiation inappropriate, it is recommended that both adrenal glands in their entirety be specifically included whenever a staging chest CT examination is performed in patients with such tumors. Percutaneous needle biopsy for pathologic confirmation of the nature of solid adrenal masses discovered in this process is also useful.

  6. Effects of prolonged infusion of basic fibroblast growth factor and IGF-I on adrenocortical differentiation in the autotransplanted adrenal: an immunohistochemical study.


    Vendeira, P; Pignatelli, D; Neves, D; Magalhães, M M; Magalhães, M C; Vinson, G P


    Adrenocortical regeneration after adrenal autotransplantation provides a model for the study of local autocrine/paracrine mechanisms involved in the growth and differentiation of the adrenal cortex. To study the possible involvement of some growth factors, namely basic fibroblast growth factor (bFGF, FGF-2) and insulin-like growth factor I (IGF-I), in cell differentiation, immunohistochemical and ultrastructural studies were carried out on adrenal autotransplants in adult male rats. To distinguish between fasciculata and glomerulosa-like cells with accuracy, tissue sections were immunostained with IZAb, which recognizes the inner zone antigen (IZAg) present in fasciculata and reticularis cells but absent from the glomerulosa, and by electron microscopy. IGF-I-treated animals exhibited a clear glomerulosa-like zone that was devoid of IZAb immunostaining. In this outer subcapsular area, ultrastructural examination showed cells containing mitochondria with irregular cristae resembling those of the fetal or immature glomerulosa cells. In contrast, no significant morphological differences were observed in bFGF-treated animals when compared with those from saline-treated controls, in both of which, IZAb immunostaining occurred in almost all adrenocortical cells, with no clear zonation or glomerulosa, as seen in the intact animal. Plasma aldosterone and corticosterone concentrations were lower in autotransplanted control animals than in intact controls, although plasma renin activities were similar. IGF-I treatment significantly increased aldosterone concentrations, whereas corticosterone and plasma renin activity were reduced. bFGF infusion further reduced plasma aldosterone, although plasma renin activity and corticosterone were unaffected. These results suggest that the two growth factors have different effects on zonal differentiation and function in the autotransplanted gland. In particular, bFGF, by reducing glomerulosa function, appears partly to replicate the

  7. Estimation of the Mechanism of Adrenal Action of Endocrine-Disrupting Compounds Using a Computational Model of Adrenal Steroidogenesis in NCI-H295R Cells

    PubMed Central

    Saito, Ryuta; Terasaki, Natsuko; Yamazaki, Makoto; Masutomi, Naoya; Tsutsui, Naohisa; Okamoto, Masahiro


    Adrenal toxicity is one of the major concerns in drug development. To quantitatively understand the effect of endocrine-active compounds on adrenal steroidogenesis and to assess the human adrenal toxicity of novel pharmaceutical drugs, we developed a mathematical model of steroidogenesis in human adrenocortical carcinoma NCI-H295R cells. The model includes cellular proliferation, intracellular cholesterol translocation, diffusional transport of steroids, and metabolic pathways of adrenal steroidogenesis, which serially involve steroidogenic proteins and enzymes such as StAR, CYP11A1, CYP17A1, HSD3B2, CYP21A2, CYP11B1, CYP11B2, HSD17B3, and CYP19A1. It was reconstructed in an experimental dynamics of cholesterol and 14 steroids from an in vitro steroidogenesis assay using NCI-H295R cells. Results of dynamic sensitivity analysis suggested that HSD3B2 plays the most important role in the metabolic balance of adrenal steroidogenesis. Based on differential metabolic profiling of 12 steroid hormones and 11 adrenal toxic compounds, we could estimate which steroidogenic enzymes were affected in this mathematical model. In terms of adrenal steroidogenic inhibitors, the predicted action sites were approximately matched to reported target enzymes. Thus, our computer-aided system based on systems biological approach may be useful to understand the mechanism of action of endocrine-active compounds and to assess the human adrenal toxicity of novel pharmaceutical drugs. PMID:27057163

  8. Estimation of the Mechanism of Adrenal Action of Endocrine-Disrupting Compounds Using a Computational Model of Adrenal Steroidogenesis in NCI-H295R Cells.


    Saito, Ryuta; Terasaki, Natsuko; Yamazaki, Makoto; Masutomi, Naoya; Tsutsui, Naohisa; Okamoto, Masahiro


    Adrenal toxicity is one of the major concerns in drug development. To quantitatively understand the effect of endocrine-active compounds on adrenal steroidogenesis and to assess the human adrenal toxicity of novel pharmaceutical drugs, we developed a mathematical model of steroidogenesis in human adrenocortical carcinoma NCI-H295R cells. The model includes cellular proliferation, intracellular cholesterol translocation, diffusional transport of steroids, and metabolic pathways of adrenal steroidogenesis, which serially involve steroidogenic proteins and enzymes such as StAR, CYP11A1, CYP17A1, HSD3B2, CYP21A2, CYP11B1, CYP11B2, HSD17B3, and CYP19A1. It was reconstructed in an experimental dynamics of cholesterol and 14 steroids from an in vitro steroidogenesis assay using NCI-H295R cells. Results of dynamic sensitivity analysis suggested that HSD3B2 plays the most important role in the metabolic balance of adrenal steroidogenesis. Based on differential metabolic profiling of 12 steroid hormones and 11 adrenal toxic compounds, we could estimate which steroidogenic enzymes were affected in this mathematical model. In terms of adrenal steroidogenic inhibitors, the predicted action sites were approximately matched to reported target enzymes. Thus, our computer-aided system based on systems biological approach may be useful to understand the mechanism of action of endocrine-active compounds and to assess the human adrenal toxicity of novel pharmaceutical drugs.

  9. Adrenal medulla calcium channel population is not conserved in bovine chromaffin cells in culture.


    Benavides, A; Calvo, S; Tornero, D; González-García, C; Ceña, V


    During the stress response adrenal medullary chromaffin cells release catecholamines to the bloodstream. Voltage-activated calcium channels present in the cell membrane play a crucial role in this process. Although the electrophysiological and pharmacological properties of chromaffin cell calcium channels have been studied in detail, the molecular composition of these channels has not been defined yet. Another aspect that needs to be explored is the extent to which chromaffin cells in culture reflect the adrenal medulla calcium channel characteristics. In this sense, it has been described that catecholamine release in the intact adrenal gland recruits different calcium channels than those recruited during secretion from cultured chromaffin cells. Additionally, recent electrophysiological studies show that chromaffin cells in culture differ from those located in the intact adrenal medulla in the contribution of several calcium channel types to the whole cell current. However there is not yet any study that compares the population of calcium channels in chromaffin cells with that one present in the adrenal medulla. In order to gain some insight into the roles that calcium channels might play in the adrenal medullary cells we have analyzed the alpha1 subunit mRNA expression profile. We demonstrate that the expression pattern of voltage-dependent calcium channels in cultured bovine chromaffin cells markedly differs from that found in the native adrenal medulla and that glucocorticoids are only partially involved in those differences. Additionally, we show, for the first time, that the cardiac isoform of L-type calcium channel is present in both bovine adrenal medulla and cultured chromaffin cells and that its levels of expression do not vary during culture. PMID:15450357

  10. PKA inhibits WNT signalling in adrenal cortex zonation and prevents malignant tumour development.


    Drelon, Coralie; Berthon, Annabel; Sahut-Barnola, Isabelle; Mathieu, Mickaël; Dumontet, Typhanie; Rodriguez, Stéphanie; Batisse-Lignier, Marie; Tabbal, Houda; Tauveron, Igor; Lefrançois-Martinez, Anne-Marie; Pointud, Jean-Christophe; Gomez-Sanchez, Celso E; Vainio, Seppo; Shan, Jingdong; Sacco, Sonia; Schedl, Andreas; Stratakis, Constantine A; Martinez, Antoine; Val, Pierre


    Adrenal cortex physiology relies on functional zonation, essential for production of aldosterone by outer zona glomerulosa (ZG) and glucocorticoids by inner zona fasciculata (ZF). The cortex undergoes constant cell renewal, involving recruitment of subcapsular progenitors to ZG fate and subsequent lineage conversion to ZF identity. Here we show that WNT4 is an important driver of WNT pathway activation and subsequent ZG differentiation and demonstrate that PKA activation prevents ZG differentiation through WNT4 repression and WNT pathway inhibition. This suggests that PKA activation in ZF is a key driver of WNT inhibition and lineage conversion. Furthermore, we provide evidence that constitutive PKA activation inhibits, whereas partial inactivation of PKA catalytic activity stimulates β-catenin-induced tumorigenesis. Together, both lower PKA activity and higher WNT pathway activity lead to poorer prognosis in adrenocortical carcinoma (ACC) patients. These observations suggest that PKA acts as a tumour suppressor in the adrenal cortex, through repression of WNT signalling. PMID:27624192

  11. PKA inhibits WNT signalling in adrenal cortex zonation and prevents malignant tumour development

    PubMed Central

    Drelon, Coralie; Berthon, Annabel; Sahut-Barnola, Isabelle; Mathieu, Mickaël; Dumontet, Typhanie; Rodriguez, Stéphanie; Batisse-Lignier, Marie; Tabbal, Houda; Tauveron, Igor; Lefrançois-Martinez, Anne-Marie; Pointud, Jean-Christophe; Gomez-Sanchez, Celso E.; Vainio, Seppo; Shan, Jingdong; Sacco, Sonia; Schedl, Andreas; Stratakis, Constantine A.; Martinez, Antoine; Val, Pierre


    Adrenal cortex physiology relies on functional zonation, essential for production of aldosterone by outer zona glomerulosa (ZG) and glucocorticoids by inner zona fasciculata (ZF). The cortex undergoes constant cell renewal, involving recruitment of subcapsular progenitors to ZG fate and subsequent lineage conversion to ZF identity. Here we show that WNT4 is an important driver of WNT pathway activation and subsequent ZG differentiation and demonstrate that PKA activation prevents ZG differentiation through WNT4 repression and WNT pathway inhibition. This suggests that PKA activation in ZF is a key driver of WNT inhibition and lineage conversion. Furthermore, we provide evidence that constitutive PKA activation inhibits, whereas partial inactivation of PKA catalytic activity stimulates β-catenin-induced tumorigenesis. Together, both lower PKA activity and higher WNT pathway activity lead to poorer prognosis in adrenocortical carcinoma (ACC) patients. These observations suggest that PKA acts as a tumour suppressor in the adrenal cortex, through repression of WNT signalling. PMID:27624192

  12. Exposure to an Extremely-Low-Frequency Magnetic Field Stimulates Adrenal Steroidogenesis via Inhibition of Phosphodiesterase Activity in a Mouse Adrenal Cell Line

    PubMed Central

    Kitaoka, Kazuyoshi; Kawata, Shiyori; Yoshida, Tomohiro; Kadoriku, Fumiya; Kitamura, Mitsuo


    Extremely low-frequency magnetic fields (ELF-MFs) are generated by power lines and household electrical devices. In the last several decades, some evidence has shown an association between ELF-MF exposure and depression and/or anxiety in epidemiological and animal studies. The mechanism underlying ELF-MF-induced depression is considered to involve adrenal steroidogenesis, which is triggered by ELF-MF exposure. However, how ELF-MFs stimulate adrenal steroidogenesis is controversial. In the current study, we investigated the effect of ELF-MF exposure on the mouse adrenal cortex-derived Y-1 cell line and the human adrenal cortex-derived H295R cell line to clarify whether the ELF-MF stimulates adrenal steroidogenesis directly. ELF-MF exposure was found to significantly stimulate adrenal steroidogenesis (p < 0.01–0.05) and the expression of adrenal steroid synthetic enzymes (p < 0.05) in Y-1 cells, but the effect was weak in H295R cells. Y-1 cells exposed to an ELF-MF showed significant decreases in phosphodiesterase activity (p < 0.05) and intracellular Ca2+ concentration (p < 0.01) and significant increases in intracellular cyclic adenosine monophosphate (cAMP) concentration (p < 0.001–0.05) and cAMP response element-binding protein phosphorylation (p < 0.05). The increase in cAMP was not inhibited by treatment with NF449, an inhibitor of the Gs alpha subunit of G protein. Our results suggest that ELF-MF exposure stimulates adrenal steroidogenesis via an increase in intracellular cAMP caused by the inhibition of phosphodiesterase activity in Y-1 cells. The same mechanism may trigger the increase in adrenal steroid secretion in mice observed in our previous study. PMID:27100201

  13. Adrenal myelolipoma.


    Cyran, K M; Kenney, P J; Memel, D S; Yacoub, I


    In 1905, Gierke [1] first described the occurrence of a tumor in the adrenal composed of mature fat and mixed myeloid and erythroid cells, subsequently termed "formations myelolipomatoses" by Oberling [2] in 1929. PMID:8553954

  14. Silicification of auxospores in the araphid diatom Tabularia fasciculata (Bacillariophyta).


    Mather, Laura; Ehrman, James M; Kaczmarska, Irena


    We report on auxospore wall structure and development in the araphid pennate diatom Tabularia fasciculata. Similar to most other pennates, these auxospores showed a typical bidirectional elongation, but unexpectedly bore no transverse perizonium, and with no detectable silicon during much of their expansion. Energy dispersive X-ray spectroscopy (EDS) analyses segregated auxospores into two types: (1) those containing no detectable silicon and (2) those with measureable amounts. Both types were of similar size. Silica precipitation began throughout the auxospore at or near maximal length, but initially was detectable in isolated regions throughout the structure. Following this initial condition, silicon was consistently detectable throughout auxospores of comparable size and corresponded to deposition of longitudinal perizonium (visible through the thin organic outer layer of the wall in some auxospores), followed by the deposition of the initial valves. Our results raise the question as to how the tubular shape of bidirectionally expanding auxospores up to ∼90 μm long is maintained in the absence of transverse siliceous elements restricting isodiametric expansion of the cell, which are present in all other known pennate auxospores and all but one other diatom. Our study is the first to systematically examine mineral elements of the auxospore wall analytically.

  15. (/sup 3/H)nitrendipine binding to adrenal capsular membranes

    SciTech Connect

    Finkel, M.S.; Aguilera, G.; Catt, K.J.; Keiser, H.R.


    The physiologic regulation of aldosterone secretion is dependent on extracellular calcium and appears to be mediated by increases in cytosolic free calcium concentration in the zona glomerulosa cell. A specific role for voltage-dependent calcium channels was suggested by previous studies with the calcium channel antagonist verapamil. The authors therefore studied the (/sup 3/H)nitrendipine calcium channel binding site in adrenal capsules. These studies revealed a single class of saturable, high affinity sites with K/sub D/ = .26 +/- .04 nM and B/sub max/ = 105 +/- 5.7 fmol/mg protein. Specific binding of (/sup 3/H)nitrendipine was inhibited by calcium channel antagonists with potencies nitrendipine = nifedipine >> verapamil, while diltiazem had no inhibitory effect. In the rat, binding sites for (/sup 3/H)nitrendipine were located in the adrenal capsule and medulla and were undetectable in the zona fasciculata. Physiologic studies with collagenase-dispersed adrenal glomerulosa cells demonstrated that nifedipine selectively inhibited angiotensin-II and potassium-stimulated steroidogenesis. These observations suggest both a pharmacologic and physiologic role for the nitrendipine binding site in aldosterone production. 17 references, 2 figures, 1 table.

  16. Adrenal glands of slaughtered bulls, heifers and cows: a histological study.


    Jelinek, F; Konecny, R


    The study involved histological and immunohistochemical examinations of the adrenal glands of healthy slaughtered cattle. Glands of 13 bulls, 10 heifers and 10 cows were examined. The following histological findings were observed: Unequal thickness of connective capsule and nodular formations of the zona glomerulosa (ZG), eosinophilic granules in cells of the ZG, globoid arrangement of the zona fasciculata, nodules or pegs of cortical tissue in the medulla, mutual interlacing of superficial and deep zones of the medulla, proliferation of cortical or medullary cells into the blood vessels wall situated in the medulla and focal inflammatory infiltrates. Cortical cells and noradrenalin-secreting (N) cells in the medulla expressed cytoplasmic positivity of S100 protein. Both adrenalin (A) cells and N cells were positive in synaptophysin. The majority of the cells in the cortex and in the medulla displayed were positive for chromogranin A. Electron microscopy showed structureless, electrondense particles of varying size and shape, mostly displaying the having mostly character of secretory granules.

  17. Generation of Murine Sympathoadrenergic Progenitor-Like Cells from Embryonic Stem Cells and Postnatal Adrenal Glands

    PubMed Central

    Saxena, Shobhit; Wahl, Joachim; Huber-Lang, Markus S.; Stadel, Dominic; Braubach, Peter; Debatin, Klaus-Michael; Beltinger, Christian


    Sympathoadrenergic progenitor cells (SAPs) of the peripheral nervous system (PNS) are important for normal development of the sympathetic PNS and for the genesis of neuroblastoma, the most common and often lethal extracranial solid tumor in childhood. However, it remains difficult to isolate sufficient numbers of SAPs for investigations. We therefore set out to improve generation of SAPs by using two complementary approaches, differentiation from murine embryonic stem cells (ESCs) and isolation from postnatal murine adrenal glands. We provide evidence that selecting for GD2 expression enriches for ESC-derived SAP-like cells and that proliferating SAP-like cells can be isolated from postnatal adrenal glands of mice. These advances may facilitate investigations about the development and malignant transformation of the sympathetic PNS. PMID:23675538

  18. Generation of murine sympathoadrenergic progenitor-like cells from embryonic stem cells and postnatal adrenal glands.


    Saxena, Shobhit; Wahl, Joachim; Huber-Lang, Markus S; Stadel, Dominic; Braubach, Peter; Debatin, Klaus-Michael; Beltinger, Christian


    Sympathoadrenergic progenitor cells (SAPs) of the peripheral nervous system (PNS) are important for normal development of the sympathetic PNS and for the genesis of neuroblastoma, the most common and often lethal extracranial solid tumor in childhood. However, it remains difficult to isolate sufficient numbers of SAPs for investigations. We therefore set out to improve generation of SAPs by using two complementary approaches, differentiation from murine embryonic stem cells (ESCs) and isolation from postnatal murine adrenal glands. We provide evidence that selecting for GD2 expression enriches for ESC-derived SAP-like cells and that proliferating SAP-like cells can be isolated from postnatal adrenal glands of mice. These advances may facilitate investigations about the development and malignant transformation of the sympathetic PNS.

  19. Angiotensin II binding to cultured bovine adrenal chromaffin cells: identification of angiotensin II receptors

    SciTech Connect

    Boyd, V.L.; Printz, M.P.


    Physiological experiments have provided evidence that angiotensin II stimulates catecholamine secretion from the adrenal gland. Their laboratory and others have now shown by receptor autoradiography the presence of angiotensin II receptors (AIIR) in bovine and rat adrenal medulla. In order to extend these studies they have undertaken to define AIIR on cultured bovine adrenal chromaffin cells. Cells were isolated using the method of Levitt including cell enrichment with Percoll gradient centrifugation. Primary cultures of bovine adrenal medullary cells were maintained in DME/F12 medium containing 10% FCS. Cells were characterized by immunocytochemistry for Met- and Leu-enkephalin, PNMT, DBH and Chromagranin A. Cultured cells bind with high affinity and specificity (/sup 125/I)-ANG II yielding a K/sub D/ of 0.74 nM and B/sub max/ of 24,350 sites/cell. After Percoll treatment values of .77 nm and 34,500 sites/cell are obtained. K/sub D/ values are in close agreement with that obtained in adrenal slices by Healy. Competition studies identify a rank order of binding by this receptor similar to that of other tissues. They conclude that cultured chromaffin cells provide a suitable model system for the investigation and characterization of the ANG II receptor and for cellular studies of its functional significance.

  20. Isolation, Characterization, and Differentiation of Progenitor Cells from Human Adult Adrenal Medulla

    PubMed Central

    Santana, Magda M.; Chung, Kuei-Fang; Vukicevic, Vladimir; Rosmaninho-Salgado, Joana; Kanczkowski, Waldemar; Cortez, Vera; Hackmann, Karl; Bastos, Carlos A.; Mota, Alfredo; Schrock, Evelin; Bornstein, Stefan R.; Cavadas, Cláudia


    Chromaffin cells, sympathetic neurons of the dorsal ganglia, and the intermediate small intensely fluorescent cells derive from a common neural crest progenitor cell. Contrary to the closely related sympathetic nervous system, within the adult adrenal medulla a subpopulation of undifferentiated progenitor cells persists, and recently, we established a method to isolate and differentiate these progenitor cells from adult bovine adrenals. However, no studies have elucidated the existence of adrenal progenitor cells within the human adrenal medulla. Here we describe the isolation, characterization, and differentiation of chromaffin progenitor cells obtained from adult human adrenals. Human chromaffin progenitor cells were cultured in low-attachment conditions for 10–12 days as free-floating spheres in the presence of fibroblast growth factor-2 (FGF-2) and epidermal growth factor. These primary human chromosphere cultures were characterized by the expression of several progenitor markers, including nestin, CD133, Notch1, nerve growth factor receptor, Snai2, Sox9, Sox10, Phox2b, and Ascl1 on the molecular level and of Sox9 on the immunohistochemical level. In opposition, phenylethanolamine N-methyltransferase (PNMT), a marker for differentiated chromaffin cells, significantly decreased after 12 days in culture. Moreover, when plated on poly-l-lysine/laminin-coated slides in the presence of FGF-2, human chromaffin progenitor cells were able to differentiate into two distinct neuron-like cell types, tyrosine hydroxylase (TH)+/β-3-tubulin+ cells and TH−/β-3-tubulin+ cells, and into chromaffin cells (TH+/PNMT+). This study demonstrates the presence of progenitor cells in the human adrenal medulla and reveals their potential use in regenerative medicine, especially in the treatment of neuroendocrine and neurodegenerative diseases. PMID:23197690

  1. Isolation, characterization, and differentiation of progenitor cells from human adult adrenal medulla.


    Santana, Magda M; Chung, Kuei-Fang; Vukicevic, Vladimir; Rosmaninho-Salgado, Joana; Kanczkowski, Waldemar; Cortez, Vera; Hackmann, Klaus; Bastos, Carlos A; Mota, Alfredo; Schrock, Evelin; Bornstein, Stefan R; Cavadas, Cláudia; Ehrhart-Bornstein, Monika


    Chromaffin cells, sympathetic neurons of the dorsal ganglia, and the intermediate small intensely fluorescent cells derive from a common neural crest progenitor cell. Contrary to the closely related sympathetic nervous system, within the adult adrenal medulla a subpopulation of undifferentiated progenitor cells persists, and recently, we established a method to isolate and differentiate these progenitor cells from adult bovine adrenals. However, no studies have elucidated the existence of adrenal progenitor cells within the human adrenal medulla. Here we describe the isolation, characterization, and differentiation of chromaffin progenitor cells obtained from adult human adrenals. Human chromaffin progenitor cells were cultured in low-attachment conditions for 10-12 days as free-floating spheres in the presence of fibroblast growth factor-2 (FGF-2) and epidermal growth factor. These primary human chromosphere cultures were characterized by the expression of several progenitor markers, including nestin, CD133, Notch1, nerve growth factor receptor, Snai2, Sox9, Sox10, Phox2b, and Ascl1 on the molecular level and of Sox9 on the immunohistochemical level. In opposition, phenylethanolamine N-methyltransferase (PNMT), a marker for differentiated chromaffin cells, significantly decreased after 12 days in culture. Moreover, when plated on poly-l-lysine/laminin-coated slides in the presence of FGF-2, human chromaffin progenitor cells were able to differentiate into two distinct neuron-like cell types, tyrosine hydroxylase (TH)(+)/β-3-tubulin(+) cells and TH(-)/β-3-tubulin(+) cells, and into chromaffin cells (TH(+)/PNMT(+)). This study demonstrates the presence of progenitor cells in the human adrenal medulla and reveals their potential use in regenerative medicine, especially in the treatment of neuroendocrine and neurodegenerative diseases. PMID:23197690

  2. Sterol carrier protein2: further evidence for its role in adrenal steroidogenesis.


    Chanderbhan, R F; Kharroubi, A T; Noland, B J; Scallen, T J; Vahouny, G V


    Homogeneous rat liver sterol carrier protein (SCP2) has been implicated in adrenal steroidogenesis by studies utilizing as a model system various sub-cellular fractions of rat adrenals. Levels of SCP2 were measured in rat adrenal subcellular fractions and various rat tissues using a highly sensitive radioimmunoassay. The levels of SCP2 in various tissues correlate well with the capacity of each tissue to either synthesize or metabolize cholesterol. The high level of SCP2 in adrenal mitochondria (46% of total tissue SCP2) is consistent with its proposed role of enhancing transfer of cholesterol from the outer to the inner mitochondrial membrane. Neither ACTH nor cycloheximide treatment of rats had a significant effect on SCP2 levels or distribution in the adrenal subcellular fractions. Western blot analysis of adrenal subcellular fractions indicates the presence of a protein of identical molecular weight and at least similar antigenicity as homogeneous rat liver SCP2. In the present studies, intact dispersed rat adrenal fasciculata cells fused with liposomal encapsulated anti-SCP2 IgG showed a 40-65% reduction in their ability to produce corticosterone when stimulated with ACTH. The steroidogenic competence of these anti-SCP2 IgG treated cells can be restored by treatment of the cells with liposomal encapsulated SCP2 prior to ACTH stimulation. These findings provide direct evidence for the involvement of SCP2 in ACTH stimulated steroidogenesis in rat adrenocortical cells, and suggests that SCP2 may not be the putative high turnover "labile protein" involved in acute steroidogenesis. PMID:3030719

  3. Ectopic Paratubal Adrenal Cell Rest Associated with Mucinous Cystadenoma of Ovary

    PubMed Central

    Dey, Soumit; Ray, Prasenjit Sen; Sarkar, Ranu; Bhattacharyya, Palas


    Ectopic adrenal cortex is a rare entity. Usually found in male children; commonly located around kidney, retroperitoneum, spermatic cord and para-testicular region. Rarely, adults with heterotopic adrenal glands are described. Incidence in females is very less; though sometimes detected accidentally in hysterectomy specimens. We describe a case of ectopic adrenal cortical cell in paratubal region in a patient with mucinous cyst adenoma of ovary. A 26-year-old female presented with complains of menstrual irregularities and abdominal discomfort for 6 months. Investigations suggested a right ovarian cyst. Right ovarian cystectomy with partial salpingectomy was performed; histopathology revealed mucinous cyst adenoma. Sections from tube showed presence of ectopic adrenal cortical rest in the paratubal region, incidentally discovered on microscopy. We present this case because of its rarity in females, interesting presentation with another unrelated gynaecological pathology, its potentiality for malignant transformation and possible complications. PMID:26557532

  4. Temporal and spatial distribution of mast cells and steroidogenic enzymes in the human fetal adrenal.


    Naccache, Alexandre; Louiset, Estelle; Duparc, Céline; Laquerrière, Annie; Patrier, Sophie; Renouf, Sylvie; Gomez-Sanchez, Celso E; Mukai, Kuniaki; Lefebvre, Hervé; Castanet, Mireille


    Mast cells are present in the human adult adrenal with a potential role in the regulation of aldosterone secretion in both normal cortex and adrenocortical adenomas. We have investigated the human developing adrenal gland for the presence of mast cells in parallel with steroidogenic enzymes profile and serotonin signaling pathway. RT-QPCR and immunohistochemical studies were performed on adrenals at 16-41 weeks of gestation (WG). Tryptase-immunopositive mast cells were found from 18 WG in the adrenal subcapsular layer, close to 3βHSD- and CYP11B2-immunoreactive cells, firstly detected at 18 and 24 WG, respectively. Tryptophan hydroxylase and serotonin receptor type 4 expression increased at 30 WG before the CYP11B2 expression surge. In addition, HDL and LDL cholesterol receptors were expressed in the subcapsular zone from 24 WG. Altogether, our findings suggest the implication of mast cells and serotonin in the establishment of the mineralocorticoid synthesizing pathway during fetal adrenal development. PMID:27302892

  5. Effects of muscarine on single rat adrenal chromaffin cells.

    PubMed Central

    Neely, A; Lingle, C J


    1. The action of muscarine on membrane currents and cytosolic calcium (Ca2+) of dissociated rat adrenal chromaffin cells was investigated using standard whole-cell voltage-clamp techniques and microfluorimetry of unclamped single cells. 2. In cells held at a constant holding potential negative to -40 mV, brief (5-10 s) applications of muscarine produced a transient activation of outward current. The activation of this current by muscarine also occurs in the presence of 5 mM-Co2+. 3. The outward current activated by muscarine at holding potentials negative to about -40 mV is blocked over 90% by either 200 microM-curare or 200 nM-apamin. One millimolar TEA produces variable blocking effects at such potentials. 4. The outward current activated by muscarine is transient even in the continuing presence of muscarine. Complete recovery between pairs of muscarine applications occurs over a 1-2 min period. If sufficient time was allowed for recovery between muscarine applications, the muscarine-activated outward current could be reliably elicited in dialysed cells for periods of 20-30 min. 5. Voltage ramps were used to examine effects of muscarine on currents over a range of membrane potentials. Over all potentials, muscarine activates a relatively voltage-independent component which is blocked almost completely by 200 nM-apamin and by 200 microM-curare. At potentials negative to about -40 mV, the apamin- and curare-sensitive current accounts for virtually all muscarine-activated current. This current appears to correspond to a Ca(2+)-activated, voltage-independent current found in these cells. Effects of muscarine on currents activated at potentials positive to 0 mV are complex. At potentials above 0 mV, muscarine can produce either an activation or an inhibition of outward current. The outward current activated at positive potentials was primarily voltage dependent and blocked by 1 mM-TEA. However, in some cells activation of voltage-dependent current was not observed and

  6. A connection between extracellular matrix and hormonal signals during the development of the human fetal adrenal gland.


    Chamoux, E; Otis, M; Gallo-Payet, N


    The human adrenal cortex, involved in adaptive responses to stress, body homeostasis and secondary sexual characters, emerges from a tightly regulated development of a zone-specific secretion pattern during fetal life. Its development during fetal life is critical for the well being of pregnancy, the initiation of delivery, and even for an adequate adaptation to extra-uterine life. As early as from the sixth week of pregnancy, the fetal adrenal gland is characterized by a highly proliferative zone at the periphery, a concentric migration accompanied by cell differentiation (cortisol secretion) and apoptosis in the central androgen-secreting fetal zone. After birth, a strong reorganization occurs in the adrenal gland so that it better fulfills the newborn's needs, with aldosterone production in the external zona glomerulosa, cortisol secretion in the zona fasciculata and androgens in the central zona reticularis. In addition to the major hormonal stimuli provided by angiotensin II and adrenocorticotropin, we have tested for some years the hypotheses that such plasticity may be under the control of the extracellular matrix. A growing number of data have been harvested during the last years, in particular about extracellular matrix expression and its putative role in the development of the human adrenal cortex. Laminin, collagen and fibronectin have been shown to play important roles not only in the plasticity of the adrenal cortex, but also in cell responsiveness to hormones, thus clarifying some of the unexplained observations that used to feed controversies. PMID:16172742

  7. The adrenal capsule is a signaling center controlling cell renewal and zonation through Rspo3.


    Vidal, Valerie; Sacco, Sonia; Rocha, Ana Sofia; da Silva, Fabio; Panzolini, Clara; Dumontet, Typhanie; Doan, Thi Mai Phuong; Shan, Jingdong; Rak-Raszewska, Aleksandra; Bird, Tom; Vainio, Seppo; Martinez, Antoine; Schedl, Andreas


    Adrenal glands are zonated endocrine organs that are essential in controlling body homeostasis. How zonation is induced and maintained and how renewal of the adrenal cortex is ensured remain a mystery. Here we show that capsular RSPO3 signals to the underlying steroidogenic compartment to induce β-catenin signaling and imprint glomerulosa cell fate. Deletion of RSPO3 leads to loss of SHH signaling and impaired organ growth. Importantly, Rspo3 function remains essential in adult life to ensure replenishment of lost cells and maintain the properties of the zona glomerulosa. Thus, the adrenal capsule acts as a central signaling center that ensures replacement of damaged cells and is required to maintain zonation throughout life. PMID:27313319

  8. The adrenal capsule is a signaling center controlling cell renewal and zonation through Rspo3.


    Vidal, Valerie; Sacco, Sonia; Rocha, Ana Sofia; da Silva, Fabio; Panzolini, Clara; Dumontet, Typhanie; Doan, Thi Mai Phuong; Shan, Jingdong; Rak-Raszewska, Aleksandra; Bird, Tom; Vainio, Seppo; Martinez, Antoine; Schedl, Andreas


    Adrenal glands are zonated endocrine organs that are essential in controlling body homeostasis. How zonation is induced and maintained and how renewal of the adrenal cortex is ensured remain a mystery. Here we show that capsular RSPO3 signals to the underlying steroidogenic compartment to induce β-catenin signaling and imprint glomerulosa cell fate. Deletion of RSPO3 leads to loss of SHH signaling and impaired organ growth. Importantly, Rspo3 function remains essential in adult life to ensure replenishment of lost cells and maintain the properties of the zona glomerulosa. Thus, the adrenal capsule acts as a central signaling center that ensures replacement of damaged cells and is required to maintain zonation throughout life.

  9. Adipose cell-adrenal interactions: current knowledge and future perspectives.


    Ronconi, Vanessa; Turchi, Federica; Bujalska, Iwona J; Giacchetti, Gilberta; Boscaro, Marco


    The central role of adipose tissue in the development of cardiovascular and metabolic pathology has been highlighted by the discovery of mediators (adipokines) secreted by adipose tissue and their involvement in the regulation of various biological processes. In light of recent experimental data, cross-talk between adipose tissue and the adrenal gland, particularly via the mineralocorticoid aldosterone, has been proposed. Aldosterone can induce adipogenesis, and human white adipose tissue is reported to release as-yet-uncharacterized factors that stimulate adrenocortical steroidogenesis and aldosterone production. These data could provide new insights into the pathophysiology of obesity-related disorders, including hypertension and aldosterone excess, with further studies necessary for confirming and better defining such adipose-adrenal interactions.

  10. [Solitary fibrous tumor of the adrenal gland with renal cell carcinoma and angiomyolipoma at the same time; a case report].


    Hashizume, Kazumi; Matsumoto, Seiji; Nakazono, Syusaku; Tamaki, Gaku; Motoya, Tadasu; Iwata, Tatsuya; Kitahara, Katsuyuki; Kakizaki, Hidehiro


    Solitary fibrous tumor (SFT) is a neoplasm of pleura and its occurrence in the retroperitoneal space is rare. We report a case of SFT of the adrenal gland associated with ipsilateral renal cell carcinoma (RCC) and angiomyolipoma (AML). A 48-year-old woman was referred to our hospital for a left renal AML. Computed tomography (CT) in our hospital showed a left adrenal mass (25 x 20 mm). Because the adrenal tumor was nonfunctioning, she was followed at outpatient clinic. Four years later, CT showed an increase in the left adrenal tumor size (42 x 30 mm) and a left RCC. Left adrenectomy and partial nephrectomy for RCC and AML were simultaneously performed. Histological examination revealed adrenal SFT and clear cell carcinoma and AML of the kidney. We present a brief review on histological characteristics of retroperitoneal SFT and its occurrence in the adrenal grand region.

  11. Regulation of α3-containing GABAA receptors in guinea-pig adrenal medullary cells by adrenal steroids.


    Inoue, M; Harada, K; Nakamura, J; Matsuoka, H


    GABA is thought to function as a paracrine factor in adrenal medullary (AM) cells. Thus, we electrophysiologically and immunologically examined the properties of GABAA receptors (GABAARs) in guinea-pig AM cells. Bath application of GABA produced an inward current at -60 mV in a dose-dependent manner with an EC50 of 32.3 μM. This GABA-induced current was enhanced by allopregnanolone at concentrations of 0.01 μM and more. A prior exposure to allopregnanolone resulted in a decrease in an EC50 for GABA in activating GABAARs. The GABA-induced current was suppressed by Zn(2+) in a dose-dependent manner with an IC50 of 18 μM, whereas it was enhanced by 100 μM La(3+). The benzodiazepine analog diazepam was three times more potent than zolpidem in enhancing the GABA current, and it was also augmented by L-838,417, which has no action on α1-containing GABAARs. The GABAAR α3, but not α1, and γ2 subunits were immunologically detected at the cell periphery. The expression of α3 subunits in PC12 cells was enhanced by glucocorticoid activity. The results indicated that GABAARs in guinea-pig AM cells mainly comprise α3, β, and γ2 subunits and are enhanced by allopreganalone and glucocorticoids may play a major role in the expression of α3 subunits. PMID:24012744

  12. Requirement for metalloendoprotease in exocytosis: evidence in mast cells and adrenal chromaffin cells.


    Mundy, D I; Strittmatter, W J


    Exocytosis is initiated by the receptor-mediated influx of calcium that results in fusion of the secretory vesicle with the plasma membrane. We examined the possibility that calcium-dependent exocytosis in mast cells and adrenal chromaffin cells requires metalloendoprotease activity. Metalloendoprotease inhibitors and dipeptide substrates block exocytosis in these cells with the same specificity and dose dependency as that with which they interact with metalloendoproteases. Metalloendoprotease activity is identified in these cells with fluorogenic synthetic substrates, which also blocked exocytosis. Metalloendoprotease activity is highest in the plasma membrane of chromaffin cells. The metalloendoprotease appears to be required in exocytosis at a step dependent on or after calcium entry, since exocytosis initiated by direct calcium introduction in both mast cells and chromaffin cells is blocked by metalloendoprotease inhibitors.

  13. Adrenal Insufficiency


    ... What is adrenal insufficiency? Did you know? The adrenal glands, located on top of the kidneys, make hormones ... body functions. The outer layer (cortex) of the adrenal glands makes three types of steroid hormones. In adrenal ...

  14. PC12 Cells Differentiate into Chromaffin Cell-Like Phenotype in Coculture with Adrenal Medullary Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Mizrachi, Yaffa; Naranjo, Jose R.; Levi, Ben-Zion; Pollard, Harvey B.; Lelkes, Peter I.


    Previously we described specific in vitro interactions between PC12 cells, a cloned, catecholamine-secreting pheochromocytoma cell line derived from the rat adrenal medulla, and bovine adrenal medullary endothelial cells. We now demonstrate that these interactions induce the PC12 cells to acquire physical and biochemical characteristics reminiscent of chromaffin cells. Under coculture conditions involving direct cell-cell contact, the endothelial cells and the PC12 cells reduced their rates of proliferation; upon prolonged coculture PC12 cells clustered into nests of cells similar to the organization of chromaffin cells seen in vivo. Within 3 days in coculture with endothelial cells, but not with unrelated control cells, PC12 cells synthesized increased levels of [Met]enkephalin. In addition, PC12 cells, growing on confluent endothelial monolayers, failed to extend neurites in response to nerve growth factor. Neither medium conditioned by endothelial cells nor fixed endothelial cells could by themselves induce all of these different phenomena in the PC12 cells. These results suggest that under coculture conditions PC12 cells change their state of differentiation toward a chromaffin cell-like phenotype. The rapid, transient increase in the expression of the protooncogene c-fos suggests that the mechanism(s) inducing the change in the state of differentiation in PC12 cells in coculture with the endothelial cells may be distinct from that described for the differentiation of PC12 cells--e.g., by glucocorticoids. We propose that similar interactions between endothelial cells and chromaffin cell precursors may occur during embryonic development and that these interactions might be instrumental for the organ-specific differentiation of the adrenal medulla in vivo.

  15. Differentiation of mesenchymal stem cells into gonad and adrenal steroidogenic cells

    PubMed Central

    Yazawa, Takashi; Imamichi, Yoshitaka; Miyamoto, Kaoru; Umezawa, Akihiro; Taniguchi, Takanobu


    Hormone replacement therapy is necessary for patients with adrenal and gonadal failure. Steroid hormone treatment is also employed in aging people for sex hormone deficiency. These patients undergo such therapies, which have associated risks, for their entire life. Stem cells represent an innovative tool for tissue regeneration and the possibility of solving these problems. Among various stem cell types, mesenchymal stem cells have the potential to differentiate into steroidogenic cells both in vivo and in vitro. In particular, they can effectively be differentiated into steroidogenic cells by expressing nuclear receptor 5A subfamily proteins (steroidogenic factor-1 and liver receptor homolog-1) with the aid of cAMP. This approach will provide a source of cells for future regenerative medicine for the treatment of diseases caused by steroidogenesis deficiencies. It can also represent a useful tool for studying the molecular mechanisms of steroidogenesis and its related diseases. PMID:24772247

  16. The effect of short-wavelength ultraviolet light on antigens, lectin receptors and the ultrastructure of Crithidia fasciculata.


    Santos, M A; Barros, A M; Andrade, P P; Padovan, I P


    Crithidia fasciculata is an important trypanosomatid parasite commonly affecting insects and is used extensively as a model for the study of the biochemistry, ultrastructure and organization of the kDNA network of trypanosomatids. The present study describes the evolution of UV-induced morphological changes detectable by transmission electron microscopy in Crithidia fasciculata. Although only rare and minor changes in kinetoplast DNA were demonstrable 7 h after UV irradiation, alterations of this organelle were present in almost all flagellates observed 24 h and 48 h after irradiation. Other cell structures were apparently undamaged. Ultrastructural changes in kDNA did not correspond to changes in antigenicity of protein bands in western blotting against serum from Chagas' disease patients or in the presence of 3 different lectin receptors on the surface of the parasite. PMID:2553178

  17. Role of calcium in effects of atrial natriuretic peptide on aldosterone production in adrenal glomerulosa cells

    SciTech Connect

    Chartier, L.; Schiffrin, E.L.


    Atrial natriuretic peptide (ANP) inhibits the stimulation of aldosterone secretion by isolated adrenal glomerulosa cells produced by angiotensin II (ANG II), ACTH, and potassium. The effect of ANP on the dose-response curve of aldosterone stimulated by ANG II, ACTH, and potassium on isolated rat adrenal glomerulosa cells was studied. In the presence of ANP the maximal response of aldosterone output stimulated by ANG II or potassium decreased and the half-maximum (EC/sub 50/) of the response to ACTH was displaced to the right. Because these effects resemble those of calcium-channel blockers, the authors investigated the effect of different concentrations of nifedipine, a dihydropyridine calcium-channel blocker, on the dose-response curve of aldosterone stimulated by ANG II, ACTH, and potassium. Nifedipine produced effects similar to ANP. The maximal response of aldosterone stimulated by ANG II and potassium was decreased and the dose-response curve to ACTH was displaced to the right. ANP decreased the maximal response of aldosterone to the dihydropyridine derivative BAY K8644, a calcium-channel activator, without change in its EC/sub 50/. In contrast, nifedipine displaced the dose-response curve to BAY K8644 to the right as expected of a competitive inhibitor. The effect of ANP and nifedipine on basal and stimulated /sup 45/Ca influx into isolated rat adrenal glomerulosa cells was studied. ANP may act on the rat adrenal glomerulosa cells at least in part by interference with calcium entry.

  18. Expression of the human apolipoprotein E gene suppresses steroidogenesis in mouse Y1 adrenal cells

    SciTech Connect

    Reyland, M.E.; Forgez, P.; Prack, M.M.; Williams, D.L. ); Gwynne, J.T. )


    The lipid transport protein, apolipoprotein E (apoE), is expressed in many peripheral tissues in vivo including the adrenal gland and testes. To investigate the role of apoE in adrenal cholesterol homeostasis, the authors have expressed a human apoE genomic clone in the Y1 mouse adrenocortical cell line. Y1 cells do not express endogenous apoE mRNA or protein. Expression of apoE in Y1 cells resulted in a dramatic decrease in basal steroidogenesis; secretion of fluorogenic steroid was reduced 7- to {gt}100-fold relative to Y1 parent cells. Addition of 5-cholesten-3{beta},25-idol failed to overcome the suppression of steroidogenesis in these cells. Cholesterol esterification under basal conditions, as measured by the production of cholesteryl ({sup 14}C)oleate, was similar in the Y1 parent and the apoE-transfected cell lines. Upon incubation with adrenocorticotropin or dibutyryl cAMP, production of cholesteryl ({sup 14}C)oleate decreased 5-fold in the Y1 parent cells but was unchanged in the apoE-transfected cell lines. These results suggest that apoE may be an important modulator of cholesterol utilization and steroidogenesis in adrenal cells.

  19. Expression of adiponectin receptors in mouse adrenal glands and the adrenocortical Y-1 cell line: adiponectin regulates steroidogenesis.


    Li, Ping; Sun, Fei; Cao, Huang-Ming; Ma, Qin-Yun; Pan, Chun-Ming; Ma, Jun-Hua; Zhang, Xiao-Na; Jiang, He; Song, Huai-Dong; Chen, Ming-Dao


    Obesity is frequently associated with malfunctions of the hypothalamus-pituitary-adrenal (HPA) axis and hyperaldosteronism, but the mechanism underlying this association remains unclear. Since the adrenal glands are embedded in adipose tissue, direct cross-talk between adipose tissue and the adrenal gland has been proposed. A previous study found that adiponectin receptor mRNA was expressed in human adrenal glands and aldosterone-producing adenoma (APA). However, the expression of adiponectin receptors in adrenal glands has not been confirmed at the protein level or in other species. Furthermore, it is unclear whether adiponectin receptors expressed in adrenal cells are functional. We found, for the first time, that adiponectin receptor (AdipoR1 and AdipoR2) mRNA and protein were expressed in mouse adrenal and adrenocortical Y-1 cells. However, adiponectin itself was not expressed in mouse adrenal or Y-1 cells. Furthermore, adiponectin acutely reduced basal levels of corticosterone and aldosterone secretion. ACTH-induced steroid secretion was also inhibited by adiponectin, and this was accompanied by a parallel change in the expression of the key genes involved in steroidogenesis. These findings indicate that adiponectin may take part in the modulation of steroidogenesis. Thus, adiponectin is likely to have physiological and/or pathophysiological significance as an endocrine regulator of adrenocortical function.

  20. Endotoxic lipopolysaccharides stimulate steroidogenesis and adenylate cyclase in adrenal tumor cells.


    Wolff, J; Cook, G H


    Lipopolysaccharides (endotoxins) from Escherichia coli, Serratia marcesens and Salmonella typhosa stimulated steroid production in Y-1 adrenal tumor cells in culture with a latent period of 3-4 h. Lipid A, derived from Escherichia coli lipopolysaccharide, also stimulated steroidogenesis. Lipopolysaccharides and lipid A also stimulate adenylate cyclase activity and cause rounding of the cells. In contrast, lipopolysaccharides do not stimulate steroidogenesis in receptor-deficient adrenal tumor cells (OS-3) or Leydig tumor cells (I-10). This tends to rule out contamination by enterotoxin to which these lines respond. Although both hormone and lipopolysaccharide responses are lost in these lines, there was no interaction between these sites as judged by the failure of lipopolysaccharides to block, during their latency, the response to corticotropin in Y-1 cells. The possibility that the lipopolysaccharide effect is one on membrane conformation is discussed.

  1. Different contributions of calcium channel subtypes to electrical excitability of chromaffin cells in rat adrenal slices.


    Albiñana, Elisa; Segura-Chama, Pedro; Baraibar, Andres M; Hernández-Cruz, Arturo; Hernández-Guijo, Jesus M


    We characterized the ionic currents underlying the cellular excitability and the Ca(2+) -channel subtypes involved in action potential (AP) firing of rat adrenal chromaffin cells (RCCs) preserved in their natural environment, the adrenal gland slices, through the perforated patch-clamp recording technique. RCCs prepared from adrenal slices exhibit a resting potential of -54 mV, firing spontaneous APs (2-3 spikes/s) generated by the opening of Na(+) and Ca(2+) -channels, and terminated by the activation of voltage and Ca(2+) -activated K(+) -channels (BK). Ca(2+) influx via L-type Ca(2+) -channels is involved in reaching threshold potential for AP firing, and is responsible for activation of BK-channels contributing to AP-repolarization and afterhyperpolarization, whereas P/Q-type Ca(2+) -channels are involved only in the repolarization phase. BK-channels carry total outward current during AP-repolarization. Blockade of L-type Ca(2+) -channels reduces BK-current ~60%, whereas blockade of N- or P/Q-type produces little effect. This study demonstrates that Ca(2+) influx through L-type Ca(2+) -channels plays a key role in modulating the threshold potential from RCCs in situ. This study demonstrates that Ca(2+) influx through L-type Ca(2+) channels plays a key role in modulating the threshold potential for action potential firing and activating BK channels contributing to repolarization and afterhyperpolarization from rat adrenal chromaffin cells in situ.

  2. Aldosterone-stimulating somatic gene mutations are common in normal adrenal glands

    PubMed Central

    Nishimoto, Koshiro; Tomlins, Scott A.; Kuick, Rork; Cani, Andi K.; Giordano, Thomas J.; Hovelson, Daniel H.; Liu, Chia-Jen; Sanjanwala, Aalok R.; Edwards, Michael A.; Gomez-Sanchez, Celso E.; Nanba, Kazutaka; Rainey, William E.


    Primary aldosteronism (PA) represents the most common cause of secondary hypertension, but little is known regarding its adrenal cellular origins. Recently, aldosterone-producing cell clusters (APCCs) with high expression of aldosterone synthase (CYP11B2) were found in both normal and PA adrenal tissue. PA-causing aldosterone-producing adenomas (APAs) harbor mutations in genes encoding ion channels/pumps that alter intracellular calcium homeostasis and cause renin-independent aldosterone production through increased CYP11B2 expression. Herein, we hypothesized that APCCs have APA-related aldosterone-stimulating somatic gene mutations. APCCs were studied in 42 normal adrenals from kidney donors. To clarify APCC molecular characteristics, we used microarrays to compare the APCC transcriptome with conventional adrenocortical zones [zona glomerulosa (ZG), zona fasciculata, and zona reticularis]. The APCC transcriptome was most similar to ZG but with an enhanced capacity to produce aldosterone. To determine if APCCs harbored APA-related mutations, we performed targeted next generation sequencing of DNA from 23 APCCs and adjacent normal adrenal tissue isolated from both formalin-fixed, paraffin-embedded, and frozen tissues. Known aldosterone driver mutations were identified in 8 of 23 (35%) APCCs, including mutations in calcium channel, voltage-dependent, L-type, α1D-subunit (CACNA1D; 6 of 23 APCCs) and ATPase, Na+/K+ transporting, α1-polypeptide (ATP1A1; 2 of 23 APCCs), which were not observed in the adjacent normal adrenal tissue. Overall, we show three major findings: (i) APCCs are common in normal adrenals, (ii) APCCs harbor somatic mutations known to cause excess aldosterone production, and (iii) the mutation spectrum of aldosterone-driving mutations is different in APCCs from that seen in APA. These results provide molecular support for APCC as a precursor of PA. PMID:26240369

  3. Aldosterone-stimulating somatic gene mutations are common in normal adrenal glands.


    Nishimoto, Koshiro; Tomlins, Scott A; Kuick, Rork; Cani, Andi K; Giordano, Thomas J; Hovelson, Daniel H; Liu, Chia-Jen; Sanjanwala, Aalok R; Edwards, Michael A; Gomez-Sanchez, Celso E; Nanba, Kazutaka; Rainey, William E


    Primary aldosteronism (PA) represents the most common cause of secondary hypertension, but little is known regarding its adrenal cellular origins. Recently, aldosterone-producing cell clusters (APCCs) with high expression of aldosterone synthase (CYP11B2) were found in both normal and PA adrenal tissue. PA-causing aldosterone-producing adenomas (APAs) harbor mutations in genes encoding ion channels/pumps that alter intracellular calcium homeostasis and cause renin-independent aldosterone production through increased CYP11B2 expression. Herein, we hypothesized that APCCs have APA-related aldosterone-stimulating somatic gene mutations. APCCs were studied in 42 normal adrenals from kidney donors. To clarify APCC molecular characteristics, we used microarrays to compare the APCC transcriptome with conventional adrenocortical zones [zona glomerulosa (ZG), zona fasciculata, and zona reticularis]. The APCC transcriptome was most similar to ZG but with an enhanced capacity to produce aldosterone. To determine if APCCs harbored APA-related mutations, we performed targeted next generation sequencing of DNA from 23 APCCs and adjacent normal adrenal tissue isolated from both formalin-fixed, paraffin-embedded, and frozen tissues. Known aldosterone driver mutations were identified in 8 of 23 (35%) APCCs, including mutations in calcium channel, voltage-dependent, L-type, α1D-subunit (CACNA1D; 6 of 23 APCCs) and ATPase, Na(+)/(K+) transporting, α1-polypeptide (ATP1A1; 2 of 23 APCCs), which were not observed in the adjacent normal adrenal tissue. Overall, we show three major findings: (i) APCCs are common in normal adrenals, (ii) APCCs harbor somatic mutations known to cause excess aldosterone production, and (iii) the mutation spectrum of aldosterone-driving mutations is different in APCCs from that seen in APA. These results provide molecular support for APCC as a precursor of PA.

  4. Synthesis of hydroxyeicosatetraenoic acids (HETE's) by adrenal glomerulosa cells and incorporation into cellular lipids

    SciTech Connect

    Campbell, W.B.; Richards, C.F.; Brady, M.T.; Falck, J.R.


    The role of lipoxygenase metabolites of arachidonic acid (AA) in the regulation of aldosterone secretion was studied in isolated rat adrenal glomerulosa cells. Cells were incubated with /sup 14/C-AA in the presence of angiotensin (AII). The media was extracted, metabolites isolated by HPLC, and structures of the metabolites determined by UV absorbance and mass spectrometry. The major products were 12- and 15-HETE with lesser amounts of 11- and 5-HETE. When adrenal cells were incubated with 15-, 12- or 5-HPETE or their respective HETE's (0.03-300nM), there was no significant change in basal or AII-stimulated aldosterone release. Cells were incubated with (/sup 3/H)-AA, -5-HETE, -15-HETE, -12-HETE or -LTB. The cellular lipids were extracted and analyzed by TLC. AA was incorporated into phospholipids (22%), cholesterol esters (50%) and triglycerides (21%). Neither the HETE's or LTB/sub 4/ were incorporated into phospholipids. 5-HETE was taken up into di- and mono-glycerides. The rates of incorporation of AA and 5-HETE were similar (+ 1/2 = 10 min). The incorporation of 5-HETE into glycerol esters did not modify the release of aldosterone by the cells. Thus, while adrenal cells synthesize HETE's, these eicosanoids do not appear to alter the synthesis of aldosterone.

  5. [Histoenzymologic features of adrenal medulla ganglionic cells 60 days after exposure to detergents].


    Devecerski, V; Marjanov, M; Milićević, S


    We investigated histochemical reactions in adrenal medulla sympathic ganglionic cells in the animals who after a 30-day stay in a detergent manufactory department survived 60 days in laboratory conditions. The obtained data show a strong isocytrate dehydrogenase activity in the experimental animals; the reaction to the lactate dehydrogenase activity reflects a decrease of the ganglionic cell volume and a slight decrease of the reaction intensity. The activity of isoenzyme F is mildly increased; similarly was found for isoenzyme S. There was a significant decrease of the succinate dehydrogenase activity--all this was detected in the animals exposed to detergents. Sympathic ganglionic cells within the adrenal medulla are rather sensitive to the influence of detergents. The recovery after the exposure to their toxic effects takes more than 2 months.

  6. Giant adrenal germ cell tumour in a 59-year-old woman

    PubMed Central

    Chen, Lei; Fang, Lu; Liu, Zhiqi; Yu, Dexin; Wang, Daming; Wang, Yi; Xie, Dongdong; Min, Jie; Ding, Demao; Zhang, Tao; Zou, Ci; Zhang, Zhiqiang


    Adrenal germ cell tumour is very rare. We report a case of a 59-year-old woman who presented with right flank discomfort. The laboratory examinations were normal and the chest computed tomography (CT) showed right pleural effusion. The abdominal CT scan revealed a large mass on the right adrenal gland. The patient underwent an adrenalectomy. Histopathologic examination and immunohistochemical findings were consistent with mixed germ cell tumour. Three months later following the operation, the patient was admitted to our hospital again with chest tightness and shortness of breath. The chest CT showed right pleural effusion recurrence and enlargement of mediastinal lymph nodes and right hilar lymph nodes. The patient had right supraclavicular lymphadenectasis on physical examination. Fine needle aspiration cytology from the supraclavicular lymph nodes showed groups of malignant tumour cells. The patient died within 6 months postoperatively. In this case, the lymph node pathway played an important role in the metastatic procedure.

  7. Directional left-sided asymmetry of adrenals in experimentally domesticated animals.


    Trut, L N; Prasolova, L A; Kharlamova, A V; Plyusnina, I Z


    Directional left-sided asymmetry of the adrenals was typical of black and silver foxes, American minks, and gray rats selected by their behavior. In domesticated, but to a greater extent, in aggressive animals, the weight of the left adrenal and the width of its medulla and cortex markedly surpassed the corresponding parameters of the right adrenal. In aggressive animals enlargement of the left adrenal cortex was associated with widening of the zona reticularis, while in domesticated animals with enlargement of the zona fasciculata. PMID:12420075

  8. Monolayer co-culture of rat heart cells and bovine adrenal chromaffin paraneurons.


    Trifaró, J M; Tang, R; Novas, M L


    This paper describes a method for the preparation of co-cultures of rat heart cells and bovine adrenal chromaffin paraneurons. The most suitable condition for heart cell isolation was when a combination of trypsin-DNAse I in Locke's solution was used for digestion. The best co-culture conditions were obtained when 10(6) heart cells were plated on 7- to 8-d-old adrenal chromaffin paraneuron cultures containing 0.5 x 10(6) cells per 35-mm diameter culture dishes. Measurements of DNA (heart cells and chromaffin paraneurons), monitoring of beating frequency (heart cells), and catecholamine (chromaffin paraneurons) levels and release indicated that both cell types remain viable and functional for several weeks. Heart cells started their characteristic contractile activity 24 h earlier when plated either on viable or lysed chromaffin paraneurons, an effect apparently due to faster surface adhesion of heart cells. The beating frequency of heart cells increased after treatment of co-cultures with either noradrenaline or nicotine, with the latter agent acting indirectly through the release of chromaffin paraneuron catecholamines. Propranolol produced a dose-related inhibition of the responses to either noradrenaline or nicotine, thus suggesting that the increase in myocyte's beating activity was mediated through beta-receptors. Anti-myosin and anti-dopamine-beta-hydroxylase immunostaining was used for cell type identification and for the demonstration of body-to-body and process-to-process contacts between adrenal chromaffin paraneurons and heart cells. This co-culture system will serve as a starting point of further studies directed to understand a) the influence of a cell type on the development and on the phenotypic characteristics of a second cell type and b) the interaction of cells derived from different organs and species.

  9. Morphological and microvascular changes of the adrenal glands in streptozotocin-induced long-term diabetic rats.


    Sricharoenvej, Sirinush; Boonprasop, Surasak; Lanlua, Passara; Piyawinijwong, Sitha; Niyomchan, Apichaya


    It has been known that diabetes mellitus is associated with hyperfunction of the adrenal gland. However, the structural changes of adrenal gland in diabetes have rarely been studied. The aims of this study were to investigate the morphological and microvascular alterations in streptozotocin (STZ)-induced long-term diabetic rats. Twelve male Sprague-Dawley rats were divided into diabetic (n=8) and control (n=4) groups. Each diabetic rat was induced by an intraperitoneal injection of STZ (60 mg/kg) in citrate buffer (pH 4.5). Control rats were intraperitoneally injected with the same amounts of the buffer. These animals were sacrificed at 20 weeks after the injections. The adrenal glands were processed for the morphological and microvascular studies by using conventional light microscopy (LM) and vascular corrosion cast technique combined with scanning electron microscopy (SEM), respectively. In the diabetic group, the cells in zona glomeruloza (ZG) became atrophied and the thickness of this zone was found to be less than that of the controls. In the zona fasciculata (ZF) and zona reticularis (ZR), the hypertrophic cells were investigated in both layers. The degenerated chromaffin and hypertrophic sympathetic ganglion cells in the adrenal medulla were observed. Also some degenerated ganglion cells were found. Additionally, lymphocyte infiltration, macrophages and amyloidosis were found in the adrenal medulla of long-term diabetic rats with renal failure. Under the SEM observation, the luminal diameters of capillaries in the diabetic group were dilated in all zones. In addition, these capillaries in the ZF and ZR were arranged in tortuous courses. This study demonstrates morphological and microvascular changes in the adrenal gland of diabetic rats which are in accordance with the hormonal changes reported by previous investigators.

  10. Partial MCM4 deficiency in patients with growth retardation, adrenal insufficiency, and natural killer cell deficiency

    PubMed Central

    Gineau, Laure; Cognet, Céline; Kara, Nihan; Lach, Francis Peter; Dunne, Jean; Veturi, Uma; Picard, Capucine; Trouillet, Céline; Eidenschenk, Céline; Aoufouchi, Said; Alcaïs, Alexandre; Smith, Owen; Geissmann, Frédéric; Feighery, Conleth; Abel, Laurent; Smogorzewska, Agata; Stillman, Bruce; Vivier, Eric; Casanova, Jean-Laurent; Jouanguy, Emmanuelle


    Natural killer (NK) cells are circulating cytotoxic lymphocytes that exert potent and nonredundant antiviral activity and antitumoral activity in the mouse; however, their function in host defense in humans remains unclear. Here, we investigated 6 related patients with autosomal recessive growth retardation, adrenal insufficiency, and a selective NK cell deficiency characterized by a lack of the CD56dim NK subset. Using linkage analysis and fine mapping, we identified the disease-causing gene, MCM4, which encodes a component of the MCM2-7 helicase complex required for DNA replication. A splice-site mutation in the patients produced a frameshift, but the mutation was hypomorphic due to the creation of two new translation initiation methionine codons downstream of the premature termination codon. The patients’ fibroblasts exhibited genomic instability, which was rescued by expression of WT MCM4. These data indicate that the patients’ growth retardation and adrenal insufficiency likely reflect the ubiquitous but heterogeneous impact of the MCM4 mutation in various tissues. In addition, the specific loss of the NK CD56dim subset in patients was associated with a lower rate of NK CD56bright cell proliferation, and the maturation of NK CD56bright cells toward an NK CD56dim phenotype was tightly dependent on MCM4-dependent cell division. Thus, partial MCM4 deficiency results in a genetic syndrome of growth retardation with adrenal insufficiency and selective NK deficiency. PMID:22354167

  11. Effect of angiotensin II, ATP, and ionophore A23187 on potassium efflux in adrenal glomerulosa cells

    SciTech Connect

    Lobo, M.V.; Marusic, E.T.


    Angiotensin II stimulus on perifused bovine adrenal glomerulosa cells elicited an increase in 86Rb efflux from cells previously equilibrated with the radioisotope. When 45Ca fluxes were measured under similar conditions, it was observed that Ca and Rb effluxes occurred within the first 30 s of the addition of the hormone and were independent of the presence of external Ca. The 86Rb efflux due to angiotensin II was inhibited by quinine and apamin. The hypothesis that the angiotensin II response is a consequence of an increase in the K permeability of the glomerulosa cell membrane triggered by an increase in cytosolic Ca is supported by the finding that the divalent cation ionophore A23187 also initiated 86Rb or K loss (as measured by an external K electrode). This increased K conductance was also seen with 10(-4) M ATP. Quinine and apamin greatly reduced the effect of ATP or A23187 on 86Rb or K release in adrenal glomerulosa cells. The results suggest that Ca-dependent K channels or carriers are present in the membranes of bovine adrenal glomerulosa cells and are sensitive to hormonal stimulus.

  12. Tetrodotoxin-insensitive Na+ channel activator palytoxin inhibits tyrosine uptake into cultured bovine adrenal chromaffin cells

    SciTech Connect

    Morita, K.; Teraoka, K.; Azuma, M.; Oka, M.; Hamano, S. )


    The effects of the tetrodotoxin-insensitive Na+ channel activator palytoxin on both the secretion of endogenous catecholamines and the formation of 14C-catecholamines from (14C)tyrosine were examined using cultured bovine adrenal chromaffin cells. Palytoxin was shown to cause the stimulation of catecholamine secretion in a concentration-dependent manner. However, this toxin caused the reduction rather than the stimulation of 14C-catecholamine formation at the same concentrations. Palytoxin failed to cause any alteration in the activity of tyrosine hydroxylase prepared from bovine adrenal medulla. Furthermore, the uptake of (14C)tyrosine into the cells was shown to be inhibited by this toxin under the conditions in which the suppression of 14C-catecholamine formation was observed, and this inhibitory action on tyrosine uptake was closely correlated with that on catecholamine formation. The inhibitory action of palytoxin on tyrosine uptake into the cells was observed to be noncompetitive, and this effect was not altered by the removal of Na+ from the incubation mixture. These results suggest that palytoxin may be able to inhibit the uptake of (14C)tyrosine into the cells, resulting in the suppression of 14C-catecholamine formation, probably through its direct action on the plasma membranes of bovine adrenal chromaffin cells.

  13. Pannexin 1 channels: new actors in the regulation of catecholamine release from adrenal chromaffin cells

    PubMed Central

    Momboisse, Fanny; Olivares, María José; Báez-Matus, Ximena; Guerra, María José; Flores-Muñoz, Carolina; Sáez, Juan C.; Martínez, Agustín D.; Cárdenas, Ana M.


    Chromaffin cells of the adrenal gland medulla synthesize and store hormones and peptides, which are released into the blood circulation in response to stress. Among them, adrenaline is critical for the fight-or-flight response. This neurosecretory process is highly regulated and depends on cytosolic [Ca2+]. By forming channels at the plasma membrane, pannexin-1 (Panx1) is a protein involved in many physiological and pathological processes amplifying ATP release and/or Ca2+ signals. Here, we show that Panx1 is expressed in the adrenal gland where it plays a role by regulating the release of catecholamines. In fact, inhibitors of Panx1 channels, such as carbenoxolone (Cbx) and probenecid, reduced the secretory activity induced with the nicotinic agonist 1,1-dimethyl-4-phenyl-piperazinium (DMPP, 50 μM) in whole adrenal glands. A similar inhibitory effect was observed in single chromaffin cells using Cbx or 10Panx1 peptide, another Panx1 channel inhibitors. Given that the secretory response depends on cytosolic [Ca2+] and Panx1 channels are permeable to Ca2+, we studied the possible implication of Panx1 channels in the Ca2+ signaling occurring during the secretory process. In support of this possibility, Panx1 channel inhibitors significantly reduced the Ca2+ signals evoked by DMPP in single chromaffin cells. However, the Ca2+ signals induced by caffeine in the absence of extracellular Ca2+ was not affected by Panx1 channel inhibitors, suggesting that this mechanism does not involve Ca2+ release from the endoplasmic reticulum. Conversely, Panx1 inhibitors significantly blocked the DMPP-induce dye uptake, supporting the idea that Panx1 forms functional channels at the plasma membrane. These findings indicate that Panx1 channels participate in the control the Ca2+ signal that triggers the secretory response of adrenal chromaffin cells. This mechanism could have physiological implications during the response to stress. PMID:25237296

  14. Intracellular Molecular Differences in Aldosterone- Compared to Cortisol-Secreting Adrenal Cortical Adenomas.


    Seidel, Eric; Scholl, Ute I


    The adrenal cortex is a major site of steroid hormone production. Two hormones are of particular importance: aldosterone, which is produced in the zona glomerulosa in response to volume depletion and hyperkalemia, and cortisol, which is produced in the zona fasciculata in response to stress. In both cases, acute stimulation leads to increased hormone production, and chronic stimulation causes hyperplasia of the respective zone. Aldosterone- and cortisol-producing adenomas (APAs and CPAs) are benign tumors of the adrenal cortex that cause excess hormone production, leading to primary aldosteronism and Cushing's syndrome, respectively. About 40% of the APAs carry somatic heterozygous gain-of-function mutations in the K(+) channel KCNJ5. These mutations lead to sodium permeability, depolarization, activation of voltage-gated Ca(2+) channels, and Ca(2+) influx. Mutations in the Na(+)/K(+)-ATPase subunit ATP1A1 and the plasma membrane Ca(2+)-ATPase ATP2B3 similarly cause Na(+) or H(+) permeability and depolarization, whereas mutations in the Ca(2+) channel CACNA1D directly lead to increased calcium influx. One in three CPAs carries a recurrent gain-of-function mutation (L206R) in the PRKACA gene, encoding the catalytic subunit of PKA. This mutation causes constitutive PKA activity by abolishing the binding of the inhibitory regulatory subunit to the catalytic subunit. These mutations activate pathways that are relatively specific to the respective cell type (glomerulosa versus fasciculata), and there is little overlap in mutation spectrum between APAs and CPAs, but co-secretion of both hormones can occur. Mutations in CTNNB1 (beta-catenin) and GNAS (Gsα) are exceptions, as they can cause both APAs and CPAs through pathways that are incompletely understood. PMID:27445978

  15. Intracellular Molecular Differences in Aldosterone- Compared to Cortisol-Secreting Adrenal Cortical Adenomas.


    Seidel, Eric; Scholl, Ute I


    The adrenal cortex is a major site of steroid hormone production. Two hormones are of particular importance: aldosterone, which is produced in the zona glomerulosa in response to volume depletion and hyperkalemia, and cortisol, which is produced in the zona fasciculata in response to stress. In both cases, acute stimulation leads to increased hormone production, and chronic stimulation causes hyperplasia of the respective zone. Aldosterone- and cortisol-producing adenomas (APAs and CPAs) are benign tumors of the adrenal cortex that cause excess hormone production, leading to primary aldosteronism and Cushing's syndrome, respectively. About 40% of the APAs carry somatic heterozygous gain-of-function mutations in the K(+) channel KCNJ5. These mutations lead to sodium permeability, depolarization, activation of voltage-gated Ca(2+) channels, and Ca(2+) influx. Mutations in the Na(+)/K(+)-ATPase subunit ATP1A1 and the plasma membrane Ca(2+)-ATPase ATP2B3 similarly cause Na(+) or H(+) permeability and depolarization, whereas mutations in the Ca(2+) channel CACNA1D directly lead to increased calcium influx. One in three CPAs carries a recurrent gain-of-function mutation (L206R) in the PRKACA gene, encoding the catalytic subunit of PKA. This mutation causes constitutive PKA activity by abolishing the binding of the inhibitory regulatory subunit to the catalytic subunit. These mutations activate pathways that are relatively specific to the respective cell type (glomerulosa versus fasciculata), and there is little overlap in mutation spectrum between APAs and CPAs, but co-secretion of both hormones can occur. Mutations in CTNNB1 (beta-catenin) and GNAS (Gsα) are exceptions, as they can cause both APAs and CPAs through pathways that are incompletely understood.

  16. Intracellular Molecular Differences in Aldosterone- Compared to Cortisol-Secreting Adrenal Cortical Adenomas

    PubMed Central

    Seidel, Eric; Scholl, Ute I.


    The adrenal cortex is a major site of steroid hormone production. Two hormones are of particular importance: aldosterone, which is produced in the zona glomerulosa in response to volume depletion and hyperkalemia, and cortisol, which is produced in the zona fasciculata in response to stress. In both cases, acute stimulation leads to increased hormone production, and chronic stimulation causes hyperplasia of the respective zone. Aldosterone- and cortisol-producing adenomas (APAs and CPAs) are benign tumors of the adrenal cortex that cause excess hormone production, leading to primary aldosteronism and Cushing’s syndrome, respectively. About 40% of the APAs carry somatic heterozygous gain-of-function mutations in the K+ channel KCNJ5. These mutations lead to sodium permeability, depolarization, activation of voltage-gated Ca2+ channels, and Ca2+ influx. Mutations in the Na+/K+-ATPase subunit ATP1A1 and the plasma membrane Ca2+-ATPase ATP2B3 similarly cause Na+ or H+ permeability and depolarization, whereas mutations in the Ca2+ channel CACNA1D directly lead to increased calcium influx. One in three CPAs carries a recurrent gain-of-function mutation (L206R) in the PRKACA gene, encoding the catalytic subunit of PKA. This mutation causes constitutive PKA activity by abolishing the binding of the inhibitory regulatory subunit to the catalytic subunit. These mutations activate pathways that are relatively specific to the respective cell type (glomerulosa versus fasciculata), and there is little overlap in mutation spectrum between APAs and CPAs, but co-secretion of both hormones can occur. Mutations in CTNNB1 (beta-catenin) and GNAS (Gsα) are exceptions, as they can cause both APAs and CPAs through pathways that are incompletely understood. PMID:27445978

  17. Adrenal glands


    ... disorders , infections, tumors, and bleeding. Related topics: Addison disease Adrenal insufficiency Congenital adrenal hyperplasia Cushing syndrome Diabetes mellitus - secondary Glucocorticoid medications Hirsutism Hump ...

  18. Quantitative and qualitative evaluation of CART-containing cells in adrenal glands of male rats with hypertension.


    Kasacka, I; Piotrowska, Ż; Knaś, M; Lewandowska, A


    Adrenal activity is stimulated and secretion of stress hormones is increased during advanced stages of renovascular hypertension. The literature suggests that the neuropeptide, cocaine and amphetamine regulated transcript (CART), might regulate adrenal secretory function and thus could influence its activity. We assessed potential quantitative and qualitative changes in the cells that contained CART in the adrenal glands of rats with renovascular hypertension. The renal arteries of ten rats were subjected to a clipping procedure, i.e., two-kidney one-clip (2K1C) model of arterial hypertension, and after 6 weeks each rat developed stable hypertension. CART was localized using immunohistochemistry. CART was detected in a large population of cells in the medulla, sparse nerve fibers in the cortex and the capsule of the adrenal gland. The population of CART-positive cells in adrenal glands of two kidney-one clip (2K1C) treated rats was greater and their immunoreactivity was increased compared to controls. Similarly, the length, width, area and diameter of CART-immunoreactive cells were significantly greater in the hypertensive rats than in controls. We demonstrated that renovascular hypertension alters the number and immunoreactivity of CART-containing cells in adrenal glands.

  19. Sex-related gene expression profiles in the adrenal cortex in the mature rat: Microarray analysis with emphasis on genes involved in steroidogenesis

    PubMed Central



    Notable sex-related differences exist in mammalian adrenal cortex structure and function. In adult rats, the adrenal weight and the average volume of zona fasciculata cells of females are larger and secrete greater amounts of corticosterone than those of males. The molecular bases of these sex-related differences are poorly understood. In this study, to explore the molecular background of these differences, we defined zone- and sex-specific transcripts in adult male and female (estrous cycle phase) rats. Twelve-week-old rats of both genders were used and samples were taken from the zona glomerulosa (ZG) and zona fasciculata/reticularis (ZF/R) zones. Transcriptome identification was carried out using the Affymetrix® Rat Gene 1.1 ST Array. The microarray data were compared by fold change with significance according to moderated t-statistics. Subsequently, we performed functional annotation clustering using the Gene Ontology (GO) and Database for Annotation, Visualization and Integrated Discovery (DAVID). In the first step, we explored differentially expressed transcripts in the adrenal ZG and ZF/R. The number of differentially expressed transcripts was notably higher in the female than in the male rats (702 vs. 571). The differentially expressed genes which were significantly enriched included genes involved in steroid hormone metabolism, and their expression levels in the ZF/R of adult female rats were significantly higher compared with those in the male rats. In the female ZF/R, when compared with that of the males, prevailing numbers of genes linked to cell fraction, oxidation/reduction processes, response to nutrients and to extracellular stimuli or steroid hormone stimuli were downregulated. The microarray data for key genes involved directly in steroidogenesis were confirmed by qPCR. Thus, when compared with that of the males, in the female ZF/R, higher expression levels of genes involved directly in steroid hormone synthesis were accompanied by lower

  20. Stimulatory actions of bioflavenoids on tyrosine uptake into cultured bovine adrenal chromaffin cells

    SciTech Connect

    Morita, K.; Hamano, S.; Oka, M.; Teraoka, K. )


    The effects of flavenoids on L-({sup 14}C)tyrosine uptake into cultured adrenal chromaffin cells were examined. Flavone markedly stimulated tyrosine uptake into these cells in a manner dependent on its concentration. Apigenin also caused a moderate stimulatory action, but quercetin had no significant effect on the uptake. Flavone also stimulated the uptake of histidine, but did not affect the uptake of serine, lysine, or glutamic acid. These results are considered to propose the possibility that flavonoids may be able to stimulate the precursor uptake into the cells, resulting in an enhancement of the biogenic amine production.

  1. Endocrine and neurogenic regulation of the orphan nuclear receptors Nur77 and Nurr-1 in the adrenal glands.

    PubMed Central

    Davis, I J; Lau, L F


    nurr77 and nurr-1 are growth factor-inducible members of the steroid/thyroid hormone receptor gene superfamily. In order to gain insight into the potential roles of nur77 in the living organism, we used pharmacologic treatments to examine the expression of nur77 in the mouse adrenal gland. We found that nur77 and nurr-1 are induced in the adrenal gland upon treatment with pentylene tetrazole (Ptz; Metrazole). This induction is separable into distinct endocrine and neurogenic mechanisms. In situ hybridization analysis demonstrates that nur77 expression upon Ptz treatment in the adrenal cortex is localized primarily to the inner cortical region, the zona fasciculata-reticularis, with minimal induction in the zona glomerulosa. This induction is inhibitable by pretreatment with dexamethasone, indicating involvement of the hypothalamic-pituitary-adrenal axis in the activation of adrenal cortical expression. When mice were injected with adrenocorticotrophic hormone (ACTH), nur77 expression in the adrenal gland spanned all cortical layers including the zona glomerulosa, but medullary expression was not induced. Ptz also induces expression of both nur77 and nurr-1 in the adrenal medulla. Medullary induction is likely to have a neurogenic origin, as nur77 expression was not inhibitable by dexamethasone pretreatment and induction was seen after treatment with the cholinergic neurotransmitter nicotine. nur77 is also inducible by ACTH, forskolin, and the second messenger analog dibutyryl cyclic AMP in the ACTH-responsive adrenal cortical cell line Y-1. Significantly, Nur77 isolated from ACTH-stimulated Y-1 cells bound to its response element whereas Nur77 present in unstimulated cells did not. Moreover, Nur77 in ACTH-treated Y-1 cells was hypophosphorylated at serine 354 compared with that in untreated cells. These results, taken together with the previous observation that dephosphorylation of serine 354 affects DNA binding affinity in vitro, show for the first time that

  2. Synthetic High-Density Lipoprotein (sHDL) Inhibits Steroid Production in HAC15 Adrenal Cells.


    Taylor, Matthew J; Sanjanwala, Aalok R; Morin, Emily E; Rowland-Fisher, Elizabeth; Anderson, Kyle; Schwendeman, Anna; Rainey, William E


    High density lipoprotein (HDL) transported cholesterol represents one of the sources of substrate for adrenal steroid production. Synthetic HDL (sHDL) particles represent a new therapeutic option to reduce atherosclerotic plaque burden by increasing cholesterol efflux from macrophage cells. The effects of the sHDL particles on steroidogenic cells have not been explored. sHDL, specifically ETC-642, was studied in HAC15 adrenocortical cells. Cells were treated with sHDL, forskolin, 22R-hydroxycholesterol, or pregnenolone. Experiments included time and concentration response curves, followed by steroid assay. Quantitative real-time RT-PCR was used to study mRNA of 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase, lanosterol 14-α-methylase, cholesterol side-chain cleavage enzyme, and steroid acute regulatory protein. Cholesterol assay was performed using cell culture media and cell lipid extracts from a dose response experiment. sHDL significantly inhibited production of cortisol. Inhibition occurred in a concentration- and time-dependent manner and in a concentration range of 3μM-50μM. Forskolin (10μM) stimulated cortisol production was also inhibited. Incubation with 22R-hydroxycholesterol (10μM) and pregnenolone (10μM) increased cortisol production, which was unaffected by sHDL treatment. sHDL increased transcript levels for the rate-limiting cholesterol biosynthetic enzyme, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase. Extracellular cholesterol assayed in culture media showed a positive correlation with increasing concentration of sHDL, whereas intracellular cholesterol decreased after treatment with sHDL. The current study suggests that sHDL inhibits HAC15 adrenal cell steroid production by efflux of cholesterol, leading to an overall decrease in steroid production and an adaptive rise in adrenal cholesterol biosynthesis. PMID:27253994

  3. Interaction of urokinase with specific receptors stimulates mobilization of bovine adrenal capillary endothelial cells

    SciTech Connect

    Fibbi, G.; Ziche, M.; Morbidelli, L. ); Magnelli, L.; Del Rosso, M. )


    On the basis of {sup 125}I-labeled plasminogen activator binding analysis the authors have found that bovine adrenal capillary endothelial cells have specific receptors for human urinary-type plasminogen activator on the cell membrane. Each cell exposes about 37,000 free receptors with a K{sub d} of 0.8958{times}10{sup {minus}12} M. A monoclonal antibody against the 17,500 proteolytic fragment of the A chain of the plasminogen activator, not containing the catalytic site of the enzyme, impaired the specific binding, thus suggesting the involvement of a sequence present on the A chain in the interaction with the receptor, as previously shown in other cell model systems. Both the native molecule and the A chain are able to stimulate endothelial cell motility in the Boyden chamber, when used at nanomolar concentrations. The use of the same monoclonal antibody that can inhibit ligand-receptor interaction can impair the plasminogen activator and A-chain-induced endothelial cell motility, suggesting that under the conditions used in this in vitro model system, the motility of bovine adrenal capillary endothelial cells depends on the specific interaction of the ligand with free receptors on the surface of endothelial cells.

  4. Differentiation of steroidogenic cells in the developing adrenal gland of Testudo hermanni Gmelin, 1789 (chelonian reptiles).


    Chimenti, C; Accordi, F


    The aim of this study was to investigate the development and differentiation of steroidogenic cells in the embryonic adrenal gland of Testudo hermanni using histological, histochemical, immunohistochemical and ultrastructural methods. The 26 developmental stages were divided into three periods: early (stages 1-18, up to 20 days of incubation), intermediate (stages 19-22, incubation days 21-35) and advanced (stages 23-26, from incubation day 36 to hatching). A small presumptive bud of steroidogenic cells was visible at the end of the early period, protruding into the coelom from the lateral wall of intermediate mesoderm. Ultrastructural characteristics suggested that young and scarcely differentiated cells could already be able to perform steroidogenic activity: lipid droplets, large amount of SER and RER, small rounded mitochondria with variously shaped cristae and dense matrix. The cell membrane showed microvilli and coated pits. During the intermediate period, the interrenal bud deepened into the haemopoietic tissue, close to the mesonephros and the newly formed metanephros. The ultrastructural, immunohistochemical and immunocytochemical characteristics pointed to enhanced steroidogenic activity. The contact with both kidney types (mesonephros and metanephros) continued in the advanced period, and chromaffin cells were also extensively mixed with steroidogenic cells. This is a peculiar feature of chelonian adrenal gland, in comparison with that of other reptiles. The variable cytological characteristics of embryonic steroidogenic cells in the advanced period suggest a four-phase cycle of steroidogenic activity.

  5. Oligometastatic non-small cell lung cancer (NSCLC): adrenal metastases. Experience in a single institution.


    Barone, Mirko; Di Nuzzo, Decio; Cipollone, Giuseppe; Camplese, Pierpaolo; Mucilli, Felice


    Though the actual incidence of an adrenal oligometastasis is between 1.5 and 3.5 %, secondary adrenal neoplasms occur in less than 10 % patients with non-small cell lung cancer (NSCLC). According to 7° ed. TNM staging system, the presence of an adrenal metastasis (M1b disease) configures stage IV, which is usually associated with poor prognosis. We evaluated if metastasectomy in selected patients with oligometastatic disease improves overall survival. A 15-year retrospective study concerning patients with NSCLC was performed and an oligometastatic disease was found in 1.61 % of the patients. 18 adrenalectomies were performed. Clustering the population according to different therapeutic strategies, a benefit in terms of survival was found in patients who underwent adrenalectomy. A statistical relevance was found, indeed, between adrenalectomy (p < 0.01), metachronous disease (p < 0.01), the presence of a homolateral disease (p < 0.05) and overall survival. Adrenalectomy should be offered in selected patients with oligometastatic disease.

  6. Mobile and immobile calcium buffers in bovine adrenal chromaffin cells.

    PubMed Central

    Zhou, Z; Neher, E


    1. The calcium binding capacity (kappa S) of bovine chromaffin cells preloaded with fura-2 was measured during nystatin-perforated-patch recordings. 2. Subsequently, the perforated patch was ruptured to obtain a whole-cell recording situation, and the time course of kappa S was monitored during periods of up to one hour. 3. No rapid change (within 10-20 s) of kappa S was observed upon transition to whole-cell recording, as would be expected, if highly mobile organic anions contributed significantly to calcium buffering. However, approximately half of the cells investigated displayed a drop in kappa S within 2-5 min, indicative of the loss of soluble Ca2+ binding proteins in the range of 7-20 kDa. 4. The average Ca2+ binding capacity (differential ratio of bound calcium over free calcium) was 9 +/- 7 (mean +/- S.E.M.) for the poorly mobile component and 31 +/- 10 for the fixed component. It was concluded that a contribution of 7 from highly mobile buffer would have been detected, if present. Thus, this value can be considered as an upper bound to highly mobile Ca2+ buffer. 5. Both mobile and fixed calcium binding capacity appeared to have relatively low Ca2+ affinity, since kappa S did not change in the range of Ca2+ concentrations between 0.1 and 3 microM. 6. It was found that cellular autofluorescence and contributions to fluorescence of non-hydrolysed or compartmentalized dye contribute a serious error in estimation of kappa S. 'Balanced loading', a degree of fura-2 loading such that the calcium binding capacity of fura-2 equals cellular calcium binding capacity, minimizes these errors. Also, changes in kappa S at the transition from perforated-patch to whole-cell recording can be most faithfully recorded for similar degrees of loading in both situations. 7. Nystatin was found unable to make pores from inside of the plasma membrane of chromaffin cells. With careful preparation and storage the diluted nystatin solution maintained its high activity of membrane

  7. Influence of dietary sodium restriction on angiotensin II receptors in rat adrenals.


    Lehoux, J G; Bird, I M; Briere, N; Martel, D; Ducharme, L


    We studied the distribution of angiotensin II (AII) receptors type 1 (AT1) and type 2 (AT2) and the effects of a low sodium intake on these two subtypes of receptors in male rat adrenals. Binding studies on adrenal slices, on cell membranes and on cell suspensions were performed using [125I]AII and specific analogs for AT1 (Losartan) and AT2 (PD 123319) receptors. The distribution of AT1 was also studied by immunofluorescence. Complementary approaches were necessary to reach our goal. Indeed, by autoradiography on adrenal slices, [125I]AII was shown to bind to the zona glomerulosa (ZG) and to the medulla (M). When coincubated with [125I]AII, PD 123319 displaced [125I]AII from the medulla and from the ZG, indicating the presence of AT2 receptors in both zones. Losartan partially displaced [125I]AII from the ZG, indicating the presence of AT1 receptors in that zone. Furthermore, the labeling intensity of the medulla (AT2 receptors) was much stronger in adrenal sections from rats kept on a low sodium regimen than from controls. Immunofluorescence microscopy revealed that AT1 receptors were located mainly in the ZG of control rats. After sodium restriction, AT1 receptors appeared to be uniformly distributed within an enlarged ZG; furthermore AT1 receptor-positive cells were found to a limited degree in the zona fasciculata and possibly in the zona reticularis, and a greater number of these positive cells appeared in these zones under sodium restriction. Cell suspensions from rats fed a low sodium diet showed a 2.7- and 2.1-fold increase in total AII receptors in adrenal ZG and ZFR + M cells when compared with controls. Based on Losartan displacement, we calculated that [125I]AII bound to AT1 and to AT2 receptors was increased in both ZG and ZFR + M cell preparations under sodium restriction. Results of binding studies on cell membranes were also indicative of an increasing effect of sodium restriction on AT1 and AT2 receptors binding capacity. Furthermore, Northern

  8. Identification, characterization, and regulation of a nicotinic acetylcholine receptor on bovine adrenal chromaffin cells in culture

    SciTech Connect

    Higgins, L.S.


    Synaptic input to bovine adrenal chromaffin cells is mediated by nicotinic acetylcholine receptors (AChRs) and results in secretion of catecholamines. Three probes previously shown to recognize AChRs on neurons were used to identify the AChR on bovine adrenal chromaffin cells in culture: monoclonal antibody mAb 35, a toxin that blocks receptor function, and the agonist nicotine. Competition for {sup 3}H-nicotine binding was used to measure the affinity of cholinergic ligands, and revealed the pharmacological profile expected for a neuronal-type AChR. At steady state the rate both of receptor insertion into and loss from the plasma membrane is about 3%/hour, resulting in a half-life in the surface of about 24 hours. Exposure to the anti-AChR antibody results in a loss of AChRs from the surface of the cells through a process that has the characteristics of antigenic modulation. The number of AChRs on the surface of the chromaffin cells can also be modulated by agonists and hormones, including glucocotricoids. Catecholamines, three peptides that may be secreted by chromaffin cells, and K{sup +}-induced secretion reduce agonist-induced catecholamine release by decreasing the number of AChRs, providing a mechanism for autoregulation.

  9. Human Adrenocortical Remodeling Leading to Aldosterone-Producing Cell Cluster Generation

    PubMed Central

    Hayashi, Yuichiro; Al-Eyd, Ghaith; Nakagawa, Ken; Morita, Shinya; Kosaka, Takeo; Oya, Mototsugu; Mitani, Fumiko; Suematsu, Makoto; Kabe, Yasuaki


    Background. The immunohistochemical detection of aldosterone synthase (CYP11B2) and steroid 11β-hydroxylase (CYP11B1) has enabled the identification of aldosterone-producing cell clusters (APCCs) in the subcapsular portion of the human adult adrenal cortex. We hypothesized that adrenals have layered zonation in early postnatal stages and are remodeled to possess APCCs over time. Purposes. To investigate changes in human adrenocortical zonation with age. Methods. We retrospectively analyzed adrenal tissues prepared from 33 autopsied patients aged between 0 and 50 years. They were immunostained for CYP11B2 and CYP11B1. The percentage of APCC areas over the whole adrenal area (AA/WAA, %) and the number of APCCs (NOA, APCCs/mm2) were calculated by four examiners. Average values were used in statistical analyses. Results. Adrenals under 11 years old had layered zona glomerulosa (ZG) and zona fasciculata (ZF) without apparent APCCs. Some adrenals had an unstained (CYP11B2/CYP11B1-negative) layer between ZG and ZF, resembling the rat undifferentiated cell zone. Average AA/WAA and NOA correlated with age, suggesting that APCC development is associated with aging. Possible APCC-to-APA transitional lesions were incidentally identified in two adult adrenals. Conclusions. The adrenal cortex with layered zonation remodels to possess APCCs over time. APCC generation may be associated with hypertension in adults. PMID:27721827

  10. Evidence for functionally distinct subpopulations of steroidogenic cells in the domestic turkey (Meleagris gallopavo) adrenal gland.


    Kocsis, J F; Lamm, E T; McIlroy, P J; Scanes, C G; Carsia, R V


    A body of histological and functional evidence supports the hypothesis that there are functionally distinct subpopulations of steroidogenic cells comprising the avian adrenal gland. In the present study, we tested this hypothesis by evaluating the steroidogenic responses of density-dependent subpopulations of adrenal steroidogenic cells isolated from domestic turkeys fed either a high-normal (control) sodium diet (0.4% Na+) or a Na(+)-restricted diet (0.04% Na+) for 8 days, the latter to stimulate the activity or appearance of possible zona glomerulosa-like cells. Subpopulations were visually yet reproducibly determined by their density-dependent separation on a continuous density gradient of Percoll (45%). The subpopulations were arbitrarily ascribed as being either low-density or high-density adrenal steroidogenic cells [LDAC (p = 1.0350-1.0585 g/ml) and HDAC (p = 1.0590-1.0720 g/ml), respectively]. LDAC and HDAC comprised 95.2 and 4.8%, respectively, of the total number of adrenal steroidogenic cells isolated. The LDAC was further subdivided into three visually distinct subpopulations. The functional differences between the LDAC subpopulations is discussed but was less dramatic than the functional distinction between the HDAC subpopulation and the pooled LDAC subpopulations. Basal aldosterone production values between control LDAC and HDAC were equivalent. In addition, there were no differences in maximal aldosterone production between control LDAC and HDAC in response to [Ile5]angiotensin II (AII), the avian equivalent, [Val5]AII, K+ (as KCl), and that supported by exogenous corticosterone. However, maximal aldosterone production in response to human ACTH-(1-39) (ACTH) of the LDAC was 32% greater than that of the HDAC. Na+ restriction enhanced basal aldosterone production of the LDAC by 84% over the control LDAC. In addition, it enhanced maximal aldosterone production of the LDAC in response to AII peptides, K+, ACTH and that supported by corticosterone by 54

  11. Synthetic modified N-POMC(1-28) controls in vivo proliferation and blocks apoptosis in rat adrenal cortex.


    Torres, Thompson Eusebio Pavan; de Mendonça, Pedro Omori Ribeiro; Lotfi, Claudimara Ferini Pacicco


    The identity of the pro-opiomelanocortin (POMC)-derived mitogen in the adrenal cortex has been historically controversial. We have used well-established in vivo models, viz., hypophysectomized (Hyp) or dexamethasone (Dex)-treated rats, to study the effect of the synthetic modified peptide N-terminal POMC (N-POMC(1-28)) on DNA synthesis in the adrenal cortex, as assessed by BrdU incorporation and compared with adrenocorticotropic hormone (ACTH). We evaluated the importance of disulfide bridges on proliferation by employing N-POMC(1-28) without disulfide bridges and with methionines replacing cysteines. Acute administration of synthetic modified N-POMC(1-28) distinctly increased DNA synthesis in the zona glomerulosa and zona fasciculata, but not in the zona reticularis in Hyp rats, whereas in Dex-treated rats, this peptide was effective in all adrenal zones. ACTH administration led to an increase of BrdU-positive cells in all adrenal zones irrespective of the depletion of Hyp or Dex-POMC peptides. The use of the ACTH antagonist, ACTH(7-38), confirmed the direct participation of ACTH in proliferation. Two different approaches to measure apoptosis revealed that both peptides similarly exerted a protective effect on all adrenocortical zones, blocking the apoptotic cell death induced by hypophysectomy. Thus, ACTH(1-39) and N-POMC(1-28) have similar actions suggesting that the disulfide bridges are important but not essential. Both peptides seem to be important factors determining adrenocortical cell survival throughout the adrenal cortex, reinforcing the idea that each zone can be renewed from within itself.

  12. Impaired maturation of large dense-core vesicles in muted-deficient adrenal chromaffin cells.


    Hao, Zhenhua; Wei, Lisi; Feng, Yaqin; Chen, Xiaowei; Du, Wen; Ma, Jing; Zhou, Zhuan; Chen, Liangyi; Li, Wei


    The large dense-core vesicle (LDCV), a type of lysosome-related organelle, is involved in the secretion of hormones and neuropeptides in specialized secretory cells. The granin family is a driving force in LDCV biogenesis, but the machinery for granin sorting to this biogenesis pathway is largely unknown. The mu mutant mouse, which carries a spontaneous null mutation on the Muted gene (also known as Bloc1s5), which encodes a subunit of the biogenesis of lysosome-related organelles complex-1 (BLOC-1), is a mouse model of Hermansky-Pudlak syndrome. Here, we found that LDCVs were enlarged in mu adrenal chromaffin cells. Chromogranin A (CgA, also known as CHGA) was increased in mu adrenals and muted-knockdown cells. The increased CgA in mu mice was likely due a failure to export this molecule out of immature LDCVs, which impairs LDCV maturation and docking. In mu chromaffin cells, the size of readily releasable pool and the vesicle release frequency were reduced. Our studies suggest that the muted protein is involved in the selective export of CgA during the biogenesis of LDCVs.

  13. Monkey adrenal chromaffin cells express α6β4* nicotinic acetylcholine receptors.


    Hernández-Vivanco, Alicia; Hone, Arik J; Scadden, Mick L; Carmona-Hidalgo, Beatriz; McIntosh, J Michael; Albillos, Almudena


    Nicotinic acetylcholine receptors (nAChRs) that contain α6 and β4 subunits have been demonstrated functionally in human adrenal chromaffin cells, rat dorsal root ganglion neurons, and on noradrenergic terminals in the hippocampus of adolescent mice. In human adrenal chromaffin cells, α6β4* nAChRs (the asterisk denotes the possible presence of additional subunits) are the predominant subtype whereas in rodents, the predominant nAChR is the α3β4* subtype. Here we present molecular and pharmacological evidence that chromaffin cells from monkey (Macaca mulatta) also express α6β4* receptors. PCR was used to show the presence of transcripts for α6 and β4 subunits and pharmacological characterization was performed using patch-clamp electrophysiology in combination with α-conotoxins that target the α6β4* subtype. Acetylcholine-evoked currents were sensitive to inhibition by BuIA[T5A,P6O] and MII[H9A,L15A]; α-conotoxins that inhibit α6-containing nAChRs. Two additional agonists were used to probe for the expression of α7 and β2-containing nAChRs. Cells with currents evoked by acetylcholine were relatively unresponsive to the α7-selctive agonist choline but responded to the agonist 5-I-A-85380. These studies provide further insights into the properties of natively expressed α6β4* nAChRs.

  14. Muscarinic receptor-mediated inositol tetrakisphosphate response in bovine adrenal chromaffin cells

    SciTech Connect

    Sanborn, B.B.; Schneider, A.S. )


    Inositol trisphosphate (IP{sub 3}), a product of the phosphoinositide cycle, mobilizes intracellular Ca{sup 2+} in many cell types. New evidence suggests that inositol tetrakisphosphate (IP{sub 4}), an IP{sub 3} derivative, may act as another second messenger to further alter calcium homeostasis. However, the function and mechanism of action of IP{sub 4} are presently unresolved. We now report evidence of muscarinic receptor-mediated accumulation of IP{sub 4} in bovine adrenal chromaffin cells, a classic neurosecretory system in which calcium movements have been well studied. Muscarine stimulated an increase in ({sup 3}H)IP{sub 4} and ({sup 3}H)IP{sub 3} accumulation in chromaffin cells and this effect was completely blocked by atropine. ({sup 3}H)IP{sub 4} accumulation was detectable within 15 sec, increased to a maximum by 30 sec and thereafter declined. 2,3-diphosphoglycerate, an inhibitor of IP{sub 3} and IP{sub 4} hydrolysis, enhanced accumulation of these inositol polyphosphates. The results provide the first evidence of a rapid inositol tetrakisphosphate response in adrenal chromaffin cells, which should facilitate the future resolution of the relationship between IP{sub 4} and calcium homeostasis.

  15. Impaired maturation of large dense-core vesicles in muted-deficient adrenal chromaffin cells.


    Hao, Zhenhua; Wei, Lisi; Feng, Yaqin; Chen, Xiaowei; Du, Wen; Ma, Jing; Zhou, Zhuan; Chen, Liangyi; Li, Wei


    The large dense-core vesicle (LDCV), a type of lysosome-related organelle, is involved in the secretion of hormones and neuropeptides in specialized secretory cells. The granin family is a driving force in LDCV biogenesis, but the machinery for granin sorting to this biogenesis pathway is largely unknown. The mu mutant mouse, which carries a spontaneous null mutation on the Muted gene (also known as Bloc1s5), which encodes a subunit of the biogenesis of lysosome-related organelles complex-1 (BLOC-1), is a mouse model of Hermansky-Pudlak syndrome. Here, we found that LDCVs were enlarged in mu adrenal chromaffin cells. Chromogranin A (CgA, also known as CHGA) was increased in mu adrenals and muted-knockdown cells. The increased CgA in mu mice was likely due a failure to export this molecule out of immature LDCVs, which impairs LDCV maturation and docking. In mu chromaffin cells, the size of readily releasable pool and the vesicle release frequency were reduced. Our studies suggest that the muted protein is involved in the selective export of CgA during the biogenesis of LDCVs. PMID:25673877

  16. Monkey Adrenal Chromaffin Cells Express α6β4* Nicotinic Acetylcholine Receptors

    PubMed Central

    Scadden, Mick´l; Carmona-Hidalgo, Beatriz; McIntosh, J. Michael; Albillos, Almudena


    Nicotinic acetylcholine receptors (nAChRs) that contain α6 and β4 subunits have been demonstrated functionally in human adrenal chromaffin cells, rat dorsal root ganglion neurons, and on noradrenergic terminals in the hippocampus of adolescent mice. In human adrenal chromaffin cells, α6β4* nAChRs (the asterisk denotes the possible presence of additional subunits) are the predominant subtype whereas in rodents, the predominant nAChR is the α3β4* subtype. Here we present molecular and pharmacological evidence that chromaffin cells from monkey (Macaca mulatta) also express α6β4* receptors. PCR was used to show the presence of transcripts for α6 and β4 subunits and pharmacological characterization was performed using patch-clamp electrophysiology in combination with α-conotoxins that target the α6β4* subtype. Acetylcholine-evoked currents were sensitive to inhibition by BuIA[T5A,P6O] and MII[H9A,L15A]; α-conotoxins that inhibit α6-containing nAChRs. Two additional agonists were used to probe for the expression of α7 and β2-containing nAChRs. Cells with currents evoked by acetylcholine were relatively unresponsive to the α7-selctive agonist choline but responded to the agonist 5-I-A-85380. These studies provide further insights into the properties of natively expressed α6β4* nAChRs. PMID:24727685

  17. Disruption of the Crithidia fasciculata RNH1 gene results in the loss of two active forms of ribonuclease H.

    PubMed Central

    Ray, D S; Hines, J C


    Both prokaryotic and eukaryotic cells contain multiple forms of ribonuclease H, a ribonuclease that specifically degrades the RNA strand of RNA-DNA hybrids and which has been implicated in the processing of initiator RNAs and in the removal of RNA primers from Okazaki fragments. The Crithidia fasciculata RNH1 gene encodes an RNase H and was shown to be a single-copy gene in this diploid trypanosomatid. The RNH1 gene has been disrupted by targeted gene disruption using hygromycin or G418 drug-resistance cassettes. Major active forms of RNase H (38 and 45 kDa) were observed on activity gels of extracts of wild-type cells or cells in which one allele of RNH1 was disrupted. Both the 38 and 45 kDa activities were absent in extracts of cells in which both alleles of RNH1 were disrupted indicating that both forms of the C.fasciculata RNase H are encoded by the RNH1 gene. Images PMID:7630731

  18. Identification and characterization of an angiotensin II receptor on cultured bovine adrenal chromaffin cells

    SciTech Connect

    Boyd, V.L.


    The presence of an angiotensin II receptor on cultured bovine adrenal chromaffin cells was demonstrated by radioligand binding. A single class of finding sites with a K/sub D/ of 0.7 nM was characterized. The use of radioligands also allows the localization of receptors by autoradiography. Autoradiography demonstrated that approximately 50% of the isolated cells bound angiotensin II. It was of interest to see if angiotensin II bound to a cell that possessed a certain phenotype. In order to evaluate this possibility a technique was developed that combined autoradiography and immunocytochemistry. Results indicated that angiotensin II binding sites were not localized preferentially to either norepinephrine or epinephrine cells. Binding of angiotensin II was associated with the release of intracellular catecholamine stores. Cells were pre-loaded with /sup 3/H-norepinephrine and secretion was monitored by following radioactivity released into the supernatant. Alternatively, release of endogenous catecholamines was determined by fluorometric assay.

  19. Woman with virilizing congenital adrenal hyperplasia and Leydig cell tumor of the ovary.


    Fernández-García Salazar, Rosario; Muñoz-Darias, Carmen; Haro-Mora, Juan Jesús; Almaraz, M Cruz; Audí, Laura; Martínez-Tudela, Juana; Yahyaoui, Raquel; Esteva, Isabel


    We report the case of a 36-year-old woman with congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency, and corticosteroid replacement therapy since birth. She manifested persistent virilization and high testosterone levels that were attributed to nonadherence to medical treatment. The patient was referred to our gender unit for genitoplastic surgery. We recommended the patient for left oophorectomy after detecting an ovarian mass. Pathologic findings confirmed an ovarian hilus cell tumor. Testosterone levels fell back to normal and masculinization disappeared but ACTH remained elevated. This case represents a very rare type of primary ovarian tumor that must be considered in persistent virilizing symptoms in women with CAH.

  20. Combined steroidogenic characters of fetal adrenal and Leydig cells in childhood adrenocortical carcinoma.


    Fujisawa, Yasuko; Sakaguchi, Kimiyoshi; Ono, Hiroyuki; Yamaguchi, Rie; Kato, Fumiko; Kagami, Masayo; Fukami, Maki; Ogata, Tsutomu


    Although childhood adrenocortical carcinomas (c-ACCs) with a TP53 mutation are known to produce androgens, detailed steroidogenic characters have not been clarified. Here, we examined steroid metabolite profiles and expression patterns of steroidogenic genes in a c-ACC removed from the left adrenal position of a 2-year-old Brazilian boy with precocious puberty, using an atrophic left adrenal gland removed at the time of tumorectomy as a control. The c-ACC produced not only abundant dehydroepiandrosterone-sulfate but also a large amount of testosterone via the Δ5 pathway with Δ5-androstenediol rather than Δ4-androstenedione as the primary intermediate metabolite. Furthermore, the c-ACC was associated with elevated expressions of CYP11A1, CYP17A1, POR, HSD17B3, and SULT2A1, a low but similar expression of CYB5A, and reduced expressions of AKR1C3 (HSD17B5) and HSD3B2. Notably, a Leydig cell marker INSL3 was expressed at a low but detectable level in the c-ACC. Furthermore, molecular studies revealed a maternally inherited heterozygous germline TP53 mutation, and several post-zygotic genetic aberrations in the c-ACC including loss of paternally derived chromosome 17 with a wildtype TP53 and loss of maternally inherited chromosome 11 and resultant marked hyperexpression of paternally expressed growth promoting gene IGF2 and drastic hypoexpression of maternally expressed growth suppressing gene CDKN1C. These results imply the presence of combined steroidogenic properties of fetal adrenal and Leydig cells in this patient's c-ACC with a germline TP53 mutation and several postzygotic carcinogenic events.

  1. Effect of cyproterone acetate, levonorgestrel and progesterone on adrenal glands and reproductive organs in the beagle bitch.


    El Etreby, M F


    The effects of short-term (8 weeks) treatment with different doses of cyproterone acetate (CPA), levonorgestrel (LN) and progesterone (PRO) on the adrenal gland, ovary, uterus and vagina were studied in cycle-synchronised beagle bitches (first anoestrus). The same organs from non-treated primiparous beagle bitches at the 6th and 9th weeks of pregnancy were also included. In the animals treated with the highest doses of CPA (4.0 mg/kg/day orally) and PRO (42.5 mg/kg/day subcutaneously), as well as in pregnant bitches (9th week of pregnancy), a decrease in adrenal weight and cortex width and also an apparent loss of cells in the zona fasciculata and zona reticularis were observed. A marked increase in ovarian weight was recorded only in pregnant bitches (6th week of pregnancy). This was reflected by the presence of multiple well-developed corpora lutea. The ovaries of virgin control and progestagen-treated bitches revealed ovarian atrophy. Progestagen treatment caused marked stimulation of the uterus, resulting in dose-related oedematous and hyperplastic changes. Comparable findings were also observed during pregnancy. The vaginal epithelium of the progestagen-treated and pregnant bitches showed marked mucification as compared with control bitches. These structural responses indicate that progestagen treatment stimulates a pseudopregnancy-like condition in the adrenal glands, uterus and vagina of the beagle bitch.

  2. Adrenal insufficiency.


    Li-Ng, Melissa; Kennedy, Laurence


    Adrenocortical insufficiency may arise through primary failure of the adrenal glands or due to lack of ACTH stimulation as a result of pituitary or hypothalamic dysfunction. Prolonged administration of exogenous steroids will suppress the hypothalamic-pituitary-adrenal axis, and hence cortisol secretion. We review briefly the causes, investigation, and treatment of adrenal insufficiency, and highlight aspects of particular relevance to patients with adrenal tumors.

  3. Signaling Interactions in the Adrenal Cortex

    PubMed Central

    Spät, András; Hunyady, László; Szanda, Gergő


    The major physiological stimuli of aldosterone secretion are angiotensin II (AII) and extracellular K+, whereas cortisol production is primarily regulated by corticotropin (ACTH) in fasciculata cells. AII triggers Ca2+ release from internal stores that is followed by store-operated and voltage-dependent Ca2+ entry, whereas K+-evoked depolarization activates voltage-dependent Ca2+ channels. ACTH acts primarily through the formation of cAMP and subsequent protein phosphorylation by protein kinase A. Both Ca2+ and cAMP facilitate the transfer of cholesterol to mitochondrial inner membrane. The cytosolic Ca2+ signal is transferred into the mitochondrial matrix and enhances pyridine nucleotide reduction. Increased formation of NADH results in increased ATP production, whereas that of NADPH supports steroid production. In reality, the control of adrenocortical function is a lot more sophisticated with second messengers crosstalking and mutually modifying each other’s pathways. Cytosolic Ca2+ and cGMP are both capable of modifying cAMP metabolism, while cAMP may enhance Ca2+ release and voltage-activated Ca2+ channel activity. Besides, mitochondrial Ca2+ signal brings about cAMP formation within the organelle and this further enhances aldosterone production. Maintained aldosterone and cortisol secretion are optimized by the concurrent actions of Ca2+ and cAMP, as exemplified by the apparent synergism of Ca2+ influx (inducing cAMP formation) and Ca2+ release during response to AII. Thus, cross-actions of parallel signal transducing pathways are not mere intracellular curiosities but rather substantial phenomena, which fine-tune the biological response. Our review focuses on these functionally relevant interactions between the Ca2+ and the cyclic nucleotide signal transducing pathways hitherto described in the adrenal cortex. PMID:26973596

  4. Inhibition of polyamine biosynthesis in Crithidia fasciculata by D,L-alpha-difluoromethylornithine and D,L-alpha-difluoromethylarginine.


    Hunter, K J; Strobos, C A; Fairlamb, A H


    Using Crithidia fasciculata as a model organism for Trypanosoma cruzi, we have examined the effects of D,L-alpha-difluoromethylornithine (DFMO) and D,L-alpha-difluoromethylarginine (DFMA) on growth and polyamine synthesis. In a defined, polyamine-free medium growth was markedly inhibited by DFMO (94% at 50 mM; IC50 = 37 mM) and to a lesser extent by DFMA (65% at 50 mM). Addition of putrescine, but not agmatine, reverses inhibition of growth, suggesting that the site of inhibition is ornithine decarboxylase (ODC). Consistent with this conclusion, DFMO or DFMA results in a complete loss of putrescine and significant reductions in intracellular spermidine, glutathionylspermidine and N1,N8-bis(glutathionyl)spermidine (trypanothione). In addition, significant concentrations of DFMO (0.8 mM) were present in DFMA-treated cells. However, in contrast to other organisms, conversion of DFMA to DFMO is probably not catalysed by arginase. Substantial ornithine decarboxylase activity (63.1 pmol min-1 mg-1; ODC) was observed in control cells, sufficient to account for polyamine synthesis during growth. In addition, a trace arginine decarboxylase (ADC) activity (1.19 pmol min-1 mg-1) was found. Evidence is presented showing that the apparent ADC activity is actually due to the concerted action of arginase (1.5 nmol min-1 mg-1) and ODC. Thus DFMA appears to inhibit growth of C. fasciculata via conversion to DFMO and subsequent inhibition of ODC.

  5. Thymus and adrenal glands in elder abuse.


    Hayashi, Takahito; Bunai, Yasuo; Ago, Kazutoshi; Ago, Mihoko; Ogata, Mamoru


    Endogenous glucocorticoid-induced thymic involution is generally considered to be an important finding for determining child abuse. The present study investigated the weight of the thymus and the adrenal glands in elder abuse cases to identify a potential marker for elder abuse. There was no significant difference in the thymus and the adrenal weight between elder abuse and control cases. However, the elder abuse cases in which the duration of abuse was less than 3 months showed a significant increase in the adrenal weight in comparison to control cases. In such cases, histopathological findings showed a loss of intracellular light granules from the zona fasciculata, which might indicate a loss of cholesterol due to the overproduction of glucocorticoid. These results might imply that the elderly, who were maltreated for less than 3 months, were in the early phase of a long-term stress state during which stress-induced overproduction of glucocorticoid was observed in adrenal glands as indicated by Selye. Our results suggest that an increase in adrenal weight may be a potential marker for elder abuse of relatively short periods, especially less than a few months.

  6. Bovine thrombospondin-2: complete complementary deoxyribonucleic acid sequence and immunolocalization in the external zones of the adrenal cortex.


    Danik, M; Chinn, A M; Lafeuillade, B; Keramidas, M; Aguesse-Germon, S; Penhoat, A; Chen, H; Mosher, D F; Chambaz, E M; Feige, J J


    Given the variety of biological functions in the adrenal cortex that are controlled by ACTH, we hypothesized that some extracellular proteins act as biological relays for this systemic hormone. One candidate protein [corticotropin-induced secreted protein (CISP)] was purified from the conditioned medium of bovine adrenocortical cells on the basis of a 5- to 14-fold increase in its synthesis after the addition of ACTH. We report here the cloning of overlapping complementary DNAs that span the sequence encoding the full-length protein (1170 amino acids). The deduced CISP protein sequence is 89% identical to that of human thrombospondin-2 (TSP2), but only 61% identical to that of bovine TSP1, confirming that CISP is the bovine ortholog of TSP2. The bovine TSP2 sequence aligned perfectly with human, mouse, and chicken TSP2 sequences, except for a gap of 2 amino acids located in a linker region. All 58 cysteine residues that are conserved in other species were present in the bovine sequence as well as most of the functional domains. Most endocrine tissues (adrenal cortex, testis, ovary, and placenta) appeared to express TSP2, as determined by Western blot analysis. The highest levels of TSP2 protein were found in the adrenal cortex, followed by the heart, spleen, brain, and kidney. A differential extent of N-glycosylation or tissular proteolytic maturation may be responsible for the mol wt differences observed between bovine TSP2 detected in the medium from primary cultures and that in fresh tissue extracts. The immunohistochemical analysis of the distribution of TSP2 in the bovine adrenal gland revealed that the protein is much more abundant in the external zones (zona glomerulosa and zona fasciculata) than in the internal reticularis zone, a pattern similar to that reported for ACTH receptors. This distribution clearly suggests that TSP2 is a candidate relay protein for a subset of ACTH actions in the adrenal cortex. PMID:10342868

  7. Histological structure of the adrenal gland of the bottlenose dolphin (Tursiops truncatus) and the striped dolphin (Stenella coeruleoalba) from the Adriatic Sea.


    Vuković, S; Lucić, H; Zivković, A; Duras Gomercić, M; Gomercić, T; Galov, A


    The structure of the adrenal gland was studied in 11 bottlenose dolphins (Tursiops truncatus), and five striped dolphins (Stenella coeruleoalba). These species are legally protected in Croatia. All examined animals died of natural causes and were found stranded along eastern Adriatic coast. In both species the adrenal gland consists of a cortex and a medulla; the cortex is divided into three zones. Whereas in the bottlenose dolphin, there is a zona arcuata which contains columnar cells arranged in the form of arches; in the striped dolphin this zone is replaced by zona glomerulosa containing rounded clusters of polygonal cells. In both species, the zona fasciculata consists of radially oriented cords of polygonal cells, whereas in zona reticularis cells are arranged in branching and anastomosing cords. The adrenal medulla in both species contains dark, epinephrine-secreting cells and light norepinephrine-secreting cells. Epinephrine-secreting cells are localized in the outer part of the medulla, whereas norepinephrine-secreting cells are found in the inner part, arranged in clusters and surrounded by septa of thin connective tissue. The gland is surrounded by a thick connective-tissue capsule, from where thick trabeculae extend towards the interior. In the bottlenose dolphin, group of cells resembling both medullar and cortical cells can be seen within the capsule; whereas only groups of cells resembling cortical cells are found within the capsule of the striped dolphin. In the bottlenose dolphin invagination of the adrenal cortex into the medulla is obvious as well as medullary protrusions extending through cortex to the connective tissue capsule. PMID:19912161

  8. Catecholamine secretion by chemical hypoxia in guinea-pig, but not rat, adrenal medullary cells: differences in mitochondria.


    Harada, K; Endo, Y; Warashina, A; Inoue, M


    The effects of mitochondrial inhibitors (CN(-), a complex IV inhibitor and CCCP, protonophore) on catecholamine (CA) secretion and mitochondrial function were explored functionally and biochemically in rat and guinea-pig adrenal chromaffin cells. Guinea-pig chromaffin cells conspicuously secreted CA in response to CN(-) or CCCP, but rat cells showed a little, if any, secretory response to either of them. The resting metabolic rates in rat adrenal medullae did not differ from those in guinea-pig adrenal medullae. On the other hand, the time course of depolarization of the mitochondrial membrane potential (ΔΨm) in guinea-pig chromaffin cells in response to CN(-) was slower than that in rat chromaffin cells, and this difference was abolished by oligomycin, an F1F0-ATPase inhibitor. The extent of CCCP-induced decrease in cellular ATP in guinea-pig chromaffin cells, which was indirectly measured using a Mg(2+) indicator, was smaller than that in rat chromaffin cells. Relative expression levels of F1F0-ATPase inhibitor factor in guinea-pig adrenal medullae were smaller than in rat adrenal medullae, and the opposite was true for F1F0-ATPase α subunit. The present results indicate that guinea-pig chromaffin cells secrete more CA in response to a mitochondrial inhibitor than rat chromaffin cells and this higher susceptibility in the former is accounted for by a larger extent of reversed operation of F1F0-ATPase with the consequent decrease in ATP under conditions where ΔΨm is depolarized. PMID:26047729

  9. Catecholamine secretion by chemical hypoxia in guinea-pig, but not rat, adrenal medullary cells: differences in mitochondria.


    Harada, K; Endo, Y; Warashina, A; Inoue, M


    The effects of mitochondrial inhibitors (CN(-), a complex IV inhibitor and CCCP, protonophore) on catecholamine (CA) secretion and mitochondrial function were explored functionally and biochemically in rat and guinea-pig adrenal chromaffin cells. Guinea-pig chromaffin cells conspicuously secreted CA in response to CN(-) or CCCP, but rat cells showed a little, if any, secretory response to either of them. The resting metabolic rates in rat adrenal medullae did not differ from those in guinea-pig adrenal medullae. On the other hand, the time course of depolarization of the mitochondrial membrane potential (ΔΨm) in guinea-pig chromaffin cells in response to CN(-) was slower than that in rat chromaffin cells, and this difference was abolished by oligomycin, an F1F0-ATPase inhibitor. The extent of CCCP-induced decrease in cellular ATP in guinea-pig chromaffin cells, which was indirectly measured using a Mg(2+) indicator, was smaller than that in rat chromaffin cells. Relative expression levels of F1F0-ATPase inhibitor factor in guinea-pig adrenal medullae were smaller than in rat adrenal medullae, and the opposite was true for F1F0-ATPase α subunit. The present results indicate that guinea-pig chromaffin cells secrete more CA in response to a mitochondrial inhibitor than rat chromaffin cells and this higher susceptibility in the former is accounted for by a larger extent of reversed operation of F1F0-ATPase with the consequent decrease in ATP under conditions where ΔΨm is depolarized.

  10. Immunohistochemical analysis of the hypothalamic-pituitary-adrenal axis in dogs: Sex-linked and seasonal variation.


    Gallelli, M F; Lombardo, D; Vissio, P; Quiroga, A; Caggiano, N; Soler, E; Meikle, A; Castillo, V A


    This study evaluated sexual dimorphism and seasonal variations in corticotrophs and adrenal zona fasciculata in dogs, as well as the expression of oestrogen receptor alpha (ERα). An immunohistochemical analysis was conducted in pituitaries for ACTH and in adrenal glands for ERα and for the melanocortin-2-receptor (MC2R) in winter and summer. Double immunofluorescence was performed to identify ERα in corticotrophs. Females had a greater proportion of corticotrophs per field (p<0.01), with a greater cellular area and optical density (p<0.001) than males. Optical density of corticotrophs was greater in winter for both sexes (p<0.001). In zona fasciculata, ERα and MC2R expression was greater in females (p<0.001) and was greater in winter (p<0.001). ERα was identified in corticotrophs. This study is the first to demonstrate ERα expression in corticotrophs and the adrenal cortex in dogs, providing evidence for sexual dimorphism and seasonal variations. PMID:26850531

  11. Immunohistochemical analysis of the hypothalamic-pituitary-adrenal axis in dogs: Sex-linked and seasonal variation.


    Gallelli, M F; Lombardo, D; Vissio, P; Quiroga, A; Caggiano, N; Soler, E; Meikle, A; Castillo, V A


    This study evaluated sexual dimorphism and seasonal variations in corticotrophs and adrenal zona fasciculata in dogs, as well as the expression of oestrogen receptor alpha (ERα). An immunohistochemical analysis was conducted in pituitaries for ACTH and in adrenal glands for ERα and for the melanocortin-2-receptor (MC2R) in winter and summer. Double immunofluorescence was performed to identify ERα in corticotrophs. Females had a greater proportion of corticotrophs per field (p<0.01), with a greater cellular area and optical density (p<0.001) than males. Optical density of corticotrophs was greater in winter for both sexes (p<0.001). In zona fasciculata, ERα and MC2R expression was greater in females (p<0.001) and was greater in winter (p<0.001). ERα was identified in corticotrophs. This study is the first to demonstrate ERα expression in corticotrophs and the adrenal cortex in dogs, providing evidence for sexual dimorphism and seasonal variations.

  12. YPEL4 modulates HAC15 adrenal cell proliferation and is associated with tumor diameter.


    Oki, Kenji; Plonczynski, Maria W; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E


    Yippee-like (YPEL) proteins are thought to be related to cell proliferation because of their structure and location in the cell. The aim of this study was to clarify the effects of YPEL4 on aldosterone production and cell proliferation in the human adrenocortical cell line (HAC15) and aldosterone producing adenoma (APA). Basal aldosterone levels in HAC15 cells over-expressing YPEL4 was higher than those of control HAC15 cells. The positive effects of YPEL4 on cell proliferation were detected by XTT assay and crystal violet staining. YPEL4 levels in 39 human APA were 2.4-fold higher compared to those in 12 non-functional adrenocortical adenomas, and there was a positive relationship between YPEL4 levels and APA diameter (r = 0.316, P < 0.05). In summary, we have demonstrated that YPEL4 stimulates human adrenal cortical cell proliferation, increasing aldosterone production as a consequence. These results in human adrenocortical cells are consistent with the clinical observations with APA in humans. PMID:27333825

  13. Selective accumulation of meso-tetra(hydroxyphenyl)chlorin in steroid-synthesizing cells of the rat adrenal gland

    NASA Astrophysics Data System (ADS)

    Colombo-Benkmann, Mario; Muhm, Markus; Gahlen, Johannes; Vry, Magnus-Sebastian; Deubzer, Hedwig; Holloschi, Andreas; Haffner, Matthias; Heym, Christine; Senninger, Norbert


    Rat adrenal glands fluoresce intensely after systemic application of meso-tetra(hydroxyphenyl)chlorin (mTHPC). We investigated which parts of the adrenal gland accumulate mTHPC. Furthermore we examined the time course of adrenal mTHPC-accumulation. Ten male Wistar rats each were given 0.5 or 0.7 mg mTHPC kg-1 iv. Each two animals were perfused with normal saline and Zamboni fixative 6, 12, 24, 48 and 72 hours after photosensitization. Untreated animals served as controls. Fluorescence was quantified on 20 micrometer frozen sections with CCD-camera and appropriate software. Immunohistochemistry identified specific cell types with antibodies to steroid-synthesizing enzymes. The cortex exhibited an intense fluorescence, with weaker fluorescence of corticocytes in the zona glomerulosa compared to the other zones. Besides intensely fluorescing singly lying scattered cells, the medulla showed a faint mTHPC-induced fluorescence. Immunohistochemistry revealed that intramedullary cells with intense fluorescence were corticocytes, showing a positive reaction to the 21-(beta) -hydroxylase antibody. Peak accumulation of mTHPC was always observed after 24 hours. Our results indicate for the first time that only steroid synthesizing cells of the adrenal gland exhibit an intense photosensitizer-induced fluorescence. Thus mTHPC-application is an uncomplicated method to identify steroid-synthesizing cells, possibly also in other organs.

  14. Secretion of Catecholamines from Adrenal Gland by a Single Electrical Shock: Electrotonic Depolarization of Medullary Cell Membrane

    NASA Astrophysics Data System (ADS)

    Wakade, Arun R.; Wakade, Taruna D.


    Transmural stimulation of the isolated adrenal gland of the rat and guinea pig results in secretion of catecholamines. The secretion is due to activation of cholinergic receptors of the adrenal medulla by acetylcholine released from splanchnic nerve terminals after transmural stimulation. Our aim was to see whether the same experimental technique could be used to directly excite the adrenal medullary cell membrane by electrical stimulation and whether such stimulation would result in secretion of catecholamines. We demonstrate here that a single electrical shock to the perfused adrenal gland of the rat results in massive secretion of epinephrine and norepinephrine. The secretion is directly related to the strength and duration of the applied stimulus over a wide range. Catecholamine secretion is unaffected by tetrodotoxin or hexamethonium/atropine but is abolished by Ca2+ lack or 3 mM Mn2+. We suggest that the adrenal medullary membrane undergoes nonpropagated electrotonic depolarization on electrical stimulation and thereby voltage-dependent Ca2+ channels are opened to initiate secretion.

  15. Calcitriol-mediated hypercalcemia in a patient with bilateral adrenal non-Hodgkin's B-cell lymphoma case report

    PubMed Central

    Abaroa-Salvatierra, Ana; Shaikh, Bilal; Deshmukh, Mrunalini; Alweis, Richard; Patel, Arti


    Calcitriol-mediated hypercalcemia is a frequent manifestation of hematological malignancies. However, there are a few reports of cases presenting with increased angiotensin-converting enzyme (ACE) level, which suggests a possible mechanism similar to that of granulomatous diseases. We present a patient with hypercalcemia, normal parathyroid hormone, and parathyroid hormone-related protein levels but high calcitriol and ACE levels that, after further investigation, was diagnosed with bilateral adrenal non-Hodgkin's B-cell lymphoma. Primary adrenal lymphoma represents only 1% of all non-Hodgkin's lymphomas and is usually asymptomatic but should be considered by clinicians among the malignancies that cause calcitriol-mediated hypercalcemia. PMID:27124160

  16. Silent intravascular lymphoma initially manifesting as a unilateral adrenal incidentaloma.


    Takahashi, Yoshiko; Iida, Keiji; Hino, Yasuhisa; Ohara, Takeshi; Kurahashi, Toshifumi; Tashiro, Takashi; Chihara, Kazuo


    Intravascular large B-cell lymphoma (IVLBCL) is a rare subtype of malignant lymphoma. Although the involvement of adrenal glands in IVLBCL is often observed, primary adrenal IVLBCL is rare. Most reported cases of adrenal IVLBCL showed bilateral lesions resulting in rapidly progressive adrenal failure and poor prognosis. Here, we report a case of slowly progressive primary adrenal IVLBCL manifesting initially with unilateral adrenal incidentaloma. This case is a silent IVLBCL and shows that the enlargement of both adrenal glands can be followed.

  17. Ovarian steroid cell tumor, not otherwise specified, associated with congenital adrenal hyperplasia: rare tumors of an endocrine disease.


    Thomas, Tina T; Ruscher, Kimberly R; Mandavilli, Srinivas; Balarezo, Fabiola; Finck, Christine M


    Ovarian steroid cell tumors, not otherwise specified (OSCTs), are extremely rare and present a diagnostic challenge when evaluating an ovarian mass. We present a case of such a tumor in a patient with known Congenital Adrenal Hyperplasia (CAH), secondary to 21-hydroxylase deficiency, who was noncompliant with her medications. The workup, diagnosis, and treatment of this rare condition are described.

  18. Fine-needle aspiration cytology of primary granulosa cell tumor of the adrenal gland: a case report.


    Hameed, A; Coleman, R L


    Extraovarian granulosa cell tumors are extremely rare. We report on a primary granulosa cell tumor of the adrenal gland. A 69-yr-old African-American female presented with a 1-yr history of irregular uterine bleeding and a palpable right abdominal mass. CT scan showed a 9.0-cm suprarenal mass as well as an enlarged uterus. CT-guided fine-needle aspiration (FNA) cytology of the adrenal mass was interpreted as a malignant neoplasm. She underwent exploratory laparotomy, right nephrectomy, and hysterectomy with bilateral salpingo-oophorectomy. The gross, histologic, and immunohistochemical findings of the adrenal mass were characteristic of a granulosa cell tumor. The uterus contained multiple leiomyomas. The endometrium showed simple hyperplasia. Both fallopian tubes and ovaries showed no pathologic abnormality. There was no evidence of tumor elsewhere. Although rare, extraovarian granulosa cell tumor should be considered in the differential diagnosis of adrenal tumors in women showing the FNA features described herein, especially when there is evidence of excessive estrogen production. Diagn. Cytopathol. 2000;22:107-109.

  19. Application of magnetically induced hyperthermia in the model protozoan Crithidia fasciculata as a potential therapy against parasitic infections

    PubMed Central

    Grazú, V; Silber, AM; Moros, M; Asín, L; Torres, TE; Marquina, C; Ibarra, MR; Goya, GF


    Background Magnetic hyperthermia is currently a clinical therapy approved in the European Union for treatment of tumor cells, and uses magnetic nanoparticles (MNPs) under time-varying magnetic fields (TVMFs). The same basic principle seems promising against trypanosomatids causing Chagas disease and sleeping sickness, given that the therapeutic drugs available have severe side effects and that there are drug-resistant strains. However, no applications of this strategy against protozoan-induced diseases have been reported so far. In the present study, Crithidia fasciculata, a widely used model for therapeutic strategies against pathogenic trypanosomatids, was targeted with Fe3O4 MNPs in order to provoke cell death remotely using TVMFs. Methods Iron oxide MNPs with average diameters of approximately 30 nm were synthesized by precipitation of FeSO4 in basic medium. The MNPs were added to C. fasciculata choanomastigotes in the exponential phase and incubated overnight, removing excess MNPs using a DEAE-cellulose resin column. The amount of MNPs uploaded per cell was determined by magnetic measurement. The cells bearing MNPs were submitted to TVMFs using a homemade AC field applicator (f = 249 kHz, H = 13 kA/m), and the temperature variation during the experiments was measured. Scanning electron microscopy was used to assess morphological changes after the TVMF experiments. Cell viability was analyzed using an MTT colorimetric assay and flow cytometry. Results MNPs were incorporated into the cells, with no noticeable cytotoxicity. When a TVMF was applied to cells bearing MNPs, massive cell death was induced via a nonapoptotic mechanism. No effects were observed by applying TVMF to control cells not loaded with MNPs. No macroscopic rise in temperature was observed in the extracellular medium during the experiments. Conclusion As a proof of principle, these data indicate that intracellular hyperthermia is a suitable technology to induce death of protozoan parasites

  20. Molecular characterization of a Leydig cell tumor presenting as congenital adrenal hyperplasia.


    Solish, S B; Goldsmith, M A; Voutilainen, R; Miller, W L


    We present an unusual patient with a Leydig cell tumor to show that greatly elevated serum concentrations of 17-hydroxyprogesterone (17OHP) may not be diagnostic of congenital adrenal hyperplasia (CAH). A 3.5-yr-old boy had a small testicular mass and plasma 17OHP concentrations of 147-333 nmol/L (4,850-11,000 ng/dL), suggesting CAH with adrenal rests. However, normal plasma cortisol values and the unresponsiveness of the 17OHP concentration to dexamethasone suppression or ACTH stimulation suggested a diagnosis of Leydig cell tumor. A 4-fold elevation in plasma 21-deoxycortisol compared with a 200-fold elevation in 17OHP suggested that the elevated 17OHP derived from the normal pathway of testosterone synthesis in the testis. This was proven by normalization of all hormonal values after tumor resection. Compared to the abundance of mRNA for P450c17, the tumor contained unusually large amounts of mRNA for P450scc, the cholesterol side-chain cleavage enzyme, which is the rate-limiting step in steroid hormone synthesis. Increased P450scc activity, which increased the conversion of cholesterol to pregnenolone, apparently permitted the 17,20-lyase activity of P450c17 to become rate limiting, thus accounting for the increased secretion of 17OHP. Thus, Leydig cell tumors can produce quantities of 17OHP previously reported only in CAH due to 21-hydroxylase deficiency. The molecular characterization of steroidogenic mRNAs in this tumor indicates an unusual ratio in the expression of the genes for the steroidogenic enzymes, probably accounting for the unusual pattern of serum steroids.

  1. Regulation of Calcium Channels and Exocytosis in Mouse Adrenal Chromaffin Cells by Prostaglandin EP3 Receptors

    PubMed Central

    Jewell, Mark L.; Breyer, Richard M.


    Prostaglandin (PG) E2 controls numerous physiological functions through a family of cognate G protein-coupled receptors (EP1–EP4). Targeting specific EP receptors might be therapeutically useful and reduce side effects associated with nonsteroidal anti-inflammatory drugs and selective cyclooxygenase-2 inhibitors that block prostanoid synthesis. Systemic immune challenge and inflammatory cytokines have been shown to increase expression of the synthetic enzymes for PGE2 in the adrenal gland. Catecholamines and other hormones, released from adrenal chromaffin cells in response to Ca2+ influx through voltage-gated Ca2+ channels, play central roles in homeostatic function and the coordinated stress response. However, long-term elevation of circulating catecholamines contributes to the pathogenesis of hypertension and heart failure. Here, we investigated the EP receptor(s) and cellular mechanisms by which PGE2 might modulate chromaffin cell function. PGE2 did not alter resting intracellular [Ca2+] or the peak amplitude of nicotinic acetylcholine receptor currents, but it did inhibit CaV2 voltage-gated Ca2+ channel currents (ICa). This inhibition was voltage-dependent and mediated by pertussis toxin-sensitive G proteins, consistent with a direct Gβγ subunit-mediated mechanism common to other Gi/o-coupled receptors. mRNA for all four EP receptors was detected, but using selective pharmacological tools and EP receptor knockout mice, we demonstrated that EP3 receptors mediate the inhibition of ICa. Finally, changes in membrane capacitance showed that Ca2+-dependent exocytosis was reduced in parallel with ICa. To our knowledge, this is the first study of EP receptor signaling in mouse chromaffin cells and identifies a molecular mechanism for paracrine regulation of neuroendocrine function by PGE2. PMID:21383044

  2. Expression of reelin in adult mammalian blood, liver, pituitary pars intermedia, and adrenal chromaffin cells.


    Smalheiser, N R; Costa, E; Guidotti, A; Impagnatiello, F; Auta, J; Lacor, P; Kriho, V; Pappas, G D


    Reelin regulates telencephalic and cerebellar lamination during mammalian development and is expressed in several structures of the adult brain; however, only traces of reelin were believed to be in peripheral tissues. Because reelin structurally resembles extracellular matrix proteins, and because many of these proteins are expressed in blood, we hypothesized that reelin also might be detectable in the circulation. Reelin (420 kDa) and two reelin-like immunoreactive bands (310 and 160 kDa) are expressed in serum and platelet-poor plasma of rats, mice, and humans, but these three bands were not detectable in serum of homozygous reeler (rl/rl) mice. Reelin plasma levels in heterozygous (rl/+) mice were half of those in wild-type littermates. Western blotting and immunocytochemistry using antireelin mAbs indicated that reelin-like immunoreactivity was expressed in a subset of chromaffin cells within the rat adrenal medulla and in a subset of cells coexpressing alpha-melanocyte-stimulating hormone within the pituitary pars intermedia. However, surgical removal of adrenal or pituitary failed to decrease the amount of reelin (420-kDa band) expressed in serum. Adult liver expressed one-third of the reelin mRNA concentration expressed in adult mouse cerebral cortex. Full-length reelin protein was detectable in liver extracts in situ; acutely isolated liver cells also secreted full-length reelin in vitro. Liver appears to be a prime candidate to produce and maintain the circulating reelin pool. It now becomes relevant to ask whether circulating reelin has a physiologic role on one or more peripheral target tissues.

  3. Expression of reelin in adult mammalian blood, liver, pituitary pars intermedia, and adrenal chromaffin cells

    PubMed Central

    Smalheiser, Neil R.; Costa, Erminio; Guidotti, Alessandro; Impagnatiello, Francesco; Auta, James; Lacor, Pascale; Kriho, Virginia; Pappas, George D.


    Reelin regulates telencephalic and cerebellar lamination during mammalian development and is expressed in several structures of the adult brain; however, only traces of reelin were believed to be in peripheral tissues. Because reelin structurally resembles extracellular matrix proteins, and because many of these proteins are expressed in blood, we hypothesized that reelin also might be detectable in the circulation. Reelin (420 kDa) and two reelin-like immunoreactive bands (310 and 160 kDa) are expressed in serum and platelet-poor plasma of rats, mice, and humans, but these three bands were not detectable in serum of homozygous reeler (rl/rl) mice. Reelin plasma levels in heterozygous (rl/+) mice were half of those in wild-type littermates. Western blotting and immunocytochemistry using antireelin mAbs indicated that reelin-like immunoreactivity was expressed in a subset of chromaffin cells within the rat adrenal medulla and in a subset of cells coexpressing α-melanocyte-stimulating hormone within the pituitary pars intermedia. However, surgical removal of adrenal or pituitary failed to decrease the amount of reelin (420-kDa band) expressed in serum. Adult liver expressed one-third of the reelin mRNA concentration expressed in adult mouse cerebral cortex. Full-length reelin protein was detectable in liver extracts in situ; acutely isolated liver cells also secreted full-length reelin in vitro. Liver appears to be a prime candidate to produce and maintain the circulating reelin pool. It now becomes relevant to ask whether circulating reelin has a physiologic role on one or more peripheral target tissues. PMID:10655522

  4. Ultrastructural study of binucleation in cells of the rat adrenal glomerular zone after a prolonged low-sodium diet.


    Palacios, G; Lafarga, M; Perez, R


    Binucleate cells have been found in the glomerular zone of the adrenal cortex in rats subjected to low-sodium diets. By considering the various possibilities for their production, both the findings of nuclei in process of constriction and nuclei identical in form, confronted and smaller in size than those of neighbour cells, are in agreement with an amitotic nuclear division as the possible mechanism for the formation of these cells.

  5. Unilateral primary adrenal natural killer/T-cell lymphoma: Role of fluorine-18 fluorodeoxyglucose positron emission tomography/computed tomography for staging and interim response assessment

    PubMed Central

    Kabnurkar, Rasika; Agrawal, Archi; Epari, Sridhar; Purandare, Nilendu; Shah, Sneha; Rangarajan, Venkatesh


    Primary adrenal lymphoma (PAL) is a rare malignancy often involving bilateral adrenal glands. Diffuse large B-cell is the most common histological type. Unilateral presentation and T-cell/natural killer (T/NK) cell histological type is rarer. We report fluorine-18 fluorodeoxyglucose positron emission tomography/computed tomography scan findings in a case of unilateral T/NK cell PAL performed for staging and interim treatment response assessment. PMID:26917897

  6. Comparative stereological studies on zonation and cellular composition of adrenal glands of normal and anencephalic human fetuses. II. Cellular composition of the gland.


    Bocian-Sobkowska, J; Malendowicz, L K; Woźniak, W


    In our previous paper (Bocian-Sobkowska et al., 1997) we demonstrated a striking difference in development of zonation in adrenals of normal and anencephalic human fetuses. The purpose of the present study was to characterize, by means of stereology, the cellular composition of developing adrenals in the same case. Studies were performed on 11 pairs of adrenal glands from normal fetuses and 10 from anencephalic fetuses. In the studied period of development (24 to 39 weeks of intra-uterine life) the average volume of cells in normal glands increased as follows: zona glomerulosa (ZG) from 355 to 870 microns3; zona fasciculata (ZF) from 779 to 1200 microns3; fetal zone (FZ) from 2004 to 2380 microns3: and medulla (M) from 600 to 970 microns3. In anencephalic fetuses, the appropriate values were: ZG-380-680 microns3; ZF-460-680 microns3; FZ-1820-1680 microns3; and M-870-1400 microns3. At the end of the studied period the number of ZG cells in normal fetuses was two fold higher than in anencephalics, ZF cells-6-fold and in FZ-5-fold higher, while in the M the number of cells was nearly equal in both groups. During the whole investigated period of intra-uterine development the total number of adrenocortical cells in normal glands increased ca 2.5-fold, while in anencephalic glands only ca 0.5-fold, reaching at the end ca 40% of normal value. In both normal and anencephalic adrenals the number of ZG and M cells was highly correlated with ZG/M cell ratio, being slightly higher in normal glands. No such relation was demonstrated for cells of the remaining adrenocortical zones. PMID:9151128

  7. Phenolic acids, hydrolyzable tannins, and antioxidant activity of geopropolis from the stingless bee Melipona fasciculata Smith.


    Dutra, Richard Pereira; Abreu, Bruno Vinicius de Barros; Cunha, Mayara Soares; Batista, Marisa Cristina Aranha; Torres, Luce Maria Brandão; Nascimento, Flavia Raquel Fernandes; Ribeiro, Maria Nilce Sousa; Guerra, Rosane Nassar Meireles


    Geopropolis is a mixture of plant resins, waxes, and soil produced by the stingless bee Melipona fasciculata Smith. This paper describes the antioxidant activity and chemical composition of geopropolis produced by M. fasciculata. The total phenolic content determined with the Folin-Ciocalteu reagent was highest in the ethyl acetate fraction and hydroalcoholic extract. Antioxidant activity was assayed by the in vitro DPPH, ABTS, and FRAP assays. The hydroalcoholic extract and fractions of geopropolis, except for the hexane fraction, exhibited antioxidant activity against DPPH, ABTS, and FRAP. The phenolic compounds were identified by HPLC-DAD-MS on the basis of the evaluation of their UV-vis absorption maxima (λmax) and mass spectral analysis. Eleven compounds belonging to the classes of phenolic acids and hydrolyzable tannins (gallotannins and ellagitannins) were tentatively identified. These compounds are responsible for the antioxidant activity and high phenolic content of geopropolis produced by M. fasciculata.

  8. Bradykinin and histamine-induced cytosolic calcium increase in capillary endothelial cells of bovine adrenal medulla.


    Vinet, Raúl; Cortés, Magdalena P; Alvarez, Rocío; Delpiano, Marco A


    We have assessed the effect of bradykinin and histamine on the cytosolic free calcium concentration ([Ca(2+)]i ) of bovine adrenal medulla capillary endothelial cells (BAMCECs). To measure [Ca(2+)]i changes in BAMCECs the intracellular fluorescent probe, fluo-3 AM, was used. Bradykinin (3 µM) produced a transient monophasic increase in [Ca(2+)]i , which was depressed by B1650 (0.1 µM), a B2-bradykinin receptor antagonist (D-Arg-[Hyp(3), Thi(5,8) , D-Phe(7)]-Bradykinin). Similarly, increase in [Ca(2+)]i induced by histamine was also depressed by tripolidine (0.1 µM), an H1-histamine receptor antagonist. [Ca(2+)]i increase induced by both agonists was unaffected in the absence of extracellular Ca(2+) or presence of antagonists of voltage operated Ca(2+) channels (VOCCs). Thapsigargin (1 µM) did not abolish the increase of [Ca(2+)]i produced by bradykinin, but abolished that of histamine. In contrast, caffeine (100 µM), abolished the [Ca(2+)]i response induced by bradykinin (3 µM), but did not affect the [Ca(2+)]i increase induced by histamine (100 µM). The results indicate the presence of B2 bradykinin- and H1 histamine-receptors in BAMCECs. Liberation of Ca(2+) induced by both agonists occurs through 2 different intracellular mechanisms. While bradykinin activates a sarco(endo) plasmic reticulum (SER) containing a SER Ca(2+) -ATPase (SERCA) thapsigargin-insensitive, histamine activates a SER containing a SERCA thapsigargin-sensitive. We suggest that the increase in [Ca(2+)]i induced by bradykinin and histamine could be of physiological relevance, modulating adrenal gland microcirculation.

  9. A rare adrenal incidentaloma: adrenal schwannoma.


    Adas, Mine; Ozulker, Filiz; Adas, Gokhan; Koc, Bora; Ozulker, Tamer; Sahin, Ilknur Mansuroglu


    Adrenal schwannoma is an extremely uncommon cause of incidentaloma. It originates from neural sheath Schwann cells of the adrenal gland. We report the case of a left adrenal schwannoma incidentally discovered in a 32-year-old woman during examination of bloated feeling and stomach ache. The patient was incidentally found to have a left adrenal mass of 9 cm on abdominal ultrasonography. Computed tomography (CT) of the abdomen and [(18)F] fluorodeoxyglucose positron emission tomography (PET) were also performed. Metabolic evaluation was unremarkable. Due to the large size of the tumor, left adrenalectomy was performed. The postoperative course was uneventful. Histological examination established the diagnosis of schwannoma. This diagnosis was supported by immunohistochemistry of S-100 and vimentin positivity. In conclusion, adrenal schwannoma is an extremely rare entity and can grow considerably in size. The present case report emphasizes that clinicians should be aware of the possibility of retroperitoneal schwannoma. Total excision of benign schwannoma is associated with a favorable outcome. To our knowledge, there are case reports of schwannoma with CT and magnetic resonance imaging findings in the literature, although this is the first schwannoma case with PET-CT imaging. PMID:24403879

  10. A Rare Adrenal Incidentaloma: Adrenal Schwannoma

    PubMed Central

    Adas, Mine; Ozulker, Filiz; Adas, Gokhan; Koc, Bora; Ozulker, Tamer; Sahin, Ilknur Mansuroglu


    Adrenal schwannoma is an extremely uncommon cause of incidentaloma. It originates from neural sheath Schwann cells of the adrenal gland. We report the case of a left adrenal schwannoma incidentally discovered in a 32-year-old woman during examination of bloated feeling and stomach ache. The patient was incidentally found to have a left adrenal mass of 9 cm on abdominal ultrasonography. Computed tomography (CT) of the abdomen and [18F] fluorodeoxyglucose positron emission tomography (PET) were also performed. Metabolic evaluation was unremarkable. Due to the large size of the tumor, left adrenalectomy was performed. The postoperative course was uneventful. Histological examination established the diagnosis of schwannoma. This diagnosis was supported by immunohistochemistry of S-100 and vimentin positivity. In conclusion, adrenal schwannoma is an extremely rare entity and can grow considerably in size. The present case report emphasizes that clinicians should be aware of the possibility of retroperitoneal schwannoma. Total excision of benign schwannoma is associated with a favorable outcome. To our knowledge, there are case reports of schwannoma with CT and magnetic resonance imaging findings in the literature, although this is the first schwannoma case with PET-CT imaging. PMID:24403879

  11. Isolation of the peptide inhibitor of H+-ATP synthase from Crithidia fasciculata and Trypanosoma cruzi.


    Rilo, M C; Cataldi de Flombaum, M A; Stoppani, A O


    An inhibitor of Crithidia fasciculata and Trypanosoma cruzi H+ -ATP synthase (ATPase) was isolated from these organims mitochondrial particles, either by (a) ammonium sulfate-cholate extraction followed by heat treatment and ethanol precipitation, or (b) gel-filtration on Sephadex G-50, followed by a similar purification procedure. Inactivation by trypsin supported the inhibitor peptide structure. Removal of the peptide inhibitor increased about three-fold the specific activity of the protozoan ATPases. The isolated peptides and a highly purified bovine heart ATPase inhibitor inhibited C. fasciculata ATPase as a function of the peptide concentration.

  12. Class I and class II ribonuclease H activities in Crithidia fasciculata (Protozoa).


    Vonwirth, H; Köck, J; Büsen, W


    The protozoan Crithidia fasciculata contains two different ribonuclease H activities. These enzymes display similar physical and biochemical characteristics to their homologues in higher eukaryotes, for instance calf thymus class I and class II ribonuclease H. Class I ribonuclease H of lower and higher eukaryotes can be activated by Mg2(+)- and Mn2(+)-ions. However, the presence of Mn2(+)-ions is inhibitory for the Mg2(+)-dependent class II ribonuclease H activity of Crithidia fasciculata and calf thymus. The protozoan class I-homologue enzyme appears to be serologically related to the class I ribonuclease H of calf thymus.

  13. Trifluoperazine inhibits 45Ca2+ uptake and catecholamine secretion and synthesis in adrenal medullary cells.


    Wada, A; Yanagihara, N; Izumi, F; Sakurai, S; Kobayashi, H


    In isolated adrenal medullary cells, carbamylcholine and high K+ cause the calcium-dependent secretion of catecholamines with a simultaneous increase in the synthesis of 14C-catecholamines from [14C]tyrosine. In these cells, trifluoperazine, a selective antagonist of calmodulin, inhibited both the secretion and synthesis of catecholamines. The stimulatory effect of carbamylcholine was inhibited to a greater extent than that of high K+. The inhibitory effect of trifluoperazine on carbamylcholine-evoked secretion of catecholamines was not overcome by an increase in either carbamylcholine or calcium concentration, showing that inhibition by trifluoperazine occurs by a mechanism distinct from competitive antagonism at the cholinergic receptor and from direct inactivation of calcium channels. Doses of trifluoperazine that inhibited catecholamine secretion and synthesis also inhibited the uptake of radioactive calcium by the cells. These results suggest that trifluoperazine inhibits the secretion and synthesis of catecholamines mainly due to its inhibition of calcium uptake. Trifluoperazine seems to inhibit calcium uptake by uncoupling the linkage between calcium uptake by uncoupling the linkage between cholinergic receptor stimulation and calcium channel activation.

  14. Hypothalamus-Pituitary-Adrenal cell-mediated immunity regulation in the Immune Restoration Inflammatory Syndrome

    PubMed Central

    Khakshooy, Allen; Chiappelli, Francesco


    Over one third of the patients sero-positive for the human immunodeficiency virus (HIV) with signs of the acquired immune deficiency syndrome (AIDS), and under treatment with anti-retroviral therapy (ART), develop the immune reconstitution inflammatory syndrome (IRIS). It is not clear what variables are that determine whether a patient with HIV/AIDS will develop ART-related IRIS, but the best evidence base thus far indicates that HIV/AIDS patients with low CD4 cell count, and HIV/AIDS patients whose CD4 count recovery shows a sharp slope, suggesting a particularly fast "immune reconstitution", are at greater risk of developing IRIS. Here, we propose the hypothesis that one important variable that can contribute to low CD4 cell count number and function in ART-treated HIV/AIDS patients is altered hypothalamic-pituitary-adrenal (HPA) cell-mediated immune (CMI) regulation. We discuss HPA-CMI deregulation in IRIS as the new frontier in comparative effectiveness research (CRE) for obtaining and utilizing the best evidence base for treatment of patients with HIV/AIDS in specific clinical settings. We propose that our hypothesis about altered HPA-CMI may extend to the pathologies observed in related viral infection, including Zika PMID:27212842

  15. Development and dissipation of Ca(2+) gradients in adrenal chromaffin cells.

    PubMed Central

    Marengo, F D; Monck, J R


    We used pulsed laser imaging to measure the development and dissipation of Ca(2+) gradients evoked by the activation of voltage-sensitive Ca(2+) channels in adrenal chromaffin cells. Ca(2+) gradients appeared rapidly (<5 ms) upon membrane depolarization and dissipated over several hundred milliseconds after membrane repolarization. Dissipation occurred with an initial fast phase, as the steep gradient near the membrane collapsed, and a slower phase as the remaining shallow gradient dispersed. Inhibition of active Ca(2+) uptake by the endoplasmic reticulum (thapsigargin) and mitochondria (carbonylcyanide p-trifluoro-methoxyphenylhydrazone/oligomycin) had no effect on the size of Ca(2+) changes or the rate of gradient dissipation, suggesting that passive endogenous Ca(2+) buffers are responsible for the slow Ca(2+) redistribution. We used a radial diffusion model incorporating Ca(2+) diffusion and binding to intracellular Ca(2+) buffers to simulate Ca(2+) gradients. We included a 3D optical sectioning model, simulating the effects of out-of-focus light, to allow comparison with the measured gradients. Introduction of a high-capacity immobile Ca(2+) buffer, with a buffer capacity on the order of 1000 and appropriate affinity and kinetics, approximated the size of the Ca(2+) increases and rate of dissipation of the measured gradients. Finally, simulations without exogenous buffer suggest that the Ca(2+) signal due to Ca(2+) channel activation is restricted by the endogenous buffer to a space less than 1 microm from the cell membrane. PMID:11023887

  16. Angiotensin II increases diacylglycerol in calf adrenal glomerulosa cells by activating de novo phospholipid synthesis

    SciTech Connect

    Foster, R.H.; Farese, R.V. )


    Effects of angiotension II (AII) on diacylglycerol (DAG) synthesis were examined in calf adrenal glomerulosa cells. AII provoked rapid increases in ({sup 3}H) glycerol-labeling and content of DAG. Effects on ({sup 3}H) glycerol-labeling of DAG were observed both in cells prelabeled with ({sup 3}H) glycerol for 60 minutes, and when AII and ({sup 3}H) glycerol were added simultaneously. Increases in ({sup 3}H) DAG labeling were associated with increases in total glycerolipid labeling, and in simultaneous addition experiments, were preceded by increased ({sup 3}H) phosphatidic acid (PA) labeling. Labeling of glycerol-3-PO{sub 4}, on the other hand, was not increased by AII, suggesting that increases in lipid labeling were not due to prior increases in precursor specific activity. ACTH, which were not increase precursor specific activity. ACTH, which does not increase the hydrolysis of inositol-phospholipids appreciably in this tissue, provoked increases in content and ({sup 3}H) glycerol-labeling of DAG, which were only slightly less than those provoked by AII. Thus, part of the AII-induced increase in DAG may also be derived from sources other than inositol-phospholipids. Moreover, AII-induced increase in DAG appear to be at least partly derived from increased de novo synthesis of PA.

  17. Diabetic Ketoacidosis with Concurrent Pancreatitis, Pancreatic β Islet Cell Tumor, and Adrenal Disease in an Obese Ferret (Mustela putorius furo)

    PubMed Central

    Phair, Kristen A; Carpenter, James W; Schermerhorn, Thomas; Ganta, Chanran K; DeBey, Brad M


    A 5.5-y-old spayed female ferret (Mustela putorius furo) with a history of adrenal disease, respiratory disease, and chronic obesity was evaluated for progressive lethargy and ataxia, diminished appetite, and possible polyuria and polydipsia. Physical examination revealed obesity, lethargy, tachypnea, dyspnea, a pendulous abdomen, significant weakness and ataxia of the hindlimbs, prolonged skin tenting, and mild tail-tip alopecia. Clinicopathologic analysis revealed severe hyperglycemia, azotemia, an increased anion gap, glucosuria, ketonuria, proteinuria, and hematuria. Abdominal ultrasonography showed hyperechoic hepatomegaly, bilateral adrenomegaly, splenic nodules, mild peritoneal effusion, and thickened and mildly hypoechoic limbs of the pancreas with surrounding hyperechoic mesentery. Fine-needle aspirates of the liver were highly suggestive of hepatic lipidosis. In light of a diagnosis of concurrent diabetic ketoacidosis and pancreatitis, the ferret was treated with fluid therapy, regular and long-acting insulin administration, and pain medication. However, electrolyte derangements, metabolic acidosis, dyspnea, and the clinical appearance of the ferret progressively worsened despite treatment, and euthanasia was elected. Necropsy revealed severe hepatic lipidosis, severe suppurative pancreatitis and vacuolar degeneration of pancreatic islet cells, a pancreatic β islet cell tumor, bilateral adrenal cortical adenomas, and myocardial fibrosis. To our knowledge, this case represents the first report of concurrent diabetes mellitus, pancreatitis, pancreatic β islet cell tumor (insulinoma), and adrenal disease in a domestic ferret. The simultaneous existence of 3 endocrine diseases, pancreatitis, and their associated complications is a unique and clinically challenging situation. PMID:21838985

  18. Dietary unsaturated fatty acids differently affect catecholamine handling by adrenal chromaffin cells.


    Gomes, Andreia; Correia, Gustavo; Coelho, Marisa; Araújo, João Ricardo; Pinho, Maria João; Teixeira, Ana Luisa; Medeiros, Rui; Ribeiro, Laura


    Catecholamines (CA) play an important role in cardiovascular (CDV) disease risk. Namely, noradrenaline (NA) levels positively correlate whereas adrenaline (AD) levels negatively correlate with obesity and/or CDV disease. Western diets, which are tipically rich in Ω-6 fatty acids (FAs) and deficient in Ω-3 FAs, may contribute to the development of obesity, type 2 diabetes and/or coronary artery disease. Taking this into consideration and the fact that our group has already described that saturated FAs affect catecholamine handling by adrenal chromaffin cells, this work aimed to investigate the effect of unsaturated FAs upon catecholamine handling in the same model. Our results showed that chronic exposure to unsaturated FAs differently modulated CA cellular content and release, regardless of both FA series and number of carbon atoms. Namely, the Ω-6 arachidonic and linoleic acids, based on their effect on CA release and cellular content, seemed to impair NA and AD vesicular transport, whereas γ-linolenic acid selectively impaired AD synthesis and release. Within the Ω-9 FAs, oleic acid was devoid of effect, and elaidic acid behaved similarly to γ-linolenic acid. Eicosapentaenoic and docosahexaenoic acids (Ω-3 series) impaired the synthesis and release of both NA and AD. These results deserve attention and future development, namely, in what concerns the mechanisms involved and correlative effects in vivo. PMID:25727966

  19. Transformation of adrenal medullary chromaffin cells increases asthmatic susceptibility in pups from allergen-sensitized rats

    PubMed Central


    Background Studies have shown that epinephrine release is impaired in patients with asthma. The pregnancy of female rats (dams) with asthma promotes in their pups the differentiation of adrenal medulla chromaffin cells (AMCCs) into sympathetic neurons, mediated by nerve growth factor, which leads to a reduction in epinephrine secretion. However, the relatedness between the alteration of AMCCs and increased asthma susceptibility in such offspring has not been established. Methods In this study, we observed the effects of allergization via ovalbumin on rat pups born of asthmatic dams. Results Compared to the offspring of untreated controls, bronchial hyperreactivity and airway inflammation were more severe in the pups from sensitized (asthmatic) dams. In pups exposed to nerve growth factor (NGF) in utero these effects were aggravated further, but the effects were blocked in pups whose dams had been treated with anti-NGF. Furthermore, alterations in AMCC phenotype corresponded to the degree of bronchial hyperreactivity and lung lesions of the different treatment groups. Such AMCC alterations included degranulation of chromaffin granules, reduction of epinephrine and phenylethanolamine-n-methyl transferase, and elevation of NGF and peripherin levels. Conclusions Our results present evidence that asthma during the pregnancy of rat dams promotes asthma susceptibility in their offspring, and that the transformation of AMCCs to neurons induced by NGF plays an important role in this process. PMID:23137120

  20. T-Type Calcium Channel: A Privileged Gate for Calcium Entry and Control of Adrenal Steroidogenesis

    PubMed Central

    Rossier, Michel F.


    Intracellular calcium plays a crucial role in modulating a variety of functions such as muscle contraction, hormone secretion, gene expression, or cell growth. Calcium signaling has been however shown to be more complex than initially thought. Indeed, it is confined within cell microdomains, and different calcium channels are associated with different functions, as shown by various channelopathies. Sporadic mutations on voltage-operated L-type calcium channels in adrenal glomerulosa cells have been shown recently to be the second most prevalent genetic abnormalities present in human aldosterone-producing adenoma. The observed modification of the threshold of activation of the mutated channels not only provides an explanation for this gain of function but also reminds us on the importance of maintaining adequate electrophysiological characteristics to make channels able to exert specific cellular functions. Indeed, the contribution to steroid production of the various calcium channels expressed in adrenocortical cells is not equal, and the reason has been investigated for a long time. Given the very negative resting potential of these cells, and the small membrane depolarization induced by their physiological agonists, low threshold T-type calcium channels are particularly well suited for responding under these conditions and conveying calcium into the cell, at the right place for controlling steroidogenesis. In contrast, high threshold L-type channels are normally activated by much stronger cell depolarizations. The fact that dihydropyridine calcium antagonists, specific for L-type channels, are poorly efficient for reducing aldosterone secretion either in vivo or in vitro, strongly supports the view that these two types of channels differently affect steroid biosynthesis. Whether a similar analysis is transposable to fasciculata cells and cortisol secretion is one of the questions addressed in the present review. No similar mutations on L-type or T-type channels

  1. T-Type Calcium Channel: A Privileged Gate for Calcium Entry and Control of Adrenal Steroidogenesis.


    Rossier, Michel F


    Intracellular calcium plays a crucial role in modulating a variety of functions such as muscle contraction, hormone secretion, gene expression, or cell growth. Calcium signaling has been however shown to be more complex than initially thought. Indeed, it is confined within cell microdomains, and different calcium channels are associated with different functions, as shown by various channelopathies. Sporadic mutations on voltage-operated L-type calcium channels in adrenal glomerulosa cells have been shown recently to be the second most prevalent genetic abnormalities present in human aldosterone-producing adenoma. The observed modification of the threshold of activation of the mutated channels not only provides an explanation for this gain of function but also reminds us on the importance of maintaining adequate electrophysiological characteristics to make channels able to exert specific cellular functions. Indeed, the contribution to steroid production of the various calcium channels expressed in adrenocortical cells is not equal, and the reason has been investigated for a long time. Given the very negative resting potential of these cells, and the small membrane depolarization induced by their physiological agonists, low threshold T-type calcium channels are particularly well suited for responding under these conditions and conveying calcium into the cell, at the right place for controlling steroidogenesis. In contrast, high threshold L-type channels are normally activated by much stronger cell depolarizations. The fact that dihydropyridine calcium antagonists, specific for L-type channels, are poorly efficient for reducing aldosterone secretion either in vivo or in vitro, strongly supports the view that these two types of channels differently affect steroid biosynthesis. Whether a similar analysis is transposable to fasciculata cells and cortisol secretion is one of the questions addressed in the present review. No similar mutations on L-type or T-type channels

  2. Inhibition of the Tcf/beta-catenin complex increases apoptosis and impairs adrenocortical tumor cell proliferation and adrenal steroidogenesis

    PubMed Central

    Leal, Letícia F.; Bueno, Ana Carolina; Gomes, Débora C.; Abduch, Rafael; de Castro, Margaret; Antonini, Sonir R.


    Background To date, there is no effective therapy for patients with advanced/metastatic adrenocortical cancer (ACC). The activation of the Wnt/beta-catenin signaling is frequent in ACC and this pathway is a promising therapeutic target. Aim To investigate the effects of the inhibition of the Wnt/beta-catenin in ACC cells. Methods Adrenal (NCI-H295 and Y1) and non-adrenal (HeLa) cell lines were treated with PNU-74654 (5–200 μM) for 24–96 h to assess cell viability (MTS-based assay), apoptosis (Annexin V), expression/localization of beta-catenin (qPCR, immunofluorescence, immunocytochemistry and western blot), expression of beta-catenin target genes (qPCR and western blot), and adrenal steroidogenesis (radioimmunoassay, qPCR and western blot). Results In NCI-H295 cells, PNU-74654 significantly decreased cell proliferation 96 h after treatment, increased early and late apoptosis, decreased nuclear beta-catenin accumulation, impaired CTNNB1/beta-catenin expression and increased beta-catenin target genes 48 h after treatment. No effects were observed on HeLa cells. In NCI-H295 cells, PNU-74654 decreased cortisol, testosterone and androstenedione secretion 24 and 48 h after treatment. Additionally, in NCI-H295 cells, PNU-74654 decreased SF1 and CYP21A2 mRNA expression as well as the protein levels of STAR and aldosterone synthase 48 h after treatment. In Y1 cells, PNU-74654 impaired corticosterone secretion 24 h after treatment but did not decrease cell viability. Conclusions Blocking the Tcf/beta-catenin complex inhibits the Wnt/beta-catenin signaling in adrenocortical tumor cells triggering increased apoptosis, decreased cell viability and impairment of adrenal steroidogenesis. These promising findings pave the way for further experiments inhibiting the Wnt/beta-catenin pathway in pre-clinical models of ACC. The inhibition of this pathway may become a promising adjuvant therapy for patients with ACC. PMID:26515592

  3. Binding sites of atrial natriuretic peptide in tree shrew adrenal gland

    SciTech Connect

    Fuchs, E.; Shigematsu, K.; Saavedra, J.M.


    Adrenal gland binding sites for atrial natriuretic peptide-(99-126) (ANP) were quantitated in tree shrew (Tupaia belangeri) by incubation of adrenal sections with (3-(/sup 125/I)-iodotyrosyl28) atrial natriuretic peptide-(99-126), followed by autoradiography with computerized microdensitometry. In the adrenal glands, there are three types of ANP binding sites. One is located in the zona glomerulosa (BMax 84 +/- 6 fmol/mg protein; Kd 122 +/- 9 pM); the second in the zona fasciculata and reticularis (BMax 29 +/- 2 fmol/mg protein; Kd 153 +/- 6 pM) and the third in the adrenal medulla (BMax 179 +/- 1 fmol/mg protein; Kd 70 +/- 2 pM). Besides the influence of ANP on the regulation of adrenocortical mineralcorticoid and glucocorticoid secretion our findings raise the possibility for a local site of action of atrial natriuretic peptide in the regulation of adrenomedullary catecholamines in the tree shrew, primates and man.

  4. Control and localization of rat adrenal cyclic guanosine 3', 5'-monophosphate. Comparison with adrenal cyclic adenosine 3', 5'-monophosphate.

    PubMed Central

    Whitley, T H; Stowe, N W; Ong, S H; ey, R L; Steiner, A L


    Cyclic AMP and cyclic GMP were measured in rat adrenal glands after either hypophysectomy alone or after hypophysectomy and treatment with ACTH. Adrenal cyclic GMP levels rise in acutely hypophysectomized rats to a maximum at 1 h of approximately 200% of control levels; there is a return to base line at 4-12 h after hypophysectomy. In contrast, adrenal cyclic AMP falls immediately to about 50% of control levels after hypophysectomy and remains at approximately 1 pmol per mg tissue. Doses of ACTH beyond the physiological range markedly suppress adrenal cyclic GMP while producing a 50-fold or greater rise in cyclic AMP in hypophysectomized rats. This pattern of adrenal cyclic GMP rise was unchanged in acutely hypophysectomized animals treated with desamethasone. N-6-2'-0 dibutyryl cyclic AMP acted similarly to the effect of ACTH in bringing about a suppression of adrenal cyclic GMP levels. Physiological i.v. pulse doses of ACTH produced a rapid dose related increase in adrenal cyclic GMP. In vitro incubation of quartered adrenal pairs with 500 mU ACTH produced elevated cyclic AMP levels and suppression of cyclic GMP. Whereas adrenal cyclic AMP fell rapidly to 50% of control levels after hypophysectomy and remained at about 1 pmol per mg tissue for 7 days, adrenal cyclic GMP showed a biphasic rhythm in long-term hypophysectomized animals. After an initial peak at 1 h after hypophysectomy, adrenal cyclic GMP declined to baseline at 4-12 h but thereafter progressively rose with time, eventually reaching levels over 1 pmol per mg tissue. Fluorescent immunocytochemical staining of rat adrenal zona fasciculata showed cyclic AMP largely confined to cytoplasmic elements with little fluorescence contained in nuclei. In constant, cyclic GMP was found discretely positioned in nuclei with prominent fluorescence in nucleoli in addition to cytoplasmic localization. It is concluded that in hypophysectomized rats ACTH, either directly or in conjunction with altertion of adrenal

  5. Corticomedullary tumors of the adrenal glands. Report of two cases. Association of corticomedullary tumor with spindle cell sarcoma.


    Michal, M; Havlicek, F


    We describe two cases of corticomedullary tumors of the adrenal gland. The patients suffered from Cushings syndrome and paroxysmal hypertension. The corticomedullary tumors consisted of benign looking cortical adenoma cells growing on the background of the pheochromocytoma cells. We further present the ultrastructural and immunohistochemical features of these tumors. Focally a spindle cell sarcoma arising from the corticomedullary tumor was found in one case. The spindle cell sarcoma was immunohistochemically negative with antibodies to chromogranin, synaptophysin, cytokeratin and S-100 protein. Ultrastructurally the sarcoma was composed of undifferentiated primitive cells poorly endowed with cytoplasmic organelles. Focal transitions of the pheochromocytoma into the spindle cell sarcoma were seen. It is hypothesized that the spindle cell sarcoma was arising from the pheochromocytoma component of the corticomedullary tumor.

  6. Leiomyosarcoma of the adrenal vein.


    Shao, I-Hung; Lee, Wei-Chen; Chen, Tai-Di; Chiang, Yang-Jen


    Leiomyosarcoma of the adrenal gland is extremely rare in the literature. We present a patient with an adrenal leiomyosarcoma originating from the adrenal vein, the pathologic findings and management. A 66-year-old man who was a hepatitis B virus carrier was found to have a huge left suprarenal mass on sonography and computed axial tomography. A huge tumor in the left suprarenal area with a markedly engorged adrenal vein was found during an adrenalectomy. The tumor thrombus extended into the renal vein, close to the inferior vena cava. The left adrenal gland with the whole tumor thrombus was removed completely. Microscopically, the adrenal gland was compressed but not invaded by the spindle cell tumor, which was composed of interlacing fascicles of neoplastic smooth muscle cells. The tumor was localized within the adrenal vein and arose from the venous wall. The patient had no local recurrence for 18 months after en bloc excision of the tumor. We suggest that en bloc excision with a clear and adequate surgical margin is the most important cure procedure for adrenal leiomyosarcoma.

  7. Enhanced BDNF signalling following chronic hypoxia potentiates catecholamine release from cultured rat adrenal chromaffin cells

    PubMed Central

    Scott, Angela L; Zhang, Min; Nurse, Colin A


    Environmental stressors, including chronic hypoxia, enhance the ability of adrenomedullary chromaffin cells (AMCs) to secrete catecholamines; however, the underlying molecular mechanisms remain unclear. Here, we investigated the role of brain-derived neurotrophic factor (BDNF) signalling in rat AMCs exposed to chronic hypoxia. In rat adrenal glands, BDNF and its tropomyosin-related kinase B (TrkB) receptor are highly expressed in the cortex and medulla, respectively. Exposure of AMCs to chronic hypoxia (2% O2; 48 h) in vitro caused a significant increase to TrkB mRNA expression. A similar increase was observed in an immortalized chromaffin cell line (MAH cells); however, it was absent in MAH cells deficient in the transcription factor HIF-2α. A specific TrkB agonist, 7,8-dihydroxyflavone (7,8-DHF), stimulated quantal catecholamine secretion from chronically hypoxic (CHox; 2% O2) AMCs to a greater extent than normoxic (Nox; 21% O2) controls. Activation of TrkB by BDNF or 7,8-DHF increased intracellular Ca2+ ([Ca2+]i), an effect that was significantly larger in CHox cells. The 7,8-DHF-induced [Ca2+]i rise was sensitive to the tyrosine kinase inhibitor K252a and nickel (2 mm), but not the Ca2+ store-depleting agent cyclopiazonic acid. Blockade of T-type calcium channels with TTA-P2 (1 μm) or voltage-gated Na+ channels with TTX inhibited BDNF-induced [Ca2+]i increases. BDNF also induced a dose-dependent enhancement of action potential firing in CHox cells. These data demonstrate that during chronic hypoxia, enhancement of BDNF-TrkB signalling increases voltage-dependent Ca2+ influx and catecholamine secretion in chromaffin cells, and that T-type Ca2+ channels play a key role in the signalling pathway. Key points We investigated the role of the neurotrophin BDNF signalling via the TrkB receptor in rat adrenomedullary chromaffin cells (AMCs) exposed to normoxia (Nox; 21% O2) and chronic hypoxia (CHox; 2% O2) in vitro for ∼48 h. TrkB receptor expression was

  8. Zinc deficiency affects the composition of the rat adrenal gland

    SciTech Connect

    Rothman, R.J.; Leure-DuPree, A.E.; Fosmire, G.J.


    The response of the adrenal gland to zinc deficiency was examined in male weanling rats. In comparison with decapsulated adrenals from ad libitum fed controls, glands from zinc deficient rats had greater relative weight (mg/g body wt), DNA concentration, and total lipid and cholesterol concentrations as well as a smaller protein/DNA ratio. Several of these differences (protein/DNA and cholesterol concentration) could be attributed to the inanition accompanying zinc deficient values were similar to those of pair fed controls. Values for total DNA and protein concentration were similar for all groups. Electron micrographs of the zona fasciculata showed a small number of lipid droplets in the adrenals from ad libitum fed controls, an increase in lipid droplets from pair fed controls, and an even more striking increase in lipid droplets from the zinc deficient adrenals. The increased adrenal lipid composition in the zinc deficient group may be secondary to enhanced steroidogenesis or a zinc deficiency-induced defect of lipid metabolism.

  9. Ageing changes the cellular basis of the "fight-or-flight" response in human adrenal chromaffin cells.


    Elhamdani, Abdeladim; Palfrey, Clive H; Artalejo, Cristina R


    Stress-induced increases in plasma epinephrine in man have been reported to decrease with age. To investigate the possible cellular basis for this decline we determined the characteristics of calcium currents and their relationship to catecholamine secretion in isolated human adrenal chromaffin (AC) cells. Cells derived from young individuals displayed prominent prepulse facilitation of L-type Ca channels but this property was absent in cells from older subjects. Robust quantal secretion in young cells as determined by amperometry was strongly coupled to the activation of these channels with an average delay of only approximately 3 msec. N- and P-type Ca channels also contributed to secretion but were more weakly coupled to catecholamine release sites. Cells from older subjects secreted much less efficiently and showed only weak coupling between Ca channels and secretion. These studies suggest that the magnitude and timing of adrenal secretion changes with age and that the facilitation Ca channel is key to rapid activation of the fight-or-flight response in young individuals.

  10. Photosensitizer-induced fluorescence of the rat adrenal gland and rat pheochromocytoma cells (PC 12) by meso-tetra(hydroxyphenyl)chlorin (mTHPC)

    NASA Astrophysics Data System (ADS)

    Colombo-Benkmann, Mario; Muhm, Markus; Gahlen, Johannes; Heym, Christine; Senninger, Norbert


    Rat adrenal glands exhibit an intense mTHPC-induced fluorescence. The objective of our study was the identification of adrenal cells exhibiting mTHPC-induced fluorescence under normal conditions and under stimulation of adrenal proliferation by reserpine. Furthermore mTHPC-uptake of rat pheochromocytoma (PC 12) cells was investigated. Four male Wistar rats received 0.5 mg mTHPC/kg iv 48 hours before perfusion. Furthermore four rats received reserpine (2 mg/kg im od), bromo-deoxy-uridine (BrdU; 50 mg/kg ip od) each for one week and mTHPC (0.5 mg/kg) 48 hours before perfusion. BrdU was detected immunohistochemically. PC 12-cells were incubated with 0.5 mg mTHPC/l culture medium for 24 or 48 hours. Cells and tissues were examined by fluorescence microscopy. The adrenal cortex exhibited an intense mTHPC-induced fluorescence. The adrenal medulla fluoresced faintly. Reserpine increased fluorescence of intramedullary cells, not coinciding with adrenal proliferation. Cortical fluorescence remained unchanged. PC 12-cells lying singly or in small groups and differentiating cells showed a more intense mTHPC- induced fluorescence than confluent cells. Differences of cortical and medullary uptake of mTHPC are independent of proliferation and may be explained by lipophilia of mTHPC, since adrenocytes have an uptake mechanism for cholesterol. The difference of mTHPC-uptake between PC 12-cells and chromaffin cells implicate the possibility of photodynamic applications for medullary neoplasia.

  11. Zonal corticosteroid hormone biosynthesis in the adrenal cortex in rats exposed to emotional stress combined with salt loading

    SciTech Connect

    Shul'ga, V.A.


    The authors study the pattern of biosynthesis of corticosteroid hormones in the zona glomerulosa and the combined zona fasciculata + zona reticularis of the adrenals, which are responsible for the mineralocorticoid and glucocorticoid function of the glands, during simultaneous exposure of animals to salt loading and emotional stress. Experiments were carried out on rats. The adrenals were divided into parts and samples were incubated in vitro with the addition of /sup 3/H-progesterone to each sample. The specific activity of the /sup 3/H-labeled corticosteroids decreased significantly in rats with a normal salt intake exposed to emotional stress.

  12. [Adrenal mass and adrenal insufficiency].


    Martínez Albaladejo, M; García López, B; Serrano Corredor, S; Alguacil García, G


    Primary adrenal insufficiency is a non frequent disease, that is declared in young adults and in the most of the cases is produced from an autoimmune mechanism or a tuberculous disease. The incidence of these forms in the different geographic areas is dependent of degree of irradication of the tuberculosis. We report the case of a patient with latent chronic adrenal insufficiency of tuberculous origin who was affected for an addisonian crisis during an intercurrent infectious disease, which permitted the diagnosis of the addisonian crisis, and Mal of Pott was moreover detected. Evolution with corticosteroid and specific treatment was very favorable.

  13. Correlative light and electron microscopy of the frog adrenal gland cells using adjacent epon-embedded sections.


    Nakai, Y; Iwashita, T


    Correlative light and electron microscopy on the same cells of the adrenal gland of the frog, Rana nigromaculata, fixed in glutaraldehyde followed by osmium tetroxide, was done using the adjacent Epon embedded sections. Electron microscope observation revealed three different types of granule-filled secretory cells; the noradrenaline-storing cells (NA cells) filled with intensely dense and varying shaped granules, the adrenaline-strong cells (A cells) filled with relatively less dense granules and the summer cells (STILLING, 1898) containing very large, round or polygonal granules (0.2-1.3 mu in diameter). Light microscopically, an essential difference could be observed in the affinity to ammoniacal silver solution between NA and A cells. It was clarified that the granules of NA cells stained in black and were clearly distinguishable from the yellow- or brown-stained granules in both A cells and summer cells. This silver method can be applied for the light microscopic identification of the NA cells in the Epon-embedded sections. Furthermore, after immersing the thick sections in toluidine blue or methylene blue, the granules of NA cells showed much stronger affinity to both dyes than those of A cells and became dark blue and occasionally stained greenish blue in methylene blue, while the summer cells became blue and the granules of the A cells stained light blue.

  14. Maternal dietary restriction during the periconceptional period in normal-weight or obese ewes results in adrenocortical hypertrophy, an up-regulation of the JAK/STAT and down-regulation of the IGF1R signaling pathways in the adrenal of the postnatal lamb.


    Zhang, Song; Morrison, Janna L; Gill, Amreet; Rattanatray, Leewen; MacLaughlin, Severence M; Kleemann, David; Walker, Simon K; McMillen, I Caroline


    Maternal dietary restriction during the periconceptional period results in an increase in adrenal growth and in the cortisol stress response in the offspring. The intraadrenal mechanisms that result in the programming of these changes are not clear. Activation of the IGF and the signal transducer and activator of transcription (STAT)/suppressors of cytokine signaling (SOCS) pathways regulate adrenal growth. We have used an embryo transfer model in sheep to investigate the impact of exposure to either dietary restriction in normal or obese mothers or to maternal obesity during the periconceptional period on adrenal growth and function in the offspring. We assessed the adrenal abundance of key signaling molecules in the IGF-I and Janus kinase/STAT/SOCS pathways including IGF-I receptor, IGF-II receptor, Akt, mammalian target of rapamycin, ribosomal protein S6, eukaryotic translation initiation factor 4E-binding protein 1, eukaryotic translation initiation factor 4E, STAT1, STAT3, STAT5, SOCS1, and SOCS3 in female and male postnatal lambs. Maternal dietary restriction in the periconceptional period resulted in the hypertrophy of the adrenocortical cells in the zona fasciculata-reticularis and an up-regulation in STAT1, phospho-STAT1, and phospho-STAT3 (Ser727) abundance and a down-regulation in IGF-I receptor, Akt, and phospho-Akt abundance in the adrenal cortex of the postnatal lamb. These studies highlight that weight loss around the time of conception, independent of the starting maternal body weight, results in the activation of the adrenal Janus kinase/STAT pathway and adrenocortical hypertrophy. Thus, signals of adversity around the time of conception have a long-term impact on the mechanisms that regulate adrenocortical growth.

  15. Maternal Dietary Restriction During the Periconceptional Period in Normal-Weight or Obese Ewes Results in Adrenocortical Hypertrophy, an Up-Regulation of the JAK/STAT and Down-Regulation of the IGF1R Signaling Pathways in the Adrenal of the Postnatal Lamb

    PubMed Central

    Zhang, Song; Morrison, Janna L.; Gill, Amreet; Rattanatray, Leewen; MacLaughlin, Severence M.; Kleemann, David; Walker, Simon K.


    Maternal dietary restriction during the periconceptional period results in an increase in adrenal growth and in the cortisol stress response in the offspring. The intraadrenal mechanisms that result in the programming of these changes are not clear. Activation of the IGF and the signal transducer and activator of transcription (STAT)/suppressors of cytokine signaling (SOCS) pathways regulate adrenal growth. We have used an embryo transfer model in sheep to investigate the impact of exposure to either dietary restriction in normal or obese mothers or to maternal obesity during the periconceptional period on adrenal growth and function in the offspring. We assessed the adrenal abundance of key signaling molecules in the IGF-I and Janus kinase/STAT/SOCS pathways including IGF-I receptor, IGF-II receptor, Akt, mammalian target of rapamycin, ribosomal protein S6, eukaryotic translation initiation factor 4E-binding protein 1, eukaryotic translation initiation factor 4E, STAT1, STAT3, STAT5, SOCS1, and SOCS3 in female and male postnatal lambs. Maternal dietary restriction in the periconceptional period resulted in the hypertrophy of the adrenocortical cells in the zona fasciculata-reticularis and an up-regulation in STAT1, phospho-STAT1, and phospho-STAT3 (Ser727) abundance and a down-regulation in IGF-I receptor, Akt, and phospho-Akt abundance in the adrenal cortex of the postnatal lamb. These studies highlight that weight loss around the time of conception, independent of the starting maternal body weight, results in the activation of the adrenal Janus kinase/STAT pathway and adrenocortical hypertrophy. Thus, signals of adversity around the time of conception have a long-term impact on the mechanisms that regulate adrenocortical growth. PMID:24108072

  16. Insulin-like growth factor I enhances proenkephalin synthesis and dopamine. beta. -hydroxylase activity in adrenal chromaffin cells

    SciTech Connect

    Wilson, S.P. )


    Insulin-like growth factor I (IGF-I) increased both the contents of proenkephalin derived enkephalin-containing peptides and the activity of dopamine {beta}-hydroxylase in bovine adrenal chromaffin cells. These increases in dopamine {beta}-hydroxylase and enkephalin-containing peptides continued for at least 8 days. The half-maximal IGF-I concentration for these effects was {approximately} 1 nM, with maximal effects observed at 10-30 nM. In contrast, insulin was 1,000-fold less potent. Pretreatment of chromaffin cells with IGF-I increased the rate of ({sup 35}S)proenkephalin synthesis 4-fold compared to untreated cells. Total protein synthesis increased only 1.5-fold under these conditions. These results suggest that IGF-I may be a normal regulator of chromaffin cell function.

  17. Direct visualization of secretion from single bovine adrenal chromaffin cells by laser-induced native fluorescence imaging microscopy

    SciTech Connect

    Tong, W.; Yeung, E.S.


    Direct visualization of the secretion process of individual bovine adrenal chromaffin cells was achieved with laser-induced native fluorescence imaging microscopy. By monitoring the native fluorescence of catecholamines excited by the 275 nm laser line with an intensified charge-coupled-device (CCD) camera, we obtained good temporal and spatial resolution simultaneously without using additional fluorescent probes. Large variations were found among individual cells in terms of the amounts of catecholamines secreted and the rates of secretion. Different regions of a cell also behave differently during the secretion process. However, the degree of this local heterogeneity is smaller than in neurons and neuralgia. The influence of deep-ultraviolet (UV) laser excitation on cells is also discussed. This quantitative imaging technique provides a useful noninvasive approach for the study of dynamic cellular changes and the understanding of the molecular mechanisms of secretory processes. {copyright} {ital 1998} {ital Society for Applied Spectroscopy}

  18. Toxicity of cadmium, endosulfan, and atrazine in adrenal steroidogenic cells of two amphibian species, Xenopus laevis and Rana catesbeiana.


    Goulet, Benoît N; Hontela, Alice


    The effects of cadmium, endosulfan, and atrazine on corticosterone secretion and viability of adrenal cells of African clawed frog (Xenopus laevis) and bullfrog (Rana catesbeiana) were assessed in vitro using a new bioassay. The bioassay relies on stimulation with adrenocorticotropic hormone (ACTH), the endogenous secretagogue for corticosterone secretion, and with dibutyryl cyclic adenosine monophosphate (dbcAMP), an analogue of cAMP, to pinpoint the site of action of the xenobiotics within the steroidogenic cell. To compare the test toxicants according to their endocrine-disrupting potential, the lethal concentration needed to kill 50% of the cells:effective concentration of 50% (LC50:EC50) ratio was calculated, with LC50 as the concentration that kills 50% of the steroidogenic cells and the EC50 as the concentration that impairs corticosterone secretion by 50%. The higher the ratio, the higher the potential for endocrine disruption. Atrazine had no affect on cell viability and on corticosterone secretion in X. laevis, but its endocrine-disrupting potential was high in R. catesbeiana. The LC50:EC50 ratio for cadmium and endosulfan in X. laevis was 26.07 and 1.23, respectively, and for atrazine, cadmium, and endosulfan in R. catesbeiana it was 909, 41, and 3, respectively. The dbcAMP did not restore corticosterone secretion in the cells exposed to the test toxicants in both species. Our study suggests that the secretory capacity of adrenal cells of amphibians can be impaired by environmental chemicals, especially atrazine in the bullfrog, and that these adrenotoxicants disrupt the enzymatic pathways leading to corticosterone secretion downstream from the step-generating cAMP.

  19. Angiotensin II receptor and postreceptor events in adrenal glomerulosa cells from streptozotocin-induced diabetic rats with hypoaldosteronism.


    Azukizawa, S; Kaneko, M; Nakano, S; Kigoshi, T; Uchida, K; Morimoto, S


    Streptozotocin-induced chronic diabetic rats develop hyporeninemic hypoaldosteronism. The hypoaldosteronism is associated with selective unresponsiveness of aldosterone to angiotensin II (AII) and an atrophy of the zona glomerulosa. To assess the nature of the adrenal unresponsiveness to AII, we examined the [125I]monoiodoAII binding and the responses of pregnenolone formation and aldosterone production to AII using adrenal glomerulosa cells from diabetic rats 6 weeks after an injection of streptozotocin. Comparisons were made using the cells from control rats treated with vehicle. Diabetic rats had low levels of plasma renin activity, plasma 18-hydroxycorticosterone, and plasma aldosterone, and normal levels of plasma corticosterone and plasma potassium. The zona glomerulosa width was narrower in diabetic than in control rats. Scatchard analysis of the AII binding data demonstrated that the number and affinity of the receptors were similar in the cells from control and diabetic rats. When corrected to an uniform number of cells per group, baseline levels of pregnenolone formation and aldosterone production were similar in the cells from control and diabetic rats. However, cells from diabetic rats had a less sensitive and lower response of both pregnenolone formation and aldosterone production to AII. In contrast, the effect of ACTH on pregnenolone formation and aldosterone production was similar in the cells from control and diabetic rats. These results indicate that the main defect responsible for the hypoaldosteronism may be located on some step(s) mediating between AII receptors and conversion of cholesterol to pregnenolone, presumably on the calcium messenger system, with a disturbance downstream from AII binding.

  20. Dual effects of nobiletin, a citrus polymethoxy flavone, on catecholamine secretion in cultured bovine adrenal medullary cells.


    Zhang, Han; Toyohira, Yumiko; Ueno, Susumu; Shinohara, Yuko; Itoh, Hideaki; Furuno, Yumi; Yamakuni, Tohru; Tsutsui, Masato; Takahashi, Kojiro; Yanagihara, Nobuyuki


    Nobiletin, a compound of polymethoxy flavones found in citrus fruits, possesses a wide range of pharmacological activities. Here we report the effects of nobiletin on catecholamine secretion in cultured bovine adrenal medullary cells. Nobiletin (1.0-100 microM) concentration-dependently stimulated catecholamine secretion and (45)Ca(2+) influx. Its stimulatory effect of nobiletin on catecholamine secretion was abolished by deprivation of extracellular Ca(2+) and partially inhibited by specific inhibitors of voltage-dependent Ca(2+) channels and Na(+)/Ca(2+) exchangers. On the other hand, nobiletin suppressed catecholamine secretion and (22)Na(+) and (45)Ca(2+) influx induced by acetylcholine, an agonist of nicotinic acetylcholine receptors, in a concentration-dependent manner. It also inhibited catecholamine secretion, (22)Na(+) influx and/or (45)Ca(2+) influx induced by veratridine, an activator of voltage-dependent Na(+) channels, and 56 mM K(+), an activator of voltage-dependent Ca(2+) channels. In Xenopus oocytes expressing alpha3beta4 neuronal acetylcholine receptors, nobiletin directly inhibited the current evoked by acetylcholine in a concentration-dependent manner similar to that observed in catecholamine secretion. The present findings suggest that nobiletin, by itself, stimulates catecholamine secretion via activation of voltage-dependent Ca(2+) channels or Na(+)/Ca(2+) exchangers, whereas it inhibits catecholamine secretion induced by acetylcholine through the suppression of Na(+) influx and Ca(2+) influx in cultured bovine adrenal medullary cells.

  1. Halothane inhibits the cholinergic-receptor-mediated influx of calcium in primary culture of bovine adrenal medulla cells

    SciTech Connect

    Yashima, N.; Wada, A.; Izumi, F.


    Adrenal medulla cells are cholinoceptive cells. Stimulation of the acetylcholine receptor causes the influx of Ca to the cells, and Ca acts as the coupler of the stimulus-secretion coupling. In this study, the authors investigated the effects of halothane on the receptor-mediated influx of /sup 45/Ca using cultured bovine adrenal medulla cells. Halothane at clinical concentrations (0.5-2%) inhibited the influx of /sup 45/Ca caused by carbachol, with simultaneous inhibition of catecholamine secretion. The influx of /sup 45/Ca and the secretion of catecholamines caused by K depolarization were inhibited by a large concentration of Mg, which competes with Ca at Ca channels, but not inhibited by halothane. Inhibition of the /sup 45/Ca influx by halothane was not overcome by increase in the carbachol concentration. Inhibition of the /sup 45/Ca influx by halothane was examined in comparison with that caused by a large concentration of Mg by the application of Scatchard analysis as the function of the external Ca concentration. Halothane decreased the maximal influx of /sup 45/Ca without altering the apparent kinetic constant of Ca to Ca channels. On the contrary, a large concentration of Mg increased the apparent kinetic constant without altering the maximal influx of /sup 45/Ca. Based on these findings, the authors suggest that inhibition of the /sup 45/Ca influx by halothane was not due to the direct competitive inhibition of Ca channels, nor to the competitive antagonism of agonist-receptor interaction. As a possibility, halothane seems to inhibit the receptor-mediated activation of Ca channels through the interference of coupling between the receptor and Ca channels.

  2. [Immunoendocrine associations in adrenal glands].


    Sterzl, I; Hrdá, P


    Immune and endocrine systems are basic regulatory mechanisms of organism and, including the nervous system, maintain the organism's homeostasis. The main immune system representatives are mononuclear cells, T- and B-cells and their products, in the endocrine system the main representatives are cells of the glands with inner secretion and their products. One of the most important glands for maintaining homeostasis are adrenal glands. It has been proven that either cells of the immune system, either endocrine cells can, although in trace amounts, produce mutually mediators of both systems (hormones, cytokines). Disorders in one system can lead to pathological symptoms in the other system. Also here represent adrenals an important model.

  3. Cortisol-dependent stress effects on cell distribution in healthy individuals and individuals suffering from chronic adrenal insufficiency.


    Geiger, Ashley M; Pitts, Kenneth P; Feldkamp, Joachim; Kirschbaum, Clemens; Wolf, Jutta M


    Chronic adrenal insufficiency (CAI) is characterized by a lack of glucocorticoid and mineralocorticoid production due to destroyed adrenal cortex cells. However, elevated cortisol secretion is thought to be a central part in a well-orchestrated immune response to stress. This raises the question to what extent lack of cortisol in CAI affects stress-related changes in immune processes. To address this question, 28 CAI patients (20 females) and 18 healthy individuals (11 females) (age: 44.3 ± 8.4 years) were exposed to a psychosocial stress test (Trier Social Stress Test: TSST). Half the patients received a 0.03 mg/kg body weight injection of hydrocortisone (HC) post-TSST to mimic a healthy cortisol stress response. Catecholamines and immune cell composition were assessed in peripheral blood and free cortisol measured in saliva collected before and repeatedly after TSST. CAI patients showed norepinephrine (NE) stress responses similar to healthy participants, however, epinephrine (E) as well as cortisol levels were significantly lower. HC treatment post-TSST resulted in cortisol increases comparable to those observed in healthy participants (interaction effects--NE: F=1.05, p=.41; E: F=2.56, p=.045; cortisol: F=13.28, p<.001). Healthy individuals showed the expected pattern of stress-related early lymphocyte increase with subsequent decrease below baseline. The opposite pattern was observed in granulocytes. While exhibiting a similar initial increase, lymphocytes kept increasing over the following 2h in untreated patients. HC treatment buffered this effect (interaction effects--lymphocyte%: F=7.31, p<.001; granulocyte%: F=7.71, p<.001). Using CAI in humans as a model confirms cortisol's central involvement in post-stress lymphocyte migration from blood into immune-relevant body compartments. As such, future studies should investigate whether psychosocial stress exposure may put CAI patients at an increased health risk due to attenuated immune responses to pathogens.

  4. USP10 Expression in Normal Adrenal Gland and Various Adrenal Tumors.


    Zeng, Zhi; Zhou, Ziying; Zhan, Na; Yuan, Jingping; Ye, Baixin; Gu, Lijuan; Wang, Jun; Jian, Zhihong; Xiong, Xiaoxing


    Ubiquitin-specific protease 10 (USP10), a novel deubiquitinating enzyme, is associated with androgen receptor transcriptional activity and pathological processes of tumor. However, information between USP10 and the adrenal gland is limited. In particular, the role of USP10 in adrenal tumors has not been elucidated yet. This study aims to investigate the expression of USP10 in the human normal adrenal gland and various adrenal tumors. Tissue samples were obtained from 30 adrenocortical adenomas, nine adrenocortical adenocarcinomas, and 20 pheochromocytomas following laparoscopic surgery. Twenty normal adrenal glands were obtained from kidney surgical resection conducted due to renal cell carcinomas. USP10 expression was investigated on protein levels using immunohistochemistry and on mRNA levels using bioinformatics analysis in the Gene Expression Omnibus (GEO) Datasets. In the 20 cases of normal adrenal glands analyzed, USP10 protein was constantly expressed in situ in the cortex of the adrenal glands, but in the medulla of the gland, only the sustentacular cells were detected positive. In adrenal tumors, detectable levels of USP10 protein were found in 100 % (30/30) adrenocortical adenomas, 88.89 % (8/9) adrenocortical carcinomas, and 10 % (2/20) pheochromocytomas. Bioinformatics analysis did not show a significant difference in USP10 messenger RNA (mRNA) expression between adrenal tumors and normal adrenal gland tissues. A positive USP10 immunoreaction can be useful in distinguishing adrenal cortical tumors from pheochromocytoma.

  5. Increased Catecholamine Secretion from Single Adrenal Chromaffin Cells in DOCA-Salt Hypertension Is Associated with Potassium Channel Dysfunction

    PubMed Central


    The mechanism of catecholamine release from single adrenal chromaffin cells isolated from normotensive and DOCA-salt hypertensive rats was investigated. These cells were used as a model for sympathetic nerves to better understand how exocytotic release of catecholamines is altered in this model of hypertension. Catecholamine secretion was evoked by local application of acetylcholine (1 mM) or high K+ (70 mM), and continuous amperometry was used to monitor catecholamine secretion as an oxidative current. The total number of catecholamine molecules secreted from a vesicle, the total number of vesicles fusing and secreting, and the duration of secretion in response to a stimulus were all significantly greater for chromaffin cells from hypertensive rats as compared to normotensive controls. The greater catecholamine secretion from DOCA-salt cells results, at least in part, from functionally impaired large conductance, Ca2+-activated (BK) and ATP-sensitive K+ channels. This work reveals that there is altered vesicular release of catecholamines from these cells (and possibly from perivascular sympathetic nerves) and this may contribute to increased vasomotor tone in DOCA-salt hypertension. PMID:23937098

  6. Conservation of structure and function of DNA replication protein A in the trypanosomatid Crithidia fasciculata.

    PubMed Central

    Brown, G W; Melendy, T E; Ray, D S


    Human replication protein A (RP-A) is a three-subunit protein that is required for simian virus 40 (SV40) replication in vitro. The trypanosome homologue of RP-A has been purified from Crithidia fasciculata. It is a 1:1:1 complex of three polypeptides of 51, 28, and 14 kDa, binds single-stranded DNA via the large subunit, and is localized within the nucleus. C. fasciculata RP-A substitutes for human RP-A in the large tumor antigen-dependent unwinding of the SV40 origin of replication and stimulates both DNA synthesis and DNA priming by human DNA polymerase alpha/primase, but it does not support efficient SV40 DNA replication in vitro. This extraordinary conservation of structure and function between human and trypanosome RP-A suggests that the mechanism of DNA replication, at both the initiation and the elongation level, is conserved in organisms that diverged from the main eukaryotic lineage very early in evolution. Images PMID:1332038

  7. Laparoscopic Resection of Adrenal Teratoma

    PubMed Central

    Vitagliano, Gonzalo; Villeta, Matias; Arellano, Leonardo; Santis, Oscar


    Background: Teratoma is a germ-cell tumor that commonly affects the gonads. Its components originate in the ectoderm, endoderm, and mesoderm. Extragonadal occurrence is rare. Teratomas confined to the adrenal gland are exceptional; only 3 cases have been reported in the English-language literature. We report 2 cases of mature teratomas of the adrenal gland that were laparoscopically excised. Methods: Two patients (ages 8 and 61 years) were diagnosed with adrenal teratoma at our institution. Radiological examination showed a solid 8-cm adrenal lesion in both cases. Hormonal assessment was normal. Both patients underwent laparoscopic transperitoneal adrenalectomy. Results: Surgical time was 120 minutes and 50 minutes, respectively. One patient was discharged on postoperative day 2, and the other remained hospitalized until day 10. The latter patient required percutaneous drainage of a retroperitoneal collection. Both tumors were identified as mature cystic teratomas. No evidence was present of recurring disease in either patient. Conclusions: Adrenal teratoma is rare. Laparoscopic transperitoneal adrenalectomy is a feasible, effective technique that enables excellent oncologic results. To our knowledge, this is the first report of laparoscopic adrenalectomy for pure adrenal teratoma. PMID:17575773

  8. Purification and properties of poly(ADP-ribose)polymerase from Crithidia fasciculata. Automodification and poly(ADP-ribosyl)ation of DNA topoisomerase I.


    Podestá, Dolores; García-Herreros, María I; Cannata, Joaquín J B; Stoppani, Andrés O M; Fernández Villamil, Silvia H


    Poly(ADP-ribose)polymerase has been purified more than 160000-fold from Crithidia fasciculata. This is the first PARP isolated to apparent homogeneity from trypanosomatids. The purified enzyme absolutely required DNA for catalytic activity and histones enhanced it 2.5-fold, when the DNA:histone ratio was 1:1.3. The enzyme required no magnesium or any other metal ion cofactor. The apparent molecular mass of 111 kDa, determined by gel filtration would correspond to a dimer of two identical 55-kDa subunits. Activity was inhibited by nicotinamide, 3-aminobenzamide, theophylline, thymidine, xanthine and hypoxanthine but not by adenosine. The enzyme was localized to the cell nucleus. Our findings suggest that covalent poly(ADP-ribosyl)ation of PARP itself or DNA topoisomerase I resulted in the inhibition of their activities and provide an initial biochemical characterization of this covalent post-translational modification in trypanosomatids.

  9. Laparoscopic Resection of an Adrenal Schwannoma

    PubMed Central

    Konstantinos, Toutouzas G.; Panagiotis, Kekis B.; Nikolaos, Michalopoulos V.; Ioannis, Flessas; Andreas, Manouras; Geogrios, Zografos


    Background and Objectives: Schwannomas are tumors originating from Schwann cells of the peripheral nerve sheath (neurilemma) of the neuroectoderm. Rarely, schwannomas can arise from the retroperitoneum and adrenal medulla. We describe a case of a 71-y-old woman who presented with an incidentally discovered adrenal tumor. Methods: Ultrasound and computed tomography scans revealed a lesion with solid and cystic areas originating from the left adrenal gland. The patient underwent complete laparoscopic resection of the tumor and the left adrenal gland. Results: Histopathological examination and immunohistochemical staining of the excised specimen revealed a benign schwannoma measuring 5.5×5×3.7 cm. To our knowledge, few other cases of laparoscopic resection of adrenal schwannomas have been reported. Conclusion: Because preoperative diagnosis of adrenal tumors is inconclusive, complete laparoscopic excision allows for definitive diagnosis with histological evaluation and represents the treatment of choice. PMID:23484583

  10. Spontaneous and electrically-evoked catecholamine secretion from long-term cultures of bovine adrenal chromaffin cells.


    Noga, Brian R; Pinzon, Alberto


    Catecholamine release was measured from bovine adrenal medullary chromaffin cell (CC) cultures maintained over a period of three months. Cells were plated over simple biocompatible cell platforms with electrical stimulation capability and at specified times transferred to an acrylic superfusion chamber designed to allow controlled flow of superfusate over the culture. Catecholamine release was measured from the superfusates using fast cyclic voltammetry before, during and after electrical stimulation of the cells. Immunocytochemical staining of CC cultures revealed that they were composed of epinephrine (EP) and/or norepinephrine (NE) type cells. Both spontaneous and evoked-release of catecholamines from CCs were observed throughout the testing period. EP predominated during spontaneous release, whereas NE was more prevalent during electrically-evoked release. Electrical stimulation for 20 s, increased total catecholamine release by 60-130% (measured over a period of 500 s) compared to that observed for an equivalent 20 s period of spontaneous release. Stimulus intensity was correlated with the amount of evoked release, up to a plateau which was observed near the highest intensities. Shorter intervals between stimulation trials did not significantly affect the initial amount of release, and the amount of evoked release was relatively stable over time and did not decrease significantly with age of the culture. The present study demonstrates long-term survival of CC cultures in vitro and describes a technique useful for rapid assessment of cell functionality and release properties of cultured monoaminergic cell types that later can be transplanted for neurotransmitter replacement following injury or disease. PMID:23891791

  11. Dynamics of cocaine- and amphetamine-regulated transcript containing cell changes in the adrenal glands of two kidney, one clip rats.


    Kasacka, Irena; Piotrowska, Zaneta; Janiuk, Izabela; Zbucki, Robert


    Taking into consideration the homeostatic disorders resulting from renal hypertension and the essential role of cocaine- and amphetamine-regulated transcript (CART) in maintaining homeostasis by regulating many functions of the body, the question arises as to what extent the renovascular hypertension affects the morphology and dynamics of changes of CART-containing cells in the adrenal glands. The aim of the present study was to examine the distribution, morphology, and dynamics of changes of CART-containing cells in the adrenal glands of "two kidney, one clip" (2K1C) renovascular hypertension model in rats. The studies were carried out on the adrenal glands of rats after 3, 14, 28, 42, and 91 days from the renal artery clipping procedure. To identify neuroendocrine cells, immunohistochemical reaction was performed with the use of a specific antibody against CART. It was revealed that renovascular hypertension causes changes in the endocrine cells containing CART in the adrenal glands of rats. The changes observed in the endocrine cells depend on the time when the rats with experimentally induced hypertension were examined. In the first period of hypertension, the number and immunoreactivity of CART-containing cells were decreased, while from the 28-day test, it significantly increased, as compared to the control rats. CART is relevant to the regulation of homeostasis in the cardiovascular system and seems to be involved in renovascular hypertension. The results of the present work open the possibility of new therapeutic perspectives for the treatment of arterial hypertension, since CART function is involved in their pathophysiology.

  12. Imaging of adrenal and renal hemorrhage.


    Hammond, Nancy A; Lostumbo, Antonella; Adam, Sharon Z; Remer, Erick M; Nikolaidis, Paul; Yaghmai, Vahid; Berggruen, Senta M; Miller, Frank H


    Hemorrhage of the kidneys and adrenal glands has many etiologies. In the adrenal glands, trauma, anticoagulation, stress, sepsis, surgery, and neoplasms are common causes of hemorrhage. In the kidneys, reasons for hemorrhage include trauma, bleeding diathesis, vascular diseases, infection, infarction, hemorrhagic cyst rupture, the Antopol-Goldman lesion, and neoplasms. Angiomyolipoma and renal cell carcinoma are the neoplasms most commonly associated with hemorrhage in the kidneys and adrenal cortical carcinoma, metastases, and pheochromocytoma are associated with hemorrhage in the adrenal glands. Understanding the computed tomography and magnetic resonance imaging features, and causes of hemorrhage in the kidneys and adrenal glands is critical. It is also important to keep in mind that mimickers of hemorrhage exist, including lymphoma in both the kidneys and adrenal glands, and melanoma metastases in the adrenal glands. Appropriate imaging follow-up of renal and adrenal hemorrhage should occur to exclude an underlying malignancy as the cause. If there is suspicion for malignancy that cannot be definitively diagnosed on imaging, surgery or biopsy may be warranted. Angiography may be indicated when there is a suspected underlying vascular disease. Unnecessary intervention, such as nephrectomy, may be avoided in patients with benign causes or no underlying disease. Appropriate management is dependent on accurate diagnosis of the cause of renal or adrenal hemorrhage and it is incumbent upon the radiologist to determine the etiology.

  13. Adrenal Steroidogenesis and Congenital Adrenal Hyperplasia

    PubMed Central

    Turcu, Adina F.; Auchus, Richard J.


    Synopsis Adrenal steroidogenesis is a dynamic process, reliant on de novo synthesis from cholesterol, under the stimulation of ACTH and other regulators. The syntheses of mineralocorticoids, glucocorticoids and adrenal androgens occur in separate adrenal cortical zones, each expressing specific enzymes. Congenital adrenal hyperplasia (CAH) encompasses a group of autosomal recessive enzymatic defects in cortisol biosynthesis. 21-hydroxylase (21OHD) deficiency accounts for over 90% of CAH cases and when milder or nonclassic forms are included, 21OHD is one of the most common genetic diseases. This review discusses in detail the epidemiology, genetics, diagnostic, clinical aspects and management of 21OHD. PMID:26038201

  14. How Is Adrenal Surgery Performed?


    HOME ADRENAL GLANDS Background Where are the adrenal glands? What do the adrenal glands do? Is this adrenal tumor a genetic problem? Primary hyperaldosteronism (aldosterone-producing tumor) What is primary hyperaldosteronism? Signs ...

  15. Formation of inositol 1,3,4,6-tetrakisphosphate during angiotensin II action in bovine adrenal glomerulosa cells

    SciTech Connect

    Balla, T.; Guillemette, G.; Baukal, A.J.; Catt, K.J.


    Angiotensin II stimulates the formation of several inositol polyphosphates in cultured bovine adrenal glomerulosa cells prelabelled with (/sup 3/H) inositol. Analysis by high performance anion exchange chromatography of the inositol-phosphate compounds revealed the existence of two additional inositol tetrakisphosphate (InsP4) isomers in proximity to Ins-1,3,4,5-P4, the known phosphorylation product of Ins-1,4,5-trisphosphate and precursor of Ins-1,3,4-trisphosphate. Both of these new compounds showed a slow increase after stimulation with angiotensin II. The structure of one of these new InsP4 isomers, which is a phosphorylation product of Ins-1,3,4-P3, was deduced by its resistance to periodate oxidation to be Ins-1,3,4,6-P4. The existence of multiple cycles of phosphorylation-dephosphorylation reactions for the processing of Ins-1,4,5-P4 may represent a new aspect of the inositol-lipid related signalling mechanism in agonist-activated target cells.

  16. Quantitative alterations in the liver and adrenal gland in pregnant rats induced by Pyralene 3000

    SciTech Connect

    Vreci, M.; Sek, S.; Lorger, J.; Bavdek, S.; Pogacnik, A.


    Polychlorinated biphenyls (PCBs) are among the most widespread environmental pollutants known in the world. The half-life of PCBs is very long and, therefore, once released into the environment, they accumulate in food chains and tissues of various mammals, including man. Their presence can cause numerous toxic effects, e.g., hepatotoxicity, immunotoxicity, dermatotoxicity, neurotoxicity, and disorders of the reproductive system, among others. These effects depend on the distribution route in the organism, the rate of metabolism and excretion. Their characteristics are closely associated with the number and position of the chlorine atoms in the molecule. Previous studies of trichlorobiphenyl distributions in various tissues demonstrated that low chlorinated trichlorobiphenyls do no accumulate in endocrine organs, whereas higher chlorinated biphenyls, such as hexa- and octachlorobiphenyl, are deposited and retained in the adrenal gland. A selective distribution of radioabelled tetrachlorobiphenyl to the zona fasciculata, accompanied by morphometric evidence of the hypertrophy of the zona fasciculata, was also noted. The purpose of this study was to examine changes in the tissue structure of the pregnant rat liver and adrenal gland induced experimentally by Pyralene 3000 administration. We chose this commercial low chlorinated PCB because it was in use in Slovenia and, discharged from the electroindustrial plants, caused a serious incidence of environmental pollution in the region of Bela Krajina. Our further aim was to research the transplacental influences of Pyralene 3000 in rats. 17 refs., 1 fig., 3 tabs.

  17. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.


    MacKay, R M; Gray, M W; Doolittle, W F


    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  18. The structure of the kinetoplast DNA network of Crithidia fasciculata revealed by atomic force microscopy.


    Cavalcanti, Danielle Pereira; Gonçalves, Daniela Leão; Costa, Lilian Terezinha; de Souza, Wanderley


    DNA is the biopolymer most studied by scanning probe methods, and it is now possible to obtain reliable and reproducible images of DNA using atomic force microscopy (AFM). AFM has been extensively used to elucidate morphological changes to DNA structure, such as the formation of knots, nicks, supercoiling and bends. The mitochondrial or kinetoplast DNA (kDNA) of trypanosomatids is the most unusual DNA found in nature, being unique in organization and replication. The kDNA is composed of thousands of topologically interlocked DNA circles that form a giant network. To understand the biological significance of the kinetoplast DNA, it is necessary to learn more about its structure. In the present work, we used two procedures to prepare kDNA networks of Crithidia fasciculata for observation by AFM. Because AFM allows for the examination of kDNA at high resolution, we were able to identify regions of overlapping kDNA molecules and sites where several molecules cross. This found support the earlier described kDNA structural organization as composed by interlocked circles. We also observed an intricate high-density height pattern around the periphery of the network of C. fasciculata, which appears to be a bundle of DNA fibers that organizes the border of the network. Our present data confirm that AFM is a powerful tool to study the structural organization of biological samples, including complex arrays of DNA such as kDNA, and can be useful in revealing new details of structures previously visualized by other means. PMID:21377370

  19. Effects of collagenase on the release of [3H]-noradrenaline from bovine cultured adrenal chromaffin cells.

    PubMed Central

    Almazan, G.; Aunis, D.; García, A. G.; Montiel, C.; Nicolás, G. P.; Sánchez-García, P.


    Bovine isolated adrenal chromaffin cells maintained in culture at 37 degrees C for 1-7 days become polygonal and bipolar, with typical varicosity-like extensions. Catecholamine levels and dopamine beta-hydroxylase activity decreased after 24-48 h of culture, but recovered to normal levels 3-7 days later. Incubation of 1-7 day-old cells in the presence of increasing concentrations of [3H]-noradrenaline (3.91 to 125 nM) resulted in the retention by the cells of amounts of radioactivity directly proportional to the amine present in the media. One day-old cells took up and retained only one third of the radioactivity found in 2-7 day-old cells. The addition of collagenase to cultured cells caused a decrease in the uptake of tritium. However, the enzyme treatment did not affect the amine taken up by the cell before collagenase treatment. Release of tritium from cultured cells evoked by nicotine, acetylcholine (ACh) or 59 mM K+ was very poor in 24 h-old cells; the secretory response to nicotine, ACh or K+ was dramatically increased after 2-7 days of culture. Bethanecol did not cause any secretory response. When treated with collagenase, cultured cells which had recovered fully their secretory response, lost again the ability to release tritium evoked by ACh or nicotine. However, the responses to high K+, veratridine or ionophore X537A were not affected. The nicotinic response was recovered two days after collagenase treatment. The data suggest that the use of collagenase to disperse the adrenomedullary tissue during the isolation procedure might be responsible for the lost secretory response of young cultured chromaffin cells. Since collagenase specifically impairs the nicotinic cholinoceptor-mediated catecholamine release, it seems likely that the enzyme is exerting its action on the ACh receptor complex. It is unlikely that either voltage-sensitive Na+ or Ca2+ channels are affected by collagenase as the responses induced by high K+ or veratridine were unaffected by

  20. Laparoscopic Adrenal Gland Removal


    ... adrenal tumors that appear malignant. What are the Advantages of Laparoscopic Adrenal Gland Removal? In the past, ... of procedure and the patients overall condition. Common advantages are: Less postoperative pain Shorter hospital stay Quicker ...

  1. Adrenal Gland Disorders


    The adrenal glands are small glands located on top of each kidney. They produce hormones that you can't live ... stress and has many other important functions. With adrenal gland disorders, your glands make too much or not ...

  2. Adrenal Gland Cancer


    ... either benign or malignant. Benign tumors aren't cancer. Malignant ones are. Most adrenal gland tumors are ... and may not require treatment. Malignant adrenal gland cancers are uncommon. Types of tumors include Adrenocortical carcinoma - ...

  3. A possible role of insulin-like growth factor-II C-peptide in regulating the function of steroidogenic cells in adult frog adrenal glands.


    Castillo, Songül Süren


    The sole structural determinant for the differential ability of the insulin-like growth factors (IGF-I and IGF-II) to induce autophosphorylation of specific insulin receptor (IR) tyrosine residues and activate downstream signaling molecules is the C domain. The IR is structurally related to the type I insulin-like growth factor receptor (IGF-IR). This study aimed to identify the presence of IGF receptors by which the IGF-II C-peptide could mediate its effects in the frog (Rana ridibunda) adrenal glands and to observe whether injection of IGF-II C-peptide affects the function of adrenal steroidogenic cells using light and transmission electron microscopy and by the evaluation of the immunoreactivity of steroidogenic acute regulatory protein (StAR). After IGF-II C-peptide injection, there was a reduction of StAR protein immunoreactivity levels, an accumulation of large lipid droplets in close contact with each other, and an induction of proliferation of the steroidogenic cells. These results indicate a possible role of IGF-II C-peptide in steroidogenic cell function and in induction of steroidogenesis. The detection in this study of IGF-I receptor (IGF-IR) immunoreactivity in frog adrenal glands also indicates that the metabolic and mitogenic effects of IGF-II C-peptide in these glands may occur via the IGF-IR.

  4. Rooibos flavonoids inhibit the activity of key adrenal steroidogenic enzymes, modulating steroid hormone levels in H295R cells.


    Schloms, Lindie; Swart, Amanda C


    Major rooibos flavonoids--dihydrochalcones, aspalathin and nothofagin, flavones--orientin and vitexin, and a flavonol, rutin, were investigated to determine their influence on the activity of adrenal steroidogenic enzymes, 3β-hydroxysteroid dehydrogenase (3βHSD2) and cytochrome P450 (P450) enzymes, P450 17α-hydroxylase/17,20-lyase (CYP17A1), P450 21-hydroxylase (CYP21A2) and P450 11β-hydroxylase (CYP11B1). All the flavonoids inhibited 3βHSD2 and CYP17A1 significantly, while the inhibition of downstream enzymes, CYP21A2 and CYP11B1, was both substrate and flavonoid specific. The dihydrochalcones inhibited the activity of CYP21A2, but not that of CYP11B1. Although rutin, orientin and vitexin inhibited deoxycortisol conversion by CYP11B1 significantly, inhibition of deoxycorticosterone was <20%. These three flavonoids were unable to inhibit CYP21A2, with negligible inhibition of deoxycortisol biosynthesis only. Rooibos inhibited substrate conversion by CYP17A1 and CYP21A2, while the inhibition of other enzyme activities was <20%. In H295R cells, rutin had the greatest inhibitory effect on steroid production upon forskolin stimulation, reducing total steroid output 2.3-fold, while no effect was detected under basal conditions. Nothofagin and vitexin had a greater inhibitory effect on overall steroid production compared to aspalathin and orientin, respectively. The latter compounds contain two hydroxyl groups on the B ring, while nothofagin and vitexin contain a single hydroxyl group. In addition, all of the flavonoids are glycosylated, albeit at different positions--dihydrochalcones at C3' and flavones at C8 on ring A, while rutin, a larger molecule, has a rutinosyl moiety at C3 on ring C. Structural differences regarding the number and position of hydroxyl and glucose moieties as well as structural flexibility could indicate different mechanisms by which these flavonoids influence the activity of adrenal steroidogenic enzymes.

  5. Adrenal imaging (Part 2): Medullary and secondary adrenal lesions

    PubMed Central

    Dhamija, Ekta; Panda, Ananya; Das, Chandan J.; Gupta, A. K.


    Adrenal malignancies can be either primary adrenal tumors or secondary metastases, with metastases representing the most common malignant adrenal lesion. While imaging cannot always clearly differentiate between various adrenal malignancies, presence of certain imaging features, in conjunction with appropriate clinical background and hormonal profile, can suggest the appropriate diagnosis. The second part of the article on adrenal imaging describes adrenal medullary tumors, secondary adrenal lesions, bilateral adrenal lesions, adrenal incidentalomas and provides an algorithmic approach to adrenal lesions based on current imaging recommendations. PMID:25593821

  6. Transcription of (pro)renin mRNA in the rat adrenal cortex, and the effects of ACTH treatment and a low sodium diet.


    Ho, M M; Vinson, G P


    Transcription of the (pro)renin gene in the adult rat adrenal gland was studied by non-isotopic in situ hybridization. In glands from control (untreated) animals, transcription was relatively sparse, and occurred mostly in the outer zona fasciculata. Treatment with ACTH increased the apparent signal in both the glomerulosa and in fasciculata zones. A low sodium diet initially enhanced the transcription signal specifically in the glomerulosa, but as the regime was extended from 5 days to more than 2 weeks, the signal was also increased dramatically in the zona reticularis. The results emphasize the potential importance of the intraglandular renin-angiotensin system, particularly under conditions of chronic stimulation. They also suggest that angiotensin II, as well as being the major regulator of the glomerulosa, may also have some role in inner adrenocortical zone functions.

  7. Corticotropin-releasing hormone directly stimulates cortisol and the cortisol biosynthetic pathway in human fetal adrenal cells.


    Sirianni, Rosa; Rehman, Khurram S; Carr, Bruce R; Parker, C Richard; Rainey, William E


    Near term the human fetal adrenals (HFAs) initiate production of cortisol, which promotes organ maturation and acts to increase placental CRH biosynthesis. The objective of the present study was to determine whether CRH directly stimulates both cortisol production and expression of the steroidogenic enzymes in HFA-definitive zone cells. CRH stimulated the production of cortisol in a time- and dose-dependent manner, with an effective concentration of as low as 0.01 nm. In real-time RT-PCR experiments, CRH treatment increased the mRNA levels of steroidogenic acute regulatory protein and each of the enzymes needed to produce cortisol. CRH induced 3beta-hydroxysteroid dehydrogenase type II (HSD3B2) by 34-fold, 21-hydroxylase (CYP21) by 55-fold, and 11beta-hydroxylase by 41-fold. Induction of steroidogenic acute regulatory protein, cholesterol side chain cleavage (CYP11A), and 17alpha-hydroxylase (CYP17) mRNA by CRH was 6-, 4-, and 6-fold, respectively. We also demonstrated that submaximal concentrations of CRH (30 pm) and ACTH (30 pm) that are seen in fetal circulation were additive on cortisol biosynthesis and 3beta-hydroxysteroid dehydrogenase type II mRNA induction. We suggest that CRH may play an important role in the late gestational rise in cortisol secretion from the HFAs, which may serve to augment placental CRH production and therefore participate in the endocrine cascade that is involved in fetal organ maturation and potentially in the timing of human parturition.

  8. Disorders of adrenal development.


    Ferraz-de-Souza, Bruno; Achermann, John C


    Human adrenal development is a complex and relatively poorly understood process. However, significant insight into some of the mechanisms regulating adrenal development and function is being obtained through the analysis of individuals and families with adrenal hypoplasia. Adrenal hypoplasia can occur: (1) secondary to defects in pituitary adrenocorticotropin (ACTH) synthesis, processing and release (secondary adrenal hypoplasia; e.g. HESX1, LHX4, SOX3, TPIT, pituitary POMC, PC1); (2) as part of several ACTH resistance syndromes (e.g. MC2R/ACTHR, MRAP, Alacrima, Achalasia, Addison disease), or as (3) a primary defect in the development of the adrenal gland itself (primary adrenal hypoplasia; e.g. DAX1/NR0B1 - dosage-sensitive sex reversal, adrenal hypoplasia congenita critical region on the X chromosome 1). Indeed, the X-linked form of primary adrenal hypoplasia due to deletions or mutations in the orphan nuclear receptor DAX1 occurs in around half of male infants presenting with a salt-losing adrenal crisis, where no obvious steroidogenic defect (e.g. 21-hydroxylase deficiency), metabolic abnormality (e.g. neonatal adrenoleukodystrophy) or physical cause (e.g. adrenal haemorrhage) is found. Establishing the underlying basis of adrenal failure can have important implications for investigating associated features, the likely long-term approach to treatment, and for counselling families about the risk of other children being affected.

  9. Butanol isomers exert distinct effects on voltage-gated calcium channel currents and thus catecholamine secretion in adrenal chromaffin cells.


    McDavid, Sarah; Bauer, Mary Beth; Brindley, Rebecca L; Jewell, Mark L; Currie, Kevin P M


    Butanol (C4H10OH) has been used both to dissect the molecular targets of alcohols/general anesthetics and to implicate phospholipase D (PLD) signaling in a variety of cellular functions including neurotransmitter and hormone exocytosis. Like other primary alcohols, 1-butanol is a substrate for PLD and thereby disrupts formation of the intracellular signaling lipid phosphatidic acid. Because secondary and tertiary butanols do not undergo this transphosphatidylation, they have been used as controls for 1-butanol to implicate PLD signaling. Recently, selective pharmacological inhibitors of PLD have been developed and, in some cases, fail to block cellular functions previously ascribed to PLD using primary alcohols. For example, exocytosis of insulin and degranulation of mast cells are blocked by primary alcohols, but not by the PLD inhibitor FIPI. In this study we show that 1-butanol reduces catecholamine secretion from adrenal chromaffin cells to a much greater extent than tert-butanol, and that the PLD inhibitor VU0155056 has no effect. Using fluorescent imaging we show the effect of these drugs on depolarization-evoked calcium entry parallel those on secretion. Patch-clamp electrophysiology confirmed the peak amplitude of voltage-gated calcium channel currents (I(Ca)) is inhibited by 1-butanol, with little or no block by secondary or tert-butanol. Detailed comparison shows for the first time that the different butanol isomers exert distinct, and sometimes opposing, effects on the voltage-dependence and gating kinetics of I(Ca). We discuss these data with regard to PLD signaling in cellular physiology and the molecular targets of general anesthetics.

  10. Control of adrenal androgen production.


    Odell, W D; Parker, L N

    The major adrenal androgens are dehydroepiandrosterone (DHEA), dehydroepiandrosterone sulphate (DHEAS) and androstenedione (delta 4). Studies by Cutler et al in 1978 demonstrated that these androgens are detectable in blood of all domestic and laboratory animals studied, but that only 4 species show increase in one or more with sexual maturation: rabbit, dog, chimpanzee and man. Studies by Grover and Odell in 1975 show these androgens do not bind to the androgen receptor obtained from rat prostate and thus probably are androgens only by conversion to an active androgen in vivo. Thomas and Oake in 1974 showed human skin converted DHEA to testosterone. The control of adrenal androgen secretion is in part modulated by ACTH. However, other factors or hormones must exist also, for a variety of clinical observations show dissociation in adrenal androgen versus cortisol secretion. Other substances that have been said to be controllers of adrenal androgen secretion include estrogens, prolactin, growth hormone, gonadotropins and lipotropin. None of these appear to be the usual physiological modulator, although under some circumstances each may increase androgen production. Studies from our laboratory using in vivo experiments in the castrate dog and published in 1979 indicated that crude extracts of bovine pituitary contained a substance that either modified ACTH stimulation of adrenal androgen secretion, or stimulated secretion itself - Cortisol Androgen Stimulating Hormone. Parker et al in 1983 showed a 60,000 MW glycoprotein was extractable from human pituitaries, which stimulated DHA secretion by dispersed canine adrenal cells in vitro, but did not stimulate cortisol secretion. This material contained no ACTH by radioimmunoassay. In 1982 Brubaker et al reported a substance was also present in human fetal pituitaries, which stimulated DHA secretion, but did not effect cortisol. PMID:6100259

  11. Manganese superoxide dismutase activity in the rat adrenal.


    Raza, F S; Okamoto, M; Takemori, H; Vinson, G P


    In the light of studies suggesting that transcription of the gene coding for manganese superoxide dismutase (MnSOD) is induced by ACTH in the rat adrenal gland, northern blot analysis was used to determine its mRNA distribution. It was found that mRNA coding for MnSOD is primarily present in the inner zones of the rat adrenal cortex, and not the glomerulosa. To investigate the functional relationships between MnSOD activity and expression and adrenocortical function, adrenals and blood were taken from animals pretreated with corticotrophin or betamethasone (Betnesol), or subjected to a low-sodium diet. MnSOD activity in inner zone mitochondrial fractions was enhanced by corticotrophin and by a low-sodium diet, but suppressed by betamethasone. Apparent cytosolic MnSOD activity, total cytosolic MnSOD and CuZnMn-SOD, and glomerulosa mitochondrial MnSOD all were unaffected. Steroid assays showed a clear correlation between circulating corticosterone and inner zone mitochondrial MnSOD, but none between aldosterone and glomerulosa MnSOD. Immunoblot analysis of MnSOD showed two apparent isoforms, at approximately 25 kDa and 75 kDa. There was a partial relationship between expression of the 75 kDa isoform and MnSOD activity, in that it was induced by corticotrophin. However, there was also a slight induction with betamethasone, and a low-sodium diet had no effect. The 25 kDa MnSOD isoform was unaffected by the treatments. The results suggest that MnSOD may have a specific role in the steroidogenic function of the fasciculata/reticularis of the rat adrenal, but not in that of the glomerulosa.

  12. Microelectrode Arrays of Diamond-Insulated Graphitic Channels for Real-Time Detection of Exocytotic Events from Cultured Chromaffin Cells and Slices of Adrenal Glands.


    Picollo, Federico; Battiato, Alfio; Bernardi, Ettore; Marcantoni, Andrea; Pasquarelli, Alberto; Carbone, Emilio; Olivero, Paolo; Carabelli, Valentina


    A microstructured graphitic 4 × 4 multielectrode array was embedded in a single-crystal diamond substrate (4 × 4 μG-SCD MEA) for real-time monitoring of exocytotic events from cultured chromaffin cells and adrenal slices. The current approach relies on the development of a parallel ion beam lithographic technique, which assures the time-effective fabrication of extended arrays with reproducible electrode dimensions. The reported device is suitable for performing amperometric and voltammetric recordings with high sensitivity and temporal resolution, by simultaneously acquiring data from 16 rectangularly shaped microelectrodes (20 × 3.5 μm(2)) separated by 200 μm gaps. Taking advantage of the array geometry we addressed the following specific issues: (i) detect both the spontaneous and KCl-evoked secretion simultaneously from several chromaffin cells directly cultured on the device surface, (ii) resolve the waveform of different subsets of exocytotic events, and (iii) monitoring quantal secretory events from thin slices of the adrenal gland. The frequency of spontaneous release was low (0.12 and 0.3 Hz, respectively, for adrenal slices and cultured cells) and increased up to 0.9 Hz after stimulation with 30 mM KCl in cultured cells. The spike amplitude as well as rise and decay time were comparable with those measured by carbon fiber microelectrodes and allowed to identify three different subsets of secretory events associated with "full fusion" events, "kiss-and-run" and "kiss-and-stay" exocytosis, confirming that the device has adequate sensitivity and time resolution for real-time recordings. The device offers the significant advantage of shortening the time to collect data by allowing simultaneous recordings from cell populations either in primary cell cultures or in intact tissues. PMID:27376596

  13. Microelectrode Arrays of Diamond-Insulated Graphitic Channels for Real-Time Detection of Exocytotic Events from Cultured Chromaffin Cells and Slices of Adrenal Glands.


    Picollo, Federico; Battiato, Alfio; Bernardi, Ettore; Marcantoni, Andrea; Pasquarelli, Alberto; Carbone, Emilio; Olivero, Paolo; Carabelli, Valentina


    A microstructured graphitic 4 × 4 multielectrode array was embedded in a single-crystal diamond substrate (4 × 4 μG-SCD MEA) for real-time monitoring of exocytotic events from cultured chromaffin cells and adrenal slices. The current approach relies on the development of a parallel ion beam lithographic technique, which assures the time-effective fabrication of extended arrays with reproducible electrode dimensions. The reported device is suitable for performing amperometric and voltammetric recordings with high sensitivity and temporal resolution, by simultaneously acquiring data from 16 rectangularly shaped microelectrodes (20 × 3.5 μm(2)) separated by 200 μm gaps. Taking advantage of the array geometry we addressed the following specific issues: (i) detect both the spontaneous and KCl-evoked secretion simultaneously from several chromaffin cells directly cultured on the device surface, (ii) resolve the waveform of different subsets of exocytotic events, and (iii) monitoring quantal secretory events from thin slices of the adrenal gland. The frequency of spontaneous release was low (0.12 and 0.3 Hz, respectively, for adrenal slices and cultured cells) and increased up to 0.9 Hz after stimulation with 30 mM KCl in cultured cells. The spike amplitude as well as rise and decay time were comparable with those measured by carbon fiber microelectrodes and allowed to identify three different subsets of secretory events associated with "full fusion" events, "kiss-and-run" and "kiss-and-stay" exocytosis, confirming that the device has adequate sensitivity and time resolution for real-time recordings. The device offers the significant advantage of shortening the time to collect data by allowing simultaneous recordings from cell populations either in primary cell cultures or in intact tissues.

  14. Human adrenal tumor cell line SW-13 contains a natriuretic peptide receptor system that responds preferentially to ANP among various natriuretic peptides

    SciTech Connect

    Mizuno, T.; Katafuchi, T.; Hagiwara, H.; Ito, T.; Kangawa, K.; Matsuo, H.; Hirose, S. )


    A new type of ANP receptor system which clearly distinguishes natriuretic peptides A and B (ANP and BNP) has been identified in the human adrenal tumor cell line SW-13 and characterized. SW-13 cells responded to nanomolar concentrations of ANP with large increases in cGMP levels but in the case of BNP, much higher concentrations were required to produce the same extent of response. This property is unique since the 140-kDa ANP receptors so far characterized do not discriminate between ANP and BNP. For comparison, various natriuretic peptide receptors were also re-characterized using the recently identified CNP.

  15. Subcellular compartmentalization of 1-methyl-4-phenylpyridinium with catecholamines in adrenal medullary chromaffin vesicles may explain the lack of toxicity to adrenal chromaffin cells

    SciTech Connect

    Reinhard, J.F. Jr.; Diliberto, E.J. Jr.; Viveros, O.H.; Daniels, A.J.


    Cultures of bovine adrenomedullary chromaffin cells accumulated 1-methyl-4-phenylpyridinium (MPP/sup +/) in a time- and concentration-dependent manner by a process that was prevented by desmethylimipramine. The subcellular localization of the incorporated (methyl-/sup 3/H)MPP/sup +/ was examined by differential centrifugation and sucrose density gradient fractionation and was found to be predominantly colocalized with catecholamines in chromaffin vesicles, and negligible amounts were detected within the mitochondrial fraction. When chromaffin cell membranes were made permeable with the detergent digitonin the absence of calcium, there was no increase in the release of (/sup 3/H)MPP/sup +/, indicating that there is negligible accumulation of the neurotoxin in the cytosol. Simultaneous exposure to digitonin and calcium induced cosecretion of MPP/sup +/ and catecholamines. Stimulation of the cells with nicotine released both catecholamines and MPP/sup +/ at identical rates and percentages of cellular content in a calcium-dependent manner. Last, when cells were incubated with MPP/sup +/ in the presence of tetrabenazine (an inhibitor of vesicular uptake), the chromaffin cell toxicity of MPP/sup +/ was potentiated. The authors submit that the ability of the chromaffin cells to take up and store MPP/sup +/ in the chromaffin vesicle prevents the toxin's interaction with other structures and, thus, prevents cell damage. As an extension of this hypothesis, the relative resistance of some brain monoaminergic neurons to the toxic actions of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine may result from the subcellular sequestration of MPP/sup +/ in the storage vesicle.

  16. Evidence for chronic stress in captive but not free-ranging cheetahs (Acinonyx jubatus) based on adrenal morphology and function.


    Terio, Karen A; Marker, Laurie; Munson, Linda


    The cheetah (Acinonyx jubatus) is highly endangered because of loss of habitat in the wild and failure to thrive in captivity. Cheetahs in zoos reproduce poorly and have high prevalences of unusual diseases that cause morbidity and mortality. These diseases are rarely observed in free-ranging cheetahs but have been documented in cheetahs that have been captured and held in captive settings either temporarily or permanently. Because captivity may be stressful for this species and stress is suspected as contributing to poor health and reproduction, this study aimed to measure chronic stress by comparing baseline concentrations of fecal corticoid metabolites and adrenal gland morphology between captive and free-ranging cheetahs. Additionally, concentrations of estradiol and testosterone metabolites were quantified to determine whether concentrations of gonadal steroids correlated with corticoid concentration and to assure that corticosteroids in the free-ranging samples were not altered by environmental conditions. Concetntrations of fecal corticoids, estradiol, and testosterone were quantified by radioimmunoassay in 20 free-ranging and 20 captive cheetahs from samples collected between 1994 and 1999. Concentrations of baseline fecal corticoids were significantly higher (p = 0.005) in captive cheetahs (196.08 +/- 36.20 ng/g dry feces) than free-ranging cheetahs (71.40 +/- 14.35 ng/g dry feces). Testosterone concentrations were lower in captive male cheetahs (9.09 +/- 2.84 ng/g dry feces) than in free-ranging cheetahs (34.52 +/- 12.11 ng/g dry feces), which suggests suppression by elevated corticoids in the captive males. Evidence for similar sulppression of estradiol concentrations in females was not present. Adrenal corticomedullary ratios were determined on midsagittal sections of adrenal glands from 13 free-ranging and 13 captive cheetahs obtained between 1991 and 2002. The degree of vacuolation of cortical cells in the zona fasciculata was graded for each animal

  17. Chiral effects in adrenocorticolytic action of o,p'-DDD (mitotane) in human adrenal cells.


    Asp, V; Cantillana, T; Bergman, A; Brandt, I


    Adrenocortical carcinoma (ACC) is a rare malignant disease with poor prognosis. The main pharmacological choice, o,p'-DDD (mitotane), produces severe adverse effects. Since o,p'-DDD is a chiral molecule and stereoisomers frequently possess different pharmacokinetic and/or pharmacodynamic properties, we isolated the two o,p'-DDD enantiomers, (R)-(+)-o,p'-DDD and (S)-(-)-o,p'-DDD, and determined their absolute structures. The effects of each enantiomer on cell viability and on cortisol and dehydroepiandrosterone (DHEA) secretion in the human adrenocortical cell line H295R were assessed. We also assayed the o,p'-DDD racemate and the m,p'- and p,p'-isomers. The results show small but statistically significant differences in activity of the o,p'-DDD enantiomers for all parameters tested. The three DDD isomers were equally potent in decreasing cell viability, but p,p'-DDD affected hormone secretion slightly less than the o,p'- and m,p'-isomers. The small chiral differences in direct effects on target cells alone do not warrant single enantiomer administration, but might reach importance in conjunction with possible stereochemical effects on pharmacokinetic processes in vivo.

  18. Internalization and lysosomal association of (/sup 125/I)angiotensin II in norepinephrine-containing cells of the rat adrenal medulla

    SciTech Connect

    Bianchi, C.; Gutkowska, J.; Charbonneau, C.; Ballak, M.; Anand-Srivastava, M.B.; De Lean, A.; Genest, J.; Cantin, M.


    The morphological localization of (/sup 125/I)angiotensin II (AII) in the rat adrenal medulla (AM) was studied by light- and electron-microscopic radioautography in vivo. With light microscopy the presence of binding sites for AII in both norepinephrine-containing (NE) and epinephrine-containing (E) cells was confirmed. With electron microscopy, it was found that AII binds to the cell surface of NE cells, is progressively internalized, and is associated with lysosomes and Golgi complex within 20 min, whereas in E cells AII seems to be internalized earlier and recycled back to the cell surface within 5 min without any appreciable association with intracellular organelles. These results suggest different intracellular pathways for AII in NE and E cells of the rat AM.

  19. X-ray structure of trypanothione reductase from Crithidia fasciculata at 2. 4- angstrom resolution

    SciTech Connect

    Kuriyan, J.; Xiangpeng Kong; Krishna, T.S.R.; Murgolo, N.J.; Field, H.; Cerami, A.; Henderson, G.B. ); Sweet, R.M. )


    Trypanosomes and related protozoan parasites lack glutathione reductase and possess instead a closely related enzyme that serves as the reductant of a bis(glutathione)-spermidien conjugate, trypanothione. The human and parasite enzymes have mutually exclusive substrate specificities, providing a route for the design of therapeutic agents by specific inhibition of the parasite enzyme. The authors report here the three-dimensional structure of trypanothione reductase from Crithidia fasciculata and show that it closely resembles the structure of human glutathione reductase. In particular, the core structure surrounding the catalytic machinery is almost identical in the two enzymes. However, significant differences are found at the substrate binding sites. A cluster of basic residues in glutathione reductase is replaced by neutral, hydrophobic, or acidic residues in trypanothione reductase, consistent with the nature of the spermidine linkage and the change in overall charge of the substrate from {minus}2 to +1, respectively. The binding site is more open in trypanothione reductase due to rotations of about 4{degree} in the domains that form in site, with relative shifts of as much as 2-3 {angstrom} in residues that can interact with potential inhibitors and complement previous modeling and mutagenesis studies on the two enzymes.

  20. In vitro galactosylation of a 110-kDa glycoprotein by an endogenous cell surface galactosyltransferase correlates with the invasiveness of adrenal carcinoma cells

    SciTech Connect

    Penno, M.B.; Passaniti, A.; Hart, G.W.; Jordan, C.; Kumar, S.; Scott, A.F. ); Fridman, R. )


    The authors have examined the role of a cell surface galactosyltransferase, laminin, and laminin-binding protein (receptor) in the invasion of clonal derivatives of a murine adrenal carcinoma cell line. Although a 10-fold variation was found in the ability to invade a reconstituted basement membrane matrix, levels of intracellular laminin and the laminin-binding protein were shown to be present and secreted equally in all lines. Of the eight lines tested, seven showed a correlation between invasion and the incorporation of ({sup 3}H)galactose from UDP-({sup 3}H)galactose into a 90- to 110-kDa protein. One noninvasive line (clone HSR), however, retained high galactosyltransferase activity yet could not galactosylate the endogenous 90- to 110-kDa substrate. Interestingly, this clone was unable to attach to laminin. Although high galactosyltransferase activity can be consistent with cells of high invasiveness, the results suggest that the galactosylation status of a 90- to 110-kDa Y1 cell surface glycoprotein is most indicative of invasion potential.

  1. Divalent cation permeability and blockade of Ca2+-permeant non-selective cation channels in rat adrenal zona glomerulosa cells

    PubMed Central

    Lotshaw, David P; Sheehan, Katherine A


    The effects of the divalent cations Ca2+, Mg2+ and Ni2+ on unitary Na+ currents through receptor-regulated non-selective cation channels were studied in inside-out and cell-attached patches from rat adrenal zona glomerulosa cells.External Ca2+ caused a concentration-dependent and voltage-independent inhibition of inward Na+ current, exhibiting an IC50 of 1.4 mm. The channel was also Ca2+ permeant and external Ca2+ shifted the reversal potential as expected for a channel exhibiting a constant Ca2+:Na+ permeability ratio near to 4.External and internal 2 mm Mg2+ caused voltage-dependent inhibition of inward and outward Na+ current, respectively. Modelling Mg2+ as an impermeant fast open channel blocker indicated that external Mg2+ blocked the pore at a single site exhibiting a zero voltage Kd of 5.1 mm for Mg2+ and located 19% of the distance through the transmembrane electric field from the external surface. Internal Mg2+ blocked the pore at a second site exhibiting a Kd of 1.7 mm for Mg2+ and located 36% of the distance through the transmembrane electric field from the cytosolic surface.External Ni2+ caused a voltage- and concentration-dependent slow blockade of inward Na+ current. Modelling Ni2+ as an impermeant slow open channel blocker indicated that Ni2+ blocked the pore at a single site exhibiting a Kd of 1.09 mm for Ni2+ and located 13.7% of the distance through the transmembrane electric field from the external surface.External 2 mm Mg2+ increased the Kd for external Ni2+ binding to 1.27 mm, consistent with competition for a single binding site. Changing ionic strength did not substantially affect Ni2+ blockade indicating the absence of surface potential under physiological ionic conditions.It is concluded that at least two divalent cation binding sites, separated by a high free energy barrier (the selectivity filter), are located in the pore and contribute to Ca2+ selectivity and permeability of the channel. PMID:9852322

  2. Nitric oxide sets off an antioxidant response in adrenal cells: involvement of sGC and Nrf2 in HO-1 induction.


    Astort, F; Mercau, M; Giordanino, E; Degese, M S; Caldareri, L; Coso, O; Cymeryng, C B


    Induction of microsomal heme oxygenase 1 (HO-1) activity is considered a cytoprotective mechanism in different cell types. In adrenal cells, HO-1 induction by ACTH exerts a modulatory effect on steroid production as well. As nitric oxide (NO) has been also regarded as an autocrine/paracrine modulator of adrenal steroidogenesis we sought to study the effects of NO on the induction of HO-1 and the mechanism involved. We hereby analyzed the time and dose-dependent effect of a NO-donor (DETA/NO) on HO-1 induction in a murine adrenocortical cell line. We showed that this effect is mainly exerted at a transcriptional level as it is inhibited by actinomycin D and HO-1 mRNA degradation rates were not affected by DETA/NO treatment. HO-1 induction by NO does not appear to involve the generation of oxidative stress as it was not affected by antioxidant treatment. We also demonstrated that NO-treatment results in the nuclear translocation of the nuclear factor-erythroid 2-related factor (Nrf2), an effect that is attenuated by transfecting the cells with a dominant negative isoform of Nrf2. We finally show that the effects of the NO-donor are reproduced by a permeable analog of cGMP and that a soluble guanylate cyclase specific inhibitor blocked both the induction of HO-1 by NO and the nuclear translocation of Nrf2. PMID:24361900

  3. Nitric oxide sets off an antioxidant response in adrenal cells: involvement of sGC and Nrf2 in HO-1 induction.


    Astort, F; Mercau, M; Giordanino, E; Degese, M S; Caldareri, L; Coso, O; Cymeryng, C B


    Induction of microsomal heme oxygenase 1 (HO-1) activity is considered a cytoprotective mechanism in different cell types. In adrenal cells, HO-1 induction by ACTH exerts a modulatory effect on steroid production as well. As nitric oxide (NO) has been also regarded as an autocrine/paracrine modulator of adrenal steroidogenesis we sought to study the effects of NO on the induction of HO-1 and the mechanism involved. We hereby analyzed the time and dose-dependent effect of a NO-donor (DETA/NO) on HO-1 induction in a murine adrenocortical cell line. We showed that this effect is mainly exerted at a transcriptional level as it is inhibited by actinomycin D and HO-1 mRNA degradation rates were not affected by DETA/NO treatment. HO-1 induction by NO does not appear to involve the generation of oxidative stress as it was not affected by antioxidant treatment. We also demonstrated that NO-treatment results in the nuclear translocation of the nuclear factor-erythroid 2-related factor (Nrf2), an effect that is attenuated by transfecting the cells with a dominant negative isoform of Nrf2. We finally show that the effects of the NO-donor are reproduced by a permeable analog of cGMP and that a soluble guanylate cyclase specific inhibitor blocked both the induction of HO-1 by NO and the nuclear translocation of Nrf2.

  4. Hemorrhagic adrenal cyst.


    Cunningham, M D


    Adrenal cysts are uncommon. They may be fatal if they hemorrhage and are not rapidly diagnosed. Most adrenal cysts are small and asymptomatic. When they are symptomatic, it is usually because the cyst has enlarged, causing flank discomfort, gastrointestinal complaints, and hemorrhage. Occasionally, a palpable mass may be found. It is thought that hemorrhage occurs secondary to trauma or some toxic or infectious process. The author describes a case in which a previously healthy man had a sudden hemorrhage within a benign adrenal cyst with infarction of the kidney. A discussion of adrenal cysts follows.

  5. Congenital Adrenal Hyperplasia

    PubMed Central

    Speiser, Phyllis W.


    Congenital adrenal hyperplasia associated with deficiency of steroid 21-hydroxylase is the most common inborn error in adrenal function and the most common cause of adrenal insufficiency in the pediatric age group. As patients now survive into adulthood, adult health-care providers must also be familiar with this condition. Over the past several years, F1000 has published numerous commentaries updating research and practical guidelines for this condition. The purposes of this review are to summarize basic information defining congenital adrenal hyperplasia and to highlight current knowledge and controversies in management. PMID:26339484

  6. Alzheimer caregiver stress: basal natural killer cell activity, pituitary-adrenal cortical function, and sympathetic tone.


    Irwin, M; Hauger, R; Patterson, T L; Semple, S; Ziegler, M; Grant, I


    The association between Alzheimer caregiving and natural killer (NK) cell activity and basal plasma levels of adrenocorticotropic hormone (ACTH), cortisol, beta-endorphin, prolactin, epinephrine, norepinephrine, and neuropeptide Y was determined in 100 spousal Alzheimer caregivers and 33 age- and gender-comparable control volunteers upon intake into a study of the psychological and physiologic impact of caregiving. The relationship between these physiologic measures and individual characteristics such as age, gender, medical status, severity of stress, severity of depressive symptoms, and caregiver burden was tested. In addition, the association between NK activity and alterations of the neuroendocrine measures was investigated. As compared to controls, the Alzheimer caregivers had similar levels of NK activity and of basal plasma neuroendocrine hormones and sympathetic measures. While older age and male gender status were associated with increased levels of ACTH, neither medical caseness, severity of life stress, nor severity of depressive symptoms was associated with alterations in any of the multiple physiologic domains. Classification of Alzheimer caregiver burden identified caregivers who were mismatched in terms of the amount of care they were required to provide and the amount of respite time received. The mismatched caregivers had significantly higher basal plasma ACTH but no change in other physiological measures, as compared to non-mismatched caregivers. NK activity was negatively correlated with plasma levels of neuropeptide Y but not with any of the other neuroendocrine measures. Based on this cross-sectional evaluation of NK activity and neuroendocrine and sympathetic measures, we conclude that most Alzheimer caregivers do not show evidence of altered basal physiology.

  7. Primary Bilateral Non-Hodgkin's Lymphoma of the Adrenal Gland Presenting as Incidental Adrenal Masses

    PubMed Central

    Rizzo, Christopher; Camilleri, David James; Gatt, Andre'


    Although lymphoma may occasionally involve the adrenal glands as part of a generalized disease process, primary adrenal lymphoma (PAL) is a rare disease. We present a case of a 62-year-old woman with a history of mild/moderate hereditary spherocytosis with a well-compensated baseline haemoglobin, who presented with rapidly progressive symptomatic anaemia. During the diagnostic workup, imaging revealed bilateral large adrenal masses and she was later diagnosed with diffuse large B-cell non-Hodgkin's lymphoma (DLBCL), with the adrenal glands being the dominant site of the disease. The patient was started on systemic chemotherapy, but her disease progressed with neurological involvement which responded to second-line therapy. Her adrenal disease however was refractory to further therapy. PMID:26681947

  8. Adrenal adrenoceptors in heart failure

    PubMed Central

    de Lucia, Claudio; Femminella, Grazia D.; Gambino, Giuseppina; Pagano, Gennaro; Allocca, Elena; Rengo, Carlo; Silvestri, Candida; Leosco, Dario; Ferrara, Nicola; Rengo, Giuseppe


    Heart failure (HF) is a chronic clinical syndrome characterized by the reduction in left ventricular (LV) function and it represents one of the most important causes of morbidity and mortality worldwide. Despite considerable advances in pharmacological treatment, HF represents a severe clinical and social burden. Sympathetic outflow, characterized by increased circulating catecholamines (CA) biosynthesis and secretion, is peculiar in HF and sympatholytic treatments (as β-blockers) are presently being used for the treatment of this disease. Adrenal gland secretes Epinephrine (80%) and Norepinephrine (20%) in response to acetylcholine stimulation of nicotinic cholinergic receptors on the chromaffin cell membranes. This process is regulated by adrenergic receptors (ARs): α2ARs inhibit CA release through coupling to inhibitory Gi-proteins, and β ARs (mainly β2ARs) stimulate CA release through coupling to stimulatory Gs-proteins. All ARs are G-protein-coupled receptors (GPCRs) and GPCR kinases (GRKs) regulate their signaling and function. Adrenal GRK2-mediated α2AR desensitization and downregulation are increased in HF and seem to be a fundamental regulator of CA secretion from the adrenal gland. Consequently, restoration of adrenal α2AR signaling through the inhibition of GRK2 is a fascinating sympatholytic therapeutic strategy for chronic HF. This strategy could have several significant advantages over existing HF pharmacotherapies minimizing side-effects on extra-cardiac tissues and reducing the chronic activation of the renin–angiotensin–aldosterone and endothelin systems. The role of adrenal ARs in regulation of sympathetic hyperactivity opens interesting perspectives in understanding HF pathophysiology and in the identification of new therapeutic targets. PMID:25071591

  9. Expression and roles of steroidogenic acute regulatory (StAR) protein in 'non-classical', extra-adrenal and extra-gonadal cells and tissues.


    Anuka, Eli; Gal, Michael; Stocco, Douglas M; Orly, Joseph


    The activity of the steroidogenic acute regulatory (StAR) protein is indispensable and rate limiting for high output synthesis of steroid hormones in the adrenal cortex and the gonads, known as the 'classical' steroidogenic organs (StAR is not expressed in the human placenta). In addition, studies of recent years have shown that StAR is also expressed in many tissues that produce steroid hormones for local use, potentially conferring some functional advantage by acting via intracrine, autocrine or paracrine fashion. Others hypothesized that StAR might also function in non-steroidogenic roles in specific tissues. This review highlights the evidence for the presence of StAR in 17 extra-adrenal and extra-gonadal organs, cell types and malignancies. Provided is the physiological context and the rationale for searching for the presence of StAR in such cells. Since in many of the tissues the overall level of StAR is relatively low, we also reviewed the methods used for StAR detection. The gathered information suggests that a comprehensive understanding of StAR activity in 'non-classical' tissues will require the use of experimental approaches that are able to analyze StAR presence at single-cell resolution.

  10. Just another abdominal pain? Psoas abscess-like metastasis in large cell lung cancer with adrenal insufficiency.


    Bernardino, Vera; Val-Flores, Luis Silva; Dias, João Lopes; Bento, Luís


    The authors report the case of a 69-year-old man with chronic obstructive pulmonary disease and previous pulmonary tuberculosis, who presented to the emergency department with abdominal and low back pain, anorexia and weight loss, rapidly evolving into shock. An initial CT scan revealed pulmonary condensation with associated cavitation and an iliopsoas mass suggestive of a psoas abscess. He was admitted in an intensive care unit unit; after a careful examination and laboratory assessment, the aetiology was yet undisclosed. MRI showed multiple retroperitoneal lymphadenopathies, bulky nodular adrenal lesions and bilateral iliac lytic lesions. Hypocortisolism was detected and treated with steroids. A CT-guided biopsy to the psoas mass and lytic lesions identified infiltration of non-small lung carcinoma. The patient died within days. Psoas metastases and adrenal insufficiency as initial manifestations of malignancy are rare and can be misdiagnosed, particularly in the absence of a known primary tumour. PMID:26063108

  11. Inhibition of /sup 22/Na influx by tricyclic and tetracyclic antidepressants and binding of (/sup 3/H)imipramine in bovine adrenal medullary cells

    SciTech Connect

    Arita, M.; Wada, A.; Takara, H.; Izumi, F.


    In bovine adrenal medullary cells we investigated the effects of antidepressants on ionic channels and secretion of catecholamines. Tricyclic (imipramine, amitriptyline and nortriptyline) and tetracyclic (maprotiline and mianserin) antidepressants inhibited carbachol-induced influx of /sup 22/Na, /sup 45/Ca and secretion of catecholamines (IC50, 14-96 microM). Influx of /sup 22/Na, /sup 45/Ca and secretion of catecholamines due to veratridine also were inhibited by these drugs (IC50, 10-17 microM). However, antidepressants did not suppress high concentration of K-induced 45Ca influx and catecholamine secretion, suggesting that antidepressants do not inhibit voltage-dependent Ca channels. (/sup 3/H)Imipramine bound specifically to adrenal medullary cells. Binding was saturable, reversible and with two different equilibrium dissociation constants (13.3 and 165.0 microM). Tricyclic and tetracyclic antidepressants competed for the specific binding of (/sup 3/H)imipramine at the same concentrations as they inhibited /sup 22/Na influx caused by carbachol or veratridine. Carbachol, d-tubocurarine, hexamethonium, tetrodotoxin, veratridine and scorpion venom did not inhibit the specific binding of (/sup 3/H)imipramine. These results suggest that tricyclic and tetracyclic antidepressants bind to two populations of binding sites which are functionally associated with nicotinic receptor-associated ionic channels and with voltage-dependent Na channels, and inhibit Na influx. Inhibition of Na influx leads to the reduction of Ca influx and catecholamine secretion caused by carbachol or veratridine.

  12. Stimulatory effect of nobiletin, a citrus polymethoxy flavone, on catecholamine synthesis through Ser19 and Ser40 phosphorylation of tyrosine hydroxylase in cultured bovine adrenal medullary cells.


    Zhang, Han; Yanagihara, Nobuyuki; Toyohira, Yumiko; Takahashi, Keita; Inagaki, Hirohide; Satoh, Noriaki; Li, Xiaoja; Goa, Xiumei; Tsutsui, Masato; Takahaishi, Kojiro


    We previously reported the dual effects of nobiletin, a compound of polymethoxy flavones found in citrus fruits, on catecholamine secretion in cultured bovine adrenal medullary cells. Here, we report the effects of nobiletin on catecholamine synthesis in the cells. Nobiletin increased the synthesis of (14)C-catecholamines from [(14)C]tyrosine in a time (20-30 min)- and concentration (1.0-100 μM)-dependent manner. Nobiletin (10-100 μM) also activated tyrosine hydroxylase activity. The stimulatory effect of nobiletin on (14)C-catecholamine synthesis was not observed when extracellular Ca(2+) was not present in the incubation medium. Protein kinase inhibitors including H-89, an inhibitor of cyclic AMP-dependent protein kinase, and KN-93, an inhibitor of Ca(2+)/calmodulin-dependent protein kinase II, suppressed the stimulatory effects of nobiletin on catecholamine synthesis as well as tyrosine hydroxylase activity. Nobiletin also induced the phosphorylation of tyrosine hydroxylase at Ser(19) and Ser(40). Nobiletin (1.0-100 μM) inhibited (14)C-catecholamine synthesis induced by acetylcholine. The present findings suggest that nobiletin, by itself, stimulates catecholamine synthesis through tyrosine hydroxylase phosphorylation at Ser(19) and Ser(40), whereas it inhibits catecholamine synthesis induced by acetylcholine in bovine adrenal medulla.

  13. Antimicrobial activity of honey of stingless bees, tiúba (Melipona fasciculata) and jandaira (Melipona subnitida) compared to the strains of Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa

    NASA Astrophysics Data System (ADS)

    Tenório, Eleuza Gomes; de Jesus, Natália Rocha; Nascimento, Adenilde Ribeiro; Teles, Amanda Mara


    This study aimed to investigate the antimicrobial activity of honeys of stingless bees produced in Maranhão, tiúba (Melipona fasciculata) and jandaira (Melipona subnitida), opposite the strains of pathogenic bacteria, namely, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. The honey samples were collected from different regions of Maranhão. Of the 17 samples collected, twelve samples were honey M. fasciculata and five were honey M. subnitida. We used the Kirby-Bauer method, and the technique of agar disk diffusion through the extent of inhibition in milimetros. Results were negative for all samples from M. fasciculata. However, the tests for M. subnitida demonstrated bacteriostatic halos ranging from 12 to 32,6mm.

  14. Regulation of cytochrome b5 gene transcription by Sp3, GATA-6, and steroidogenic factor 1 in human adrenal NCI-H295A cells.


    Huang, Ningwu; Dardis, Andrea; Miller, Walter L


    Sex steroid synthesis requires the 17,20 lyase activity of P450c17, which is enhanced by cytochrome b5, acting as an allosteric factor to promote association of P450c17 with its electron donor, P450 oxidoreductase. Cytochrome b5 is preferentially expressed in the fetal adrenal and postadrenarchal adrenal zona reticularis; the basis of this tissue-specific, developmentally regulated transcription of the b5 gene is unknown. We found b5 expression in all cell lines tested, including human adrenal NCI-H295A cells, where its mRNA is reduced by cAMP and phorbol ester. Multiple sites, between -83 and -122 bp upstream from the first ATG, initiate transcription. Deletional mutagenesis localized all detectable promoter activity within -327/+15, and deoxyribonuclease I footprinting identified protein binding at -72/-107 and -157/-197. DNA segments -65/-40, -114/-70 and -270/-245 fused to TK32/Luc yielded significant activity, and mutations in their Sp sites abolished that activity; electrophoretic mobility shift assay (EMSA) showed that Sp3, but not Sp1, binds to these Sp sites. Nuclear factor 1 (NF-1) and GATA-6, but not GATA-4 bind to the NF-1 and GATA sites in -157/-197. In Drosophila S2 cells, Sp3 increased -327/Luc activity 58-fold, but Sp1 and NF-1 isoforms were inactive. Mutating the three Sp sites ablated activity without or with cotransfection of Sp1/Sp3. In NCI-H295A cells, mutating the three Sp sites reduced activity to 39%; mutating the Sp, GATA, and NF-1 sites abolished activity. In JEG-3 cells, GATA-4 was inactive, GATA-6 augmented -327/Luc activity to 231% over the control, and steroidogenic factor 1 augmented activity to 655% over the control; these activities required the Sp and NF-1 sites. Transcription of cytochrome b5 shares many features with the regulation of P450c17, whose activity it enhances. PMID:15831526

  15. Adrenal insufficiency: diagnosis and management.


    Munver, Ravi; Volfson, Ilya A


    Adrenal insufficiency is a disorder characterized by hypoactive adrenal glands resulting in insufficient production of the hormones cortisol and aldosterone by the adrenal cortex. This disorder may develop as a primary failure of the adrenal cortex or be secondary to an abnormality of the hypothalamic-pituitary axis. Patients with adrenal insufficiency often are asymptomatic or they may present with fatigue, muscle weakness, weight loss, low blood pressure, and sometimes darkening of the skin. The presentation of adrenal insufficiency varies dramatically and poses a major diagnostic dilemma. This review focuses on the diagnosis and treatment of primary and secondary adrenal insufficiency.

  16. High risk of adrenal toxicity of N1-desoxy quinoxaline 1,4-dioxide derivatives and the protection of oligomeric proanthocyanidins (OPC) in the inhibition of the expression of aldosterone synthetase in H295R cells.


    Wang, Xu; Yang, Chunhui; Ihsan, Awais; Luo, Xun; Guo, Pu; Cheng, Guyue; Dai, Menghong; Chen, Dongmei; Liu, Zhenli; Yuan, Zonghui


    Quinoxaline 1,4-dioxide derivatives (QdNOs) with a wide range of biological activities are used in animal husbandry worldwide. It was found that QdNOs significantly inhibited the gene expression of CYP11B1 and CYP11B2, the key aldosterone synthases, and thus reduced aldosterone levels. However, whether the metabolites of QdNOs have potential adrenal toxicity and the role of oxidative stress in the adrenal toxicity of QdNOs remains unclear. The relatively new QdNOs, cyadox (CYA), mequindox (MEQ), quinocetone (QCT) and their metabolites, were selected for elucidation of their toxic mechanisms in H295R cells. Interestingly, the results showed that the main toxic metabolites of QCT, MEQ, and CYA were their N1-desoxy metabolites, which were more harmful than other metabolites and evoked dose and time-dependent cell damage on adrenal cells and inhibited aldosterone production. Gene and protein expression of CYP11B1 and CYP11B2 and mRNA expression of transcription factors, such as NURR1, NGFIB, CREB, SF-1, and ATF-1, were down regulated by N1-desoxy QdNOs. The natural inhibitors of oxidant stress, oligomeric proanthocyanidins (OPC), could upregulate the expression of diverse transcription factors, including CYP11B1 and CYP11B2, and elevated aldosterone levels to reduce adrenal toxicity. This study demonstrated for the first time that N1-desoxy QdNOs have the potential to be the major toxic metabolites in adrenal toxicity, which may shed new light on the adrenal toxicity of these fascinating compounds and help to provide a basic foundation for the formulation of safety controls for animal products and the design of new QdNOs with less harmful effects.

  17. Naloxone inhibits and morphine potentiates. The adrenal steroidogenic response to ACTH

    NASA Technical Reports Server (NTRS)

    Heybach, J. P.; Vernikos, J.


    The adrenal actions were stereospecific since neither the positve stereoisomer of morphine, nor that of naloxone, had any effect on the adrenal response to exogenous adrenocorticotrophic hormone (ACTH). The administration of human beta endorphin to phyophysectomized rats had no effect on the adrenal corticosterone concentration nor did it alter the response of the adrenal gland to ACTH. These results indicate that morphine can potentiate the action of ACTH on the adrenal by a direct, stereospecific, dose dependent mechanism that is prevented by naloxone pretreatment and which may involve competition for ACTH receptors on the corticosterone secreting cells of the adrenal cortex.

  18. Functional complementation of an Escherichia coli ribonuclease H mutation by a cloned genomic fragment from the trypanosomatid Crithidia fasciculata.

    PubMed Central

    Campbell, A G; Ray, D S


    A gene designated Cfa RNH1 has been cloned by complementation of an RNase H deficiency in an Escherichia coli rnhA mutant by using a genomic DNA library from the trypanosomatid Crithidia fasciculata. The encoded RNase H is predicted to have 494 amino acid residues and a molecular mass of 53.7 kDa. The carboxyl half of the protein is homologous to the 155-residue E. coli RNase HI (41% identity) and the 166-residue Saccharomyces cerevisiae RNase HI (33% identity). The recombinant protein has been purified as a six-histidine-tagged fusion protein by metal chelate chromatography and was shown to have RNase H activity. Antibodies against the recombinant protein recognize proteins of approximately 65 kDa and 56 kDa on Western blots of C. fasciculata extracts. These results demonstrate the feasibility of cloning trypanosome genes by complementation of appropriate E. coli mutants with genomic DNA libraries. Images Fig. 3 Fig. 5 PMID:8415705

  19. [Mechanisms of adrenal embryogenesis].


    Barinov, E F; Sulaeva, O N


    The aim of this vie is to discuss the general principles of prenatal development of adrenal gland. On the basis of spatial-temporal heterogenity of structural particularites of fetal adrenal cortex, spectrum steroidogenic enzymes and secreting hormones expression in adrenocorticocytes, regulation of proliferation and differentiation processes mechanisms, authors discuss adrenal morphogenesis in three periods of gestation. It was noted the close relationship between placenta development and hypothalamo-pituitary-adrenocortical system formation with specification in each gestation period. Adrenal embryogenesis accompanied by remodeling of structural, functional and biochemical properties of parenchimal-stromal elements of fetal organ. Definitive zonation formation determined by morphogens: ACTH, renal and intraadrenal angiotensin II, estrogens, prostaglandines and other. The action of these factors realization is due to immediately and thought growth factor system (IGF-I, IGF-II, EGF, bFGF), working as paracrine amplificators of morphogenetic signals and activators of transcriptional factors--c-fos and c-jun.

  20. Acute adrenal crisis


    ... condition that occurs when there is not enough cortisol. This is a hormone produced by the adrenal ... parts. The outer portion, called the cortex, produces cortisol. This is an important hormone for controlling blood ...

  1. Calbindin 28 kDa in endocrine cells of known or putative calcium-regulating function. Thyro-parathyroid C cells, gastric ECL cells, intestinal secretin and enteroglucagon cells, pancreatic glucagon, insulin and PP cells, adrenal medullary NA cells and some pituitary (TSH?) cells.


    Buffa, R; Mare, P; Salvadore, M; Solcia, E; Furness, J B; Lawson, D E


    The distribution of calbindin in some endocrine glands (thyroid, parathyroid, ultimobranchial body, pituitary and adrenals) and in the diffuse endocrine cells of the gut and pancreas has been investigated immunohistochemically using an antiserum raised against the 28 kDa calbindin from chicken duodenum. The identity of calbindin-immunoreactive cells in a number of avian and mammalian species was ascertained by comparison with hormone-reactive cells in consecutive sections or by double immunostaining of the same section with both calbindin and hormone antibodies. Calcitonin-producing C cells of the mammalian and avian thyroid, parathyroid or ultimobranchial body, PP, glucagon and insulin cells of the mammalian and avian pancreas, enteroglucagon cells of the avian intestine, secretin cells of the mammalian duodenum, histamine-producing ECL cells of the mammalian stomach, as well as noradrenaline-producing cells of the adrenal medulla and some (TSH?) cells of the adenohypophysis were among the calbindin-immunoreactive cells. Although some species variability has been observed in the intensity and distribution of the immunoreactivity, especially in the pancreas and the gut, a role for calbindin in the mechanisms of calcium-mediated endocrine cell stimulation or of intracellular and extracellular calcium homeostasis is suggested. PMID:2737922

  2. Luteinizing hormone (LH)-releasing hormone agonist reduces serum adrenal androgen levels in prostate cancer patients: implications for the effect of LH on the adrenal glands.


    Nishii, Masahiro; Nomura, Masashi; Sekine, Yoshitaka; Koike, Hidekazu; Matsui, Hiroshi; Shibata, Yasuhiro; Ito, Kazuto; Oyama, Tetsunari; Suzuki, Kazuhiro


    Recently, adrenal androgens have been targeted as key hormones for the development of castration-resistant prostate cancer therapeutics. Although circulating adrenal androgens originate mainly from the adrenal glands, the testes also supply about 10%. Although widely used in androgen deprivation medical castration therapy, the effect of luteinizing hormone-releasing hormone (LH-RH) agonist on adrenal androgens has not been fully studied. In this study, changes in testicular and adrenal androgen levels were measured and compared to adrenocorticotropic hormone levels. To assess the possible role of LH in the adrenal glands, immunohistochemical studies of the LH receptor in normal adrenal glands were performed. Forty-seven patients with localized or locally progressive prostate cancer were treated with LH-RH agonist with radiotherapy. Six months after initiation of treatment, testosterone, dihydrotestosterone, and estradiol levels were decreased by 90%-95%, and dehydroepiandrosterone-sulfate, dehydroepiandrosterone, and androstenedione levels were significantly decreased by 26%-40%. The suppressive effect of LH-RH agonist at 12 months was maintained. Adrenocorticotropic hormone levels showed an increasing trend at 6 months and a significant increase at 12 months. LH receptors were positively stained in the cortex cells of the reticular layer of the adrenal glands. The long-term LH-RH agonist treatment reduced adrenal-originated adrenal androgens. LH receptors in the adrenal cortex cells of the reticular layer might account for the underlying mechanism of reduced adrenal androgens.

  3. A Novel Population of Inner Cortical Cells in the Adrenal Gland That Displays Sexually Dimorphic Expression of Thyroid Hormone Receptor-β1

    PubMed Central

    Huang, Chen-Che Jeff; Kraft, Cary; Moy, Nicole; Ng, Lily


    The development of the adrenal cortex involves the formation and then subsequent regression of immature or fetal inner cell layers as the mature steroidogenic outer layers expand. However, controls over this remodeling, especially in the immature inner layer, are incompletely understood. Here we identify an inner cortical cell population that expresses thyroid hormone receptor-β1 (TRβ1), one of two receptor isoforms encoded by the Thrb gene. Using mice with a Thrbb1 reporter allele that expresses lacZ instead of TRβ1, β-galactosidase was detected in the inner cortex from early stages. Expression peaked at juvenile ages in an inner zone that included cells expressing 20-α-hydroxysteroid dehydrogenase, a marker of the transient, so-called X-zone in mice. The β-galactosidase-positive zone displayed sexually dimorphic regression in males after approximately 4 weeks of age but persisted in females into adulthood in either nulliparous or parous states. T3 treatment promoted hypertrophy of inner cortical cells, induced some markers of mature cortical cells, and, in males, delayed the regression of the TRβ1-positive zone, suggesting that TRβ1 could partly divert the differentiation fate and counteract male-specific regression of inner zone cells. TRβ1-deficient mice were resistant to these actions of T3, supporting a functional role for TRβ1 in the inner cortex. PMID:25774556

  4. Differential expression and function of beacon in the rat adrenal cortex and medulla.


    Rucinski, Marcin; Andreis, Paola G; Ziolkowska, Agnieszka; Nussdorfer, Gastone G; Malendowicz, Ludwik K


    Beacon gene is overexpressed in obese rats, and beacon was found to stimulate food intake. Evidence has been recently provided that beacon is also expressed in the endocrine glands of normal rats, including adrenal cortex, of which it appears to regulate secretory activity. To further characterize the role of beacon in the rat adrenals, we investigated the level of beacon expression in the adrenal zona glomerulosa (ZG), zona fasciculata-reticularis (ZF/R) and medulla (AM), and the in vitro secretory responses to beacon[47-73] (hereinafter, beacon) of adrenocortical and adrenomedullary tissues. Real-time polymerase chain reaction revealed similar high levels of beacon mRNA in the ZG and ZF/R, and significantly lower (-80%) levels in AM. Immunocytochemistry showed that the distribution of beacon protein followed that of beacon mRNA. Quantitative high pressure liquid chromatography demonstrated that beacon (5x10(-7) M) reduced by about 56% the in vitro total steroid-hormone production from ZG and ZF/R tissues, without affecting catecholamine secretion from AM specimens. The beacon-induced lowering in the secretory activity of adrenal cortex depended on similar reductions (from 50-64%) in the production of the main adrenocortical hormones (pregnenolone, progesterone, 11-deoxycorticosterone, corticosterone, 18-hydroxy-corticosterone and aldosterone), thereby suggesting an inhibitory action of beacon in the early step of steroidogenesis (i.e. the conversion of cholesterol to pregnenolone). The hypothesis is advanced that beacon is to be considered an autocrine-paracrine negative regulator of mineralo- and glucocorticoid synthesis in the rat adrenal gland.

  5. [Morphometry in Development of Red Deer's Adrenal Glands].


    Ovcharenko, N D; Gribanova, O G; Bondyreva, L A


    Histological structures and morphometric and some histochemical indicators of elk's adrenal gland development as subspecies of red deer in prenatal and postnatal ontogenies stages was studied. It was found that the growth of the fetus adrenal glands weight and the thickness of the structures adrenal glands fragments continue throughout the prenatal period of ontogeny. The cells of androgenic zone with single wandering sympathogoniae are differentiated in the adrenal glands in the second month of development. The androgenic and definite zone and the adrenal medulla are differentiated by the third month of development. At the 4 months, adrenal gland cortex zona glomerulosa and zona fasciculate-reticularis are differentiated; zona reticularis is differentiated only by the seventh month. By the eighth month, the structure of adrenal glands corresponds to the adrenal glands of a newborn. Full structural formation of the adrenal glands takes place in young animals by age 1.5. Obvious structural changes were not found late in the postnatal stages of development.

  6. Catecholamines of the adrenal medula and their morphological changes during adaptation to repeated immobilization stress

    NASA Technical Reports Server (NTRS)

    Kvetnansky, R.; Mitro, A.; Mikulaj, L.; Hocman, G.


    Changes of the adrenal medulla of rats were studied in the course of adaptation to repeated immobilization stress. An increase in the number of cells in the adrenal medulla was found in the adapted animals; this increase was confirmed by weight indices of the medulla and by cell counts per surface unit. Simultaneous karyometric measurements of the nuclei of adrenal medulla cells and an analysis of the catecholamine contents in the adrenals explain the increased activity of the adrenal medulla in the course of adaptation.

  7. [Adrenal pseudocyst; a case report].


    Minagawa, Tomonori; Nishizawa, Shuji; Nakayama, Tsuyoshi; Okaneya, Toshikazu


    We report a case of adrenal pseudocyst. A 35-year-old woman presented with palpation of right upper abdominal mass without tenderness. Abdominal computed tomographic scan showed a right retroperitoneal cystic mass 20 cm in diameter. The patient underwent complete resection of the mass, including the normal adrenal gland. The cyst contained 3100 ml of dark brown thrombotic liquid. Histopathological examination revealed adrenal pseudocyst with a thick figrocollagenous wall. The normal adrenal gland was compressed by the wall. Adrenal pseudocyst is a rare disease. The mechanisms of adrenal pseudocyst formation and their expanding nature are discussed.

  8. [Heterozygosity for Mutations Affecting Coat Pigmentation in the American Mink (Neovison vison) Enhances Structural Stability of Adrenal Cortex under Stress Conditions].


    Trapezov, O V; Luzenko, N D; Trapezova, L I


    The results of the study of the effects of heterozygosity for mutations affecting coat pigmentation on the response to the environmental stress caused by extreme feeding conditions are provided. The animals with the following genotypes were taken into the study: homozygotes standard (+/+), hedlund white (h/h), and aleutian (a/a) and heterozygotes hedlund white (h/+) and aleutian (a/+). The animals homozygous for the aleutian mutation (a/a) showed a statistically lower growth rate than the animals of other genotypes both in the ontrol and in the experiment (p < 0.05). Under the control conditions, the animals homozygous forboth the wild type standard allele (+/+) and the mutant hedlund white (h/h) and aleutian (a/a) alleles showed the evident tendency for the zona fasciculata and zona reticularis of the adrenal cortex broadening compared to the experimental conditions. At the same time, in the animals heterozygous for the hedlund white (h/+) and the aleutian (a/+) mutations, a clear tendency for increasing size of the zona fasciculata and zona reticularis under the experimental conditions was observed. In the heterozygous animals, although we observed single destructive changes in the adrenal cortex under stress conditions, they were much less profound than in the homozygous ones. This may be related to the broader range of morphological adaptation in the heterozygotes, which gives them the possibility of more significant enlargement of the secreting zone to provide for its adequate functioning. PMID:27529984

  9. [Heterozygosity for Mutations Affecting Coat Pigmentation in the American Mink (Neovison vison) Enhances Structural Stability of Adrenal Cortex under Stress Conditions].


    Trapezov, O V; Luzenko, N D; Trapezova, L I


    The results of the study of the effects of heterozygosity for mutations affecting coat pigmentation on the response to the environmental stress caused by extreme feeding conditions are provided. The animals with the following genotypes were taken into the study: homozygotes standard (+/+), hedlund white (h/h), and aleutian (a/a) and heterozygotes hedlund white (h/+) and aleutian (a/+). The animals homozygous for the aleutian mutation (a/a) showed a statistically lower growth rate than the animals of other genotypes both in the ontrol and in the experiment (p < 0.05). Under the control conditions, the animals homozygous forboth the wild type standard allele (+/+) and the mutant hedlund white (h/h) and aleutian (a/a) alleles showed the evident tendency for the zona fasciculata and zona reticularis of the adrenal cortex broadening compared to the experimental conditions. At the same time, in the animals heterozygous for the hedlund white (h/+) and the aleutian (a/+) mutations, a clear tendency for increasing size of the zona fasciculata and zona reticularis under the experimental conditions was observed. In the heterozygous animals, although we observed single destructive changes in the adrenal cortex under stress conditions, they were much less profound than in the homozygous ones. This may be related to the broader range of morphological adaptation in the heterozygotes, which gives them the possibility of more significant enlargement of the secreting zone to provide for its adequate functioning.

  10. Trichosporin-B-III, an alpha-aminoisobutyric acid-containing peptide, causes Ca(2+)-dependent catecholamine secretion from adrenal medullary chromaffin cells.


    Tachikawa, E; Takahashi, S; Furumachi, K; Kashimoto, T; Iida, A; Nagaoka, Y; Fujita, T; Takaishi, Y


    We examined the effect of trichosporin-B-III, an alpha-aminoisobutyric acid-containing antibiotic peptide consisting of 19 amino acid residues and a phenylalaninol, on catecholamine secretion from cultured bovine adrenal chromaffin cells. Incubation of the cells with trichosporin-B-III (3-20 microM) caused an increase in the secretion of catecholamines. The secretion induced by trichosporin-B-III at low concentrations (3 and 5 microM) was completely dependent on external Ca2+, whereas that induced by higher concentrations (10 and 20 microM) was partly independent of Ca2+. Trichosporin-B-III at low concentration (5 microM) did not increase the release of lactate dehydrogenase, a marker enzyme of cytoplasm, from the cells. In contrast, the peptide at higher concentration (10 microM) increased the release of the enzyme. Trichosporin-B-III also caused both 45Ca2+ influx into the cells and an increase in the intracellular free Ca2+ concentration. The increases in catecholamine secretion and 45Ca2+ influx behaved similarly in relation to trichosporin-B-III concentration (3-10 microM). The time courses of the increases in secretion, 45Ca2+ influx, and intracellular free Ca2+ concentration induced by trichosporin-B-III were also quite similar. Trichosporin-B-III-induced (at 5 microM) secretion was not affected by the elimination of Na+ from the incubation medium or by the addition of tetrodotoxin, a blocker of highly selective voltage-dependent Na+ channels, or hexamethonium, a blocker of nicotinic acetylcholine receptors. On the other hand, both diltiazem (2-200 microM) and nicardipine (1-200 microM), blockers of voltage-dependent Ca2+ channels, inhibited the secretion induced by trichosporin-B-III (5 microM) in a concentration-dependent manner. Trichosporin-B-III-induced (at 5 microM) secretion also was suppressed by the addition of Mn2+ (5 mM) to the medium. The diltiazem (20 microM) inhibition of trichosporin-B-III-induced (at 5 microM) secretion was reversed by

  11. What Is Adrenal Cortical Cancer?


    ... include pheochromocytomas (which are most often benign) and neuroblastomas . This document is about tumors and cancers of ... does not discuss tumors of the adrenal medulla. Neuroblastoma s are covered in a separate document . Adrenal cortex ...

  12. [Giant adrenal myelolipoma].


    El Mejjad, Amine; Fekak, Hamid; Dakir, Mohamed; Sarf, Ismail; Manni, Ahmed; Meziane, Fethi


    Adrenal myelolipoma is a rare, benign, non-secreting tumour composed of adipose and haematopoietic tissue. The authors report a rare case of giant adrenal myelolipoma in a 53-year-old patient presenting with low back pain and a palpable flank mass on examination. CT scan suggested the diagnosis and surgical resection was indicated in view of the size and symptomatic nature of this mass. Histological examination confirmed the diagnosis. The outcome was favourable without recurrence after a follow-up of one year. The diagnosis of adrenal myelolipoma is based on radiology. Conservative management is generally sufficient for small asymptomatic tumours, but resection is required for large (> 5 cm) and/or symptomatic tumours.

  13. Genetics of adrenal tumors.


    Opocher, G; Schiavi, F; Cicala, M V; Patalano, A; Mariniello, B; Boaretto, F; Zovato, S; Pignataro, V; Macino, B; Negro, I; Mantero, F


    The impact of genetics and genomics on clinical medicine is becoming more and more important. Endocrinology pioneered the development of molecular medicine, but also the study of adrenal tumors had a great impact in this field. Particularly important was the detection of genetics of tumors derived from the adrenal medulla, as well as that of those derived from the sympathetic and parasympathetic paraganglia. The identification of mutations in one of the several pheochromocytoma/paraganglioma susceptibility genes may indicate a specific clinical management drive. Less well understood is the genetics of adrenal cortex tumors, in particular adrenocortical carcinoma, a rare and particularly aggressive disease. There are only a few examples of hereditary transmission of adrenocortical carcinoma, but the analysis of low penetrance genes by genome wide association study may enable us to discover new genetic mechanisms responsible for adrenocortical-derived tumors. PMID:19471236

  14. Frequency of varicella zoster virus DNA in human adrenal glands.


    Badani, Hussain; White, Teresa; Schulick, Nicole; Raeburn, Christopher D; Topkaya, Ibrahim; Gilden, Don; Nagel, Maria A


    Varicella zoster virus (VZV) becomes latent in ganglionic neurons derived from neural crest cells. Because the adrenal gland also contains medullary chromaffin cells of neural crest origin, we examined human adrenal glands and medullary chromaffin cell tumors (pheochromocytomas) for VZV and herpes simplex virus type 1 (HSV-1). We found VZV, but not HSV-1, DNA in 4/63 (6 %) normal adrenal glands. No VZV transcripts or antigens were detected in the 4 VZV DNA-positive samples. No VZV or HSV-1 DNA was found in 21 pheochromocytomas.

  15. Noncholinergic control of adrenal catecholamine secretion.

    PubMed Central

    Livett, B G; Marley, P D


    It has been known for over 70 years that adrenal catecholamine secretion can be modulated or elicited by noncholinergic neurotransmitters and hormones. However, our understanding of the cellular mechanisms by which these agents produce their effects and the physiological conditions under which they act are not well characterised. Here we briefly review the mechanisms by which one such agent (the neuropeptide substance P) modulates the cholinergic secretory response of adrenal chromaffin cells, and another agent (angiotensin II) elicits catecholamine secretion independently of the cholinergic innervation. PMID:7507911

  16. Gallium-68 PSMA uptake in adrenal adenoma.


    Law, W Phillip; Fiumara, Frank; Fong, William; Miles, Kenneth A


    Gallium-68 (Ga-68) labelled prostate-specific membrane antigen (PSMA) imaging by positron emission tomography (PET) has emerged as a promising tool for staging of prostate cancer and restaging of disease in recurrence or biochemical failure after definitive treatment of prostate cancer. Ga-68 PSMA PET produces high target-to-background images of prostate cancer and its metastases which are reflective of the significant overexpression of PSMA in these cells and greatly facilitates tumour detection. However, relatively little is known about the PSMA expression of benign neoplasms and non-prostate epithelial malignancies. This is a case report of PSMA uptake in an adrenal adenoma incidentally discovered on PET performed for restaging of biochemically suspected prostate cancer recurrence. With the increasing use of PSMA PET in the management of prostate cancer - and the not infrequent occurrence of adrenal adenomas - the appearance of low- to moderate-grade PSMA uptake in adrenal adenomas should be one with which reporting clinicians are familiar.

  17. Adrenal venous sampling in a patient with adrenal Cushing syndrome

    PubMed Central

    Villa-Franco, Carlos Andrés; Román-Gonzalez, Alejandro; Velez-Hoyos, Alejandro; Echeverri-Isaza, Santiago


    The primary bilateral macronodular adrenal hyperplasia or the independent adrenocorticotropic hormone bilateral nodular adrenal hyperplasia is a rare cause hypercortisolism, its diagnosis is challenging and there is no clear way to decide the best therapeutic approach. Adrenal venous sampling is commonly used to distinguish the source of hormonal production in patients with primary hyperaldosteronism. It could be a useful tool in this context because it might provide information to guide the treatment. We report the case of a patient with ACTH independent Cushing syndrome in whom the use of adrenal venous sampling with some modifications radically modified the treatment and allowed the diagnosis of a macronodular adrenal hyperplasia. PMID:26309345

  18. Adrenal venous sampling in a patient with adrenal Cushing syndrome.


    Builes-Montaño, Carlos Esteban; Villa-Franco, Carlos Andrés; Román-Gonzalez, Alejandro; Velez-Hoyos, Alejandro; Echeverri-Isaza, Santiago


    The primary bilateral macronodular adrenal hyperplasia or the independent adrenocorticotropic hormone bilateral nodular adrenal hyperplasia is a rare cause hypercortisolism, its diagnosis is challenging and there is no clear way to decide the best therapeutic approach. Adrenal venous sampling is commonly used to distinguish the source of hormonal production in patients with primary hyperaldosteronism. It could be a useful tool in this context because it might provide information to guide the treatment. We report the case of a patient with ACTH independent Cushing syndrome in whom the use of adrenal venous sampling with some modifications radically modified the treatment and allowed the diagnosis of a macronodular adrenal hyperplasia.

  19. Identification of des-(Gly-Ile)-endozepine as an effector of corticotropin-dependent adrenal steroidogenesis: stimulation of cholesterol delivery is mediated by the peripheral benzodiazepine receptor.

    PubMed Central

    Besman, M J; Yanagibashi, K; Lee, T D; Kawamura, M; Hall, P F; Shively, J E


    Delivery of cholesterol to inner mitochondrial membranes is rate-limiting for steroidogenesis in the zona fasciculata of adrenal cortex. A protein that stimulates this process was isolated to homogeneity from bovine adrenal tissue. This protein's primary structure has been determined in its entirety by a combination of automated Edman microsequencing, fast-atom bombardment mass spectrometry (FAB-MS). The sequence was identical to that previously reported for bovine brain endozepine, except that it lacks the last two residues, -Gly-Ile, at the C terminus. To our knowledge, isolation of an endozepine-related protein from a tissue other than brain has not been reported previously. Endozepine competes with benzodiazepines for saturable binding sites in synaptosomes and in mitochondria of specific peripheral tissues. Previous reports have localized the adrenal benzodiazepine receptor to the outer mitochondrial membrane. In this report, we show that the prototypic benzodiazepine, diazepam, effects a stimulation of adrenal mitochondrial cholesterol delivery similar to that observed for endozepine. The effective diazepam concentration was consistent with that previously shown to displace a high-affinity ligand of the mitochondrial benzodiazepine receptor. The action of diazepam in adrenal mitochondria suggests that the mediation of corticotropin-induced steroidogenesis may be the physiological function of the peripheral-type benzodiazepine receptor. These studies provide new insights into the previously unknown function of peripheral benzodiazepine receptors and should allow new investigations into the stimulation of steroidogenesis by endozepines and benzodiazepines in the brain and in certain peripheral tissues. PMID:2544879

  20. Adrenal Homografts in Mice, with special reference to `Immunological Adrenalectomy'

    PubMed Central

    Medawar, P. B.; Russell, P. S.


    Adrenal cortical grafts transplanted between members of an inbred strain of mice (`isografts') are held to be successful when they empower adrenalectomized mice to subsist upon a diet low in NaCl. By this criterion, in which due allowance must be made for the hypertrophy of accessory adrenal tissue, the intramuscular implantation of adrenal cortical shavings, free from medullary tissue, is a reliable method of grafting. The intravascular injection of dissociated cortical cells, though sometimes successful, is not reliable. The testis, the anterior chamber of the eye, and the brain will also serve as sites of transplantation, though less efficiently than muscle. Adrenal cortical grafts transplanted by the intramuscular method between members of different inbred strains of mice (`homografts') are unsuccessful. Homografts may, however, survive in the anterior chamber of the eye. Immunological tolerance may be procured in respect of adrenal cortical tissue: adult A-line mice into which CBA splenic cells have been injected shortly after birth will accept CBA adrenal homografts as readily as they accept isografts. It is accordingly argued that all the `transplantation antigens' possessed by a mouse's adrenal cortical tissue are also possessed by its spleen. Tolerant A-line mice subsisting upon homografts of CBA adrenal cortical tissue will die after adoptive immunization, i.e. after the injection of lymphoid cells taken from normal A-line mice which have been actively immunized against CBA tissues. It is shown that this procedure causes CBA tissue in the tolerant host to be destroyed; death is therefore attributed to an immunological `adrenalectomy'. Adrenal homografts transplanted between mice of unrelated strains behave essentially like skin homografts. No opinion is expressed upon whether or not adrenal homografts might survive their transplantation between mice belonging to strains which, though closely related, stand far enough apart for skin homografts to fail

  1. Silent corticotroph adenoma with adrenal cortical choristoma: a rare but distinct morphological entity.


    Mete, Ozgur; Ng, Thomas; Christie-David, Darshika; McMaster, Jacqueline; Asa, Sylvia L


    This report describes a case of pituitary adenoma with interspersed adrenal cortical cells. The pituitary cells were confirmed to be corticotrophs with Tpit and adrenocorticotropic hormone immunohistochemistry, whereas the adrenal cortical cells were verified to be such with steroidogenic factor-1 (SF-1), inhibin, calretinin, and Melan A staining. The presence of normal adrenal cortical cells in the heterotopic location of the sella fulfills the definition of choristoma. The origin of adrenal cortical cells within a pituitary adenoma remains unexplained. The important role of SF-1 in both pituitary and adrenal cortex may explain a relationship that supports the possibility of an abnormal proliferation and differentiation of uncommitted mesenchymal stem cells within the sella. However, it remains possible that misplaced adrenal cortical cells derived during embryogenesis give rise to this rare but distinct morphological entity that can pose a difficult diagnostic dilemma. The approach to differential diagnosis is discussed.

  2. Micropenis and congenital adrenal hypoplasia.


    Bourgeois, M J; Jones, B; Waagner, D C; Dunn, D


    Micropenis is often an early sign of congenital hypopituitarism. It has also been associated with congenital adrenal hypoplasia in infants with anencephaly and pituitary agenesis. This report is on two infants with micropenis and congenital adrenal hypoplasia. One presented with a similar clinical course and postmortem findings to previously reported cases of adrenal hypoplasia and pituitary agenesis. The other patient represents the first reported case of an infant with micropenis and congenital adrenal hypoplasia in the absence of pituitary agenesis. The histologic patterns of adrenal hypoplasia, as well as the etiologic and clinical implications of its association with micropenis, are discussed.

  3. Congenital adrenal hyperplasia


    ... or inappropriately). Congenital adrenal hyperplasia can affect both boys and girls. About 1 in 10,000 to 18,000 ... penis but normal testes Well-developed muscles Both boys and girls will be tall as children, but much shorter ...

  4. Immunological Studies on Adrenal Glands

    PubMed Central

    Milgrom, Felix; Witebsky, Ernest


    Rabbits injected with a bovine adrenal suspension incorporated into Freund adjuvants produced antibodies reacting in a variety of serological tests with extracts of bovine adrenals as well as with extracts of other bovine organs. The double diffusion gel precipitation procedure and absorption experiments revealed that part of these antibodies were specific for adrenal only. In immunoelectrophoretic analysis the adrenal-specific reaction appeared as a line on the anodal part of the electrophoretic field. When extraction was performed at 100° and the extracts autoclaved at 120°, the adrenal-specific antigen remained unaltered, whereas all but one of the non-adrenal-specific antigens (i.e. antigens shared by other bovine organs) were destroyed. The adrenal-specific antigen was localized predominantly, if not exclusively, in the medulla. A similar or identical antigen was found in the adrenals of sheep but not in those of any other species tested. The adrenal-specific antigen was precipitated by ethanol at 72 per cent concentration; it was not destroyed by 90 per cent phenol extraction. Re-dissolved ethanol precipitate of boiled bovine adrenal extract incorporated into Freund adjuvants elicited production of adrenal-specific antibodies when injected into rabbits. ImagesFIG. 2FIG. 3FIG. 4FIG. 5FIG. 8 PMID:14473880

  5. Knockout of the BK β2 subunit abolishes inactivation of BK currents in mouse adrenal chromaffin cells and results in slow-wave burst activity.


    Martinez-Espinosa, Pedro L; Yang, Chengtao; Gonzalez-Perez, Vivian; Xia, Xiao-Ming; Lingle, Christopher J


    Rat and mouse adrenal medullary chromaffin cells (CCs) express an inactivating BK current. This inactivation is thought to arise from the assembly of up to four β2 auxiliary subunits (encoded by the kcnmb2 gene) with a tetramer of pore-forming Slo1 α subunits. Although the physiological consequences of inactivation remain unclear, differences in depolarization-evoked firing among CCs have been proposed to arise from the ability of β2 subunits to shift the range of BK channel activation. To investigate the role of BK channels containing β2 subunits, we generated mice in which the gene encoding β2 was deleted (β2 knockout [KO]). Comparison of proteins from wild-type (WT) and β2 KO mice allowed unambiguous demonstration of the presence of β2 subunit in various tissues and its coassembly with the Slo1 α subunit. We compared current properties and cell firing properties of WT and β2 KO CCs in slices and found that β2 KO abolished inactivation, slowed action potential (AP) repolarization, and, during constant current injection, decreased AP firing. These results support the idea that the β2-mediated shift of the BK channel activation range affects repetitive firing and AP properties. Unexpectedly, CCs from β2 KO mice show an increased tendency toward spontaneous burst firing, suggesting that the particular properties of BK channels in the absence of β2 subunits may predispose to burst firing.

  6. Acute and chronic methyl mercury poisoning impairs rat adrenal and testicular function

    SciTech Connect

    Burton, G.V.; Meikle, A.W.


    Animals poisoned with methyl mercury (CH/sub 3/Hg) exhibit stress intolerance and decreased sexual activity, which suggest both adrenal and testicular dysfunction. Adrenal and testicular function was studied in male rats after treatment with CH/sub 3/Hg. In animals treated chronically, the adrenal glands were markedly hyperplastic with enlargement of the zona fasciculata. The mean basal serum levels of corticosterone were similar in experimental (17.8 and control (16.8 groups. However, with ether stress, experimental animals had a subnormal response, and the mean serum levels of corticosterone increased to only 23.9 compared to 40.6 in the controls. Exogenous ACTH stimulation produced a mean level of 19.0 in the CH/sub 3/Hg-treated animals and 49.7 in the controls. In vitro studies demonstrated a defect in the conversion of cholesterol to pregnenolone. A profound impairment in swimming was partially reversed with glucocorticoid therapy. In animals treated with CH/sub 3/Hg, serum testosterone was lower than normal in the basal state. Human chorionic gonadotropin stimulation increased the mean serum concentration of testosterone to 23.4 ng/ml in controls, but it was only 4.50 ng/ml in experimental animals. The data indicate that CH/sub 3/Hg poisoning impairs adrenal and testicular steroid hormone secretion, which accounts in part for the diminished stress tolerance and decreased sexual activity observed in CH/sub 3/Hg-intoxicated animals.

  7. Role of toll-like receptors and inflammation in adrenal gland insufficiency.


    Kanczkowski, Waldemar; Zacharowski, Kai; Bornstein, Stefan R


    Adrenal gland insufficiency - the clinical manifestation of deficient production or action of adrenal steroids - is a life-threatening disorder. Among many factors which can predispose to primary adrenal failure, an autoimmune adrenalitis and infectious agents play a major role. The initial host defense against bacterial infections is executed primarily by the pattern recognition receptors, e.g. Toll-like receptors (TLRs), expressed in cells from the innate immune system. Upon activation, TLRs have been found to regulate various levels of innate and adaptive immunity as well as control tissue inflammation. TLRs are implicated in adrenal cell turnover and steroidogenesis during inflammation. Therefore, TLRs play a crucial role in the activation of adrenal inflammation mediating adrenal gland dysfunction during septicemia.

  8. The presence of two cytochrome P450 aldosterone synthase mRNAs in the hamster adrenal.


    LeHoux, J G; Mason, J I; Bernard, H; Ducharme, L; LeHoux, J; Véronneau, S; Lefebvre, A


    We isolated a cDNA from a hamster adrenal cDNA library which was similar in sequence to those of the mouse and rat P450c18 cDNAs. The hamster P450c18 cDNA, however, was shorter than the rat and mouse P450c18 cDNAs at its 5'-end and the peptide leader sequence was absent. From a hamster genomic library we isolated and sequenced the first seven exons and a 5'-flanking region of the first P450c18 gene exon. With this information we were able to generate a P450c18 cDNA containing the peptide leader sequence using the polymerase chain reaction. Northern analyses were performed on adrenals from hamsters maintained on a low sodium diet for 0, 4, 7 and 10 days using a 32P-labeled sequence specific to P450c18; two mRNA bands were found at 2 and 3.4 kb. The intensity of both bands was increased about 3- to 5-fold under sodium restriction compared to controls. A distinct mRNA band of 2.3 kb hybridized with an oligonucleotide specific to P450(11) beta and its intensity did not change following low sodium intake. Immunoblotting analyses were performed using an antibovine adrenal P450(11) beta antibody that does not discriminate between P450(11) beta and P450c18 proteins. Three bands were detected at 52, 48 and 45 kDa in homogenate preparations of entire glands. Furthermore, the 45 kDa protein band was present in homogenates of the zona glomerulosa and absent in homogenates of the zone fasciculata-reticularis. In conclusion, these results show that the hamster adrenals express P450c18 as do mouse, rat and human adrenal glands. Furthermore, two P450c18 mRNAs, which are inducible by a low sodium intake, are present in the hamster adrenal vs one for the rat. The physiological role of these two hamster adrenal mRNA species remains to be elucidated.

  9. Extensive esterification of adrenal C19-delta 5-sex steroids to long-chain fatty acids in the ZR-75-1 human breast cancer cell line

    SciTech Connect

    Poulin, R.; Poirier, D.; Merand, Y.; Theriault, C.; Belanger, A.; Labrie, F.


    Estrogen-sensitive human breast cancer cells (ZR-75-1) were incubated with the 3H-labeled adrenal C19-delta 5-steroids dehydroepiandrosterone (DHEA) and its fully estrogenic derivative, androst-5-ene-3 beta,17 beta-diol (delta 5-diol) for various time intervals. When fractionated by solvent partition, Sephadex LH-20 column chromatography and silica gel TLC, the labeled cell components were largely present (40-75%) in three highly nonpolar, lipoidal fractions. Mild alkaline hydrolysis of these lipoidal derivatives yielded either free 3H-labeled DHEA or delta 5-diol. The three lipoidal fractions cochromatographed with the synthetic DHEA 3 beta-esters, delta 5-diol 3 beta (or 17 beta)-monoesters and delta 5-diol 3 beta,17 beta-diesters of long-chain fatty acids. DHEA and delta 5-diol were mainly esterified to saturated and mono-unsaturated fatty acids. For delta 5-diol, the preferred site of esterification of the fatty acids is the 3 beta-position while some esterification also takes place at the 17 beta-position. Time course studies show that ZR-75-1 cells accumulate delta 5-diol mostly (greater than 95%) as fatty acid mono- and diesters while DHEA is converted to delta 5-diol essentially as the esterified form. Furthermore, while free C19-delta 5-steroids rapidly diffuse out of the cells after removal of the precursor (3H)delta 5-diol, the fatty acid ester derivatives are progressively hydrolyzed, and DHEA and delta 5-diol thus formed are then sulfurylated prior to their release into the culture medium. The latter process however is rate-limited, since new steady-state levels of free steroids and fatty acid esters are rapidly reached and maintained for extended periods of time after removal of precursor, thus maintaining minimal concentrations of intracellular steroids.

  10. Genetic disorders involving adrenal development.


    Lin, Lin; Ferraz-de-Souza, Bruno; Achermann, John C


    The past decade has seen significant advances in our understanding of the genetic aetiology of several forms of adrenal failure that present in infancy or childhood. Several of these disorders affect adrenal development and are termed 'adrenal hypoplasia'. These conditions can be broadly divided into: (1) secondary forms of adrenal hypoplasia due to panhypopituitarism (e.g. HESX1, LHX4, SOX3) or abnormalities in ACTH synthesis (TPIT) or processing (e.g. POMC or PC1); (2) adrenal hypoplasia as part of an ACTH resistance syndrome [MC2R/ACTH receptor, MRAP, AAAS (triple A syndrome)], and (3) primary defects in the development of the adrenal gland itself (primary adrenal hypoplasia). Primary adrenal hypoplasia most commonly occurs in an X-linked form due to mutations in the nuclear receptor DAX1 (NR0B1) but can occur in a poorly understood recessive form or as part of the IMAGe (intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia, genitourinary anomalies) syndrome. Defining the molecular basis of these conditions can have significant clinical implications for management, counselling and presymptomatic diagnosis, as well as providing fascinating insight into normal and abnormal mechanisms of adrenal development in humans.

  11. Atrial natriuretic factor: radioimmunoassay and effects on adrenal and pituitary glands

    SciTech Connect

    Gutkowska, J.; Horky, K.; Schiffrin, E.L.; Thibault, G.; Garcia, R.; De Lean, A.; Hamet, P.; Tremblay, J.; Anand-Srivastava, M.B.; Januszewicz, P.


    A simple and sensitive radioimmunoassay was developed for measurement of immunoreactive atrial natriuretic factor (IR-ANF) in rat and human plasma and in rat atria. The two atria contain about 20 ANF per rat. The right atrium contained 2.5 times more ANF than did the left. Ether anesthesia and morphine markedly increased IR-ANF in rat plasma. The concentration of IR-ANF in plasma of clinically normal human subjects was 65.3 +/- 2.5 pg/ml. Paroxysmal tachycardia and rapid atrial pacing significantly increased IR-ANF in human plasma. Two- to seven-fold higher concentrations were found in coronary sinus blood than in the peripheral circulation. In the plasma of rats and humans, circulating ANF is probably a small-molecular-weight peptide. ANF acts on the adrenal and the pituitary. ANF inhibits aldosterone secretion from rat zona glomerulosa and steroid secretion by bovine adrenal zona glomerulosa and fasciculata. ANF stimulated the basal secretion of arginine vasopressin (AVP) in vitro and inhibited KCl-stimulated release of AVP.

  12. Immunolocalization of steroidogenic enzymes in equine fetal adrenal glands during mid-late gestation.


    Weng, Qiang; Tanaka, Yumiko; Taniyama, Hiroyuki; Tsunoda, Nobuo; Nambo, Yasuo; Watanabe, Gen; Taya, Kazuyoshi


    To elucidate the relationship between steroidogenic hormones and developing adrenal glands, we investigated the immunolocalization of steroidogenic enzymes in equine fetal adrenal glands during mid-late gestation. Fetal adrenal glands were obtained from three horses at 217, 225 and 235 days of gestation. Steroidogenic enzymes were immunolocalized using polyclonal antisera raised against bovine adrenal cholesterol side-chain cleavage cytochrome P450 (P450scc), human placental 3beta-hydroxysteroid dehydrogenase (3betaHSD), porcine testicular 17alpha-hydroxylase cytochrome P450 (P450c17) and human placental aromatase cytochrome P450 (P450arom). Histologically, cortex and medulla cells were clearly observed in the three fetal adrenal gland tissue samples. P450scc and P450c17 were identified in cortex cells close to medulla cells and in some medulla cells in the fetal adrenal glands. P450arom was present in both cortex and medulla cells in the fetal adrenal glands. However, 3betaHSD was not found in any of the equine fetal adrenal gland tissue samples. These results suggest that equine fetal adrenal glands have the ability to synthesize androgen and estrogen, which may play an important physiological role in the development of equine fetal adrenal glands.

  13. Pendrin localizes to the adrenal medulla and modulates catecholamine release.


    Lazo-Fernandez, Yoskaly; Aguilera, Greti; Pham, Truyen D; Park, Annie Y; Beierwaltes, William H; Sutliff, Roy L; Verlander, Jill W; Pacak, Karel; Osunkoya, Adeboye O; Ellis, Carla L; Kim, Young Hee; Shipley, Gregory L; Wynne, Brandi M; Hoover, Robert S; Sen, Shurjo K; Plotsky, Paul M; Wall, Susan M


    Pendrin (Slc26a4) is a Cl(-)/HCO3 (-) exchanger expressed in renal intercalated cells and mediates renal Cl(-) absorption. With pendrin gene ablation, blood pressure and vascular volume fall, which increases plasma renin concentration. However, serum aldosterone does not significantly increase in pendrin-null mice, suggesting that pendrin regulates adrenal zona glomerulosa aldosterone production. Therefore, we examined pendrin expression in the adrenal gland using PCR, immunoblots, and immunohistochemistry. Pendrin protein was detected in adrenal lysates from wild-type but not pendrin-null mice. However, immunohistochemistry and qPCR of microdissected adrenal zones showed that pendrin was expressed in the adrenal medulla, rather than in cortex. Within the adrenal medulla, pendrin localizes to both epinephrine- and norepinephrine-producing chromaffin cells. Therefore, we examined plasma catecholamine concentration and blood pressure in wild-type and pendrin-null mice under basal conditions and then after 5 and 20 min of immobilization stress. Under basal conditions, blood pressure was lower in the mutant than in the wild-type mice, although epinephrine and norepinephrine concentrations were similar. Catecholamine concentration and blood pressure increased markedly in both groups with stress. With 20 min of immobilization stress, epinephrine and norepinephrine concentrations increased more in pendrin-null than in wild-type mice, although stress produced a similar increase in blood pressure in both groups. We conclude that pendrin is expressed in the adrenal medulla, where it blunts stress-induced catecholamine release.

  14. Folliculo-stellate cells - potential mediators of the inflammaging-induced hyperactivity of the hypothalamic-pituitary-adrenal axis in healthy elderly individuals.


    Jovanović, Ivan; Ugrenović, Slađana; Ljubomirović, Miljana; Vasović, Ljiljana; Cukuranović, Rade; Stefanović, Vladisav


    Some evidence has suggested that, with age, the hypothalamic-pituitary-adrenal (HPA) axis becomes less resilient, leading to higher glucocorticoids nocturnal levels and a flattening of the circadian profiles. Such age-related changes in the activity of the HPA axis has overexposed the brain and peripheral organs to the effects of the glucocorticoids, increasing the morbidity and mortality rates of the elderly. Debate among scientists regarding the contributions of HPA axis age-related changes of impaired feedback regulation vs. direct overactivation persists. Supporters of impaired feedback regulation assumed that this effect might be the consequence of the hippocampal age-related neuronal loss and the reduction of the number of mineralocorticoid and glucocorticoid receptors. On the other hand, healthy elderly individuals are characterized by an increase of proinflammatory cytokines, including IL-1, IL-6, and TNF-α, and the development of a chronic low-grade inflammatory state, known as inflammaging. Cytokines central to inflammaging send signals to the brain, activate HPA axis, and, by increased cortisol secretion, down-regulate inflammaging in a process known as anti-inflammaging. Even as these cytokines act at the level of the hypothalamic paraventricular nucleus, they are hampered by the intact blood-brain barrier. Further, the corticotropes in the anterior pituitary do not express cytokine receptors, and the density of folliculo-stellate cells generally increases with age. Therefore, we assumed that folliculo-stellate cells were the target structures through which the elevated levels of cytokines, as a part of the inflammaging phenomenon, would cause the overactivation of the HPA axis in healthy elderly individuals. Folliculo-stellate cells are non-endocrine cells that were originally considered to act as supporting cells for the endocrine cells. Despite the fact that FS cells do not produce any of the established hormones of the anterior pituitary, they

  15. CT demonstration of bilateral adrenal hemorrhage

    SciTech Connect

    Ling, D.; Korobkin, M.; Silverman, P.M.; Dunnick, N.R.


    Bilateral adrenal hemorrhage with subsequent adrenal insufficiency is a recognized complication of anticoagulant therapy. Because the clinical manifestations are often nonspecific, the antemortem diagnosis of adrenal hemorrhage has been a difficult clinical problem. Computed tomography (CT) provides detailed images of the adrenal glands that are not possible with conventional imaging methods. The CT findings of bilateral adrenal hemorrhage in an anticoagulated patient are reported.

  16. SAH pituitary adrenal dysfunction.


    Vespa, P


    Disruption of the hypothalamic-pituitary-adrenal axis may occur after aneurysmal subarachnoid hemorrhage, resulting in hypopituitarism. An electronic literature search was conducted to identify articles with English-language abstracts published between 1980 and March 2011 that addressed hypothalamic-pituitary-adrenal axis insufficiency and hormone replacement. A total of 18 observational and prospective, randomized studies were selected for this review. Limited data are available evaluating pituitary effects during the acute stage after subarachnoid hemorrhage, with inconsistent results reported. Overall, acutely after subarachnoid hemorrhage, cortisol levels may initially be supranormal, decreasing toward normal levels over time. During the months to years after subarachnoid hemorrhage, pituitary deficiency may occur in up to one in three patients. Limited data suggest modest outcome benefits with fludrocortisone and no benefit or harm from corticosteroids. PMID:21800209

  17. Thyroid and adrenal relationships

    PubMed Central

    Parsons, Victor; Ramsay, Ian


    A brief review of the actions of adrenal medullary and thyroid hormones is presented and the ways in which they interact are examined. It is concluded that thyroid hormone produces the necessary intracellular environment without which the steady state and emergency actions of cathecholamines would be vitiated. In hyperthyroidism the increased concentration of thyroid hormones results in a lowering of the threshold for catecholamine action. For this reason it is possible to alleviate many of the symptoms of thyrotoxicosis by means of drugs which block β-adrenergic receptors. Attention is also drawn to the simultaneous occurrence of thyroid and adrenal disease, in the hope that this will encourage the search for further links in this field of endocrinology. PMID:5655216

  18. Lycium europaeum fruit extract: antiproliferative activity on A549 human lung carcinoma cells and PC12 rat adrenal medulla cancer cells and assessment of its cytotoxicity on cerebellum granule cells.


    Ghali, Wafa; Vaudry, David; Jouenne, Thierry; Marzouki, Mohamed Nejib


    Cancer is a major worldwide health problem and one of the leading causes of death either in developed or developing countries. Plant extracts and derivatives have always been used for various disease treatments and many anticancer agents issued from plants and vegetables are clinically recognized and used all over the world. Lycium europaeum (Solanaceae) also called "wolfberry" was known since ancient times in the Mediterranean area as a medicinal plant and used in several traditional remedies. The Lycium species capacity of reducing the incidence of cancer and also of halting or reserving the growth of cancer was reported by traditional healers. In this study, the antiproliferative capacity, protective properties, and antioxidant activity of the hydro-alcoholic fruit extract of Lycium europaeum were investigated. Results showed that Lycium extract exhibits the ability to reduce cancer cell viability, inhibits proliferation, and induces apoptosis in A549 human lung cancer cells and PC12 rat adrenal medulla cancer cells, in a concentration- and time-dependent manner. Cytotoxic effect on normal rat cerebellum granule cells was assessed to be nonsignificant. Results also showed that Lycium fruit extract protected lipids, proteins, and DNA against oxidative stress damages induced by H2O2 via scavenging reactive oxygen species.

  19. Radioguided Adrenal Surgery

    PubMed Central

    Deus, Javier; Millera, Alfonso; Andrés, Alejandro; Prats, Enrique; Gil, Ismael; Suarez, Manuel; Salcini, José L.; Lahoz, Manuel


    Abstract The laparoscopic adrenalectomy is considered as the procedure of choice for the treatment of adrenal hyperplasia and tumor lesions. However, some special situations may limit the use of this method due to the difficulty to locate the gland and perform the lesion excision. We analyze 2 patients of a left adrenal tumor, explaining how they have overcome the difficulties in both situations. The first case was a patient with a history of intra-abdominal surgery and the other patient suffered from severe obesity. We performed with the use of the gamma probe, and the 2 cases, was of great help to access and glandular localization. The help of gamma probe test was achieved in the surgical bed, that removal was complete. The use of the portable gamma probe facilitated the access to the left adrenal gland as well as conducting the glandular excision without delay, despite the difficulties due to the intra abdominal surgery caused by the previous surgery, and in the case of severe obesity. PMID:26426608

  20. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    PubMed Central

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.


    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  1. New Directions for the Treatment of Adrenal Insufficiency

    PubMed Central

    Ruiz-Babot, Gerard; Hadjidemetriou, Irene; King, Peter James; Guasti, Leonardo


    Adrenal disease, whether primary, caused by defects in the hypothalamic–pituitary–adrenal (HPA) axis, or secondary, caused by defects outside the HPA axis, usually results in adrenal insufficiency, which requires lifelong daily replacement of corticosteroids. However, this kind of therapy is far from ideal as physiological demand for steroids varies considerably throughout the day and increases during periods of stress. The development of alternative curative strategies is therefore needed. In this review, we describe the latest technologies aimed at either isolating or generating de novo cells that could be used for novel, regenerative medicine application in the adrenocortical field. PMID:25999916

  2. Adrenal Schwannoma: A Rare Incidentaloma.


    Kumar, Sumit; Karthikeyan, Vilvapathy S; Manohar, Chikkamoga S; Sreelakshmi, K; Shivalingaiah, Maregowda


    Adrenal schwannomas are very rare tumours that are difficult to diagnose preoperatively. A 42-year-old male presented with epigastric pain and indigestion. He had history of repeated operations for recurrent facial swelling on both sides of face diagnosed as Angiolymphoid Hyperplasia with Eosinophilia (ALHE). Physical examination revealed right facial swelling. Laboratory tests showed no evidence of hormonal hypersecretion. CECT abdomen showed a well-defined heterogenously enhancing right adrenal mass (5x4cm). Patient underwent right adrenalectomy. Histopathology revealed adrenal schwannoma, confirmed by immunohistochemistry (IHC) showing diffuse expression of S-100. Fine-needle aspiration biopsy of facial lesion confirmed ALHE recurrence. Less than 35 cases have been reported. Diagnosis of adrenal schwannoma on imaging studies is very difficult and surgical resection when performed for non-functioning adrenal masses >4cm clinches the diagnosis. Adrenal schwannoma is highly uncommon and was incidentally associated with recurrent ALHE. PMID:27656499

  3. Primary Non Hodgkin’s Lymphoma of Left Adrenal Gland – A Rare Presentation

    PubMed Central

    Kaur, Paramjeet; Chauhan, Ashok K; Kataria, Sant Parkash; Bansal, Nupur


    Primary adrenal lymphoma is rare and constitutes for 3% of extranodal lymphoma cases. Approximately 70% of patients present with bilateral disease and have adrenal insufficiency. Prognosis of primary adrenal lymphoma (PAL) is poor, most of patient die within one year of diagnosis. Moreover, there are no standard treatment protocols on such cases. Patients are generally treated with regimens similar to other nonhodgkin lymphoma which includes surgery, combination chemotherapy and or radiotherapy. We are presenting a successfully treated case of primary diffuse large B cell non Hodgkin lymphoma of adrenal gland in a 57-year-old patient. The patient had unilateral adrenal involvement (left adrenal gland), without adrenal insufficiency and normal Serum lactate dehyrogenase level. The patient was treated with left adrenalectomy followed by combination chemotherapy. Two years after diagnosis and treatment the patient is disease free on clinical and imaging studies. PMID:26023630

  4. Etiopathogeny of Primary Adrenal Hypercortisolism.


    Vélayoudom-Céphise, Fritz-Line; Haissaguerre, Magali; Tabarin, Antoine


    Primary adrenal hypercortisolism is mainly due to cortisol-producing adrenocortical adenomas, bilateral micronodular or macronodular disease, and adrenal carcinomas. Important advances in the pathophysiology of primary adrenal hypercortisolism have been made in the last few years, partly through the use of new molecular biology tools. Most adrenal abnormalities leading to increased cortisol production involve somatic or germinal mutations of genes encoding elements of the cyclic AMP/protein kinase A signaling pathway, as shown in adrenal adenomas in 2014. One peculiar condition is primary macronodular adrenal hyperplasia (PMAH), which has given rise to new pathophysiological concepts such as regulation of cortisol secretion by illegitimate ligands through aberrant expression of G protein-coupled transmembrane receptors in adrenal nodules and stimulation of cortisol production by local adrenocorticotropic hormone production through autocrine/paracrine mechanisms. These findings provide a basis for the development of targeted therapies as an alternative to surgery. The recent identification of germinal mutations of ARMC5 in PMAH raises the possibility that this is much more frequently an inherited disease than previously suspected. It also offers the possibility of earlier diagnosis of PMAH by genetic screening and, hopefully, of earlier intervention to prevent the onset of hypercortisolism and its complications. The pathophysiology of Cushing's syndrome associated with a subset of adrenal adenomas, including subclinical cortisol-secreting incidentalomas and adrenal carcinomas, remains to be determined. PMID:27212135

  5. Adrenal crisis secondary to bilateral adrenal haemorrhage after hemicolectomy

    PubMed Central

    Tsang, Venessa H M; Kabir, Shahrir; Ip, Julian C Y


    Summary Adrenal haemorrhage is a rare cause of adrenal crisis, which requires rapid diagnosis, prompt initiation of parenteral hydrocortisone and haemodynamic monitoring to avoid hypotensive crises. We herein describe a case of bilateral adrenal haemorrhage after hemicolectomy in a 93-year-old female with high-grade colonic adenocarcinoma. This patient’s post-operative recovery was complicated by an acute hypotensive episode, hypoglycaemia and syncope, and subsequent computed tomography (CT) scan of the abdomen revealed bilateral adrenal haemorrhage. Given her labile blood pressure, intravenous hydrocortisone was commenced with rapid improvement of blood pressure, which had incompletely responded with fluids. A provisional diagnosis of hypocortisolism was made. Initial heparin-induced thrombocytopenic screen (HITTS) was positive, but platelet count and coagulation profile were both normal. The patient suffered a concurrent transient ischaemic attack with no neurological deficits. She was discharged on a reducing dose of oral steroids with normal serum cortisol levels at the time of discharge. She and her family were educated about lifelong steroids and the use of parenteral steroids should a hypoadrenal crisis eventuate. Learning points: Adrenal haemorrhage is a rare cause of hypoadrenalism, and thus requires prompt diagnosis and management to prevent death from primary adrenocortical insufficiency. Mechanisms of adrenal haemorrhage include reduced adrenal vascular bed capillary resistance, adrenal vein thrombosis, catecholamine-related increased adrenal blood flow and adrenal vein spasm. Standard diagnostic assessment is a non-contrast CT abdomen. Intravenous hydrocortisone and intravenous substitution of fluids are the initial management. A formal diagnosis of primary adrenal insufficiency should never delay treatment, but should be made afterwards.

  6. GATA transcription factors in adrenal development and tumors.


    Parviainen, Helka; Kiiveri, Sanne; Bielinska, Malgorzata; Rahman, Nafis; Huhtaniemi, Ilpo T; Wilson, David B; Heikinheimo, Markku


    Of the six GATA transcription factors, GATA-4 and GATA-6 are expressed in the mouse and human adrenal with distinct developmental profiles. GATA-4 is confined to the fetal cortex, i.e. to the less differentiated proliferating cells, while GATA-6 is expressed both in the fetal and adult adrenal. In vitro, GATA-4 regulates inhibin-alpha and steroidogenic factor-1 implicated in normal adrenal function. GATA-6 probably has roles in the development and differentiation of adrenocortical cells, and in the regulation of steroidogenesis. GATA-4 expression is dramatically upregulated and GATA-6 downregulated in gonadotropin dependent mouse adrenocortical tumors. This is accompanied by the appearance of luteinizing hormone receptor (LHR). In vitro, GATA-4 transactivates LHR promoter, and gonadotropins upregulate GATA-4 levels. Human adrenal tumors occasionally express GATA-4, whereas GATA-6 levels are usually lower than normal.

  7. Renal and adrenal tumors: Pathology, radiology, ultrasonography, therapy, immunology

    SciTech Connect

    Lohr, E.; Leder, L.D.


    Aspects as diverse as radiology, pathology, urology, pediatrics and immunology have been brought together in one book. The most up-do-date methods of tumor diagnosis by CT, NMR, and ultrasound are covered, as are methods of catheter embolization and radiation techniques in case of primarily inoperable tumors. Contents: Pathology of Renal and Adrenal Neoplasms; Ultrasound Diagnosis of Renal and Pararenal Tumors; Computed-Body-Tomography of Renal Carcinoma and Perirenal Masses; Magnetic Resonance Imaging of Renal Mass Lesions; I-125 Embolotherapy of Renal Tumors; Adrenal Mass Lesions in Infants and Children; Computed Tomography of the Adrenal Glands; Scintigraphic Studies of Renal and Adrenal Function; Surgical Management of Renal Cell Carcinoma; Operative Therapy of Nephroblastoma; Nonoperative Treatment of Renal Cell Carcinoma; Prenatal Wilms' Tumor; Congenital Neuroblastoma; Nonsurgical Management of Wilms' Tumor; Immunologic Aspects of Malignant Renal Disease.

  8. Non-Functional Adrenal Gland Ganglioneuroma Masquerading as Chronic Calculus Cholecystitis.


    Patel, Rashmi D; Vanikar, Aruna V; Trivedi, H L


    Adrenal ganglioneuromas in young adults are rare and ill-understood. We report an incidentally detected adrenal gland tumor diagnosed as ganglioneuroma (mature type) in 33 years old man who presented with vomiting and epigastric pain for 2 months. Histopathology examination revealed a well-encapsulated benign tumor of mature ganglion cells and Schwann-like cells arranged in fascicles, staining strongly with NSE and s-100 proteins, with adjacent unremarkable adrenal cortex and medulla. PMID:27608876

  9. Expression of ghrelin in human fetal adrenal glands and paraadrenal nerve ganglions.


    Obara-Moszyńska, Monika; Kedzia, Andrzej; Chmielnicka-Kopaczyk, Maria


    The aim of this paper was assessment of location, expression and role of ghrelin in the development and maturation of human fetal adrenal glands and paraadrenal nerve ganglions. Immunohistochemistry was used. The strongest expression of ghrelin was detected in the fetal zone of the adrenal glands, in the neuroepithelial cells of the medullar portion of the adrenals and in few nerve ganglion cells. Ghrelin takes part in molecular processes of proliferation and maturation, and does not influence on steroidogenesis.

  10. Traumatic and non-traumatic adrenal emergencies.


    Chernyak, Victoria; Patlas, Michael N; Menias, Christine O; Soto, Jorge A; Kielar, Ania Z; Rozenblit, Alla M; Romano, Luigia; Katz, Douglas S


    Multiple traumatic and non-traumatic adrenal emergencies are occasionally encountered during the cross-sectional imaging of emergency department patients. Traumatic adrenal hematomas are markers of severe polytrauma, and can be easily overlooked due to multiple concomitant injuries. Patients with non-traumatic adrenal emergencies usually present to an emergency department with a non-specific clinical picture. The detection and management of adrenal emergencies is based on cross-sectional imaging. Adrenal hemorrhage, adrenal infection, or rupture of adrenal neoplasm require immediate detection to avoid dire consequences. More often however, adrenal emergencies are detected incidentally in patients being investigated for non-specific acute abdominal pain. A high index of suspicion is required for the establishment of timely diagnosis and to avert potentially life-threatening complications. We describe cross-sectional imaging findings in patients with traumatic and non-traumatic adrenal hemorrhage, adrenal infarctions, adrenal infections, and complications of adrenal masses.

  11. Adrenal imaging with technetium-99m-labelled low density lipoproteins

    SciTech Connect

    Isaacsohn, J.L.; Lees, A.M.; Lees, R.S.; Strauss, H.W.; Barlai-Kovach, M.; Moore, T.J.


    Evaluation of adrenal cortical function by external imaging is currently accomplished by injection of radiolabelled analogs of cholesterol. Although the adrenals do utilized exogenous cholesterol for steroid hormone synthesis, the cholesterol is delivered to the glands not as free cholesterol but through the uptake of low density lipoproteins (LDL), which are subsequently degraded within the adrenal cortical cells to provide cholesterol. Thus, we sought to assess the use of /sup 99m/Tc-labelled LDL injected into rabbits to obtain external images of the adrenal glands. Adrenal images of all nine rabbits tested were obtained within 18 to 21 hours after injection of /sup 99m/Tc-LDL. Seven of the rabbits were subjected to adrenal cortical suppression with dexamethasone and then all nine rabbits were imaged a second time. In the untreated animals, visualization of the adrenal glands was accompanied by normal serum cortisol concentrations and accumulation of radiolabel in the adrenals, whereas in the dexamethasone-treated animals, lack of visualization of the adrenal glands was correlated with low serum cortisols, and greatly decreased accumulation of the radionuclide in the adrenals. These findings demonstrate for the first time that LDL, when labelled with /sup 99m/Tc, can be used to evaluate adrenal cortical function by external imaging.

  12. Heterogeneous distribution of exocytotic microdomains in adrenal chromaffin cells resolved by high-density diamond ultra-microelectrode arrays

    PubMed Central

    Gosso, Sara; Turturici, Marco; Franchino, Claudio; Colombo, Elisabetta; Pasquarelli, Alberto; Carbone, Emilio; Carabelli, Valentina


    Here we describe the ability of a high-density diamond microelectrode array targeted to resolve multi-site detection of fast exocytotic events from single cells. The array consists of nine boron-doped nanocrystalline diamond ultra-microelectrodes (9-Ch NCD-UMEA) radially distributed within a circular area of the dimensions of a single cell. The device can be operated in voltammetric or chronoamperometric configuration. Sensitivity to catecholamines, tested by dose–response calibrations, set the lowest detectable concentration of adrenaline to ∼5 μm. Catecholamine release from bovine or mouse chromaffin cells could be triggered by electrical stimulation or external KCl-enriched solutions. Spikes detected from the cell apex using carbon fibre microelectrodes showed an excellent correspondence with events measured at the bottom of the cell by the 9-Ch NCD-UMEA, confirming the ability of the array to resolve single quantal secretory events. Subcellular localization of exocytosis was provided by assigning each quantal event to one of the nine channels based on its location. The resulting mapping highlights the heterogeneous distribution of secretory activity in cell microdomains of 12–27 μm2. In bovine chromaffin cells, secretion was highly heterogeneous with zones of high and medium activity in 54% of the cell surface and zones of low or no activity in the remainder. The ‘non-active’ (‘silent’) zones covered 24% of the total and persisted for 6–8 min, indicating stable location. The 9-Ch NCD-UMEA therefore appears suitable for investigating the microdomain organization of neurosecretion with high spatial resolution. PMID:24879870

  13. Bilateral adrenal EBV-associated smooth muscle tumors in a child with a natural killer cell deficiency

    PubMed Central

    Shaw, Rachel K.; Issekutz, Andrew C.; Fraser, Robert; Schmit, Pierre; Morash, Barb; Monaco-Shawver, Linda; Orange, Jordan S.


    EBV-associated smooth muscle tumors are found in immunocompromised patients, most commonly HIV/AIDS. We present a 12-year-old girl with the first documented case of EBV-related smooth muscle tumors in the presence of a rare classic NK cell deficiency. This sheds light on the role of NK cells in controlling EBV-related smooth muscle tumors. PMID:22427204

  14. Characterization of the LPS-induced inflammation of the adrenal gland in mice.


    Kanczkowski, Waldemar; Chatzigeorgiou, Antonios; Samus, Maryna; Tran, Nguyen; Zacharowski, Kai; Chavakis, Triantafyllos; Bornstein, Stefan R


    Systemic administration of endotoxin, which closely mimics the bacteria-induced systemic inflammatory response syndrome (SIRS) can ultimately lead to organ failure. Adrenal gland insufficiency is frequently diagnosed in critically ill patients; however, the underlying mechanisms are still unclear. In the present study, we studied comprehensively the characteristics of adrenal gland dysregulation, including inflammation, leukocyte infiltration and cell death in the adrenal glands in the course of LPS-induced systemic inflammation in mice. LPS enhanced expression of many proinflammatory cytokines, chemokines and adhesion molecules, which resulted in rapid recruitment of leukocytes into the adrenal gland. Furthermore, LPS-mediated inflammation was associated with increased apoptosis of adrenocortical and chromaffin cells. Our results performed in mice, suggest that LPS-induced adrenal gland inflammation and cell death might be mechanisms potentially involved in the adrenal gland dysfunction in patients with sepsis.

  15. Three dimensional visualization and fractal analysis of mosaic patches in rat chimeras: cell assortment in liver, adrenal cortex and cornea.


    Iannaccone, Stephen; Zhou, Yue; Walterhouse, David; Taborn, Greg; Landini, Gabriel; Iannaccone, Philip


    The production of organ parenchyma in a rapid and reproducible manner is critical to normal development. In chimeras produced by the combination of genetically distinguishable tissues, mosaic patterns of cells derived from the combined genotypes can be visualized. These patterns comprise patches of contiguously similar genotypes and are different in different organs but similar in a given organ from individual to individual. Thus, the processes that produce the patterns are regulated and conserved. We have previously established that mosaic patches in multiple tissues are fractal, consistent with an iterative, recursive growth model with simple stereotypical division rules. Fractal dimensions of various tissues are consistent with algorithmic models in which changing a single variable (e.g. daughter cell placement after division) switches the mosaic pattern from islands to stripes of cells. Here we show that the spiral pattern previously observed in mouse cornea can also be visualized in rat chimeras. While it is generally held that the pattern is induced by stem cell division dynamics, there is an unexplained discrepancy in the speed of cellular migration and the emergence of the pattern. We demonstrate in chimeric rat corneas both island and striped patterns exist depending on the age of the animal. The patches that comprise the pattern are fractal, and the fractal dimension changes with the age of the animal and indicates the constraint in patch complexity as the spiral pattern emerges. The spiral patterns are consistent with a loxodrome. Such data are likely to be relevant to growth and cell division in organ systems and will help in understanding how organ parenchyma are generated and maintained from multipotent stem cell populations located in specific topographical locations within the organ. Ultimately, understanding algorithmic growth is likely to be essential in achieving organ regeneration in vivo or in vitro from stem cell populations.

  16. ACTH-induced caveolin-1 tyrosine phosphorylation is related to podosome assembly in Y1 adrenal cells.


    Colonna, Cecilia; Podestá, Ernesto J


    Y1 adrenocortical cells respond to ACTH with a characteristic rounding-up that facilitates cAMP signaling, critical for transport of cholesterol to the mitochondria and increase in steroid secretion. We here demonstrate that caveolin-1 participates in coupling activation of protein kinase A (PKA) to the control of cell shape. ACTH/8-Br-cAMP induced reorganization of caveolin-1-positive structures in correlation with the cellular rounding-up. Concomitant with this change, there was an increase in the phosphorylation of caveolin-1 (Tyr-14) localized at focal adhesions (FA) with reorganization of FA to rounded, ringlike structures. Colocalization with phalloidin showed that phosphocaveolin is present at the edge of actin filaments and that after ACTH stimulation F-actin dots at the cell periphery become surrounded by phosphocaveolin-1. These observations along with electron microscopy studies revealed these structures as podosomes. Podosome assembly was dependent on both PKA and tyrosine kinase activities because their formation was impaired after treatment with specific inhibitors [myristoylated PKI (mPKI) or PP2, respectively] previous to ACTH/8-Br-cAMP stimulation. These results show for the first time that ACTH induces caveolin-1 phosphorylation and podosome assembly in Y1 cells and support the view that the morphological and functional responses to PKA activation in steroidogenic cells are related to cytoskeleton dynamics.

  17. ACTH-induced caveolin-1 tyrosine phosphorylation is related to podosome assembly in Y1 adrenal cells

    SciTech Connect

    Colonna, Cecilia . E-mail:; Podesta, Ernesto J.


    Y1 adrenocortical cells respond to ACTH with a characteristic rounding-up that facilitates cAMP signaling, critical for transport of cholesterol to the mitochondria and increase in steroid secretion. We here demonstrate that caveolin-1 participates in coupling activation of protein kinase A (PKA) to the control of cell shape. ACTH/8-Br-cAMP induced reorganization of caveolin-1-positive structures in correlation with the cellular rounding-up. Concomitant with this change, there was an increase in the phosphorylation of caveolin-1 (Tyr-14) localized at focal adhesions (FA) with reorganization of FA to rounded, ringlike structures. Colocalization with phalloidin showed that phosphocaveolin is present at the edge of actin filaments and that after ACTH stimulation F-actin dots at the cell periphery become surrounded by phosphocaveolin-1. These observations along with electron microscopy studies revealed these structures as podosomes. Podosome assembly was dependent on both PKA and tyrosine kinase activities because their formation was impaired after treatment with specific inhibitors [myristoylated PKI (mPKI) or PP2, respectively] previous to ACTH/8-Br-cAMP stimulation. These results show for the first time that ACTH induces caveolin-1 phosphorylation and podosome assembly in Y1 cells and support the view that the morphological and functional responses to PKA activation in steroidogenic cells are related to cytoskeleton dynamics.

  18. Beacon[47-73] inhibits glucocorticoid secretion and growth of cultured rat and human adrenocortical cells.


    Ziolkowska, Agnieszka; Carraro, Gianni; Rebuffat, Piera; Spinazzi, Raffaella; Nussdorfer, Gastone G; Rucinski, Marcin; Malendowicz, Ludwik K


    Evidence has been recently provided that beacon, an ubiquitin-like protein overexpressed in the hypothalamus of Israeli sand rat, is also expressed in several endocrine glands of the Wistar rat, including adrenal cortex. Moreover, it has been shown that the in vivo administration of beacon[47-73] (hereinafter, beacon) evokes within 60 min a marked decrease in the plasma concentrations of ACTH and corticosterone. Hence, we have investigated the effect of beacon (4x10(-9) or 4x10(-7) M) on the secretion and growth of cultured rat and human zona fasciculata/reticularis (ZF/R) cells. Reverse transcription-polymerase chain reaction detected beacon mRNA in all human adrenal cortexes examined. A 3-h exposure to beacon was ineffective, but prolonged (24 and 96 h) exposures significantly lowered basal corticosterone and cortisol secretion from cultured rat and human ZF/R cells, respectively. Moreover, beacon (4x10(-7) M) counteracted the secretagogue action of 10(-8) M ACTH on cultured cells. The 96-h exposure to beacon concentration-dependently decreased basal proliferation rate of cultured cells, without inducing significant changes in the number of apoptotic and necrotic cells. Beacon (4x10(-7) M) significantly inhibited the proliferogenic effect of 10(-8) M adrenomedullin. In light of the involvement of ubiquitin-like proteins in the control of cell cycle and protein sorting and degradation, the hypothesis is advanced that the inhibitory effect of beacon on the secretion and growth of cultured rat ZF/R cells may be connected to its stimulating effect on proteolysis of steroidogenic enzymes and proteins involved in cell replication.

  19. [Morphometry of the adrenals].


    Chumachenko, P A


    The authors report on the method of determination of the weight indices of the adrenyl gland glomerular, testicular-reticular and medullar zones with a spheroid shape; it is substantiated by mathematical analysis of a plasticine model of the adrenal gland, whose characteristics approached the actual ones. The method was particularly accurate in determination of the weight of the fascicular-reticular and glomerular zones, and less--in determination of the weight of the medullary layer, the method's error being 0.6-0.9% in the first case, 2.7-3.5% in the second and 5.3-6.4 in the last. PMID:884280

  20. Enhanced Ca(2+)-induced Ca(2+) release from intracellular stores contributes to catecholamine hypersecretion in adrenal chromaffin cells from spontaneously hypertensive rats.


    Segura-Chama, Pedro; López-Bistrain, Patricia; Pérez-Armendáriz, Elia Martha; Jiménez-Pérez, Nicolás; Millán-Aldaco, Diana; Hernández-Cruz, Arturo


    Adrenal chromaffin cells (CCs) from spontaneously hypertensive rats (SHRs) secrete more catecholamine (CA) upon stimulation than CCs from normotensive Wistar Kyoto rats (WKY). Unitary CA exocytosis events, both spontaneous and stimulated, were amperometrically recorded from cultured WKY and SHR CCs. Both strains display spontaneous amperometric spikes but SHR CCs produce more spikes and of higher mean amplitude. After a brief stimulation with high K(+) or caffeine which produces voltage-gated Ca(2+) influx or intracellular Ca(2+) release, respectively, more spikes and of greater mean amplitude and unitary charge were recorded in SHR CCs. Consequently, peak cumulative charge was ~2-fold higher in SHR CCs. Ryanodine (10 μM), a specific blocker of the ryanodine receptors reduced depolarization-induced peak cumulative charge by ~10 % in WKY and ~77 % in SHR CCs, suggesting, a larger contribution of Ca(2+)-induced Ca(2+) release to CA exocytosis in SHR CCs. Accordingly, Ca(2+) imaging showed larger [Ca(2+)]i signals induced both by depolarization and caffeine in SHR CCs. Distribution amplitude histograms showed that small amperometric spikes (0-50 pA) are more frequent in WKY than in SHR CCs. Conversely, medium (50-190 pA) and large (190-290 pA) spikes are more numerous in SHR than in WKY CCs. This study reveals that the enhanced CA secretion in SHR CCs results from a combination of (1) larger depolarization-induced Ca(2+) transients, due to a greater Ca(2+)-induced intracellular Ca(2+) release, (2) more exocytosis events per time unit, and (3) a greater proportion of medium and large amperometric spikes probably due to a higher mean CA content per granule. Enhanced CA release by excessive amplification by Ca(2+) induced Ca(2+) release and larger granule catecholamine content contributes to the increased CA plasma levels and vasomotor tone in SHRs. PMID:25791627

  1. Adrenal hemangioma: a case report.


    Auh, Y H; Anand, J; Zirinsky, K; Kazam, E


    Adrenal hemangioma is a very rare tumor. Presented is the 18th case proved by autopsy or surgery reported in world literature. The tumor was incidentally discovered at autopsy. Unless this tumor has characteristic calcifications, phlebolith or phlebolithlike, its computed tomography appearance is nonspecific. Therefore, by computed tomography this tumor cannot be differentiated from other primary or secondary adrenal tumors. PMID:3943357

  2. Primary bilateral adrenal non-Hodgkin's lymphoma associated with normal adrenal function.


    Gu, Bin; Ding, Qiang; Xia, Guowei; Fang, Zujun; Fang, Jie; Jiang, Haowen; Yao, Mengshu


    Primary bilateral adrenal non-Hodgkin's lymphoma is rare. Adrenal insufficiency or adrenal failure as a result of tumor destruction is the main pathophysiological change of most cases. Normal adrenal function despite bulky bilateral adrenal masses is extremely rare. We present a case of primary bilateral adrenal non-Hodgkin's lymphoma associated with normal adrenal function. Positron emission tomography-computed tomography is helpful to the diagnosis.

  3. Giant adrenal cyst: case study

    PubMed Central

    Carsote, M; Chirita, P; Terzea, D; Paun, S; Beuran, M


    One of the rarest situations regarding an adrenal incidentaloma is an adrenal cyst. We present the case of a 61Z–year old male patient diagnosed with peritonitis. During surgery, a right adrenal tumor of 2 cm is discovered. The patient was referred to endocrinology. 6 months later the diameter of the tumor is 7 times bigger than the initial stage. It has no secretory phenotype, except for the small increase of serum aldosterone and the 24–h 17–ketosteroids. Open right adrenalectomy is performed and a cyst of 15 cm is removed. The evolution after surgery is good. The pathological exam reveals an adrenal cyst with calcifications and osteoid metaplasia. The immunohistochemistry showed a positive reaction for CD34 and ACT in the vessels and VIM in the stroma. The adrenal cysts are not frequent and represent a challenge regarding the preoperative diagnostic and surgical procedure of resection. The pathological exam highlights the major aspects. PMID:20945822

  4. Cyclic AMP-dependent phosphorylation modifies the gating properties of L-type Ca2+ channels in bovine adrenal chromaffin cells.


    Doupnik, C A; Pun, R Y


    We investigated the effects of cAMP-dependent phosphorylation on the voltage- and time-dependent gating properties of Ca2+ channel currents recorded from bovine adrenal chromaffin cells under whole-cell voltage clamp. Extracellular perfusion with the membrane-permeant activator of cAMP-dependent protein kinase, 8-bromo(8-Br)-cAMP (1 mM), caused a 49%, 29%, and 21% increase in Ca2+ current (ICa) amplitudes evoked by voltage steps to 0, +10, and +20 mV respectively (mean values from eight cells, p less than or equal to 0.05). Analysis of voltage-dependent steady-state activation (m infinity) curves revealed a 0.70 +/- 0.27 charge increase in the activation-gate valency (zm) following 8-Br-cAMP perfusion. Similar responses were observed when Ba2+ was the charge carrier, where zm was increased by 1.33 +/- 0.34 charges (n = 8). The membrane potential for half activation (V1/2) was also significantly shifted 6 mV more negative for IBa (mean, n = 8). The time course for IBa (and ICa) activation was well described by second-order m2 kinetics. The derived time constant for activation (tau m) was voltage-dependent, and the tau m/V relation shifted negatively after 8-Br-cAMP treatment. Ca2+ channel gating rates were derived from the tau m and m infinity 2 values according to a Hodgkin-Huxley type m2 activation process. The forward rate (alpha m) for channel activation was increased by 8-Br-cAMP at membrane potentials greater than or equal to 0 mV, and the backward rate (beta m) decreased at potentials less than or equal to + 10 mV. Time-dependent inactivation of ICa consisted of a slowly decaying component (tau h approximately 300 ms) and a "non-inactivating" steady-state component. The currents contributed by the two inactivation processes displayed different voltage dependences, the effects of 8-Br-cAMP being exclusively on the slowly inactivating L-type component.

  5. Diagnostic dilemmas in enlarged and diffusely hemorrhagic adrenal glands.


    Diolombi, Mairo L; Khani, Francesca; Epstein, Jonathan I


    We have noted an increasing number of cases of enlarged adrenal glands where the underlying diagnosis was masked by a diffusely hemorrhagic process. We identified from our database 59 cases (32 consults, 27 routine) of adrenal glands with diffuse (>25%) hemorrhage received between 2000 and 2014. Fifty-three adrenalectomies and 6 biopsies were identified. The diagnoses after central review were 41 adrenocortical adenomas, 1 nodular adrenocortical hyperplasia with associated myelolipoma, 1 benign adrenocortical cyst, and 10 nonneoplastic adrenal glands with hemorrhage. A definitive diagnosis for the 6 biopsies was precluded by the sample size. The adrenocortical adenomas (size, 1-13 cm; 25%-95% hemorrhage) showed clear cell change in the neoplastic area (10%-80% of the tumor), 19 showed focal calcification (1 with ossification), 11 showed areas of papillary endothelial hyperplasia, 10 showed scattered lymphoplasmacytic inflammation, 6 showed benign cortical tissue extending beyond the adrenal capsule into soft tissue, 1 showed necrosis in the form of ghost cells, 2 showed lipomatous change, and 6 were associated with incidental benign lesions (1 cortical cyst, 1 schwannoma, and 4 myelolipomas). Twenty-four of the adrenocortical adenomas were consults where the referring pathologist had trouble classifying the lesion. Of the 10 nonneoplastic adrenals (4.5-22 cm; 40%-80% hemorrhage), 2 were consults. In summary, pathologists have difficulties recognizing adrenocortical adenomas in the setting of a massively enlarged and hemorrhagic adrenal gland. Although there is a correlation between adrenocortical malignancy and size, hemorrhage into nonmalignant adrenal glands can result in markedly enlarged adrenals.

  6. Expression and localization of the diacylglycerol kinase family and of phosphoinositide signaling molecules in adrenal gland.


    Hozumi, Yasukazu; Akimoto, Ryo; Suzuki, Akihito; Otani, Koichi; Watanabe, Masahiko; Goto, Kaoru


    Adrenal glands play a central role in the secretion of steroid hormones and catecholamines. Previous studies have revealed that molecules engaged in phosphoinositide (PI) turnover are expressed in the adrenal gland, suggesting the importance of PI signaling in adrenal signal transduction. Diacylglycerol kinase (DGK) catalyzes the phosphorylation of diacylglycerol (DG), a major second messenger in the PI signaling cascade. The DGK family is expressed in distinct patterns in endocrine organs at the mRNA and protein levels. Nevertheless, little is known about the characteristics and morphological aspects of DGKs in the adrenal gland. We have performed immunohistochemical analyses to investigate the expression and localization of DGK isozymes, together with PI signaling molecules, in the adrenal gland at the protein level. Our results show that the DGK family and a set of PI signaling molecules are expressed intensely in zona glomerulosa cells and medullary chromaffin cells in the adrenal gland. In adrenal cells, DGKγ localizes to the Golgi complex, DGKε to the plasma membrane, and DGKζ to the nucleus. These findings show the distinct expression and subcellular localization of DGK isozymes and PI signaling molecules in the adrenal gland, suggesting that each DGK isozyme has a role in signal transduction in adrenal cells, especially in the zona glomerulosa and medulla.

  7. [Adrenal failure caused by primary adrenal non-Hodgkin lymphoma: a case report and review of the literature].


    Hernández Marín, B; Díaz Muñoz de la Espada, V M; Alvarez Alvarez, R; Encinas García, S; Khosravi Shahi, P; Pérez Fernández, R; Pérez Manga, G


    We report a case of 78-year old man who presented with symptoms of adrenal insufficiency. The computed tomography (CT) scan showed the presence of bilateral adrenal masses. A CT-scan guided needle biopsy revealed diffuse large- B cell lymphoma. The absence of pathological findings in clinical, bone marrow and CT scan examinations supported the diagnosis of primary non-Hodgkin Lymphoma of the adrenal glands. The patient was treated with four cycles of R-CHOP chemotherapy with Rituximab, liposomal Doxorubicin, Cyclophosphamide, Vincristine and Prednisolone. At the end of fourth cycle there was radiological improvement but the chemotherapy was stopped because of IV grade toxicity. He completed treatment with radiotherapy of right adrenal mass. Few days after finishing radiation therapy the patient died due to a disseminated infection. No progressive disease was founded.

  8. Nicotinic receptor Alpha7 expression during mouse adrenal gland development.


    Gahring, Lorise C; Myers, Elizabeth; Palumbos, Sierra; Rogers, Scott W


    The nicotinic acetylcholine receptor alpha 7 (α7) is a ligand-activated ion channel that contributes to a diversity of cellular processes involved in development, neurotransmission and inflammation. In this report the expression of α7 was examined in the mouse developing and adult adrenal gland that expresses a green fluorescent protein (GFP) reporter as a bi-cistronic extension of the endogenous α7 transcript (α7(G)). At embryonic day 12.5 (E12.5) α7(G) expression was associated with the suprarenal ganglion and precursor cells of the adrenal gland. The α7(G) cells are catecholaminergic chromaffin cells as reflected by their progressive increase in the co-expression of tyrosine hydroxylase (TH) and dopamine-beta-hydroxylase (DBH) that is complete by E18.5. In the adult, α7(G) expression is limited to a subset of chromaffin cells in the adrenal medulla that cluster near the border with the adrenal cortex. These chromaffin cells co-express α7(G), TH and DBH, but they lack phenylethanolamine N-methyltransferase (PNMT) consistent with only norepinephrine (NE) synthesis. These cell groups appear to be preferentially innervated by pre-ganglionic afferents identified by the neurotrophin receptor p75. No afferents identified by beta-III tubulin, neurofilament proteins or p75 co-expressed α7(G). Occasional α7(G) cells in the pre-E14.5 embryos express neuronal markers consistent with intrinsic ganglion cells and in the adult some α7(G) cells co-express glutamic acid decarboxylase. The transient expression of α7 during adrenal gland development and its prominent co-expression by a subset of NE chromaffin cells in the adult suggests that the α7 receptor contributes to multiple aspects of adrenal gland development and function that persist into adulthood. PMID:25093893

  9. Nicotinic receptor Alpha7 expression during mouse adrenal gland development.


    Gahring, Lorise C; Myers, Elizabeth; Palumbos, Sierra; Rogers, Scott W


    The nicotinic acetylcholine receptor alpha 7 (α7) is a ligand-activated ion channel that contributes to a diversity of cellular processes involved in development, neurotransmission and inflammation. In this report the expression of α7 was examined in the mouse developing and adult adrenal gland that expresses a green fluorescent protein (GFP) reporter as a bi-cistronic extension of the endogenous α7 transcript (α7(G)). At embryonic day 12.5 (E12.5) α7(G) expression was associated with the suprarenal ganglion and precursor cells of the adrenal gland. The α7(G) cells are catecholaminergic chromaffin cells as reflected by their progressive increase in the co-expression of tyrosine hydroxylase (TH) and dopamine-beta-hydroxylase (DBH) that is complete by E18.5. In the adult, α7(G) expression is limited to a subset of chromaffin cells in the adrenal medulla that cluster near the border with the adrenal cortex. These chromaffin cells co-express α7(G), TH and DBH, but they lack phenylethanolamine N-methyltransferase (PNMT) consistent with only norepinephrine (NE) synthesis. These cell groups appear to be preferentially innervated by pre-ganglionic afferents identified by the neurotrophin receptor p75. No afferents identified by beta-III tubulin, neurofilament proteins or p75 co-expressed α7(G). Occasional α7(G) cells in the pre-E14.5 embryos express neuronal markers consistent with intrinsic ganglion cells and in the adult some α7(G) cells co-express glutamic acid decarboxylase. The transient expression of α7 during adrenal gland development and its prominent co-expression by a subset of NE chromaffin cells in the adult suggests that the α7 receptor contributes to multiple aspects of adrenal gland development and function that persist into adulthood.

  10. Nicotinic Receptor Alpha7 Expression during Mouse Adrenal Gland Development

    PubMed Central

    Gahring, Lorise C.; Myers, Elizabeth; Palumbos, Sierra; Rogers, Scott W.


    The nicotinic acetylcholine receptor alpha 7 (α7) is a ligand-activated ion channel that contributes to a diversity of cellular processes involved in development, neurotransmission and inflammation. In this report the expression of α7 was examined in the mouse developing and adult adrenal gland that expresses a green fluorescent protein (GFP) reporter as a bi-cistronic extension of the endogenous α7 transcript (α7G). At embryonic day 12.5 (E12.5) α7G expression was associated with the suprarenal ganglion and precursor cells of the adrenal gland. The α7G cells are catecholaminergic chromaffin cells as reflected by their progressive increase in the co-expression of tyrosine hydroxylase (TH) and dopamine-beta-hydroxylase (DBH) that is complete by E18.5. In the adult, α7G expression is limited to a subset of chromaffin cells in the adrenal medulla that cluster near the border with the adrenal cortex. These chromaffin cells co-express α7G, TH and DBH, but they lack phenylethanolamine N-methyltransferase (PNMT) consistent with only norepinephrine (NE) synthesis. These cell groups appear to be preferentially innervated by pre-ganglionic afferents identified by the neurotrophin receptor p75. No afferents identified by beta-III tubulin, neurofilament proteins or p75 co-expressed α7G. Occasional α7G cells in the pre-E14.5 embryos express neuronal markers consistent with intrinsic ganglion cells and in the adult some α7G cells co-express glutamic acid decarboxylase. The transient expression of α7 during adrenal gland development and its prominent co-expression by a subset of NE chromaffin cells in the adult suggests that the α7 receptor contributes to multiple aspects of adrenal gland development and function that persist into adulthood. PMID:25093893

  11. Adrenal glands of Spix's yellow-toothed cavy (Galea spixii, Wagler, 1831): morphological and morphometric aspects.


    Santos, A C; Viana, D C; Bertassoli, B M; Vasconcelos, B G; Oliveira, D M; Rici, R E G; Oliveira, M F; Miglino, M A; Assis-Neto, A C


    Considering the physiological importance and need of greater morphophysiological knowledge of adrenal glands, the aims of present study were compare the morphometric data between left and right adrenal of male and female; perform a histological, scanning and transmission electron microscopy study showing tissue constitution of glands; finally, in order to define the presence and correct site of the cytochrome P450c17 expression in adrenal glands, immunohistochemical study of this enzyme was performed in 18 adrenal glands (right n=9 and left n=9) of nine adult Galea spixii (four males and five females). Right adrenal was more cranially positioned than left adrenal; dimensions (weight, length and width) of right adrenal was larger than left adrenal; no differences between male and female body and adrenal measurements were found; the morphology of cells and different amounts of lipid droplets may be related to the different demands of steroid hormones production, related to each zone of the adrenal cortex; and, the cytochrome P450c17 immunolocalization in fasciculate and reticular zone may be related with synthesis of 17-hydroxy-pregnenolone, 17-hydroxy-progesterone, dehydroepiandrosterone or androstenedione. PMID:27143060

  12. Adrenal glands of Spix's yellow-toothed cavy (Galea spixii, Wagler, 1831): morphological and morphometric aspects.


    Santos, A C; Viana, D C; Bertassoli, B M; Vasconcelos, B G; Oliveira, D M; Rici, R E G; Oliveira, M F; Miglino, M A; Assis-Neto, A C


    Considering the physiological importance and need of greater morphophysiological knowledge of adrenal glands, the aims of present study were compare the morphometric data between left and right adrenal of male and female; perform a histological, scanning and transmission electron microscopy study showing tissue constitution of glands; finally, in order to define the presence and correct site of the cytochrome P450c17 expression in adrenal glands, immunohistochemical study of this enzyme was performed in 18 adrenal glands (right n=9 and left n=9) of nine adult Galea spixii (four males and five females). Right adrenal was more cranially positioned than left adrenal; dimensions (weight, length and width) of right adrenal was larger than left adrenal; no differences between male and female body and adrenal measurements were found; the morphology of cells and different amounts of lipid droplets may be related to the different demands of steroid hormones production, related to each zone of the adrenal cortex; and, the cytochrome P450c17 immunolocalization in fasciculate and reticular zone may be related with synthesis of 17-hydroxy-pregnenolone, 17-hydroxy-progesterone, dehydroepiandrosterone or androstenedione.

  13. Dual effect of digitalis glycosides on norepinephrine release from human atrial tissue and bovine adrenal chromaffin cells: differential dependence on [Na+]i and [Ca2+]i.


    Haass, M; Serf, C; Gerber, S H; Krüger, C; Haunstetter, A; Vahl, C F; Nobiling, R; Kübler, W


    It was the aim of the present study (1) to characterize the influence of Na+/K(+)-ATPase inhibition by the digitalis glycoside ouabain on both spontaneous and nicotine-evoked norepinephrine release from the human heart; and (2) to further investigate the role of glycoside-induced changes in [Na+]i and [Ca2+]i (determined by microfluorimetry) for catecholamine release. The latter experiments were performed in bovine adrenal medullary chromaffin cells (BCC), an established cell culture model for sympathetic nerves. Ouabain (1-1000 mumol/l) exerted a dual effect on norepinephrine release (determined by HPLC) from incubated human atrial tissue: (I) Ouabain induced a concentration-dependent increase in norepinephrine release, that was calcium-independent and almost completely prevented by blockade of the uptake1-carrier by desipramine (1 mumol/l). The characteristics of this release process are consistent with a non-exocytotic mechanism. (II) In addition, ouabain augmented the nicotine-evoked (1-100 mumol/l) calcium-dependent norepinephrine release, which can be considered to be exocytotic. Na+/K(+)-ATPase inhibition also reduced the threshold concentration of nicotine from 10 to 1 mumol/l and it delayed the rapid tachyphylaxis of its norepinephrine releasing effect in human atrial tissue. In BCC, ouabain increased [Na+]i, [Ca2+]i and [3H]-norepinephrine release in parallel. Under calcium-free conditions, not only the ouabain-induced increase in [Na+]i, but also [3H]-norepinephrine release were enhanced. The ouabain-induced [3H]-norepinephrine release was always closely related to changes in [Na+]i, indicating a key role of [Na+]i for this calcium-independent non-exocytotic norepinephrine release. In addition, pretreatment with ouabain (1 mmol/l) augmented the nicotine-evoked (0.1-10 mumol/l) increments in [Na+]i, [Ca2+]i and [3H]-norepinephrine release. As nicotine-induced norepinephrine release depends on an increase in both [Na+]i and [Ca2+]i, these findings are

  14. Kinetic studies of Ca2+ binding and Ca2+ clearance in the cytosol of adrenal chromaffin cells.

    PubMed Central

    Xu, T; Naraghi, M; Kang, H; Neher, E


    The Ca2+ binding kinetics of fura-2, DM-nitrophen, and the endogenous Ca2+ buffer, which determine the time course of Ca2+ changes after photolysis of DM-nitrophen, were studied in bovine chromaffin cells. The in vivo Ca2+ association rate constants of fura-2, DM-nitrophen, and the endogenous Ca2+ buffer were measured to be 5.17 x 10(8) M-1 s-1, 3.5 x 10(7) M-1 s-1, and 1.07 x 10(8) M-1 s-1, respectively. The endogenous Ca2+ buffer appeared to have a low affinity for Ca2+ with a dissociation constant around 100 microM. A fast Ca2+ uptake mechanism was also found to play a dominant role in the clearance of Ca2+ after flashes at high intracellular free Ca2+ concentrations ([Ca2+]), causing a fast [Ca2+]i decay within seconds. This Ca2+ clearance was identified as mitochondrial Ca2+ uptake. Its uptake kinetics were studied by analyzing the Ca2+ decay at high [Ca2+]i after flash photolysis of DM-nitrophen. The capacity of the mitochondrial uptake corresponds to a total cytosolic Ca2+ load of approximately 1 mM. Images FIGURE 2 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 PMID:9199815

  15. Adrenal involvement in non-Hodgkin lymphoma

    SciTech Connect

    Paling, M.R.; Williamson, B.R.J.


    Adrenal masses are described in seven cases of non-Hodgkin lymphoma in a series of 173 patients. In all seven patients the lymphoma was diffuse rather than nodular. Three patients had adrenal masses at the time of presentation, whereas in four cases the adrenal gland was a site of tumor recurrence after therapy. Three patients had simultaneous bilateral adrenal involvement by tumor. No characteristic features were recognized that might have distinguished these tumors from other adrenal masses. Appropriate therapy successfully resolved the adrenal masses in all but one case. The latter patient was the only one with evidence of adrenal insufficiency.

  16. Evidence of adrenal failure in aging Dax1-deficient mice.


    Scheys, Joshua O; Heaton, Joanne H; Hammer, Gary D


    Dosage-sensitive sex reversal, adrenal hypoplasia congenita (AHC) critical region on the X chromosome, gene 1 (Dax1) is an orphan nuclear receptor essential for development and function of the mammalian adrenal cortex and gonads. DAX1 was cloned as the gene responsible for X-linked AHC, which is characterized by adrenocortical failure necessitating glucocorticoid replacement. Contrary to these human data, young mice with genetic Dax1 knockout (Dax1(-/Y)) exhibit adrenocortical hyperfunction, consistent with the historic description of Dax1 as a transcriptional repressor that inhibits steroidogenic factor 1-dependent steroidogenesis. This paradox of molecular function and two apparently opposite phenotypes associated with Dax1 deficiency in mice and humans is compounded by the recent observations that under certain circumstances, Dax1 can serve as a transcriptional activator of steroidogenic factor 1. The recently revealed role of Dax1 in embryonic stem cell pluripotency, together with the observation that its expression in the adult adrenal is restricted to the subcapsular cortex, where presumptive undifferentiated progenitor cells reside, has led us to reexamine the phenotype of Dax1(-/Y) mice in order to reconcile the conflicting mouse and human data. In this report, we demonstrate that although young Dax1(-/Y) mice have enhanced steroidogenesis and subcapsular adrenocortical proliferation, as these mice age, they exhibit declining adrenal growth, decreasing adrenal steroidogenic capacity, and a reversal of their initial enhanced hormonal sensitivity. Together with a marked adrenal dysplasia in aging mice, these data reveal that both Dax1(-/Y) mice and patients with X-linked AHC exhibit adrenal failure that is consistent with adrenocortical subcapsular progenitor cell depletion and argue for a significant role of Dax1 in maintenance of these cells.

  17. Adrenal cytomegaly: two cases detected by prenatal diagnosis.


    Noguchi, Shin-ichi; Masumoto, Kouji; Taguchi, Tomoaki; Takahashi, Yukiko; Tsuneyoshi, Masazumi; Suita, Sachiyo


    We report our experience with two cases of adrenal cytomegaly, both of which were detected as cystic adrenal masses during prenatal ultrasonographic examinations. In Case 1, a left suprarenal cystic mass was detected in the fetus at 25 weeks of gestation. The mass, measuring 7 cm in diameter, did not show any change in size and was resected 26 days after birth. In Case 2, a right suprarenal lesion was found at 30 weeks of gestation. The cystic lesion, measuring 2 cm x 1.5 cm, did not change in size and was resected 3 months after birth. Adrenal cytomegaly is still not well known. It is characterized by the presence of large polyhedral cells with eosinophilic granular cytoplasm and enlarged nuclei in the adrenal cortex. This condition is thought to be a degenerative process but not a malignancy. Adrenal cytomegaly rarely forms cysts. It seemed to be impossible to diagnose preoperatively in our cases. Because of the difficulty of differentiating between cystic adrenal cytomegaly and other cystic diseases such as neuroblastoma, operative intervention is required in cases where the cysts do not decrease in size. Further study of a larger number of cases is needed to establish an optimal treatment protocol for these tumours.

  18. Adrenal lymphangioma: clinicopathologic and immunohistochemical characteristics of a rare lesion.


    Ellis, Carla L; Banerjee, Priya; Carney, Erin; Sharma, Rajni; Netto, George J


    flattened, bland, simple lining. The cystic channels/spaces occasionally contained proteinaceous material and lacked red blood cell content. On immunohistochemical stains, D2-40 cytoplasmic staining was positive in all 9 examined lesions, whereas AE1/AE3 was negative, thus, confirming their lymphatic nature. D2-40 staining was diffuse in 2 and focal in the 7 remaining lesions. Adrenal lymphangiomas are very rare, benign lymphatic neoplasms with a female, right-sided predominance in our current series. They may clinically present with abdominal pain or can be incidentally found during adulthood as a mass, necessitating surgical removal to rule out other types of adrenal neoplasms. PMID:21315417

  19. Computed tomography evaluation of the adrenal gland in the preoperative assessment of bronchogenic carcinoma

    SciTech Connect

    Sandler, M.A.; Pearlberg, J.L.; Madrazo, B.L.; Gitschlag, K.F.; Gross, S.C.


    One hundred ten patients with proved bronchogenic carcinoma who were undergoing computed tomography (CT) of the thorax also underwent CT of the adrenals to determine the value of routine preoperative assessement of this gland. Sixteen adrenal masses were found in 11 patients. In five patients the adrenals were the only site of metastasis. CT of the adrenals should be performed routinely when the thorax is examined pre-operatively in patients with non-oat-cell bronchogenic carcinoma to improve patient selection for thoractomy.

  20. Nicotine-induced exocytotic norepinephrine release in guinea-pig heart, human atrium and bovine adrenal chromaffin cells: modulation by single components of ischaemia.


    Krüger, C; Haunstetter, A; Gerber, S; Serf, C; Kaufmann, A; Kübler, W; Haass, M


    The influence of single components of myocardial ischaemia, such as anoxia, substrate withdrawal, hyperkalemia and extracellular acidosis, on nicotine-induced norepinephrine (NE) release was investigated in the isolated perfused guinea-pig heart, in incubated human atrial tissue and in cultured bovine adrenal chromaffin cells (BCC). In normoxia, nicotine (1-1000 mumol/l) evoked a concentration-dependent release of NE (determined by high pressure liquid chromatography and electrochemical detection) from guinea-pig heart and human atrium. In contrast to selective anoxia (Po2 < 5 mmHg) or glucose withdrawal, respectively, anoxia in combination with glucose withdrawal (5-40 min) markedly potentiated nicotine-induced NE release both in guinea-pig heart and human atrium. The sensitization of cardiac sympathetic nerve endings to nicotine was characterized by a lower threshold concentration and an approximate two-fold increase of maximum NE release, peaking after 10 min of anoxia and glucose withdrawal. Cyanide intoxication (1 mmol/l) combined with glucose withdrawal resulted in a similar increase of nicotine-induced sympathetic transmitter release both in guinea-pig heart and human atrium. In contrast, the nicotine-induced (10 mumol/l) NE overflow was only slightly potentiated by 10 min of global ischaemia in guinea-pig heart. Both hyperkalemia ([K+] 16 mmol/l) and acidosis (pH 6.8-6.0) distinctly attenuated the stimulatory effect of nicotine in guinea-pig heart and human atrium under normoxic conditions. Consistent with an exocytotic release mechanism, NE release was dependent on the presence of extracellular calcium under all conditions tested. Furthermore, NE overflow from guinea-pig heart was accompanied by a release of the exocytosis marker neuropeptide Y (NPY; determined by radioimmunoassay). In BCC, nicotine (1-10 mumol/l) evoked a release of NE and NPY and a transient rise of [Ca2+]i (determined with fura-2) during normoxia which were both dependent on the

  1. Adrenal Gland Disorders: Condition Information


    ... of salt and water Controlling the "fight or flight" response to stress Maintaining pregnancy Initiating and controlling ... overview of the adrenal glands: Beyond fight or flight . Retrieved June 29, 2012 from http://www.endocrineweb. ...

  2. IMAGe association: report of two cases in siblings with adrenal hypoplasia and review of the literature.


    Phillips, Katherine; Arroyo, May R; Duckworth, Lizette Vila


    We report the postmortem findings of two siblings with gross and microscopic features consistent with IMAGe association (Intrauterine growth retardation, Metaphyseal dysplasia, Adrenal hypoplasia congenita, and Genital anomalies) with an emphasis on the histopathology of the adrenal gland in this rare syndrome. The first sibling was an 8-week old male diagnosed postnatally with primary adrenal insufficiency. There was no deletion of the DAX1 gene by FISH. Examination at autopsy revealed dysmorphic features including frontal bossing, epicanthal folds, flat philtrum, cryptorchidism, penile chordee, overriding fourth toe, and height and weight below 3rd percentile. Grossly, the adrenal glands were not identified; however, microscopic examination of the suprarenal soft tissue revealed a 3 mm focus of disorganized fetal adrenal cortex with distended "cytomegalic" cells with abundant pink eosinophilic cytoplasm, vesicular nuclei, and cytoplasmic vacuolization. A minute focus of permanent adult cortex was also seen, but no adrenal medulla was identified. An autopsy of the sibling, who died 12 years previously at day 9 of life, revealed dysmorphic facial features with cryptorchidism and a large phallus. The adrenal glands were grossly hypoplastic (11 mm). Histologically, the adrenal glands showed disorganized fetal cortex with cytomegalic cells, a larger amount of permanent adult cortex, and bizarre nuclei with numerous pseudoinclusions. While there is currently limited information regarding the histopathologic adrenal findings in IMAGe association, our small case series suggests overlapping features between X-linked recessive congenital adrenal hypoplasia (cytomegalic cells with lack of permanent adult cortex) and autosomal recessive congenital adrenal hypoplasia (diminished permanent adult cortex without cytomegalic cells).

  3. Interconversion of inositol (1,4,5)-trisphosphate to inositol (1,3,4,5)-tetrakisphosphate and (1,3,4)-trisphosphate in permeabilized adrenal glomerulosa cells is calcium-sensitive and ATP-dependent

    SciTech Connect

    Rossier, M.F.; Dentand, I.A.; Lew, P.D.; Capponi, A.M.; Vallotton, M.B.


    The metabolism of (/sub 3/H)inositol (1,4,5)-trisphosphate was followed in permeabilized bovine adrenal glomerulosa cells. At low Ca++ concentration (pCa = 7.2), more than 90% of (/sub 3/H)inositol (1,4,5)-trisphosphate had disappeared within 2 min, while two other metabolites, (/sub 3/H)inositol (1,3,4)-trisphosphate and (/sub 3/H)inositol (1,3,4,5)-tetrakisphosphate appeared progressively. At higher Ca++ concentrations (pCa = 5.7 and 4.8), the formation of these two metabolites was markedly increased, but completely abolished if the medium was ATP-depleted. The peak levels for the generation of (/sub 3/H)inositol (1,3,4,5)-tetrakisphosphate (1 min) preceded those of (3H)inositol (1,3,4)-trisphosphate and were closely correlated. These results suggest that, in adrenal glomerulosa cells, the isomer inositol (1,3,4)-trisphosphate is generated from inositol (1,4,5)-trisphosphate via a calcium-sensitive and ATP-dependent phosphorylation/dephosphorylation pathway involving the formation of inositol (1,3,4,5)-tetrakisphosphate.

  4. Naloxone inhibits and morphine potentiates the adrenal steroidogenic response to ACTH

    NASA Technical Reports Server (NTRS)

    Heybach, J. P.; Vernikos, J.


    The administration of morphine to hypophysectomized rats potentiated the steroidogenic response of the adrenal cortex to exogenous adrenocorticotrophic hormone (ACTH) in a dose-dependent fashion. Conversely, the opiate antagonist naloxone inhibited the adrenal response to ACTH. Naloxone pretreatment also antagonized the potentiating effect of morphine on ACTH-induced steroidogenesis in a dose-dependent manner. Neither morphine nor naloxone, administered to hypophysectomized rats, had any direct effect on adrenal steroidogenesis. These adrenal actions were stereospecific since neither the (+)-stereoisomer of morphine, nor that or naloxone, had any effect on the adrenal response to ACTH. The administration of human beta-endorphin to hypophysectomized rats had no effect on the adrenal corticosterone concentration nor did it alter the response of the adrenal gland to ACTH. These results indicate that morphine can potentiate the action of ACTH on the adrenal by a direct, stereospecific, dose-dependent mechanism that is prevented by naloxone pretreatment and which may involve competition for ACTH receptors on the corticosterone-secreting cells of the adrenal cortex.

  5. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.


    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  6. Nonreutilizaton of adrenal chromaffin granule membranes following secretion

    SciTech Connect

    Nobiletti, J.B.


    The intracellular postexocytotic fate of the adrenal chromaffin granule membrane (reutilization vs. nonreutilization) was addressed through two experimental approaches. First, (/sup 3/H) leucine pulse-chase labeling experiments were conducted in two systems - the isolated retrograde perfused cat adrenal gland and cultured bovine adrenal chromaffin cells to compare chromaffin granule soluble dopamine-B-hydroxylase (DBH) turnover (marker for granule soluble content turnover) to that of membrane-bound DBH (marker for granule membrane turnover). Experiments in cat adrenal glands showed that at all chase periods the granule distribution of radiolabeled DBH was in agreement with the DBH activity distribution (73% membrane-bound/27% soluble) - a result consistent with parallel turnover of soluble and membrane-bound DBH. Experiments in cultured bovine cells showed that labeled soluble and membrane-bound DBH had parallel turnover patterns and at all chase period, the distribution of radiolabeled DBH between the soluble contents and membranes was similar to the DBH activity distribution (50% soluble/50% membrane-bound). The above experiments showed that the soluble contents and membranes turnover in parallel and are consistent with nonreutilization of chromaffin granule membranes following exocytosis. Isolated retrograde perfused bovine adrenal glands were subjected to repetitive acetylcholine stimulation to induce exocytosis and then the dense and less-dense chromaffin granule fractions were isolated. Since both approaches gave results consistent with membrane nonreutilization, the authors conclude that once a chromaffin granule is involved in exocytosis, its membrane is not reutilized for the further synthesis, storage, and secretion of catecholamines.

  7. Role of bone morphogenetic proteins in adrenal physiology and disease.


    Johnsen, Inga K; Beuschlein, Felix


    Bone morphogenetic proteins (BMPs) are members of the transforming growth factor-beta superfamily of ligands that impact on a multitude of biological processes including cell type specification, differentiation and organogenesis. Furthermore, a large body of evidence points towards important BMP-dependent mechanisms in tumorigenesis. In accordance with their diverse actions, BMPs have been demonstrated to serve as auto-, para- and endocrine modulators also in a number of hormonal systems. In this review, we highlight novel aspects of BMP-dependent regulatory networks that pertain to adrenal physiology and disease, which have been uncovered during recent years. These aspects include the role of BMP-dependent mechanism during adrenal development, modulating effects on catecholamine synthesis and steroidogenesis and dysregulation of BMP signalling in adrenal tumorigenesis. Furthermore, we summarize potential therapeutic approaches that are based on reconstitution of BMP signalling in adrenocortical tumour cells. PMID:20133384

  8. Retained fetal adrenal cortex in a cynomolgus macaque (Macaca fascicularis).


    Radi, Zaher; Evans, Mark


    An incidental, bilateral, retained fetal adrenal cortex was detected in a male cynomolgus macaque (age, approximately 2.4 y) used in a 4-week toxicology study. Microscopic examination of the adrenal gland cortex zone revealed the presence of additional solid sheets and columns of cells supported by vascular capillary bed and composed of large polyhedral cells with abundant eosinophilic, slightly finely vacuolated cytoplasm that surrounded the entire circumference of the medulla. Nuclei were vesicular, round to oval with prominent small nucleoli. There was no evidence for inflammation or cellular degeneration. Based on the microscopic examination, a diagnosis of retained fetal cortex of the adrenal gland was made. This morphologic change resembles fetal cortex in human infants. To our knowledge, this case description is the first report of a cynomolgus macaque with the rare entity of retained fetal cortex, which should not be misinterpreted as a test article-related change.

  9. Ganglioneuroma of adrenal gland in a patient with Turner syndrome.


    Kamoun, Mahdi; Mnif, Mouna Feki; Rekik, Nabila; Belguith, Neila; Charfi, Nadia; Mnif, Lilia; Elleuch, Mouna; Mnif, Fatma; Kamoun, Thouraya; Mnif, Zeinab; Kamoun, Hassen; Sellami-Boudawara, Tahia; Hachicha, Mongia; Abid, Mohamed


    A 15-year-old girl with Turner syndrome was unexpectedly found to have a left suprarenal mass. Extensive investigations showed a clinically and biochemically inapparent mass. Computed tomography disclosed a well-defined solid lesion in the left adrenal measuring 6.5 x 5 cm with minimal contrast enhancement. Laparoscopic adrenalectomy was done. Histologic examination revealed an encapsulated mass originated from the left adrenal medulla. Tumor tissue comprised abundant collagen fibers and spindloid cells admixed with mature ganglion cells. The tumor was diagnosed as left adrenal ganglioneuroma. According to literature, we report the eighth case of ganglioneuroma complicating Turner syndrome. Patients with this syndrome are predisposed to the development of neuroblastoma and related tumors. Reasons for this predisposition might relate to genetic and hormonal factors. Given that these tumors are often limited stage and of good prognosis, we recommend their screening in all patients with Turner syndrome.

  10. Genetics Home Reference: X-linked adrenal hypoplasia congenita


    ... glands on top of each kidney called the adrenal glands . These glands produce a variety of hormones that ... disorder is adrenal insufficiency, which occurs when the adrenal glands do not produce enough hormones. Adrenal insufficiency typically ...

  11. Ectopic adrenal tissue in the thorax: a case report with in situ hybridization and immunohistochemical studies.


    Shigematsu, Kazuto; Toriyama, Kan; Kawai, Kioko; Takahara, Osamu


    Ectopic or accessory adrenal tissues are usually found in the upper abdomen or along the path of descent of the gonads. The occurrence of supradiaphragmatic adrenal tissue is extremely rare. We report a case of ectopic adrenal tissue composed of both cortical and medullary cells in a 99-year-old woman. The lesion was found incidentally in the paratracheal region at autopsy. We performed in situ hybridization and immunohistochemistry to confirm that the ectopic adrenal tissue possessed the same steroidogenesis as a normal adrenal gland. The ectopic adrenal tissue was encapsulated by fibrous tissue and composed of cells expressing all steroidogenic enzyme mRNAs. The centrally located cells showed immunoreactivities for tyrosine hydroxylase (TH), dopamine beta hydroxylase (DBH), and phenylethanolamine-N-methyltransferase (PNMT). Expression of ACTH receptor (ACTHR) was also evident. These findings indicated that this ectopic adrenal tissue had the capability for steroid and catecholamine biosynthesis under the control of ACTH, and that it might function adequately even under a condition of bilateral adrenal insufficiency.

  12. Compensatory adrenal growth - A neurally mediated reflex

    NASA Technical Reports Server (NTRS)

    Dallman, M. F.; Engeland, W. C.; Shinsako, J.


    The responses of young rats to left adrenalectomy or left adrenal manipulation were compared to surgical sham adrenalectomy in which adrenals were observed but not touched. At 12 h right adrenal wet weight, dry weight, DNA, RNA, and protein content were increased (P less than 0.05) after the first two operations. Left adrenal manipulation resulted in increased right adrenal weight at 12 h but no change in left adrenal weight. Sequential manipulation of the left adrenal at time 0 and the right adrenal at 12 h resulted in an enlarged right adrenal at 12 h (P less than 0.01), and an enlarged left adrenal at 24 h (P less than 0.05), showing that the manipulated gland was capable of response. Bilateral adrenal manipulation of the adrenal glands resulted in bilateral enlargement of 12 h (P less than 0.01). Taken together with previous results, these findings strongly suggest that compensatory adrenal growth is a neurally mediated reflex.

  13. Autonomic control of adrenal function.

    PubMed Central

    Edwards, A V; Jones, C T


    Recent studies of adrenal function in conscious calves are reviewed. These have involved collecting the whole of the adrenal effluent blood from the right adrenal gland at intervals and, where necessary, prior functional hypophysectomy by destruction of the pituitary stalk under general halothane anaesthesia 3 d previously. The adrenal medulla was found to release numerous neuropeptides, in addition to catecholamines, in response to stimulation of the peripheral end of the right splanchnic nerve, which was carried out below behavioural threshold. Many of these responses were enhanced by stimulating intermittently at a relatively high frequency. Intra-aortic infusions of a relatively low dose of acetylcholine (4.5 nmol min-1 kg-1) elicited similar responses. In the adrenal cortex, agonists which either potentiated the steroidogenic response to ACTH or exerted a direct steroidogenic action included VIP, CGRP, CRF and ACh acting via muscarinic receptors. Stimulation of the peripheral end of the right splanchnic nerve strongly potentiated the steroidogenic response to ACTH and there is compelling evidence that the innervation normally plays an important part in cortisol secretion. PMID:8300417

  14. Rare association of adrenal tumors.


    Tica, Irjna; Tica, V I; Mihailov, Claudia


    Adrenal incidentalomas represent a true problem both in the clinical diagnosis and in their treatment. A great variety of pathologies may be found under the umbrella of this concept: benign adenomas - functioning or not, myelolipomas, hamartomas, or granulomatous infiltrations of the adrenal. The possibility of malignancy should be considered in each case, especially in patients with a known extra-adrenal primary. In true incidentalomas, size appears to be predictive of malignancy. We present an interesting case because of the surprising association of two adrenal tumors, with a long time lapse between them, with ascites and pleurisy and because of the difficulty of treatment in a patient refusing surgery. We did not find such an association in the medical literature. Miss MR, 61 years old, was treated surgically for pheochromocytoma 28 years ago (left adrenalectomy). She was diagnosed in the past with peritoneal carcinomatosis; paraneoplastic left pleurisy, chronic hepatitis of unknown etiology. She presented at admission cashexia, pallor, signs of left pleural effusion and of ascites, hearts beats and blood pressure within normal limits. Investigations were performed including hormonal tests, ultrasound investigation, hepatic tests, and CT scan but no specific tumour markers. A right adrenal incidentaloma of 21/15 mm - in association with ascites and pleurisy - was found at CT scan. Diagnostic problems are discussed because the patient refused surgery, so no pathological examination was available.

  15. Adrenal oncoctyoma of uncertain malignant potential: a rare etiology of adrenal incidentaloma.


    Kedia, Rohit R; Muinov, Lucy; Lele, Subodh M; Shivaswamy, Vijay


    A rare cause for rapid adrenal enlargement is adrenal oncocytoma of uncertain malignant potential. A full biochemical evaluation is warranted to screen secreting adrenal adenomas as well as to evaluate adrenal cortical carcinoma. Careful pathologic evaluation is required as the diagnosis of AOC cannot be made by imaging. PMID:27014458

  16. Giant adrenal cyst displacing the right kidney.


    Chodisetti, Subbarao; Boddepalli, Yogesh; Kota, Malakondareddy


    Adrenal cysts are rare and should be considered in the differential diagnosis of retroperitoneal cysts. We present a case of a huge adrenal cyst displacing the right kidney anteriorly toward the left side in a young female.

  17. Cushing syndrome due to adrenal tumor


    Adrenal tumor - Cushing syndrome ... Cushing syndrome is a disorder that occurs when your body has a higher than normal level of the ... or cancerous (malignant). Noncancerous tumors that can cause ... Adrenal adenomas Micronodular hyperplasia Cancerous tumors that ...

  18. Adrenal cortex dysfunction: CT findings

    SciTech Connect

    Huebener, K.H.; Treugut, H.


    The computed tomographic appearance of the adrenal gland was studied in 302 patients with possible endocrinologic disease and 107 patients undergoing CT for nonendocrinologic reasons. Measurements of adrenal size were also made in 100 adults with no known adrenal pathology. CT proved to be a sensitive diagnostic tool in combination with clinical studies. When blood hormone levels are increased, CT can differentiate among homogeneous organic hyperplasia, nodular hyperplasia, benign adenoma, and malignant cortical adenoma. When blood hormone levels are decreased, CT can demonstrate hypoplasia or metastatic tumorous destruction. Calcifications can be demonstrated earlier than on plain radiographs. When hormone elimination is increased, the morphologic substrate can be identified; tumorous changes can be localized and infiltration of surrounding organs recognized.

  19. Spontaneous adrenal haemorrhage in pregnancy

    PubMed Central

    A, Anagnostopoulos; S, Sharma


    The authors present a case of spontaneous adrenal haemorrhage, in a 28-year-old woman at 36 weeks of a twin pregnancy. Initial symptom was sudden onset chest pain which soon migrated to abdomen, accompanied by hypovolaemic shock and fetal bradycardia. Subsequent caesarean section for suspected placental abruption and resuscitation with nine units of blood, 10 of cryoprecipitate, four of fresh frozen plasma and two of platelets, in order to treat anaemia of Hgb of 3.6 g/dl and disseminated intravascular coagulation, failed to stabilise the woman. A CT scan of abdomen and pelvis then revealed a 15×17×17 cm retroperitoneal haematoma, secondary to right adrenal haemorrhage. Management was with laparotomy drainage and packing of the retroperitoneal haematoma along with the use of activated factor VII. Adrenal haemorrhage in pregnancy is an extremely rare, acute, life-threatening condition, presenting with non-specific symptoms. PMID:22679231

  20. Angiomyolipoma and Malignant PEComa: Discussion of Two Rare Adrenal Tumors

    PubMed Central

    Kwazneski II, Douglas; Merrill, Megan; Young, Jessica; Sell, Harry


    Angiomyolipoma and PEComa are rare tumors descending from perivascular epithelial cells (PECs), with distinctive IHC, morphological, and ultrastructural features. The kidney is the most frequent site of origin, but not the only one; however, adrenal gland angiomyolipomas are extremely rare. We describe two cases being found in the adrenal glands. Given the paucity of literature on the subject, more information on this disease is necessary for diagnosis and treatment. Here, we describe two complete case reports, from presentation to treatment and follow-up, along with imaging and microscopic pathology samples, and provide a comprehensive review as to the history and current literature available regarding these extremely rare tumors. PMID:26998374

  1. [Adrenal cystic masses. Our experience].


    Costantino, V; Petrin, P; Da Lio, C; Zaramella, D; Pedrazzoli, S


    Cystic masses of the adrenal gland are clinically and pathologically rare findings and few cases have been reported up to now in the medical literature. In the present work 5 new cases are reported: 3 adrenal pseudocysts, 1 lymphangioma, 1 cystic pheochromocytoma. In 3 cases there were clinical symptoms of retroperitoneal mass (lumbar pain, palpable mass, digestive symptoms); in 3 cases conventional radiology was helpful; ultrasonography was used for diagnosis in 1, CT scan in 2. In the pheochromocytoma case the real nature of the mass was determined through fluid hormone determination after fine needle puncture. All cases were treated by surgery.

  2. Two case reports of bilateral adrenal myelolipomas

    PubMed Central

    Yang, Yu; Ye, Lin-Yang; Yu, Bo; Guo, Jia-Xiang; Liu, Qian; Chen, Yun


    Primary adrenal myelolipoma is a rare, non-functioning adrenal benign tumor that is composed of mature adipose tissue and a variable amount of haemopoietic elements. Clinically, it is difficult to get diagnosed with adrenal myelolipoma because the patient usually doesn’t have obvious symptoms and signs in early stage. In the present study, two cases of primary bilateral adrenal myelolipomas are reported. Clinical presentation, imaging diagnostic features, histopathological changes and surgical treatments of the two patients are discussed. Preoperative diagnostic imaging examinations (B-mode ultrasonography, computed tomography and magnetic resonance imaging sans) assisted getting a prediction diagnosis of bilateral adrenal myelolipomas. A two-stage surgery was used to successfully excise bilateral adrenal myelolipomas in the two patients. Conventional open adrenalectomy was applied to remove the adrenal myelolipomas greater than 6 cm, and laparoscopic adrenalectomy was performed to excise the adrenal tumors smaller than 6 cm. Bilateral adrenal myelolipomas of the two patients were finally confirmed by postoperative histopathological examinations. Understanding clinical, imaging diagnostic and histopathological features of bilateral adrenal myelolipomas will facilitate timely diagnosis and treatment of this condition. Surgical removal of bilateral adrenal myelolipomas is safe, curative and beneficial. The two-stage surgery appears to be the best treatment option for the patients with bilateral adrenal myelolipomas because it achieves optimal treatment effectiveness with minimized sequelae. PMID:26380835

  3. Spontaneous Retroperitoneal Hemorrhage from Adrenal Artery Aneurysm

    SciTech Connect

    Gonzalez Valverde, F.M. Balsalobre, M.; Torregrosa, N.; Molto, M.; Gomez Ramos, M.J.; Vazquez Rojas, J.L.


    Spontaneous adrenal hemorrhage is a very rare but serious disorder of the adrenal gland that can require emergent treatment. We report on a 42-year-old man who underwent selective angiography for diagnosis and treatment of retroperitoneal hemorrhage from small adrenal artery aneurysm. This case gives further details about the value of transluminal artery embolization in the management of visceral aneurysm rupture.

  4. Adrenal insufficiency and adrenal replacement therapy. Current status in Spain.


    Aulinas, Anna; Casanueva, Felipe; Goñi, Fernando; Monereo, Susana; Moreno, Basilio; Picó, Antonio; Puig-Domingo, Manel; Salvador, Javier; Tinahones, Francisco J; Webb, Susan M


    Adrenal insufficiency (AI) is a rare endocrine disease, associated to increased mortality if left untreated. It can be due to a primary failure of the adrenal glands (primary AI) or malfunctioning of the hypothalamic-pituitary-adrenal axis (HPA) (secondary AI). The lack of data on incidence/prevalence of adrenal insufficiency in Spain complicates any evaluation of the magnitude of the problem in our country. Initial symptoms are non-specific, so often there is a delay in diagnosis. Current therapy with available glucocorticoids is associated with decreased quality of life in patients with treated AI, as well as with increased mortality and morbidity, probably related to both over-treatment and lack of hydrocortisone, associated with non-physiological peaks and troughs of the drug over the 24 hours. The availability of a new drug with a modified dual release (immediate and retarded), that requires one only daily dose, improves and simplifies the treatment, increases compliance as well as quality of life, morbidity and possibly mortality. This revision deals with the knowledge on the situation both globally and in Spain, prior to the availability of this new drug.

  5. Anesthetic considerations on adrenal gland surgery.


    Domi, Rudin; Sula, Hektor; Kaci, Myzafer; Paparisto, Sokol; Bodeci, Artan; Xhemali, Astrit


    Adrenal gland surgery needs a multidisciplinary team including endocrinologist, radiologist, anesthesiologist, and surgeon. The indications for adrenal gland surgery include hormonal secreting and non-hormonal secreting tumors. Adrenal hormonal secreting tumors present to the anesthesiologist unique challenges requiring good preoperative evaluation, perioperative hemodynamic control, corrections of all electrolytes and metabolic abnormalities, a detailed and careful anesthetic strategy, overall knowledge about the specific diseases, control and maintaining of postoperative adrenal function, and finally a good collaboration with other involved colleagues. This review will focus on the endocrine issues, as well as on the above-mentioned aspects of anesthetic management during hormone secreting adrenal gland tumor resection. PMID:25368694

  6. Adrenal lymphangioma removed by a retroperitoneoscopic procedure.


    Liu, Ben; Li, Yanyuan; Wang, Shuo


    We report a case of an adrenal lymphangioma removed by retroperitoneal laparoscopy. A 45-year-old female was referred to the urological ward for an adrenal mass that was incidentally detected by ultrasound examination one month earlier. An abdominal ultrasonography (US) scan revealed a 3.0 cm anechoic cystic mass, while a computed tomography (CT) scan revealed a 3.0×2.7 cm left adrenal cystic mass, which was suspected to be an adrenal cyst. The patient underwent retroperitoneoscopic removal of the tumor. Pathological evaluation revealed a cystic lymphangioma in the left adrenal gland.

  7. Anesthetic Considerations on Adrenal Gland Surgery

    PubMed Central

    Domi, Rudin; Sula, Hektor; Kaci, Myzafer; Paparisto, Sokol; Bodeci, Artan; Xhemali, Astrit


    Adrenal gland surgery needs a multidisciplinary team including endocrinologist, radiologist, anesthesiologist, and surgeon. The indications for adrenal gland surgery include hormonal secreting and non-hormonal secreting tumors. Adrenal hormonal secreting tumors present to the anesthesiologist unique challenges requiring good preoperative evaluation, perioperative hemodynamic control, corrections of all electrolytes and metabolic abnormalities, a detailed and careful anesthetic strategy, overall knowledge about the specific diseases, control and maintaining of postoperative adrenal function, and finally a good collaboration with other involved colleagues. This review will focus on the endocrine issues, as well as on the above-mentioned aspects of anesthetic management during hormone secreting adrenal gland tumor resection. PMID:25368694

  8. Adrenal gland and nonrenal retroperitoneum.


    Yeh, H C


    Ultrasound, as the initial cross-sectional imaging technique, confirmed the value of axial records. Although computerized tomography and possibly magnetic resonance offers better resolution, ultrasonography has the advantage of being less expensive, convenient, and highly portable. With these specific indications and reservations, ultrasonography of the adrenal and retroperitoneum has an accepted role in imaging.

  9. The effects of intra-abdominal hypertension on the secretory function of canine adrenal glands.


    Yu, Jian; Fu, XiaoJuan; Chang, MingTao; Zhang, LiangChao; Chen, ZhiQiang; Zhang, LianYang


    Intra-abdominal hypertension (IAH) can damage multiple organ systems, but the explicit impact on the adrenal gland is unclear. To evaluate the effects of intra-abdominal pressure (IAP) on the secretory function of the adrenal glands, we established canine models of IAH. By comparing morphology; hemodynamics; plasma cortisol, aldosterone, epinephrine, and norepinephrine concentrations; and the expression of IL-1, IL-6, and TNF-α in adrenal gland tissue from these dogs, we found that hemodynamic instability occurred after IAH and that IAH increased the plasma cortisol, aldosterone, epinephrine, and norepinephrine concentrations. Higher IAPs resulted in more significant changes, and the above indicators gradually returned to normal 2 h after decompression. Compared with the sham-operated group, IAH significantly increased IL-1, IL-6, and TNF-α levels in adrenal tissue, with larger increases in the presence of higher IAPs. However, the concentrations of these markers remained higher than those in the sham-operated group despite their decrease after 2 h of decompression. Histopathological examination revealed congestion, red blood cell exudation, and neutrophil infiltration in the adrenal glands when IAP was elevated; these conditions became more significant with more severe IAH. These results suggest that the secretion of adrenal hormones and adrenal gland inflammation are positively correlated with IAP and that abdominal decompression effectively corrects adrenal gland function.

  10. Chronic cardiac pressure overload induces adrenal medulla hypertrophy and increased catecholamine synthesis.


    Schneider, Johanna; Lother, Achim; Hein, Lutz; Gilsbach, Ralf


    Increased activity of the sympathetic system is an important feature contributing to the pathogenesis and progression of chronic heart failure. While the mechanisms and consequences of enhanced norepinephrine release from sympathetic nerves have been intensely studied, the role of the adrenal gland in the development of cardiac hypertrophy and progression of heart failure is less well known. Thus, the aim of the present study was to determine the effect of chronic cardiac pressure overload in mice on adrenal medulla structure and function. Cardiac hypertrophy was induced in wild-type mice by transverse aortic constriction (TAC) for 8 weeks. After TAC, the degree of cardiac hypertrophy correlated significantly with adrenal weight and adrenal catecholamine storage. In the medulla, TAC caused an increase in chromaffin cell size but did not result in chromaffin cell proliferation. Ablation of chromaffin α(2C)-adrenoceptors did not affect adrenal weight or epinephrine synthesis. However, unilateral denervation of the adrenal gland completely prevented adrenal hypertrophy and increased catecholamine synthesis. Transcriptome analysis of microdissected adrenal medulla identified 483 up- and 231 downregulated, well-annotated genes after TAC. Among these genes, G protein-coupled receptor kinases 2 (Grk2) and 6 and phenylethanolamine N-methyltransferase (Pnmt) were significantly upregulated by TAC. In vitro, acetylcholine-induced Pnmt and Grk2 expression as well as enhanced epinephrine content was prevented by inhibition of nicotinic acetylcholine receptors and Ca(2+)/calmodulin-dependent signaling. Thus, activation of preganglionic sympathetic nerves innervating the adrenal medulla plays an essential role in inducing adrenal hypertrophy, enhanced catecholamine synthesis and induction of Grk2 expression after cardiac pressure overload.

  11. Intraoperative identification of adrenal-renal fusion

    PubMed Central

    Boll, Griffin; Rattan, Rishi; Yilmaz, Osman; Tarnoff, Michael E


    Adrenal - renal fusion is a rare entity defined as incomplete encapsulation of the adrenal gland and kidney with histologically adjacent functional tissue. This report describes the first published intraoperative identification of this anomaly during laparoscopic adrenalectomy. The patient was a 59-year-old man with chronic hypertension refractory to multiple antihypertensives found to be caused by a right-sided aldosterone-producing adrenal adenoma in the setting of bilateral adrenal hyperplasia. During laparoscopic adrenalectomy, the normal avascular plane between the kidney and adrenal gland was absent. Pathologic evaluation confirmed adrenal - renal fusion without adrenal heterotopia. Identified intraoperatively, this may be misdiagnosed as invasive malignancy, and thus awareness of this anomaly may help prevent unnecessarily morbid resection. PMID:26195881

  12. [Adrenal injury in blunt abdominal trauma].


    Abakumov, M M; Smoliar, A N; Barmina, T G; Boĭko, A V; Shalimova, I G


    10 patients with adrenal damage were observed during 2.5 years. It amounted 0.93% of all patients with closed abdominal injuries. The right adrenal gland was traumatized in all cases evidently due to it's compression between right lobe of liver and vertebral column. Adrenal damage is observed quite often in combination with injuries of right liver lobe, right kidney and retroperitoneal hematoma formation. 5 patients underwent laparotomy on account of intra-abdominal bleeding, but adrenal damage was never revealed. Ultrasound and tomographic semiotics of adrenal damage was worked out, which allowed ascertaining diagnosis in 80% on application of ultrasound study and in 100% at computer tomography. Injury of one adrenal gland was not accompanied by adrenal failure and did not require hormonal replacement therapy.

  13. Pathophysiology and management aspects of adrenal angiomyolipomas

    PubMed Central

    Hussain, T


    Angiomyolipomas are benign mesenchymal tumours originating from the kidney and adrenals. They are rare tumours that can be sporadic and isolated or occur as a part of tuberous sclerosis. These tumours have a high content in the cells, which is pathognomonic for diagnosis using ultrasonography, computed tomography and magnetic resonance imaging. Atypical angiomyolipomas occur with excessive smooth muscle cells and less adipose tissue, and are sensitive to immunohistochemistry studies. Most of these lesions are detected incidentally but some can cause back and abdominal pains if large in size. Larger lesions are also vulnerable to spontaneous or traumatic rupture, causing large retropertitoneal bleeds. Surgery should be considered as the definitive management for larger lesions to avoid associated complications. There have been no reports of any malignant change being reported in any of the lesions but a long follow-up period is still required, given the unknown clinical progression of these rare tumours. PMID:22613297

  14. Functional Zonation of the Adult Mammalian Adrenal Cortex

    PubMed Central

    Vinson, Gavin P.


    The standard model of adrenocortical zonation holds that the three main zones, glomerulosa, fasciculata, and reticularis each have a distinct function, producing mineralocorticoids (in fact just aldosterone), glucocorticoids, and androgens respectively. Moreover, each zone has its specific mechanism of regulation, though ACTH has actions throughout. Finally, the cells of the cortex originate from a stem cell population in the outer cortex or capsule, and migrate centripetally, changing their phenotype as they progress through the zones. Recent progress in understanding the development of the gland and the distribution of steroidogenic enzymes, trophic hormone receptors, and other factors suggests that this model needs refinement. Firstly, proliferation can take place throughout the gland, and although the stem cells are certainly located in the periphery, zonal replenishment can take place within zones. Perhaps more importantly, neither the distribution of enzymes nor receptors suggest that the individual zones are necessarily autonomous in their production of steroid. This is particularly true of the glomerulosa, which does not seem to have the full suite of enzymes required for aldosterone biosynthesis. Nor, in the rat anyway, does it express MC2R to account for the response of aldosterone to ACTH. It is known that in development, recruitment of stem cells is stimulated by signals from within the glomerulosa. Furthermore, throughout the cortex local regulatory factors, including cytokines, catecholamines and the tissue renin-angiotensin system, modify and refine the effects of the systemic trophic factors. In these and other ways it more and more appears that the functions of the gland should be viewed as an integrated whole, greater than the sum of its component parts. PMID:27378832

  15. [Occurrence and structure of accessory adrenal glands in Wistar rats].


    Schwabedal, P E; Partenheimer, U


    In complete series of histological sections through the entire abdomen of one normal Wistar-rat, one untreated and two bilaterally adrenalectomized, spontaneously hypertensive Wistar-rats accessory suprarenal glands were found in each case. The detailed findings in the various groups of animals investigated were as follows: (1) In the normal animal 10 accessory suprarenal glands were present. They consisted of tiny aggregates of cortical cells and were surrounded by a thin layer of collageneous fibers. The diameters of the accessory suprarenal complexes were in the order of 0.3 mm. (2) In the untreated, spontaneously hypertensive rat three accessory suprarenal glands were found. However, in contrast to what was seen in the normal rat, these complexes were larger and had diameters of up to 1 mm. Some of these accessory suprarenal glands consisted almost exclusively of small, chromophobe cells, whereas in others a rim of such cells was seen to surround a central core of larger and more acidophile cortical cells. There were few and collapsed capillaries. (3) In the bilaterally adrenalectomized, spontaneously hypertensive rats three, respectively four, accessory suprarenal glands were found. They were situated in the retroperitoneum and partly within the adipose capsule of the kidney but never in the place of the exstirpated main suprarenal glands. In one case an accessory gland was found within the fibrous capsule of the kidney and seen to compress the renal parenchyma. In the bilaterally adrenalectomized animals the average diameters of the accessory glands were larger than in the other groups reaching values of up to 5 mm. At least in both animals one of the accessory glands had a diameter comparable to that of the normal suprarenal gland of an untreated animal. The capillaries were dilated and their number was increased in comparison to what was seen in the other groups. In certain regions the cortical tissue of the accessory glands had an appearance resembling

  16. Adrenal imaging (Part 1): Imaging techniques and primary cortical lesions

    PubMed Central

    Panda, Ananya; Das, Chandan J.; Dhamija, Ekta; Kumar, Rakesh; Gupta, A. K.


    Adrenal glands can be affected by a variety of lesions. Adrenal lesions can either be primary, of adrenal origin, or secondary to other pathologies. Primary adrenal lesions can further be either of cortical or medullary origin. Functioning adrenal lesions can also give clues to the histologic diagnosis and direct workup. Over the years, various imaging techniques have been developed that have increased diagnostic accuracy and helped in better characterization of adrenal lesions non-invasively. In the first part of the two part series, we review adrenal imaging techniques and adrenal cortical tumors such as adenomas, adrenocortical tumors, adrenal hyperplasia and oncocytomas. PMID:25593820

  17. Robotic renal and adrenal surgery.


    Sung, Gyung Tak; Gill, Inderbir S


    Technology today is evolving at a dramatic rate. Quantum development has occurred in the area of robotic enhancement technology (RET) in the last decade. Incorporation of RET with advanced telecommunication technologies is a recent integration in medicine, with growth potential and application in the delivery of modern health care. There remain, however, many areas which need to be further improved and evaluated before clinical applications of the robot become accepted in adrenal and renal minimally invasive surgery. PMID:14712880

  18. Atrial natriuretic factor mRNA and binding sites in the adrenal gland.

    PubMed Central

    Nunez, D J; Davenport, A P; Brown, M J


    The factor inhibiting aldosterone secretion produced by the adrenal medulla may be atrial natriuretic factor (ANF), since the latter abolishes aldosterone release in response to a number of secretagogues, including angiotensin II and K+. In this study we have shown that cells in the adrenal medulla contain ANF mRNA and therefore have the potential to synthesize this peptide. The presence of binding sites for ANF predominantly in the adrenal zona glomerulosa suggests that, if ANF is synthesized in the medulla and transferred to the cortex, it may affect mineralocorticoid status. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. PMID:2146954

  19. Adrenal cyst--a case report.


    Huang, S P; Chen, C C; Li, C C; Wu, W J; Chou, Y H; Huang, C H


    Adrenal cysts are rare and mostly silent clinically. Herein we report a case of adrenal cyst. A 55-year-old female was incidentally found to have a left suprarenal cystic lesion with a calcified wall by abdominal sonography during a work-up for her epigastralgia and left flank pain. Then, computed tomography (CT) revealed a left adrenal cystic mass with wall calcification, magnetic resonance imaging (MRI) showed left retroperitoneal cystic mass with fluid content, and angiography demonstrated an avascular lesion. Surgical exploration was performed via a flank incision and a calcified cystic adrenal mass was excised. The pathologic diagnosis was adrenal pseudocyst with calcified wall. We discuss the diagnosis and management of adrenal cyst and briefly review the literature.

  20. Solitary fibrous tumour of the adrenal gland associated with pregnancy.


    Bongiovanni, M; Viberti, L; Giraudo, G; Morino, M; Papotti, M


    Solitary fibrous tumour (SFT), first described as a pleural lesion, has been reported in several extrathoracic sites over the past 10 years. We describe a SFT of the left adrenal gland incidentally discovered in a 23-year-old, 22-week pregnant woman and characterised by a rapid growth during the third trimester of pregnancy. Elevated serum and urinary levels of cortisol and elevated blood levels of delta 4 androstendione and 17-OH progesterone were observed. After spontaneous delivery, the patient underwent laparoscopic resectioning of the mass and of the left adrenal gland from which the tumour was apparently originating. The kidney was not involved, and no other abdominal tumours were found. Histological and immunohistochemical features were typical of SFT of pleura and other locations. Only one case of adrenal SFT is on record, and the adrenal gland is to be added to the long list of extrathoracic locations of SFT. The association with pregnancy was a previously unrecognised event in SFT. The focal expression of progesterone receptors in the tumour cells may be related to pregnancy. This observation prompted an analysis of steroid hormone receptors in SFT of classical sites (pleura). Two of five cases had focal progesterone receptors too, a finding which deserves further investigations in a much larger series of SFTs.

  1. Operative approaches to the adrenal gland.


    Guz, B V; Straffon, R A; Novick, A C


    Various adrenal disorders necessitate surgical intervention, and familiarity with adrenal pathophysiology and surgical anatomy is crucial to the success of these procedures. A number of operative approaches--anterior, posterior, flank, and thoracoabdominal--are available; the choice must be made on the basis of the patient's adrenal pathology, body habitus, and surgical history as well as the surgeon's experience and familiarity with the different options. PMID:2665278

  2. Adrenal Failure due to Adrenal Metastasis of Lung Cancer: A Case Report

    PubMed Central

    Faulhaber, Gustavo Adolpho Moreira; Borges, Flavia Kessler; Ascoli, Aline Maria; Seligman, Renato; Furlanetto, Tania Weber


    We report a case of a patient with adrenal failure due to bilateral adrenal metastasis of lung cancer. This is a rare presentation of lung cancer. We review the differential diagnosis of weight loss and how to make diagnosis of adrenal insufficiency. PMID:22606443

  3. Adrenal scan in 17-alpha-hydroxylase deficiency: false indication of adrenal adenoma

    SciTech Connect

    Shore, R.M.; Lieberman, L.M.; Newman, T.J.; Friedman, A.; Bargman, G.J.


    A patient who was thought to have testicular feminization syndrome and primary aldosteronism had an adrenal scan that suggested an adrenal adenoma. After later diagnosis of 17-alpha-hydroxylase deficiency, she was treated with glucocorticoids rather than surgery. Her clinical course and a repeat adrenal scan confirmed she did not have a tumor.

  4. Adrenal Cortical Adenoma: The Fourth Component Of Carney Triad and an Association With Subclinical Cushing Syndrome

    PubMed Central

    Carney, J. Aidan; Stratakis, Constantine A.; Young, William F.


    Carney triad is the combination of gastric stromal sarcoma, pulmonary chondroma, and extra-adrenal paraganglioma. Herein, we describe the clinical, imaging, pathologic, and follow-up findings from 14 patients for a fourth component of the syndrome, adrenal adenoma, and clinical and imaging findings consistent with the tumor from 14 others. The adrenal neoplasm was asymptomatic and usually a late finding. Results of adrenocortical function tests were normal. Computed tomography revealed low-density adrenal masses that were consistent with adenomas. Bilateral lesions were present in 4 patients. In 13 of the 14 patients who underwent surgery, resected adrenal glands and biopsy specimens featured 1 or more circumscribed, yellow tumors, up to 3.5 cm in diameter, composed of well-differentiated polygonal cells with clear vacuolated cytoplasm and a smaller component of eosinophilic cells. The extratumoral cortex had combinations normal histologic features, discrete clear cell micronodules, zonal clear cell hypertrophy, or marked atrophy. The lesion in the 14th patient was different, grossly and microscopically resembling the usual sporadic cortisol-secreting adenoma. After the tumor was excised, the patient required glucocorticoid support. None of the tumors recurred or metastasized. Fourteen additional patients had unilateral or bilateral adrenal tumors consistent with adenomas detected by imaging studies. PMID:23681078

  5. Effects of long-term simvastatin treatment on testicular and adrenal steroidogenesis in hypercholesterolemic patients.


    Bernini, G P; Argenio, G F; Gasperi, M; Vivaldi, M S; Franchi, F; Salvetti, A


    Simvastatin is an inhibitor of 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-CoA) reductase, the key enzyme in the synthesis of cholesterol, recently introduced in the therapy of hypercholesterolemic patients. Cholesterol is the precursor of the biosynthesis of steroid hormones; thus, a reduction of the availability of cholesterol in the adrenal and testicular cells may reduce the synthesis of corticosteroids and androgens. To establish whether chronic therapy with simvastatin interferes with the integrity of the hypothalamic-pituitary-adrenal axis and with the adrenal and testicular reserve, we administered simvastatin orally in a single-day 10 mg dose for 6 months in 8 mildly hypercholesterolemic male patients. At weeks 0, 6 and 24 of treatment we evaluated the lipids, the activity of the hypothalamic-pituitary-adrenal axis by means of the Corticotropin-Releasing Hormone (CRH) test, the adrenal reserve by means of the Corticotropin rapid test and, finally, the testicular reserve by means of the Human Chorionic Gonadotropin (HCG) test. Total cholesterol and LDL-cholesterol were significantly reduced by Simvastatin, while the HDL-cholesterol and triglycerides did not change significantly. The hormonal responses to CRH, ACTH and HCG tests at weeks 6 and 24 of treatment were comparable to those obtained in basal conditions. We conclude that Simvastatin, while effective in reducing total and LDL-cholesterol in hypercholesterolemic male patients, did not interfere with hypothalamic-pituitary-adrenal axis activity or with basal and stimulated adrenal and testicular steroidogenesis.

  6. Neural differentiation potential of sympathoadrenal progenitors derived from fresh and cryopreserved neonatal porcine adrenal glands.


    Bozhok, G A; Sidorenko, O S; Plaksina, E M; Gurina, T M; Sukach, A N; Kholodnyy, V S; Ustichenko, V D; Bilyavskaya, S B; Bondarenko, T P; Legach, E I


    Stem/progenitor cells are thought to have the potential in the treatment of severe neurodegenerative diseases. Recently, sympathoadrenal progenitors expressing specific markers of neural crest derivatives and capable to differentiate into neurons were discovered in adult bovine and human adrenal glands, but there was no reported data on cryopreservation of sympathoadrenal progenitors. The aim of the present study was to examine the neural differentiation potential of sympathoadrenal progenitors derived from fresh and cryopreserved neonatal porcine adrenal glands. Considering impact of various initial state of frozen biomaterial on cell recovery, we carried out a comparative estimation of cryopreservation outcome both for adrenal tissue fragments and isolated primary cells. The estimation consisted of determining cell yield, viability, ability to adhere, proliferate and differentiate in vitro. Cells isolated from the fresh adrenal glands were cultured until confluence. A formation of sympathoadrenal progenitors-embedded spherical cell colonies, whose cells are differentiated then into βIII-tubulin-positive cells with neuron-like morphology, was observed on the monolayer. The colonies were well preserved after cryopreservation of cell culture with a cooling rate of 1 °C/min in the cryoprotectant media containing 5-15% of dimethylsulfoxide. Adrenal tissue fragments were cryopreserved in the presence of 10% dimethylsulfoxide at the cooling rates of 0.3; 1: 5; 40 and > 100 °C/min. Sympathoadrenal progenitors were recovered after cryopreservation with 0.3 °C/min cooling rate but not higher. PMID:27539465

  7. Neural differentiation potential of sympathoadrenal progenitors derived from fresh and cryopreserved neonatal porcine adrenal glands.


    Bozhok, G A; Sidorenko, O S; Plaksina, E M; Gurina, T M; Sukach, A N; Kholodnyy, V S; Ustichenko, V D; Bilyavskaya, S B; Bondarenko, T P; Legach, E I


    Stem/progenitor cells are thought to have the potential in the treatment of severe neurodegenerative diseases. Recently, sympathoadrenal progenitors expressing specific markers of neural crest derivatives and capable to differentiate into neurons were discovered in adult bovine and human adrenal glands, but there was no reported data on cryopreservation of sympathoadrenal progenitors. The aim of the present study was to examine the neural differentiation potential of sympathoadrenal progenitors derived from fresh and cryopreserved neonatal porcine adrenal glands. Considering impact of various initial state of frozen biomaterial on cell recovery, we carried out a comparative estimation of cryopreservation outcome both for adrenal tissue fragments and isolated primary cells. The estimation consisted of determining cell yield, viability, ability to adhere, proliferate and differentiate in vitro. Cells isolated from the fresh adrenal glands were cultured until confluence. A formation of sympathoadrenal progenitors-embedded spherical cell colonies, whose cells are differentiated then into βIII-tubulin-positive cells with neuron-like morphology, was observed on the monolayer. The colonies were well preserved after cryopreservation of cell culture with a cooling rate of 1 °C/min in the cryoprotectant media containing 5-15% of dimethylsulfoxide. Adrenal tissue fragments were cryopreserved in the presence of 10% dimethylsulfoxide at the cooling rates of 0.3; 1: 5; 40 and > 100 °C/min. Sympathoadrenal progenitors were recovered after cryopreservation with 0.3 °C/min cooling rate but not higher.

  8. "Looks Can Be Deceiving": Adrenal Teratoma Causing Diagnostic Difficulty.


    Nadeem, Mehwash; Ather, Muhammad Hammad; Sulaiman, M Nasir; Pervez, Shahid


    Teratomas are unusual tumours that derived from totipotent cells with their origin from more than one or usually all three germ cells. Here authors are presenting a case of primary retroperitoneal tumour that is a rare clinical entity. A 19-year-old male presented with right lumbar pain and was found to have complex cyst with large calcification in right adrenal gland on imaging. Intraoperatively, he was found to have a solid mass with areas of soft consistency, which was excised en bloc. On gross examination, the cyst contained pieces of bone, few teeth, and hairs entangled in mucinous material. On histological evaluation, it was confirmed to be mature teratoma arising from the right adrenal gland. He made uneventful recovery and was kept well on annual follow-up.

  9. Primary adrenal leiomyosarcoma: a case report and review of literature

    PubMed Central

    Zhou, Yihong; Tang, Yuxin; Tang, Jin; Deng, Fei; Gong, Guanghui; Dai, Yingbo


    Primary adrenal leiomyosarcoma (PAL) is an extremely rare mesenchymal tumors and originates from the smooth muscle wall of the central adrenal vein and its branches. Herein we report a case of a 49-year-old female suffering from PAL. Computed tomography revealed a well-circumscribed heterogeneously mass measuring 6×5×5 cm located in the left suprarenal areal, and a left laparoscopic adrenalectomy was underwent. Microscopic examination showed a hypercellular tumor with intersecting fascicled of spindled cells. Immunohistochemical staining showed that the cells were positive for desmin, smooth muscle actin (SMA), vimentin and negative for CD34, CD117, S100, Bcl-2 and Dog1. No oncological treatment underwent after surgery, and the patient had no recurrence or metastasis at 6 months postoperatively. PMID:26097622

  10. Primary adrenal leiomyosarcoma: a case report and review of literature.


    Zhou, Yihong; Tang, Yuxin; Tang, Jin; Deng, Fei; Gong, Guanghui; Dai, Yingbo


    Primary adrenal leiomyosarcoma (PAL) is an extremely rare mesenchymal tumors and originates from the smooth muscle wall of the central adrenal vein and its branches. Herein we report a case of a 49-year-old female suffering from PAL. Computed tomography revealed a well-circumscribed heterogeneously mass measuring 6 × 5 × 5 cm located in the left suprarenal areal, and a left laparoscopic adrenalectomy was underwent. Microscopic examination showed a hypercellular tumor with intersecting fascicled of spindled cells. Immunohistochemical staining showed that the cells were positive for desmin, smooth muscle actin (SMA), vimentin and negative for CD34, CD117, S100, Bcl-2 and Dog1. No oncological treatment underwent after surgery, and the patient had no recurrence or metastasis at 6 months postoperatively.

  11. Adrenal haemorrhage with cholestasis and adrenal crisis in a newborn of a diabetic mother.


    Koklu, Esad; Kurtoglu, Selim; Akcakus, Mustafa; Koklu, Selmin


    The large hyperaemic foetal adrenal gland is vulnerable to vascular damage. This may occur in the neonatal period as a consequence of difficult labour, or its aetiology may not be apparent. The spectrum of presentation is considerable, ranging from asymptomatic to severe life-threatening intra-abdominal haemorrhage. The presentation of adrenal insufficiency may be delayed but the regenerative capacity of the adrenal is great, and most adrenal haemorrhage is not associated with significantly impaired function. Some reports showed that cholestatic hepatopathy with congenital hypopituitarism reversed by hydrocortisone treatment is considered in the context of the endocrine syndrome, probably as a consequence of the adrenal failure. We describe a case of bilateral adrenal haemorrhage with hepatitis syndrome and persistent hypoglycaemia in a newborn male with striking features of neonatal cholestasis and adrenal crisis.

  12. Delayed Diagnosis of Graves' Thyrotoxicoisis Presenting as Recurrent Adrenal Crisis in Primary Adrenal Insufficiency.


    Naik, Dukhabandhu; Jebasingh, K Felix; Thomas, Nihal


    Adrenal crisis is a potential life threatening complication. The common causes of adrenal crisis are infections, surgical stress and abrupt cessation of steroid medications. Endocrine causes like Graves' disease with thyrotoxicosis is one of the less common causes of an adrenal crisis. We report a 42-year-old female who presented with recurrent episodes of adrenal crisis due to delayed diagnosis of thyrotoxicosis. She was initially treated with Carbimazole followed by Radio-iodine ablation and currently she is euthyroid. Her adrenal insufficiency was initially treated with hydrocortisone during the time of adrenal crisis followed by Prednisolone 5 mg once daily in the morning along with fludrocortisone 50 mcg once daily. This case highlights the need for high index of suspicion and less common causes like thyrotoxicosis should be ruled out in patients with adrenal crisis.

  13. Adrenal Development in Mice Requires GATA4 and GATA6 Transcription Factors.


    Tevosian, Sergei G; Jiménez, Elizabeth; Hatch, Heather M; Jiang, Tianyu; Morse, Deborah A; Fox, Shawna C; Padua, Maria B


    The adrenal glands consist of an outer cortex and an inner medulla, and their primary purposes include hormone synthesis and secretion. The adrenal cortex produces a complex array of steroid hormones, whereas the medulla is part of the sympathetic nervous system and produces the catecholamines epinephrine and norepinephrine. In the mouse, GATA binding protein (GATA) 4 and GATA6 transcription factors are coexpressed in several embryonic tissues, including the adrenal cortex. To explore the roles of GATA4 and GATA6 in mouse adrenal development, we conditionally deleted these genes in adrenocortical cells using the Sf1Cre strain of animals. We report here that mice with Sf1Cre-mediated double deletion of Gata4 and Gata6 genes lack identifiable adrenal glands, steroidogenic factor 1-positive cortical cells and steroidogenic gene expression in the adrenal location. The inactivation of the Gata6 gene alone (Sf1Cre;Gata6(flox/flox)) drastically reduced the adrenal size and corticosterone production in the adult animals. Adrenocortical aplasia is expected to result in the demise of the animal within 2 weeks after birth unless glucocorticoids are provided. In accordance, Sf1Cre;Gata4(flox/flox)Gata6(flox/flox) females depend on steroid supplementation to survive after weaning. Surprisingly, Sf1Cre;Gata4(flox/flox)Gata6(flox/flox) males appear to live normal lifespans as vital steroidogenic synthesis shifts to their testes. Our results reveal a requirement for GATA factors in adrenal development and provide a novel tool to characterize the transcriptional network controlling adrenocortical cell fates.

  14. Adrenal Development in Mice Requires GATA4 and GATA6 Transcription Factors

    PubMed Central

    Jiménez, Elizabeth; Hatch, Heather M.; Jiang, Tianyu; Morse, Deborah A.; Fox, Shawna C.


    The adrenal glands consist of an outer cortex and an inner medulla, and their primary purposes include hormone synthesis and secretion. The adrenal cortex produces a complex array of steroid hormones, whereas the medulla is part of the sympathetic nervous system and produces the catecholamines epinephrine and norepinephrine. In the mouse, GATA binding protein (GATA) 4 and GATA6 transcription factors are coexpressed in several embryonic tissues, including the adrenal cortex. To explore the roles of GATA4 and GATA6 in mouse adrenal development, we conditionally deleted these genes in adrenocortical cells using the Sf1Cre strain of animals. We report here that mice with Sf1Cre-mediated double deletion of Gata4 and Gata6 genes lack identifiable adrenal glands, steroidogenic factor 1-positive cortical cells and steroidogenic gene expression in the adrenal location. The inactivation of the Gata6 gene alone (Sf1Cre;Gata6flox/flox) drastically reduced the adrenal size and corticosterone production in the adult animals. Adrenocortical aplasia is expected to result in the demise of the animal within 2 weeks after birth unless glucocorticoids are provided. In accordance, Sf1Cre;Gata4flox/floxGata6flox/flox females depend on steroid supplementation to survive after weaning. Surprisingly, Sf1Cre;Gata4flox/floxGata6flox/flox males appear to live normal lifespans as vital steroidogenic synthesis shifts to their testes. Our results reveal a requirement for GATA factors in adrenal development and provide a novel tool to characterize the transcriptional network controlling adrenocortical cell fates. PMID:25933105

  15. Images of pheochromocytoma in adrenal glands

    PubMed Central

    McCarthy, Colin J.; Blake, Michael A.


    Pheochromocytomas are relatively rare tumors of the adrenal medulla. A wide spectrum of imaging findings has been described. The aim of this article is to describe the multimodality imaging features of pheochromocytomas including diagnostic pearls that can help differentiate them from other adrenal lesions and pitfalls to avoid. PMID:26310999

  16. Unilateral adrenal hemorrhagic infarction in essential thrombocythemia.


    Burnet, G; Lambert, M; Annet, L; Lefebvre, C


    Adrenal hemorrhage is a rare disease associated with various conditions. We report a case of a 68-year-old woman with abdominal and back pain. The diagnostic work-up showed a left adrenal gland infarction associated with essential thrombocythemia. Treatment consisted in painkillers and treating the underlying condition in order to prevent further thrombotic events.

  17. Images of pheochromocytoma in adrenal glands.


    McDermott, Shaunagh; McCarthy, Colin J; Blake, Michael A


    Pheochromocytomas are relatively rare tumors of the adrenal medulla. A wide spectrum of imaging findings has been described. The aim of this article is to describe the multimodality imaging features of pheochromocytomas including diagnostic pearls that can help differentiate them from other adrenal lesions and pitfalls to avoid.

  18. Computed tomographic findings in bilateral adrenal tuberculosis

    SciTech Connect

    Wilms, G.E.; Baert, A.L.; Kint, E.J.; Pringot, J.H.; Goddeeris, P.G.


    The computed tomographic (CT) features of bilateral adrenal tuberculosis are reported in two cases that demonstrate two typical different clinical and morphological manifestations of the disease. The incidence and CT appearance of adrenal tuberculosis are discussed, with emphasis on differential diagnosis.

  19. [Two cystic retroperitoneal lesions mimicking adrenal cysts].


    Grabellus, F; Dereskewitz, C; Schmitz, K J; Kaiser, G M; Kühl, H; Kersting, C; Frilling, A; Metz, K A; Baba, H A


    Adrenal cysts are uncommon lesions and most of them are found incidentally during abdominal imaging. We report on two benign extraadrenal lesions mimicking adrenal tumors in abdominal imaging. The histopathological investigation of the lesions revealed a foregut duplication cyst of the lesser gastric curvature and an epithelial inclusion cyst (epidermoid cyst) in an intrapancreatic accessory spleen respectively.

  20. Laparoscopic extirpation of giant adrenal ganglioneuroma

    PubMed Central

    Abraham, George P; Siddaiah, Avinash T; Das, Krishanu; Krishnamohan, Ramaswami; George, Datson P; Abraham, Jisha J; Chandramathy, Sreerenjini K


    Laparoscopic adrenalectomy is the standard of care for management of adrenal neoplasms. However, large sized adrenal lesions are considered as relative contraindication for laparoscopic extirpation. We report laparoscopic excision of giant ganglioneuroma of adrenal gland in a 33-year-old female patient. Patient was presented with left loin pain of 2 months duration. Computed tomography (CT) scan was suggestive of non-enhancing left suprarenal mass measuring 17 × 10 cm. Preoperative endocrine evaluation ruled out functional adrenal tumor. Patient underwent transperitoneal excision of suprarenal mass. The lesion could be completely extirpated laparoscopically. Duration of surgery was 250 minutes. Estimated blood loss was 230 milliliters. Specimen was extracted through pfannenstiel incision. No significant intraoperative or postoperative happenings were recorded. Microscopic features were suggestive of ganglioneuroma of adrenal gland. PMID:24501511

  1. Diagnosis and management of adrenal insufficiency.


    Bancos, Irina; Hahner, Stefanie; Tomlinson, Jeremy; Arlt, Wiebke


    Adrenal insufficiency continues to be a challenge for patients, their physicians, and researchers. During the past decade, long-term studies have shown increased mortality and morbidity and impaired quality of life in patients with adrenal insufficiency. These findings might, at least partially, be due to the failure of glucocorticoid replacement therapy to closely resemble physiological diurnal secretion of cortisol. The potential effect of newly developed glucocorticoid drugs is a focus of research, as are the mechanisms potentially underlying increased morbidity and mortality. Adrenal crisis remains a threat to lives, and awareness and preventative measures now receive increasing attention. Awareness should be raised in medical teams and patients about adrenal insufficiency and management of adrenal crisis to improve clinical outcome.

  2. Extensive expertise in endocrinology. Adrenal crisis.


    Allolio, Bruno


    Adrenal crisis is a life-threatening emergency contributing to the excess mortality of patients with adrenal insufficiency. Studies in patients on chronic replacement therapy for adrenal insufficiency have revealed an incidence of 5-10 adrenal crises/100 patient years and suggested a mortality rate from adrenal crisis of 0.5/100 patient years. Patients with adrenal crisis typically present with profoundly impaired well-being, hypotension, nausea and vomiting, and fever responding well to parenteral hydrocortisone administration. Infections are the major precipitating causes of adrenal crisis. Lack of increased cortisol concentrations during infection enhances pro-inflammatory cytokine release and sensitivity to the toxic effects of these cytokines (e.g. tumour necrosis factor alpha). Furthermore, pro-inflammatory cytokines may impair glucocorticoid receptor function aggravating glucocorticoid deficiency. Treatment of adrenal crisis is simple and highly effective consisting of i.v. hydrocortisone (initial bolus of 100  mg followed by 200  mg over 24  h as continuous infusion) and 0.9% saline (1000  ml within the first hour). Prevention of adrenal crisis requires appropriate hydrocortisone dose adjustments to stressful medical procedures (e.g. major surgery) and other stressful events (e.g. infection). Patient education is a key for such dose adjustments but current education concepts are not sufficiently effective. Thus, improved education strategies are needed. Every patient should carry an emergency card and should be provided with an emergency kit for parenteral hydrocortisone self-administration. A hydrocortisone pen would hold a great potential to lower the current barriers to hydrocortisone self-injection. Improved patient education and measures to facilitate parenteral hydrocortisone self-administration in impending crisis are expected to significantly reduce morbidity and mortality from adrenal crisis.

  3. A case of human intramuscular adrenal gland transplantation as a cure for chronic adrenal insufficiency.


    Grodstein, E; Hardy, M A; Goldstein, M J


    Intramuscular endocrine gland transplantation has been well described as it pertains to parathyroid autotransplantation; however, transplantation of the adrenal gland is less well characterized. While adrenal autotransplantation in the setting of Cushing's disease has been described, intramuscular adrenal allotransplantation as a cure for adrenal insufficiency to our knowledge has not been previously carried out. Current treatment for adrenal insufficiency leaves patients without diurnal variation in cortisol release and susceptible to the detrimental effects of chronic hypercortisolism. We describe here the case of a 5-year-old girl with renal failure who had adrenal insufficiency following fulminant meningococcemia that led to requirements for both stress-dose steroid and mineralocorticoid replacement. Ten months after the onset of her disease, she received a simultaneous renal and adrenal gland transplant from her mother. The adrenal gland allograft was morselized into 1 mm(3) segments and implanted into three 2 cm pockets created in her rectus abdominis muscle. Three years after surgery, her allograft remains fully functional, responding well to adrenocorticotropin hormone stimulation and the patient does not require any steroid or mineral-corticoid supplementation. We believe this case represents the first description of successful functional intramuscular adrenal allograft transplantation with long-term follow up as a cure for adrenal insufficiency.

  4. Sonography of the adrenal glands in the adult.


    Kim, Kyoung Won; Kim, Jeong Kon; Choi, Hyuck Jae; Kim, Mi-hyun; Lee, Jeongjin; Cho, Kyoung-Sik


    Although its capability has been overlooked, sonography can be a useful screening tool for adrenal lesion in adults. In this article, we discuss scan technique, patient positioning, and anatomic consideration for adrenal sonography in adults and illustrate sonographic appearance of normal adrenal gland as well as adrenal tumors and tumor-like lesions.

  5. Clinicopathological correlates of adrenal Cushing's syndrome.


    Duan, Kai; Hernandez, Karen Gomez; Mete, Ozgur


    Endogenous Cushing's syndrome is a rare endocrine disorder that incurs significant cardiovascular morbidity and mortality, due to glucocorticoid excess. It comprises adrenal (20%) and non-adrenal (80%) aetiologies. While the majority of cases are attributed to pituitary or ectopic corticotropin (ACTH) overproduction, primary cortisol-producing adrenal cortical lesions are increasingly recognised in the pathophysiology of Cushing's syndrome. Our understanding of this disease has progressed substantially over the past decade. Recently, important mechanisms underlying the pathogenesis of adrenal hypercortisolism have been elucidated with the discovery of mutations in cyclic AMP signalling (PRKACA, PRKAR1A, GNAS, PDE11A, PDE8B), armadillo repeat containing 5 gene (ARMC5) a putative tumour suppressor gene, aberrant G-protein-coupled receptors, and intra-adrenal secretion of ACTH. Accurate subtyping of Cushing's syndrome is crucial for treatment decision-making and requires a complete integration of clinical, biochemical, imaging and pathology findings. Pathological correlates in the adrenal glands include hyperplasia, adenoma and carcinoma. While the most common presentation is diffuse adrenocortical hyperplasia secondary to excess ACTH production, this entity is usually treated with pituitary or ectopic tumour resection. Therefore, when confronted with adrenalectomy specimens in the setting of Cushing's syndrome, surgical pathologists are most commonly exposed to adrenocortical adenomas, carcinomas and primary macronodular or micronodular hyperplasia. This review provides an update on the rapidly evolving knowledge of adrenal Cushing's syndrome and discusses the clinicopathological correlations of this important disease. PMID:26045561

  6. Clinicopathological correlates of adrenal Cushing's syndrome.


    Duan, Kai; Gomez Hernandez, Karen; Mete, Ozgur


    Endogenous Cushing's syndrome is a rare endocrine disorder that incurs significant cardiovascular morbidity and mortality, due to glucocorticoid excess. It comprises adrenal (20%) and non-adrenal (80%) aetiologies. While the majority of cases are attributed to pituitary or ectopic corticotropin (ACTH) overproduction, primary cortisol-producing adrenal cortical lesions are increasingly recognised in the pathophysiology of Cushing's syndrome. Our understanding of this disease has progressed substantially over the past decade. Recently, important mechanisms underlying the pathogenesis of adrenal hypercortisolism have been elucidated with the discovery of mutations in cyclic AMP signalling (PRKACA, PRKAR1A, GNAS, PDE11A, PDE8B), armadillo repeat containing 5 gene (ARMC5) a putative tumour suppressor gene, aberrant G-protein-coupled receptors, and intra-adrenal secretion of ACTH. Accurate subtyping of Cushing's syndrome is crucial for treatment decision-making and requires a complete integration of clinical, biochemical, imaging and pathology findings. Pathological correlates in the adrenal glands include hyperplasia, adenoma and carcinoma. While the most common presentation is diffuse adrenocortical hyperplasia secondary to excess ACTH production, this entity is usually treated with pituitary or ectopic tumour resection. Therefore, when confronted with adrenalectomy specimens in the setting of Cushing's syndrome, surgical pathologists are most commonly exposed to adrenocortical adenomas, carcinomas and primary macronodular or micronodular hyperplasia. This review provides an update on the rapidly evolving knowledge of adrenal Cushing's syndrome and discusses the clinicopathological correlations of this important disease. PMID:25425660

  7. Clinicopathological correlates of adrenal Cushing's syndrome.


    Duan, Kai; Gomez Hernandez, Karen; Mete, Ozgur


    Endogenous Cushing's syndrome is a rare endocrine disorder that incurs significant cardiovascular morbidity and mortality, due to glucocorticoid excess. It comprises adrenal (20%) and non-adrenal (80%) aetiologies. While the majority of cases are attributed to pituitary or ectopic corticotropin (ACTH) overproduction, primary cortisol-producing adrenal cortical lesions are increasingly recognised in the pathophysiology of Cushing's syndrome. Our understanding of this disease has progressed substantially over the past decade. Recently, important mechanisms underlying the pathogenesis of adrenal hypercortisolism have been elucidated with the discovery of mutations in cyclic AMP signalling (PRKACA, PRKAR1A, GNAS, PDE11A, PDE8B), armadillo repeat containing 5 gene (ARMC5) a putative tumour suppressor gene, aberrant G-protein-coupled receptors, and intra-adrenal secretion of ACTH. Accurate subtyping of Cushing's syndrome is crucial for treatment decision-making and requires a complete integration of clinical, biochemical, imaging and pathology findings. Pathological correlates in the adrenal glands include hyperplasia, adenoma and carcinoma. While the most common presentation is diffuse adrenocortical hyperplasia secondary to excess ACTH production, this entity is usually treated with pituitary or ectopic tumour resection. Therefore, when confronted with adrenalectomy specimens in the setting of Cushing's syndrome, surgical pathologists are most commonly exposed to adrenocortical adenomas, carcinomas and primary macronodular or micronodular hyperplasia. This review provides an update on the rapidly evolving knowledge of adrenal Cushing's syndrome and discusses the clinicopathological correlations of this important disease.

  8. Clinicopathological correlates of adrenal Cushing's syndrome.


    Duan, Kai; Hernandez, Karen Gomez; Mete, Ozgur


    Endogenous Cushing's syndrome is a rare endocrine disorder that incurs significant cardiovascular morbidity and mortality, due to glucocorticoid excess. It comprises adrenal (20%) and non-adrenal (80%) aetiologies. While the majority of cases are attributed to pituitary or ectopic corticotropin (ACTH) overproduction, primary cortisol-producing adrenal cortical lesions are increasingly recognised in the pathophysiology of Cushing's syndrome. Our understanding of this disease has progressed substantially over the past decade. Recently, important mechanisms underlying the pathogenesis of adrenal hypercortisolism have been elucidated with the discovery of mutations in cyclic AMP signalling (PRKACA, PRKAR1A, GNAS, PDE11A, PDE8B), armadillo repeat containing 5 gene (ARMC5) a putative tumour suppressor gene, aberrant G-protein-coupled receptors, and intra-adrenal secretion of ACTH. Accurate subtyping of Cushing's syndrome is crucial for treatment decision-making and requires a complete integration of clinical, biochemical, imaging and pathology findings. Pathological correlates in the adrenal glands include hyperplasia, adenoma and carcinoma. While the most common presentation is diffuse adrenocortical hyperplasia secondary to excess ACTH production, this entity is usually treated with pituitary or ectopic tumour resection. Therefore, when confronted with adrenalectomy specimens in the setting of Cushing's syndrome, surgical pathologists are most commonly exposed to adrenocortical adenomas, carcinomas and primary macronodular or micronodular hyperplasia. This review provides an update on the rapidly evolving knowledge of adrenal Cushing's syndrome and discusses the clinicopathological correlations of this important disease.

  9. Adrenomyeloneuropathy Presenting With Adrenal Insufficiency

    PubMed Central

    Park, Hee Dong; Choi, Yong Min; Kang, Jin Ho


    Adrenomyeloneuropathy (AMN), one of the variants of X-linked adrenoleukodystrophy (ALD), is inherited peroxisomal disorder associated with the accumulation of very long chain fatty acids (VLCFA). AMN is characterized primarily by involvements of long ascending and descending tracts of the spinal cord and peripheral neuropathy, which leads to spastic paraparesis and urinary and erectile dysfunction. We experienced the AMN case of a 33-year-old man presenting bilateral progressive spastic paraparesis, impotence and urge incontinence with primary adrenal failures, as confirmed by increased serum of VLCFA concentrations. Considering that somatosensory evoked potentials in posterior tibial nerve was the only abnormal finding in electrophysiologic findings when compared with the severe spastic gait pattern shown, it is necessary to follow up with electrophysiologic studies. PMID:24020038

  10. Recognition and management of adrenal emergencies.


    Torrey, Susan P


    Although clinical conditions associated with dysfunction of the ad-renal gland are often subtle, even insidious, in their presentation,and diagnosis and treatment usually are confined to outpatient clinics and offices, there are several situations that warrant the attention of emergency physicians. Recognition of the spectrum of presentations of pheochromocytoma, adrenal insufficiency, and pituitary apoplexy, and the sequelae of corticosteroid therapy and withdrawal, are critically important areas to emergency medicine. Prompt diagnosis with appropriate treatment and referral will reduce morbidity and mortality in many patients each year. A related topic pertinent to emergency physicians is the management of incidental adrenal masses that are discovered on abdominal radio-logic imaging.

  11. Muscarine binding sites in bovine adrenal medulla.


    Barron, B A; Murrin, L C; Hexum, T D


    The presence of muscarinic binding sites in the bovine adrenal medulla was investigated using [3H]QNB and the bovine adrenal medulla. Scatchard analysis combined with computer analysis yielded data consistent with a two binding site configuration. KDs of 0.15 and 14 nM and Bmax s of 29 and 210 fmol/mg protein, respectively, were observed. Displacement of [3H]QNB by various cholinergic agents is, in order of decreasing potency: QNB, dexetimide, atropine, scopolamine, imipramine, desipramine, oxotremorine, pilocarpine, acetylcholine, methacholine and carbachol. These results demonstrate the presence of more than one muscarine binding site in the bovine adrenal gland. PMID:3709656

  12. The adrenal gland and progesterone stimulates testicular steroidogenesis in the rat in vivo.


    Feek, C M; Tuzi, N L; Edwards, C R


    Administration of pharmacological doses of glucocorticoid to male rats in vivo suppresses adrenal steroidogenesis and inhibits testicular steroidogenesis by inhibiting the anterior pituitary secretion of LH. In contrast, administration of ACTH to these pharmacologically-suppressed rats stimulates the adrenal secretion of progesterone and testicular steroidogenesis. The mechanism by which ACTH increases testicular steroidogenesis is dependent on the presence of the adrenal gland and is reproduced by the administration of progesterone. The conclusion from these data is that the adrenal gland has an important role in generating external signals that modulate the hypothalamic-pituitary-gonadal axis in male rats. The adrenal secretion of glucocorticoid acts as a negative signal to testicular steroidogenesis whereas progesterone acts as a positive signal. The adrenal secretion of progesterone and its conversion to testosterone by steroidogenic enzymes in the cytoplasm of the Leydig cell may provide an alternative pathway for testosterone biosynthesis and may account for the increased plasma testosterone levels during the acute phase of stress and mating.

  13. Down-regulation of the beacon gene expression in the regenerating rat adrenal cortex.


    Ziolkowska, Agnieszka; Rucinski, Marcin; Tyczewska, Marianna; Belloni, Anna Sandra; Nowak, Magdalena; Nussdorfer, Gastone G; Malendowicz, Ludwik K


    Beacon, a hypothalamic peptide involved in the regulation of food intake, has been recently shown to be expressed in the adrenal cortex, and to inhibit its secretion and growth. To further characterize the role of beacon in the control of adrenal growth, we investigated the level of beacon gene expression in the regenerating rat adrenal cortex. Conventional reverse transcription-polymerase chain reaction (PCR) and immunocytochemistry demonstrated the expression of beacon mRNA and protein in the adrenals at both days 5 and 8 of regeneration after enucleation and contralateral adrenalectomy. Semiquantitative real time-PCR revealed a net down-regulation of beacon mRNA in the regenerating glands, as compared to the intact adrenal cortex of sham-operated animals. Beacon gene expression was higher at day 8 than at day 5 of regeneration. Mitotic index, as assayed by the stachmokinetic method with vincristin, was negligible in the intact adrenal, but greatly elevated in regenerating gland, with a higher index found at day 5 than at day 8 after surgery. Taken together our findings indicate that the level of beacon gene expression is inversely correlated with the proliferative activity of adrenocortical cells, and suggest that beacon might act as an endogenous inhibitor of adrenocortical growth in the rat.

  14. Acute Abdominal Pain after Intercourse: Adrenal Hemorrhage as the First Sign of Metastatic Lung Cancer

    PubMed Central

    Packer, Clifford D.


    Although the adrenal glands are a common site of cancer metastases, they are often asymptomatic and discovered incidentally on CT scan or autopsy. Spontaneous adrenal hemorrhage associated with metastatic lung cancer is an exceedingly rare phenomenon, and diagnosis can be difficult due to its nonspecific symptoms and ability to mimic other intra-abdominal pathologies. We report a case of a 65-year-old man with a history of right upper lobectomy seven months earlier for stage IB non-small cell lung cancer who presented with acute abdominal pain after intercourse. CT scan revealed a new right adrenal mass with surrounding hemorrhage, and subsequent FDG-PET scan confirmed new metabolic adrenal metastases. The patient's presentation of abdominal pain and adrenal hemorrhage immediately after sexual intercourse suggests that exertion, straining, or increased intra-abdominal pressure might be risk factors for precipitation of hemorrhage in patients with adrenal metastases. Management includes pain control and supportive treatment in mild cases, with arterial embolization or adrenalectomy being reserved for cases of severe hemorrhage. PMID:25126096

  15. A case of adrenal Cushing’s syndrome with bilateral adrenal masses

    PubMed Central

    Guo, Ya-Wun; Hwu, Chii-Min; Won, Justin Ging-Shing; Chu, Chia-Huei


    Summary A functional lesion in corticotrophin (ACTH)-independent Cushing’s syndrome is difficult to distinguish from lesions of bilateral adrenal masses. Methods for distinguishing these lesions include adrenal venous sampling and 131I-6β-iodomethyl-19-norcholesterol (131I-NP-59) scintigraphy. We present a case of a 29-year-old Han Chinese female patient with a history of hypercholesterolaemia and polycystic ovary syndrome. She presented with a 6month history of an 8kg body weight gain and gradual rounding of the face. Serial examinations revealed loss of circadian rhythm of cortisol, elevated urinary free-cortisol level and undetectable ACTH level (<5pg/mL). No suppression was observed in both the low- and high-dose dexamethasone suppression tests. Adrenal computed tomography revealed bilateral adrenal masses. Adrenal venous sampling was performed, and the right-to-left lateralisation ratio was 14.29. The finding from adrenal scintigraphy with NP-59 was consistent with right adrenal adenoma. The patient underwent laparoscopic right adrenalectomy, and the pathology report showed adrenocortical adenoma. Her postoperative cortisol level was 3.2μg/dL, and her Cushingoid appearance improved. In sum, both adrenal venous sampling and 131I-NP-59 scintigraphy are good diagnostic methods for Cushing’s syndrome presenting with bilateral adrenal masses. Learning points The clinical presentation of Cushing’ syndrome includes symptoms and signs of fat redistribution and protein-wasting features. The diagnosis of patients with ACTH-independent Cushing’s syndrome with bilateral adrenal masses is challenging for localisation of the lesion. Both adrenal venous sampling and 131I-NP-59 scintigraphy are good methods to use in these patients with Cushing’s syndrome presenting with bilateral adrenal masses. PMID:27252858

  16. Presence of kisspeptin-like immunoreactivity in human adrenal glands and adrenal tumors.


    Takahashi, Kazuhiro; Shoji, Itaru; Shibasaki, Akiko; Kato, Ichiro; Hiraishi, Keisuke; Yamamoto, Hajime; Kaneko, Kiriko; Murakami, Osamu; Morimoto, Ryo; Satoh, Fumitoshi; Ito, Sadayoshi; Totsune, Kazuhito


    Kisspeptins are neuropeptides which activate the hypothalamo-pituitary gonadal axis and are considered to play important physiological roles in the reproduction. Kisspeptins have also been reported to stimulate the aldosterone secretion from the adrenal cortex. However, the expression of kisspeptins in human adrenal glands and adrenal tumors has not been clarified yet. We, therefore, studied the presence of kisspeptin-like immunoreactivity (LI) in human adrenal glands and adrenal tumors (adrenocortical adenomas, adrenocortical carcinomas, and pheochromocytomas) by radioimmunoassay and immunocytochemistry. Kisspeptin-LI was detected in all the tissues examined; normal portions of adrenal glands (3.0 +/- 2.3 pmol/g wet weight, n = 21, mean +/- SD), aldosterone-producing adenomas (4.6 +/- 3.3 pmol/g wet weight, n = 10), cortisol-producing adenomas (2.7 +/- 1.4 pmol/g wet weight, n = 14), adrenocortical carcinomas (1.7 +/- 0.2 pmol/g wet weight, n = 4), and pheochromocytomas (1.8 +/- 0.8 pmol/g wet weight, n = 6). There was no significant difference in kisspeptin-LI levels among them. Immunocytochemistry showed positive kisspeptin-immunostaining in normal adrenal glands, with stronger immunostaining found in the medulla. Furthermore, positive kisspeptin-immunostaining was found in all types of adrenal tumors examined; adrenocortical adenomas, adrenocortical carcinomas, and pheochromocytomas. The intensity of kisspeptin-immunostaining in these adrenal tumors was, however, not so strong as that in normal adrenal medulla. The present study has shown for the first time the presence of kisspeptin-LI in adrenal glands and adrenal tumors.

  17. Tryparedoxins from Crithidia fasciculata and Trypanosoma brucei: photoreduction of the redox disulfide using synchrotron radiation and evidence for a conformational switch implicated in function.


    Alphey, Magnus S; Gabrielsen, Mads; Micossi, Elena; Leonard, Gordon A; McSweeney, Sean M; Ravelli, Raimond B G; Tetaud, Emmanuel; Fairlamb, Alan H; Bond, Charles S; Hunter, William N


    Tryparedoxin (TryX) is a member of the thioredoxin (TrX) fold family involved in the regulation of oxidative stress in parasitic trypanosomatids. Like TrX, TryX carries a characteristic Trp-Cys-Xaa-Xaa-Cys motif, which positions a redox-active disulfide underneath a tryptophan lid. We report the structure of a Crithidia fasciculata tryparedoxin isoform (CfTryX2) in two crystal forms and compare them with structures determined previously. Efforts to chemically generate crystals of reduced TryX1 were unsuccessful, and we carried out a novel experiment to break the redox-active disulfide, formed between Cys-40 and Cys-43, utilizing the intense x-radiation from a third generation synchrotron undulator beamline. A time course study of the S-S bond cleavage is reported with the structure of a TryX1 C43A mutant as the control. When freed from the constraints of a disulfide link to Cys-43, Cys-40 pivots to become slightly more solvent-accessible. In addition, we have determined the structure of Trypanosoma brucei TryX, which, influenced by the molecular packing in the crystal lattice, displays a significantly different orientation of the active site tryptophan lid. This structural change may be of functional significance when TryX interacts with tryparedoxin peroxidase, the final protein in the trypanothione-dependent peroxidase pathway. Comparisons with chloroplast TrX and its substrate fructose 1,6-bisphosphate phosphatase suggest that this movement may represent a general feature of redox regulation in the trypanothione and thioredoxin peroxidase pathways.

  18. Radiology of the adrenals with sonography and CT

    SciTech Connect

    Mitty, H.A.; Yeh, H.C.


    The basic science and application of clinical adrenal imaging is presented. The initial chapters deal with anatomic review and methods of adrenal imaging. The bulk of the book consists of individual chapters describing pathologic entities and syndromes of adrenal disease. The final chapter deals with differentiation of adrenal lesions from masses arising in adjacent organs. There is no other single source available which so concisely presents adrenal imaging. (KRM)

  19. [A rare form of adrenal tuberculosis presenting as an asymptomatic adrenal mass].


    Sarf, Ismail; el Mejjad, Amine; Badre, Latifa; Dakir, Mohamed; Aboutaieb, Rachid; Meziane, Fethi


    The authors report a case of adrenal tuberculosis discovered during staging of a biopsy-confirmed bladder tumour, in a 70-year-old patient consulting for haematuria. Cystoscopy with biopsy revealed a high-grade papillary urothelial carcinoma invading the detrusor. Staging abdominopelvic computed tomography revealed a necrotic, multilobed right adrenal mass. Histological examination of the adrenalectomy specimen revealed adrenal tuberculosis. Antituberculous therapy was administered for 9 months and comprised streptomycin, isoniazid, rifampicin and pyrazinamide for 2 months, followed by rifampicin and isoniazid for 7 months. In the light of this case and with the increasing incidence of AIDS, the diagnosis of adrenal tuberculosis must be considered in any case of incidentaloma.

  20. Bilateral adrenal myelolipoma in Cushing's disease: a relook into the role of corticotropin in adrenal tumourigenesis.


    Chakraborty, Partha Pratim; Bhattacharjee, Rana; Mukhopadhyay, Pradip; Chowdhury, Subhankar


    Adrenal myelolipomas are infrequently encountered benign tumours of unknown aetiology. In the majority of cases they are unilateral, and clinically and hormonally silent, only requiring periodic follow-up. However, bilateral adrenal myelolipomas are sometimes associated with endocrine disorders and warrant appropriate evaluation. Though the understanding of the pathophysiology of adrenal myelolipomas has long been elusive, adrenocorticotropic hormone (ACTH) has been proposed as the main tropic factor in a number of studies. Cushing's disease is rarely associated with bilateral and sometimes giant myelolipomas. In this article, the association of bilateral adrenal myelolipomas with Cushing's disease has been discussed and the role of ACTH in the tumourigenesis has been reviewed. PMID:27307426

  1. Bilateral adrenal myelolipoma in Cushing's disease: a relook into the role of corticotropin in adrenal tumourigenesis.


    Chakraborty, Partha Pratim; Bhattacharjee, Rana; Mukhopadhyay, Pradip; Chowdhury, Subhankar


    Adrenal myelolipomas are infrequently encountered benign tumours of unknown aetiology. In the majority of cases they are unilateral, and clinically and hormonally silent, only requiring periodic follow-up. However, bilateral adrenal myelolipomas are sometimes associated with endocrine disorders and warrant appropriate evaluation. Though the understanding of the pathophysiology of adrenal myelolipomas has long been elusive, adrenocorticotropic hormone (ACTH) has been proposed as the main tropic factor in a number of studies. Cushing's disease is rarely associated with bilateral and sometimes giant myelolipomas. In this article, the association of bilateral adrenal myelolipomas with Cushing's disease has been discussed and the role of ACTH in the tumourigenesis has been reviewed.

  2. Testosterone-secreting adrenal adenoma in a peripubertal girl

    SciTech Connect

    Kamilaris, T.C.; DeBold, C.R.; Manolas, K.J.; Hoursanidis, A.; Panageas, S.; Yiannatos, J.


    A 15-year-old girl who presented with primary amenorrhea and virilization had an adrenocortical adenoma that secreted predominantly testosterone. To the authors' knowledge, she is the first peripubertal and second youngest patient with a testosterone-secreting adrenal tumor described. Serum dehydroepiandrosterone sulfate and urinary 17-ketosteroid an 17-hydroxycorticosteroid levels were normal. A tumor was located by a computed tomographic (CT) scan and by uptake of 6-..beta..-(/sup 75/Se) selenomethylnorcholesterol. Microscopic examination of the tumor showed typical features of an adrenocortical adenoma with no histologic features characteristic of Leydig cells. Postoperatively, her hirsutism regressed, she rapidly went through puberty, and regular monthly menstruation started four months later. Finding the source of testosterone in a virilized patient can be difficult. Eleven of the 14 previously described patients with testosterone-secreting adrenal tumors initially underwent misdirected surgery on the ovaries. Review of these cases revealed that results of hormone stimulation and suppression tests are unreliable and that these tumors are usually large. Therefore, CT scanning of the adrenal glands is recommended in all patients suspected of having a testosterone-secreting tumor.

  3. Nonsalt-losing congenital adrenal hyperplasia due to 3 beta-hydroxysteroid dehydrogenase deficiency with normal glomerulosa function.


    Pang, S; Levine, L S; Stoner, E; Opitz, J M; Pollack, M S; Dupont, B; New, M I


    glucuronide, suggesting the presence of normal peripheral 3 beta-HSD activity. We propose that in these siblings, there is a deficiency of 3 beta-HSD in the adrenal zona fasciculata and zona reticularis, whereas 3 beta-HSD activity is intact in the zona glomerulosa. In addition, in these siblings, 3 beta-HSD deficiency was present in the gonads, while peripheral 3 beta-HSD activity appeared to be intact. These cases demonstrate further the heterogeneity of congenital adrenal hyperplasia due to 3 beta-HSD deficiency. PMID:6300166

  4. [Sexual and gonadal dysfunction in adrenal disorders].


    Horiba, N


    Among various diseases of the adrenals, major disorders that cause sexual and gonadal disturbances are congenital adrenal hyperplasia(CAH) and Cushing's syndrome, and the others include virilizing or feminizing adrenocortical tumors. CAH was reviewed based on the recent advances in molecular genetics. The most striking discovery was steroidogenic acute regulatory protein, mutations of which produce lipoid adrenal hyperplasia that was previously attributed to P-450scc deficiency. Reversible amenorrhea or impotence is found in patients with Cushing's syndrome. Low plasma estrogen and testosterone levels are associated with female and male patients, respectively. Elevated adrenal androgen accounts for mild virilization in female patients with ACTH-dependent subtypes. The sites of action at which hypercortisolemia suppresses the hypothalamic-pituitary-gonadal axis were discussed.

  5. The innervation of the mammalian adrenal gland.

    PubMed Central

    Parker, T L; Kesse, W K; Mohamed, A A; Afework, M


    Early conflicting reports and the lack of sensitive anatomical methods have led to an oversimplified view of adrenal gland innervation. It was not until the introduction of nerve fibre tracing techniques in the mid-1970s that the true complexity of adrenal innervation began to emerge. The first part of this article comprises a brief review of these and other relevant reports dealing with both medullary and cortical innervation. In the second part a detailed account is given of the work undertaken in Rex Coupland's Department relating to the innervation of the rodent and primate adrenal medulla using a retrograde fluorescent tracer technique. It was concluded that, in all 3 species studied, the adrenal medulla receives a sympathetic and parasympathetic efferent and an afferent innervation. The possible interrelationship between neural control of cortical and medullar secretions is discussed briefly. Images Fig. 1 Fig. 2 Fig. 5 PMID:8300416

  6. Image-Guided Ablation of Adrenal Lesions

    PubMed Central

    Yamakado, Koichiro


    Although laparoscopic adrenalectomy has remained the standard of care for the treatment for adrenal tumors, percutaneous image-guided ablation therapy, such as chemical ablation, radiofrequency ablation, cryoablation, and microwave ablation, has been shown to be clinically useful in many nonsurgical candidates. Ablation therapy has been used to treat both functioning adenomas and malignant tumors, including primary adrenal carcinoma and metastasis. For patients with functioning adenomas, biochemical and symptomatic improvement is achieved in 96 to 100% after ablation; for patients with malignant adrenal neoplasms, however, the survival benefit from ablation therapy remains unclear, though good initial results have been reported. This article outlines the current role of ablation therapy for adrenal lesions, as well as identifying some of the technical considerations for this procedure. PMID:25049444

  7. Hyperkalemic paralysis in primary adrenal insufficiency

    PubMed Central

    Mishra, Ajay; Pandya, Himanshu V.; Dave, Nikhil; Sapre, Chinmaye M.; Chaudhary, Sneha


    Hyperkalemic paralysis due to Addison's disease is rare, and potentially life-threatening entity presenting with flaccid motor weakness. This case under discussion highlights Hyperkalemic paralysis as initial symptomatic manifestation of primary adrenal insufficiency. PMID:25136192

  8. Adrenal hemangioma: computed tomogram and angiogram appearances.


    Wang, J H; Chiang, J H; Chang, T


    Adrenal hemangiomas are rare. To our knowledge, about 22 cases have been reported in the literature, of which 13 cases were surgically removed. We report probably the first case of CT and angiographically diagnosed and surgically confirmed adrenal hemangioma in Taiwan. We concluded that characteristic appearances on computed tomogram and angiogram associated with phlebolith-like calcification in the tumor may allow the radiologists to make correct preoperative diagnosis. PMID:1327475

  9. Hormonal and metabolic evaluation of adrenal incidentalomas.


    Wagnerova, H; Dudasova, D; Lazurova, I


    The biochemical and hormonal data in patients with adrenal incidentalomas were evaluated to compare the differences between adrenal adenomas and other benign lesions and to find the relationship between metabolic parameters and adrenal hormones. Ninety two patients (29men, age 20-90 years) with incidentally discovered unilateral or bilateral adrenal masses detected on CT were included in this study for the reasons others than adrenal pathology. Glycemia, cholesterolemia, triglyceridemia, hormonal evaluation including plasma ACTH, plasma aldosterone, plasma renin acitivity, overnight dexametasone test, ACTH test, free plasma metanephrines, urinary catecholamines were determined. In the group of patients with adrenal masses the prevalence of arterial hypertension was three fold higher, the prevalence of DM was approximately five fold higher and the prevalence of the overweight and obesity two fold higher than is reported in the general population. The most frequent adrenal masses were nonfunctional masses, the occurence of functional lesions was as follows: steroid enzymopathies (an exaggerated response of 17-OHP indicating a possible 21-hydroxylase deficiency), subclinical Cushing syndrome, primary aldosteronism and pheochromocytoma (5%, 2%, 2% and 1% respectively). There were no significant differences in evaluated data between patients with adenomas and hyperplasia and also no significant difference in evaluated data between lesions smaller than 3 cm and lesions greater than 3 cm. We did not find any correlations between plasma cortisol and lipid values. In this study we confirmed a higher prevalence of symptoms characteristic for different metabolic syndromes in these patients with adrenal incidentalomas, which indicate systematic screening for the metabolic syndrome including evaluation of the insuline resistance in this patients. PMID:19728761

  10. Chronic Heroin Dependence Leading to Adrenal Insufficiency

    PubMed Central


    Opioids have been the mainstay for pain relief and palliation over a long period of time. They are commonly abused by drug addicts and such dependence usually imparts severe physiologic effects on multiple organ systems. The negative impact of opioids on the endocrine system is poorly understood and often underestimated. We describe a patient who developed severe suppression of the hypothalamic-pituitary adrenal (HPA) axis leading to secondary adrenal insufficiency due to long standing abuse of opioids. PMID:25221675

  11. Co-existence of P2Y-and PPADS-insensitive P2U-purinoceptors in endothelial cells from adrenal medulla.

    PubMed Central

    Mateo, J.; Miras-Portugal, M. T.; Castro, E.


    1. We have studied the effects of purinoceptor stimulation on Ca2+ signals in bovine adrenomedullary endothelial cells. [Ca2+]i was determined with the fluorescent probe fura-2 both in population samples and in single, isolated, endothelial cells in primary culture and after subculturing. 2. In endothelial cells, maintained in culture for more than one passage, several purinoceptor agonists elicited clear [Ca2+]i transient peaks that remained in the absence of extracellular Ca2+. Adenosine 5'-triphosphate (ATP) and uridine 5'-triphosphate (UTP) were equipotently active, with EC50 values of 8.5 +/- 0.9 microM and 6.9 +/- 1.5 microM, respectively, whereas 2-methylthioadenosine 5'-triphosphate (2MeSATP), adenosine 5'-(alpha, beta-methylene)triphosphate (alpha, beta-MeATP) and adenosine(5')tetraphospho(5')adenosine (Ap4A) were basically inactive. Adenosine 5'-O-(2-thiodiphosphate) (ADP beta S) was a weak agonist. The apparent potency order was UTP = ATP > ADP beta S >> 2MeSATP > alpha, beta-MeATP. 3. Cross-desensitization experiments revealed that UTP or ATP, added sequentially at concentrations of maximal effect, could completely abolish the [Ca2+]i response to the second agonist. ADP beta S exerted only a partial desensitization of the response to maximal ATP, in accordance with its lower potency in raising [Ca2+]i. 4. The effect on [Ca2+]i of 100 microM ATP in subcultured cells was reduced by only 25% with 100 microM suramin pretreatment and was negligibly affected by exposure to 10 microM pyridoxalphosphate-6-azophenyl-2', 4'-disulphonic acid (PPADS). The concentration-effect curve for ATP was not significantly affected by PPADS, but was displaced to the right by a factor of 6.5 by 100 microM suramin. 5. In primary cultures, clear [Ca2+]i responses were elicited by 2MeSATP. Suramin totally and selectively blocked 2MeSATP responses, whereas UTP-evoked [Ca2+]i transients were mainly unaffected by suramin or PPADS. Over 80% of cells tested showed responses to both 2Me

  12. The innervation of the adrenal gland. IV. The source of pre- and postganglionic nerve fibres to the guinea-pig adrenal gland.


    Parker, T L; Mohamed, A A; Coupland, R E


    The pre- and postganglionic sympathetic innervation of the guinea-pig adrenal medulla was investigated using the retrograde neuronal tracers Fast Blue and WGA-HRP. Labelled preganglionic cell bodies were located in the intermediolateral horn of spinal segments T3-L2, the majority (73.9%) were found between T6-T12 representing 70.2% of the total number of labelled cells; the segment T10 contained the largest number of labelled neurons. Labelled postganglionic cell bodies were found in the paravertebral ganglia between vertebral levels T3-T12 (representing 22.6% of the total labelled neurons), the maximum number was found at T10. In addition, labelled neurons were found in the suprarenal ganglion (representing 7.2%). No labelled cells were found in the coeliac ganglia. The labelled neurons were found ipsilateral to the site of injection into the left adrenal gland. It is concluded that the guinea-pig adrenal gland receives both a pre- and a significant postganglionic sympathetic innervation. The destination of these nerve fibres within the adrenal gland has yet to be determined.

  13. Modulation of adrenal catecholamine secretion by in vivo gene transfer and manipulation of G protein-coupled receptor kinase-2 activity.


    Lymperopoulos, Anastasios; Rengo, Giuseppe; Zincarelli, Carmela; Soltys, Stephen; Koch, Walter J


    We recently reported that the upregulation of adrenal G protein-coupled receptor kinase-2 (GRK2) causes enhanced catecholamine (CA) secretion by desensitizing sympatho-inhibitory alpha (2)-adrenergic receptors (alpha (2)ARs) of chromaffin cells, and thereby aggravating heart failure (HF). In this study, we sought to develop an efficient and reproducible in vivo adrenal gene transfer method to determine whether manipulation of adrenal GRK2 levels/activity regulates physiological CA secretion in rats. We specifically investigated two different in vivo gene delivery methods: direct injection into the suprarenal glands, and retrograde delivery through the suprarenal veins. We delivered adenoviral (Ad) vectors containing either GRK2 or an inhibitor of GRK2 activity, the beta ARKct. We found both delivery approaches equally effective at supporting robust (>80% of the whole organ) and adrenal-restricted transgene expression, in the cortical region as well as in the medullar region. Additionally, rats with AdGRK2-infected adrenals exhibit enhanced plasma CA levels when compared with control rats (AdGFP-injected adrenals), whereas plasma CA levels after Ad beta ARKct infection were significantly lower. Finally, in isolated chromaffin cells, alpha (2)ARs of AdGRK2-infected cells failed to inhibit CA secretion whereas Ad beta ARKct-infected cells showed normal alpha (2)AR responsiveness. These results not only indicate that in vivo adrenal gene transfer is an effective way of manipulating adrenal gland signalling, but also identify GRK2 as a critically important molecule involved in CA secretion.

  14. The agonistic adrenal: melatonin elicits female aggression via regulation of adrenal androgens.


    Rendon, Nikki M; Rudolph, Lauren M; Sengelaub, Dale R; Demas, Gregory E


    Classic findings have demonstrated an important role for sex steroids as regulators of aggression, but this relationship is lacking within some environmental contexts. In mammals and birds, the adrenal androgen dehydroepiandrosterone (DHEA), a non-gonadal precursor of biologically active steroids, has been linked to aggression. Although females, like males, use aggression when competing for limited resources, the mechanisms underlying female aggression remain understudied. Here, we propose a previously undescribed endocrine mechanism regulating female aggression via direct action of the pineal hormone melatonin on adrenal androgens. We examined this in a solitary hamster species, Phodopus sungorus, in which both sexes are highly territorial across the seasons, and display increased aggression concomitant with decreased serum levels of sex steroids in short 'winter-like' days. Short- but not long-day females had increased adrenal DHEA responsiveness co-occurring with morphological changes in the adrenal gland. Further, serum DHEA and total adrenal DHEA content were elevated in short days. Lastly, melatonin increased DHEA and aggression and stimulated DHEA release from cultured adrenals. Collectively, these findings demonstrate that DHEA is a key peripheral regulator of aggression and that melatonin coordinates a 'seasonal switch' from gonadal to adrenal regulation of aggression by direct action on the adrenal glands.

  15. Failure to visualize adrenal glands in a patient with bilateral adrenal hyperplasia. [/sup 131/I

    SciTech Connect

    Gordon, L.; Mayfield, R.K.; Levine, J.H.; Lopes-Virella, M.F.; Sagel, J.; Buse, M.G.


    A patient with clinical and biochemical evidence of Cushing's disease and severe hyperlipidemia underwent an adrenal imaging procedure with NP-59 (6..beta..-(/sup 131/I)iodomethyl-19-norcholesterol), without visualization of either gland. Correction of the hyperlipidemia followed by repeated adrenal imaging resulted in bilateral visualization. A pituitary tumor was removed at surgery, confirming the diagnosis of Cushing's disease.

  16. A morphometric study of the adrenal cortex of the female DDD mouse.


    Tsujio, Masashi; Mizorogi, Toshihiro; Nishijima, Kazutoshi; Kuwahara, Sachi; Aoyama, Hiroaki; Ohno, Tamio; Tanaka, Shin


    The aim of this study was to determine whether the thickness of the adrenocortical zone is associated with age in virgin and parous female DDD mice. The zona reticularis and zona glomerulosa of parous mice tended to be thicker than those of virgin mice at all ages. The zona fasciculata lactating parous mice was significantly thicker than that of virgin mice at 20 weeks of age (P<0.01). Age did not affect the thickness of the three outer adrenocortical zones in either group. However, in virgin mice, the X zone consisted of vacuolated and nonvacuolated cells at 5 weeks of age and only of vacuolated cells at 10 weeks of age; the number of vacuolated cells and the thickness of the zone decreased at 40 weeks of age. In contrast, parous mice of all ages lacked an X zone. The decrease in X zone thickness with age was most evident when expressed relative to organ weight. In conclusion, the thickness of the outer three adrenocortical zones is affected by endocrine changes associated with pregnancy and lactation but not by age. The thickness of the X zone is an index of growth and maturation in nulliparous female DDD mice less than one year of age.

  17. [Adrenal insufficiency in cirrhotic patients].


    Orozco, Federico; Anders, María; Mella, José; Antinucci, Florencia; Pagano, Patricia; Esteban, Paula; Cartier, Mariano; Romero, Gustavo; Francini, Bettina; Mastai, Ricardo


    Relative adrenal insufficiency (RAI) is a common finding in cirrhotic patients with severe sepsis, and increased mortality. Its significance is unknown in stable conditions. The aim of this study was to evaluate the prevalence of RAI in stable cirrhotic patients at different stages of the disease. Also, the impact of RAI on the survival was evaluated and basal cortisol levels between plasma and saliva was correlated in control subjects and cirrhotic patients. Forty seven ambulatory patients and 16 control subjects were studied. RAI was defined as a serum cortisol increase of less than 9 υg/dl from baseline after the stimulation with 250 mg of synthetic ACTH. Twenty two had Child-Pugh = 8 and 25 = 9. The prevalence of RAI in patients with stable cirrhosis was 22%. A higher incidence of RAI was observed in patients with a Child-Pugh = 9 (8/32) than in those with = 8 (3/13, p < 0.05). A correlation between salivary cortisol and basal plasma cortisol (r = 0.6, p < 0.0004) was observed. Finally, survival at 1 year (97%) and 3 years (91%) was significantly higher without RAI than those who developed this complication (79% and 51%, p < 0.05, respectively). In summary, the prevalence of RAI is frequent in patients with stable cirrhosis and that it is related to the severity of liver diseaseand increased mortality. PMID:27576278

  18. The effects of the fungicide methyl thiophanate on adrenal gland morphophysiology of the lizard, Podarcis sicula.


    De Falco, Maria; Sciarrillo, Rosaria; Capaldo, Anna; Russo, Tiziana; Gay, Flaminia; Valiante, Salvatore; Varano, Lorenzo; Laforgia, Vincenza


    Endocrine-disrupting chemicals (EDCs) are a large group of substances able to modulate endocrine-signaling pathways, altering the normal function of the endocrine system. Although the fungicide methyl thiophanate (MT) is not considering a specific reproductive and developmental toxicant, it can induce histopathological damages in rat thyroid and adrenal glands that have a pivotal role in both processes. We investigated the MT effects on adrenal glands of Podarcis sicula lizard, the endemic species of Southern Italy living in open country and in cultivated fields. Reptiles are good bioindicators because they are easily harvested; they have a wide distribution and large populations. Moreover, they have good sensitivity to contaminants, and bioaccumulate and biomagnify pollutants to levels equal to or greater than those of birds and mammals. We used 1.5% MT/water to pollute terraria, food, and water twice a week for 15 and 30 days, and we evaluated adrenal toxicity through biochemical (adrenal and pituitary hormone plasma levels) and histological parameters (adrenal gland histopathology). We demonstrated a time-dependent increase of corticosterone plasma levels and a decrease of ACTH plasma levels, a hypertrophy of the steroidogenic tissue, and an enlargement of blood capillaries. Moreover, we observed a time-dependent increase of adrenaline plasma levels and adrenaline-producing cells, and an opposite trend of noradrenaline plasma concentrations. We also observed lymphocyte and macrophage infiltrations, signs of cell degeneration. Our findings on the bioindicator P. sicula provide an interesting basis to further elucidate the systemic mechanisms of EDCs. PMID:17549544

  19. Diagnosis of adrenal tumors with radionuclide imaging

    SciTech Connect

    Beierwaltes, W.H.; Sisson, J.C.; Shapiro, B.


    The development of radiolabeled cholesterols in 1969 as precursors of adrenocortical steroid production allowed the first noninvasive imaging of the adrenal cortices. FDA-NDA approval in 1984 should allow routine use of these agents in most hospitals. NP-59 is most commonly used in the diagnosis and management of Cushing syndrome; the second most common use is in the diagnosis of primary aldosteronism. It is also helpful in the differential diagnosis of adrenal and ovarian hyperandrogenism and hirsutism, and is the only noninvasive method of detecting unilateral adrenocortical hypofunction. The newest and most popular use is in the differential diagnosis of asymptomatic masses in the region of the adrenal gland discovered incidentally with CT scan (incidentalomas). In this situation, the NP-59 scan can define whether the tumor is in the adrenal gland and if it is functional or nonfunctional. The authors believe that, in the future, radiolabeled enzyme inhibitors might offer better diagnostic imaging of the adrenal cortex, although these agents will probably not be available for routine use for some time. The development of a radioiodinated guanethidine analog, /sup 131/I-MIBG, has allowed differentiation of normal adrenal medullary function from bilateral adrenal medullary hyperplasia before the development of hypertension or tachycardia, diagnostic increases in plasma or urinary catecholamines, or abnormal CT scans. The search for a pheochromocytoma should begin with /sup 131/I-MIBG scintigraphy. While over 90% of primary pheochromocytomas occur in the abdomen, neither a survey of the abdomen nor the finding of a single tumor should conclude the search.

  20. [The imaging diagnosis of adrenal tumors].


    Cózar Olmo, J M; Martínez-Piñeiro, J A; García-Matres, M J; Hervás, C M; Cárcamo, P; Martínez-Piñeiro, L; Avellana, J A; de la Peña, J


    From 1967 to 1991 we have diagnosed and treated 73 adrenal tumors in 63 patients: 12 pheochromocytomas, 24 adrenal cortical adenomas, 15 hyperplasias, 16 carcinomas, 3 myelolipomas, 2 cysts and 1 neuroblastoma. We conducted a retrospective study to analyze the preoperative images obtained by different diagnostic techniques and attempted to correlate tumor size and site with the results of the histological analysis of the surgical specimen. Nephrotomography with pneumoretroperitoneum and IV Nephrotomography were useful in detecting the increase of the size of the gland in 10 of 25 cases submitted to these procedures (40%). Arteriography as second or third technique of choice confirmed the presence of an adrenal tumor in 15 of the 21 cases evaluated by this procedure (70%). US and CT detected 94% (31/33) and 100% (33/33) of the cases, respectively. Fourteen cases were incidentally discovered by CT (7) and US (7). A direct relationship between tumor size and degree of malignancy could be established since the carcinomas had a mean diameter of 7 cm (range 5 to 12 cm). Concerning the histologic nature of the disease, specific images were found in 3 cases of adrenal myelolipoma (hyperechoic on US and of low density similar to fat on CT) and 2 cysts (anechoic with posterior band evidenced on us and liquid on CT). Radioisotopes were also utilized for tumor localization and there was positive uptake of I-131-IMBG in 2 cases of adrenal pheochromocytoma; 1 extra-adrenal (left lateral aortic paraganglioma) and 1 case of malignant adrenal pheochromocytoma with metastasis to the lungs.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Development of adrenal cortical zonation and expression of key elements of adrenal androgen production in the chimpanzee (Pan troglodytes) from birth to adulthood.


    Parker, C R; Grizzle, W E; Blevins, J K; Hawkes, K


    The basis for the pattern of adrenal androgen production in the chimpanzee, which resembles that of humans, is poorly defined. We characterized the developmental zonation and expression of elements of the androgen biosynthetic pathway in the chimpanzee adrenal. The newborn adrenal contained a broad fetal zone (FZ) expressing CYP17, SULT2A1, and Cytochrome B5 (CB5) but not HSD3B; the outer cortex expressed HSD3B but not SULT2A1 or CB5. During infancy, the FZ involuted and the HSD3B-expressing outer cortex broadened. By 3years of age, a thin layer of cells that expressed CB5, SULT2A1, and CYP17 adjoined the medulla and likely represented the zona reticularis; the outer cortex consisted of distinct zonae fasiculata and glomerulosa. Thereafter, the zona reticularis broadened as also occurs in the human. The adult chimpanzee adrenal displayed other human-like characteristics: intramedullary clusters of reticularis-like cells and also a cortical cuff of zona fasiculata-like cells adjoining the central vein.

  2. Comprehensive imaging of porcine adrenal gland lipids by MALDI-FTMS using quercetin as a matrix.


    Wang, Xiaodong; Han, Jun; Pan, Jingxi; Borchers, Christoph H


    Adrenal glands synthesize and release functional zone-specific steroid and catecholamine hormones to regulate mammalian stress responses. Lipids such as sphingolipids have been shown to control the steroid hormone biosynthesis in adrenal glands, indicating their important roles in endocrine organs. Molecular imaging by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a well-established analytical technique for determining both the spatial location and the relative abundances of various lipids on tissue. To better understand the overall roles of different lipid classes that play in the mammalian adrenal glands, it is necessary to comprehensively determine the spatial distributions of various lipids in the different functional zones of adrenal glands. However, the potential of this technique has not been fully reached, considering there are thousands of lipid species in a cell or tissue. To achieve this, we used quercetin as a MALDI matrix for negative ion detection of endogenous lipids on tissue sections of porcine adrenal glands by MALDI-Fourier-transform ion cyclotron resonance (FTICR) MS. As a result of these experiments, 409 endogenous compounds were detected in the negative ion mode. Combining both the positive and negative ion detection led to successful determination of the spatial distribution patterns of 555 unique endogenous compounds that were identified as 544 lipid entities and 11 nonlipid metabolites. Many classes of these lipids showed distinct distribution patterns in different functional zones of the adrenal gland. To the best of our knowledge, this work presents the largest group of lipid entities that have been analyzed in a single MS imaging study so far, and comprehensive profiles of the spatial distributions of lipids in porcine adrenal glands are shown here for the first time.

  3. Human Adrenocortical Carcinoma Cell Lines

    PubMed Central

    Wang, Tao; Rainey, William E.


    Summary The human adrenal cortex secretes mineralocorticoids, glucocorticoids and adrenal androgens. These steroids are produced from unique cell types located within the three distinct zones of the adrenal cortex. Disruption of adrenal steroid production results in a variety of diseases that can lead to hypertension, metabolic syndrome, infertility and androgen excess. The adrenal cortex is also a common site for the development of adenomas, and rarely the site for the development of carcinomas. The adenomas can lead to diseases associated with adrenal steroid excess, while the carcinomas are particularly aggressive and have a poor prognosis. In vitro cell culture models provide an important tool to examine molecular and cellular mechanisms controlling both the normal and pathologic function of the adrenal cortex. Herein we discuss the human adrenocortical cell lines and their use as model systems for adrenal studies. PMID:21924324

  4. [Acute adrenal insufficiency in the newborn].


    Limal, J-M; Bouhours-Nouet, N; Rouleau, S; Gatelais, F; Coutant, R


    Neonatal acute adrenal insufficiency is a rare condition. Congenital adrenal hyperplasia with 21-hydroxylase defect appears to be the most frequent cause, but the neonatal screening has improved its potential severe outcome. The other causes and the various clinical presentations have been exposed, with a special reference to the salt-wasting syndrome. Among them, the severity of X-linked adrenal hypoplasia congenita (AHC) deserves special attention. Two other causes of adrenal hypoplasia have been recently discovered, i.e. a mutation of the SF-1 gene and the syndrome IMAGe. Adrenal insufficiency secondary to ACTH deficiency is often unrecognised despite the risk of severe seizures and hypoglycaemia with brain damage. Finally, the hormonal diagnostic testing and the main therapeutic approach by corticosteroids have been indicated. The aim of this work is to focus the attention of paediatricians who examine a newborn because the risk of delayed diagnosis and fatal outcome may be limited if the clinical symptoms are soon recognized. PMID:16962294

  5. Role of adrenal imaging in surgical management

    SciTech Connect

    Lamki, L.M.; Haynie, T.P. )


    Adrenal imaging using radiopharmaceuticals is a functional test that can contribute significantly to surgical management and follow-up of patients with either benign or malignant conditions of the adrenal cortex and medulla. Imaging of the cortex is achieved by iodine-131-labeled iodomethyl nor-cholesterol (NP-59), while adrenal medulla imaging can be successfully accomplished by 131I-metaiodobenzylguanidine (MIBG), which localizes in the adrenergic nerve terminal with norepinephrine. Both tests carry high sensitivity and specificity for functional tumors and hyperplasia, and often better than CT scanning. This article reviews the current status and clinical utility of nuclear imaging of the adrenal cortex in congenital hyperplasia, low renin hypertension and aldosteronism, and Cushing's syndrome. Adrenal medulla imaging is reviewed in light of our experience at the University of Texas M.D. Anderson Cancer Center in pheochromocytoma, neuroblastoma, and other neuroectodermal tumors. Investigation of {sup 131}I-MIBG therapy of metastatic tumors of neuroectodermal origin potentially offers a means of at least controlling symptoms of hormonal secretion in these patients. 40 references.

  6. Adrenal insufficiency in patients with decompensated cirrhosis

    PubMed Central

    Karagiannis, Apostolos KA; Nakouti, Theodora; Pipili, Chrysoula; Cholongitas, Evangelos


    Adrenal reserve depletion and overstimulation of the hypothalamus-pituitary-adrenal (HPA) axis are causes for adrenal insufficiency (AI) in critically ill individuals. Cirrhosis is a predisposing condition for AI in cirrhotics as well. Both stable cirrhotics and liver transplant patients (early and later after transplantation) have been reported to present AI. The mechanisms leading to reduced cortisol production in cirrhotics are the combination of low cholesterol levels (the primary source of cortisol), the increased cytokines production that overstimulate and exhaust HPA axis and the destruction of adrenal glands due to coagulopathy. AI has been recorded in 10%-82% cirrhotics depending on the test used to evaluate adrenal function and in 9%-83% stable cirrhotics. The similarity of those proportions support the assumption that AI is an endogenous characteristic of liver disease. However, the lack of a gold standard method for AI assessment and the limitation of precise thresholds in cirrhotics make difficult the recording of the real prevalence of AI. This review aims to summarize the present data over AI in stable, critically ill cirrhotics and liver transplant recipients. Moreover, it provides information about the current knowledge in the used diagnostic tools and the possible effectiveness of corticosteroids administration in critically ill cirrhotics with AI. PMID:26052400

  7. Isolation of neural crest derived chromaffin progenitors from adult adrenal medulla.


    Chung, Kuei-Fang; Sicard, Flavie; Vukicevic, Vladimir; Hermann, Andreas; Storch, Alexander; Huttner, Wieland B; Bornstein, Stefan R; Ehrhart-Bornstein, Monika


    Chromaffin cells of the adrenal medulla are neural crest-derived cells of the sympathoadrenal lineage. Unlike the closely-related sympathetic neurons, a subpopulation of proliferation-competent cells exists even in the adult. Here, we describe the isolation, expansion, and in vitro characterization of proliferation-competent progenitor cells from the bovine adrenal medulla. Similar to neurospheres, these cells, when prevented from adherence to the culture dish, grew in spheres, which we named chromospheres. These chromospheres were devoid of mRNA specific for smooth muscle cells (MYH11) or endothelial cells (PECAM1). During sphere formation, markers for differentiated chromaffin cells, such as phenylethanolamine-N-methyl transferase, were downregulated while neural progenitor markers nestin, vimentin, musashi 1, and nerve growth factor receptor, as well as markers of neural crest progenitor cells such as Sox1 and Sox9, were upregulated. Clonal analysis and bromo-2'-deoxyuridine-incorporation analysis demonstrated the self-renewing capacity of chromosphere cells. Differentiation protocols using NGF and BMP4 or dexamethasone induced neuronal or endocrine differentiation, respectively. Electrophysiological analyses of neural cells derived from chromospheres revealed functional properties of mature nerve cells, such as tetrodotoxin-sensitive sodium channels and action potentials. Our study provides evidence that proliferation and differentiation competent chromaffin progenitor cells can be isolated from adult adrenal medulla and that these cells might harbor the potential for the treatment of neurodegenerative diseases, such as Parkinson's disease. PMID:19609938

  8. Role of ACTH in the Interactive/Paracrine Regulation of Adrenal Steroid Secretion in Physiological and Pathophysiological Conditions.


    Lefebvre, Hervé; Thomas, Michaël; Duparc, Céline; Bertherat, Jérôme; Louiset, Estelle


    In the normal human adrenal gland, steroid secretion is regulated by a complex network of autocrine/paracrine interactions involving bioactive signals released by endothelial cells, nerve terminals, chromaffin cells, immunocompetent cells, and adrenocortical cells themselves. ACTH can be locally produced by medullary chromaffin cells and is, therefore, a major mediator of the corticomedullary functional interplay. Plasma ACTH also triggers the release of angiogenic and vasoactive agents from adrenocortical cells and adrenal mast cells and, thus, indirectly regulates steroid production through modulation of the adrenal blood flow. Adrenocortical neoplasms associated with steroid hypersecretion exhibit molecular and cellular defects that tend to reinforce the influence of paracrine regulatory loops on corticosteroidogenesis. Especially, ACTH has been found to be abnormally synthesized in bilateral macronodular adrenal hyperplasia responsible for hypercortisolism. In these tissues, ACTH is detected in a subpopulation of adrenocortical cells that express gonadal markers. This observation suggests that ectopic production of ACTH may result from impaired embryogenesis leading to abnormal maturation of the adrenogonadal primordium. Globally, the current literature indicates that ACTH is a major player in the autocrine/paracrine processes occurring in the adrenal gland in both physiological and pathological conditions. PMID:27489549

  9. Role of ACTH in the Interactive/Paracrine Regulation of Adrenal Steroid Secretion in Physiological and Pathophysiological Conditions

    PubMed Central

    Lefebvre, Hervé; Thomas, Michaël; Duparc, Céline; Bertherat, Jérôme; Louiset, Estelle


    In the normal human adrenal gland, steroid secretion is regulated by a complex network of autocrine/paracrine interactions involving bioactive signals released by endothelial cells, nerve terminals, chromaffin cells, immunocompetent cells, and adrenocortical cells themselves. ACTH can be locally produced by medullary chromaffin cells and is, therefore, a major mediator of the corticomedullary functional interplay. Plasma ACTH also triggers the release of angiogenic and vasoactive agents from adrenocortical cells and adrenal mast cells and, thus, indirectly regulates steroid production through modulation of the adrenal blood flow. Adrenocortical neoplasms associated with steroid hypersecretion exhibit molecular and cellular defects that tend to reinforce the influence of paracrine regulatory loops on corticosteroidogenesis. Especially, ACTH has been found to be abnormally synthesized in bilateral macronodular adrenal hyperplasia responsible for hypercortisolism. In these tissues, ACTH is detected in a subpopulation of adrenocortical cells that express gonadal markers. This observation suggests that ectopic production of ACTH may result from impaired embryogenesis leading to abnormal maturation of the adrenogonadal primordium. Globally, the current literature indicates that ACTH is a major player in the autocrine/paracrine processes occurring in the adrenal gland in both physiological and pathological conditions. PMID:27489549

  10. Adrenal Lymphangioma Masquerading as a Catecholamine Producing Tumor

    PubMed Central

    Hodish, Israel; Schmidt, Lindsay; Moraitis, Andreas G.


    Objective. To report the unusual case of an adrenal lymphangioma presenting in a patient with an adrenal cystic lesion and biochemical testing concerning for pheochromocytoma. The pertinent diagnostic and imaging features of adrenal lymphangiomas are reviewed. Methods. We describe a 59-year-old patient who presented with hyperhidrosis and a 2.2 by 2.2 cm left adrenal nodule. Biochemical evaluation revealed elevated plasma-free normetanephrine, urine normetanephrine, urine vanillylmandelic acid, and urine norepinephrine levels. Elevated plasma norepinephrine levels were not suppressed appropriately with clonidine administration. Results. Given persistent concern for pheochromocytoma, the patient underwent adrenalectomy. The final pathology was consistent with adrenal lymphangioma. Conclusions. Lymphangiomas are benign vascular lesions that can very rarely occur in the adrenal gland. Imaging findings are generally consistent with a cyst but are nonspecific. Excluding malignancy in patients presenting with adrenal cysts can be difficult. Despite its benign nature, the diagnosis of adrenal lymphangioma may ultimately require pathology. PMID:26618011

  11. How Do I Find an Experienced Adrenal Surgeon?


    ... NICHD Research Information Clinical Trials Resources and Publications Adrenal Gland Disorders: Other FAQs Skip sharing on social media links Share this: Page ... do I find an experienced adrenal surgeon? Make sure that the surgeon you choose ...

  12. What Are the Treatments for Adrenal Gland Disorders?


    ... Resources and Publications What are the treatments for adrenal gland disorders? Skip sharing on social media links Share ... a variety of surgical and medical treatments for adrenal gland disorders. These include 1 : Surgery to remove tumors ...

  13. Neurologic complications of disorders of the adrenal glands.


    Bertorini, Tulio E; Perez, Angel


    Disorders of the adrenal glands frequently have secondary neurological manifestations, while some diseases that involve the central nervous system are accompanied by adrenal gland dysfunction. Excessive corticosteroid secretions in primary or secondary Cushing's syndrome causes muscle weakness and behavioral disturbances, such as emotional lability and sometimes depression, while adrenal insufficiency may cause fatigue, weakness, and depression. Adrenoleukodystrophy and adrenoneuromyelopathy are X-linked recessive disorders of the metabolism of very long chain fatty acids that manifest with white matter abnormalities of the brain, myelopathy and/or neuropathy, as well as adrenal insufficiency. Other disorders of the adrenal glands include hyperaldosteroidism, which may cause weakness from hypokalemia. Dysfunction of the adrenal medulla causes excessive or deficient secretion of catecholamines, primarily causing cardiovascular symptoms. This chapter reviews the clinical manifestations and diagnostic aspects and treatment of the various disorders of the adrenal glands. Some of the congenital adrenal diseases are also discussed.

  14. Adrenal Hypoplasia Congenita: A Rare Cause of Primary Adrenal Insufficiency and Hypogonadotropic Hypogonadism

    PubMed Central

    Loureiro, Marta; Reis, Filipa; Robalo, Brígida; Pereira, Carla; Sampaio, Lurdes


    Primary adrenal insufficiency is defined by the impaired synthesis of adrenocortical hormones due to an intrinsic disease of the adrenal cortex. Determining its etiology is crucial to allow adequate long-term management and genetic counseling. We report the case of a male adolescent that presented in the neonatal period with adrenal crisis and received replacement therapy for primary adrenal insufficiency. During follow-up, adrenal hypoplasia congenita (AHC) was suspected given his persistently raised adrenocorticotropic hormone levels, with markedly low 17-OH progesterone and androstenedione levels. DNA sequence analysis revealed a mutation in NR0B1 gene (c.1292delG), confirming the diagnosis. Delayed puberty and persistent low levels of gonadotropins led to testosterone replacement therapy. X-linked AHC is a rare cause of primary adrenal insufficiency and hypogonadotropic hypogonadism, related to mutations in NR0B1 gene. Despite its rarity, AHC should be considered in patients who present with primary adrenal failure, low levels of 17-OH progesterone and hypogonadotropic hypogonadism. PMID:26500747

  15. Expression of DAX-1, the gene responsible for X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism, in the hypothalamic-pituitary-adrenal/gonadal axis.


    Guo, W; Burris, T P; McCabe, E R


    DAX-1, an orphan member of the nuclear hormone receptor superfamily, is responsible for X-linked adrenal hypoplasia congenita (AHC) and the frequently associated hypogonadotropic hypogonadism (HH). The entire DAX-1 genomic region has been sequenced and a putative steroidogenic factor-1 response element has been identified in the promoter region of the gene. The purpose of these investigations was to determine if DAX-1 was expressed in the central nervous system, particularly the hypothalamus and pituitary, in order to better understand the relationship of mutations in this gene to HH associated with AHC. We used Northern blot analysis and reverse transcription PCR to demonstrate that DAX-1 was expressed in the hypothalamus and the pituitary, and to confirm its expression in adrenal cortex and gonads. The expression of DAX-1 in these tissues indicates the involvement of DAX-1 in the development of the reproductive system at multiple levels within the hypothalamic-pituitary-adrenal/gonadal axis. We also observed the expression of DAX-1 in a human adrenocortical carcinoma cell line, NCI-H295, that has features characteristic of the fetal adrenal cortex. Therefore, NCI-H295 cells will be a useful cellular model for investigating the involvement of DAX-1 in the regulation of steroidogenesis.

  16. Tissue damage in kidney, adrenal glands and diaphragm following extracorporeal shock wave lithotripsy.


    Gecit, Ilhan; Kavak, Servet; Oguz, Elif Kaval; Pirincci, Necip; Günes, Mustafa; Kara, Mikail; Ceylan, Kadir; Kaba, Mehmet; Tanık, Serhat


    This study was designed to investigate whether exposure to short-term extracorporeal shock wave lithotripsy (ESWL) produces histologic changes or induces apoptosis in the kidney, adrenal glands or diaphragm muscle in rats. The effect of shock waves on the kidney of male Wistar rats (n = 12) was investigated in an experimental setting using a special ESWL device. Animals were killed at 72 h after the last ESWL, and the tissues were stained with an in situ Cell Death Detection Kit, Fluorescein. Microscopic examination was performed by fluorescent microscopy. Apoptotic cell deaths in the renal tissue were not observed in the control group under fluorescent microscopy. In the ESWL group, local apoptotic changes were observed in the kidney in the area where the shock wave was focused. The apoptotic cell deaths observed in the adrenal gland of the control group were similar to those observed in the ESWL groups, and apoptosis was occasionally observed around the capsular structure. Apoptotic cell deaths in the diaphragm muscle were infrequently observed in the control group. Apoptosis in the ESWL group was limited to the mesothelial cells. This study demonstrated that serious kidney, adrenal gland and diaphragm muscles damage occurred following ESWL, which necessitated the removal of the organ in the rat model. It is recognized that the ESWL complications related to the kidney, adrenal gland and diaphragm muscles are rare and may be managed conservatively.

  17. Image-Guided Adrenal and Renal Biopsy

    PubMed Central

    Sharma, Karun V.; Venkatesan, Aradhana M.; Swerdlow, Daniel; DaSilva, Daniel; Beck, Avi; Jain, Nidhi; Wood, Bradford J.


    Image-guided biopsy is a safe and well-established technique that is familiar to most interventional radiologists (IRs). Improvements in image-guidance, biopsy tools and biopsy techniques now routinely allow for safe biopsy of renal and adrenal lesions which traditionally were considered difficult to reach or technically challenging. Image-guided biopsy is used to establish the definitive tissue diagnosis in adrenal mass lesions that can not be fully characterized with imaging or laboratory tests alone. It is also used to establish definitive diagnosis in some cases of renal parenchymal disease and has an expanding role in diagnosis and characterization of renal masses prior to treatment. Although basic principles and techniques for image-guided needle biopsy are similar regardless of organ, this paper will highlight some technical considerations, indications and complications which are unique to the adrenal gland and kidney because of their anatomic location and physiologic features. PMID:20540919

  18. Imaging of the adrenal gland lesions.


    Herr, Keith; Muglia, Valdair F; Koff, Walter José; Westphalen, Antonio Carlos


    With the steep increase in the use of cross-sectional imaging in recent years, the incidentally detected adrenal lesion, or "incidentaloma", has become an increasingly common diagnostic problem for the radiologist, and a need for an approach to classifying these lesions as benign, malignant or indeterminate with imaging has spurred an explosion of research. While most incidentalomas represent benign disease, typically an adenoma, the possibility of malignant involvement of the adrenal gland necessitates a reliance on imaging to inform management decisions. In this article, we review the literature on adrenal gland imaging, with particular emphasis on computed tomography, magnetic resonance imaging, and photon-emission tomography, and discuss how these findings relate to clinical practice. Emerging technologies, such as contrast-enhanced ultrasonography, dual-energy computed tomography, and magnetic resonance spectroscopic imaging will also be briefly addressed.

  19. Imaging of the adrenal gland lesions*

    PubMed Central

    Herr, Keith; Muglia, Valdair F.; Koff, Walter José; Westphalen, Antonio Carlos


    With the steep increase in the use of cross-sectional imaging in recent years, the incidentally detected adrenal lesion, or "incidentaloma", has become an increasingly common diagnostic problem for the radiologist, and a need for an approach to classifying these lesions as benign, malignant or indeterminate with imaging has spurred an explosion of research. While most incidentalomas represent benign disease, typically an adenoma, the possibility of malignant involvement of the adrenal gland necessitates a reliance on imaging to inform management decisions. In this article, we review the literature on adrenal gland imaging, with particular emphasis on computed tomography, magnetic resonance imaging, and photon-emission tomography, and discuss how these findings relate to clinical practice. Emerging technologies, such as contrast-enhanced ultrasonography, dual-energy computed tomography, and magnetic resonance spectroscopic imaging will also be briefly addressed. PMID:25741090

  20. Bilateral adrenal hemorrhage in polycythemia vera.


    Bhandari, Shruti; Agito, Katrina; Krug, Esther I


    Bilateral adrenal hemorrhage (BAH) is a rare complication typically seen in critically ill patients, which can lead to acute adrenal insufficiency and death unless it is recognized promptly and treated appropriately. We describe the case of a 64-year-old man with polycythemia vera found to be unresponsive with fever, hypotension, tachycardia, and hypoglycemia. Electrocardiogram showed ST-elevation with elevated troponin, hemoglobin, prothrombin time, and partial thromboplastin time. He required aggressive ventilator and vasopressor support. Despite primary coronary intervention, he remained hypotensive. Random cortisol level was low. He received stress dose hydrocortisone with immediate hemodynamic stability. BAH was highly suspected and was confirmed by non-contrast abdominal computed tomography. Prompt recognition and timely initiated treatment remain crucial to impact the mortality associated with acute adrenal insufficiency. PMID:27609733

  1. Bilateral adrenal hemorrhage in polycythemia vera

    PubMed Central

    Agito, Katrina; Krug, Esther I.


    Bilateral adrenal hemorrhage (BAH) is a rare complication typically seen in critically ill patients, which can lead to acute adrenal insufficiency and death unless it is recognized promptly and treated appropriately. We describe the case of a 64-year-old man with polycythemia vera found to be unresponsive with fever, hypotension, tachycardia, and hypoglycemia. Electrocardiogram showed ST-elevation with elevated troponin, hemoglobin, prothrombin time, and partial thromboplastin time. He required aggressive ventilator and vasopressor support. Despite primary coronary intervention, he remained hypotensive. Random cortisol level was low. He received stress dose hydrocortisone with immediate hemodynamic stability. BAH was highly suspected and was confirmed by non-contrast abdominal computed tomography. Prompt recognition and timely initiated treatment remain crucial to impact the mortality associated with acute adrenal insufficiency. PMID:27609733

  2. A very rare bilateral adrenal tumor.


    Toniato, Antonio; Boschin, Isabella Merante; Pelizzo, Maria Rosa


    We report a case of very rare adrenal tumor. A 54-year-old patient was classified as affected by bilateral adrenal incidentaloma that surprisingly, on histology resulted solitary fibrous tumors. Solitary fibrous tumor (SFT) is an uncommon mesenchymal neoplasm. Only five cases of localization of SFT in adrenal gland are reported in the literature, while the frequency of retroperitoneum localization is more frequent, about 30 cases. Immunohistochemically, SFT can be positive for CD34 antigen, vimentin, CD99, and bcl-2 and usually negative for cytokeratins, chromogranin A, NSE, neurofilaments, synoptophysin, and S-100. Surgical excision remains the main treatment in fact the recurrence is locoregional and correlated with positive margins due to incomplete excision, while distant metastases are correlated with atypical or malignant features.

  3. Principles and management of adrenal cancer

    SciTech Connect

    Javadpour, N.


    This book provides information on adrenal diseases of latest developments and guides the clinicians in the care of their patients. The book is divided into two parts. The first section gives an overview of the embryology, anatomy, physiology, markers, pathology, imaging and the current progress in the field. The second edition covers specific diseases of the adrenal cortex and medulla. The increasingly significant roles played by steroids, catecholamines, blockers, computed tomography and magnetic resonance are elucidated and discussed. The contents include: Overview of progress; current problems, and perspectives - embryology anatomy, physiology, and biologic markers; pathology; advances in diagnosis; imaging techniques; adrenal disorders in childhood; primary aldosteronism; Cushing's syndrome; carcinoma; pheochromocytoma; neuroblastoma; metastatic disease; surgical management; and subject index.

  4. Spontaneous Idiopathic Unilateral Adrenal Haemorrhage (SIAH).


    Naqvi, Syed Ali; Zaman, Shamas; Ahmed, Irfan


    Spontaneous Idiopathic Adrenal Haemorrhage (SIAH) is an unusual surgical emergency which can present with life threatening massive retroperitoneal bleeding. Most of the cases reported in the literature are associated with use of anticoagulation or underlying adrenal pathology such as tumors or cysts. Since this clinical entity is uncommon and clinical presentation is very indistinct, the diagnosis can be easily missed and can be challenging for the treating physicians. Nevertheless a raised clinical suspicion coupled with advances in radiological imaging have considerably improved the detection of SIAH in recent times. We report an unusual case of a 20 years old healthy female student who presented to our hospital with sudden onset of abdominal pain and shock. She was diagnosed as a case of massive spontaneous idiopathic unilateral adrenal haemorrhage, unaccompanied by any hematologic disorder, trauma or underlying pathology. Although patient was hemodynamically unstable at presentation, she was resuscitated promptly, investigated appropriately, hence recovered uneventfully with conservative management alone.

  5. Primary adrenal sarcomatoid carcinoma metastatic to the lung: Case report and review of the literature

    PubMed Central



    Adrenal sarcomatoid carcinoma is a rare adrenal carcinoma. To the best of our knowledge, only 11 cases have been reported since 1987. Adrenal sarcomatoid carcinoma presents a diagnostic challenge due to its atypical symptoms and histological patterns. At the time of diagnosis, a large percentage of patients are already at the metastatic stage and succumb within a few months. The present study reports a case of a 59-year-old man presenting with asthenia and weight loss with adrenal sarcomatoid carcinoma metastatic to the lung. A computed tomography (CT) scan and ultrasonography of the patient's abdomen suggested a large homogeneous mass in the right adrenal gland, and a CT scan of his chest suggested lung metastasis. Right adrenalectomy was performed. Histological examination revealed that the tumor was composed of sarcomatous and carcinomatous differentiation elements. Immunohistochemical examination revealed tumor cell positivity for vimentin and cytokeratin. At the 6-month follow-up the patient exhibited no disease progression and refused further proposed treatment. The patient was alive at the time of writing the current report. The present case report additionally reviews the literature, for the purpose of raising awareness of these rare lesions and assisting in achieving accurate diagnoses and effective treatment. PMID:27123074

  6. Autoradiographic localization of (/sup 125/I)-angiotensin II binding sites in the rat adrenal gland

    SciTech Connect

    Healy, D.P.; Maciejewski, A.R.; Printz, M.P.


    To gain greater insight into sites of action of circulating angiotensin II (Ang II) within the adrenal, we have localized the (/sup 125/I)-Ang II binding site using in vitro autoradiography. Autoradiograms were generated either by apposition of isotope-sensitive film or with emulsion-coated coverslips to slide-mounted adrenal sections labeled in vitro with 1.0 nM (/sup 125/I)-Ang II. Analysis of the autoradiograms showed that Ang II binding sites were concentrated in a thin band in the outer cortex (over the cells of the zona glomerulosa) and in the adrenal medulla, which at higher power was seen as dense patches. Few sites were evident in the inner cortex. The existence of Ang II binding sites in the adrenal medulla was confirmed by conventional homogenate binding techniques which revealed a single class of high affinity Ang II binding site (K/sub d/ . 0.7nM, B/sub max/ . 168.7 fmol/mg). These results suggest that the adrenal medulla may be a target for direct receptor-mediated actions of Ang II.

  7. Cystic lymphangioma of adrenal gland: a clinicopathological study of 3 cases and review of literature

    PubMed Central

    Zhao, Ming; Gu, Qianfeng; Li, Changshui; Yu, Jingjing; Qi, Honggang


    Cystic lymphangioma of the adrenal gland is a rare and benign lesion, most often found incidentally during abdominal imaging studies, abdominal surgery or at autopsy. We aimed to retrospectively review all adrenal lymphangioma cases at our hospital, further document their lymphatic origin by immunohistochemical staining and discuss the differential diagnosis with other cystic adrenal gland lesions. A total of 3 adrenal lymphangioma cases were identified. All three patients were men and adults at time of diagnosis aged 41 years, 43 years, and 66 years, respectively. All were incidentally identified during investigating for unrelated reasons, two of which were discovered by routine radiologic check-up while the last one was found during imaging detection of ureteral cancer. The average size of an adrenal lymphangioma lesion was 3.2 cm (range, 2.5-4.6 cm). Histologically, all three cases showed a typical multicystic architecture with dilated spaces lined by flattened, bland, simple lining. The cystic spaces occasionally contained proteinaceous material but lacked red blood cell content. On immunohistochemical stains, D2-40 cytoplasmic staining was positive in all three lesions, whereas AE1/AE3 was negative, thus, confirming their lymphatic nature. PMID:25197378

  8. Adrenal glands in patients with cogenital renal anomalies: CT appearance

    SciTech Connect

    Kenney, P.J.; Robbins, G.L.; Ellis, D.A.; Spirt, B.A.


    The CT appearance of the adrenal glands was investigated in 30 patients with congenital renal anomalies. The ipsilateral adrenal was clearly identified in 83% of these patients; in all of them, the adrenal was a paraspinal disk-shaped organ, which appeared linear on CT. Conversely, the adrenals retained their normal shape in a control group of 20 patients with acquired renal atrophy or prior simple nephrectomy.

  9. Localization of metastatic adrenal cortical carcinoma with Ga-67

    SciTech Connect

    Ward, F.T.; Anderson, J.H.; Jelinek, J.; Anderson, D.W. )


    Data are limited on the localization of Ga-67 in primary or metastatic adrenal cortical carcinoma. We report the localization of Ga-67 to pathologically confirmed adrenal cortical carcinoma metastatic to the lung. A review of the literature revealed four patients have previously been reported to have metastatic adrenal cortical carcinoma detected on Ga-67 scan. Gallium imaging may be useful in the evaluation of patients with adrenal cortical carcinoma. SPECT imaging should further improve lesion resolution and localization.

  10. Ovarian adrenal interactions during the menopausal transition

    PubMed Central

    Lasley, B. L.; Crawford, S. L.; Mcconnell, D. S.


    Observations over the past decade using longitudinal data reveal a gender-specific shift in adrenal steroid production. This shift is represented by an increase in the circulating concentrations of delta 5 steroids in 85% of all women and is initiated only after the menopausal transition has begun. While the associated rise in the major adrenal androgen, dehydroepiandrosterone sulfate (DHEAS), is modest, the parallel rises in dehydroepiandrosteone (DHEA) and androstenediol (Adiol) are much more robust. These increases in circulating steroid concentrations are qualitatively similar on average between ethnicities but quantitatively different between individual women. Both circulating testosterone (T) and androstenedione (Adione) also rise concomitantly but modestly by comparison. This phenomenon presents a new and provocative aspect to the endocrine foundations of the menopausal transition and may provide important clues to understanding the fundamentals of mid-aged women's healthy aging, particularly an explanation for the wide diversity in phenotypes observed during the MT as well as their different responses to hormone replacement therapies. Experimental studies using the nonhuman primate animal model show an acute adrenal response to human chorionic gonadotropin (hCG) challenge as well as the presence of luteinizing hormone receptors (LHR) in their adrenal cortices. These experimental results support the concept that LHRs are recruited to the adrenal cortices of mid-aged women that subsequently function to respond to increasing circulating LH to shunt pregnenolone metabolites towards the delta 5 pathway. Future investigations are required to determine the relationship of these changes in adrenal function to symptoms and health outcomes of mid-aged women. PMID:24346252

  11. A success story in congenital adrenal hyperplasia.


    Kriplani, Alka; Lunkad, Amol; Agarwal, Nutan; Kulshreshtha, Bindu; Ariachery, C Aminni


    Congenital adrenal hyperplasia (CAH) is a group of autosomal recessive disorders characterized by enzyme defects in adrenal steroidogenic pathways. CAH due to 21-hydroxylase deficiency accounts for 95 % of cases. This case was diagnosed to have simple virilizing type of CAH and started on dexamethasone, and underwent genitoplasty and clitoroplasty at 25 years of age, then was married 3 years after surgery and conceived spontaneously 2 years after marriage, to deliver a healthy male baby. Thus, proper diagnosis and treatment with steroids and genitoplasty can give females with CAH a normal sexual, normal menstrual, and reproductive function.

  12. Diagnosis and Management of Hereditary Adrenal Cancer.


    Angelousi, Anna; Zilbermint, Mihail; Berthon, Annabel; Espiard, Stéphanie; Stratakis, Constantine A


    Benign adrenocortical tumours (ACT) are relatively frequent lesions; on the contrary, adrenocortical carcinoma (ACC) is a rare and aggressive malignancy with unfavourable prognosis. Recent advances in the molecular understanding of adrenal cancer offer promise for better therapies in the future. Many of these advances stem from the molecular elucidation of genetic conditions predisposing to the development of ACC. Six main clinical syndromes have been described to be associated with hereditary adrenal cancer. In these conditions, genetic counselling plays an important role for the early detection and follow-up of the patients and the affected family members. PMID:27075352

  13. Prenatal Diagnosis of Congenital Adrenal Hyperplasia.


    Yau, Mabel; Khattab, Ahmed; New, Maria I


    Congenital adrenal hyperplasia (CAH) owing to 21-hydroxylase deficiency is a monogenic disorder of adrenal steroidogenesis. To prevent genital ambiguity, in girls, prenatal dexamethasone treatment is administered early in the first trimester. Prenatal genetic diagnosis of CAH and fetal sex determination identify affected female fetuses at risk for genital virilization. Advancements in prenatal diagnosis are owing to improved understanding of the genetic basis of CAH and improved technology. Cloning of the CYP21A2 gene ushered in molecular genetic analysis as the current standard of care. Noninvasive prenatal diagnosis allows for targeted treatment and avoids unnecessary treatment of males and unaffected females. PMID:27241964

  14. Brain serotonin and pituitary-adrenal functions

    NASA Technical Reports Server (NTRS)

    Vernikos-Danellis, J.; Berger, P.; Barchas, J. D.


    It had been concluded by Scapagnini et al. (1971) that brain serotonin (5-HT) was involved in the regulation of the diurnal rhythm of the pituitary-adrenal system but not in the stress response. A study was conducted to investigate these findings further by evaluating the effects of altering brain 5-HT levels on the daily fluctuation of plasma corticosterone and on the response of the pituitary-adrenal system to a stressful or noxious stimulus in the rat. In a number of experiments brain 5-HT synthesis was inhibited with parachlorophenylalanine. In other tests it was tried to raise the level of brain 5-HT with precursors.

  15. A case of non-Hodgkin's lymphoma primary arising in both adrenal glands associated with adrenal failure.


    Nishiuchi, Takamasa; Imachi, Hitomi; Fujiwara, Mako; Murao, Koji; Onishi, Hiroaki; Kiguchi, Tohru; Takimoto, Hidetaka; Kushida, Yoshio; Haba, Reiji; Ishida, Toshihiko


    It is known that adrenal insufficiency is one of the complications in primary adrenal lymphoma, especially those with bilateral adrenal involvement. A 73-year-old man was referred for general fatigue and high fever to the nearest hospital. The patient was transferred to our hospital for evaluation of bilateral adrenal tumors and hyponatremia. He was diagnosed as having non-Hodgkin's lymphoma (NHL) with primaries arising in both adrenal glands. Primary adrenal lymphoma (PAL) is a rare extra-nodal NHL. Although an appropriate treatment of this disease has not been established, our case has demonstrated that the combination of rituximab and THP-COP chemotherapy could be administered, and that it improved clinical manifestations. This case raises the suggestion that malignant lymphoma should be suspected in patients with bilateral adrenal tumors that present with progressive adrenal insufficiency.

  16. [SF-1, a key player in adrenal and gonadal differentiation: implications in gonadal dysgenesis and primary ovarian insufficiency].


    Martinerie, L; Bouvattier, C; Lombes, M


    Steroidogenic factor 1 (SF-1) gene, identified by Keith Parker in 1992, encodes for an orphan nuclear receptor, NR5A1, whose expression is detected during fetal life in adrenal and gonadal steroidogenic tissues, but also in the developing hypothalamus and in pituitary gonadotropic cells. SF-1 knock-out mouse models exhibit complete adrenal and gonadal agenesis. Human mutations of this transcription factor, were initially associated with primary adrenal failure and male gonadal dysgenesis with various degrees of under androgenization. More recently, identification of novel SF-1 mutations responsible for isolated 46, XY gonadal dysgenesis or 46, XX primary ovarian insufficiency, underscores its central role in the control and maintenance of adrenal and reproductive functions. A better understanding in the regulatory mechanisms of SF-1 signaling pathway, will open new avenues for diagnostic and therapeutic managements of sex differentiation disorders and infertilities.

  17. Adrenal pseudotumors on CT due to dilated portosystemic veins

    SciTech Connect

    Mitty, H.M.; Cohen, B.A.; Sprayregen, S.; Schwartz, K.


    The adrenal and periadrenal venous systems are part of the portosystemic collateral pathways that may enlarge in portal hypertension. The cross-sectional image of the resulting enlarged venous channels may simulate an adrenal msss. Three examples of such computed tomographic (CT) scans are presented with selective venographic correlation. Patients with portal hypertension and suspected adrenal pathology may require enhanced or dynamic CT scans.

  18. Ultrasonographic appearance of adrenal glands in healthy and sick cats.


    Combes, Anaïs; Pey, Pascaline; Paepe, Dominique; Rosenberg, Dan; Daminet, Sylvie; Putcuyps, Ingrid; Bedu, Anne-Sophie; Duchateau, Luc; de Fornel-Thibaud, Pauline; Benchekroun, Ghita; Saunders, Jimmy H


    The first part of the study aimed to describe prospectively the ultrasonographic features of the adrenal glands in 94 healthy cats and 51 chronically sick cats. It confirmed the feasibility of ultrasonography of adrenal glands in healthy and chronically sick cats, which were not statistically different. The typical hypoechoic appearance of the gland surrounded by hyperechoic fat made it recognisable. A sagittal plane of the gland, not in line with the aorta, may be necessary to obtain the largest adrenal measurements. The reference intervals of adrenal measurements were inferred from the values obtained in the healthy and chronically sick cats (mean ± 0.96 SD): adrenal length was 8.9-12.5 mm; cranial height was 3.0-4.8 mm; caudal height was 3.0-4.5 mm. The second part of the study consisted of a retrospective analysis of the ultrasonographic examination of the adrenal glands in cats with adrenal diseases (six had hyperaldosteronism and four had pituitary-dependent hyperadrenocorticism) and a descriptive comparison with the reference features obtained in the control groups from the prospective study. Cats with hyperaldosteronism presented with unilateral severely enlarged adrenal glands. However, a normal contralateral gland did not preclude a contralateral infiltration in benign or malignant adrenal neoplasms. The ultrasonographic appearance of the adrenal glands could not differentiate benign and malignant lesions. The ultrasonographic appearance of pituitary-dependent hyperadrenocorticism was mainly a symmetrical adrenal enlargement; however, a substantial number of cases were within the reference intervals of adrenal size.

  19. Biopsy of the right adrenal gland by the transhepatic approach

    SciTech Connect

    Price, R.B.; Bernardino, M.E.; Berkman, W.A.; Sones, P.J. Jr.; Torres, W.E.


    A transhepatic computed-tomographic-guided biopsy of a right adrenal mass is described. This method is simpler to perform than the usual posterior biopsy carried out with the patient prone and is less likely to cause a complicating pneumothorax. In seven of eight patients with right adrenal masses, adrenal tissue was obtained and an accurate diagnosis was possible. No complications resulted.

  20. Imaging of an adrenal cortical carcinoma and its skeletal metastasis

    SciTech Connect

    Drane, W.E.; Graham, M.M.; Nelp, W.B.


    Though the typical scintigraphic appearance in adrenal cortical carcinoma is bilateral nonvisualization of the adrenal glands, a case with simultaneous visualization of both an adrenal cortical carcinoma and its skeletal metastasis using 6-..beta..-(/sup 131/I)iodomethyl-19-norcholesterol is reported.

  1. Imaging of an adrenal cortical carcinoma and its skeletal metastasis

    SciTech Connect

    Drane, W.E.; Graham, M.M.; Nelp, W.B.


    Though the typical scintigraphic appearance in adrenal cortical carcinoma is bilateral nonvisualization of the adrenal glands, we report a case with simultaneous visualization of both an adrenal cortical carcinoma and its skeletal metastasis using 6-beta-(/sup 131/I)iodomethyl-19-norcholesterol.

  2. Retroperitoneal foregut duplication cyst presenting as an adrenal mass.


    Terry, N Elizabeth; Senkowski, Christopher K; Check, William; Brower, Steven T


    A 75 year-old woman presented to the authors' institution with abdominal pain and early satiety. An adrenal mass was found on CT scanning. Laparoscopic adrenalectomy was performed, and the patient was found to have a retroperitoneal bronchogenic cyst adherent to the adrenal gland. The workup of an adrenal mass is discussed as well as the pathophysiology of bronchogenic cysts.

  3. GIP-dependent adrenal Cushing's syndrome with incomplete suppression of ACTH.


    Croughs, R J; Zelissen, P M; van Vroonhoven, T J; Hofland, L J; N'Diaye, N; Lacroix, A; de Herder, W W


    ACTH-independent Cushing's syndrome may be due to the development of ectopic hormone receptors in adrenal tissue. Thus, in food-dependent Cushing's syndrome the adrenals aberrantly express receptors for gastric inhibitory polypeptide (GIP). We present the case of a 60-year-old woman with food-dependent Cushing's syndrome whose cortisol levels increased after stimulation with CRH. In this patient with Cushing's syndrome the finding of low basal plasma cortisol levels in the late night and early morning as well as a paradoxical rise of plasma cortisol during a 7-h infusion with dexamethasone (carried out without any restriction in food intake), suggested that cortisol production was stimulated at times of food intake. Hourly measurements of plasma cortisol for 48 h revealed prominent meal-related peaks. A plasma cortisol response, elicited by oral glucose administration, could be prevented by octreotide. Plasma ACTH was low or undetectable. CRH administration was followed by a ACTH response from 3 to 16 ng/l and a plasma cortisol response from 230 to 680 nmol/l. Octreotide treatment for nearly five months induced a partial clinical and biochemical remission. Total bilateral adrenalectomy was performed. The left adrenal was grossly enlarged (7 x 5.5 x 4 cm) and the right adrenal was slightly enlarged (6 x 4 x 1.8 cm). Microscopy revealed bilateral nodular hyperplasia. Cell suspensions of adrenal tissue from the patient did respond in a dose-dependent fashion to stimulation with GIP and were very sensitive to stimulation with synthetic ACTH1-24. However, CRH had no significant effect on cortisol production in vitro. Using RT-PCR amplification and cDNA hybridization, GIP receptor was found to be overexpressed in the left and right adrenal tissues from this patient as compared to adrenal tissues from a normal individual or from non GIP-dependent adrenal Cushing's syndrome. There was no evidence of presence of adrenal CRH receptors. Thus, in this patient with food

  4. [Von Hippel-Lindau disease type 2-related pancreatic neuroendocrine tumor and adrenal myelolipoma].


    Dolzhansky, O V; Morozova, M M; Korostelev, S A; Kanivets, I V; Chardarov, N K; Shatveryan, G A; Pal'tseva, E M; Fedorov, D N


    The paper describes a case of von Hippel--Lindau-related pancreatic neuroendocrine tumor and adrenal myelolipoma in a 44-year-old woman. The pancreatic tumor and a left retroperitoneal mass were removed in the women in July 2014 and May 2015. Histological examination of the pancreatic tumor revealed that the latter consisted of clear cells forming tubular and tubercular structures showing the expression of chromogranin A, synaptophysin, and cytokeratins 18 and 19 and a negative response to CD10 and RCC. The adrenal medullary mass presented as clear-cell alveolar structures with inclusions of adipose tissue mixed with erythroid, myeloid, and lymphoid cells. The clear-cell component of the adrenal gland expressed neuroendocrine markers with a negative response to cytokeratins, CD10, and RCC. Molecular genetic examination yielded a signal corresponding to two copies of the VHL gene. No deletions or amplifications of the gene were detected. Cases of von Hippel--Lindau disease concurrent with adrenal pheochromocytoma and myelolipoma and simultaneous pancreatic involvement were not found in the literature. PMID:26978235

  5. Coated vesicles in the rat adrenal glomerular zone after a low-sodium diet.


    Palacios, G; Lafarga, M


    In rats subjected to a low-sodium diet, a great activity was observed of the coated vesicles at Golgi complex and cell surfaces of glomerular adrenal zone. These findings are related to the function of these organoids in the uptake and transport of necessary substances under stimulating conditions of the zone.

  6. Physiological Basis for the Etiology, Diagnosis, and Treatment of Adrenal Disorders: Cushing’s Syndrome, Adrenal Insufficiency, and Congenital Adrenal Hyperplasia

    PubMed Central

    Raff, Hershel; Sharma, Susmeeta T.; Nieman, Lynnette K.


    The hypothalamic-pituitary-adrenal (HPA) axis is a classic neuroendocrine system. One of the best ways to understand the HPA axis is to appreciate its dynamics in the variety of diseases and syndromes that affect it. Excess glucocorticoid activity can be due to endogenous cortisol overproduction (spontaneous Cushing’s syndrome) or exogenous glucocorticoid therapy (iatrogenic Cushing’s syndrome). Endogenous Cushing’s syndrome can be subdivided into ACTH-dependent and ACTH-independent, the latter of which is usually due to autonomous adrenal overproduction. The former can be due to a pituitary corticotroph tumor (usually benign) or ectopic ACTH production from tumors outside the pituitary; both of these tumor types overexpress the proopiomelanocortin gene. The converse of Cushing’s syndrome is the lack of normal cortisol secretion and is usually due to adrenal destruction (primary adrenal insufficiency) or hypopituitarism (secondary adrenal insufficiency). Secondary adrenal insufficiency can also result from a rapid discontinuation of long-term, pharmacological glucocorticoid therapy because of HPA axis suppression and adrenal atrophy. Finally, mutations in the steroidogenic enzymes of the adrenal cortex can lead to congenital adrenal hyperplasia and an increase in precursor steroids, particularly androgens. When present in utero, this can lead to masculinization of a female fetus. An understanding of the dynamics of the HPA axis is necessary to master the diagnosis and differential diagnosis of pituitary-adrenal diseases. Furthermore, understanding the pathophysiology of the HPA axis gives great insight into its normal control. PMID:24715566

  7. Embryologic development of rat adrenal medulla in transplants to the anterior chamber of the eye.


    Unsicker, K


    The morphological development and plasticity of embryonic and postnatal rat adrenal medullary cells were studied in homologous adrenal grafts to the anterior chamber of the eye. The eyes of recipient rats were adrenergically denervated 10 days prior to grafting by extirpation of the superior cervical ganglion in order to increase levels of NGF and NGF-like activities in the iris. Grafts taken at the 15th day of embryonic development (E15), i.e., at the beginning of immigration of medullary progenitor cells into the adrenal cortical anlagen, contained no cortical or mature medullary cells after 2 weeks in oculo. Numerous sympathoblastic cells, however, were located at the anterior surface of the iris. E 16 and E 17 transplants showed abundant mature cortical tissue after 2 weeks. Small groups of medullary cells with the ultrastructural characteristics of mature pheochromoblasts or young chromaffin cells were interspersed among cortical cells without forming a discrete medulla. Neuronal cells were exclusively found outside the cortical cell mass. Sympathoblasts grew at the surface of the iris, while young sympathetic nerve cells, which were invested by Schwann cells and received synaptic axon terminals, were embedded into the stroma of the iris. Grafting of E 21 adrenals yielded very similar results except that, in a few instances, young chromaffin cells were located outside the cortex and sympathetic nerve cells were seen to be in close contact with cortical cells. In transplants of adult medullary cells typical mature adrenaline and noradrenaline cells were clearly distinguishable after 8 weeks even in the absence of cortical cells. The only indication of phenotypical changes in these cells was the formation by some of them, of neuritic processes which could be visualized in glyoxylic acid-treated whole mounts of irises. These results are compatible with the idea that embryonic adrenal medullary cells have the environmentally controlled potential to develop along

  8. Bilateral adrenal [corrected] nodules due to histoplasmosis in an elderly.


    Carvalho, Flávio Pedreira de Freitas de; Curiati, José Antônio Esper; Mauad, Thaís; Incerti, Milena Mendes; Jacob Filho, Wilson


    We report a case history of an 84-year-old elderly male patient that presented with a clinical picture suggestive of adrenal failure and bilateral adrenal nodules detected by abdominal computed tomography. A fine needle-guided biopsy was inconclusive for achieving a final diagnosis. The patient died due to septic shock and the autopsy disclosed histoplasmosis with extensive bilateral necrosis of the adrenal glands. Although the adrenal involvement in chronic disseminated histoplasmosis has been described, there have been few reports of the infection being associated with adrenal insufficiency.

  9. Functioning adrenal myelolipoma: A rare cause of hypertension

    PubMed Central

    Jakka, Nagendar; Venkateshwarlu, J.; Satyavani, Naga; Neelaveni, K.; Ramesh, Jayanthy


    Co-occurrence of adrenal incidentaloma with hypertension calls for evaluation of endocrine causes including pheochromocytoma, Cushing's disease, and primary aldosteronism. We are reporting 40-years-old man who presented with hypertension and adrenal mass. He had elevated metanephrines, histology of resected adrenal mass revealed adrenal myelolipoma, and immuno-histochemistry was positive for chromogranin A. Both his blood pressure and urinary metanephrines returned to normal after surgery. The association of hypertension and adrenal myelolipoma may not be entirely coincidental, as it may be associated with secreting catecholamine. Literature on such an uncommon association is reviewed briefly as well. PMID:24251175

  10. Adrenal gland denervation and diving in ducks.


    Mangalam, H J; Jones, D R; Lacombe, A M


    The extreme elevation in plasma levels of free norepinephrine (NE) and free epinephrine (EP), which occurs during forced diving of ducks (Anas platyrhynchos), was studied before and after denervation of the adrenal glands. In intact animals both NE and EP concentration increased by up to two orders of magnitude in a 4-min dive but by a significantly lesser amount if the duck breathed O2 before the dive. Denervating the adrenal glands reduced the amounts of both catecholamines (CA) released during dives, plasma EP decreased to 10%, and NE to 50% of values obtained before denervation. Breathing O2 before a dive virtually eliminated CA release in denervates, indicating that hypoxia was the important non-neural releasing agent. Hypoxia was also the most important neural releasing agent compared with hypercapnia, acidosis, or hypoglycemia. Adrenal denervation did not cause significant changes in heart rate, blood pressure, arterial blood gas tensions, pH, or plasma glucose during dives, although denervation caused increased variation in some of these variables. In ducks CA release in dives is largely due to decreasing arterial O2 partial pressure, and full expression of the response is dependent on intact innervation of the adrenal gland. PMID:3591985

  11. Genetics Home Reference: primary macronodular adrenal hyperplasia


    ... germline and somatic mutations are associated with both primary macronodular adrenal hyperplasia and meningioma. J Clin Endocrinol Metab. 2015 Jan;100(1):E119-28. doi: 10.1210/jc.2014-2648. Citation on PubMed or Free article on PubMed Central Faucz FR, Zilbermint M, Lodish ...

  12. Imaging features of benign adrenal cysts.


    Sanal, Hatice Tuba; Kocaoglu, Murat; Yildirim, Duzgun; Bulakbasi, Nail; Guvenc, Inanc; Tayfun, Cem; Ucoz, Taner


    Benign adrenal gland cysts (BACs) are rare lesions with a variable histological spectrum and may mimic not only each other but also malignant ones. We aimed to review imaging features of BACs which can be helpful in distinguishing each entity and determining the subsequent appropriate management. PMID:16962278

  13. Adrenal Cushing's syndrome may resemble eating disorders.


    Hatakeyama, Makiko; Nakagami, Taku; Yasui-Furukori, Norio


    We encountered a patient who presented extreme weight loss and received an eating disorder diagnosis that was later identified as adrenal Cushing's syndrome. A 32-year-old woman with a 2-year history of an eating disorder was admitted to our psychiatric ward due to dehydration, malnutrition and low weight. Her height and body weight were 152.1 cm and 29.8 kg, respectively (body mass index: 12.8). Her other symptoms included a depressed mood, decreased interest, retardation and suicidal ideation. Standard medical cares were prescribed to treat the depressive symptoms and eating disorder, but the depressive episode and low body weight of the patient persisted. Computed tomography of the abdomen revealed an unexpected left adrenal gland tumor. Cushing's syndrome was diagnosed based on several endocrinological examinations. After an enucleation of the left adrenal gland tumor, the patient began eating, and her body weight increased gradually. Her body weight increased to 42.0-47.0 kg (body mass index: 18.2-20.3). Her mental and physical conditions had stabilized. This case suggests that adrenal Cushing's syndrome may resemble eating disorders.

  14. Adrenal metabolism of mitotane and related compounds

    SciTech Connect

    Djanegara, T.K.S.


    Mitotane (o,p{prime}-DDD; 1-(2-chlorophenyl)-1-(4-chlorophenyl)-2,2-dichloroethane) has been used in the treatment of Cushing's syndrome due to adrenal hyperfunction and it the drug of choice for adrenocortical carcinoma. The object of this investigation is to study the biotransformation of o,p{prime}-DDD and p,p{prime}-DDD in dogs and bovine adrenal cortex to explain its selective toxicity and mechanism of action. The in vitro biotransformation of {sup 14}C-labeled o,p{prime}-DDD and p,p{prime}-DDD by dog and bovine adrenal cortex as studied. Of the cortex subcellular fractions, the cytosol fraction was found to be the most active in metabolizing the substrates, followed by the mitochondrial fraction. This metabolism including that in cytosolic fractions, did not take place with boiled enzyme preparations and required an NADPH generating system. This study has been directed towards establishing the metabolic activation mechanism which may account for the adrenocorticolytic effect of mitotane in contrast to detoxication by the liver. HPLC and TLC metabolic profiles have been generated from incubations of bovine and dog adrenal cortex homogenates and their subfractions for {sup 14}C-labeled p,p{prime}-DDD, o,p{prime}-DDD and its monochloroethylene derivative, o,p{prime}-DDMU.

  15. Haemorrhagic adrenal pseudocyst: a case report.


    Jain, P; Shukla, N K; Das, S K; Kapila, K; Kapur, M


    A case of a non-functioning adrenal pseudocyst is reported herein. The key role of sonography and abdominal CT in the diagnosis of this rare retroperitoneal cystic lesion is highlighted. A possible etiological relationship with the trauma of parturition is proposed in our patient.

  16. Zone-specific regulation of two messenger RNAs for P450c11 in the adrenals of pregnant and nonpregnant rats.


    Malee, M P; Mellon, S H


    Adrenal mitochondria possess two steroidogenic cytochrome P450s. P450c11 converts deoxycorticosterone to corticosterone and aldosterone, and P450scc converts cholesterol to pregnenolone. These P450s receive electrons from NADPH via adrenodoxin reductase and adrenodoxin. A single bovine P450c11 protein has 11-hydroxylase, 18-hydroxylase, and 18-oxidase activities, but this series of enzymatic steps may be mediated by more than one enzyme in rats. Enzymatic assays of purified rat mitochondrial proteins have suggested that one enzyme found in all zones of the adrenal cortex has both 11- and 18-hydroxylase activities, whereas another enzyme, found exclusively in the zona glomerulosa, catalyzes 18-hydroxylation and 18-oxidation of corticosterone. We studied the number and zonal distribution of P450c11 mRNA species in the rat adrenal and how these mRNAs are regulated in the adrenals of normal and pregnant rats. Rats synthesize two similar, but distinct, P450c11 mRNAs. One, P450c11A, is found in both the zona glomerulosa and fasciculata/reticularis, whereas the second, P450c11B, is found only in the zona glomerulosa. The abundance of neither P450c11A mRNA nor P450c11B mRNA is affected by a high-salt diet. However, when rats receive a low-salt diet, P450c11A mRNA decreases and P450c11B mRNA increases. Dexamethasone decreases the amount of P450c11A mRNA without affecting P450c11B mRNA. The combination of a high-salt diet and dexamethasone decreases the amount of both mRNAs further to almost undetectable amounts. Rats given a low-salt diet and dexamethasone have a dramatic increase in the abundance of P450c11B mRNA. Thus both forms of P450c11 mRNA are regulated independently in the rat adrenal cortex. In situ hybridization studies show that only the P450c11 found in the zona glomerulosa is regulated by salt treatment in vivo, whereas glucocorticoid treatment in vivo regulates P450c11 in all zones. In the adrenals of pregnant rats, P450c11B is regulated in a similar fashion

  17. Association of the GTP-binding protein Rab3A with bovine adrenal chromaffin granules

    SciTech Connect

    Darchen, F.; Hammel, F.; Monteils, M.P.; Scherman, D. ); Zahraoui, A.; Tavitian, A. )


    The Rab3A protein belongs to a large family of small GTP-binding proteins that are present in eukaryotic cells and that share amino acid identities with the Ras proteins (products of the ras protooncogenes). Rab3A, which is specifically located in nervous and endocrine tissues, is suspected to play a key role in secretion. Its localization was investigated in bovine adrenal gland by using a polyclonal antibody. Rab3A was detected in adrenal medulla but not in adrenal cortex. In cultured adrenal medulla cells, Rab3A was specifically expressed in the catecholamine-secreting chromaffin cells. Subcellular fractionation suggested that Rab3A is about 30% cytosolic and that particulate Rab3A is associated with the membrane of chromaffin granules (the catecholamine storage organelles) and with a second compartment likely to be the plasma membrane. The Rab3A localization on chromaffin granule membranes was confirmed by immunoadsorption with an antibody against dopamine {beta}-hydroxylase. Rab3A was not extracted from this membrane by NaCl or KBr but was partially extracted by urea and totally solubilized by Triton X-100, suggesting either an interaction with an intrinsic protein or a membrane association through fatty acid acylation. This study suggests that Rab3A, which may also be located on other secretory vesicles containing noncharacterized small GTP-binding proteins, is involved in their biogenesis or in the regulated secretion process.

  18. Decreased catecholamine secretion from the adrenal medullae of chronically diabetic BB-Wistar rats

    NASA Technical Reports Server (NTRS)

    Wilke, R. A.; Riley, D. A.; Lelkes, P. I.; Hillard, C. J.


    Many humans with IDDM eventually lose the capacity to secrete epinephrine from their adrenal medullae. The mechanism for this pathological change is unknown. We hypothesized that this abnormality is attributable to neuropathic changes in the greater splanchnic nerves or in the chromaffin cells that they innervate. To study this hypothesis, we isolated rat adrenal glands, perfused them ex vivo, and measured the epinephrine content of the perfusate under various conditions of stimulation. We used transmural electrical stimulation (20-80 V, at 10 Hz) to induce epinephrine secretion indirectly by selectively activating residual splanchnic nerve terminals within the isolated glands. Under these conditions, epinephrine secretion was severely attenuated in glands from female BB-Wistar rats with diabetes of 4 mo duration compared with their age-matched, nondiabetic controls. These perfused diabetic adrenal medullae also demonstrated decreased catecholamine release in response to direct chromaffin cell depolarization with 20 mM K+, evidence that a functional alteration exists within the chromaffin cells themselves. Nonetheless, total catecholamine content of adrenal medullae from these diabetic rats was not significantly different from controls, indicating that the secretory defect was not simply attributable to a difference in the amount of catecholamines stored and available for release. Herein, we also provide histological evidence of degenerative changes within the cholinergic nerve terminals that innervate these glands.

  19. Adrenal myelolipoma: Controversies in its management

    PubMed Central

    Shenoy, Vasanth G.; Thota, Anuroop; Shankar, Ravi; Desai, Mallikarjun G.


    Adrenal myelolipomas (AMLs) are rare, benign neoplasms of the adrenal gland with varied clinical presentations. The rarity of these tumors precludes any case-controlled or randomized study into their management. The available literature is limited to case reports and short series from referral centers. This review is an effort to put the available literature into perspective such that clinical decision making can be done with some clarity. The PubMed and Cochrane databases were searched with key words Adrenal Myelolipoma, Adrenal Incidentaloma (AI) and Adrenal Collision Tumor (ACT). From over 1300 search results, 547 relevant publications dating from 1954 to 2014 were reviewed. Details of about 1231 AMLs in the indexed literature were analyzed. Increasing usage of imaging studies has significantly increased the discovery of AMLs. Although AMLs are benign tumors, those measuring larger than 6 cm are prone to rupture and hemorrhage. Thorough endocrine work-up may benefit a selected group of patients, especially those who are hypertensive, diabetic/pre-diabetic, young patients (<50 years) and those with bilateral AML. Regular observation is needed for AML patients who are being treated non-operatively, as many of them may require surgery during follow-up. Although the AACE/AAES guidelines for AI (2009) exclude AML from mandatory metabolic work-up for a newly discovered AI, we feel that a significant number of patients with AML would benefit from metabolic work-up. In the literature, endocrine dysfunction in AML is 7% as compared with 11% in AI. Endocrine dysfunction in AML is probably underdiagnosed. PMID:25878407

  20. Histoplasmosis of the adrenal glands studied by CT

    SciTech Connect

    Wilson, D.A.; Muchmore, H.G.; Tisdal, R.G.; Fahmy, A.; Pitha, J.V.


    Computed tomography (CT) of the adrenal glands was performed on seven patients who had histologically proved disseminated histoplasmosis. All seven patients showed some degree of adrenal gland abnormality. The range of CT findings included minimal enlargement with faint flecks of calcium, moderate enlargement with focal low attenuation nodules, and massive enlargement with large areas of necrosis or dense calcification. The changes in each patient were bilateral and symmetrical. Adrenal gland shape was usually preserved. Finding of percutaneous adrenal biopsy, which was performed under CT guidance, made the diagnosis in one patient. Five of seven patients had adrenal insufficiency. It is concluded that the diagnosis of disseminated histoplasmosis should be considered in any patient who has bilateral adrenal gland enlargement and who resides in an endemic area, especially if there is evidence of adrenal insufficiency.

  1. A Rare Case of Adrenal Pheochromocytoma with Unusual Clinical and Biochemical Presentation: 
A Case Report and Literature Review

    PubMed Central

    Mula-Abed, Waad-Allah S.; Ahmed, Riyaz; Ramadhan, Fatima A.; Al-Kindi, Manal K.; Al-Busaidi, Noor B.; Al-Muslahi, Hilal N.; Al-Lamki, Mohammad A.


    A 50-year-old Omani woman presented to the Outpatient Clinic, Royal Hospital, Oman with right upper abdominal pain and backache that had lasted 10 days. She had no palpitation, sweating, or hypertension (blood pressure 122/78mmHg). The patient’s history revealed that she had a similar incidence of abdominal pain two months prior, which was a "dull ache" in nature and somewhat associated with headache. The pain was relieved using a mild analgesic drug. Abdominal ultrasonography showed a right adrenal mass, and both computed tomography and magnetic resonance imaging of the adrenal glands confirmed a right adrenal mass consistent with adrenal pheochromocytoma. However, clinical biochemistry tests revealed normal levels of plasma catecholamines (dopamine, norepinephrine, and epinephrine) and metanephrine, which are unusual findings in adrenal pheochromocytoma. Meanwhile, the patient had markedly raised plasma normetanephrine (10-fold) which, together with the normal metanephrine, constitutes a metabolic profile that is compatible with extra-adrenal pheochromocytoma. The patient also had markedly raised chromogranin A (16-fold), consistent with the presence of a neuroendocrine tumor. Laparoscopic right adrenalectomy was done and the adrenal tumor was excised and retrieved in total. Histopathology and immunohistochemistry confirmed the diagnosis of adrenal pheochromocytoma; the tumor cells being positive for chromogranin, synaptophysin, and S-100 protein. Following surgery, the patient did well and showed full recovery at follow-up after three months. Molecular genetic testing showed no pathogenic mutation in pheochromocytoma genes: MAX, SDHA, SDHAF2, SDHB, SDHC, SDHD, VHL, and PRKAR1A. A review of the literature was conducted to identify the pathophysiology and any previous reports of such case. To our knowledge, this is the first report in Oman of the extremely rare entity of pheochromocytoma with an unusual clinical and biochemical scenario. PMID:26421121

  2. A Rare Case of Adrenal Pheochromocytoma with Unusual Clinical and Biochemical Presentation: 
A Case Report and Literature Review.


    Mula-Abed, Waad-Allah S; Ahmed, Riyaz; Ramadhan, Fatima A; Al-Kindi, Manal K; Al-Busaidi, Noor B; Al-Muslahi, Hilal N; Al-Lamki, Mohammad A


    A 50-year-old Omani woman presented to the Outpatient Clinic, Royal Hospital, Oman with right upper abdominal pain and backache that had lasted 10 days. She had no palpitation, sweating, or hypertension (blood pressure 122/78mmHg). The patient's history revealed that she had a similar incidence of abdominal pain two months prior, which was a "dull ache" in nature and somewhat associated with headache. The pain was relieved using a mild analgesic drug. Abdominal ultrasonography showed a right adrenal mass, and both computed tomography and magnetic resonance imaging of the adrenal glands confirmed a right adrenal mass consistent with adrenal pheochromocytoma. However, clinical biochemistry tests revealed normal levels of plasma catecholamines (dopamine, norepinephrine, and epinephrine) and metanephrine, which are unusual findings in adrenal pheochromocytoma. Meanwhile, the patient had markedly raised plasma normetanephrine (10-fold) which, together with the normal metanephrine, constitutes a metabolic profile that is compatible with extra-adrenal pheochromocytoma. The patient also had markedly raised chromogranin A (16-fold), consistent with the presence of a neuroendocrine tumor. Laparoscopic right adrenalectomy was done and the adrenal tumor was excised and retrieved in total. Histopathology and immunohistochemistry confirmed the diagnosis of adrenal pheochromocytoma; the tumor cells being positive for chromogranin, synaptophysin, and S-100 protein. Following surgery, the patient did well and showed full recovery at follow-up after three months. Molecular genetic testing showed no pathogenic mutation in pheochromocytoma genes: MAX, SDHA, SDHAF2, SDHB, SDHC, SDHD, VHL, and PRKAR1A. A review of the literature was conducted to identify the pathophysiology and any previous reports of such case. To our knowledge, this is the first report in Oman of the extremely rare entity of pheochromocytoma with an unusual clinical and biochemical scenario. PMID:26421121

  3. Placental estrogen suppresses cyclin D1 expression in the nonhuman primate fetal adrenal cortex.


    Dumitrescu, Adina; Aberdeen, Graham W; Pepe, Gerald J; Albrecht, Eugene D


    We have previously shown that estrogen selectively suppresses growth of the fetal zone of the baboon fetal adrenal cortex, which produces the C19-steroid precursors, eg, dehydroepiandrosterone sulfate, which are aromatized to estrogen within the placenta. In the present study, we determined whether fetal adrenal expression of cell cycle regulators are altered by estrogen and thus provide a mechanism by which estrogen regulates fetal adrenocortical development. Cyclin D1 mRNA levels in the whole fetal adrenal were increased 50% (P < .05), and the number of cells in the fetal adrenal definitive zone expressing cyclin D1 protein was increased 2.5-fold (P < .05), whereas the total number of cells in the fetal zone and fetal serum dehydroepiandrosterone sulfate levels were elevated 2-fold (P < .05) near term in baboons in which fetal serum estradiol levels were decreased by 95% (P < .05) after maternal administration of the aromatase inhibitor letrozole and restored to normal by concomitant administration of letrozole plus estradiol throughout second half of gestation. However, fetal adrenocortical expression of cyclin D2, the cyclin-dependent kinase (Cdk)-2, Cdk4, and Cdk6, and Cdk regulatory proteins p27(Kip1) and p57(Kip2) were not changed by letrozole or letrozole plus estradiol administration. We suggest that estrogen controls the growth of the fetal zone of the fetal adrenal by down-regulating cyclin D1 expression and thus proliferation of progenitor cells within the definitive zone that migrate to the fetal zone. We propose that estrogen restrains growth and function of the fetal zone via cyclin D1 to maintain estrogen levels in a physiological range during primate pregnancy.

  4. Placental Estrogen Suppresses Cyclin D1 Expression in the Nonhuman Primate Fetal Adrenal Cortex*

    PubMed Central

    Dumitrescu, Adina; Aberdeen, Graham W.; Pepe, Gerald J.


    We have previously shown that estrogen selectively suppresses growth of the fetal zone of the baboon fetal adrenal cortex, which produces the C19-steroid precursors, eg, dehydroepiandrosterone sulfate, which are aromatized to estrogen within the placenta. In the present study, we determined whether fetal adrenal expression of cell cycle regulators are altered by estrogen and thus provide a mechanism by which estrogen regulates fetal adrenocortical development. Cyclin D1 mRNA levels in the whole fetal adrenal were increased 50% (P < .05), and the number of cells in the fetal adrenal definitive zone expressing cyclin D1 protein was increased 2.5-fold (P < .05), whereas the total number of cells in the fetal zone and fetal serum dehydroepiandrosterone sulfate levels were elevated 2-fold (P < .05) near term in baboons in which fetal serum estradiol levels were decreased by 95% (P < .05) after maternal administration of the aromatase inhibitor letrozole and restored to normal by concomitant administration of letrozole plus estradiol throughout second half of gestation. However, fetal adrenocortical expression of cyclin D2, the cyclin-dependent kinase (Cdk)-2, Cdk4, and Cdk6, and Cdk regulatory proteins p27Kip1 and p57Kip2 were not changed by letrozole or letrozole plus estradiol administration. We suggest that estrogen controls the growth of the fetal zone of the fetal adrenal by down-regulating cyclin D1 expression and thus proliferation of progenitor cells within the definitive zone that migrate to the fetal zone. We propose that estrogen restrains growth and function of the fetal zone via cyclin D1 to maintain estrogen levels in a physiological range during primate pregnancy. PMID:25247468

  5. Antiaging Gene Klotho Regulates Adrenal CYP11B2 Expression and Aldosterone Synthesis.


    Zhou, Xiaoli; Chen, Kai; Wang, Yongjun; Schuman, Mariano; Lei, Han; Sun, Zhongjie


    Deficiency of the antiaging gene Klotho (KL) induces renal damage and hypertension through unknown mechanisms. In this study, we assessed whether KL regulates expression of CYP11B2, a key rate-limiting enzyme in aldosterone synthesis, in adrenal glands. We found that haplodeficiency of KL(+/-) in mice increased the plasma level of aldosterone by 16 weeks of age, which coincided with spontaneous and persistent elevation of BP. Blockade of aldosterone actions by eplerenone reversed KL deficiency-induced hypertension and attenuated the kidney damage. Protein expression of CYP11B2 was upregulated in adrenal cortex of KL(+/-) mice. KL and CYP11B2 proteins colocalized in adrenal zona glomerulosa cells. Silencing of KL upregulated and overexpression of KL downregulated CYP11B2 expression in human adrenocortical cells. Notably, silencing of KL decreased expression of SF-1, a negative transcription factor of CYP11B2, but increased phosphorylation of ATF2, a positive transcription factor of CYP11B2, which may contribute to upregulation of CYP11B2 expression. Therefore, these results show that KL regulates adrenal CYP11B2 expression. KL deficiency-induced spontaneous hypertension and kidney damage may be partially attributed to the upregulation of CYP11B2 expression and aldosterone synthesis. PMID:26471128

  6. Splenomegaly and adrenal weight changes in isolated adult mice chronically exposed to Lead

    SciTech Connect

    Ogilvie, D.M.; Martin, A.H.


    Inorganic lead is an environmental contaminant of continuing toxicological concern. Since the effects of chronic lead ingestion are most pronounced in neonatal or very young animals, investigations relating to the mental health effects of lead on children have to date been of prime importance. As the perspective of lead toxicity has widened, however, concern about the effects of lead exposure in adults has also been expressed, and several studies have now documented lead-induced learning abnormalities in adult animals. Recently research has shown that lead-treated adult mice fail to develop the isolation-induced aggressiveness typical of untreated control animals. Animal aggression has both neural and endocrine substrates, and with regard to the latter, it is well known that many mammals exhibit changes of adrenal weight and function when subjected to irritable aggression associated with the pressure of population density. Although impairment of adrenal gland functioning has been reported for lead-poisoned humans, few animal studies have yet investigated the effects of chronic lead exposure on the pituitary-adrenal axis. In this paper, changes are described in adrenal weights for mice subjected to isolation and lead exposure. In addition, since it is well known that lead exposure can reduce the survival time of red blood cells, the possibility that the spleen, the disposal center for discarded red cells, might also be affected by lead exposure was investigated.

  7. Science review: Mechanisms of impaired adrenal function in sepsis and molecular actions of glucocorticoids

    PubMed Central

    Prigent, Hélène; Maxime, Virginie; Annane, Djillali


    This review describes current knowledge on the mechanisms that underlie glucocorticoid insufficiency in sepsis and the molecular action of glucocorticoids. In patients with severe sepsis, numerous factors predispose to glucocorticoid insufficiency, including drugs, coagulation disorders and inflammatory mediators. These factors may compromise the hypothalamic–pituitary axis (i.e. secondary adrenal insufficiency) or the adrenal glands (i.e. primary adrenal failure), or may impair glucocorticoid access to target cells (i.e. peripheral tissue resistance). Irreversible anatomical damages to the hypothalamus, pituitary, or adrenal glands rarely occur. Conversely, transient functional impairment in hormone synthesis may be a common complication of severe sepsis. Glucocorticoids interact with a specific cytosolic glucocorticoid receptor, which undergoes conformational changes, sheds heat shock proteins and translocates to the nucleus. Glucocorticoids may also interact with membrane binding sites at the surface of the cells. The molecular action of glucocorticoids results in genomic and nongenomic effects. Direct and indirect transcriptional and post-transcriptional effects related to the cytosolic glucocorticoid receptor account for the genomic effects. Nongenomic effects are probably subsequent to cytosolic interaction between the glucocorticoid receptor and proteins, or to interaction between glucocorticoids and specific membrane binding sites. PMID:15312206

  8. A dual-color luciferase assay system reveals circadian resetting of cultured fibroblasts by co-cultured adrenal glands.


    Noguchi, Takako; Ikeda, Masaaki; Ohmiya, Yoshihiro; Nakajima, Yoshihiro


    In mammals, circadian rhythms of various organs and tissues are synchronized by pacemaker neurons in the suprachiasmatic nucleus (SCN) of the hypothalamus. Glucocorticoids released from the adrenal glands can synchronize circadian rhythms in other tissues. Many hormones show circadian rhythms in their plasma concentrations; however, whether organs outside the SCN can serve as master synchronizers to entrain circadian rhythms in target tissues is not well understood. To further delineate the function of the adrenal glands and the interactions of circadian rhythms in putative master synchronizing organs and their target tissues, here we report a simple co-culture system using a dual-color luciferase assay to monitor circadian rhythms separately in various explanted tissues and fibroblasts. In this system, circadian rhythms of organs and target cells were simultaneously tracked by the green-emitting beetle luciferase from Pyrearinus termitilluminans (ELuc) and the red-emitting beetle luciferase from Phrixothrix hirtus (SLR), respectively. We obtained tissues from the adrenal glands, thyroid glands, and lungs of transgenic mice that expressed ELuc under control of the promoter from a canonical clock gene, mBmal1. The tissues were co-cultured with Rat-1 fibroblasts as representative target cells expressing SLR under control of the mBmal1 promoter. Amplitudes of the circadian rhythms of Rat-1 fibroblasts were potentiated when the fibroblasts were co-cultured with adrenal gland tissue, but not when co-cultured with thyroid gland or lung tissue. The phases of Rat-1 fibroblasts were reset by application of adrenal gland tissue, whereas the phases of adrenal gland tissue were not influenced by Rat-1 fibroblasts. Furthermore, the effect of the adrenal gland tissue on the fibroblasts was blocked by application of a glucocorticoid receptor (GR) antagonist. These results demonstrate that glucocorticoids are strong circadian synchronizers for fibroblasts and that this co

  9. [Ectopic adrenal cortical adenoma in the spinal canal: A case report and a review of the literature].


    Konstantinov, A S; Shelekhova, K V


    Ectopic adrenal cortical neoplasms are extremely rare. The authors describe their own case of intradural, extramedullary conus medullaris adenoma that occurred in a 55-year-old woman, which was clinically accompanied by lumbar pains, left leg numbness, and left foot weakness during 10 years. The mass was histologically composed of rounded and polygonal cell fields with rounded, regular nuclei and abundant eosinophilic and clear cytoplasm. There were no necroses or mitoses. The cells were immunohistochemically positive for cytokeratin AE1/3, vimentin, inhibin-α, melan-A, and synaptophysin. An ectopic adrenocortical adenoma was diagnosed after ruling out myxopapillary ependymoma, meningioma with oncocytic transformation, paraganglioma, metastatic renal cell carcinoma, and adrenal cortical carcinoma. In the opinion of most investigators, extra-adrenal tumors develop from ectopic adrenal cortical tissue. To date, only eight intraspinal adrenal cortical tumors have been described. These tumors should be considered in the differential diagnosis of central nervous system masses located in the lower spinal canal. PMID:27296006

  10. [Hyperplasia of adrenal rests in the testicle: a rare cause of male infertility].


    san Miguel Fraile, P; Fernández Fernández, G; Meijide Rico, F; Antón Badiola, I; Ortiz-Rey, J A; Alvarez Alvarez, C; de la Fuente Buceta, A


    We report the case of a 37-year-old man with infertility caused by bilateral testicular masses secondary to congenital adrenal hyperplasia (21-hydroxylase deficiency). Testicular biopsy was done and its was initially interpreted as Leydig cell tumor but after clinical information was histologically reclassified as tumor of the adrenogenital syndrome. The differential diagnosis with Leydig cell tumor is discussed and it must be established through the clinical, biochemical, radiological and pathological features.

  11. Giant adrenal pseudocyst harbouring adrenocortical cancer

    PubMed Central

    Wilkinson, Michael; Fanning, Deirdre Mary; Moloney, James; Flood, Hugh


    The authors report a very rare case of adreno-cortical carcinoma arising in a giant adrenal pseudocyst. A 64-year-old woman presented to the emergency department with a 6 week history of progressively worsening severe left abdominal pain, anorexia, anergia and constipation. On examination, she was cachectic with tenderness over the left abdomen and flank. Medical history was significant for gastritis and anaemia. During her investigation, a well-defined para-renal 12×6 centimetre multi-loculated cyst, of uncertain origin was identified on CT. Ultrasound-guided biopsy was not diagnostic. MRI showed the cyst to be likely adrenal in origin. Serum and urinary catecholamines were unremarkable. At laparotomy an unresectable large, tense, fixed, cystic mass was seen to occupy the left side of the abdomen. The cyst was de-roofed. Pathology showed a high-grade poorly differentiated adreno-cortical carcinoma with a pseudo-capsule. She died 2 months postoperatively. PMID:22679267

  12. Allgrove Syndrome: Adrenal Insufficiency with Hypertensive Encephalopathy.


    Aftab, Sommayya; Manzoor, Jaida; Talat, Nabila; Khan, Hafiz Sajid; Subhanie, Maroof; Khalid, Nauman Abbas


    Allgrove syndrome or triple-Asyndrome is a rare familial multisystem autosomal recessive disorder. It is characterised by triad of alacrima, achalasia and adrenal insufficiency due to adrenocorticotropin hormone (ACTH) resistance. If it is associated with autonomic dysfunction, it is termed as 4-Asyndrome. This syndrome is caused by a mutation in the Achalasia - Addisonism - Alacrima (AAAS) gene on chromosome 12q13 encoding the nuclear pore protein ALADIN. A5-year boy presented with history of fits and altered sensorium for one day. He also had increased pigmentation of body and persistent vomiting since six months of age. Laboratory investigations and imaging revealed alacrimia, achalasia and adrenal insufficiency due to ACTH resistance. He had episodes of hypertensive crises, for which he was thoroughly investigated and it was found to be due to autonomic instability. Based on clinical findings and investigations he was diagnosed as case of Allgrove syndrome or 4-Asyndrome with autonomic dysfunction. PMID:27671188

  13. Bilateral adrenal gland haemorrhage: an unusual cause

    PubMed Central

    Shenoy, Vasant; Malabu, Usman; Cameron, Donald; Sangla, Kunwarjit


    Summary Our patient had drainage of a large amoebic liver abscess. This got complicated by a severe degree of hypotension, which required aggressive fluid resuscitation and hydrocortisone support. Computerised tomography (CT) of the abdomen revealed bilateral adrenal gland haemorrhage (BAH) resulting in primary adrenal gland failure, which was the cause for hypotension. Patient was on long-term warfarin for provoked deep vein thrombosis of lower limb, which was discontinued before the procedure. Thrombophilia profile indicated the presence of lupus anticoagulant factor with prolonged activated partial thromboplastin time (aPTT). Patient was discharged on lifelong warfarin. This case emphasises the need for strong clinical suspicion for diagnosing BAH, rare but life-threatening condition, and its association with amoebic liver abscess and anti-phospholipid antibody syndrome (APLS). Learning points Recognition of BAH as a rare complication of sepsis.APLS can rarely cause BAH. PMID:25276353

  14. Cushing syndrome associated with an adrenal tumour

    PubMed Central

    Vieira, Helena; Brain, Caroline


    Cushing syndrome (CS) in children is a rare disorder that is most frequently caused by an adrenal tumour or a pituitary corticotrophin-secreting adenoma. The management is challenging and requires an individualised approach and multidisciplinary care. We present the case of a 23-month-old female child with a history of excessive weight gain, growth failure, hirsutism, acne and behavioural difficulties. Investigations revealed elevated serum midnight cortisol and 24 h urinary free cortisol. Overnight dexamethasone suppression testing showed no suppression of cortisol levels. Abdominal imaging revealed a right-sided suprarenal mass. She underwent right adrenalectomy and the histology showed an adrenal cortical carcinoma. There was clinical improvement with catch-up growth and weight normalisation. Despite being rare in clinical practice, in a child with weight gain, hirsuitism and growth failure the diagnosis must be considered. The overall prognosis of CS in childhood is good, but challenges remain to ensure normal growth and body composition. PMID:22927284

  15. Adrenal Metastasis from Uterine Papillary Serous Carcinoma

    PubMed Central

    Lubana, Sandeep Singh; Singh, Navdeep; Tuli, Sandeep S.; Seligman, Barbara


    Patient: Female, 60 Final Diagnosis: UPSC with adrenal metastasis Symptoms: Post menopausal bleeding Medication: — Clinical Procedure: Adrenalectomy Specialty: Oncology Objective: Rare disease Background: Uterine papillary serous carcinoma (UPSC) is a highly malignant form of endometrial cancer with a high propensity for metastases and recurrences even when there is minimal or no myometrial invasion. It usually metastasizes to the pelvis, retroperitoneal lymph nodes, upper abdomen, and peritoneum. However, adrenal metastases from UPSC is extremely rare. Here, we present a case of UPSC with adrenal metastasis that occurred 6 years after the initial diagnosis. Case Report: A 60-year-old woman previously diagnosed with uterine papillary serous carcinoma at an outside facility presented in September of 2006 with postmenopausal bleeding. She underwent comprehensive surgical staging with FIGO (International Federation of Gynecology and Obstetrics) stage 2. Post-operatively, the patient was treated with radiation and chemotherapy. The treatment was completed in April of 2007. The patient had no evidence of disease until July 2009 when she was found to have a mass highly suspicious for malignancy. Subsequently, she underwent right upper lobectomy. The morphology of the carcinoma was consistent with UPSC. She refused chemotherapy due to a previous history of chemotherapy-induced neuropathy. The patient was followed up with regular computed tomography (CT) scans. In October 2012 a new right adrenal nodule was seen on CT, which showed intense metabolic uptake on positron emission tomography (PET)/CT scan. The patient underwent right adrenalectomy. Pathology of the surgical specimen was consistent with UPSC. Conclusions: UPSC is an aggressive variant of endometrial cancer associated with high recurrence rate and poor prognoses. Long-term follow-up is needed because there is a possibility of late metastases, as in this case. PMID:27117594

  16. Renal infarction associated with adrenal pheochromocytoma.


    Thewjitcharoen, Yotsapon; Atikankul, Taywin; Sunthornyothin, Sarat


    The coexistence of pheochromocytoma and renal artery stenosis had been reported occasionally from the possible mechanism of catecholoamine-induced vasospasm and extrinsic compression of renal artery in some reported cases. However, renal infarction caused by pheochromocytoma is an uncommon phenomenon. Herein, we report an interesting case of adrenal pheochromocytoma associated with renal artery thrombosis, which should be included in the differential diagnosis of pheochromocytoma patients who present with abdominal pain.

  17. Endoscopic Retroperitoneal Adrenalectomy for Adrenal Metastases

    PubMed Central

    Simutis, Gintaras; Lengvenis, Givi; Beiša, Virgilijus; Strupas, Kęstutis


    Objectives. To evaluate whether retroperitoneal approach for adrenalectomy is a safe and effective treatment for adrenal metastases (AM). Methods. From June 2004 to January 2014, nine consecutive patients with AM were treated with endoscopic retroperitoneal adrenalectomy (ERA). A retrospective study was conducted, and clinical data, tumor characteristics, and oncologic outcomes were acquired and analyzed. Results. Renal cancer was the primary site of malignancy in 44.4% of cases. The mean operative time was 132 ± 10.4 min. There were 5 synchronous and 4 metachronous AM. One patient required conversion to transperitoneal laparoscopic procedure. No mortality or perioperative complications were observed. The median overall survival was 11 months (range: 2–42 months). Survival rates of 50% and 25% were identified at 1 and 3 years, respectively. At the end of the study, 4 patients were alive with a mean observed follow-up of 20 months. No patients presented with local tumor relapse or port-site metastases. Conclusions. This study shows that ERA is a safe and effective procedure for resection of AM and advances the surgical treatment of adrenal disease. The use of the retroperitoneal approach for adrenal tumors less than 6 cm can provide very favorable surgical outcomes. PMID:25276132

  18. [Oncocytic tumors of the adrenal gland].


    Capela, Andreia; Martinho, Aurélia; Paixão Duarte, Fernanda; Garcia, Hermano; Rocha Pires, Francisco; Theias Manso, Rita; Aparício, Samuel; Costa, Ana Maria


    The oncocytic tumors of the adrenal gland are rare. To date there's only 147 cases published. The authors present a case of a 34 year-old man admitted to the hospital with lumbar pain and fever. At medical examination a mass was found in the left upper quadrant of the abdomen. The hormonal measurements of the adrenal gland were normal and the abdominal angio CT showed a left retroperitoneal lesion measuring 145 x 157 x 128 mm with extensive necrotic and hemorrhagic areas. The patient underwent a complete surgical resection of the lesion. The mass weighted 1495g and the histological exam revealed an oncocytic tumor of the adrenal gland with uncertain potential. Most of the oncocytic tumors are non functioning and must be considered in the differential diagnosis of adrenocortical tumors. The biologic behavior and the prognosis of these tumors are variable and still need a better definition. Due to the rarity of these tumors the authors made a revision on the published bibliography.

  19. [A Case of Synchronous Malignant Pheochromocytomas in Bilateral Adrenal Glands].


    Usui, Kimitsugu; Hirasawa, Terukazu; Kobayashi, Masataka; Shioi, Kouichi; Kobayashi, Kazuki; Sakai, Naoki; Noguchi, Sumio; Tsuura, Yukio


    We present a case of synchronous malignant pheochromocytoma in bilateral adrenal glands. A 73- year-old man presented to our hospital with bilateral adrenal masses incidentally found during abdominal ultrasonography examination for an unrelated issue. The patient had a 30-year history of hypertension and paroxysmal atrial fibrillation. Computed tomography and magnetic resonance imaging showed heterogeneous tumors in bilateral adrenal glands and an enlarged para-aortic lymph node. Hormonal examinations revealed a high value of urinary catecholamines. Metaiodobenzylguanidine (MIBG) scintigraphy showed increased uptake in bilateral adrenal glands and the lymph node. Both adrenal tumors and the node were surgically removed. Pathological examination revealed histologically distinct tissue between the two adrenal tumors. The patient received five cycles of adjuvant chemotherapy, consisting of cyclophosphamide, vincristine, and dacarbazine. The patient has been in remission for 32 months following surgical treatment. PMID:27452493

  20. [A Case of Synchronous Malignant Pheochromocytomas in Bilateral Adrenal Glands].


    Usui, Kimitsugu; Hirasawa, Terukazu; Kobayashi, Masataka; Shioi, Kouichi; Kobayashi, Kazuki; Sakai, Naoki; Noguchi, Sumio; Tsuura, Yukio


    We present a case of synchronous malignant pheochromocytoma in bilateral adrenal glands. A 73- year-old man presented to our hospital with bilateral adrenal masses incidentally found during abdominal ultrasonography examination for an unrelated issue. The patient had a 30-year history of hypertension and paroxysmal atrial fibrillation. Computed tomography and magnetic resonance imaging showed heterogeneous tumors in bilateral adrenal glands and an enlarged para-aortic lymph node. Hormonal examinations revealed a high value of urinary catecholamines. Metaiodobenzylguanidine (MIBG) scintigraphy showed increased uptake in bilateral adrenal glands and the lymph node. Both adrenal tumors and the node were surgically removed. Pathological examination revealed histologically distinct tissue between the two adrenal tumors. The patient received five cycles of adjuvant chemotherapy, consisting of cyclophosphamide, vincristine, and dacarbazine. The patient has been in remission for 32 months following surgical treatment.