Science.gov

Sample records for adult detection efficiency

  1. Efficient single muscle fiber isolation from alcohol-fixed adult muscle following β-galactosidase staining for satellite cell detection.

    PubMed

    Verma, Mayank; Asakura, Atsushi

    2011-01-01

    Staining for β-galactosidase activity for whole tissues, sections, and cells is a common method to detect expression of β-galactosidase reporter transgene as well as senescence-dependent β-galactosidase activity. Choice of fixatives is a critical step for detection of β-galactosidase activity, subsequent immunostaining, and enzymatic digestion of tissue to dissociate cells. In this report, the authors examined several aldehyde and alcohol fixatives in mouse skeletal muscle tissues for their efficiency at improving detection of β-galactosidase activity as well as detection by immunostaining. In addition, fixatives were also analyzed for their efficiency for collagenase digestion to isolate single muscle fibers on postfixed β-galactosidase-stained whole skeletal muscle tissues. The results show that fixing cells with isopropanol yields the greatest reliability and intensity in both β-galactosidase staining as well as double staining for β-galactosidase activity and antibodies. In addition, isopropanol and ethanol, but not glutaraldehyde or paraformaldehyde, allow for the isolation of single muscle fibers from the diaphragm and tibialis anterior muscles following postfixed β-galactosidase staining. Using this method, it is possible to identify the amount of cells that occupy the satellite cell compartment in single muscle fibers prepared from any muscle tissues, including tibialis anterior muscle and diaphragm.

  2. Efficient human face detection in infancy.

    PubMed

    Jakobsen, Krisztina V; Umstead, Lindsey; Simpson, Elizabeth A

    2016-01-01

    Adults detect conspecific faces more efficiently than heterospecific faces; however, the development of this own-species bias (OSB) remains unexplored. We tested whether 6- and 11-month-olds exhibit OSB in their attention to human and animal faces in complex visual displays with high perceptual load (25 images competing for attention). Infants (n = 48) and adults (n = 43) passively viewed arrays containing a face among 24 non-face distractors while we measured their gaze with remote eye tracking. While OSB is typically not observed until about 9 months, we found that, already by 6 months, human faces were more likely to be detected, were detected more quickly (attention capture), and received longer looks (attention holding) than animal faces. These data suggest that 6-month-olds already exhibit OSB in face detection efficiency, consistent with perceptual attunement. This specialization may reflect the biological importance of detecting conspecific faces, a foundational ability for early social interactions.

  3. Detecting lies in children and adults.

    PubMed

    Edelstein, Robin S; Luten, Tanya L; Ekman, Paul; Goodman, Gail S

    2006-02-01

    In this study, observers' abilities to detect lies in children and adults were examined. Adult participants observed videotaped interviews of both children and adults either lying or telling the truth about having been touched by a male research assistant. As hypothesized, observers detected children's lies more accurately than adults' lies; however, adults' truthful statements were detected more accurately than were children's. Further analyses revealed that observers were biased toward judging adults' but not children's statements as truthful. Finally, consistent with the notion that there are stable individual differences in the ability to detect lies, observers who were highly accurate in detecting children's lies were similarly accurate in detecting adults' lies. Implications of these findings for understanding lie-detection accuracy are discussed, as are potential applications to the forensic context.

  4. Energy Efficiency Adult Tracking Report - Final

    SciTech Connect

    Gibson-Grant, Amy

    2014-09-30

    Postwave tracking study for the Energy Efficiency Adult Campaign This study serves as measure of key metrics among the campaign’s target audience, homeowners age 25+. Key measures include: Awareness of messages relating to the broad issue; Recognition of the PSAs; Relevant attitudes, including interest, ease of taking energy efficient steps, and likelihood to act; Relevant knowledge, including knowledge of light bulb alternatives and energy efficient options; and Relevant behaviors, including specific energy-saving behaviors mentioned within the PSAs. Wave 1: May 27 – June 7, 2011 Wave 2: May 29 – June 8, 2012 Wave 3: May 29 – June 19, 2014 General market sample of adults 25+ who own their homes W1 sample: n = 704; W2: n=701; W3: n=806 Online Survey Panel Methodology Study was fielded by Lightspeed Research among their survey panel. Sample is US Census representative of US homeowners by race/ethnicity, income, age, region, and family status. At least 30% of respondents were required to have not updated major appliances in their home in the past 5 years (dishwasher, stove, refrigerator, washer, or dryer).

  5. An Efficient Method for Transferring Adult Mosquitoes during Field Tests,

    DTIC Science & Technology

    CULICIDAE, *COLLECTING METHODS, REPRINTS, BLOOD SUCKING INSECTS, FIELD TESTS, HAND HELD, EFFICIENCY, LABORATORY EQUIPMENT, MORTALITY RATES , ADULTS, AEDES, ASPIRATORS, CULICIDAE, TEST AND EVALUATION, REPRINTS

  6. Violation of local realism versus detection efficiency

    SciTech Connect

    Massar, Serge; Pironio, Stefano

    2003-12-01

    We put bounds on the minimum detection efficiency necessary to violate local realism in Bell experiments. These bounds depend on simple parameters like the number of measurement settings or the dimensionality of the entangled quantum state. We derive them by constructing explicit local hidden variable models which reproduce the quantum correlations for sufficiently small detectors efficiency.

  7. Entanglement verification with detection efficiency mismatch

    NASA Astrophysics Data System (ADS)

    Zhang, Yanbao; Lütkenhaus, Norbert

    Entanglement is a necessary condition for secure quantum key distribution (QKD). When there is an efficiency mismatch between various detectors used in the QKD system, it is still an open problem how to verify entanglement. Here we present a method to address this problem, given that the detection efficiency mismatch is characterized and known. The method works without assuming an upper bound on the number of photons going to each threshold detector. Our results suggest that the efficiency mismatch affects the ability to verify entanglement: the larger the efficiency mismatch is, the smaller the set of entangled states that can be verified becomes. When there is no mismatch, our method can verify entanglement even if the method based on squashing maps [PRL 101, 093601 (2008)] fails.

  8. Incidentally Detected Situs Ambiguous in Adults

    PubMed Central

    Kim, Jae-Gyung; Kim, Gee-Hee; Park, Mi-Hee; Hur, Joon; Yu, Jin-Sok; Jung, Soo-Yeon; An, Soe-Hee

    2011-01-01

    Situs ambiguous is rare congenital anomaly in adults. In 2 adult patients who admitted for different cardiac problems, situs ambiguous with polysplenia was detected. A 42-year-old male admitted for radio frequent catheter ablation of atrial fibrillation, and he had left-sided inferior vena cava (IVC), hepatic segment of IVC interruption with hemiazygos continuation, multiple spleens and intestinal malrotation. And in a 52-year-old female case who was hospitalized due to infective endocarditis after implanting pacemaker for sick sinus syndrome, multiple spleens, left-sided stomach, bilateral liver with midline gallbladder, and left-sided IVC were found. Those findings were consistent with situs ambiguous with polysplenia, but their features were distinctive. PMID:22259667

  9. An efficient parallel termination detection algorithm

    SciTech Connect

    Baker, A. H.; Crivelli, S.; Jessup, E. R.

    2004-05-27

    Information local to any one processor is insufficient to monitor the overall progress of most distributed computations. Typically, a second distributed computation for detecting termination of the main computation is necessary. In order to be a useful computational tool, the termination detection routine must operate concurrently with the main computation, adding minimal overhead, and it must promptly and correctly detect termination when it occurs. In this paper, we present a new algorithm for detecting the termination of a parallel computation on distributed-memory MIMD computers that satisfies all of those criteria. A variety of termination detection algorithms have been devised. Of these, the algorithm presented by Sinha, Kale, and Ramkumar (henceforth, the SKR algorithm) is unique in its ability to adapt to the load conditions of the system on which it runs, thereby minimizing the impact of termination detection on performance. Because their algorithm also detects termination quickly, we consider it to be the most efficient practical algorithm presently available. The termination detection algorithm presented here was developed for use in the PMESC programming library for distributed-memory MIMD computers. Like the SKR algorithm, our algorithm adapts to system loads and imposes little overhead. Also like the SKR algorithm, ours is tree-based, and it does not depend on any assumptions about the physical interconnection topology of the processors or the specifics of the distributed computation. In addition, our algorithm is easier to implement and requires only half as many tree traverses as does the SKR algorithm. This paper is organized as follows. In section 2, we define our computational model. In section 3, we review the SKR algorithm. We introduce our new algorithm in section 4, and prove its correctness in section 5. We discuss its efficiency and present experimental results in section 6.

  10. Earthquake detection through computationally efficient similarity search.

    PubMed

    Yoon, Clara E; O'Reilly, Ossian; Bergen, Karianne J; Beroza, Gregory C

    2015-12-01

    Seismology is experiencing rapid growth in the quantity of data, which has outpaced the development of processing algorithms. Earthquake detection-identification of seismic events in continuous data-is a fundamental operation for observational seismology. We developed an efficient method to detect earthquakes using waveform similarity that overcomes the disadvantages of existing detection methods. Our method, called Fingerprint And Similarity Thresholding (FAST), can analyze a week of continuous seismic waveform data in less than 2 hours, or 140 times faster than autocorrelation. FAST adapts a data mining algorithm, originally designed to identify similar audio clips within large databases; it first creates compact "fingerprints" of waveforms by extracting key discriminative features, then groups similar fingerprints together within a database to facilitate fast, scalable search for similar fingerprint pairs, and finally generates a list of earthquake detections. FAST detected most (21 of 24) cataloged earthquakes and 68 uncataloged earthquakes in 1 week of continuous data from a station located near the Calaveras Fault in central California, achieving detection performance comparable to that of autocorrelation, with some additional false detections. FAST is expected to realize its full potential when applied to extremely long duration data sets over a distributed network of seismic stations. The widespread application of FAST has the potential to aid in the discovery of unexpected seismic signals, improve seismic monitoring, and promote a greater understanding of a variety of earthquake processes.

  11. Earthquake detection through computationally efficient similarity search

    PubMed Central

    Yoon, Clara E.; O’Reilly, Ossian; Bergen, Karianne J.; Beroza, Gregory C.

    2015-01-01

    Seismology is experiencing rapid growth in the quantity of data, which has outpaced the development of processing algorithms. Earthquake detection—identification of seismic events in continuous data—is a fundamental operation for observational seismology. We developed an efficient method to detect earthquakes using waveform similarity that overcomes the disadvantages of existing detection methods. Our method, called Fingerprint And Similarity Thresholding (FAST), can analyze a week of continuous seismic waveform data in less than 2 hours, or 140 times faster than autocorrelation. FAST adapts a data mining algorithm, originally designed to identify similar audio clips within large databases; it first creates compact “fingerprints” of waveforms by extracting key discriminative features, then groups similar fingerprints together within a database to facilitate fast, scalable search for similar fingerprint pairs, and finally generates a list of earthquake detections. FAST detected most (21 of 24) cataloged earthquakes and 68 uncataloged earthquakes in 1 week of continuous data from a station located near the Calaveras Fault in central California, achieving detection performance comparable to that of autocorrelation, with some additional false detections. FAST is expected to realize its full potential when applied to extremely long duration data sets over a distributed network of seismic stations. The widespread application of FAST has the potential to aid in the discovery of unexpected seismic signals, improve seismic monitoring, and promote a greater understanding of a variety of earthquake processes. PMID:26665176

  12. Highly efficient transduction of primary adult CNS and PNS neurons

    PubMed Central

    Levin, Evgeny; Diekmann, Heike; Fischer, Dietmar

    2016-01-01

    Delivery and expression of recombinant genes, a key methodology for many applications in biological research, remains a challenge especially for mature neurons. Here, we report easy, highly efficient and well tolerated transduction of adult peripheral and central neuronal populations of diverse species in culture using VSV-G pseudo-typed, recombinant baculovirus (BacMam). Transduction rates of up to 80% were reliably achieved at high multiplicity of infection without apparent neuro-cytopathic effects. Neurons could be transduced either shortly after plating or after several days in culture. Co-incubation with two different baculoviruses attained near complete co-localization of fluorescent protein expression, indicating multigene delivery. Finally, evidence for functional protein expression is provided by means of cre-mediated genetic recombination and neurite outgrowth assays. Recombinant protein was already detected within hours after transduction, thereby enabling functional readouts even in relatively short-lived neuronal cultures. Altogether, these results substantiate the usefulness of baculovirus-mediated transduction of mature neurons for future research in neuroscience. PMID:27958330

  13. Detection of Adult Green Sturgeon Using Environmental DNA Analysis.

    PubMed

    Bergman, Paul S; Schumer, Gregg; Blankenship, Scott; Campbell, Elizabeth

    2016-01-01

    Environmental DNA (eDNA) is an emerging sampling method that has been used successfully for detection of rare aquatic species. The Identification of sampling tools that are less stressful for target organisms has become increasingly important for rare and endangered species. A decline in abundance of the Southern Distinct Population Segment (DPS) of North American Green Sturgeon located in California's Central Valley has led to its listing as Threatened under the Federal Endangered Species Act in 2006. While visual surveys of spawning Green Sturgeon in the Central Valley are effective at monitoring fish densities in concentrated pool habitats, results do not scale well to the watershed level, providing limited spatial and temporal context. Unlike most traditional survey methods, environmental DNA analysis provides a relatively quick, inexpensive tool that could efficiently monitor the presence and distribution of aquatic species. We positively identified Green Sturgeon DNA at two locations of known presence in the Sacramento River, proving that eDNA can be effective for monitoring the presence of adult sturgeon. While further study is needed to understand uncertainties of the sampling method, our study represents the first documented detection of Green Sturgeon eDNA, indicating that eDNA analysis could provide a new tool for monitoring Green Sturgeon distribution in the Central Valley, complimenting traditional on-going survey methods.

  14. Detection of Adult Green Sturgeon Using Environmental DNA Analysis

    PubMed Central

    Bergman, Paul S.; Schumer, Gregg; Blankenship, Scott; Campbell, Elizabeth

    2016-01-01

    Environmental DNA (eDNA) is an emerging sampling method that has been used successfully for detection of rare aquatic species. The Identification of sampling tools that are less stressful for target organisms has become increasingly important for rare and endangered species. A decline in abundance of the Southern Distinct Population Segment (DPS) of North American Green Sturgeon located in California’s Central Valley has led to its listing as Threatened under the Federal Endangered Species Act in 2006. While visual surveys of spawning Green Sturgeon in the Central Valley are effective at monitoring fish densities in concentrated pool habitats, results do not scale well to the watershed level, providing limited spatial and temporal context. Unlike most traditional survey methods, environmental DNA analysis provides a relatively quick, inexpensive tool that could efficiently monitor the presence and distribution of aquatic species. We positively identified Green Sturgeon DNA at two locations of known presence in the Sacramento River, proving that eDNA can be effective for monitoring the presence of adult sturgeon. While further study is needed to understand uncertainties of the sampling method, our study represents the first documented detection of Green Sturgeon eDNA, indicating that eDNA analysis could provide a new tool for monitoring Green Sturgeon distribution in the Central Valley, complimenting traditional on-going survey methods. PMID:27096433

  15. Hypertension Detection and Results Among Young Adults

    ERIC Educational Resources Information Center

    Garner, Walton R.; Gerald, Michael C.

    1977-01-01

    A comprehensive hypertension education and detection program, in which 2,852 students were tested and, if necessary, referred to area physicians, illustrates the unique position a university setting offers for work in this area. (MB)

  16. High-Collection-Efficiency Fluorescence Detection Cell

    NASA Technical Reports Server (NTRS)

    Hanisco, Thomas; Cazorla, Maria; Swanson, Andrew

    2013-01-01

    A new fluorescence cell has been developed for the laser induced fluorescence (LIF) detection of formaldehyde. The cell is used to sample a flow of air that contains trace concentrations of formaldehyde. The cell provides a hermetically sealed volume in which a flow of air containing formaldehyde can be illuminated by a laser. The cell includes the optics for transmitting the laser beam that is used to excite the formaldehyde and for collecting the resulting fluorescence. The novelty of the cell is its small size and simple design that provides a more robust and cheaper alternative to the state of the art. Despite its simplicity, the cell provides the same sensitivity to detection as larger, more complicated cells.

  17. Carbon dioxide detection in adult Odonata.

    PubMed

    Piersanti, Silvana; Frati, Francesca; Rebora, Manuela; Salerno, Gianandrea

    2016-04-01

    The present paper shows, by means of single-cell recordings, responses of antennal sensory neurons of the damselfly Ischnura elegans when stimulated by air streams at different CO2 concentrations. Unlike most insects, but similarly to termites, centipedes and ticks, Odonata possess sensory neurons strongly inhibited by CO2, with the magnitude of the off-response depending upon the CO2 concentration. The Odonata antennal sensory neurons responding to CO2 are also sensitive to airborne odors; in particular, the impulse frequency is increased by isoamylamine and decreased by heptanoic and pentanoic acid. Further behavioral investigations are necessary to assign a biological role to carbon dioxide detection in Odonata.

  18. Efficiency of caries risk assessment in young adults using Cariogram

    PubMed Central

    Celik, Esra Uzer; Gokay, Necmi; Ates, Mustafa

    2012-01-01

    Objective The aims of this study were to: (1) evaluate the caries risk in young adults using Cariogram and (2) compare the efficiency of Cariogram with the regression risk models created using the same variables in Cariogram by examining the actual caries progression over a 2-year period. Methods: This study included 100 subjects that were either twenty or twenty-one years-old. Data on general health, diet, oral hygiene and use of fluoride were obtained. Saliva analyses were performed, including mutans streptococci and lactobacilli counts, secretion rate and buffer capacity. DMFT and DMFS values were calculated by clinical examinations and radiographs. The participants were divided into 5 groups according to their Cariogram caries risk scores at baseline. Re-examination for caries was done after 2-years. The data were analyzed using Kruskall Wallis, Mann Whitney-U, and logistic regression analyses. Results: Diet frequency, plaque amount and secretion rate were significantly associated with caries increment (P<.05). Cariogram and the regression risk models explained the caries formation at a higher rate than single-variables. However, the regression risk model developed by diet frequency, plaque amount and secretion rate explained the caries formation similar to Cariogram, while the other regression model developed by all variables used in Cariogram explained the caries formation at a higher rate than this computer program. Conclusions: Cariogram is effective and can be used for caries risk assessment instead of single variables; however, it is possible to develop simplier models with regression analyses to determine caries risk. PMID:22904655

  19. Aerosol detection efficiency in inductively coupled plasma mass spectrometry

    SciTech Connect

    Hubbard, Joshua A.; Zigmond, Joseph A.

    2016-03-02

    We used an electrostatic size classification technique to segregate particles of known composition prior to being injected into an inductively coupled plasma mass spectrometer (ICP-MS). Moreover, we counted size-segregated particles with a condensation nuclei counter as well as sampled with an ICP-MS. By injecting particles of known size, composition, and aerosol concentration into the ICP-MS, efficiencies of the order of magnitude aerosol detection were calculated, and the particle size dependencies for volatile and refractory species were quantified. Similar to laser ablation ICP-MS, aerosol detection efficiency was defined as the rate at which atoms were detected in the ICP-MS normalized by the rate at which atoms were injected in the form of particles. This method adds valuable insight into the development of technologies like laser ablation ICP-MS where aerosol particles (of relatively unknown size and gas concentration) are generated during ablation and then transported into the plasma of an ICP-MS. In this study, we characterized aerosol detection efficiencies of volatile species gold and silver along with refractory species aluminum oxide, cerium oxide, and yttrium oxide. Aerosols were generated with electrical mobility diameters ranging from 100 to 1000 nm. In general, it was observed that refractory species had lower aerosol detection efficiencies than volatile species, and there were strong dependencies on particle size and plasma torch residence time. Volatile species showed a distinct transition point at which aerosol detection efficiency began decreasing with increasing particle size. This critical diameter indicated the largest particle size for which complete particle detection should be expected and agreed with theories published in other works. Aerosol detection efficiencies also displayed power law dependencies on particle size. Aerosol detection efficiencies ranged from 10-5 to 10-11. Free molecular heat and mass transfer

  20. Aerosol detection efficiency in inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Hubbard, Joshua A.; Zigmond, Joseph A.

    2016-05-01

    An electrostatic size classification technique was used to segregate particles of known composition prior to being injected into an inductively coupled plasma mass spectrometer (ICP-MS). Size-segregated particles were counted with a condensation nuclei counter as well as sampled with an ICP-MS. By injecting particles of known size, composition, and aerosol concentration into the ICP-MS, efficiencies of the order of magnitude aerosol detection were calculated, and the particle size dependencies for volatile and refractory species were quantified. Similar to laser ablation ICP-MS, aerosol detection efficiency was defined as the rate at which atoms were detected in the ICP-MS normalized by the rate at which atoms were injected in the form of particles. This method adds valuable insight into the development of technologies like laser ablation ICP-MS where aerosol particles (of relatively unknown size and gas concentration) are generated during ablation and then transported into the plasma of an ICP-MS. In this study, we characterized aerosol detection efficiencies of volatile species gold and silver along with refractory species aluminum oxide, cerium oxide, and yttrium oxide. Aerosols were generated with electrical mobility diameters ranging from 100 to 1000 nm. In general, it was observed that refractory species had lower aerosol detection efficiencies than volatile species, and there were strong dependencies on particle size and plasma torch residence time. Volatile species showed a distinct transition point at which aerosol detection efficiency began decreasing with increasing particle size. This critical diameter indicated the largest particle size for which complete particle detection should be expected and agreed with theories published in other works. Aerosol detection efficiencies also displayed power law dependencies on particle size. Aerosol detection efficiencies ranged from 10- 5 to 10- 11. Free molecular heat and mass transfer theory was applied, but

  1. Aerosol detection efficiency in inductively coupled plasma mass spectrometry

    DOE PAGES

    Hubbard, Joshua A.; Zigmond, Joseph A.

    2016-03-02

    We used an electrostatic size classification technique to segregate particles of known composition prior to being injected into an inductively coupled plasma mass spectrometer (ICP-MS). Moreover, we counted size-segregated particles with a condensation nuclei counter as well as sampled with an ICP-MS. By injecting particles of known size, composition, and aerosol concentration into the ICP-MS, efficiencies of the order of magnitude aerosol detection were calculated, and the particle size dependencies for volatile and refractory species were quantified. Similar to laser ablation ICP-MS, aerosol detection efficiency was defined as the rate at which atoms were detected in the ICP-MS normalized bymore » the rate at which atoms were injected in the form of particles. This method adds valuable insight into the development of technologies like laser ablation ICP-MS where aerosol particles (of relatively unknown size and gas concentration) are generated during ablation and then transported into the plasma of an ICP-MS. In this study, we characterized aerosol detection efficiencies of volatile species gold and silver along with refractory species aluminum oxide, cerium oxide, and yttrium oxide. Aerosols were generated with electrical mobility diameters ranging from 100 to 1000 nm. In general, it was observed that refractory species had lower aerosol detection efficiencies than volatile species, and there were strong dependencies on particle size and plasma torch residence time. Volatile species showed a distinct transition point at which aerosol detection efficiency began decreasing with increasing particle size. This critical diameter indicated the largest particle size for which complete particle detection should be expected and agreed with theories published in other works. Aerosol detection efficiencies also displayed power law dependencies on particle size. Aerosol detection efficiencies ranged from 10-5 to 10-11. Free molecular heat and mass transfer theory was

  2. Detecting delirium in older adults living at home.

    PubMed

    Malenfant, Priscilla; Voyer, Philippe

    2012-01-01

    The aim of this study was to determine whether in-home care nurses had the necessary knowledge to detect delirium in older adults. To this end, 87 home care nurses from 2 sites in the greater Quebec City region in Canada answered a questionnaire. The results showed nurses had limited level of knowledge about the diagnostic criteria for delirium, the main signs and symptoms of delirium, and the tools for its detection. Moreover, 54.4% of the in-home care nurses were able to recognize delirium, from structured clinical vignettes.

  3. Heterodyne efficiency of a detection system for partially coherent beams.

    PubMed

    Salem, Mohamed; Rolland, Jannick P

    2010-05-01

    We consider the heterodyne efficiency as a measure of quality for a coherent detection system. The heterodyne efficiency reflects the matching between the received beam and the local oscillator beam on the detector surface, and one can use this property for the alignment of the system. In this paper we derive a general expression for the heterodyne efficiency of a detection system for beams at any state of coherence, assuming that the propagation directions for the two signals (the received signal and the locally generated one) are slightly different. We derive an analytical expression for the heterodyne efficiency when mixing coherently two partially coherent Gaussian Schell-model beams on a photodetector surface. Numerical examples are given for the variation in the heterodyne efficiency with the misalignment angle, the detector radius, and the parameters of the overlapping beams. We show that partially coherent beams, although they suffer more than coherent beams from a decrease in the heterodyne efficiency, are less affected than coherent beams by the misalignment of the detection system.

  4. A novel technique for detection efficiency determination of HPGe

    NASA Astrophysics Data System (ADS)

    Tayyebi, Pouneh; Abbasi Davani, Fereydoun; Tabasi, Mohsen; Afarideh, Hossein

    2017-04-01

    In this work, we present an experimental method to determine the detection efficiency of HPGe when the reference source according to the geometry of interest is not accessible. We use known activity point sources (PS) of 152Eu, 137Cs, 241Am and 133Ba to find the detection efficiency for disc source (DS) geometry. It can be assumed that a DS consists of several PS's. Mapping the detector surface by means of 137Cs PS shows that there is radial symmetry for detection efficiency vs. energy. Each radial distance on the detector surface contains some points, which can be considered as a PS. By selecting two points in two different radii and central point, the DS efficiency is obtained. To ensure that the method is correct, we measure the activity of a known activity DS considering DS efficiency obtained by PS's. The DS comprises 137Cs, 133Ba and 60Co. The relative difference between the measured and the reported activity of DS in most energies is less than 5%.

  5. Efficient method for events detection in phonocardiographic signals

    NASA Astrophysics Data System (ADS)

    Martinez-Alajarin, Juan; Ruiz-Merino, Ramon

    2005-06-01

    The auscultation of the heart is still the first basic analysis tool used to evaluate the functional state of the heart, as well as the first indicator used to submit the patient to a cardiologist. In order to improve the diagnosis capabilities of auscultation, signal processing algorithms are currently being developed to assist the physician at primary care centers for adult and pediatric population. A basic task for the diagnosis from the phonocardiogram is to detect the events (main and additional sounds, murmurs and clicks) present in the cardiac cycle. This is usually made by applying a threshold and detecting the events that are bigger than the threshold. However, this method usually does not allow the detection of the main sounds when additional sounds and murmurs exist, or it may join several events into a unique one. In this paper we present a reliable method to detect the events present in the phonocardiogram, even in the presence of heart murmurs or additional sounds. The method detects relative maxima peaks in the amplitude envelope of the phonocardiogram, and computes a set of parameters associated with each event. Finally, a set of characteristics is extracted from each event to aid in the identification of the events. Besides, the morphology of the murmurs is also detected, which aids in the differentiation of different diseases that can occur in the same temporal localization. The algorithms have been applied to real normal heart sounds and murmurs, achieving satisfactory results.

  6. Determination of a Limited Scope Network's Lightning Detection Efficiency

    NASA Technical Reports Server (NTRS)

    Rompala, John T.; Blakeslee, R.

    2008-01-01

    This paper outlines a modeling technique to map lightning detection efficiency variations over a region surveyed by a sparse array of ground based detectors. A reliable flash peak current distribution (PCD) for the region serves as the technique's base. This distribution is recast as an event probability distribution function. The technique then uses the PCD together with information regarding: site signal detection thresholds, type of solution algorithm used, and range attenuation; to formulate the probability that a flash at a specified location will yield a solution. Applying this technique to the full region produces detection efficiency contour maps specific to the parameters employed. These contours facilitate a comparative analysis of each parameter's effect on the network's detection efficiency. In an alternate application, this modeling technique gives an estimate of the number, strength, and distribution of events going undetected. This approach leads to a variety of event density contour maps. This application is also illustrated. The technique's base PCD can be empirical or analytical. A process for formulating an empirical PCD specific to the region and network being studied is presented. A new method for producing an analytical representation of the empirical PCD is also introduced.

  7. Efficient method of image edge detection based on FSVM

    NASA Astrophysics Data System (ADS)

    Cai, Aiping; Xiong, Xiaomei

    2013-07-01

    For efficient object cover edge detection in digital images, this paper studied traditional methods and algorithm based on SVM. It analyzed Canny edge detection algorithm existed some pseudo-edge and poor anti-noise capability. In order to provide a reliable edge extraction method, propose a new detection algorithm based on FSVM. Which contains several steps: first, trains classify sample and gives the different membership function to different samples. Then, a new training sample is formed by increase the punishment some wrong sub-sample, and use the new FSVM classification model for train and test them. Finally the edges are extracted of the object image by using the model. Experimental result shows that good edge detection image will be obtained and adding noise experiments results show that this method has good anti-noise.

  8. Efficient stepwise detection of communities in temporal networks

    NASA Astrophysics Data System (ADS)

    He, Jialin; Chen, Duanbing; Sun, Chongjing; Fu, Yan; Li, Wenjun

    2017-03-01

    In temporal networks, dynamic community detection is composed of two separate stages: (i) community detection at each time step; (ii) community matching across time steps. In the traditional methods, the community matching across time steps is based on nodes, which is time consuming. In this paper, we suggest a simple method which takes advantage of historic community information to detect dynamic communities. After dividing each community at previous time step into a few modules, we cannot only use these modules to detect communities at current time step but also map communities across time steps. Results on synthetic and real networks demonstrate that our method cannot only maintain the quality of communities but also improve the efficiency of community matching significantly.

  9. Fall detection algorithm in energy efficient multistate sensor system.

    PubMed

    Korats, Gundars; Hofmanis, Janis; Skorodumovs, Aleksejs; Avots, Egils

    2015-01-01

    Health issues for elderly people may lead to different injuries obtained during simple activities of daily living (ADL). Potentially the most dangerous are unintentional falls that may be critical or even lethal to some patients due to the heavy injury risk. Many fall detection systems are proposed but only recently such health care systems became available. Nevertheless sensor design, accuracy as well as energy consumption efficiency can be improved. In this paper we present a single 3-axial accelerometer energy-efficient sensor system. Power saving is achieved by selective event processing triggered by fall detection procedure. The results in our simulations show 100% accuracy when the threshold parameters are chosen correctly. Estimated energy consumption seems to extend battery life significantly.

  10. High resolution PET breast imager with improved detection efficiency

    DOEpatents

    Majewski, Stanislaw

    2010-06-08

    A highly efficient PET breast imager for detecting lesions in the entire breast including those located close to the patient's chest wall. The breast imager includes a ring of imaging modules surrounding the imaged breast. Each imaging module includes a slant imaging light guide inserted between a gamma radiation sensor and a photodetector. The slant light guide permits the gamma radiation sensors to be placed in close proximity to the skin of the chest wall thereby extending the sensitive region of the imager to the base of the breast. Several types of photodetectors are proposed for use in the detector modules, with compact silicon photomultipliers as the preferred choice, due to its high compactness. The geometry of the detector heads and the arrangement of the detector ring significantly reduce dead regions thereby improving detection efficiency for lesions located close to the chest wall.

  11. Parallel Flux Tensor Analysis for Efficient Moving Object Detection

    DTIC Science & Technology

    2011-07-01

    convolution, power efficient 1. INTRODUCTION Realtime persistent moving object detection and target track- ing for surveillance and situational awareness ...synchronization for programming the Cell/B.E. some tools for mapping serial code in a semi-automatic fashion are in development [22]. We first give a brief...version for HD video using a single PS-3 Cell/B.E. processor and is faster than realtime for a range of filter con- figurations and video frame sizes. We

  12. Robust and efficient anomaly detection using heterogeneous representations

    NASA Astrophysics Data System (ADS)

    Hu, Xing; Hu, Shiqiang; Xie, Jinhua; Zheng, Shiyou

    2015-05-01

    Various approaches have been proposed for video anomaly detection. Yet these approaches typically suffer from one or more limitations: they often characterize the pattern using its internal information, but ignore its external relationship which is important for local anomaly detection. Moreover, the high-dimensionality and the lack of robustness of pattern representation may lead to problems, including overfitting, increased computational cost and memory requirements, and high false alarm rate. We propose a video anomaly detection framework which relies on a heterogeneous representation to account for both the pattern's internal information and external relationship. The internal information is characterized by slow features learned by slow feature analysis from low-level representations, and the external relationship is characterized by the spatial contextual distances. The heterogeneous representation is compact, robust, efficient, and discriminative for anomaly detection. Moreover, both the pattern's internal information and external relationship can be taken into account in the proposed framework. Extensive experiments demonstrate the robustness and efficiency of our approach by comparison with the state-of-the-art approaches on the widely used benchmark datasets.

  13. A Robust and Efficient Approach to License Plate Detection.

    PubMed

    Yuan, Yule; Zou, Wenbin; Zhao, Yong; Wang, Xinan; Hu, Xuefeng; Komodakis, Nikos

    2017-03-01

    This paper presents a robust and efficient method for license plate detection with the purpose of accurately localizing vehicle license plates from complex scenes in real time. A simple yet effective image downscaling method is first proposed to substantially accelerate license plate localization without sacrificing detection performance compared with that achieved using the original image. Furthermore, a novel line density filter approach is proposed to extract candidate regions, thereby significantly reducing the area to be analyzed for license plate localization. Moreover, a cascaded license plate classifier based on linear support vector machines using color saliency features is introduced to identify the true license plate from among the candidate regions. For performance evaluation, a data set consisting of 3977 images captured from diverse scenes under different conditions is also presented. Extensive experiments on the widely used Caltech license plate data set and our newly introduced data set demonstrate that the proposed approach substantially outperforms state-of-the-art methods in terms of both detection accuracy and run-time efficiency, increasing the detection ratio from 91.09% to 96.62% while decreasing the run time from 672 to 42 ms for processing an image with a resolution of 1082×728 . The executable code and our collected data set are publicly available.

  14. Efficient color face detection algorithm under different lighting conditions

    NASA Astrophysics Data System (ADS)

    Chow, Tze-Yin; Lam, Kin-Man; Wong, Kwok-Wai

    2006-01-01

    We present an efficient and reliable algorithm to detect human faces in an image under different lighting conditions. In our algorithm, skin-colored pixels are identified using a region-based approach, which can provide more reliable skin color segmentation under various lighting conditions. In addition, to compensate for extreme lighting conditions, a color compensation scheme is proposed, and the distributions of the skin-color components under various illuminations are modeled by means of the maximum-likelihood method. With the skin-color regions detected, a ratio method is proposed to determine the possible positions of the eyes in the image. Two eye candidates form a possible face region, which is then verified as a face or not by means of a two-stage procedure with an eigenmask. Finally, the face boundary region of a face candidate is further verified by a probabilistic approach to reduce the chance of false alarms. Experimental results based on the HHI MPEG-7 face database, the AR face database, and the CMU pose, illumination, and expression (PIE) database show that this face detection algorithm is efficient and reliable under different lighting conditions and facial expressions.

  15. Efficient implementations of hyperspectral chemical-detection algorithms

    NASA Astrophysics Data System (ADS)

    Brett, Cory J. C.; DiPietro, Robert S.; Manolakis, Dimitris G.; Ingle, Vinay K.

    2013-10-01

    Many military and civilian applications depend on the ability to remotely sense chemical clouds using hyperspectral imagers, from detecting small but lethal concentrations of chemical warfare agents to mapping plumes in the aftermath of natural disasters. Real-time operation is critical in these applications but becomes diffcult to achieve as the number of chemicals we search for increases. In this paper, we present efficient CPU and GPU implementations of matched-filter based algorithms so that real-time operation can be maintained with higher chemical-signature counts. The optimized C++ implementations show between 3x and 9x speedup over vectorized MATLAB implementations.

  16. On the Detection of Energetically Efficient Trajectories for Spacecraft

    NASA Technical Reports Server (NTRS)

    Dellnitz, Michael; Junge, Oliver; Lo, Martin; Thiere, Bianca

    2001-01-01

    We propose a new method for the detection of energy-efficient trajectories for spacecraft. Via a so called target-shooting approach a pseudo-orbit between the relevant points in space is constructed in a simple model of the problem. This approximate trajectory is meant to serve as input for a more sophisticated direct method in order to compute a true trajectory in the full model. We demonstrate the applicability of the new method by considering the redesign of part of the trajectory of the NASA/JPL Genesis discovery mission.

  17. Gadolinium loaded plastic scintillators for high efficiency neutron detection

    NASA Astrophysics Data System (ADS)

    Ovechkina, Lena; Riley, Kent; Miller, Stuart; Bell, Zane; Nagarkar, Vivek

    2009-08-01

    Gadolinium has the highest thermal neutron absorption cross section of any naturally occurring element, and emits conversion electrons as well as atomic X-rays in over 50% of its neutron captures, which makes it a useful dopant in scintillators for detecting thermal neutrons. Gadolinium isopropoxide was studied as a possible dopant for styrene-based plastic scintillators as a convenient and inexpensive method to produce high-efficiency thermal neutron detectors. Plastic scintillators with gadolinium weight concentrations of up to 3% were transparent, uniform and defect-free and were characterized with spectral measurements performed under x-ray and neutron irradiation. The new material has the same characteristic emission of styrene with a maximum at approximately 425 nm, and a light output of 76% relative to the undoped plastic. A 13 mm thick sample containing 0.5% gadolinium by weight detected 46% of incident thermal neutrons, which makes this an attractive material for a variety of applications.

  18. Increased SERS detection efficiency for characterizing rare events in flow.

    PubMed

    Jacobs, Kevin T; Schultz, Zachary D

    2015-08-18

    Improved surface-enhanced Raman scattering (SERS) measurements of a flowing aqueous sample are accomplished by combining line focus optics with sheath-flow SERS detection. The straightforward introduction of a cylindrical lens into the optical path of the Raman excitation laser increases the efficiency of SERS detection and the reproducibility of SERS signals at low concentrations. The width of the line focus is matched to the width of the sample capillary from which the analyte elutes under hydrodynamic focusing conditions, allowing for increased collection across the SERS substrate while maintaining the power density below the damage threshold at any specific point. We show that a 4× increase in power spread across the line increases the signal-to-noise ratio by a factor of 2 for a variety of analytes, such as rhodamine 6G, amino acids, and lipid vesicles, without any detectable photodamage. COMSOL simulations and Raman maps elucidate the hydrodynamic focusing properties of the flow cell, providing a clearer picture of the confinement effects at the surface where the sample exits the capillary. The lipid vesicle results suggest that the combination of hydrodynamic focusing and increased optical collection enables the reproducible detection of rare events, in this case individual lipid vesicles.

  19. Efficient eye detection using HOG-PCA descriptor

    NASA Astrophysics Data System (ADS)

    Savakis, Andreas; Sharma, Riti; Kumar, Mrityunjay

    2014-03-01

    Eye detection is becoming increasingly important for mobile interfaces and human computer interaction. In this paper, we present an efficient eye detector based on HOG-PCA features obtained by performing Principal Component Analysis (PCA) on Histogram of Oriented Gradients (HOG). The Histogram of Oriented Gradients is a dense descriptor computed on overlapping blocks along a grid of cells over regions of interest. The HOG-PCA offers an efficient feature for eye detection by applying PCA on the HOG vectors extracted from image patches corresponding to a sliding window. The HOG-PCA descriptor significantly reduces feature dimensionality compared to the dimensionality of the original HOG feature or the eye image region. Additionally, we introduce the HOG-RP descriptor by utilizing Random Projections as an alternative to PCA for reducing the dimensionality of HOG features. We develop robust eye detectors by utilizing HOG-PCA and HOG-RP features of image patches to train a Support Vector Machine (SVM) classifier. Testing is performed on eye images extracted from the FERET and BioID databases.

  20. Efficiently detecting outlying behavior in video-game players

    PubMed Central

    Kim, Young Bin; Kang, Shin Jin; Lee, Sang Hyeok; Jung, Jang Young; Kam, Hyeong Ryeol; Lee, Jung; Kim, Young Sun; Lee, Joonsoo

    2015-01-01

    In this paper, we propose a method for automatically detecting the times during which game players exhibit specific behavior, such as when players commonly show excitement, concentration, immersion, and surprise. The proposed method detects such outlying behavior based on the game players’ characteristics. These characteristics are captured non-invasively in a general game environment. In this paper, cameras were used to analyze observed data such as facial expressions and player movements. Moreover, multimodal data from the game players (i.e., data regarding adjustments to the volume and the use of the keyboard and mouse) was used to analyze high-dimensional game-player data. A support vector machine was used to efficiently detect outlying behaviors. We verified the effectiveness of the proposed method using games from several genres. The recall rate of the outlying behavior pre-identified by industry experts was approximately 70%. The proposed method can also be used for feedback analysis of various interactive content provided in PC environments. PMID:26713250

  1. Development of sampling efficiency and internal noise in motion detection and discrimination in school-aged children.

    PubMed

    Falkenberg, Helle K; Simpson, William A; Dutton, Gordon N

    2014-07-01

    The aim of this study was to use an equivalent noise paradigm to investigate the development and maturation of motion perception, and how the underlying limitations of sampling efficiency and internal noise effect motion detection and direction discrimination in school-aged children (5-14 years) and adults. Contrast energy thresholds of a 2c/deg sinusoidal grating drifting at 1.0 or 6.0 Hz were measured as a function of added dynamic noise in three tasks: detection of a drifting grating; detection of the sum of two oppositely drifting gratings and direction discrimination of oppositely drifting gratings. Compared to the ideal observer, in both children and adults, the performance for all tasks was limited by reduced sampling efficiency and internal noise. However, the thresholds for discrimination of motion direction and detection of moving gratings show very different developmental profiles. Motion direction discrimination continues to improve after the age of 14 years due to an increase in sampling efficiency that differs with speed. Motion detection and summation were already mature at the age of 5 years, and internal noise was the same for all tasks. These findings were confirmed in a 1-year follow-up study on a group of children from the initial study. The results support suggestions that the detection of a moving pattern and discriminating motion direction are processed by different systems that may develop at different rates.

  2. Older adults utilize less efficient postural control when performing pushing task

    PubMed Central

    Lee, Yun-Ju; Chen, Bing; Aruin, Alexander S.

    2015-01-01

    The ability to maintain balance deteriorates with increasing age. The aim was to investigate the role of age in generation of anticipatory (APA) and compensatory (CPA) postural adjustments during pushing an object. Older (68.8 ± 1.0 years) and young adults (30.1 ± 1.4 years) participated in the experiment involving pushing an object (a pendulum attached to the ceiling) using both hands. Electrical activity of six leg and trunk muscles and displacements of the center of pressure (COP) were recorded and analyzed during the APA and CPA phases. The onset time, integrals of muscle activity, and COP displacements were determined. In addition, the indexes of co-activation and reciprocal activation of muscles for the shank, thigh, and trunk segments were calculated. Older adults, compared to young adults, showed less efficient postural control seen as delayed anticipatory muscle onset times and delayed COP displacements. Moreover, older adults used co-activation of muscles during the CPA phase while younger subjects utilized reciprocal activation of muscles. The observed diminished efficiency of postural control during both anticipatory and compensatory postural adjustments observed in older adults might predispose them to falls while performing tasks involving pushing. The outcome provides a background for future studies focused on the optimization of the daily activities of older adults. PMID:26403099

  3. Extreme ultraviolet quantum detection efficiency of rubidium bromide opaque photocathodes

    NASA Technical Reports Server (NTRS)

    Siegmund, Oswald H. W.; Gaines, Geoffrey A.

    1990-01-01

    Measurements are presented of the quantum detection efficiency (QDE) of three samples of RbBr photocathode layers over the 44-150-A wavelength range. The QDE of RbBr-coated microchannel plate (MCP) was measured using a back-to-back Z-stack MCP configuration in a detector with a wedge and strip position-sensitive anode, of the type described by Siegmund et al. (1984). To assess the stability of RbBr layer, the RbBr photocathode was exposed to air at about 30 percent humidity for 20 hr. It was found that the QDE values for the aged cathode were within the QDE measurement errors of the original values. A simple QDE model was developed, and it was found that its predictions are in accord with the QDE measurements.

  4. Hardware Design of the Energy Efficient Fall Detection Device

    NASA Astrophysics Data System (ADS)

    Skorodumovs, A.; Avots, E.; Hofmanis, J.; Korāts, G.

    2016-04-01

    Health issues for elderly people may lead to different injuries obtained during simple activities of daily living. Potentially the most dangerous are unintentional falls that may be critical or even lethal to some patients due to the heavy injury risk. In the project "Wireless Sensor Systems in Telecare Application for Elderly People", we have developed a robust fall detection algorithm for a wearable wireless sensor. To optimise the algorithm for hardware performance and test it in field, we have designed an accelerometer based wireless fall detector. Our main considerations were: a) functionality - so that the algorithm can be applied to the chosen hardware, and b) power efficiency - so that it can run for a very long time. We have picked and tested the parts, built a prototype, optimised the firmware for lowest consumption, tested the performance and measured the consumption parameters. In this paper, we discuss our design choices and present the results of our work.

  5. Improvement of the Error-detection Mechanism in Adults with Dyslexia Following Reading Acceleration Training.

    PubMed

    Horowitz-Kraus, Tzipi

    2016-05-01

    The error-detection mechanism aids in preventing error repetition during a given task. Electroencephalography demonstrates that error detection involves two event-related potential components: error-related and correct-response negativities (ERN and CRN, respectively). Dyslexia is characterized by slow, inaccurate reading. In particular, individuals with dyslexia have a less active error-detection mechanism during reading than typical readers. In the current study, we examined whether a reading training programme could improve the ability to recognize words automatically (lexical representations) in adults with dyslexia, thereby resulting in more efficient error detection during reading. Behavioural and electrophysiological measures were obtained using a lexical decision task before and after participants trained with the reading acceleration programme. ERN amplitudes were smaller in individuals with dyslexia than in typical readers before training but increased following training, as did behavioural reading scores. Differences between the pre-training and post-training ERN and CRN components were larger in individuals with dyslexia than in typical readers. Also, the error-detection mechanism as represented by the ERN/CRN complex might serve as a biomarker for dyslexia and be used to evaluate the effectiveness of reading intervention programmes. Copyright © 2016 John Wiley & Sons, Ltd.

  6. An Efficient Conflict Detection Algorithm for Packet Filters

    NASA Astrophysics Data System (ADS)

    Lee, Chun-Liang; Lin, Guan-Yu; Chen, Yaw-Chung

    Packet classification is essential for supporting advanced network services such as firewalls, quality-of-service (QoS), virtual private networks (VPN), and policy-based routing. The rules that routers use to classify packets are called packet filters. If two or more filters overlap, a conflict occurs and leads to ambiguity in packet classification. This study proposes an algorithm that can efficiently detect and resolve filter conflicts using tuple based search. The time complexity of the proposed algorithm is O(nW+s), and the space complexity is O(nW), where n is the number of filters, W is the number of bits in a header field, and s is the number of conflicts. This study uses the synthetic filter databases generated by ClassBench to evaluate the proposed algorithm. Simulation results show that the proposed algorithm can achieve better performance than existing conflict detection algorithms both in time and space, particularly for databases with large numbers of conflicts.

  7. Correlation based efficient face recognition and color change detection

    NASA Astrophysics Data System (ADS)

    Elbouz, M.; Alfalou, A.; Brosseau, C.; Alam, M. S.; Qasmi, S.

    2013-01-01

    Identifying the human face via correlation is a topic attracting widespread interest. At the heart of this technique lies the comparison of an unknown target image to a known reference database of images. However, the color information in the target image remains notoriously difficult to interpret. In this paper, we report a new technique which: (i) is robust against illumination change, (ii) offers discrimination ability to detect color change between faces having similar shape, and (iii) is specifically designed to detect red colored stains (i.e. facial bleeding). We adopt the Vanderlugt correlator (VLC) architecture with a segmented phase filter and we decompose the color target image using normalized red, green, and blue (RGB), and hue, saturation, and value (HSV) scales. We propose a new strategy to effectively utilize color information in signatures for further increasing the discrimination ability. The proposed algorithm has been found to be very efficient for discriminating face subjects with different skin colors, and those having color stains in different areas of the facial image.

  8. Extraction of hidden information by efficient community detection in networks

    NASA Astrophysics Data System (ADS)

    Lee, Jooyoung; Lee, Juyong; Gross, Steven

    2013-03-01

    Currently, we are overwhelmed by a deluge of experimental data, and network physics has the potential to become an invaluable method to increase our understanding of large interacting datasets. However, this potential is often unrealized for two reasons: uncovering the hidden community structure of a network, known as community detection, is difficult, and further, even if one has an idea of this community structure, it is not a priori obvious how to efficiently use this information. Here, to address both of these issues, we, first, identify optimal community structure of given networks in terms of modularity by utilizing a recently introduced community detection method. Second, we develop an approach to use this community information to extract hidden information from a network. When applied to a protein-protein interaction network, the proposed method outperforms current state-of-the-art methods that use only the local information of a network. The method is generally applicable to networks from many areas. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 20120001222).

  9. Wavelet decomposition-based efficient face liveness detection

    NASA Astrophysics Data System (ADS)

    Moniruzzaman, Md.; Alam, Mohammad S.

    2016-04-01

    Existing face recognition systems are susceptible to spoofing attacks. So, Face liveness detection is a pivotal part for reliable face recognition, which has recently acknowledged vast attention. In this paper we propose a wavelet decomposition based face liveness recognition system using an energy calculation technique. Live faces contain high energy components compared to fake or printed image. In this paper, we calculate energy components of live face as well as fake face using discrete wavelet decomposition method. We analyze percentage of energy at different levels as well as for different wavelet basis function. We also analyze percentage of energy at different RGB bands and efficient face liveness detection method has been proposed. Discrete wavelet representation has been used to calculate decomposed energy components. Moreover, it provides differentiation of several spatial orientations as well as average and detailed information which are missing in the fake faces. This technique provides excellent discrimination capability when compared to the previously reported works based on the discrete Fourier transform and n-dimensional Fourier transform operations. To verify the proposed approach, we tested the performance using various face antispoofing datasets such as university of south Alabama (UFAD), and MSU face antispoofing dataset which incorporates different types of attacks. The test results obtained using the proposed technique shows better performance compared to existing techniques.

  10. Efficient object detection and tracking in video sequences.

    PubMed

    Dornaika, Fadi; Chakik, Fadi

    2012-06-01

    One of the most important problems in computer vision is the computation of the two-dimensional projective transformation (homography) that maps features of planar objects in different images and videos. This computation is required by many applications such as image mosaicking, image registration, and augmented reality. The real-time performance imposes constraints on the methods used. In this paper, we address the real-time detection and tracking of planar objects in a video sequence where the object of interest is given by a reference image template. Most existing approaches for homography estimation are based on two steps: feature extraction (first step) followed by a combinatorial optimization method (second step) to match features between the reference template and the scene frame. This paper has two main contributions. First, we detect both planar and nonplanar objects via efficient object feature classification in the input images, which is applied prior to performing the matching step. Second, for the tracking part (planar objects), we propose a fast method for the computation of the homography that is based on the transferred object features and their associated local raw brightness. The advantage of the proposed schemes is a fast matching as well as fast and robust object registration that is given by either a homography or three-dimensional pose.

  11. Lightning Detection Efficiency Analysis Process: Modeling Based on Empirical Data

    NASA Technical Reports Server (NTRS)

    Rompala, John T.

    2005-01-01

    A ground based lightning detection system employs a grid of sensors, which record and evaluate the electromagnetic signal produced by a lightning strike. Several detectors gather information on that signal s strength, time of arrival, and behavior over time. By coordinating the information from several detectors, an event solution can be generated. That solution includes the signal s point of origin, strength and polarity. Determination of the location of the lightning strike uses algorithms based on long used techniques of triangulation. Determination of the event s original signal strength relies on the behavior of the generated magnetic field over distance and time. In general the signal from the event undergoes geometric dispersion and environmental attenuation as it progresses. Our knowledge of that radial behavior together with the strength of the signal received by detecting sites permits an extrapolation and evaluation of the original strength of the lightning strike. It also limits the detection efficiency (DE) of the network. For expansive grids and with a sparse density of detectors, the DE varies widely over the area served. This limits the utility of the network in gathering information on regional lightning strike density and applying it to meteorological studies. A network of this type is a grid of four detectors in the Rondonian region of Brazil. The service area extends over a million square kilometers. Much of that area is covered by rain forests. Thus knowledge of lightning strike characteristics over the expanse is of particular value. I have been developing a process that determines the DE over the region [3]. In turn, this provides a way to produce lightning strike density maps, corrected for DE, over the entire region of interest. This report offers a survey of that development to date and a record of present activity.

  12. Evidence for Reduced Efficiency and Successful Compensation in Older Adults during Task Switching

    PubMed Central

    Hakun, Jonathan G.; Zhu, Zude; Johnson, Nathan F.; Gold, Brian T.

    2014-01-01

    Older adults often show different functional activation patterns than younger adults in prefrontal cortex (PFC) when performing cognitive control tasks. These differences include age-related increases in PFC activation magnitude and reorganized PFC functional connectivity patterns. However, it remains unclear whether age-related alterations in brain activation patterns reflect a positive mechanism (e.g. compensatory response) or a sign of brain dysfunction (e.g. reduced efficiency). Here we used functional magnetic resonance imaging (fMRI) to compare PFC activation magnitudes and PFC connectivity patterns between younger and older adult groups during performance of a task switching paradigm. Results indicated age-related increases both in PFC activation magnitudes and in PFC functional connectivity with inferotemporal (IT) regions. However, these age-related fMRI increases were differentially associated with task performance. Whereas increased PFC activation magnitudes tended to be either unrelated to task RT or associated with poorer task performance, increased PFC-IT connectivity was associated with better task performance in older adults. Our results provide new evidence suggesting that mechanisms subserving age-related reductions in efficiency and successful compensation can coexist in older adults in the context of the same task. PMID:25614233

  13. Efficient Mining and Detection of Sequential Intrusion Patterns for Network Intrusion Detection Systems

    NASA Astrophysics Data System (ADS)

    Shyu, Mei-Ling; Huang, Zifang; Luo, Hongli

    In recent years, pervasive computing infrastructures have greatly improved the interaction between human and system. As we put more reliance on these computing infrastructures, we also face threats of network intrusion and/or any new forms of undesirable IT-based activities. Hence, network security has become an extremely important issue, which is closely connected with homeland security, business transactions, and people's daily life. Accurate and efficient intrusion detection technologies are required to safeguard the network systems and the critical information transmitted in the network systems. In this chapter, a novel network intrusion detection framework for mining and detecting sequential intrusion patterns is proposed. The proposed framework consists of a Collateral Representative Subspace Projection Modeling (C-RSPM) component for supervised classification, and an inter-transactional association rule mining method based on Layer Divided Modeling (LDM) for temporal pattern analysis. Experiments on the KDD99 data set and the traffic data set generated by a private LAN testbed show promising results with high detection rates, low processing time, and low false alarm rates in mining and detecting sequential intrusion detections.

  14. Efficient List Extension Algorithm Using Multiple Detection Orders for Soft-Output MIMO Detection

    NASA Astrophysics Data System (ADS)

    Kim, Kilhwan; Jung, Yunho; Lee, Seongjoo; Kim, Jaeseok

    This paper proposes an efficient list extension algorithm for soft-output multiple-input-multiple-output (soft-MIMO) detection. This algorithm extends the list of candidate vectors based on the vector selected by initial detection, in order to solve the empty-set problem, while reducing the number of additional vectors. The additional vectors are obtained from multiple detection orders, from which high-quality soft-output can be generated. Furthermore, a method to reduce the complexity of the determination of the multiple detection orders is described. From simulation results for a 4×4 system with 16- and 64-quadrature amplitude modulations (QAM) and rate 1/2 and 5/6 duo-binary convolutional turbo code (CTC), the soft-MIMO detection to which the proposed list extension was applied showed a performance degradation of less than 0.5dB at bit error rate (BER) of 10-5, compared to that of the soft-output maximum-likelihood detection (soft-MLD) for all code rate and modulation pairs, while the complexity of the proposed list extension was approximately 38% and 17% of that of an existing algorithm with similar performance in a 4×4 system using 16- and 64-QAM, respectively.

  15. The Effect of Treadmill Exercise on Gait Efficiency During Overground Walking in Adults With Cerebral Palsy

    PubMed Central

    Kim, On-Yoo; Shin, Yoon-Kyum; Yoon, Young Kwon; Ko, Eu Jeong

    2015-01-01

    Objective To investigate the effect of treadmill walking exercise as a treatment method to improve gait efficiency in adults with cerebral palsy (CP) and to determine gait efficiency during overground walking after the treadmill walking exercise. Methods Fourteen adults with CP were recruited in the experimental group of treadmill walking exercise. A control group of 7 adults with CP who attended conventional physical therapy were also recruited. The treadmill walking exercise protocol consisted of 3-5 training sessions per week for 1-2 months (total 20 sessions). Gait distance, velocity, VO2, VCO2, O2 rate (mL/kg·min), and O2 cost (mL/kg·m) were assessed at the beginning and at the end of the treadmill walking exercise. The parameters were measured by KB1-C oximeter. Results After the treadmill walking exercise, gait distance during overground walking up to 6 minutes significantly increased from 151.29±91.79 to 193.93±79.01 m, and gait velocity increased from 28.09±14.29 to 33.49±12.69 m/min (p<0.05). Energy efficiency evaluated by O2 cost during overground walking significantly improved from 0.56±0.36 to 0.41±0.18 mL/kg·m (p<0.05), whereas O2 rate did not improve significantly after the treadmill walking exercise. On the other hand, gait velocity and O2 cost during overground walking were not significantly changed in the control group. Conclusion Treadmill walking exercise improved the gait efficiency by decreased energy expenditure during overground walking in adults with CP. Therefore, treadmill walking exercise can be an important method for gait training in adults with CP who have higher energy expenditure. PMID:25750868

  16. Efficient source separation algorithms for acoustic fall detection using a microsoft kinect.

    PubMed

    Li, Yun; Ho, K C; Popescu, Mihail

    2014-03-01

    Falls have become a common health problem among older adults. In previous study, we proposed an acoustic fall detection system (acoustic FADE) that employed a microphone array and beamforming to provide automatic fall detection. However, the previous acoustic FADE had difficulties in detecting the fall signal in environments where interference comes from the fall direction, the number of interferences exceeds FADE's ability to handle or a fall is occluded. To address these issues, in this paper, we propose two blind source separation (BSS) methods for extracting the fall signal out of the interferences to improve the fall classification task. We first propose the single-channel BSS by using nonnegative matrix factorization (NMF) to automatically decompose the mixture into a linear combination of several basis components. Based on the distinct patterns of the bases of falls, we identify them efficiently and then construct the interference free fall signal. Next, we extend the single-channel BSS to the multichannel case through a joint NMF over all channels followed by a delay-and-sum beamformer for additional ambient noise reduction. In our experiments, we used the Microsoft Kinect to collect the acoustic data in real-home environments. The results show that in environments with high interference and background noise levels, the fall detection performance is significantly improved using the proposed BSS approaches.

  17. Efficient pattern matching on GPUs for intrusion detection systems

    SciTech Connect

    Villa, Oreste; Tumeo, Antonino; Sciuto, Donatella

    2010-05-17

    Pattern matching is at the core of many security applications, like Network Intrusion Detection Systems (NIDS), spam filters and virus scanner. The always growing traffic on networks requires the ability to recognize potentially malicious signatures effectively, fastly and possibly in real time, without afftecting the performance and the latencies of the connections. Unfortunately, pattern matching is a computationally intensive procedure which poses significant challenges on current software and hardware implementations. Graphic Processing Units (GPU) have become an interesting target for such high-througput applications, but the algorithms and the data structures need to be redesigned to be parallelized and adapted to the underlining hardware, coping with the limitations imposed by these architectures. In this paper we present an efficient implementation of the Aho-Corasick pattern matching algorithm on GPU, showing how we progressively redesigned the algorithm and the data structures to fit on the architecture and comparing it with equivalent implementations on the CPU and with previous work. We show that with realistic TCP-IP workloads and signatures, our implementation obtains a speedup of 6.5 with respect to CPU implementations and of two times when compared to previous GPU solutions.

  18. Effects of image processing on the detective quantum efficiency

    NASA Astrophysics Data System (ADS)

    Park, Hye-Suk; Kim, Hee-Joung; Cho, Hyo-Min; Lee, Chang-Lae; Lee, Seung-Wan; Choi, Yu-Na

    2010-04-01

    Digital radiography has gained popularity in many areas of clinical practice. This transition brings interest in advancing the methodologies for image quality characterization. However, as the methodologies for such characterizations have not been standardized, the results of these studies cannot be directly compared. The primary objective of this study was to standardize methodologies for image quality characterization. The secondary objective was to evaluate affected factors to Modulation transfer function (MTF), noise power spectrum (NPS), and detective quantum efficiency (DQE) according to image processing algorithm. Image performance parameters such as MTF, NPS, and DQE were evaluated using the international electro-technical commission (IEC 62220-1)-defined RQA5 radiographic techniques. Computed radiography (CR) images of hand posterior-anterior (PA) for measuring signal to noise ratio (SNR), slit image for measuring MTF, white image for measuring NPS were obtained and various Multi-Scale Image Contrast Amplification (MUSICA) parameters were applied to each of acquired images. In results, all of modified images were considerably influence on evaluating SNR, MTF, NPS, and DQE. Modified images by the post-processing had higher DQE than the MUSICA=0 image. This suggests that MUSICA values, as a post-processing, have an affect on the image when it is evaluating for image quality. In conclusion, the control parameters of image processing could be accounted for evaluating characterization of image quality in same way. The results of this study could be guided as a baseline to evaluate imaging systems and their imaging characteristics by measuring MTF, NPS, and DQE.

  19. Measuring the Neutron Detection Efficiency in CLAS12

    NASA Astrophysics Data System (ADS)

    Sherman, Keegan; Gilfoyle, Gerard

    2016-09-01

    One of the central physics goals of Jefferson Lab is to understand how quarks and gluons form nuclei. To that end, one of the approved experiments in Hall B will measure the magnetic form factor of the neutron with the new CLAS12 detector. We will extract the ratio of electron-neutron to electron-proton scattering events from deuterium which requires a measurement of the neutron detection efficiency (NDE). To measure NDE we will take calibration data using a proton target to produce tagged neutrons from the p(e,e'π+)n reaction. We are now simulating this reaction and developing the analysis code to extract the NDE. We use PYTHIA 6.4 to generate p(e,e'π+)n events and simulate the response of CLAS12 with the Geant4-based Monte Carlo code gemc. To tag the neutron, we use the measured, scattered electron, and π+ information to predict the neutron's path. If the path intersects the fiducial volume of the CLAS12 electromagnetic calorimeters, then we search for a hit near that point. The NDE is the ratio of the number of neutrons found in the calorimeters to the number of neutrons predicted to hit the calorimeters. The analysis was done using the CLAS12 Common Tools. We observe a rapid rise in the NDE at low neutron momentum and a plateau above 60%. Work supported by the University of Richmond and the US Department of Energy.

  20. Detection of EBV in reactive and neoplastic lymphoproliferations in adults-when and how?

    PubMed

    Stuhlmann-Laeisz, Christiane; Oschlies, Ilske; Klapper, Wolfram

    2014-12-01

    Lymphoproliferations associated with Epstein-Barr Virus (EBV) in adult patients pose a diagnostic challenge for pathologists for several reasons. First, the EBV lymphoproliferations represent a clinically and histologically very broad spectrum ranging from self-limiting lymphoproliferations to manifest malignant lymphomas. Second, the classification of these diseases is not solely based on histopathology but rather requires a synopsis of clinical as well as pathological features. And third, a resource-efficient diagnostic procedure demands a deliberate strategy for selecting the tissue specimens that are to be tested for EBV. We describe how the clinical context and histological features may indicate to histopathologists which lymphatic tissues should be tested for the presence of EBV and how these features guide the classification. We provide recommendations as to which biopsy specimens should be investigated for EBV and which methods for detecting viral association are appropriate.

  1. Efficient regeneration by activation of neurogenesis in homeostatically quiescent regions of the adult vertebrate brain.

    PubMed

    Berg, Daniel A; Kirkham, Matthew; Beljajeva, Anna; Knapp, Dunja; Habermann, Bianca; Ryge, Jesper; Tanaka, Elly M; Simon, András

    2010-12-01

    In contrast to mammals, salamanders and teleost fishes can efficiently repair the adult brain. It has been hypothesised that constitutively active neurogenic niches are a prerequisite for extensive neuronal regeneration capacity. Here, we show that the highly regenerative salamander, the red spotted newt, displays an unexpectedly similar distribution of active germinal niches with mammals under normal physiological conditions. Proliferation zones in the adult newt brain are restricted to the forebrain, whereas all other regions are essentially quiescent. However, ablation of midbrain dopamine neurons in newts induced ependymoglia cells in the normally quiescent midbrain to proliferate and to undertake full dopamine neuron regeneration. Using oligonucleotide microarrays, we have catalogued a set of differentially expressed genes in these activated ependymoglia cells. This strategy identified hedgehog signalling as a key component of adult dopamine neuron regeneration. These data show that brain regeneration can occur by activation of neurogenesis in quiescent brain regions.

  2. Rapid and efficient gene delivery into the adult mouse brain via focal electroporation

    PubMed Central

    Nomura, Tadashi; Nishimura, Yusuke; Gotoh, Hitoshi; Ono, Katsuhiko

    2016-01-01

    In vivo gene delivery is required for studying the cellular and molecular mechanisms of various biological events. Virus-mediated gene transfer or generation of transgenic animals is widely used; however, these methods are time-consuming and expensive. Here we show an improved electroporation technique for acute gene delivery into the adult mouse brain. Using a syringe-based microelectrode, local DNA injection and the application of electric current can be performed simultaneously; this allows rapid and efficient gene transduction of adult non-neuronal cells. Combining this technique with various expression vectors that carry specific promoters resulted in targeted gene expression in astrocytic cells. Our results constitute a powerful strategy for the genetic manipulation of adult brains in a spatio-temporally controlled manner. PMID:27430903

  3. Limits on efficient human mindreading: convergence across Chinese adults and Semai children.

    PubMed

    Wang, Bo; Hadi, Nur Shafiqah Abdul; Low, Jason

    2015-11-01

    We tested Apperly and Butterfill's (2009, Psychological Review, 116, 753) theory that humans have two mindreading systems whereby the efficient-system guiding anticipatory glances displays signature limits that do not apply to the flexible system guiding verbal predictions. Experiments 1 and 2 tested urban Mainland-Chinese adults (n = 64) and Experiment 3 tested Semai children living in the rainforests of Peninsular Malaysia (3- to 4-year-olds, n = 60). Participants - across different ages, groups and methods - anticipated others' false-beliefs about object-location but not object-identity. Convergence in signature limits signalled that the early-developing efficient system involved minimal theory-of-mind. Chinese adults and older Semai children showed flexibility in their direct predictions. The flexible mindreading system in ascribing others' beliefs as such was task-sensitive and implicated maturational and cultural contributions.

  4. Rapid Detection of Visually Provocative Animals by Preschool Children and Adults

    ERIC Educational Resources Information Center

    Penkunas, Michael J.; Coss, Richard G.

    2013-01-01

    The ability to detect dangerous animals rapidly in complex landscapes has been historically important during human evolution. Previous research has shown that snake images are more readily detected than images of benign animals. To provide a stringent test of superior snake detection in preschool children and adults, Experiment 1 consisted of two…

  5. Amniotic Fluid Cells Are More Efficiently Reprogrammed to Pluripotency Than Adult Cells

    PubMed Central

    Galende, Elisa; Karakikes, Ioannis; Edelmann, Lisa; Desnick, Robert J.; Kerenyi, Thomas; Khoueiry, Georges; Lafferty, James; McGinn, Joseph T.; Brodman, Michael; Fuster, Valentin; Hajjar, Roger J.

    2010-01-01

    Abstract Recently, cultured human adult skin cells were reprogrammed to induced pluripotent stem (iPS) cells, which have characteristics similar to human embryonic stem (hES) cells. Patient-derived iPS cells offer genetic and immunologic advantages for cell and tissue replacement or engineering. The efficiency of generating human iPS cells has been very low; therefore an easily and efficiently reprogrammed cell type is highly desired. Here, we demonstrate that terminally differentiated human amniotic fluid (AF) skin cells provide an accessible source for efficiently generating abundant-induced pluripotent stem (AF-iPS) cells. By induction of pluripotency with the transcription factor quartet (OCT3/4, SOX2, KLF4, and c-MYC) the terminally differentiated, cultured AF skin cells formed iPS colonies approximately twice as fast and yielded nearly a two-hundred percent increase in number, compared to cultured adult skin cells. AF-iPS cells were identical to hES cells for morphological and growth characteristics, antigenic stem cell markers, stem cell gene expression, telomerase activity, in vitro and in vivo differentiation into the three germ layers and for their capacity to form embryoid bodies (EBs) and teratomas. Our findings provide a biological interesting conclusion that these fetal AF cells are more rapidly, easily, and efficiently reprogrammed to pluripotency than neonatal and adult cells. AF-iPS cells may have a “young,” more embryonic like epigenetic background, which may facilitate and accelerate pluripotency. The ability to efficiently and rapidly reprogram terminally differentiated AF skin cells and generate induced pluripotent stem cells provides an abundant iPS cell source for various basic studies and a potential for future patient-specific personalized therapies. PMID:20677926

  6. Does Faux Pas Detection in Adult Autism Reflect Differences in Social Cognition or Decision-Making Abilities?

    ERIC Educational Resources Information Center

    Thiébaut, Flora I.; White, Sarah J.; Walsh, Annabel; Klargaard, Solja K.; Wu, Hsuan-Chen; Rees, Geraint; Burgess, Paul W.

    2016-01-01

    43 typically-developed adults and 35 adults with ASD performed a cartoon faux pas test. Adults with ASD apparently over-detected faux pas despite good comprehension abilities, and were generally slower at responding. Signal detection analysis demonstrated that the ASD participants had significantly greater difficulty detecting whether a cartoon…

  7. Signal Detection Analysis of Factors Associated with Diabetes among Semirural Mexican American Adults

    ERIC Educational Resources Information Center

    Hanni, K. D.; Ahn, D. A.; Winkleby, M. A.

    2013-01-01

    Signal detection analysis was used to evaluate a combination of sociodemographic, acculturation, mental health, health care, and chronic disease risk factors potentially associated with diabetes in a sample of 4,505 semirural Mexican American adults. Overall, 8.9% of adults had been diagnosed with diabetes. The analysis resulted in 12 mutually…

  8. Exercise efficiency relates with mitochondrial content and function in older adults

    PubMed Central

    Broskey, Nicholas T; Boss, Andreas; Fares, Elie-Jacques; Greggio, Chiara; Gremion, Gerald; Schlüter, Leo; Hans, Didier; Kreis, Roland; Boesch, Chris; Amati, Francesca

    2015-01-01

    Chronic aerobic exercise has been shown to increase exercise efficiency, thus allowing less energy expenditure for a similar amount of work. The extent to which skeletal muscle mitochondria play a role in this is not fully understood, particularly in an elderly population. The purpose of this study was to determine the relationship of exercise efficiency with mitochondrial content and function. We hypothesized that the greater the mitochondrial content and/or function, the greater would be the efficiencies. Thirty-eight sedentary (S, n = 23, 10F/13M) or athletic (A, n = 15, 6F/9M) older adults (66.8 ± 0.8 years) participated in this cross sectional study. O2peak was measured with a cycle ergometer graded exercise protocol (GXT). Gross efficiency (GE, %) and net efficiency (NE, %) were estimated during a 1-h submaximal test (55% O2peak). Delta efficiency (DE, %) was calculated from the GXT. Mitochondrial function was measured as ATPmax (mmol/L/s) during a PCr recovery protocol with 31P-MR spectroscopy. Muscle biopsies were acquired for determination of mitochondrial volume density (MitoVd, %). Efficiencies were 17% (GE), 14% (NE), and 16% (DE) higher in A than S. MitoVD was 29% higher in A and ATPmax was 24% higher in A than in S. All efficiencies positively correlated with both ATPmax and MitoVd. Chronically trained older individuals had greater mitochondrial content and function, as well as greater exercise efficiencies. GE, NE, and DE were related to both mitochondrial content and function. This suggests a possible role of mitochondria in improving exercise efficiency in elderly athletic populations and allowing conservation of energy at moderate workloads. PMID:26059033

  9. Improvements in the detection efficiency model for the Brazilian lightning detection network (BrasilDAT)

    NASA Astrophysics Data System (ADS)

    Naccarato, K. P.; Pinto, O., Jr.

    2009-02-01

    The detection efficiency (DE) is the most important performance gauge of a lightning detection network (LDN). Moreover, the main motivation for evaluating the DE of a LDN is to separate the geographical variations of the CG lightning parameters from the variations regarding the network performance. A review of previous relative DE techniques and simple methods to correct the cloud-to-ground (CG) lightning flash density maps is presented. In addition, recent improvements in the flash DE model for the Brazilian lightning detection network (BrasilDAT) are discussed. The DE estimated values are based on the sensor individual DE probability functions, which are derived from a large amount of CG stroke data provided by the network considering different distances from the sensor and specific peak current ranges. The new approach provides better results when compared with the previous developments, since the calculation of the sensor DE probability functions neglects the lightning data provided by the minimum number of reporting sensors. Hence it is possible to minimize the unrealistic enhancement of the DE closer to the network boundaries ("border effect") without affecting significantly the performance inside the network. The main result is a more realistic correction of the CG flash density maps, particularly at the outermost network areas, leading to an improvement in the model sensitivity.

  10. Detection of Deception in Adults and Children via Facial Expressions.

    ERIC Educational Resources Information Center

    Feldman, Robert S.; And Others

    1979-01-01

    Examines the effect of age of encoder (first graders, seventh graders, and college students) on the decoding of nonverbal facial expressions indicative of verbal deception. Results showed the ratings of untrained, naive adult judges to be more accurate in decoding the first-grade stimulus persons than the older ones. (JMB)

  11. Rapid detection of visually provocative animals by preschool children and adults.

    PubMed

    Penkunas, Michael J; Coss, Richard G

    2013-04-01

    The ability to detect dangerous animals rapidly in complex landscapes has been historically important during human evolution. Previous research has shown that snake images are more readily detected than images of benign animals. To provide a stringent test of superior snake detection in preschool children and adults, Experiment 1 consisted of two parts using a touch-screen visual search task. Reaction times to detect different target snakes embedded in matrices of lizards were compared with reaction times to detect target lizards embedded in matrices of snakes. Experiment 2 compared the visual salience of lions with that of similarly colored antelopes. This experiment tested the prediction that historically dangerous felid predators would also engender rapid detection. Results from the two experiments revealed that both preschool children and adults located snakes and lions more quickly than their nonthreatening counterparts. Experiment 3 examined the ability of children and adults to distinguish between similar appearing cows and horses. Preschool children and adult men exhibited no reliable differences in detecting the two animal types. Adult women located horses reliably faster than cows, suggesting that visual biases for some animals can be acquired after childhood.

  12. Need for an efficient adult trap for the surveillance of dengue vectors

    PubMed Central

    Sivagnaname, N.; Gunasekaran, K.

    2012-01-01

    The emergence and re-emergence of arboviral diseases transmitted by Aedes aegypti and Ae. albopictus continue to be a major threat in the tropics and subtropics. Associations between currently used indices and dengue transmission have not been proven to be satisfactorily predictive of dengue epidemics. Classical larval indices in dengue surveillance have limited use in assessing transmission risk and are a poor proxy for measuring adult emergence. Besides, collection of larval indices is labour intensive and plagued by difficulties of access particularly in urban settings. The re-emergence of dengue disease in many countries despite lower immature indices has warranted the need for more effective indices in dengue vector surveillance and control. Reliable and highly useful indices could be developed with the help of efficient and appropriate entomological tools. Most current programmes emphasize reduction of immature Ae. aegypti density, but it is of little value because its relation to transmission risk is weak. More attention should be paid to methods directed toward adult rather than immature Ae. aegypti. Collection of sufficient numbers of adult mosquitoes is important to understand disease transmission dynamics and to devise an appropriate control strategy. Even though, use of certain traps such as BG-Sentinel traps has been attempted in monitoring Ae. aegypti population, their utility is limited due to various setbacks which make these insufficient for entomological and epidemiological studies. Thus, there is an urgent need for the development of an ideal trap that could be used for adult vector surveillance. The present review critically analyzes the setbacks in the existing tools of entomological surveillance of dengue vectors and highlights the importance and necessity of more improved, more sensitive and reliable adult trap that could be used for surveillance of dengue vectors. PMID:23287120

  13. Polysplenia syndrome with preduodenal portal vein detected in adults

    PubMed Central

    Seo, Hyung-Il; Jeon, Tae Yong; Sim, Mun Sup; Kim, Suk

    2008-01-01

    Polysplenia syndrome, defined as the presence of multiple spleens of almost equal volume, is a rare condition involving congenital anomalies in multiple organ systems. We report this anomaly in a 41-year-old female who underwent a left lateral sectionectomy due to recurrent cholangitis and impacted left lateral duct stones. Polysplenia syndrome with preduodenal vein was diagnosed preoperatively by computed tomography (CT) and surgery was done safely. Although the polysplenia syndrome with preduodenal portal vein (PDPV) in adult is rarely encountered, surgeons need to understand the course of the portal vein and exercise caution in approaching the biliary tract. PMID:19009663

  14. Polysplenia syndrome with preduodenal portal vein detected in adults.

    PubMed

    Seo, Hyung-Il; Jeon, Tae Yong; Sim, Mun Sup; Kim, Suk

    2008-11-07

    Polysplenia syndrome, defined as the presence of multiple spleens of almost equal volume, is a rare condition involving congenital anomalies in multiple organ systems. We report this anomaly in a 41-year-old female who underwent a left lateral sectionectomy due to recurrent cholangitis and impacted left lateral duct stones. Polysplenia syndrome with preduodenal vein was diagnosed preoperatively by computed tomography (CT) and surgery was done safely. Although the polysplenia syndrome with preduodenal portal vein (PDPV) in adult is rarely encountered, surgeons need to understand the course of the portal vein and exercise caution in approaching the biliary tract.

  15. A Wearable Hip Assist Robot Can Improve Gait Function and Cardiopulmonary Metabolic Efficiency in Elderly Adults.

    PubMed

    Lee, Hwang-Jae; Lee, Suhyun; Chang, Won Hyuk; Seo, Keehong; Shim, Youngbo; Choi, Byung-Ok; Ryu, Gyu-Ha; Kim, Yun-Hee

    2017-02-06

    The aims of this study were to investigate the effectiveness of a newly developed wearable hip assist robot that uses an active assist algorithm to improve gait function, muscle effort, and cardiopulmonary metabolic efficiency in elderly adults. Thirty elderly adults (15 males/15 females) participated in this study. The experimental protocol consisted of overground gait at comfortable speed under three different conditions: free gait without robot assistance, robot-assisted gait with zero torque (RAG-Z), and full robot-assisted gait (RAG). Under all conditions, muscle effort was analyzed using a 12-channel surface electromyography system. Spatio-temporal data were collected at 120 Hz using a 3D motion capture system with six infrared cameras. Metabolic cost parameters were collected as oxygen consumption per unit (ml/min/kg) and aerobic energy expenditure (Kcal/min). In the RAG condition, participants demonstrated improved gait function, decreased muscle effort, and reduced metabolic cost. Although the hip assist robot only provides assistance at the hip joint, our results demonstrated a clear reduction in knee and ankle muscle activity in addition to decreased hip flexor and extensor activity. Our findings suggest that this robot has the potential to improve stabilization of the trunk during walking in elderly adults.

  16. Efficient Lane Boundary Detection with Spatial-Temporal Knowledge Filtering

    PubMed Central

    Nan, Zhixiong; Wei, Ping; Xu, Linhai; Zheng, Nanning

    2016-01-01

    Lane boundary detection technology has progressed rapidly over the past few decades. However, many challenges that often lead to lane detection unavailability remain to be solved. In this paper, we propose a spatial-temporal knowledge filtering model to detect lane boundaries in videos. To address the challenges of structure variation, large noise and complex illumination, this model incorporates prior spatial-temporal knowledge with lane appearance features to jointly identify lane boundaries. The model first extracts line segments in video frames. Two novel filters—the Crossing Point Filter (CPF) and the Structure Triangle Filter (STF)—are proposed to filter out the noisy line segments. The two filters introduce spatial structure constraints and temporal location constraints into lane detection, which represent the spatial-temporal knowledge about lanes. A straight line or curve model determined by a state machine is used to fit the line segments to finally output the lane boundaries. We collected a challenging realistic traffic scene dataset. The experimental results on this dataset and other standard dataset demonstrate the strength of our method. The proposed method has been successfully applied to our autonomous experimental vehicle. PMID:27529248

  17. Efficient image acquisition design for a cancer detection system

    NASA Astrophysics Data System (ADS)

    Nguyen, Dung; Roehrig, Hans; Borders, Marisa H.; Fitzpatrick, Kimberly A.; Roveda, Janet

    2013-09-01

    Modern imaging modalities, such as Computed Tomography (CT), Digital Breast Tomosynthesis (DBT) or Magnetic Resonance Tomography (MRT) are able to acquire volumetric images with an isotropic resolution in micrometer (um) or millimeter (mm) range. When used in interactive telemedicine applications, these raw images need a huge storage unit, thereby necessitating the use of high bandwidth data communication link. To reduce the cost of transmission and enable archiving, especially for medical applications, image compression is performed. Recent advances in compression algorithms have resulted in a vast array of data compression techniques, but because of the characteristics of these images, there are challenges to overcome to transmit these images efficiently. In addition, the recent studies raise the low dose mammography risk on high risk patient. Our preliminary studies indicate that by bringing the compression before the analog-to-digital conversion (ADC) stage is more efficient than other compression techniques after the ADC. The linearity characteristic of the compressed sensing and ability to perform the digital signal processing (DSP) during data conversion open up a new area of research regarding the roles of sparsity in medical image registration, medical image analysis (for example, automatic image processing algorithm to efficiently extract the relevant information for the clinician), further Xray dose reduction for mammography, and contrast enhancement.

  18. Countering Botnets: Anomaly-Based Detection, Comprehensive Analysis, and Efficient Mitigation

    DTIC Science & Technology

    2011-05-01

    BOTNETS: ANOMALY-BASED DETECTION , COMPREHENSIVE ANALYSIS, AND EFFICIENT MITIGATION GEORGIA TECH RESEARCH CORPORATION MAY 2011 FINAL... DETECTION , COMPREHENSIVE ANALYSIS, AND EFFICIENT MITIGATION 5a. CONTRACT NUMBER N/A 5b. GRANT NUMBER FA8750-08-2-0141 5c. PROGRAM ELEMENT NUMBER...cover five general areas: (1) botnet detection , (2) botnet analysis, (3) botnet mitigation, (4) add-on tasks to the original contract, including the

  19. Gross efficiency responses to exercise conditioning in adult males of various ages.

    PubMed

    Gissane, C; Corrigan, D L; White, J A

    1991-01-01

    This study investigated gross efficiency changes in a group of 60 adult males (mean age 39.2 +/- 1.2 years) resulting from endurance training and age-related responses to such training in sub-groups (each n = 20) of younger (30.7 +/- 0.7 years), intermediate (38.3 +/- 0.5 years) and older (48.6 +/- 1.1 years) subjects. Gross efficiency (%) was calculated from work output, oxygen consumption and RER energy equivalents following 10 min standard cycle ergometry exercise at 100 W and 50 rev min-1. Measurements were made at pre-, mid- and post-8 months of training, which involved progressive walking/jogging activities designed to enhance endurance capacity. In the total group, VO2 decreased pre- to post-training from 2.15 +/- 0.02 to 1.93 +/- 0.01 1 min-1 (P less than 0.01). In the sub-groups, both the younger and older subjects showed a significantly reduced VO2, from 2.17 +/- 0.01 to 1.98 +/- 0.04 1 min-1 and 2.05 +/- 0.08 to 1.86 +/- 0.03 1 min-1 respectively (P less than 0.05), but no significant changes were noted at mid-training. In the intermediate age subjects, while there were trends towards a reduced VO2, none was significant. The ANOVA revealed increased mean gross efficiency in the total group from pre- (14.3 +/- 0.1%) to post- (15.5 +/- 0.2%) (P less than 0.05) but not at mid-training (14.8 +/- 0.2%). While similar trends were observed in the sub-groups, gross efficiency increases were not significant, although changes in gross efficiency were reflected in VO2. The findings suggest that during standardized exercise, oxygen cost may be reduced and gross efficiency increased in adult males following endurance training and that such changes may take place over a variety of age ranges.

  20. Line Length: An Efficient Feature for Seizure Onset Detection

    DTIC Science & Technology

    2007-11-02

    feature was evaluated over a total of 1,215 hours of intracranial EEG signal from 10 patients. Results confirmed this feature as being useful for...of 111 seizures analyzed of which 23 were subclinical. Keywords – seizure detection, fractal dimension . I. INTRODUCTION There is a lot of...Olsen [4], and later referred to as curve length in [3]. This feature can be derived from the fractal dimension by Katz [5] studied in [6]-[7]; however

  1. An efficient background modeling approach based on vehicle detection

    NASA Astrophysics Data System (ADS)

    Wang, Jia-yan; Song, Li-mei; Xi, Jiang-tao; Guo, Qing-hua

    2015-10-01

    The existing Gaussian Mixture Model(GMM) which is widely used in vehicle detection suffers inefficiency in detecting foreground image during the model phase, because it needs quite a long time to blend the shadows in the background. In order to overcome this problem, an improved method is proposed in this paper. First of all, each frame is divided into several areas(A, B, C and D), Where area A, B, C and D are decided by the frequency and the scale of the vehicle access. For each area, different new learning rate including weight, mean and variance is applied to accelerate the elimination of shadows. At the same time, the measure of adaptive change for Gaussian distribution is taken to decrease the total number of distributions and save memory space effectively. With this method, different threshold value and different number of Gaussian distribution are adopted for different areas. The results show that the speed of learning and the accuracy of the model using our proposed algorithm surpass the traditional GMM. Probably to the 50th frame, interference with the vehicle has been eliminated basically, and the model number only 35% to 43% of the standard, the processing speed for every frame approximately has a 20% increase than the standard. The proposed algorithm has good performance in terms of elimination of shadow and processing speed for vehicle detection, it can promote the development of intelligent transportation, which is very meaningful to the other Background modeling methods.

  2. Identifying and Prioritizing Diseases Important for Detection in Adult Hearing Health Care

    PubMed Central

    Dhar, Sumitrajit; Nielsen, Donald W.; Griffith, James W.; Lundy, Larry B.; Driscoll, Colin; Neff, Brian; Beatty, Charles; Barrs, David; Zapala, David A.

    2016-01-01

    Purpose The purpose of this research note is to identify and prioritize diseases important for detection in adult hearing health care delivery systems. Method Through literature review and expert consultation, the authors identified 195 diseases likely to occur in adults complaining of hearing loss. Five neurotologists rated the importance of disease on 3 dimensions related to the necessity of detection prior to adult hearing aid fitting. Results Ratings of adverse health consequences, diagnostic difficulty, and presence of nonotologic symptoms associated with these diseases resulted in the identification of 104 diseases potentially important for detection prior to adult hearing aid fitting. Conclusions Current and evolving health care delivery systems, including direct-to-consumer sales, involve inconsistent means of disease detection vigilance prior to device fitting. The first steps in determining the safety of these different delivery methods are to identify and prioritize which diseases present the greatest risk for poor health outcomes and, thus, should be detected in hearing health care delivery systems. Here the authors have developed a novel multidimensional rating system to rank disease importance. The rankings can be used to evaluate the effectiveness of alternative detection methods and to inform public health policy. The authors are currently using this information to validate a consumer questionnaire designed to accurately identify when pre- fitting medical evaluations should be required for hearing aid patients. PMID:27679840

  3. Efficient detection and recognition algorithm of reference points in photogrammetry

    NASA Astrophysics Data System (ADS)

    Li, Weimin; Liu, Gang; Zhu, Lichun; Li, Xiaofeng; Zhang, Yuhai; Shan, Siyu

    2016-04-01

    In photogrammetry, an approach of automatic detection and recognition on reference points have been proposed to meet the requirements on detection and matching of reference points. The reference points used here are the CCT(circular coded target), which compose of two parts: the round target point in central region and the circular encoding band in surrounding region. Firstly, the contours of image are extracted, after that noises and disturbances of the image are filtered out by means of a series of criteria, such as the area of the contours, the correlation coefficient between two regions of contours etc. Secondly, the cubic spline interpolation is adopted to process the central contour region of the CCT. The contours of the interpolated image are extracted again, then the least square ellipse fitting is performed to calculate the center coordinates of the CCT. Finally, the encoded value is obtained by the angle information from the circular encoding band of the CCT. From the experiment results, the location precision of the CCT can be achieved to sub-pixel level of the algorithm presented. Meanwhile the recognition accuracy is pretty high, even if the background of the image is complex and full of disturbances. In addition, the property of the algorithm is robust. Furthermore, the runtime of the algorithm is fast.

  4. Improving the detection efficiency in nuclear emulsion trackers

    NASA Astrophysics Data System (ADS)

    Alexandrov, A.; Bozza, C.; Buonaura, A.; Consiglio, L.; D`Ambrosio, N.; Lellis, G. De; De Serio, M.; Di Capua, F.; Di Crescenzo, A.; Di Ferdinando, D.; Di Marco, N.; Fini, R. A.; Galati, G.; Giacomelli, G.; Grella, G.; Hosseini, B.; Kose, U.; Lauria, A.; Longhin, A.; Mandrioli, G.; Mauri, N.; Medinaceli, E.; Montesi, M. C.; Paoloni, A.; Pastore, A.; Patrizii, L.; Pozzato, M.; Pupilli, F.; Rescigno, R.; Roda, M.; Rosa, G.; Schembri, A.; Shchedrina, T.; Simone, S.; Sioli, M.; Sirignano, C.; Sirri, G.; Spinetti, M.; Stellacci, S. M.; Tenti, M.; Tioukov, V.

    2015-03-01

    Nuclear emulsion films are a tracking device with unique space resolution. Their use in nowadays large-scale experiments relies on the availability of automated microscope operating at very high speed. In this paper we describe the features and the latest improvements of the European Scanning System, a last-generation automated microscope for emulsion scanning. In particular, we present a new method for the recovery of tracking inefficiencies. Stacks of double coated emulsion films have been exposed to a 10 GeV/c pion beam. Efficiencies as high as 98% have been achieved for minimum ionising particle tracks perpendicular to the emulsion films and of 93% for tracks with tan(θ) ≃ 0.8.

  5. Efficient Cargo Delivery into Adult Brain Tissue Using Short Cell-Penetrating Peptides.

    PubMed

    Kizil, Caghan; Iltzsche, Anne; Thomas, Alvin Kuriakose; Bhattarai, Prabesh; Zhang, Yixin; Brand, Michael

    2015-01-01

    Zebrafish brains can regenerate lost neurons upon neurogenic activity of the radial glial progenitor cells (RGCs) that reside at the ventricular region. Understanding the molecular events underlying this ability is of great interest for translational studies of regenerative medicine. Therefore, functional analyses of gene function in RGCs and neurons are essential. Using cerebroventricular microinjection (CVMI), RGCs can be targeted efficiently but the penetration capacity of the injected molecules reduces dramatically in deeper parts of the brain tissue, such as the parenchymal regions that contain the neurons. In this report, we tested the penetration efficiency of five known cell-penetrating peptides (CPPs) and identified two- polyR and Trans - that efficiently penetrate the brain tissue without overt toxicity in a dose-dependent manner as determined by TUNEL staining and L-Plastin immunohistochemistry. We also found that polyR peptide can help carry plasmid DNA several cell diameters into the brain tissue after a series of coupling reactions using DBCO-PEG4-maleimide-based Michael's addition and azide-mediated copper-free click reaction. Combined with the advantages of CVMI, such as rapidness, reproducibility, and ability to be used in adult animals, CPPs improve the applicability of the CVMI technique to deeper parts of the central nervous system tissues.

  6. Efficient Cargo Delivery into Adult Brain Tissue Using Short Cell-Penetrating Peptides

    PubMed Central

    Thomas, Alvin Kuriakose; Bhattarai, Prabesh; Zhang, Yixin; Brand, Michael

    2015-01-01

    Zebrafish brains can regenerate lost neurons upon neurogenic activity of the radial glial progenitor cells (RGCs) that reside at the ventricular region. Understanding the molecular events underlying this ability is of great interest for translational studies of regenerative medicine. Therefore, functional analyses of gene function in RGCs and neurons are essential. Using cerebroventricular microinjection (CVMI), RGCs can be targeted efficiently but the penetration capacity of the injected molecules reduces dramatically in deeper parts of the brain tissue, such as the parenchymal regions that contain the neurons. In this report, we tested the penetration efficiency of five known cell-penetrating peptides (CPPs) and identified two– polyR and Trans – that efficiently penetrate the brain tissue without overt toxicity in a dose-dependent manner as determined by TUNEL staining and L-Plastin immunohistochemistry. We also found that polyR peptide can help carry plasmid DNA several cell diameters into the brain tissue after a series of coupling reactions using DBCO-PEG4-maleimide-based Michael’s addition and azide-mediated copper-free click reaction. Combined with the advantages of CVMI, such as rapidness, reproducibility, and ability to be used in adult animals, CPPs improve the applicability of the CVMI technique to deeper parts of the central nervous system tissues. PMID:25894337

  7. Postnatal ethanol exposure disrupts signal detection in adult rats.

    PubMed

    Woolfrey, Kevin M; Hunt, Pamela S; Burk, Joshua A

    2005-01-01

    Human prenatal ethanol exposure that occurs during a period of increased synaptogenesis known as the "brain growth spurt" has been associated with significant impairments in attention, learning, and memory. The present experiment assessed whether administration of ethanol during the brain growth spurt in the rat, which occurs shortly after birth, disrupts attentional performance. Rats were administered 5.25 g/kg/day ethanol via intragastric intubation from postnatal days (PD) 4-9, sham-intubation, or no intubation (naïve). Beginning at PD 90, animals were trained to asymptotic performance in a two-lever attention task that required discrimination of brief visual signals from trials with no signal presentation. Finally, manipulations of background noise and inter-trial interval duration were conducted. Early postnatal ethanol administration did not differentially affect acquisition of the attention task. However, after rats were trained to asymptotic performance levels, those previously exposed to ethanol demonstrated a deficit in detection of signals but not of non-signals compared to sham-intubated and naïve rats. The signal detection deficit persisted whenever these animals were re-trained in the standard task, but further task manipulations failed to interact with ethanol pretreatment. The present data support the hypothesis that early postnatal ethanol administration disrupts aspects of attentional processing in the rat.

  8. Efficient Enzyme-Free Biomimetic Sensors for Natural Phenol Detection.

    PubMed

    Ferreira Garcia, Luane; Ribeiro Souza, Aparecido; Sanz Lobón, Germán; Dos Santos, Wallans Torres Pio; Alecrim, Morgana Fernandes; Fontes Santiago, Mariângela; de Sotomayor, Rafael Luque Álvarez; de Souza Gil, Eric

    2016-08-13

    The development of sensors and biosensors based on copper enzymes and/or copper oxides for phenol sensing is disclosed in this work. The electrochemical properties were studied by cyclic and differential pulse voltammetry using standard solutions of potassium ferrocyanide, phosphate/acetate buffers and representative natural phenols in a wide pH range (3.0 to 9.0). Among the natural phenols herein investigated, the highest sensitivity was observed for rutin, a powerful antioxidant widespread in functional foods and ubiquitous in the plant kingdom. The calibration curve for rutin performed at optimum pH (7.0) was linear in a broad concentration range, 1 to 120 µM (r = 0.99), showing detection limits of 0.4 µM. The optimized biomimetic sensor was also applied in total phenol determination in natural samples, exhibiting higher stability and sensitivity as well as distinct selectivity for antioxidant compounds.

  9. An efficient method for facial component detection in thermal images

    NASA Astrophysics Data System (ADS)

    Paul, Michael; Blanik, Nikolai; Blazek, Vladimir; Leonhardt, Steffen

    2015-04-01

    A method to detect certain regions in thermal images of human faces is presented. In this approach, the following steps are necessary to locate the periorbital and the nose regions: First, the face is segmented from the background by thresholding and morphological filtering. Subsequently, a search region within the face, around its center of mass, is evaluated. Automatically computed temperature thresholds are used per subject and image or image sequence to generate binary images, in which the periorbital regions are located by integral projections. Then, the located positions are used to approximate the nose position. It is possible to track features in the located regions. Therefore, these regions are interesting for different applications like human-machine interaction, biometrics and biomedical imaging. The method is easy to implement and does not rely on any training images or templates. Furthermore, the approach saves processing resources due to simple computations and restricted search regions.

  10. Mechanical efficiency improvement in relation to metabolic changes in sedentary obese adults

    PubMed Central

    Jabbour, Georges; Iancu, Horia-Daniel

    2015-01-01

    Purpose Mechanical efficiency (ME) refers to the ability of an individual to transfer energy consumed by external work. This performance indicator is impaired by obesity and is associated with decreased high-intensity exercise performance. However, it is unclear if ME may be improved in response to high intensity training (HIT). This study aimed to determine if ME increases in response to HIT in obese adults and to identify the factors associated with these changes. Methods 24 obese adults (body mass index=∼33 kg/m2) were randomised into control (n=12) and trained (n=12) groups. Following baseline metabolic, anthropometric, fitness and ME measurements, the participants completed a 6-week exercise intervention that included 18 sessions of six repeats of 6 s supramaximal sprints on an electromagnetically braked cycle ergometer. The metabolic, anthropometric and fitness assessments were repeated postintervention. ME (expressed as a %) was calculated during an incremental maximal cycling test at stages of 25, 50, 75, 100 and 125 W. Results ME did not differ across the groups at 25 and 50 W. Following HIT, ME increased significantly at 75, 100 and 125 W (p<0.01, respectively) compared with the control group (p<0.01, respectively). Although no changes in fat-free mass were observed following HIT, the increases in ME at 75, 100 and 125 W correlated positively with both homeostasis model assessment-estimated insulin resistance index decreases (r=0.9; r=0.89 and r=0.88, p<0.01, respectively) and peak power increases (r=0.87, r=0.88 and r=0.9, p<0.01, respectively). Conclusions Although there were no changes in the participants’ anthropometric variables, HIT improved ME in obese adults, an enhancement that appears to be related to increases in muscle strength and metabolic adaptations. PMID:27900132

  11. Efficient Detection of Occlusion prior to Robust Face Recognition

    PubMed Central

    Dugelay, Jean-Luc

    2014-01-01

    While there has been an enormous amount of research on face recognition under pose/illumination/expression changes and image degradations, problems caused by occlusions attracted relatively less attention. Facial occlusions, due, for example, to sunglasses, hat/cap, scarf, and beard, can significantly deteriorate performances of face recognition systems in uncontrolled environments such as video surveillance. The goal of this paper is to explore face recognition in the presence of partial occlusions, with emphasis on real-world scenarios (e.g., sunglasses and scarf). In this paper, we propose an efficient approach which consists of first analysing the presence of potential occlusion on a face and then conducting face recognition on the nonoccluded facial regions based on selective local Gabor binary patterns. Experiments demonstrate that the proposed method outperforms the state-of-the-art works including KLD-LGBPHS, S-LNMF, OA-LBP, and RSC. Furthermore, performances of the proposed approach are evaluated under illumination and extreme facial expression changes provide also significant results. PMID:24526902

  12. Thermal and health outcomes of energy efficiency retrofits of homes of older adults.

    PubMed

    Ahrentzen, S; Erickson, J; Fonseca, E

    2016-08-01

    Mitigation of thermal stress and adverse indoor climatic conditions is important to older low-income populations whose age, health, and economic circumstances make them vulnerable to indoor environmental conditions. This research examines whether energy retrofits in affordable housing for older adults can also improve indoor climatic (i.e., temperature, humidity, air infiltration) conditions and whether such improvements correspond with improved health and comfort of residents. An apartment complex for low-income older adults in Phoenix was the study site. In 2010, renovations were undertaken to make it more energy efficient and to replace interior cabinetry, flooring, and paint with materials that had low or no volatile organic compounds (VOCs). Fifty-seven residents from 53 apartment units participated in both baseline (pre-renovation) and 1 year post-renovation data collection trials. Environmental measures included temperature, relative humidity, and air infiltration. Health measures included general health, emotional distress, and sleep. Four questions addressed residents' perceptions of temperature quality. Results demonstrated a 19% reduction in energy consumption following the retrofit. In addition, fixed effects statistical models of the panel data showed significant stabilization of unit temperature from pre-retrofit to 1 year post-retrofit. Reductions in an apartment's temperature extremes of 27.2°C (81°F) and above also corresponded with improvement in occupant's reported health over the same time period, although not with occupant's perceptions of thermal comfort.

  13. Note: Determining the detection efficiency of excited neutral atoms by a microchannel plate detector

    SciTech Connect

    Berry, Ben; Zohrabi, M.; Hayes, D.; Ablikim, U.; Jochim, Bethany; Severt, T.; Carnes, K. D.; Ben-Itzhak, I.

    2015-04-15

    We present a method for determining the detection efficiency of neutral atoms relative to keV ions. Excited D* atoms are produced by D{sub 2} fragmentation in a strong laser field. The fragments are detected by a micro-channel plate detector either directly as neutrals or as keV ions following field ionization and acceleration by a static electric field. Moreover, we propose a new mechanism by which neutrals are detected. We show that the ratio of the yield of neutrals and ions can be related to the relative detection efficiency of these species.

  14. Patterned arrays for the efficient detection of whole cells

    NASA Astrophysics Data System (ADS)

    Alexander, Troy A.

    2006-10-01

    Surface-Enhanced-Raman-Spectroscopy (SERS) is potentially a very sensitive technique for the detection of biological agents (i.e., proteins, viruses or whole cell bacteria). However, since initial reports, its utility has not been realized. Its limited acceptance as a routine analysis technique for both chemical and biological agents is largely due to the lack of reproducible SERS-active substrates. Most established SERS substrate fabrication schemes are based on selfassembly of the metallic (typically, Au, Ag, Pt, Pd or Cu) surfaces responsible for enhancement. Further, these protocols do not lend themselves to the stringent control over the enhancing feature shape, size, and placement on a nanometer scale. SERS can be made a more robust and attractive spectroscopic technique for biological agents by developing quantifiable, highly sensitive, and highly selective SERS-active substrates. Recently, novel SERS-active substrates, fabricated from nano-patterned Si and Au have been commercialized and are easily obtained in the marketplace. Commercialized Au SERS-active substrates fabricated using semiconductor manipulation and routine metal vapor deposition techniques used for the spectral analysis of intact bacterial cells. This talk will focus on the substrate characterization (microscopic and spectral) and application towards whole cells.

  15. Neural harmonic detection approaches for FPGA area efficient implementation

    NASA Astrophysics Data System (ADS)

    Dzondé, S. R. N.; Kom, C.-H.; Berviller, H.; Blondé, J.-P.; Flieller, D.; Kom, M.; Braun, F.

    2011-12-01

    This paper deals with new neural networks based harmonics detection approaches to minimize hardware resources needed for FPGA implementation. A simple type of neural network called Adaline is used to build an intelligent Active Power Filter control unit for harmonics current elimination and reactive power compensation. For this purpose, two different approaches called Improved Three-Monophase (ITM) and Two-Phase Flow (TPF) methods are proposed. The ITM method corresponds to a simplified structure of the three-monophase method whereas the TPF method derives from the Synchronous Reference Frame method. Indeed, for both proposed methods, only 50% of Adalines with regard to the original methods is used. The corresponding designs were implemented on a FPGA Stratix II platform through Altera DSP Builder® development tool. After analyzing those two methods with respect to performance and size criteria, a comparative study with the popular p-q and also the direct method is reported. From there, one can notice that the p-q is still the most powerful method for three-phase compensation but the TPF method is the fastest and the most compact in terms of size. An experimental result is shown to validate the feasibility of FPGA implementation of ANN-based harmonics extraction algorithms.

  16. Efficiency analysis of homodyne detection for a coherent lidar with adaptive optics

    NASA Astrophysics Data System (ADS)

    Liu, Wei; Wang, Liang; Yao, Kainan; Cao, Jingtai; Huang, Danian; Gu, Haijun

    2016-12-01

    For a coherent lidar, the efficiency of homodyne detection is a significant factor. Adaptive optics (AO) is an effective way to correct the turbulence-induced wavefront distortions. Based on our previous works, an expression for the homodyne detection efficiency is given. The results of the numerical simulation show that the atmospheric coherent length has an influence on the homodyne detection efficiency for a fixed atmospheric Greenwood frequency and a closed-loop control bandwidth. In addition, an experimental AO system is employed to verify the effect of the AO on the coherent lidar. The results show that the homodyne detection efficiency is obviously improved after aberrations are corrected. The conclusion of this paper provides a reference for designing an AO system for a coherent lidar.

  17. A comparison of digital radiography systems in terms of effective detective quantum efficiency

    SciTech Connect

    Bertolini, Marco; Nitrosi, Andrea; Rivetti, Stefano; Lanconelli, Nico; Pattacini, Pierpaolo; Ginocchi, Vladimiro; Iori, Mauro

    2012-05-15

    Purpose: The purpose of this study is to compare digital radiography systems using the metric effective detective quantum efficiency (eDQE), which better reflects digital radiography imaging system performance under clinical operating conditions, in comparison with conventional metrics such as modulation transfer function (MTF), normalized noise power spectra (NNPS), and detective quantum efficiency (DQE). Methods: The eDQE was computed by the calculation of the MTF, the NNPS, the phantom attenuation and scatter, and estimation of x-ray flux. The physical characterization of the systems was obtained with the standard beam conditions RQA5 and RQA9, using the PA Chest phantom proposed by AAPM Report no. 31 simulating the attenuation and scatter characteristics of the adult human thorax. The MTF (eMTF) was measured by using an edge test placed at the frontal surface of the phantom, the NNPS (eNNPS) was calculated from images of the phantom acquired at three different exposure levels covering the operating range of the system (E{sub 0}, which is the exposure at which a system is normally operated, 1/3 E{sub 0}, and 3 E0), and scatter measurements were assessed by using a beam-stop technique. The integral of DQE (IDQE) and eDQE (IeDQE) was calculated over the whole spatial frequency range. Results: The eMTF results demonstrate degradation due to magnification and the presence of scattered radiation. The eNNPS was influenced by the grid presence, and in some systems, it contained structured noise. At typical clinical exposure levels, the magnitude of eDQE(0) with respect to DQE(0) at RQA9 beam conditions was 13%, 17%, 16%, 36%, and 24%, respectively, for Carestream DRX-1, Carestream DRX-1C, Carestream Direct View CR975, Philips Digital Diagnost VM, and GE Revolution XR/d. These results were confirmed by the ratio of IeDQE and IDQE in the same conditions. Conclusions: The authors confirm the robustness and reproducibility of the eDQE method. As expected, the DR systems

  18. Detection of Adult Beetles Inside the Stored Wheat Mass Based on Their Acoustic Emissions.

    PubMed

    Eliopoulos, P A; Potamitis, I; Kontodimas, D Ch; Givropoulou, E G

    2015-12-01

    The efficacy of bioacoustics in detecting the presence of adult beetles inside the grain mass was evaluated in the laboratory. A piezoelectric sensor and a portable acoustic emission amplifier connected with a computer were used. Adults of the most common beetle pests of stored wheat have been detected in varying population densities (0.1, 0.5, 1, and 2 adults per kilogram of wheat). The verification of the presence of the insect individuals was achieved through automated signal parameterization and classification. We tried out two different ways to detect impulses: 1) by applying a Hilbert transform on the audio recording and 2) by subtracting a noise estimation of the recording from the spectral content of the recording, thus allowing the frequency content of possible impulses to emerge. Prediction for infestation was rated falsely negative in 60-74%, 48-60%, 0-28%, and 0-4% of the cases when actual population density was 0.1, 0.5, 1, and 2 adults per kilogram, respectively, irrespective of pest species. No significant differences were recorded in positive predictions among different species in almost all cases. The system was very accurate (72-100%) in detecting 1 or 2 insects per kilogram of hard wheat grain, which is the standard threshold for classifying a grain mass "clean" or "infested." Our findings are discussed on the basis of enhancing the use of bioacoustics in stored-product IPM framework.

  19. Olfactory Detection Thresholds and Adaptation in Adults with Autism Spectrum Condition

    ERIC Educational Resources Information Center

    Tavassoli, T.; Baron-Cohen, S.

    2012-01-01

    Sensory issues have been widely reported in Autism Spectrum Conditions (ASC). Since olfaction is one of the least investigated senses in ASC, the current studies explore olfactory detection thresholds and adaptation to olfactory stimuli in adults with ASC. 80 participants took part, 38 (18 females, 20 males) with ASC and 42 control participants…

  20. Plagiarism by Adult Learners Online: A Case Study in Detection and Remediation

    ERIC Educational Resources Information Center

    Jocoy, Christine; DiBiase, David

    2006-01-01

    Detecting and combating plagiarism from Web-based sources is a concern for administrators and instructors involved in online distance education. In this paper, we quantify copy-and-paste plagiarism among adult learners in an online geography course offered through Penn State's World Campus Geographic Information Systems (GIS) certificate program.…

  1. A Curriculum Structured Design for Educating Adults in Detecting Deception and Eliciting Information

    ERIC Educational Resources Information Center

    McManus, Barry L.

    2013-01-01

    This dissertation describes the overall effectiveness of deception detection training and identifies conditions that may enhance training effectiveness through understanding how adults learn and utilizing scenario-based training. The analysis was based on a total of 1,788 evaluation data sheets (archival records). The major aim of the research is…

  2. Efficient Uptake and Dissemination of Scrapie Prion Protein by Astrocytes and Fibroblasts from Adult Hamster Brain

    PubMed Central

    Hollister, Jason R.; Lee, Kil Sun; Dorward, David W.; Baron, Gerald S.

    2015-01-01

    Prion infections target neurons and lead to neuronal loss. However, the role of non-neuronal cells in the initiation and spread of infection throughout the brain remains unclear despite the fact these cells can also propagate prion infectivity. To evaluate how different brain cells process scrapie prion protein (PrPres) during acute infection, we exposed neuron-enriched and non-neuronal cell cultures from adult hamster brain to fluorescently-labeled purified PrPres and followed the cultures by live cell confocal imaging over time. Non-neuronal cells present in both types of cultures, specifically astrocytes and fibroblasts, internalized PrPres more efficiently than neurons. PrPres was trafficked to late endosomal/lysosomal compartments and rapidly transported throughout the cell bodies and processes of all cell types, including contacts between astrocytes and neurons. These observations suggest that astrocytes and meningeal fibroblasts play an as yet unappreciated role in prion infections via efficient uptake and dissemination of PrPres. PMID:25635871

  3. Efficient uptake and dissemination of scrapie prion protein by astrocytes and fibroblasts from adult hamster brain.

    PubMed

    Hollister, Jason R; Lee, Kil Sun; Dorward, David W; Baron, Gerald S

    2015-01-01

    Prion infections target neurons and lead to neuronal loss. However, the role of non-neuronal cells in the initiation and spread of infection throughout the brain remains unclear despite the fact these cells can also propagate prion infectivity. To evaluate how different brain cells process scrapie prion protein (PrPres) during acute infection, we exposed neuron-enriched and non-neuronal cell cultures from adult hamster brain to fluorescently-labeled purified PrPres and followed the cultures by live cell confocal imaging over time. Non-neuronal cells present in both types of cultures, specifically astrocytes and fibroblasts, internalized PrPres more efficiently than neurons. PrPres was trafficked to late endosomal/lysosomal compartments and rapidly transported throughout the cell bodies and processes of all cell types, including contacts between astrocytes and neurons. These observations suggest that astrocytes and meningeal fibroblasts play an as yet unappreciated role in prion infections via efficient uptake and dissemination of PrPres.

  4. And along Came a Spider: An Attentional Bias for the Detection of Spiders in Young Children and Adults

    ERIC Educational Resources Information Center

    LoBue, Vanessa

    2010-01-01

    Spiders are among the most common targets of fears and phobias in the world. In visual search tasks, adults detect their presence more rapidly than other kinds of stimuli. Reported here is an investigation of whether young children share this attentional bias for the detection of spiders. In a series of experiments, preschoolers and adults were…

  5. Application of the EXtrapolated Efficiency Method (EXEM) to infer the gamma-cascade detection efficiency in the actinide region

    NASA Astrophysics Data System (ADS)

    Ducasse, Q.; Jurado, B.; Mathieu, L.; Marini, P.; Morillon, B.; Aiche, M.; Tsekhanovich, I.

    2016-08-01

    The study of transfer-induced gamma-decay probabilities is very useful for understanding the surrogate-reaction method and, more generally, for constraining statistical-model calculations. One of the main difficulties in the measurement of gamma-decay probabilities is the determination of the gamma-cascade detection efficiency. In Boutoux et al. (2013) [10] we developed the EXtrapolated Efficiency Method (EXEM), a new method to measure this quantity. In this work, we have applied, for the first time, the EXEM to infer the gamma-cascade detection efficiency in the actinide region. In particular, we have considered the 238U(d,p)239U and 238U(3He,d)239Np reactions. We have performed Hauser-Feshbach calculations to interpret our results and to verify the hypothesis on which the EXEM is based. The determination of fission and gamma-decay probabilities of 239Np below the neutron separation energy allowed us to validate the EXEM.

  6. Effects of age on searching for and enumerating targets that cannot be detected efficiently.

    PubMed

    Watson, Derrick G; Maylor, Elizabeth A; Bruce, Lucy A M

    2005-08-01

    We investigated the effects of old age on search, subitizing, and counting of difficult-to-find targets. In Experiment 1, young and older adults enumerated targets (Os) with and without distractors (Qs). Without distractors, the usual subitization-counting function occurred in both groups, with the same subitization span of 3.3 items. Subitization disappeared with distractors; older adults were slowed more overall by their presence but enumeration rates were not slowed by ageing either with or without distractors. In contrast, search rates for a single target (O among Qs) were twice as slow for older as for young adults. Experiment 2 tested and ruled out one account of age-equivalent serial enumeration based on the need to subvocalize numbers as items are enumerated. Alternative explanations based on the specific task differences between detecting and enumerating stimuli are discussed.

  7. Natural and synthetic antifibrinolytics in adult cardiac surgery: efficacy, effectiveness and efficiency.

    PubMed

    Hardy, J F; Bélisle, S

    1994-11-01

    Epsilon-aminocaproic acid and tranexamic acid, two synthetic antifibrinolytics, and aprotinin, an antifibrinolytic derived from bovine lung, are used to reduce excessive bleeding and transfusion of homologous blood products (HBP) after cardiac surgery. This review analyzes the studies on the utilization of antifibrinolytics in adult cardiac surgery according to the epidemiological concepts of efficacy, effectiveness and efficiency. A majority of published studies confirm the efficacy of antifibrinolytics administered prophylactically to reduce postoperative bleeding and transfusion of HBP. More studies are needed, however, to compare antifibrinolytics and determine if any one is superior to the others. Despite their demonstrated efficacy, antifibrinolytics are only one of the options available to diminish the use of HBP. Other blood-saving techniques, surgical expertise, temperature during cardiopulmonary bypass and respect of established transfusion guidelines may modify the effectiveness of antifibrinolytics to the point where antifibrinolytics may not be necessary. At this time, insufficient data have been published to perform a cost vs benefit analysis of the use of antifibrinolytics. This complex analysis takes into account not only direct costs (cost of the drug and of blood products), but also the ensuing effects of treatment such as: length of stay in the operating room, in the intensive care unit and in the hospital; need for surgical re-exploration; treatment of transfusion or drug-related complications, etc. In particular, the risk of thrombotic complications associated with antifibrinolytics is the subject of an ongoing, unresolved controversy.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Guidelines for calculating and enhancing detection efficiency of PIT tag interrogation systems

    USGS Publications Warehouse

    Connolly, Patrick J.

    2010-01-01

    With increasing use of passive integrated transponder (PIT) tags and reliance on stationary PIT tag interrogation systems to monitor fish populations, guidelines are offered to inform users how best to use limited funding and human resources to create functional systems that maximize a desired level of detection and precision. The estimators of detection efficiency and their variability as described by Connolly et al. (2008) are explored over a span of likely performance metrics. These estimators were developed to estimate detection efficiency without relying on a known number of fish passing the system. I present graphical displays of the results derived from these estimators to show the potential efficiency and precision to be gained by adding an array or by increasing the number of PIT-tagged fish expected to move past an interrogation system.

  9. Why cannot a β-lactamase gene be detected using an efficient molecular diagnostic method?

    PubMed Central

    Park, Kwang Seung; Lee, Jung Hun; Park, Moonhee; Karim, Asad Mustafa; Lee, Sang Hee

    2016-01-01

    Objective: Fast detection of β-lactamase (bla) genes can minimize the spread of antibiotic resistance. Although several molecular diagnostic methods have been developed to detect limited bla gene types, these methods have significant limitations, such as their failure to detect almost all clinically available bla genes. We have evaluated a further refinement of our fast and accurate molecular method, developed to overcome these limitations, using clinical isolates. Methods: We have recently developed the efficient large-scale bla detection method (large-scaleblaFinder) that can detect bla gene types including almost all clinically available 1,352 bla genes with perfect specificity and sensitivity. Using this method, we have evaluated a further refinement of this method using clinical isolates provided by International Health Management Associates, Inc. (Schaumburg, Illinois, USA). Results were interpreted in a blinded manner by researchers who did not know any information on bla genes harbored by these isolates. Results: With only one exception, the large-scaleblaFinder detected all bla genes identified by the provider using microarray and multiplex PCR. In one of the Escherichia coli test isolates, a blaDHA-1 gene was detected using the multiplex PCR assay but it was not detected using the large-scaleblaFinder. Conclusion: The truncation of a blaDHA-1 gene is an important reason for an efficient molecular diagnostic method (large-scaleblaFinder) not to detect the bla gene. PMID:27882043

  10. Detection efficiency and noise in a semi-device-independent randomness-extraction protocol

    NASA Astrophysics Data System (ADS)

    Li, Hong-Wei; Yin, Zhen-Qiang; Pawłowski, Marcin; Guo, Guang-Can; Han, Zheng-Fu

    2015-03-01

    In this paper, we analyze several critical issues in semi-device-independent quantum information processing protocol. In practical experimental realization, randomness generation in that scenario is possible only if the efficiency of the detectors used is above a certain threshold. Our analysis shows that the critical detection efficiency is √{2/}2 in the symmetric setup, while in the asymmetric setup if one of the bases has perfect critical detection efficiency then the other one can be arbitrarily close to 0. We also analyze the semi-device-independent random-number-generation efficiency based on different averages of guessing probability. To generate more randomness, the proper averaging method should be applied. Its choice depends on the value of a certain dimension witness. More importantly, the general analytical relationship between the maximal average guessing probability and dimension witness is given.

  11. Rapid and efficient detection of single chromophore molecules in aqueous solution

    NASA Astrophysics Data System (ADS)

    Li, Li-Qiang; Davis, Lloyd M.

    1995-06-01

    The first experiments on the detection of single fluorescent molecules in a flowing stream of an aqueous solution with high total efficiency are reported. A capillary injection system for sample delivery causes all the dye molecules to pass in a diffusion-broadened stream within a fast-moving sheath flow, through the center of the tightly focused laser excitation beam. Single-molecule detection with a transit time of approximately 1 ms is accomplished with a high-quantum-efficiency single-photon avalanche diode and a low dead-time time-gating circuit for discrimination of Raman-scattered light from the solvent.

  12. An efficient tree classifier ensemble-based approach for pedestrian detection.

    PubMed

    Xu, Yanwu; Cao, Xianbin; Qiao, Hong

    2011-02-01

    Classification-based pedestrian detection systems (PDSs) are currently a hot research topic in the field of intelligent transportation. A PDS detects pedestrians in real time on moving vehicles. A practical PDS demands not only high detection accuracy but also high detection speed. However, most of the existing classification-based approaches mainly seek for high detection accuracy, while the detection speed is not purposely optimized for practical application. At the same time, the performance, particularly the speed, is primarily tuned based on experiments without theoretical foundations, leading to a long training procedure. This paper starts with measuring and optimizing detection speed, and then a practical classification-based pedestrian detection solution with high detection speed and training speed is described. First, an extended classification/detection speed metric, named feature-per-object (fpo), is proposed to measure the detection speed independently from execution. Then, an fpo minimization model with accuracy constraints is formulated based on a tree classifier ensemble, where the minimum fpo can guarantee the highest detection speed. Finally, the minimization problem is solved efficiently by using nonlinear fitting based on radial basis function neural networks. In addition, the optimal solution is directly used to instruct classifier training; thus, the training speed could be accelerated greatly. Therefore, a rapid and accurate classification-based detection technique is proposed for the PDS. Experimental results on urban traffic videos show that the proposed method has a high detection speed with an acceptable detection rate and a false-alarm rate for onboard detection; moreover, the training procedure is also very fast.

  13. Minimum detection efficiencies for a loophole-free observable-asymmetric Bell-type test

    SciTech Connect

    Garbarino, G.

    2010-03-15

    We discuss the problem of finding the most favorable conditions for closing the detection loophole in a test of local realism with a Bell inequality. For a generic nonmaximally entangled two-qubit state and two incompatible bases to be adopted for alternative measurements of two observables a and b on each party, we apply Hardy's proof of nonlocality without inequality and derive an Eberhard-like inequality. For an infinity of nonmaximally entangled states we find that it is possible to refute local realism by requiring perfect detection efficiency for only one of the two observables, say b, to be measured on each party: The test is free from the detection loophole for any value of the detection efficiency corresponding to the other observable a. The maximum tolerable noise in such a loophole-free observable-asymmetric test is also evaluated.

  14. Detection efficiency, spatial and timing resolution of thermal and cold neutron counting MCP detectors

    NASA Astrophysics Data System (ADS)

    Tremsin, A. S.; McPhate, J. B.; Vallerga, J. V.; Siegmund, O. H. W.; Hull, J. S.; Feller, W. B.; Lehmann, E.

    2009-06-01

    Neutron counting detectors with boron or gadolinium doped microchannel plates (MCPs) have very high detection efficiency, spatial and temporal resolution, and have a very low readout noise. In this paper we present the results of both theoretical predictions and experimental evaluations of detection efficiency and spatial resolution measured at cold and thermal neutron beamlines. The quantum detection efficiency of a detector (not fully optimized) was measured to be 43% and 16% for the cold and thermal beamlines, respectively. The experiments also demonstrate that the spatial resolution can be better than 15 μm—highest achievable with the particular MCP pore dimension used in the experiment, although more electronics development is required in order to increase the counting rate capabilities of those <15 μm resolution devices. The timing accuracy of neutron detection is on the scale of few μs and is limited by the neutron absorption depth in the detector. The good agreement between the predicted and measured performance allows the optimization of the detector parameters in order to achieve the highest spatial resolution and detection efficiency in future devices.

  15. Clinical relevance of multiple respiratory virus detection in adult patients with acute respiratory illness.

    PubMed

    Choi, Seong-Ho; Chung, Jin-Won; Kim, Hye Ryoun

    2015-04-01

    Because increasing numbers of nasopharyngeal swab specimens from adult patients with acute respiratory illness (ARI) are being tested by respiratory virus (RV) multiplex reverse transcriptase PCR (RVM-RT-PCR), multiple RV detection (MRVD) is being encountered more frequently. However, the clinical relevance of MRVD in adult patients has rarely been evaluated. The clinical characteristics of hospitalized adult patients with ARI and MRVD by RVM-RT-PCR tests were compared to those of patients with single RV detection (SRVD) during a single year at a tertiary care center. MRVD was observed in 26 of the 190 adult patients (13.7%). The patients with MRVD had a higher incidence of chronic lung disease than the patients with SRVD (34.6% versus 15.9%, crude odds ratio [OR]=2.81, 95% confidence interval [CI]=1.13 to 6.98, P=0.03). Although the former were more likely than the latter to receive mechanical ventilation (19.2% versus 6.7%, crude OR=3.31, 95% CI=1.05 to 10.47, P=0.049), the length of hospital stay (median, 7 versus 6.5 days; P=0.66), and the in-hospital mortality rate (7.7% versus 4.3%, crude OR=1.87, 95% CI=0.37 to 9.53, P=0.35) were not different between the two groups. In multivariate analysis, chronic lung disease was associated with MRVD (adjusted OR=3.08, 95% CI=1.12 to 8.46, P=0.03). In summary, it was not uncommon to encounter adult patients with ARI and MRVD by RVM-RT-PCR tests of nasopharyngeal swab specimens. MRVD was associated with chronic lung disease rather than the severity of the ARI.

  16. Efficient fold-change detection based on protein-protein interactions.

    PubMed

    Buijsman, W; Sheinman, M

    2014-02-01

    Various biological sensory systems exhibit a response to a relative change of the stimulus, often referred to as fold-change detection. In the past few years, fold-change detecting mechanisms, based on transcriptional networks, have been proposed. Here we present a fold-change detecting mechanism, based on protein-protein interactions, consisting of two interacting proteins. This mechanism does not consume chemical energy and is not subject to transcriptional and translational noise, in contrast to previously proposed mechanisms. We show by analytical and numerical calculations that the mechanism is robust and can have a fast, precise, and efficient response for parameters that are relevant to eukaryotic cells.

  17. Efficient fold-change detection based on protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Buijsman, W.; Sheinman, M.

    2014-02-01

    Various biological sensory systems exhibit a response to a relative change of the stimulus, often referred to as fold-change detection. In the past few years, fold-change detecting mechanisms, based on transcriptional networks, have been proposed. Here we present a fold-change detecting mechanism, based on protein-protein interactions, consisting of two interacting proteins. This mechanism does not consume chemical energy and is not subject to transcriptional and translational noise, in contrast to previously proposed mechanisms. We show by analytical and numerical calculations that the mechanism is robust and can have a fast, precise, and efficient response for parameters that are relevant to eukaryotic cells.

  18. Fall detection in homes of older adults using the Microsoft Kinect.

    PubMed

    Stone, Erik E; Skubic, Marjorie

    2015-01-01

    A method for detecting falls in the homes of older adults using the Microsoft Kinect and a two-stage fall detection system is presented. The first stage of the detection system characterizes a person's vertical state in individual depth image frames, and then segments on ground events from the vertical state time series obtained by tracking the person over time. The second stage uses an ensemble of decision trees to compute a confidence that a fall preceded on a ground event. Evaluation was conducted in the actual homes of older adults, using a combined nine years of continuous data collected in 13 apartments. The dataset includes 454 falls, 445 falls performed by trained stunt actors and nine naturally occurring resident falls. The extensive data collection allows for characterization of system performance under real-world conditions to a degree that has not been shown in other studies. Cross validation results are included for standing, sitting, and lying down positions, near (within 4 m) versus far fall locations, and occluded versus not occluded fallers. The method is compared against five state-of-the-art fall detection algorithms and significantly better results are achieved.

  19. VirusDetect: An automated pipeline for efficient virus discovery using deep sequencing of small RNAs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate detection of viruses in plants and animals is critical for agriculture production and human health. Deep sequencing and assembly of virus-derived siRNAs has proven to be a highly efficient approach for virus discovery. However, to date no computational tools specifically designed for both k...

  20. Enhanced soft X-ray detection efficiencies for imaging microchannel plate detectors

    NASA Astrophysics Data System (ADS)

    Fraser, G. W.; Barstow, M. A.; Whiteley, M. J.; Wells, A.

    1982-12-01

    Although the microchannel plate (MCP) electron multipliers used in X-ray astronomy facilitate X-ray imaging with high spatial resolution, their intrinsic soft X-ray detection efficiencies of 1-10 percent are much lower than the near-unity values available with competing gas proportional counters. A high photoelectric yield material may be deposited on the MCP front surface and channel walls in order to enhance X-ray sensitivity at energies below a few keV. High 0.18-1.5 keV X-ray detection efficiencies are reported for MCPs bearing CsI deposition photocathodes, by which efficiency enhancement factors of up to 15 have been obtained. These results are especially pertinent to the sensitivity of such future X-ray astronomy experiments as the Roentgensatellit (Rosat) Wide Field Camera.

  1. Splenic Doppler resistive index for early detection of occult hemorrhagic shock after polytrauma in adult patients.

    PubMed

    Corradi, Francesco; Brusasco, Claudia; Garlaschi, Alessandro; Santori, Gregorio; Vezzani, Antonella; Moscatelli, Paolo; Pelosi, Paolo

    2012-11-01

    The objective of this study was to evaluate whether direct assessment of splenic circulation by splenic Doppler resistive index (Doppler RI) is a clinically useful noninvasive method for an early detection of occult hemorrhagic shock after polytrauma in adult patients. Splenic Doppler RI was measured in 49 hemodynamically stable adult patients admitted to the emergency department because of polytrauma. Renal Doppler RI was also determined in 20 patients. Spleen size, Injury Severity Score, systolic blood pressure, heart rate, blood lactate, standard base excess, pH, hemoglobin, and inferior vena cava diameter values were recorded at admission and at 24 h. Patients were grouped according to whether signs of hemorrhagic shock did (n = 22) or did not (n = 27) occur within the first 24 h from admission. Patients who developed hemorrhagic shock had significantly higher splenic and renal Doppler RI, higher Injury Severity Score, and lower standard base excess at admission. By multivariate logistic regression, splenic Doppler RI resulted to be a predictor of hemorrhagic shock development within the first 24 h from admission. Splenic Doppler RI may represent a clinically useful noninvasive method for early detection of occult hemorrhagic shock and persistent occult hypoperfusion after polytrauma in adult patients.

  2. Determination of the detective quantum efficiency of a prototype, megavoltage indirect detection, active matrix flat-panel imager.

    PubMed

    El-Mohri, Y; Jee, K W; Antonuk, L E; Maolinbay, M; Zhao, Q

    2001-12-01

    After years of aggressive development, active matrix flat-panel imagers (AMFPIs) have recently become commercially available for radiotherapy imaging. In this paper we report on a comprehensive evaluation of the signal and noise performance of a large-area prototype AMFPI specifically developed for this application. The imager is based on an array of 512 x 512 pixels incorporating amorphous silicon photodiodes and thin-film transistors offering a 26 x 26 cm2 active area at a pixel pitch of 508 microm. This indirect detection array was coupled to various x-ray converters consisting of a commercial phosphor screen (Lanex Fast B, Lanex Regular, or Lanex Fine) and a 1 mm thick copper plate. Performance of the imager in terms of measured sensitivity, modulation transfer function (MTF), noise power spectra (NPS), and detective quantum efficiency (DQE) is reported at beam energies of 6 and 15 MV and at doses of 1 and 2 monitor units (MU). In addition, calculations of system performance (NPS, DQE) based on cascaded-system formalism were reported and compared to empirical results. In these calculations, the Swank factor and spatial energy distributions of secondary electrons within the converter were modeled by means of EGS4 Monte Carlo simulations. Measured MTFs of the system show a weak dependence on screen type (i.e., thickness), which is partially due to the spreading of secondary radiation. Measured DQE was found to be independent of dose for the Fast B screen, implying that the imager is input-quantum-limited at 1 MU, even at an extended source-to-detector distance of 200 cm. The maximum DQE obtained is around 1%--a limit imposed by the low detection efficiency of the converter. For thinner phosphor screens, the DQE is lower due to their lower detection efficiencies. Finally, for the Fast B screen, good agreement between calculated and measured DQE was observed.

  3. Fall Detection Devices and their Use with Older Adults: A Systematic Review

    PubMed Central

    Chaudhuri, Shomir; Thompson, Hilaire; Demiris, George

    2013-01-01

    Background Falls represent a significant threat to the health and independence of adults 65 years of age and older. As a wide variety and large amount of passive monitoring systems are currently and increasingly available to detect when an individual has fallen, there is a need to analyze and synthesize the evidence regarding their ability to accurately detect falls to determine which systems are most effective. Objectives The purpose of this literature review is to systematically assess the current state of design and implementation of fall detection devices. This review also examines the extent to which these devices have been tested in the real world as well as the acceptability of these devices to older adults. Data sources A systematic literature review was conducted in PubMed, CINAHL, EMBASE and PsycINFO from their respective inception dates to June 25, 2013. Study Eligibility Criteria and Interventions Articles were included if they discussed a project or multiple projects involving a system with the purpose of detecting a fall in adults. It was not a requirement for inclusion in this review that the system targets persons over the age of 65. Articles were excluded if they were not written in English or if they looked at fall risk, fall detection in children, fall prevention or a Personal Emergency Response device. Study appraisal and synthesis methods Studies were initially divided into those using sensitivity, specificity or accuracy in their evaluation methods, and those using other methods to evaluate their devices. Studies were further classified into wearable devices and non-wearable devices. Studies were appraised for inclusion of older adults in sample and if evaluation included real world settings. Results This review identified 57 projects that used wearable systems and 35 projects using non-wearable systems, regardless of evaluation technique. Non-wearable systems included cameras, motion sensors, microphones and floor sensors. Of the projects

  4. Charged-particle detection efficiencies of close-packed CsI arrays

    NASA Astrophysics Data System (ADS)

    Morfouace, P.; Lynch, W. G.; Tsang, M. B.

    2017-03-01

    Detector efficiency determination is essential to correct the measured yields and extract reliable cross sections of particles emitted in nuclear reactions. We investigate the efficiencies for measuring the full energies of light charged particle in arrays of CsI crystals employed in particle detection arrays such as HiRA, LASSA and MUST2. We perform these simulations with a GEANT4 Monte Carlo transport code implemented in the NPTool framework. Both Coulomb multiple scattering and nuclear reactions within the crystal can significantly reduce the efficiency of detecting the full energy of high energy particles. The calculated efficiencies decrease exponentially as a function of the range of the particle and are quite similar for both the hydrogen (p , d , t) and helium (3He, α) isotopes. The use of a close-packed array introduces significant position dependent efficiency losses at the interior boundaries between crystals that need to be considered in the design of an array and in the efficiency corrections of measured energy spectra.

  5. Hollow graphitic nanocapsules as efficient electrode materials for sensitive hydrogen peroxide detection.

    PubMed

    Liu, Wei-Na; Ding, Ding; Song, Zhi-Ling; Bian, Xia; Nie, Xiang-Kun; Zhang, Xiao-Bing; Chen, Zhuo; Tan, Weihong

    2014-02-15

    Carbon nanomaterials are typically used in electrochemical biosensing applications for their unique properties. We report a hollow graphitic nanocapsule (HGN) utilized as an efficient electrode material for sensitive hydrogen peroxide detection. Methylene blue (MB) molecules could be efficiently adsorbed on the HGN surfaces, and this adsorption capability remained very stable under different pH regimes. HGNs were used as three-dimensional matrices for coimmobilization of MB electron mediators and horseradish peroxidase (HRP) to build an HGN-HRP-MB reagentless amperometric sensing platform to detect hydrogen peroxide. This simple HGN-HRP-MB complex demonstrated very sensitive and selective hydrogen peroxide detection capability, as well as high reproducibility and stability. The HGNs could also be utilized as matrices for immobilization of other enzymes, proteins or small molecules and for different biomedical applications.

  6. High efficiency processing for reduced amplitude zones detection in the HRECG signal

    NASA Astrophysics Data System (ADS)

    Dugarte, N.; Álvarez, A.; Balacco, J.; Mercado, G.; Gonzalez, A.; Dugarte, E.; Olivares, A.

    2016-04-01

    Summary - This article presents part of a more detailed research proposed in the medium to long term, with the intention of establishing a new philosophy of electrocardiogram surface analysis. This research aims to find indicators of cardiovascular disease in its early stage that may go unnoticed with conventional electrocardiography. This paper reports the development of a software processing which collect some existing techniques and incorporates novel methods for detection of reduced amplitude zones (RAZ) in high resolution electrocardiographic signal (HRECG).The algorithm consists of three stages, an efficient processing for QRS detection, averaging filter using correlation techniques and a step for RAZ detecting. Preliminary results show the efficiency of system and point to incorporation of techniques new using signal analysis with involving 12 leads.

  7. Cost-efficient RGB-D smart camera for people detection and tracking

    NASA Astrophysics Data System (ADS)

    Carraro, Marco; Munaro, Matteo; Menegatti, Emanuele

    2016-07-01

    We describe a software library we developed for efficiently using the Kinect v2, a time-of-flight RGB-D sensor, with an embedded system, the NVidia Jetson TK1, as a cost-efficient RGB-D smart camera for people detection and tracking. The speed-up needed for achieving real-time operation has been obtained using NVidia CUDA to concurrently generate and process the raw depth and infrared data and to create the three-dimensional point cloud. This library has been released as open source and the smart camera has been tested in real-world scenarios, as a people-detection node in an open-source multinode RGB-D tracking system (OpenPTrack) and onboard a service robot for endowing it with robust people-following capabilities. Moreover, we show that nonembedded computers also can benefit from our library in terms of people-detection frame rate.

  8. Unsupervised Approaches for Post-Processing in Computationally Efficient Waveform-Similarity-Based Earthquake Detection

    NASA Astrophysics Data System (ADS)

    Bergen, K.; Yoon, C. E.; OReilly, O. J.; Beroza, G. C.

    2015-12-01

    Recent improvements in computational efficiency for waveform correlation-based detections achieved by new methods such as Fingerprint and Similarity Thresholding (FAST) promise to allow large-scale blind search for similar waveforms in long-duration continuous seismic data. Waveform similarity search applied to datasets of months to years of continuous seismic data will identify significantly more events than traditional detection methods. With the anticipated increase in number of detections and associated increase in false positives, manual inspection of the detection results will become infeasible. This motivates the need for new approaches to process the output of similarity-based detection. We explore data mining techniques for improved detection post-processing. We approach this by considering similarity-detector output as a sparse similarity graph with candidate events as vertices and similarities as weighted edges. Image processing techniques are leveraged to define candidate events and combine results individually processed at multiple stations. Clustering and graph analysis methods are used to identify groups of similar waveforms and assign a confidence score to candidate detections. Anomaly detection and classification are applied to waveform data for additional false detection removal. A comparison of methods will be presented and their performance will be demonstrated on a suspected induced and non-induced earthquake sequence.

  9. An Energy efficient application specific integrated circuit for electrocardiogram feature detection and its potential for ambulatory cardiovascular disease detection

    PubMed Central

    Bhaumik, Basabi

    2016-01-01

    A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm2. The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system. PMID:27284458

  10. An Energy efficient application specific integrated circuit for electrocardiogram feature detection and its potential for ambulatory cardiovascular disease detection.

    PubMed

    Jain, Sanjeev Kumar; Bhaumik, Basabi

    2016-03-01

    A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm(2). The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system.

  11. Lightening the load: perceptual load impairs visual detection in typical adults but not in autism.

    PubMed

    Remington, Anna M; Swettenham, John G; Lavie, Nilli

    2012-05-01

    Autism spectrum disorder (ASD) research portrays a mixed picture of attentional abilities with demonstrations of enhancements (e.g., superior visual search) and deficits (e.g., higher distractibility). Here we test a potential resolution derived from the Load Theory of Attention (e.g., Lavie, 2005). In Load Theory, distractor processing depends on the perceptual load of the task and as such can only be eliminated under high load that engages full capacity. We hypothesize that ASD involves enhanced perceptual capacity, leading to the superior performance and increased distractor processing previously reported. Using a signal-detection paradigm, we test this directly and demonstrate that, under higher levels of load, perceptual sensitivity was reduced in typical adults but not in adults with ASD. These findings confirm our hypothesis and offer a promising solution to the previous discrepancies by suggesting that increased distractor processing in ASD results not from a filtering deficit but from enhanced perceptual capacity.

  12. Tight detection efficiency bounds of Bell tests in no-signaling theories

    NASA Astrophysics Data System (ADS)

    Cao, Zhu; Peng, Tianyi

    2016-10-01

    No-signaling theories, which can contain nonlocal correlations stronger than quantum correlations but limited by the no-signaling condition, have deepened our understanding of the quantum theory. In practice, Bell tests are powerful tools to certify nonlocality, but their effectiveness is limited by the detector efficiency. In this work, we provide almost tight detection efficiency bounds for showing the nonlocality of no-signaling theories, by introducing a general class of Bell inequalities. In particular, we provide a tight bound for the bipartite case and an asymptotic tight bound for the multipartite case. The tightness of these bounds shows that they well characterize the structure of no-signaling theories. The bounds also imply that the detector efficiency requirement can be made arbitrarily low in both bipartite and multipartite cases by increasing the number of measurement settings. Furthermore, our work sheds light on the detector efficiency requirement for showing the nonlocality of the quantum theory.

  13. A computerized algorithm for arousal detection in healthy adults and patients with Parkinson disease.

    PubMed

    Sorensen, Gertrud L; Jennum, Poul; Kempfner, Jacob; Zoetmulder, Marielle; Sorensen, Helge B D

    2012-02-01

    Arousals occur from all sleep stages and can be identified as abrupt electroencephalogram (EEG) and electromyogram (EMG) changes. Manual scoring of arousals is time consuming with low interscore agreement. The aim of this study was to design an arousal detection algorithm capable of detecting arousals from non-rapid eye movement (REM) and REM sleep, independent of the subject's age and disease. The proposed algorithm uses features from EEG, EMG, and the manual sleep stage scoring as input to a feed-forward artificial neural network (ANN). The performance of the algorithm has been assessed using polysomnographic (PSG) recordings from a total of 24 subjects. Eight of the subjects were diagnosed with Parkinson disease (PD) and the rest (16) were healthy adults in various ages. The performance of the algorithm was validated in 3 settings: testing on the 8 patients with PD using the leave-one-out method, testing on the 16 healthy adults using the leave-one-out method, and finally testing on all 24 subjects using a 4-fold crossvalidation. For these 3 validations, the sensitivities were 89.8%, 90.3%, and 89.4%, and the positive predictive values (PPVs) were 88.8%, 89.4%, and 86.1%. These results are high compared with those of previously presented arousal detection algorithms and especially compared with the high interscore variability of manual scorings.

  14. Foot contact event detection using kinematic data in cerebral palsy children and normal adults gait.

    PubMed

    Desailly, Eric; Daniel, Yepremian; Sardain, Philippe; Lacouture, Patrick

    2009-01-01

    Initial contact (IC) and toe off (TO) times are essential measurements in the analysis of temporal gait parameters, especially in cerebral palsy (CP) gait analysis. A new gait event detection algorithm, called the high pass algorithm (HPA) has been developed and is discussed in this paper. Kinematics of markers on the heel and metatarsal are used. Their forward components are high pass filtered, to amplify the contact discontinuities, thus the local extrema of the processed signal correspond to IC and TO. The accuracy and precision of HPA are compared with the gold standard of foot contact event detection, that is, force plate measurements. Furthermore HPA is compared with two other kinematics methods. This study has been conducted on 20 CP children and on eight normal adults. For normal subjects all the methods performed equally well. True errors in HPA (mean+/-standard deviation) were found to be 1+/-23 ms for IC and 2+/-25 ms for TO in CP children. These results were significantly (p<0.05) more accurate and precise than those obtained using the other algorithms. Moreover, in the case of pathological gaits, the other methods are not suitable for IC detection when IC is flatfoot or forefoot. In conclusion, the HPA is a simple and robust algorithm, which performs equally well for adults and actually performs better when applied to the gait of CP children. It is therefore recommended as the method of choice.

  15. Differential efficiency among DNA extraction methods influences detection of the amphibian pathogen Batrachochytrium dendrobatidis.

    PubMed

    Bletz, M C; Rebollar, E A; Harris, R N

    2015-02-10

    Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is responsible for massive declines and extinctions of amphibians worldwide. The most common method for detecting Bd is quantitative polymerase chain reaction (qPCR). qPCR is a highly sensitive detection technique, but its ability to determine the presence and accurately quantify the amount of Bd is also contingent on the efficiency of the DNA extraction method used prior to PCR. Using qPCR, we compared the extraction efficiency of 3 different extraction methods commonly used for Bd detection across a range of zoospore quantities: PrepMan Ultra Reagent, Qiagen DNeasy Blood and Tissue Kit, and Mobio PowerSoil DNA Isolation Kit. We show that not all extraction methods led to successful detection of Bd for the low zoospore quantities and that there was variation in the estimated zoospore equivalents among the methods, which demonstrates that these methods have different extraction efficiencies. These results highlight the importance of considering the extraction method when comparing across studies. The Qiagen DNeasy kit had the highest efficiency. We also show that replicated estimates of less than 1 zoospore can result from known zoospore concentrations; therefore, such results should be considered when obtained from field data. Additionally, we discuss the implications of our findings for interpreting previous studies and for conducting future Bd surveys. It is imperative to use the most efficient DNA extraction method in tandem with the highly sensitive qPCR technique in order to accurately diagnose the presence of Bd as well as other pathogens.

  16. Efficiency of portable antennas for detecting passive integrated transponder tags in stream-dwelling salmonids

    USGS Publications Warehouse

    Banish, Nolan P.; Burdick, Summer M.; Moyer, Katherine R.

    2016-01-01

    Portable antennas have become an increasingly common technique for tracking fish marked with passive integrated transponder (PIT) tags. We used logistic regression to evaluate how species, fish length, and physical habitat characteristics influence portable antenna detection efficiency in stream-dwelling brown trout (Salmo trutta), bull trout (Salvelinus confluentus), and redband trout (Oncorhynchus mykiss newberrii) marked with 12-mm PIT tags. We redetected 56% (20/36) of brown trout, 34% (68/202) of bull trout, and 33% (20/61) of redband trout after a recovery period of 21 to 46 hours. Models indicate support for length and species and minor support for percent boulder, large woody debris, and percent cobble as parameters important for describing variation in detection efficiency, although 95% confidence intervals for estimates were large. The odds of detecting brown trout (1.5 ± 2.2 [mean ± SE]) are approximately four times as high as bull trout (0.4 ± 1.6) or redband trout (0.3 ± 1.8) and species-specific differences may be related to length. Our reported detection efficiency for brown trout falls within the range of other studies, but is the first reported for bull trout and redband trout. Portable antennas may be a relatively unbiased way of redetecting varying sizes of all three salmonid species.

  17. Efficiency of Portable Antennas for Detecting Passive Integrated Transponder Tags in Stream-Dwelling Salmonids.

    PubMed

    Banish, Nolan P; Burdick, Summer M; Moyer, Katherine R

    2016-01-01

    Portable antennas have become an increasingly common technique for tracking fish marked with passive integrated transponder (PIT) tags. We used logistic regression to evaluate how species, fish length, and physical habitat characteristics influence portable antenna detection efficiency in stream-dwelling brown trout (Salmo trutta), bull trout (Salvelinus confluentus), and redband trout (Oncorhynchus mykiss newberrii) marked with 12-mm PIT tags. We redetected 56% (20/36) of brown trout, 34% (68/202) of bull trout, and 33% (20/61) of redband trout after a recovery period of 21 to 46 hours. Models indicate support for length and species and minor support for percent boulder, large woody debris, and percent cobble as parameters important for describing variation in detection efficiency, although 95% confidence intervals for estimates were large. The odds of detecting brown trout (1.5 ± 2.2 [mean ± SE]) are approximately four times as high as bull trout (0.4 ± 1.6) or redband trout (0.3 ± 1.8) and species-specific differences may be related to length. Our reported detection efficiency for brown trout falls within the range of other studies, but is the first reported for bull trout and redband trout. Portable antennas may be a relatively unbiased way of redetecting varying sizes of all three salmonid species.

  18. Efficiency of Portable Antennas for Detecting Passive Integrated Transponder Tags in Stream-Dwelling Salmonids

    PubMed Central

    Moyer, Katherine R.

    2016-01-01

    Portable antennas have become an increasingly common technique for tracking fish marked with passive integrated transponder (PIT) tags. We used logistic regression to evaluate how species, fish length, and physical habitat characteristics influence portable antenna detection efficiency in stream-dwelling brown trout (Salmo trutta), bull trout (Salvelinus confluentus), and redband trout (Oncorhynchus mykiss newberrii) marked with 12-mm PIT tags. We redetected 56% (20/36) of brown trout, 34% (68/202) of bull trout, and 33% (20/61) of redband trout after a recovery period of 21 to 46 hours. Models indicate support for length and species and minor support for percent boulder, large woody debris, and percent cobble as parameters important for describing variation in detection efficiency, although 95% confidence intervals for estimates were large. The odds of detecting brown trout (1.5 ± 2.2 [mean ± SE]) are approximately four times as high as bull trout (0.4 ± 1.6) or redband trout (0.3 ± 1.8) and species-specific differences may be related to length. Our reported detection efficiency for brown trout falls within the range of other studies, but is the first reported for bull trout and redband trout. Portable antennas may be a relatively unbiased way of redetecting varying sizes of all three salmonid species. PMID:26901317

  19. Efficiency of Airborne Sample Analysis Platform (ASAP) bioaerosol sampler for pathogen detection

    PubMed Central

    Sharma, Anurag; Clark, Elizabeth; McGlothlin, James D.; Mittal, Suresh K.

    2015-01-01

    The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP) 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3) in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5 × 103 plaque-forming units (p.f.u.) [2 × 105 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection. PMID:26074900

  20. Determining the Detection Efficiency and Background Level of ATIC Electron Observation from Flight Data

    NASA Technical Reports Server (NTRS)

    Chang, J.; Wu, J.; Guzik, T. G.; Wefel, J. P.; Isbert, J.; Adams, J. H., Jr.; Christl, M.; Watts, J.; Ahn, H. S.; Kim, K. C.; Seo, E. S.; Wu, J.; Bashindzhagyan, G. L.; Kouznetsov, E. N.; Panasyuk, M. I.; Sokolskaya, N. V.; Panov, A. D.; Zatsepin, V. I.

    2009-01-01

    Observations of Cosmic-ray electrons are difficult due to the large flux of cosmic ray hadrons. The event selection efficiency and background levels can be estimated from flight data for the ATIC instrument. This reduces the dependence upon Monte Carlo simulations, which show differences between different codes, thereby reducing the systematic errors resulting from analyses that only use simulations. This paper discusses some of the methods used in the ATIC analysis to determine the detection efficiency and background level for the flight data.

  1. Recombinant adeno-associated viral (rAAV) vectors mediate efficient gene transduction in cultured neonatal and adult microglia.

    PubMed

    Su, Wei; Kang, John; Sopher, Bryce; Gillespie, James; Aloi, Macarena S; Odom, Guy L; Hopkins, Stephanie; Case, Amanda; Wang, David B; Chamberlain, Jeffrey S; Garden, Gwenn A

    2016-01-01

    Microglia are a specialized population of myeloid cells that mediate CNS innate immune responses. Efforts to identify the cellular and molecular mechanisms that regulate microglia behaviors have been hampered by the lack of effective tools for manipulating gene expression. Cultured microglia are refractory to most chemical and electrical transfection methods, yielding little or no gene delivery and causing toxicity and/or inflammatory activation. Recombinant adeno-associated viral (rAAVs) vectors are non-enveloped, single-stranded DNA vectors commonly used to transduce many primary cell types and tissues. In this study, we evaluated the feasibility and efficiency of utilizing rAAV serotype 2 (rAAV2) to modulate gene expression in cultured microglia. rAAV2 yields high transduction and causes minimal toxicity or inflammatory response in both neonatal and adult microglia. To demonstrate that rAAV transduction can induce functional protein expression, we used rAAV2 expressing Cre recombinase to successfully excise a LoxP-flanked miR155 gene in cultured microglia. We further evaluated rAAV serotypes 5, 6, 8, and 9, and observed that all efficiently transduced cultured microglia to varying degrees of success and caused little or no alteration in inflammatory gene expression. These results provide strong encouragement for the application of rAAV-mediated gene expression in microglia for mechanistic and therapeutic purposes. Neonatal microglia are functionally distinct from adult microglia, although the majority of in vitro studies utilize rodent neonatal microglia cultures because of difficulties of culturing adult cells. In addition, cultured microglia are refractory to most methods for modifying gene expression. Here, we developed a novel protocol for culturing adult microglia and evaluated the feasibility and efficiency of utilizing Recombinant Adeno-Associated Virus (rAAV) to modulate gene expression in cultured microglia.

  2. Multiplexed efficient on-chip sample preparation and sensitive amplification-free detection of Ebola virus.

    PubMed

    Du, K; Cai, H; Park, M; Wall, T A; Stott, M A; Alfson, K J; Griffiths, A; Carrion, R; Patterson, J L; Hawkins, A R; Schmidt, H; Mathies, R A

    2017-05-15

    An automated microfluidic sample preparation multiplexer (SPM) has been developed and evaluated for Ebola virus detection. Metered air bubbles controlled by microvalves are used to improve bead-solution mixing thereby enhancing the hybridization of the target Ebola virus RNA with capture probes bound to the beads. The method uses thermally stable 4-formyl benzamide functionalized (4FB) magnetic beads rather than streptavidin coated beads with a high density of capture probes to improve the target capture efficiency. Exploiting an on-chip concentration protocol in the SPM and the single molecule detection capability of the antiresonant reflecting optical waveguide (ARROW) biosensor chip, a detection limit of 0.021pfu/mL for clinical samples is achieved without target amplification. This RNA target capture efficiency is two orders of magnitude higher than previous results using streptavidin beads and the limit of detection (LOD) improves 10×. The wide dynamic range of this technique covers the whole clinically applicable concentration range. In addition, the current sample preparation time is ~1h which is eight times faster than previous work. This multiplexed, miniaturized sample preparation microdevice establishes a key technology that intended to develop next generation point-of-care (POC) detection system.

  3. Efficient and robust quantum random number generation by photon number detection

    SciTech Connect

    Applegate, M. J.; Thomas, O.; Dynes, J. F.; Yuan, Z. L.; Shields, A. J.; Ritchie, D. A.

    2015-08-17

    We present an efficient and robust quantum random number generator based upon high-rate room temperature photon number detection. We employ an electric field-modulated silicon avalanche photodiode, a type of device particularly suited to high-rate photon number detection with excellent photon number resolution to detect, without an applied dead-time, up to 4 photons from the optical pulses emitted by a laser. By both measuring and modeling the response of the detector to the incident photons, we are able to determine the illumination conditions that achieve an optimal bit rate that we show is robust against variation in the photon flux. We extract random bits from the detected photon numbers with an efficiency of 99% corresponding to 1.97 bits per detected photon number yielding a bit rate of 143 Mbit/s, and verify that the extracted bits pass stringent statistical tests for randomness. Our scheme is highly scalable and has the potential of multi-Gbit/s bit rates.

  4. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses.

    PubMed

    Yanagisawa, Hironobu; Tomita, Reiko; Katsu, Koji; Uehara, Takuya; Atsumi, Go; Tateda, Chika; Kobayashi, Kappei; Sekine, Ken-Taro

    2016-03-07

    The presence of high molecular weight double-stranded RNA (dsRNA) within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing) analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS) would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV), a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt) that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT)-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as "DECS-C," is a powerful method for detecting novel plant viruses.

  5. Efficient and robust quantum random number generation by photon number detection

    NASA Astrophysics Data System (ADS)

    Applegate, M. J.; Thomas, O.; Dynes, J. F.; Yuan, Z. L.; Ritchie, D. A.; Shields, A. J.

    2015-08-01

    We present an efficient and robust quantum random number generator based upon high-rate room temperature photon number detection. We employ an electric field-modulated silicon avalanche photodiode, a type of device particularly suited to high-rate photon number detection with excellent photon number resolution to detect, without an applied dead-time, up to 4 photons from the optical pulses emitted by a laser. By both measuring and modeling the response of the detector to the incident photons, we are able to determine the illumination conditions that achieve an optimal bit rate that we show is robust against variation in the photon flux. We extract random bits from the detected photon numbers with an efficiency of 99% corresponding to 1.97 bits per detected photon number yielding a bit rate of 143 Mbit/s, and verify that the extracted bits pass stringent statistical tests for randomness. Our scheme is highly scalable and has the potential of multi-Gbit/s bit rates.

  6. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.

    PubMed Central

    Toba, G; Ohsako, T; Miyata, N; Ohtsuka, T; Seong, K H; Aigaki, T

    1999-01-01

    We have constructed a P-element-based gene search vector for efficient detection of genes in Drosophila melanogaster. The vector contains two copies of the upstream activating sequence (UAS) enhancer adjacent to a core promoter, one copy near the terminal inverted repeats at each end of the vector, and oriented to direct transcription outward. Genes were detected on the basis of phenotypic changes caused by GAL4-dependent forced expression of vector-flanking DNA, and the transcripts were identified with reverse transcriptase PCR (RT-PCR) using the vector-specific primer and followed by direct sequencing. The system had a greater sensitivity than those already in use for gain-of-function screening: 64% of the vector insertion lines (394/613) showed phenotypes with forced expression of vector-flanking DNA, such as lethality or defects in adult structure. Molecular analysis of 170 randomly selected insertions with forced expression phenotypes revealed that 21% matched the sequences of cloned genes, and 18% matched reported expressed sequence tags (ESTs). Of the insertions in cloned genes, 83% were upstream of the protein-coding region. We discovered two new genes that showed sequence similarity to human genes, Ras-related protein 2 and microsomal glutathione S-transferase. The system can be useful as a tool for the functional mapping of the Drosophila genome. PMID:9927464

  7. Face repetition detection and social interest: An ERP study in adults with and without Williams syndrome.

    PubMed

    Key, Alexandra P; Dykens, Elisabeth M

    2016-12-01

    The present study examined possible neural mechanisms underlying increased social interest in persons with Williams syndrome (WS). Visual event-related potentials (ERPs) during passive viewing were used to compare incidental memory traces for repeated vs. single presentations of previously unfamiliar social (faces) and nonsocial (houses) images in 26 adults with WS and 26 typical adults. Results indicated that participants with WS developed familiarity with the repeated faces and houses (frontal N400 response), but only typical adults evidenced the parietal old/new effect (previously associated with stimulus recollection) for the repeated faces. There was also no evidence of exceptional salience of social information in WS, as ERP markers of memory for repeated faces vs. houses were not significantly different. Thus, while persons with WS exhibit behavioral evidence of increased social interest, their processing of social information in the absence of specific instructions may be relatively superficial. The ERP evidence of face repetition detection in WS was independent of IQ and the earlier perceptual differentiation of social vs. nonsocial stimuli. Large individual differences in ERPs of participants with WS may provide valuable information for understanding the WS phenotype and have relevance for educational and treatment purposes.

  8. Ion generation and CPC detection efficiency studies in sub 3-nm size range

    SciTech Connect

    Kangasluoma, J.; Junninen, H.; Sipilae, M.; Kulmala, M.; Petaejae, T.; Lehtipalo, K.; Mikkilae, J.; Vanhanen, J.; Attoui, M.; Worsnop, D.

    2013-05-24

    We studied the chemical composition of commonly used condensation particle counter calibration ions with a mass spectrometer and found that in our calibration setup the negatively charged ammonium sulphate, sodium chloride and tungsten oxide are the least contaminated whereas silver on both positive and negative and the three mentioned earlier in positive mode are contaminated with organics. We report cut-off diameters for Airmodus Particle Size Magnifier (PSM) 1.1, 1.3, 1.4, 1.6 and 1.6-1.8 nm for negative sodium chloride, ammonium sulphate, tungsten oxide, silver and positive organics, respectively. To study the effect of sample relative humidity on detection efficiency of the PSM we used different humidities in the differential mobility analyzer sheath flow and found that with increasing relative humidity also the detection efficiency of the PSM increases.

  9. High efficiency Hall effect micro-biosensor platform for detection of magnetically labeled biomolecules.

    PubMed

    Sandhu, Adarsh; Kumagai, Yoshimichi; Lapicki, Adam; Sakamoto, Satoshi; Abe, Masanori; Handa, Hiroshi

    2007-04-15

    Detection of magnetically labeled biomolecules using micro-Hall biosensors is a promising method for monitoring biomolecular recognition processes. The measurement efficiency of standard systems is limited by the time taken for magnetic beads to reach the sensing area of the Hall devices. Here, micro-current lines were integrated with Hall effect structures to manipulate the position of magnetic beads via field gradients generated by localized currents flowing in the current lines. Beads were accumulated onto the sensor surface within seconds of passing currents through the current lines. Real-time detection of magnetic beads using current lines integrated with Hall biosensors was achieved. These results are promising in establishing Hall biosensor platforms as efficient and inexpensive means of monitoring biomolecular reactions for medical applications.

  10. Detection and Proportion of Very Early Dental Caries in Independent Living Older Adults

    PubMed Central

    Holtzman, Jennifer S.; Kohanchi, Daniel; Biren-Fetz, John; Fontana, Margherita; Ramchandani, Manisha; Osann, Kathryn; Hallajian, Lucy; Mansour, Stephanie; Nabelsi, Tasneem; Chung, Na Eun; Wilder-Smith, Petra

    2015-01-01

    Background and Objectives Dental caries is an important healthcare challenge in adults over 65 years of age. Integration of oral health screening into non-dental primary care practice may improve access to preventive dental care for vulnerable populations such as the elderly. Such integration would require easy, fast, and accurate early caries detection tools. Primary goal of this study was to evaluate the diagnostic performance of optical coherence tomography (OCT) imaging for detecting very early caries in the elderly living in community-based settings. The International Caries Detection and Assessment System (ICDAS) served as gold standard. Secondary goal of this study was to provide baseline prevalence data of very early caries lesions in independent living adults aged 65+ years. Materials and Methods Seventy-two subjects were recruited from three sites in Southern California: a retirement community, a senior health fair, and a convalescent hospital. Clinical examination was performed using the ICDAS visual criteria and this was followed by OCT imaging. The two-dimensional OCT images (B-scan) were analyzed with simple software. Locations with a log of back-scattered light intensity (BSLI) below 2.9 were scored as sound, and areas equaling or exceeding 2.9 BSLI were considered carious. Diagnostic performance of OCT imaging was compared with ICDAS score. Results OCT-based diagnosis demonstrated very good sensitivity (95.1%) and good specificity (85.8%). 54.7% of dentate subjects had at least one tooth with very early coronal caries. Conclusions Early coronal decay is prevalent in the unrestored pits and fissures of coronal surfaces of teeth in independent living adults aged 65+ years. Though OCT imaging coupled with a simple diagnostic algorithm can accurately detect areas of very early caries in community-based settings, existing devices are expensive and not well-suited for use by non-dental health care providers. Simple, inexpensive, fast, and accurate tools

  11. Valuation of active blind spot detection systems by younger and older adults.

    PubMed

    Souders, Dustin J; Best, Ryan; Charness, Neil

    2016-08-24

    Due to their disproportional representation in fatal crashes, younger and older drivers both stand to benefit from in-vehicle safety technologies, yet little is known about how they value such technologies, or their willingness to adopt them. The current study investigated older (aged 65 and greater; N=49) and younger (ages 18-23; N=40) adults' valuation of a blind spot monitor and asked if self-reported visual difficulties while driving predicted the amount participants were willing to pay for a particular system (BMW's Active Blind Spot Detection System) that was demonstrated using a short video. Large and small anchor values ($250 and $500, respectively) were used as between subjects manipulations to examine the effects of initial valuation, and participants proceeded through a short staircase procedure that offered them either the free installation of the system on their current vehicle or a monetary prize ($25-$950) that changed in value according to which option they had selected in the previous step of the staircase procedure. Willingness to use other advanced driver assistance systems (lane-departure warning, automatic lane centering, emergency braking, adaptive cruise control, and self-parking systems) was also analyzed, additionally controlling for prior familiarity of those systems. Results showed that increased age was associated with a higher valuation for the Active Blind Spot Detection System in both the large and small anchor value conditions controlling for income, gender, and technology self-efficacy. Older adults valued blind spot detection about twice as much ($762) as younger adults ($383) in the large anchor condition, though both groups' values were in the range for the current cost of an aftermarket system. Similarly, age was the most robust positive predictor of willingness to adopt other driving technologies, along with system familiarity. Difficulties with driving-related visual factors also positively predicting acceptance levels for

  12. Study of the photo-detection efficiency of FBK High-Density silicon photomultipliers

    NASA Astrophysics Data System (ADS)

    Zappalà, G.; Acerbi, F.; Ferri, A.; Gola, A.; Paternoster, G.; Regazzoni, V.; Zorzi, N.; Piemonte, C.

    2016-11-01

    This work presents a study of the factors contributing to the Photo-Detection Efficiency of Silicon Photomultipliers (SiPMs): Quantum Efficiency, Triggering Probability and Fill Factor. Two different SiPM High-Density technologies are tested, NUV-HD, based on n-on-p junction, and RGB-HD, based on p-on-n junction, developed at FBK, Trento. The quantum efficiency was measured on photodiodes produced along with the SiPMs. The triggering probability, as a function of wavelength and bias voltage, was measured on circular Single Photon Avalanche Diodes (SPADs) with 100% fill factor. Square SPADs, having the same layout of single SiPM cells, were studied to measure the effective fill factor and compare it to the nominal value. The comparison of the circular and square SPADs allows to get the transition region size between the effective active area of the cell and the one defined by the layout.

  13. New, high-efficiency ion trap mobility detection system for narcotics and explosives

    NASA Astrophysics Data System (ADS)

    McGann, William J.; Bradley, V.; Borsody, A.; Lepine, S.

    1994-10-01

    A new patented Ion Trap Mobility Spectrometer (ITMS) design is presented. Conventional IMS designs typically operate below 0.1% efficiency. This is due primarily to electric field driven, sample ion discharge on a shutter grid. Since 99.9% of the sample ions generated in the reaction region are lost in this discharge process, the sensitivity of conventional systems is limited. The new design provides greater detection efficiency than conventional designs through the use of an `ion trap' concept. The paper describes the plasma and sample ion dynamics in the reaction region of the new detector and discusses the advantages of utilizing a `field-free' space to generate sample ions with high efficiency. Fast electronic switching is described which is used to perturb the field-free space and pulse the sample ions into the drift region for separation and subsequent detection using pseudo real-time software for analysis and display of the data. Many applications for this new detector are now being considered including the detection of narcotics and explosives. Preliminary ion spectra, reduced mobility data and sensitivity data are presented for fifteen narcotics, including cocaine, THC and LSD are reported.

  14. New high-efficiency ion-trap mobility detection system for narcotics

    NASA Astrophysics Data System (ADS)

    McGann, William J.

    1997-02-01

    A new patented Ion Trap Mobility Spectrometer design is presented. Conventional IMS designs typically operate below 0.1 percent efficiency. This is due primarily to electric field driven, sample ion discharge on a shutter grid. Since 99.9 percent of the sample ions generated in the reaction region are lost int his discharge process, the sensitivity of conventional systems is limited. The new design provides greater detection efficiency than conventional designs through the use of an 'ion trap' concept. The paper describes the plasma and sample ion dynamics in the reaction region of the new detector and discusses the advantages of utilizing a 'field-free' space to generate sample ions with high efficiency. Fast electronic switching is described which is used to perturb the field-free space and pulse the sample ions into the drift region for separation and subsequent detection using pseudo real-time software for analysis and display of the data. One application for this new detector is now being developed, a portable, hand-held system with switching capability for the detection of drugs and explosives. Preliminary ion spectra and sensitivity data are presented for cocaine and heroin using a hand sniffer configuration.

  15. Necessary detection efficiencies for secure quantum key distribution and bound randomness

    NASA Astrophysics Data System (ADS)

    Acín, Antonio; Cavalcanti, Daniel; Passaro, Elsa; Pironio, Stefano; Skrzypczyk, Paul

    2016-01-01

    In recent years, several hacking attacks have broken the security of quantum cryptography implementations by exploiting the presence of losses and the ability of the eavesdropper to tune detection efficiencies. We present a simple attack of this form that applies to any protocol in which the key is constructed from the results of untrusted measurements performed on particles coming from an insecure source or channel. Because of its generality, the attack applies to a large class of protocols, from standard prepare-and-measure to device-independent schemes. Our attack gives bounds on the critical detection efficiencies necessary for secure quantum key distribution, which show that the implementation of most partly device-independent solutions is, from the point of view of detection efficiency, almost as demanding as fully device-independent ones. We also show how our attack implies the existence of a form of bound randomness, namely nonlocal correlations in which a nonsignalling eavesdropper can find out a posteriori the result of any implemented measurement.

  16. Efficiency of the human observer detecting random signals in random backgrounds.

    PubMed

    Park, Subok; Clarkson, Eric; Kupinski, Matthew A; Barrett, Harrison H

    2005-01-01

    The efficiencies of the human observer and the channelized-Hotelling observer relative to the ideal observer for signal-detection tasks are discussed. Both signal-known-exactly (SKE) tasks and signal-known-statistically (SKS) tasks are considered. Signal location is uncertain for the SKS tasks, and lumpy backgrounds are used for background uncertainty in both cases. Markov chain Monte Carlo methods are employed to determine ideal-observer performance on the detection tasks. Psychophysical studies are conducted to compute human-observer performance on the same tasks. Efficiency is computed as the squared ratio of the detectabilities of the observer of interest to the ideal observer. Human efficiencies are approximately 2.1% and 24%, respectively, for the SKE and SKS tasks. The results imply that human observers are not affected as much as the ideal observer by signal-location uncertainty even though the ideal observer outperforms the human observer for both tasks. Three different simplified pinhole imaging systems are simulated, and the humans and the model observers rank the systems in the same order for both the SKE and the SKS tasks.

  17. [Predictive capacity of anthropometric indeces in the detection of metabolic syndrome in Chilian adults].

    PubMed

    Granfeldt Molina, Gislaine; Ibarra Pezo, Jaqueline; Mosso Corral, Constanza; Muñoz Reyes, Sara; Carrillo, Katia Sáez; Zapata Fuentes, Damaris

    2015-09-01

    The presence of cardiometabolic components conditions the risk increase in the appearance of the metabolic syndrome and the associated pathologies. The insulin resistance is probably the subjacent mechanism to the complications derived from this syndrome, where the abdominal adipose accumulation is a common and f equent characteristic. The purpose of this study was to determine the predictive capability of the anthropometric estimating central adipose distribution indexes against the body mass index in the detection of the metabolic syndrome in Chilean adults. A descriptive crosssectional study was conducted on 229 adults, information obtained through a secondary database. There were analyzed through a Pearson correlation and receiver operating curves determining the area. under the curve. The results showed the predominance of 58.3% of the metabolic syndrome prevailed according to NCEP-ATP III, where the anthropometric indexes such as waist height index (0.746), waist circumference (0.735) and body mass index (0.722) didnot-show significant differences in the detection of the metabolic syndrome components. It did show a higher correlation of these cardiometabolic. factors with the waist height index and waist circumference.

  18. Channel electron multipliers - Detection efficiencies with opaque MgF2 photocathodes at XUV wavelengths

    NASA Technical Reports Server (NTRS)

    Lapson, L. B.; Timothy, J. G.

    1976-01-01

    Detection efficiencies of channel electron multipliers (CEM) with opaque MgF2 photocathodes obtained in the extreme ultraviolet (XUV), 44 A to 990 A, are reported. A stable highly efficient response is reported for that interval, with no adverse effects on CEM performance. Efficiencies twice those of uncoated CEMs are obtained for 50 A to 350 A. The Mullard B419BL and Galileo 4510WL single-stage cone-cathode CEMs were used in the experiments. A rare-gas double ionization chamber was employed as absolute standard detector for 406 A to 990 A, and a flow Geiger counter filled with 96% argon and 4% isobutane for 44 A to 256 A. Absolute detection efficiencies are 10% higher from 67 A to 990 A when photocathodes are illuminated at an angle of incidence 45 deg. The photocathodes suffered no loss of response in storage (in vacuum or air) after an initial aging period. Effects of scattered UV radiation are greatly reduced when MgF2-coated CEMs are used in the XUV.

  19. Effectiveness and Efficiency in Higher Education for Adults: A Guide for Fostering Learning.

    ERIC Educational Resources Information Center

    Keeton, Morris T.; Sheckley, Barry G.; Griggs, Joan Krejci

    This document uses the findings of educational research and actual case studies to provide guidance on enhancing the learning of adults in higher education while reducing program costs in the context of increasing demands for demonstration of student learning outcomes and decreases in college and university resources. The novelty of the book is…

  20. 1H MRS-detectable metabolic brain changes and reduced impulsive behavior in adult rats exposed to methylphenidate during adolescence.

    PubMed

    Adriani, W; Canese, R; Podo, F; Laviola, G

    2007-01-01

    Administration of methylphenidate (MPH, Ritalin) to children affected by attention deficit hyperactivity disorder (ADHD) is an elective therapy, which however raises concerns for public health, due to possible persistent neuro-behavioral alterations. We investigated potential long-term consequences at adulthood of MPH exposure during adolescence, by means of behavioral and brain MRS assessment in drug-free state. Wistar adolescent rats (30- to 44-day-old) were treated with MPH (0 or 2 mg/kg once/day for 14 days) and then left undisturbed until adulthood. Levels of impulsive behavior were assessed in the intolerance-to-delay task: Food-restricted rats were tested in operant chambers with two nose-poking holes, delivering one food pellet immediately, or five pellets after a delay whose length was increased over days. MPH-exposed animals showed a less marked shifting profile from the large/late to the small/soon reward, suggesting reduced basal levels of impulsivity, compared to controls. In vivo MRI-guided 1H MRS examinations at 4.7 T in anaesthetised animals revealed long-term biochemical changes in the dorsal striatum (STR), nucleus accumbens (NAcc), and prefrontal cortex (PFC) of MPH-exposed rats. Notably, total creatine and taurine, metabolites respectively involved in bioenergetics and synaptic efficiency, were up-regulated in the STR and conversely down-regulated in the NAcc of MPH-exposed rats. A strong correlation was evident between non-phosphorylated creatine in the STR and behavioral impulsivity. Moreover, unaltered total creatine and increased phospho-creatine/creatine ratio were detected in the PFC, suggesting improved cortical energetic performance. Because of this enduring rearrangement in the forebrain function, MPH-exposed animals may be more efficient when faced with delay of reinforcement. In summary, MPH exposure during adolescence produced enduring MRS-detectable biochemical modifications in brain reward-related circuits, which may account for

  1. Efficient defect pixel cluster detection and correction for Bayer CFA image sequences

    NASA Astrophysics Data System (ADS)

    Tajbakhsh, Touraj

    2011-01-01

    Image sensor arrays may have defect pixels, either originating from manufacturing or being developed over the lifetime of the image sensor array. Continuous defect pixel detection and correction performing during camera runtime is desirable. On-the-fly detection and correction is challenging since edges and high-frequency image content might get identified as defect pixel regions and intact pixels become corrupted during defect pixel replacement. We propose a table-based detection and correction method which by and by fills the non-volatile table during normal camera operation. In this work we model defect pixels and pixel clusters to be stuck to fixed values or at least fixed to a narrow value range whereas the local neighborhood of these pixels indicate a normal behavior. The idea is to temporally observe the value ranges of small group of pixels (e.g. 4x4 pixel blocks) and to decide about their defective condition depending on their variability with respect to their neighbor pixels. Our method is computationally efficient, requires no frame buffer, requires modest memory, and therefore is appropriate to operate in line-buffer based image signal processing (ISP) systems. Our results indicate high reliability in terms of detection rates and robustness against high-frequency image content. As part of the defect pixel replacement system we also propose a simple and efficient defect pixel correction method based on the mean of medians operating on the Bayer CFA image domain.

  2. Accuracy and efficiency of detection dogs: a powerful new tool for koala conservation and management

    PubMed Central

    Cristescu, Romane H.; Foley, Emily; Markula, Anna; Jackson, Gary; Jones, Darryl; Frère, Céline

    2015-01-01

    Accurate data on presence/absence and spatial distribution for fauna species is key to their conservation. Collecting such data, however, can be time consuming, laborious and costly, in particular for fauna species characterised by low densities, large home ranges, cryptic or elusive behaviour. For such species, including koalas (Phascolarctos cinereus), indicators of species presence can be a useful shortcut: faecal pellets (scats), for instance, are widely used. Scat surveys are not without their difficulties and often contain a high false negative rate. We used experimental and field-based trials to investigate the accuracy and efficiency of the first dog specifically trained for koala scats. The detection dog consistently out-performed human-only teams. Off-leash, the dog detection rate was 100%. The dog was also 19 times more efficient than current scat survey methods and 153% more accurate (the dog found koala scats where the human-only team did not). This clearly demonstrates that the use of detection dogs decreases false negatives and survey time, thus allowing for a significant improvement in the quality and quantity of data collection. Given these unequivocal results, we argue that to improve koala conservation, detection dog surveys for koala scats could in the future replace human-only teams. PMID:25666691

  3. Accuracy and efficiency of detection dogs: a powerful new tool for koala conservation and management.

    PubMed

    Cristescu, Romane H; Foley, Emily; Markula, Anna; Jackson, Gary; Jones, Darryl; Frère, Céline

    2015-02-10

    Accurate data on presence/absence and spatial distribution for fauna species is key to their conservation. Collecting such data, however, can be time consuming, laborious and costly, in particular for fauna species characterised by low densities, large home ranges, cryptic or elusive behaviour. For such species, including koalas (Phascolarctos cinereus), indicators of species presence can be a useful shortcut: faecal pellets (scats), for instance, are widely used. Scat surveys are not without their difficulties and often contain a high false negative rate. We used experimental and field-based trials to investigate the accuracy and efficiency of the first dog specifically trained for koala scats. The detection dog consistently out-performed human-only teams. Off-leash, the dog detection rate was 100%. The dog was also 19 times more efficient than current scat survey methods and 153% more accurate (the dog found koala scats where the human-only team did not). This clearly demonstrates that the use of detection dogs decreases false negatives and survey time, thus allowing for a significant improvement in the quality and quantity of data collection. Given these unequivocal results, we argue that to improve koala conservation, detection dog surveys for koala scats could in the future replace human-only teams.

  4. Low background high efficiency radiocesium detection system based on positron emission tomography technology

    SciTech Connect

    Yamamoto, Seiichi; Ogata, Yoshimune

    2013-09-15

    After the 2011 nuclear power plant accident at Fukushima, radiocesium contamination in food became a serious concern in Japan. However, low background and high efficiency radiocesium detectors are expensive and huge, including semiconductor germanium detectors. To solve this problem, we developed a radiocesium detector by employing positron emission tomography (PET) technology. Because {sup 134}Cs emits two gamma photons (795 and 605 keV) within 5 ps, they can selectively be measured with coincidence. Such major environmental gamma photons as {sup 40}K (1.46 MeV) are single photon emitters and a coincidence measurement reduces the detection limit of radiocesium detectors. We arranged eight sets of Bi{sub 4}Ge{sub 3}O{sub 12} (BGO) scintillation detectors in double rings (four for each ring) and measured the coincidence between these detectors using PET data acquisition system. A 50 × 50 × 30 mm BGO was optically coupled to a 2 in. square photomultiplier tube (PMT). By measuring the coincidence, we eliminated most single gamma photons from the energy distribution and only detected those from {sup 134}Cs at an average efficiency of 12%. The minimum detectable concentration of the system for the 100 s acquisition time is less than half of the food monitor requirements in Japan (25 Bq/kg). These results show that the developed radiocesium detector based on PET technology is promising to detect low level radiocesium.

  5. Mature adult dystrophic mouse muscle environment does not impede efficient engrafted satellite cell regeneration and self-renewal.

    PubMed

    Boldrin, Luisa; Zammit, Peter Steven; Muntoni, Francesco; Morgan, Jennifer Elizabeth

    2009-10-01

    Changes that occur in the skeletal muscle environment with the progress of muscular dystrophies may affect stem cell function and result in impaired muscle regeneration. It has previously been suggested that the success of stem cell transplantation could therefore be dependent both on the properties of the cell itself and on the host muscle environment. Here we engrafted young and mature adult mdx-nude mice, which are the genetic homolog of Duchenne muscular dystrophy, with a small number of satellite cells freshly isolated from young, normal donor mice. We found that the donor satellite cells contributed to muscle regeneration and self-renewal as efficiently within mature adult, as in young, dystrophic host muscle. Donor-derived satellite cells also contributed to robust regeneration after further injury, showing that they were functional despite the more advanced dystrophic muscle environment. These findings provide evidence that muscle tissue in a later stage of dystrophy may be effectively treated by stem cells.

  6. Polysplenia Syndrome Detected after Chest Symptoms in Two Adult Patients: Case Report and Review of Literature

    PubMed Central

    Yılmaz, Güliz; Akpınar, Süha H.; Alıcıoğlu, Banu

    2014-01-01

    Summary Background Polisplenia syndrome (PSS) is a rare subtype of heterotaxy syndrome and means ambiguous location of the major thoracic and abdominal organs with vascular anomalies and multiple spleens. We reported on the findings of computed tomography (CT) of PSS in adults, detected incidentally. Case Report Two woman underwent a CT examination of the thorax for different thoracic pathologies. There were common abnormalities such as hyparterial bronchi and absence of middle lobe fissure on CTscans suggesting heterotaxy syndrome. Therefore, the abdominal CTs were performed to detect the accompanying abdominal anomalies. Our two cases defined as PSS were diagnosed with multiple spleens in the normal location in the abdomen. The left-dominant liver and short pancreas with agenesis of the pancreatic tail and lateral part of the body were detected on CT scan. In the first case, the vascular abnormalities were as follows: variant entrance of the main portal vein into the liver and atypically located superior mesenteric vein (SMV) joining with the splenic vein to form the portal vein. In the second case, the preduodenal portal vein and hemiazygos continuation with interruption of the hepatic segment of the inferior vena cava (IVC) were the vascular anomalies. The bowels were malrotated in the second case. Conclusions Although such cases are usually admitted as abdominal emergency, our two cases were detected during examinations for thoracic and cardiac pathologies. The knowledge and awareness of PSS can be helpful to diagnose pathology and plan surgical procedures. PMID:25237401

  7. Highly efficient visual detection of trace copper(II) and protein by the quantum photoelectric effect.

    PubMed

    Wang, Peng; Lei, Jianping; Su, Mengqi; Liu, Yueting; Hao, Qing; Ju, Huangxian

    2013-09-17

    This work presented a photocurrent response mechanism of quantum dots (QDs) under illumination with the concept of a quantum photoelectric effect. Upon irradiation, the photoelectron could directly escape from QDs. By using nitro blue tetrazolium (NBT) to capture the photoelectron, a new visual system was proposed due to the formation of an insoluble reduction product, purple formazan, which could be used to visualize the quantum photoelectric effect. The interaction of copper(II) with QDs could form trapping sites to interfere with the quantum confinement and thus blocked the escape of photoelectron, leading to a "signal off" visual method for sensitive copper(II) detection. Meanwhile, by using QDs as a signal tag to label antibody, a "signal on" visual method was also proposed for immunoassay of corresponding protein. With meso-2,3-dimercaptosuccinic-capped CdTe QDs and carcino-embryonic antigen as models, the proposed visual detection methods showed high sensitivity, low detection limit, and wide detectable concentration ranges. The visualization of quantum photoelectric effect could be simply extended for the detection of other targets. This work opens a new visual detection way and provides a highly efficient tool for bioanalysis.

  8. Efficient pedestrian detection from aerial vehicles with object proposals and deep convolutional neural networks

    NASA Astrophysics Data System (ADS)

    Minnehan, Breton; Savakis, Andreas

    2016-05-01

    As Unmanned Aerial Systems grow in numbers, pedestrian detection from aerial platforms is becoming a topic of increasing importance. By providing greater contextual information and a reduced potential for occlusion, the aerial vantage point provided by Unmanned Aerial Systems is highly advantageous for many surveillance applications, such as target detection, tracking, and action recognition. However, due to the greater distance between the camera and scene, targets of interest in aerial imagery are generally smaller and have less detail. Deep Convolutional Neural Networks (CNN's) have demonstrated excellent object classification performance and in this paper we adopt them to the problem of pedestrian detection from aerial platforms. We train a CNN with five layers consisting of three convolution-pooling layers and two fully connected layers. We also address the computational inefficiencies of the sliding window method for object detection. In the sliding window configuration, a very large number of candidate patches are generated from each frame, while only a small number of them contain pedestrians. We utilize the Edge Box object proposal generation method to screen candidate patches based on an "objectness" criterion, so that only regions that are likely to contain objects are processed. This method significantly reduces the number of image patches processed by the neural network and makes our classification method very efficient. The resulting two-stage system is a good candidate for real-time implementation onboard modern aerial vehicles. Furthermore, testing on three datasets confirmed that our system offers high detection accuracy for terrestrial pedestrian detection in aerial imagery.

  9. An efficient technique for nuclei segmentation based on ellipse descriptor analysis and improved seed detection algorithm.

    PubMed

    Xu, Hongming; Lu, Cheng; Mandal, Mrinal

    2014-09-01

    In this paper, we propose an efficient method for segmenting cell nuclei in the skin histopathological images. The proposed technique consists of four modules. First, it separates the nuclei regions from the background with an adaptive threshold technique. Next, an elliptical descriptor is used to detect the isolated nuclei with elliptical shapes. This descriptor classifies the nuclei regions based on two ellipticity parameters. Nuclei clumps and nuclei with irregular shapes are then localized by an improved seed detection technique based on voting in the eroded nuclei regions. Finally, undivided nuclei regions are segmented by a marked watershed algorithm. Experimental results on 114 different image patches indicate that the proposed technique provides a superior performance in nuclei detection and segmentation.

  10. Serum Multivalent Cationic Pattern: Speculation on the Efficient Approach for Detection of Alzheimer's Disease

    NASA Astrophysics Data System (ADS)

    Azhdarzadeh, Morteza; Noroozian, Maryam; Aghaverdi, Haniyeh; Akbari, Seyed Mostafa; Baum, Larry; Mahmoudi, Morteza

    2013-10-01

    Alzheimer's disease (AD) is increasingly becoming one of the greatest medical challenges. Due to the social and financial burden of AD, detection of AD in its early stages is a topic of major research interest. Thus, emergence of well-validated screening methods for fast detection of AD in the early stages would be of great importance. It is now recognized that the homeostasis and serum bioavailability of multivalent cations (e.g. zinc, copper, and iron) are disturbed in AD. Using a standard chemometric approach (hierarchical clustering analysis), we find that the serum concentrations of an array of such multivalent cations can be a fingerprint for identification of AD patients. This may pave the way for a reliable, efficient, and inexpensive method for early detection and treatment of AD.

  11. Investigations of afterpulsing and detection efficiency recovery in superconducting nanowire single-photon detectors

    NASA Astrophysics Data System (ADS)

    Burenkov, Viacheslav; Xu, He; Qi, Bing; Hadfield, Robert H.; Lo, Hoi-Kwong

    2013-06-01

    We report on the observation of a non-uniform dark count rate in Superconducting Nanowire Single Photon Detectors (SNSPDs), specifically focusing on an afterpulsing effect present when the SNSPD is operated at a high bias current regime. The afterpulsing exists for real detection events (triggered by input photons) as well as for dark counts (no laser input). In our standard set-up, the afterpulsing is most likely to occur at around 180 ns following a detection event, for both real counts and dark counts. We characterize the afterpulsing behavior and speculate that it is not due to the SNSPD itself but rather the amplifiers used to boost the electrical output signal from the SNSPD. We show that the afterpulsing indeed disappears when we use a different amplifier with a better low frequency response. We also examine the short-lived enhancement of detection efficiency during the recovery of the SNSPD due to temporary perturbation of the bias and grounding conditions.

  12. Efficient Fine Arrhythmia Detection Based on DCG P-T Features.

    PubMed

    Bie, Rongfang; Xu, Shuaijing; Zhang, Guangzhi; Zhang, Meng; Ma, Xianlin; Zhang, Xialin

    2016-07-01

    Due to the high mortality associated with heart disease, there is an urgent demand for advanced detection of abnormal heart beats. The use of dynamic electrocardiogram (DCG) provides a useful indicator of heart condition from long-term monitoring techniques commonly used in the clinic. However, accurately distinguishing sparse abnormal heart beats from large DCG data sets remains difficult. Herein, we propose an efficient fine solution based on 11 geometrical features of the DCG PQRST(P-T) waves and an improved hierarchical clustering method for arrhythmia detection. Data sets selected from MIT-BIH are used to validate the effectiveness of this approach. Experimental results show that the detection procedure of arrhythmia is fast and with accurate clustering.

  13. An Efficient Pattern Mining Approach for Event Detection in Multivariate Temporal Data.

    PubMed

    Batal, Iyad; Cooper, Gregory; Fradkin, Dmitriy; Harrison, James; Moerchen, Fabian; Hauskrecht, Milos

    2016-01-01

    This work proposes a pattern mining approach to learn event detection models from complex multivariate temporal data, such as electronic health records. We present Recent Temporal Pattern mining, a novel approach for efficiently finding predictive patterns for event detection problems. This approach first converts the time series data into time-interval sequences of temporal abstractions. It then constructs more complex time-interval patterns backward in time using temporal operators. We also present the Minimal Predictive Recent Temporal Patterns framework for selecting a small set of predictive and non-spurious patterns. We apply our methods for predicting adverse medical events in real-world clinical data. The results demonstrate the benefits of our methods in learning accurate event detection models, which is a key step for developing intelligent patient monitoring and decision support systems.

  14. Fluorescent QDs-polystyrene composite nanospheres for highly efficient and rapid protein antigen detection

    NASA Astrophysics Data System (ADS)

    Zhou, Changhua; Mao, Mao; Yuan, Hang; Shen, Huaibin; Wu, Feng; Ma, Lan; Li, Lin Song

    2013-09-01

    In this paper, high-quality carboxyl-functionalized fluorescent (red, green, and blue emitting) nanospheres (46-103 nm) consisting of hydrophobic quantum dots (QDs) and polystyrene were prepared by a miniemulsion polymerization approach. This miniemulsion polymerization approach induced a homogeneous distribution and high aqueous-phase transport efficiency of fluorescent QDs in composite nanospheres, which proved the success of our encoding QDs strategy. The obtained fluorescent nanospheres exhibited high stability in aqueous solution under a wide range of pH, different salt concentrations, PBS buffer, and thermal treatment at 80 °C. Based on the red emitting composite nanosphere, we performed fluorescent lateral flow immunoassay (LFIA) strips for high-sensitivity and rapid alpha-fetal protein detection. The detection limit reached 0.1 ng/mL, which was 200 times higher than commercial colloidal gold-labeled LFIA strips, and it reached similar detection level in enzyme-linked immunosorbent assay kit.

  15. The effect of magnetic field on the intrinsic detection efficiency of superconducting single-photon detectors

    SciTech Connect

    Renema, J. J.; Rengelink, R. J.; Komen, I.; Wang, Q.; Kes, P.; Aarts, J.; Exter, M. P. van; Dood, M. J. A. de; Gaudio, R.; Hoog, K. P. M. op 't; Zhou, Z.; Fiore, A.; Sahin, D.; Driessen, E. F. C.

    2015-03-02

    We experimentally investigate the effect of a magnetic field on photon detection in superconducting single-photon detectors (SSPDs). At low fields, the effect of a magnetic field is through the direct modification of the quasiparticle density of states of the superconductor, and magnetic field and bias current are interchangeable, as is expected for homogeneous dirty-limit superconductors. At the field where a first vortex enters the detector, the effect of the magnetic field is reduced, up until the point where the critical current of the detector starts to be determined by flux flow. From this field on, increasing the magnetic field does not alter the detection of photons anymore, whereas it does still change the rate of dark counts. This result points at an intrinsic difference in dark and photon counts, and also shows that no enhancement of the intrinsic detection efficiency of a straight SSPD wire is achievable in a magnetic field.

  16. Serum Multivalent Cationic Pattern: Speculation on the Efficient Approach for Detection of Alzheimer's Disease

    PubMed Central

    Azhdarzadeh, Morteza; Noroozian, Maryam; Aghaverdi, Haniyeh; Akbari, Seyed Mostafa; Baum, Larry; Mahmoudi, Morteza

    2013-01-01

    Alzheimer's disease (AD) is increasingly becoming one of the greatest medical challenges. Due to the social and financial burden of AD, detection of AD in its early stages is a topic of major research interest. Thus, emergence of well-validated screening methods for fast detection of AD in the early stages would be of great importance. It is now recognized that the homeostasis and serum bioavailability of multivalent cations (e.g. zinc, copper, and iron) are disturbed in AD. Using a standard chemometric approach (hierarchical clustering analysis), we find that the serum concentrations of an array of such multivalent cations can be a fingerprint for identification of AD patients. This may pave the way for a reliable, efficient, and inexpensive method for early detection and treatment of AD. PMID:24108247

  17. An Efficient Pattern Mining Approach for Event Detection in Multivariate Temporal Data

    PubMed Central

    Batal, Iyad; Cooper, Gregory; Fradkin, Dmitriy; Harrison, James; Moerchen, Fabian; Hauskrecht, Milos

    2015-01-01

    This work proposes a pattern mining approach to learn event detection models from complex multivariate temporal data, such as electronic health records. We present Recent Temporal Pattern mining, a novel approach for efficiently finding predictive patterns for event detection problems. This approach first converts the time series data into time-interval sequences of temporal abstractions. It then constructs more complex time-interval patterns backward in time using temporal operators. We also present the Minimal Predictive Recent Temporal Patterns framework for selecting a small set of predictive and non-spurious patterns. We apply our methods for predicting adverse medical events in real-world clinical data. The results demonstrate the benefits of our methods in learning accurate event detection models, which is a key step for developing intelligent patient monitoring and decision support systems. PMID:26752800

  18. Does Faux Pas Detection in Adult Autism Reflect Differences in Social Cognition or Decision-Making Abilities?

    PubMed

    Thiébaut, Flora I; White, Sarah J; Walsh, Annabel; Klargaard, Solja K; Wu, Hsuan-Chen; Rees, Geraint; Burgess, Paul W

    2016-01-01

    43 typically-developed adults and 35 adults with ASD performed a cartoon faux pas test. Adults with ASD apparently over-detected faux pas despite good comprehension abilities, and were generally slower at responding. Signal detection analysis demonstrated that the ASD participants had significantly greater difficulty detecting whether a cartoon depicted a faux pas and showed a liberal response bias. Test item analysis demonstrated that the ASD group were not in agreement with a reference control group (n = 69) about which non-faux pas items were most difficult. These results suggest that the participants with ASD had a primary problem with faux pas detection, but that there is another factor at work, possibly compensatory, that relates to their choice of a liberal response criterion.

  19. Specific and Efficient Uptake of Surfactant-Free Poly(Lactic Acid) Nanovaccine Vehicles by Mucosal Dendritic Cells in Adult Zebrafish after Bath Immersion

    PubMed Central

    Rességuier, Julien; Delaune, Emilie; Coolen, Anne-Line; Levraud, Jean-Pierre; Boudinot, Pierre; Le Guellec, Dominique; Verrier, Bernard

    2017-01-01

    Activation of mucosal immunity is a key milestone for next-generation vaccine development. Biocompatible polymer-based nanoparticles (NPs) are promising vectors and adjuvants for mucosal vaccination. However, their in vivo uptake by mucosae and their biodistribution in antigen-presenting cells (APCs) need to be better understood to optimize mucosal nanovaccine designs. Here, we assessed if APCs are efficiently targeted in a spontaneous manner by surfactant-free poly(lactic acid) nanoparticles (PLA-NPs) after mucosal administration. Combining histology and flow imaging approaches, we describe and quantify the mucosal uptake of 200 nm PLA-NPs in adult zebrafish. Following bath administration, PLA-NPs penetrated and crossed epithelial barriers from all exposed mucosae. In mucosae, PLA-NPs accumulated in APCs, which were identified as dendritic cells (DCs), macrophages, and IgZ+ B cells in gills and skin. PLA-NP uptake by phagocytes was specific to these cell types, as PLA-NPs were not detected in neutrophils. Importantly, quantitative analyses in gills revealed that DCs take up PLA-NPs with specifically high efficiency. This study shows that surfactant-free PLA-NPs, which display optimal biocompatibility, can spontaneously target DCs with high efficiency in vivo following mucosal administration, and highlights PLA-NPs as powerful platforms for mucosal vaccine delivery in the medical and veterinary fields, and particularly in aquaculture. PMID:28289416

  20. A New Efficient Method for Detecting Phase Singularity in Cardiac Fibrillation

    PubMed Central

    Hwang, Minki; Lim, Byounghyun; Joung, Boyoung; Pak, Hui-Nam

    2016-01-01

    Background The point of phase singularity (PS) is considered to represent a spiral wave core or a rotor in cardiac fibrillation. Computational efficiency is important for detection of PS in clinical electrophysiology. We developed a novel algorithm for highly efficient and robust detection of PS. Methods In contrast to the conventional method, which calculates PS based on the line integral of the phase around a PS point equal to ±2π (the Iyer-Gray method), the proposed algorithm (the location-centric method) looks for the phase discontinuity point at which PS actually occurs. We tested the efficiency and robustness of these two methods in a two-dimensional mathematical model of atrial fibrillation (AF), with and without remodeling of ionic currents. Results 1. There was a significant association, in terms of the Hausdorff distance (3.30 ± 0.0 mm), between the PS points measured using the Iyer-Gray and location-centric methods, with almost identical PS trajectories generated by the two methods. 2. For the condition of electrical remodeling of AF (0.3 × ICaL), the PS points calculated by the two methods were satisfactorily co-localized (with the Hausdorff distance of 1.64 ± 0.09 mm). 3. The proposed location-centric method was substantially more efficient than the Iyer-Gray method, with a 28.6-fold and 28.2-fold shorter run times for the control and remodeling scenarios, respectively. Conclusion We propose a new location-centric method for calculating PS, which is robust and more efficient compared with the conventionally used method. PMID:27907144

  1. Addition of Carbon to the Culture Medium Improves the Detection Efficiency of Aflatoxin Synthetic Fungi

    PubMed Central

    Suzuki, Tadahiro; Iwahashi, Yumiko

    2016-01-01

    Aflatoxin (AF) is a harmful secondary metabolite that is synthesized by the Aspergillus species. Although AF detection techniques have been developed, techniques for detection of AF synthetic fungi are still required. Techniques such as plate culture methods are continually being modified for this purpose. However, plate culture methods require refinement because they suffer from several issues. In this study, activated charcoal powder (carbon) was added to a culture medium containing cyclodextrin (CD) to enhance the contrast of fluorescence and improve the detection efficiency for AF synthetic fungi. Two culture media, potato dextrose agar and yeast extract sucrose agar, were investigated using both plate and liquid cultures. The final concentrations of CD and carbon in the media were 3 mg/mL and 0.3 mg/mL, respectively. Addition of carbon improved the visibility of fluorescence by attenuating approximately 30% of light scattering. Several fungi that could not be detected with only CD in the medium were detected with carbon addition. The carbon also facilitated fungal growth in the potato dextrose liquid medium. The results suggest that addition of carbon to media can enhance the observation of AF-derived fluorescence. PMID:27854283

  2. RiboDiff: detecting changes of mRNA translation efficiency from ribosome footprints

    PubMed Central

    Zhong, Yi; Karaletsos, Theofanis; Drewe, Philipp; Sreedharan, Vipin T.; Kuo, David; Singh, Kamini; Wendel, Hans-Guido; Rätsch, Gunnar

    2017-01-01

    Motivation: Deep sequencing based ribosome footprint profiling can provide novel insights into the regulatory mechanisms of protein translation. However, the observed ribosome profile is fundamentally confounded by transcriptional activity. In order to decipher principles of translation regulation, tools that can reliably detect changes in translation efficiency in case–control studies are needed. Results: We present a statistical framework and an analysis tool, RiboDiff, to detect genes with changes in translation efficiency across experimental treatments. RiboDiff uses generalized linear models to estimate the over-dispersion of RNA-Seq and ribosome profiling measurements separately, and performs a statistical test for differential translation efficiency using both mRNA abundance and ribosome occupancy. Availability and Implementation: RiboDiff webpage http://bioweb.me/ribodiff. Source code including scripts for preprocessing the FASTQ data are available at http://github.com/ratschlab/ribodiff. Contacts: zhongy@cbio.mskcc.org or raetsch@inf.ethz.ch Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27634950

  3. ELENA MCP detector: absolute detection efficiency for low-energy neutral atoms

    NASA Astrophysics Data System (ADS)

    Rispoli, R.; De Angelis, E.; Colasanti, L.; Vertolli, N.; Orsini, S.; Scheer, J. A.; Mura, A.; Milillo, A.; Wurz, P.; Selci, S.; Di Lellis, A. M.; Leoni, R.; D'Alessandro, M.; Mattioli, F.; Cibella, S.

    2012-09-01

    Microchannel Plates (MCP) detectors are frequently used in space instrumentation for detecting a wide range of radiation and particles. In particular, the capability to detect non-thermal low energy neutral species is crucial for the sensor ELENA (Emitted Low-Energy Neutral Atoms), part of the package SERENA (Search for Exospheric Refilling and Emitted Natural Abundances) on board the BepiColombo mission of ESA to Mercury to be launched in 2015. ELENA is a Time of Flight (TOF) sensor, based on a novel concept using an ultra-sonic oscillating shutter (Start section), which is operated at frequencies up to 50 kHz; a MCP detector is used as a Stop detector. The scientific objective of ELENA is to detect energetic neutral atoms in the range 10 eV - 5 keV, within 76° FOV, perpendicular to the S/C orbital plane. ELENA will monitor the emission of neutral atoms from the whole surface of Mercury thanks to the spacecraft motion. The major scientific objectives are the interaction between the plasma environment and the planet’s surface, the global particle loss-rate and the remote sensing of the surface properties. In particular, surface release processes are investigated by identifying particles released from the surface, via solar wind-induced ion sputtering (< 1eV - < 100 eV) as well as Hydrogen back-scattered at hundreds eV. MCP absolute detection efficiency for very low energy neutral atoms (E < 30 eV) is a crucial point for this investigation. At the MEFISTO facility of the Physical Institute of the University of Bern (CH), measurements on three different types of MCP (with and without coating) have been performed providing the detection efficiencies in the energy range 10eV - 1keV. Outcomes from such measurements are discussed here.

  4. Analysis of the kinestatic charge detection system as a high detective quantum efficiency electronic portal imaging device.

    PubMed

    Samant, Sanjiv S; Gopal, Arun

    2006-09-01

    Megavoltage x-ray imaging suffers from reduced image quality due to low differential x-ray attenuation and large Compton scatter compared with kilovoltage imaging. Notwithstanding this, electronic portal imaging devices (EPIDs) are now widely used in portal verification in radiotherapy as they offer significant advantages over film, including immediate digital imaging and superior contrast range. However video-camera-based EPIDs (VEPIDs) are limited by problems of low light collection efficiency and significant light scatter, leading to reduced contrast and spatial resolution. Indirect and direct detection-based flat-panel EPIDs have been developed to overcome these limitations. While flat-panel image quality has been reported to exceed that achieved with portal film, these systems have detective quantum efficiency (DQE) limited by the thin detection medium and are sensitive to radiation damage to peripheral read-out electronics. An alternative technology for high-quality portal imaging is presented here: kinesatic charge detection (KCD). The KCD is a scanning tri-electrode ion-chamber containing high-pressure noble gas (xenon at 100 atm) used in conjunction with a strip-collimated photon beam. The chamber is scanned across the patient, and an external electric field is used to regulate the cation drift velocity. By matching the scanning velocity with that of the cation (i.e., ion) drift velocity, the cations remain static in the object frame of reference, allowing temporal integration of the signal. The KCD offers several advantages as a portal imaging system. It has a thick detector geometry with an active detection depth of 6.1 cm, compared to the sub-millimeter thickness of the phosphor layer in conventional phosphor screens, leading to an order of magnitude advantage in quantum efficiency (>0.3). The unique principle of and the use of the scanning strip-collimated x-ray beam provide further integration of charges in time, reduced scatter, and a significantly

  5. Efficient postprocessing scheme for block-coded images based on multiscale edge detection

    NASA Astrophysics Data System (ADS)

    Wu, Shuanhu; Yan, Hong; Tan, Zheng

    2001-09-01

    The block discrete cosine transform (BDCT) is the most widely used technique for the compression of both still and moving images, a major problem related with the BDCT techniques is that the decoded images, especially at low bit rate, exhibit visually annoying blocking effects. In this paper, based on Mallets multiscale edge detection, we proposed an efficient deblocking algorithm to further improved the coding performance. The advantage of our algorithm is that it can efficiently preserve texture structure in the original decompressed images. Our method is similar to that of Z. Xiong's, where the Z.Xiong's method is not suitable for images with a large portion of texture; for instance, the Barbara Image. The difference of our method and the Z.Xiong's is that our method adopted a new thresholding scheme for multi-scale edge detection instead of exploiting cross-scale correlation for edge detection. Numerical experiment results show that our scheme not only outperforms Z.Xiong's for various images in the case of the same computational complexity, but also preserve texture structure in the decompressed images at the same time. Compared with the best iterative-based method (POCS) reported in the literature, our algorithm can achieve the same peak signal-to-noise ratio (PSNR) improvement and give visually very pleasing images as well.

  6. Detection efficiency calibration of single-photon silicon avalanche photodiodes traceable using double attenuator technique

    PubMed Central

    López, Marco; Hofer, Helmuth; Kück, Stefan

    2015-01-01

    A highly accurate method for the determination of the detection efficiency of a silicon single-photon avalanche diode (Si-SPAD) is presented. This method is based on the comparison of the detected count rate of the Si-SPAD compared to the photon rate determined from a calibrated silicon diode using a modified attenuator technique, in which the total attenuation is measured in two attenuation steps. Furthermore, a validation of this two-step method is performed using attenuators of higher transmittance. The setup is a tabletop one, laser-based, and fully automated. The measurement uncertainty components are determined and analyzed in detail. The obtained standard measurement uncertainty is < 0.5%. Main contributions are the transmission of the neutral density filters used as attenuators and the spectral responsivity of the calibrated analog silicon diode. Furthermore, the dependence of the detection efficiency of the Si-SPAD on the mean photon number of the impinging laser radiation with Poissonian statistics is investigated. PMID:25892852

  7. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    PubMed

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  8. CK-LPA: Efficient community detection algorithm based on label propagation with community kernel

    NASA Astrophysics Data System (ADS)

    Lin, Zhen; Zheng, Xiaolin; Xin, Nan; Chen, Deren

    2014-12-01

    With the rapid development of Web 2.0 and the rise of online social networks, finding community structures from user data has become a hot topic in network analysis. Although research achievements are numerous at present, most of these achievements cannot be adopted in large-scale social networks because of heavy computation. Previous studies have shown that label propagation is an efficient means to detect communities in social networks and is easy to implement; however, some drawbacks, such as low accuracy, high randomness, and the formation of a “monster” community, have been found. In this study, we propose an efficient community detection method based on the label propagation algorithm (LPA) with community kernel (CK-LPA). We assign a corresponding weight to each node according to node importance in the whole network and update node labels in sequence based on weight. Then, we discuss the composition of weights, the label updating strategy, the label propagation strategy, and the convergence conditions. Compared with the primitive LPA, existing drawbacks are solved by CK-LPA. Experiments and benchmarks reveal that our proposed method sustains nearly linear time complexity and exhibits significant improvements in the quality aspect of static community detection. Hence, the algorithm can be applied in large-scale social networks.

  9. Efficient edge-guided full-waveform inversion by Canny edge detection and bilateral filtering algorithms

    NASA Astrophysics Data System (ADS)

    Xiang, Shiming; Zhang, Haijiang

    2016-11-01

    It is known full-waveform inversion (FWI) is generally ill-conditioned and various strategies including pre-conditioning and regularizing the inversion system have been proposed to obtain a reliable estimation of the velocity model. Here, we propose a new edge-guided strategy for FWI in frequency domain to efficiently and reliably estimate velocity models with structures of the size similar to the seismic wavelength. The edges of the velocity model at the current iteration are first detected by the Canny edge detection algorithm that is widely used in image processing. Then, the detected edges are used for guiding the calculation of FWI gradient as well as enforcing edge-preserving total variation (TV) regularization for next iteration of FWI. Bilateral filtering is further applied to remove noise but keep edges of the FWI gradient. The proposed edge-guided FWI in the frequency domain with edge-guided TV regularization and bilateral filtering is designed to preserve model edges that are recovered from previous iterations as well as from lower frequency waveforms when FWI is conducted from lower to higher frequencies. The new FWI method is validated using the complex Marmousi model that contains several steeply dipping fault zones and hundreds of horizons. Compared to FWI without edge guidance, our proposed edge-guided FWI recovers velocity model anomalies and edges much better. Unlike previous image-guided FWI or edge-guided TV regularization strategies, our method does not require migrating seismic data, thus is more efficient for real applications.

  10. Pre-envelope deconvolution for increased lesion detection efficiency in ultrasonic imaging

    NASA Astrophysics Data System (ADS)

    Abbey, Craig K.; Zemp, Roger J.; Insana, Michael F.

    2003-05-01

    We use an ideal observer model to evaluate the efficiency of human observers detecting a simulated lesion in the presence of speckle, and the ability of pre-envelope deconvolution to improve performance in this task. We model the lesion as a localized area of increased scatter density, which translates into an area of higher variance in the ultrasound signal. Assuming the scattering function and electronic noise obey Gaussian distributions, the ideal observer for lesion detection is given by a quadratic function of the in-phase (I) and quadrature (Q) data. For comparison, human-observer performance is assessed through two-alternative forced-choice (2AFC) psychophysical studies after making a B-mode image by computing the magnitude (envelope) of the I and Q components. We also consider the effect of removing spatial correlations in the I and Q components, before computing the magnitude (pre-envelope deconvolution). Our Psychophysical studies indicate approximately a 4-fold improvement in detection efficiency with pre-envelope deconvolution.

  11. The efficiency of vaginal temperature measurement for detection of estrus in Japanese Black cows

    PubMed Central

    SAKATANI, Miki; TAKAHASHI, Masashi; TAKENOUCHI, Naoki

    2016-01-01

    Recently, weak estrous behavior was assumed to be the cause of a decline in breeding efficiency in cattle. The present study investigated the effect of measuring the vaginal temperature on the detection of estrus in Japanese Black cows. First, the effect of hormone administration to cows with a functional corpus luteum on the vaginal temperature was evaluated by continuous measurement using a temperature data logger. After 24 h of cloprostenol (PG) treatment, the vaginal temperature was significantly lower than on day 7 after estrus, and the low values were maintained until the beginning of estrus (P < 0.05). The cows that received PG and exogenous progesterone (CIDR) did not show a temperature decrease until the CIDR was removed. This finding suggested that the vaginal temperature change reflected the progesterone concentration. The rate of detection of natural estrus was lower for a pedometer than for the vaginal temperature (P < 0.05); synchronization of estrus resulted in a high estrus detection rate regardless of the detection method. In a subsequent experiment, the effect of vaginal temperature measurement and the use of a pedometer on estrus detection was evaluated in the cool and hot seasons. The average activities during non-estrus and the activity increase ratio (estrus/non-estrus) changed according to season (P < 0.01, P < 0.05). However, the average vaginal temperatures during estrus and non-estrus were not affected by season. The estrus detection rate of the pedometer was lower in summer and lower than that obtained using the vaginal temperature. These results indicated that vaginal temperature measurement might be effective for detecting estrus regardless of estrous behavior. PMID:26853785

  12. A robust and efficient approach to detect 3D rectal tubes from CT colonography

    SciTech Connect

    Yang Xiaoyun; Slabaugh, Greg

    2011-11-15

    Purpose: The rectal tube (RT) is a common source of false positives (FPs) in computer-aided detection (CAD) systems for CT colonography. A robust and efficient detection of RT can improve CAD performance by eliminating such ''obvious'' FPs and increase radiologists' confidence in CAD. Methods: In this paper, we present a novel and robust bottom-up approach to detect the RT. Probabilistic models, trained using kernel density estimation on simple low-level features, are employed to rank and select the most likely RT tube candidate on each axial slice. Then, a shape model, robustly estimated using random sample consensus (RANSAC), infers the global RT path from the selected local detections. Subimages around the RT path are projected into a subspace formed from training subimages of the RT. A quadratic discriminant analysis (QDA) provides a classification of a subimage as RT or non-RT based on the projection. Finally, a bottom-top clustering method is proposed to merge the classification predictions together to locate the tip position of the RT. Results: Our method is validated using a diverse database, including data from five hospitals. On a testing data with 21 patients (42 volumes), 99.5% of annotated RT paths have been successfully detected. Evaluated with CAD, 98.4% of FPs caused by the RT have been detected and removed without any loss of sensitivity. Conclusions: The proposed method demonstrates a high detection rate of the RT path, and when tested in a CAD system, reduces FPs caused by the RT without the loss of sensitivity.

  13. Detection of Babesia caballi and Babesia equi in Dermacentor nuttalli adult ticks.

    PubMed

    Battsetseg, B; Xuan, X; Ikadai, H; Bautista, J L; Byambaa, B; Boldbaatar, D; Battur, B; Battsetseg, G; Batsukh, Z; Igarashi, I; Nagasawa, H; Mikami, T; Fujisaki, K

    2001-04-01

    Ticks play an important role in human and veterinary medicine particularly due to their ability to transmit protozoan pathogens. In this study we have demonstrated that polymerase chain reaction (PCR) and nested PCR methods enabled detection of Babesia caballi and Babesia equi in field isolates of Dermacentor nuttalli adult ticks from Mongolia. Primers specific for 218 bp fragment merozoite antigen 1 (EMA-1) gene of B. equi successfully amplified products from all samples of D. nuttalli adult ticks while primers for the 430 bp fragment product from BC48 gene of B. caballi amplified products from seven of the 54 samples. Using PCR and nested PCR methods we have found mixed infections with B. equi and B. caballi in the tick vector. The amplified DNA fragment from D. nuttalli ticks was inserted into the EcoRV site of pBluescript SK and sequenced. The sequence of the 430 bp fragment was completely identical to the nucleotide sequence of the USDA strain of B. caballi. These results suggest that D. nuttalli may play an important role as a vector of both B. caballi and B. equi and also may be important in maintaining endemicity of equine piroplasmosis in Mongolia.

  14. Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1 dynamics in adult mouse

    PubMed Central

    Zampieri, Alexandre; Champagne, Julien; Auzemery, Baptiste; Fuentes, Ivanna; Maurel, Benjamin; Bienvenu, Frédéric

    2015-01-01

    We present here a novel method for the semi-quantitative detection of low abundance proteins in solution that is both fast and simple. It is based on Homogenous Time Resolved Förster Resonance Energy Transfer (HTRF), between a lanthanide labeled donor antibody and a d2 or XL665 labeled acceptor antibody that are both raised against different epitopes of the same target. This novel approach we termed “Tandem-HTRF”, can specifically reveal rare polypeptides from only a few microliters of cellular lysate within one hour in a 384-well plate format. Using this sensitive approach, we observed surprisingly that the core cell cycle regulator Cyclin D1 is sustained in fully developed adult organs and harbors an unexpected expression pattern affected by environmental challenge. Thus our method, Tandem-HTRF offers a promising way to investigate subtle variations in the dynamics of sparse proteins from limited biological material. PMID:26503526

  15. Detection efficiency calculation for photons, electrons and positrons in a well detector. Part I: Analytical model

    NASA Astrophysics Data System (ADS)

    Pommé, S.

    2009-06-01

    An analytical model is presented to calculate the total detection efficiency of a well-type radiation detector for photons, electrons and positrons emitted from a radioactive source at an arbitrary position inside the well. The model is well suited to treat a typical set-up with a point source or cylindrical source and vial inside a NaI well detector, with or without lead shield surrounding it. It allows for fast absolute or relative total efficiency calibrations for a wide variety of geometrical configurations and also provides accurate input for the calculation of coincidence summing effects. Depending on its accuracy, it may even be applied in 4π-γ counting, a primary standardisation method for activity. Besides an accurate account of photon interactions, precautions are taken to simulate the special case of 511 keV annihilation quanta and to include realistic approximations for the range of (conversion) electrons and β -- and β +-particles.

  16. An efficient sampling algorithm for uncertain abnormal data detection in biomedical image processing and disease prediction.

    PubMed

    Liu, Fei; Zhang, Xi; Jia, Yan

    2015-01-01

    In this paper, we propose a computer information processing algorithm that can be used for biomedical image processing and disease prediction. A biomedical image is considered a data object in a multi-dimensional space. Each dimension is a feature that can be used for disease diagnosis. We introduce a new concept of the top (k1,k2) outlier. It can be used to detect abnormal data objects in the multi-dimensional space. This technique focuses on uncertain space, where each data object has several possible instances with distinct probabilities. We design an efficient sampling algorithm for the top (k1,k2) outlier in uncertain space. Some improvement techniques are used for acceleration. Experiments show our methods' high accuracy and high efficiency.

  17. Detection of Cardiovascular Disease Risk's Level for Adults Using Naive Bayes Classifier

    PubMed Central

    Miranda, Eka; Amelga, Alowisius Y.; Maribondang, Marco M.; Salim, Mulyadi

    2016-01-01

    Objectives The number of deaths caused by cardiovascular disease and stroke is predicted to reach 23.3 million in 2030. As a contribution to support prevention of this phenomenon, this paper proposes a mining model using a naïve Bayes classifier that could detect cardiovascular disease and identify its risk level for adults. Methods The process of designing the method began by identifying the knowledge related to the cardiovascular disease profile and the level of cardiovascular disease risk factors for adults based on the medical record, and designing a mining technique model using a naïve Bayes classifier. Evaluation of this research employed two methods: accuracy, sensitivity, and specificity calculation as well as an evaluation session with cardiologists and internists. The characteristics of cardiovascular disease are identified by its primary risk factors. Those factors are diabetes mellitus, the level of lipids in the blood, coronary artery function, and kidney function. Class labels were assigned according to the values of these factors: risk level 1, risk level 2 and risk level 3. Results The evaluation of the classifier performance (accuracy, sensitivity, and specificity) in this research showed that the proposed model predicted the class label of tuples correctly (above 80%). More than eighty percent of respondents (including cardiologists and internists) who participated in the evaluation session agree till strongly agreed that this research followed medical procedures and that the result can support medical analysis related to cardiovascular disease. Conclusions The research showed that the proposed model achieves good performance for risk level detection of cardiovascular disease. PMID:27525161

  18. [The enhanced efficiency of nystagmus detection using the modified Frenzel goggles with congenerous illumination].

    PubMed

    Pal'chun, V T; Kryukov, A I; Guseva, A L; Chernov, A L

    2016-01-01

    The objective of the present study was to evaluate the efficiency and convenience of using the new modified Frenzel goggles in diagnostics of spontaneous nystagmus. It was shown that the modified Frenzel goggles provide more homogeneous lightening of the eyes and better diagnosis of peripheral latent spontaneous nystagmus in comparison with the traditional Frenzel goggles, available at the market. The questionnaire survey held among the doctors using both types of the goggles showed that the modified Frenzel goggles are more convenient for detecting spontaneous nystagmus in everyday practice.

  19. A novel standby mode detection scheme with light load efficiency improvement

    NASA Astrophysics Data System (ADS)

    Hu, Jiajun; Chen, Houpeng; Wang, Qian; Li, Xi; Fan, Xi; Miao, Jie; Song, Zhitang

    2016-10-01

    A novel standby mode scheme with light load efficiency improvement is proposed in this paper, which is especially suitable for modern boost dc-dc converters powered by Li-ion battery. The proposed output load estimator is able to accurately reflect the output load current under light load condition once inductor current enters in the discontinuous conduction mode (DCM). Our experimental results show that the proposed boost dc-dc converter can automatically select approximate PWM switching frequency according to the detected information of the proposed output load estimator, regardless of power supply and inductor value.

  20. Room-temperature efficient light detection by amorphous Ge quantum wells

    PubMed Central

    2013-01-01

    In this work, ultrathin amorphous Ge films (2 to 30 nm in thickness) embedded in SiO2 layers were grown by magnetron sputtering and employed as proficient light sensitizer in photodetector devices. A noteworthy modification of the visible photon absorption is evidenced due to quantum confinement effects which cause both a blueshift (from 0.8 to 1.8 eV) in the bandgap and an enhancement (up to three times) in the optical oscillator strength of confined carriers. The reported quantum confinement effects have been exploited to enhance light detection by Ge quantum wells, as demonstrated by photodetectors with an internal quantum efficiency of 70%. PMID:23496870

  1. Signal Processing and Its Effect on Scanning Efficiencies for a Field Instrument for Detecting Low-energy Radiation.

    PubMed

    Marianno, Craig M

    2015-07-01

    Signal processing within a radiation detector affects detection efficiency. Currently, organizations such as private industry, the U.S. Navy, Army, and Air Force are coupling some detector systems with data collection devices to survey large land areas for radioactive contamination. As detector technology has advanced and analog data collection has turned to digital, signal processing is becoming prevalent in some instruments. Using a NIST traceable (241)Am source, detection efficiency for a field instrument for detecting low-energy radiation (FIDLER) was examined for both a static and scanning mode. Experimental results were compared to Monte Carlo-generated efficiencies. Stationary data compared nicely to the theoretical results. Conversely, scanning detection efficiencies were considerably different from their theoretical counterparts. As speed increased, differences in detection efficiency approached two orders of magnitude. To account for these differences, a quasi time-dependent Monte Carlo simulation was created mimicking the signal processing undertaken by the FIDLER detection system. By including signal processing, experimental results fell within the bounds of the Monte Carlo-generated efficiencies, thus demonstrating the negative effects of such processing on detection efficiencies.

  2. An Efficient Moving Target Detection Algorithm Based on Sparsity-Aware Spectrum Estimation

    PubMed Central

    Shen, Mingwei; Wang, Jie; Wu, Di; Zhu, Daiyin

    2014-01-01

    In this paper, an efficient direct data domain space-time adaptive processing (STAP) algorithm for moving targets detection is proposed, which is achieved based on the distinct spectrum features of clutter and target signals in the angle-Doppler domain. To reduce the computational complexity, the high-resolution angle-Doppler spectrum is obtained by finding the sparsest coefficients in the angle domain using the reduced-dimension data within each Doppler bin. Moreover, we will then present a knowledge-aided block-size detection algorithm that can discriminate between the moving targets and the clutter based on the extracted spectrum features. The feasibility and effectiveness of the proposed method are validated through both numerical simulations and raw data processing results. PMID:25222035

  3. Accounting for Limited Detection Efficiency and Localization Precision in Cluster Analysis in Single Molecule Localization Microscopy

    PubMed Central

    Shivanandan, Arun; Unnikrishnan, Jayakrishnan; Radenovic, Aleksandra

    2015-01-01

    Single Molecule Localization Microscopy techniques like PhotoActivated Localization Microscopy, with their sub-diffraction limit spatial resolution, have been popularly used to characterize the spatial organization of membrane proteins, by means of quantitative cluster analysis. However, such quantitative studies remain challenged by the techniques’ inherent sources of errors such as a limited detection efficiency of less than 60%, due to incomplete photo-conversion, and a limited localization precision in the range of 10 – 30nm, varying across the detected molecules, mainly depending on the number of photons collected from each. We provide analytical methods to estimate the effect of these errors in cluster analysis and to correct for them. These methods, based on the Ripley’s L(r) – r or Pair Correlation Function popularly used by the community, can facilitate potentially breakthrough results in quantitative biology by providing a more accurate and precise quantification of protein spatial organization. PMID:25794150

  4. Efficient isolation of multiphoton processes and detection of collective resonances in dilute samples

    NASA Astrophysics Data System (ADS)

    Bruder, Lukas; Binz, Marcel; Stienkemeier, Frank

    2015-11-01

    A phase modulation technique to sensitively and selectively isolate multiple-quantum coherences in a femtosecond pump-probe setup is presented. By detecting incoherent observables and incorporating lock-in amplification, even weak signals of highly dilute samples can be acquired. Applying this method, efficient isolation of one- and two-photon quantum beats in a rubidium-doped helium droplet beam experiment is demonstrated and collective resonances are observed in a potassium vapor for the first time up to fourth order. Our approach provides promising perspectives for coherent time-resolved experiments in the deep UV and multidimensional spectroscopy schemes, in particular when mass-selective detection of particles in dilute gas-phase targets is possible.

  5. An Efficient Representation-Based Method for Boundary Point and Outlier Detection.

    PubMed

    Li, Xiaojie; Lv, Jiancheng; Yi, Zhang

    2016-10-19

    Detecting boundary points (including outliers) is often more interesting than detecting normal observations, since they represent valid, interesting, and potentially valuable patterns. Since data representation can uncover the intrinsic data structure, we present an efficient representation-based method for detecting such points, which are generally located around the margin of densely distributed data, such as a cluster. For each point, the negative components in its representation generally correspond to the boundary points among its affine combination of points. In the presented method, the reverse unreachability of a point is proposed to evaluate to what degree this observation is a boundary point. The reverse unreachability can be calculated by counting the number of zero and negative components in the representation. The reverse unreachability explicitly takes into account the global data structure and reveals the disconnectivity between a data point and other points. This paper reveals that the reverse unreachability of points with lower density has a higher score. Note that the score of reverse unreachability of an outlier is greater than that of a boundary point. The top-$m$ ranked points can thus be identified as outliers. The greater the value of the reverse unreachability, the more likely the point is a boundary point. Compared with related methods, our method better reflects the characteristics of the data, and simultaneously detects outliers and boundary points regardless of their distribution and the dimensionality of the space. Experimental results obtained for a number of synthetic and real-world data sets demonstrate the effectiveness and efficiency of our method.

  6. Hybrid Magnetic-DNA Directed Immobilisation Approach for Efficient Protein Capture and Detection on Microfluidic Platforms.

    PubMed

    Esmaeili, Elaheh; Ghiass, Mohammad Adel; Vossoughi, Manouchehr; Soleimani, Masoud

    2017-03-15

    In this study, a hybrid magnetic-DNA directed immobilisation approach is presented to enhance protein capture and detection on a microfluidic platform. DNA-modified magnetic nanoparticles are added in a solution to capture fluorescently labelled immunocomplexes to be detected optically. A magnetic set-up composed of cubic permanent magnets and a microchannel was designed and implemented based on finite element analysis results to efficiently concentrate the nanoparticles only over a defined area of the microchannel as the sensing zone. This in turn, led to the fluorescence emission localisation and the searching area reduction. Also, compared to processes in which the immunocomplex is formed directly on the surface, the proposed approach provides a lower steric hindrance, higher mass transfer, lower equilibrium time, and more surface concentration of the captured targets leading to a faster and more sensitive detection. As a proof-of-concept, the set-up is capable of detecting prostate-specific membrane antigen with concentrations down to 0.7 nM. Our findings suggest that the approach holds a great promise for applications in clinical assays and disease diagnosis.

  7. Efficient epileptic seizure detection by a combined IMF-VoE feature.

    PubMed

    Qi, Yu; Wang, Yueming; Zheng, Xiaoxiang; Zhang, Jianmin; Zhu, Junming; Guo, Jianping

    2012-01-01

    Automatic seizure detection from the electroen-cephalogram (EEG) plays an important role in an on-demand closed-loop therapeutic system. A new feature, called IMF-VoE, is proposed to predict the occurrence of seizures. The IMF-VoE feature combines three intrinsic mode functions (IMFs) from the empirical mode decomposition of a EEG signal and the variance of the range between the upper and lower envelopes (VoE) of the signal. These multiple cues encode the intrinsic characteristics of seizure states, thus are able to distinguish them from the background. The feature is tested on 80.4 hours of EEG data with 10 seizures of 4 patients. The sensitivity of 100% is obtained with a low false detection rate of 0.16 per hour. Average time delays are 19.4s, 13.2s, and 10.7s at the false detection rates of 0.16 per hour, 0.27 per hour, and 0.41 per hour respectively, when different thresholds are used. The result is competitive among recent studies. In addition, since the IMF-VoE is compact, the detection system is of high computational efficiency and able to run in real time.

  8. Correlates and Cross-Linguistic Comparisons of Informativeness and Efficiency on Nicholas and Brookshire Discourse Stimuli in Spanish/English Bilingual Adults

    ERIC Educational Resources Information Center

    Edmonds, Lisa A.

    2013-01-01

    Purpose: The purpose of this study was to determine (a) correlates of informativeness and efficiency in discourse and (b) potential cross-linguistic and stimulus type (picture vs. nonpicture) differences in measures of informativeness and efficiency in Spanish/English bilingual adults in the United States. Method: Eighty-eight Spanish/English…

  9. Use of CHAID Decision Trees to Formulate Pathways for the Early Detection of Metabolic Syndrome in Young Adults

    PubMed Central

    Liu, Pei-Yang

    2014-01-01

    Metabolic syndrome (MetS) in young adults (age 20–39) is often undiagnosed. A simple screening tool using a surrogate measure might be invaluable in the early detection of MetS. Methods. A chi-squared automatic interaction detection (CHAID) decision tree analysis with waist circumference user-specified as the first level was used to detect MetS in young adults using data from the National Health and Nutrition Examination Survey (NHANES) 2009-2010 Cohort as a representative sample of the United States population (n = 745). Results. Twenty percent of the sample met the National Cholesterol Education Program Adult Treatment Panel III (NCEP) classification criteria for MetS. The user-specified CHAID model was compared to both CHAID model with no user-specified first level and logistic regression based model. This analysis identified waist circumference as a strong predictor in the MetS diagnosis. The accuracy of the final model with waist circumference user-specified as the first level was 92.3% with its ability to detect MetS at 71.8% which outperformed comparison models. Conclusions. Preliminary findings suggest that young adults at risk for MetS could be identified for further followup based on their waist circumference. Decision tree methods show promise for the development of a preliminary detection algorithm for MetS. PMID:24817904

  10. Use of CHAID decision trees to formulate pathways for the early detection of metabolic syndrome in young adults.

    PubMed

    Miller, Brian; Fridline, Mark; Liu, Pei-Yang; Marino, Deborah

    2014-01-01

    Metabolic syndrome (MetS) in young adults (age 20-39) is often undiagnosed. A simple screening tool using a surrogate measure might be invaluable in the early detection of MetS. Methods. A chi-squared automatic interaction detection (CHAID) decision tree analysis with waist circumference user-specified as the first level was used to detect MetS in young adults using data from the National Health and Nutrition Examination Survey (NHANES) 2009-2010 Cohort as a representative sample of the United States population (n = 745). Results. Twenty percent of the sample met the National Cholesterol Education Program Adult Treatment Panel III (NCEP) classification criteria for MetS. The user-specified CHAID model was compared to both CHAID model with no user-specified first level and logistic regression based model. This analysis identified waist circumference as a strong predictor in the MetS diagnosis. The accuracy of the final model with waist circumference user-specified as the first level was 92.3% with its ability to detect MetS at 71.8% which outperformed comparison models. Conclusions. Preliminary findings suggest that young adults at risk for MetS could be identified for further followup based on their waist circumference. Decision tree methods show promise for the development of a preliminary detection algorithm for MetS.

  11. Efficient detection of a CW signal with a linear frequency drift

    NASA Technical Reports Server (NTRS)

    Swarztrauber, Paul N.; Bailey, David H.

    1989-01-01

    An efficient method is presented for the detection of a continuous wave (CW) signal with a frequency drift that is linear in time. Signals of this type occur in transmissions between any two locations that are accelerating relative to one another, e.g., transmissions from the Voyager spacecraft. We assume that both the frequency and the drift are unknown. We also assume that the signal is weak compared to the Gaussian noise. The signal is partitioned into subsequences whose discrete Fourier transforms provide a sequence of instantaneous spectra at equal time intervals. These spectra are then accumulated with a shift that is proportional to time. When the shift is equal to the frequency drift, the signal to noise ratio increases and detection occurs. Here, we show how to compute these accumulations for many shifts in an efficient manner using a variety of Fast Fourier Transformations (FFT). Computing time is proportional to L log L where L is the length of the time series.

  12. An Energy-Efficient Cluster-Based Vehicle Detection on Road Network Using Intention Numeration Method

    PubMed Central

    Devasenapathy, Deepa; Kannan, Kathiravan

    2015-01-01

    The traffic in the road network is progressively increasing at a greater extent. Good knowledge of network traffic can minimize congestions using information pertaining to road network obtained with the aid of communal callers, pavement detectors, and so on. Using these methods, low featured information is generated with respect to the user in the road network. Although the existing schemes obtain urban traffic information, they fail to calculate the energy drain rate of nodes and to locate equilibrium between the overhead and quality of the routing protocol that renders a great challenge. Thus, an energy-efficient cluster-based vehicle detection in road network using the intention numeration method (CVDRN-IN) is developed. Initially, sensor nodes that detect a vehicle are grouped into separate clusters. Further, we approximate the strength of the node drain rate for a cluster using polynomial regression function. In addition, the total node energy is estimated by taking the integral over the area. Finally, enhanced data aggregation is performed to reduce the amount of data transmission using digital signature tree. The experimental performance is evaluated with Dodgers loop sensor data set from UCI repository and the performance evaluation outperforms existing work on energy consumption, clustering efficiency, and node drain rate. PMID:25793221

  13. A Simple and Efficient Method to Detect Nuclear Factor Activation in Human Neutrophils by Flow Cytometry

    PubMed Central

    García-García, Erick; Uribe-Querol, Eileen; Rosales, Carlos

    2013-01-01

    Neutrophils are the most abundant leukocytes in peripheral blood. These cells are the first to appear at sites of inflammation and infection, thus becoming the first line of defense against invading microorganisms. Neutrophils possess important antimicrobial functions such as phagocytosis, release of lytic enzymes, and production of reactive oxygen species. In addition to these important defense functions, neutrophils perform other tasks in response to infection such as production of proinflammatory cytokines and inhibition of apoptosis. Cytokines recruit other leukocytes that help clear the infection, and inhibition of apoptosis allows the neutrophil to live longer at the site of infection. These functions are regulated at the level of transcription. However, because neutrophils are short-lived cells, the study of transcriptionally regulated responses in these cells cannot be performed with conventional reporter gene methods since there are no efficient techniques for neutrophil transfection. Here, we present a simple and efficient method that allows detection and quantification of nuclear factors in isolated and immunolabeled nuclei by flow cytometry. We describe techniques to isolate pure neutrophils from human peripheral blood, stimulate these cells with anti-receptor antibodies, isolate and immunolabel nuclei, and analyze nuclei by flow cytometry. The method has been successfully used to detect NF-κB and Elk-1 nuclear factors in nuclei from neutrophils and other cell types. Thus, this method represents an option for analyzing activation of transcription factors in isolated nuclei from a variety of cell types. PMID:23603868

  14. Effect of the wire width on the intrinsic detection efficiency of superconducting-nanowire single-photon detectors

    SciTech Connect

    Lusche, R. Semenov, A.; Ilin, K.; Siegel, M.; Korneeva, Y.; Trifonov, A.; Korneev, A.; Goltsman, G.; Vodolazov, D.; Hübers, H.-W.

    2014-07-28

    A thorough spectral study of the intrinsic single-photon detection efficiency in superconducting TaN and NbN nanowires with different widths has been performed. The experiment shows that the cut-off of the intrinsic detection efficiency at near-infrared wavelengths is most likely controlled by the local suppression of the barrier for vortex nucleation around the absorption site. Beyond the cut-off quasi-particle diffusion in combination with spontaneous, thermally activated vortex crossing explains the detection process. For both materials, the reciprocal cut-off wavelength scales linearly with the wire width where the scaling factor agrees with the hot-spot detection model.

  15. Efficient genome-wide detection and cataloging of EMS-induced mutations using exome capture and next-generation sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chemical mutagenesis efficiently generates phenotypic variation in otherwise homogeneous genetic backgrounds, enabling functional analysis of genes. Advances in mutation detection have brought the utility of induced mutant populations on par with those produced by insertional mutagenesis, but system...

  16. Efficient and robust ventricular tachycardia and fibrillation detection method for wearable cardiac health monitoring devices.

    PubMed

    Prabhakararao, Eedara; Manikandan, M Sabarimalai

    2016-09-01

    In this Letter, the authors propose an efficient and robust method for automatically determining the VT and VF events in the electrocardiogram (ECG) signal. The proposed method consists of: (i) discrete cosine transform (DCT)-based noise suppression; (ii) addition of bipolar sequence of amplitudes with alternating polarity; (iii) zero-crossing rate (ZCR) estimation-based VTVF detection; and (iv) peak-to-peak interval (PPI) feature based VT/VF discrimination. The proposed method is evaluated using 18,000 episodes of different ECG arrhythmias taken from 6 PhysioNet databases. The method achieves an average sensitivity (Se) of 99.61%, specificity (Sp) of 99.96%, and overall accuracy (OA) of 99.92% in detecting VTVF and non-VTVF episodes by using a ZCR feature. Results show that the method achieves a Se of 100%, Sp of 99.70% and OA of 99.85% for discriminating VT from VF episodes using PPI features extracted from the processed signal. The robustness of the method is tested using different kinds of ECG beats and various types of noises including the baseline wanders, powerline interference and muscle artefacts. Results demonstrate that the proposed method with the ZCR, PPI features can achieve significantly better detection rates as compared with the existing methods.

  17. Enhanced and efficient detection of virus-driven cytokine expression by human NK and T cells.

    PubMed

    Pattacini, Laura; Murnane, Pamela M; Fluharty, Tayler R; Katabira, Elly; De Rosa, Stephen C; Baeten, Jared M; Lund, Jennifer M

    2014-04-01

    Cutting edge immune monitoring techniques increasingly measure multiple functional outputs for various cell types, such as intracellular cytokine staining (ICS) assays that measure cytokines expressed by T cells. To date, however, there is no precise method to measure virus-specific cytokine production by both T cells as well as NK cells in the same well, which is important to a greater extent given recent identification of NK cells expressing a memory phenotype. This study describes an adaptable and efficient ICS assay platform that can be used to detect antigen-driven cytokine production by human T cells and NK cells, termed "viral ICS". Importantly, this assay uses limited amount of cryopreserved PBMCs along with autologous heat-inactivated serum, thereby allowing for this assay to be performed when sample is scarce as well as geographically distant from the laboratory. Compared to a standard ICS assay that detects antigen-specific T cell cytokine expression alone, the viral ICS assay is comparable in terms of both HIV-specific CD4 and CD8T cell cytokine response rates and magnitude of response, with the added advantage of ability to detect virus-specific NK cell responses.

  18. High-efficient physical adsorption and detection of formaldehyde using Sc- and Ti-decorated graphdiyne

    NASA Astrophysics Data System (ADS)

    Chen, Xi; Gao, Pengfei; Guo, Lei; Wen, Yanni; Fang, Dangqi; Gong, Baihua; Zhang, Yang; Zhang, Shengli

    2017-03-01

    In sensitive analysis, the ultimate limit is to achieve reliable detection on trace amount of molecules. In this work, Sc- and Ti-decorated graphdiyne were proposed as promising materials for high-efficient molecular detection. Using density functional theory calculations, we investigated the electronic response of single Sc- and Ti-atom-decorated graphdiyne to HCHO (as a typical air pollutant). Thermodynamic analysis predicted that Sc or Ti adatom could be stabilized on the corner sites of single-layer graphdiyne sheet, with migration barriers high enough to prevent Sc or Ti adatom aggregation. The adsorption of HCHO on Sc- or Ti-decorated graphdiyne was found stronger than on pristine graphene or graphdiyne, which provides a prerequisite for molecular sensing. The electronegativity of HCHO leads to strong electronic attraction from Sc or Ti adatom to HCHO, resulting in a remarkable decrease of carrier density in graphdiyne. On Ti-decorated graphdiyne, the electronic attraction of HCHO appears to be stronger than on Sc-decorated graphdiyne and changes the system from metal to n-doped semiconductor. Quantum transport calculations show a decrease of current caused by the adsorbed HCHO. The results systematically exhibit the electronic response of Sc- or Ti-decorated graphdiyne to HCHO and suggest them as promising materials for molecule detection.

  19. An efficient unsupervised fetal QRS complex detection from abdominal maternal ECG.

    PubMed

    Varanini, M; Tartarisco, G; Billeci, L; Macerata, A; Pioggia, G; Balocchi, R

    2014-08-01

    Non-invasive fetal heart rate is of great relevance in clinical practice to monitor fetal health state during pregnancy. To date, however, despite significant advances in the field of electrocardiography, the analysis of abdominal fetal ECG is considered a challenging problem for biomedical and signal processing communities. This is mainly due to the low signal-to-noise ratio of fetal ECG and difficulties in cancellation of maternal QRS complexes, motion and electromyographic artefacts. In this paper we present an efficient unsupervised algorithm for fetal QRS complex detection from abdominal multichannel signal recordings combining ICA and maternal ECG cancelling, which outperforms each single method. The signal is first pre-processed to remove impulsive artefacts, baseline wandering and power line interference. The following steps are then applied: maternal ECG extraction through independent component analysis (ICA); maternal QRS detection; maternal ECG cancelling through weighted singular value decomposition; enhancing of fetal ECG through ICA and fetal QRS detection. We participated in the Physionet/Computing in Cardiology Challenge 2013, obtaining the top official scores of the challenge (among 53 teams of participants) of event 1 and event 2 concerning fetal heart rate and fetal interbeat intervals estimation section. The developed algorithms are released as open-source on the Physionet website.

  20. An efficient method for miRNA detection and localization in crop plants

    PubMed Central

    Rosas-Cárdenas, Flor de Fátima; Escobar-Guzmán, Rocío; Cruz-Hernández, Andrés; Marsch-Martínez, Nayelli; de Folter, Stefan

    2015-01-01

    microRNAs are a class of non-coding small RNAs (sRNAs) that are important regulators of gene expression at the post-transcriptional level by mRNA cleavage or translation inhibition. Another class of sRNAs are siRNAs, which also regulate gene expression but by causing DNA methylation. This epigenetic regulatory role has been observed for some miRNAs as well. The use of sRNAs allows the development of biotechnological applications in plants. To develop these types of applications, and to better understand the natural roles they play, it is important to be able to detect and to localize these sRNAs at the plant tissue level. Sometimes, in crop plants this can be challenging. Therefore, we developed a tissue printing hybridization protocol for easy and efficient detection of sRNAs and demonstrate this by the analysis of the spatio-temporal expression patterns of the miRNAs miR159 and miR164 in fruits of various crop plants. Moreover, we show the possibility to also detect the expression of miRNAs in fruit juice using a dot blot hybridization approach. PMID:25784917

  1. PCR/SSCP detects reliably and efficiently DNA sequence variations in large scale screening projects.

    PubMed

    Miterski, B; Krüger, R; Wintermeyer, P; Epplen, J T

    2000-06-01

    A simple and fast method with high reliability is necessary for the identification of mutations, polymorphisms and sequence variants (MPSV) within many genes and many samples, e.g. for clarifying the genetic background of individuals with multifactorial diseases. Here we review our experience with the polymerase chain reaction/single-strand conformation polymorphism (PCR/SSCP) analysis to identify MPSV in a number of genes thought to be involved in the pathogenesis of multifactorial neurological disorders, including autoimmune diseases like multiple sclerosis (MS) and neurodegenerative disorders like Parkinson s disease (PD). The method is based on the property of the DNA that the electrophoretic mobility of single stranded nucleic acids depends not only on their size but also on their sequence. The target sequences were amplified, digested into fragments ranging from 50-240 base pairs (bp), heat-denatured and analysed on native polyacrylamide (PAA) gels of different composition. The analysis of a great number of different PCR products demonstrates that the detection rate of MPSV depends on the fragment lengths, the temperature during electrophoresis and the composition of the gel. In general, the detection of MPSV is neither influenced by their location within the DNA fragment nor by the type of substitution, i.e., transitions or transversions. The standard PCR/SSCP system described here provides high reliability and detection rates. It allows the efficient analysis of a large number of DNA samples and many different genes.

  2. Efficiency of AUY922 in mice with adult T-cell leukemia/lymphoma

    PubMed Central

    ISHIKAWA, CHIE; SENBA, MASACHIKA; MORI, NAOKI

    2016-01-01

    Adult T-cell leukemia/lymphoma (ATLL) is an aggressive malignancy caused by human T-cell leukemia virus type 1 (HTLV-1). ATLL is associated with poor prognosis mainly due to resistance to chemotherapy, which highlights the requirement for alternative therapies. The chaperone heat shock protein (HSP) 90 assist proteins involved in the onset and progression of ATLL. In the present study, the efficacy of a second generation HSP90 inhibitor termed AUY922 was investigated in ATLL. In vitro, AUY922 induced marked inhibition of cell viability in the HTLV-1-infected T-cell lines HUT-102 and MT-4. In immunodeficient mice bearing HUT-102 xenotransplants, AUY922 markedly retarded tumor growth, compared with the control group. Apoptosis was evident in hematoxylin and eosin stained- and terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick end labeling-labeled tissue sections from AUY922-treated mice. In addition, AUY922 significantly reduced the serum levels of the surrogate tumor markers soluble interleukin-2 receptor and soluble cluster of differentiation 30. Overall, the present results demonstrate that AUY922 has potent anti-ATLL activity, thus providing a rationale for continuing the clinical development of HSP90 inhibitors in clinical trials for the treatment of patients with ATLL. PMID:27347156

  3. Trail Making Test performance contributes to subjective judgment of visual efficiency in older adults

    PubMed Central

    Loughman, James; Savva, George M.; Kenny, RoseAnne

    2015-01-01

    Introduction. The determinant factors that influence self-reported quality of vision have yet to be fully elucidated. This study evaluated a range of contextual information, established psychophysical tests, and in particular, a series of cognitive tests as potentially novel determinant factors. Materials & Methods. Community dwelling adults (aged 50+) recruited to Wave 1 of The Irish Longitudinal Study on Ageing, excluding those registered blind, participated in this study (N = 5,021). Self-reports of vision were analysed in relation to visual acuity and contrast sensitivity, ocular pathology, visual (Choice Response Time task; Trail Making Test) and global cognition. Contextual factors such as having visited an optometrist and wearing glasses were also considered. Ordinal logistic regression was used to determine univariate and multivariate associations. Results and Discussion. Poor Trail Making Test performance (Odds ratio, OR = 1.36), visual acuity (OR = 1.72) and ocular pathology (OR = 2.25) were determinant factors for poor versus excellent vision in self-reports. Education, wealth, age, depressive symptoms and general cognitive fitness also contributed to determining self-reported vision. Conclusions. Trail Making Test contribution to self-reports may capture higher level visual processing and should be considered when using self-reports to assess vision and its role in cognitive and functional health. PMID:26664798

  4. More than Just Another Face in the Crowd: Superior Detection of Threatening Facial Expressions in Children and Adults

    ERIC Educational Resources Information Center

    LoBue, Vanessa

    2009-01-01

    Threatening facial expressions can signal the approach of someone or something potentially dangerous. Past research has established that adults have an attentional bias for angry faces, visually detecting their presence more quickly than happy or neutral faces. Two new findings are reported here. First, evidence is presented that young children…

  5. More than just another face in the crowd: superior detection of threatening facial expressions in children and adults.

    PubMed

    LoBue, Vanessa

    2009-03-01

    Threatening facial expressions can signal the approach of someone or something potentially dangerous. Past research has established that adults have an attentional bias for angry faces, visually detecting their presence more quickly than happy or neutral faces. Two new findings are reported here. First, evidence is presented that young children share this attentional bias. In five experiments, young children and adults were asked to find a picture of a target face among an array of eight distracter faces. Both age groups detected threat-relevant faces--angry and frightened--more rapidly than non-threat-relevant faces (happy and sad). Second, evidence is presented that both adults and children have an attentional bias for negative stimuli overall. All negative faces were detected more quickly than positive ones in both age groups. As the first evidence that young children exhibit the same superior detection of threatening facial expressions as adults, this research provides important support for the existence of an evolved attentional bias for threatening stimuli.

  6. Quantitative Molecular Detection of 19 Major Pathogens in the Interdental Biofilm of Periodontally Healthy Young Adults

    PubMed Central

    Carrouel, Florence; Viennot, Stéphane; Santamaria, Julie; Veber, Philippe; Bourgeois, Denis

    2016-01-01

    pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the interdental biofilm. T. forsythensis and T. denticola (0.02 and 0.04% of the interdental biofilm) were detected in 93 and 49% of healthy subjects, respectively. The effective presence of periodontal pathogens is a strong indicator of the need to develop new methods for disrupting interdental biofilm in daily oral hygiene. PMID:27313576

  7. Intravenous morphine titration as a rapid and efficient analgesia for adult patients with femoral shaft fractures after injury.

    PubMed

    Pan, Zhengqi; Qi, Yongjian; Wen, Yinxian; Chen, Liaobin

    2016-11-01

    This study aimed to compare the analgesic effects of intravenous ibuprofen and intravenous morphine titration for femoral shaft fractures in adult patients. In total, 293 participants were enrolled and randomly received intravenous ibuprofen or intravenous morphine titration. Their visual analogue scale (VAS) results were recorded every 5 minutes after the first administration. The VAS scores before and during transport were also measured. Meanwhile, the type and frequency of the adverse effects were also recorded in both groups. Patients treated with morphine showed a faster and greater reduction in the VAS than those in the ibuprofen group within 1 hour after the first administration. Interestingly, intravenous morphine titration provided consistent analgesia even during the further transport. No significant immediate adverse event was observed in all of the participants, except for sedation, which might be beneficial for keeping the patient quiet and might not be arbitrarily attributed to adverse effects. No addiction was noted in the morphine group. This study demonstrated that intravenous morphine titration is a faster and more efficient analgesia for femoral shaft fractures than ibuprofen in adult patients immediately after injury.

  8. Rapid, simple and efficient method for detection of viral genomes on raspberries.

    PubMed

    Perrin, A; Loutreul, J; Boudaud, N; Bertrand, I; Gantzer, C

    2015-11-01

    In recent years, foodborne viruses, especially human noroviruses (NoV) and hepatitis A virus (HAV), have been increasingly reported as the causes of foodborne disease outbreaks. Soft red fruits, especially raspberries, have a high incidence among the types of food concerned. Due to low infectious doses and low concentrations of enteric viruses in food samples, it is necessary to have an efficient and rapid detection method to implement prevention measures. A standard method for virus detection and quantification in food, including raspberries (XP CEN ISO/TS 15216-1 and -2, 2013) is currently available. This method proposes a consensus detection approach by RT-real time PCR (RT-qPCR) but also a virus extraction procedure based on the elution-concentration principle. In this study, an alternative method of extraction in which RNAs are directly extracted from food matrices (based on direct RNA extraction) has been optimized. First, each step was improved to make it a highly rapid, specific and simple method. Second, the standard virus concentration method was compared with the optimized direct RNA extraction one. Human enteric viral surrogates, Murine Norovirus (MNV) and F-specific RNA bacteriophage GA, were selected according to their adhesion properties and resistance to pH close to our main targets (NoV and HAV). Raspberries were artificially contaminated using two different techniques (immersion and spotting) in order to define a recovery rate and the amounts of virus recovered. Results showed that the direct RNA extraction method revealed significantly higher viral extraction efficiency (46.2%) than the elution-concentration method (20.3%), with similar proportions of inhibitors for both. In the same way with inoculation by spotting, the best recovery rate of GA phage (39.7% against 0.7%) and MNV (42.8% against 0.5%) was observed by direct RNA extraction. For the lowest concentrations of phage and virus in the immersion bath, only the direct RNA extraction method

  9. High efficiency direct detection of ions from resonance ionization of sputtered atoms

    DOEpatents

    Gruen, Dieter M.; Pellin, Michael J.; Young, Charles E.

    1986-01-01

    A method and apparatus are provided for trace and other quantitative analysis with high efficiency of a component in a sample, with the analysis involving the removal by ion or other bombardment of a small quantity of ion and neutral atom groups from the sample, the conversion of selected neutral atom groups to photoions by laser initiated resonance ionization spectroscopy, the selective deflection of the photoions for separation from original ion group emanating from the sample, and the detection of the photoions as a measure of the quantity of the component. In some embodiments, the original ion group is accelerated prior to the RIS step for separation purposes. Noise and other interference are reduced by shielding the detector from primary and secondary ions and deflecting the photoions sufficiently to avoid the primary and secondary ions.

  10. High efficiency direct detection of ions from resonance ionization of sputtered atoms

    DOEpatents

    Gruen, D.M.; Pellin, M.J.; Young, C.E.

    1985-01-16

    A method and apparatus are provided for trace and other quantitative analysis with high efficiency of a component in a sample, with the analysis involving the removal by ion or other bombardment of a small quantity of ion and neutral atom groups from the sample, the conversion of selected neutral atom groups to photoions by laser initiated resonance ionization spectroscopy, the selective deflection of the photoions for separation from original ion group emanating from the sample, and the detection of the photoions as a measure of the quantity of the component. In some embodiments, the original ion group is accelerated prior to the RIS step for separation purposes. Noise and other interference are reduced by shielding the detector from primary and secondary ions and deflecting the photoions sufficiently to avoid the primary and secondary ions.

  11. Ultraviolet quantum detection efficiency of potassium bromide as an opaque photocathode applied to microchannel plates

    NASA Technical Reports Server (NTRS)

    Siegmund, Oswald H. W.; Everman, E.; Vallerga, J. V.; Sokolowski, J.; Lampton, M.

    1987-01-01

    The quantum detection efficiency (QDE) of potassium bromide as a photocathode applied directly to the surface of a microchannel plate over the 250-1600 A wavelength range has been measured. The contributions of the photocathode material in the channels and on the interchannel web to the QDE have been determined. Two broad peaks in the QDE centered at about 450 and about 1050 A are apparent, the former with about 50 percent peak QDE and the latter with about 40 percent peak QDE. The photoelectric threshold is observed at about 1600 A, and there is a narrow QDE minimum at about 750 A which correlates with 2X the band gap energy for KBr. The angular variation of the QDE from 0 to 40 deg to the channnel axis has also been examined. The stability of Kbr with time is shown to be good with no significant degradation of QDE at wavelengths below 1216 A over a 15-day period in air.

  12. Analysis of the scatter effect on detective quantum efficiency of digital mammography

    NASA Astrophysics Data System (ADS)

    Park, Jiwoong; Yun, Seungman; Kim, Dong Woon; Baek, Cheol-Ha; Youn, Hanbean; Jeon, Hosang; Kim, Ho Kyung

    2016-03-01

    The scatter effect on detective quantum efficiency (DQE) of digital mammography is investigated using the cascaded-systems model. The cascaded-systems model includes a scatter-reduction device as a binomial selection stage. Quantum-noise-limited operation approximates the system DQE into the multiplication form of the scatter-reduction device DQE and the conventional detector DQE. The developed DQE model is validated in comparisons with the measured results using a CMOS flat-panel detector under scatter environments. For various scatter-reduction devices, the slot-scan method shows the best scatter-cleanup performance in terms of DQE, and the scatter-cleanup performance of the conventional one-dimensional grid is rather worse than the air gap. The developed model can also be applied to general radiography and will be very useful for a better design of imaging chain.

  13. Efficient baseline gathering and damage detection in guided wave structural health monitoring

    NASA Astrophysics Data System (ADS)

    Croxford, A. J.; Putkis, O.; Wilcox, P. D.

    2013-01-01

    Guided wave structural health monitoring (SHM) has been proposed as a technique to allow permanently attached sensors to provide information about the state of a structure. Typical approaches rely on gathering information about the baseline state of the structure and using this data with subtraction to highlight changes to the system. This relies on the baseline data accurately representing the conditions that the system will experience. In reality this is difficult to ensure and may result in either large periods out of service or poor performance. In addition the size of the baseline set can become prohibitively large. This paper describes an alternative approach that produces an efficient continuously evolving baseline. The paper considers how damage detection performance can be characterized within this framework and presents a series of metrics to do this. The result is a new way of considering the baseline problem with practical applications to the long term inspection of structures.

  14. Photonic crystal waveguide cavity with waist design for efficient trapping and detection of nanoparticles.

    PubMed

    Lin, Pin-Tso; Lu, Tsan-Wen; Lee, Po-Tsung

    2014-03-24

    For manipulating nanometric particles, we propose a photonic crystal waveguide cavity design with a waist structure to enhance resonance characteristic of the cavity. For trapping a polystyrene particle of 50 nm radius on the lateral side of the waist, the optical force can reach 2308 pN/W with 24.7% signal transmission. Threshold power of only 0.32 mW is required for stable trapping. The total length of the device is relatively short with only ten photonic crystal periods, and the trapping can occur precisely and only at the waist. The designed cavity can also provide particle detection and surrounding medium sensing using the transmission spectrum with narrow linewidth. The simulated figure of merit of 110.6 is relatively high compared with those obtained from most plasmonic structures for sensing application. We anticipate this design with features of compact, efficient, and versatile in functionality will be beneficial for developing lab-on-chip in the future.

  15. Efficiency comparison of graphical approaches for designing contaminant detection networks in groundwater

    NASA Astrophysics Data System (ADS)

    Hudak, Paul F.

    2002-12-01

    Graphical approaches for locating monitoring wells near landfills in aquifers dominated by intergranular porosity were evaluated. Both perpendicular groundwater monitoring networks (wells constrained to a monitoring locus perpendicular to flow) and equidistant networks (wells located the same distance along flow paths) were considered, along with several setbacks between wells and a landfill and different flow fields. For an orthogonal landfill oblique to groundwater flow, equidistant networks generally outperformed their perpendicular counterparts. Equidistant monitoring networks with well locations compressed 10-20% closer to the downgradient corner of a landfill outperformed other networks over a wide range of setbacks. However, compression reduced the detection efficiency of an equidistant network at a field setting with divergent flow, a nonlinear buffer zone boundary, and discharge zones near the sides of a landfill. Graphical approaches described in this paper identify effective monitoring networks that can be refined to site-specific conditions.

  16. Efficient Personalized Mispronunciation Detection of Taiwanese-Accented English Speech Based on Unsupervised Model Adaptation and Dynamic Sentence Selection

    ERIC Educational Resources Information Center

    Wu, Chung-Hsien; Su, Hung-Yu; Liu, Chao-Hong

    2013-01-01

    This study presents an efficient approach to personalized mispronunciation detection of Taiwanese-accented English. The main goal of this study was to detect frequently occurring mispronunciation patterns of Taiwanese-accented English instead of scoring English pronunciations directly. The proposed approach quickly identifies personalized…

  17. Frequency interleaving towards spectrally efficient directly detected optical OFDM for next-generation optical access networks.

    PubMed

    Mehedy, Lenin; Bakaul, Masuduzzaman; Nirmalathas, Ampalavanapillai

    2010-10-25

    In this paper, we theoretically analyze and demonstrate that spectral efficiency of a conventional direct detection based optical OFDM system (DDO-OFDM) can be improved significantly using frequency interleaving of adjacent DDO-OFDM channels where OFDM signal band of one channel occupies the spectral gap of other channel and vice versa. We show that, at optimum operating condition, the proposed technique can effectively improve the spectral efficiency of the conventional DDO-OFDM system as much as 50%. We also show that such a frequency interleaved DDO-OFDM system, with a bit rate of 48 Gb/s within 25 GHz bandwidth, achieves sufficient power budget after transmission over 25 km single mode fiber to be used in next-generation time-division-multiplexed passive optical networks (TDM-PON). Moreover, by applying 64- quadrature amplitude modulation (QAM), the system can be further scaled up to 96 Gb/s with a power budget sufficient for 1:16 split TDM-PON.

  18. Combined analytical FEM approach for efficient simulation of Lamb wave damage detection.

    PubMed

    Shen, Yanfeng; Giurgiutiu, Victor

    2016-07-01

    Lamb waves have been widely explored as a promising inspection tool for non-destructive evaluation (NDE) and structural health monitoring (SHM). This article presents a combined analytical finite element model (FEM) approach (CAFA) for the accurate, efficient, and versatile simulation of 2-D Lamb wave propagation and interaction with damage. CAFA used a global analytical solution to model wave generation, propagation, scattering, mode conversion, and detection, while the wave-damage interaction coefficients (WDICs) were extracted from harmonic analysis of local FEM with non-reflective boundaries (NRB). The analytical procedure was coded using MATLAB, and a predictive simulation tool called WaveFormRevealer 2-D was developed. The methodology of obtaining WDICs from local FEM was presented. Case studies were carried out for Lamb wave propagation in a pristine plate and a damaged plate. CAFA predictions compared well with full scale multi-physics FEM simulations and experiments with scanning laser Doppler vibrometry (SLDV), while achieving remarkable performance in computational efficiency and computer resource saving compared with conventional FEM.

  19. Telehealth streams reduction based on pattern recognition techniques for events detection and efficient storage in EHR.

    PubMed

    Henriques, J; Rocha, T; Paredes, S; de Carvalho, P

    2013-01-01

    This work proposes a framework for telehealth streams analysis, founded on a pattern recognition technique that evaluates the similarity between multi-sensorial biosignals. The strategy combines the Haar wavelet with the Karhunen-Loève transforms to describe biosignals by means of a reduced set of parameters. These, that reflect the dynamic behavior of the biosignals, can support the detection of relevant clinical conditions. Moreover, the simplicity and fast execution of the proposed approach allow its application in real-time operation, as well as provide a practical way to manage historical electronic health records: i) common and uncommon behaviors can be distinguished; ii) the creation of different models, tailored to specific conditions can be efficiently stored. The efficiency of the methodology is assessed through its performance analysis, namely by computing the required number of operations and the compression rate. Its effectiveness is evaluated in the prediction of decompensation episodes using biosignals daily collected in the myHeart study (blood pressure, weight, respiration and heart rates).

  20. Occasional detection of thymic epithelial tumor 4 years after diagnosis of adult onset Still disease

    PubMed Central

    Lococo, Filippo; Bajocchi, Gianluigi; Caruso, Andrea; Valli, Riccardo; Ricchetti, Tommaso; Sgarbi, Giorgio; Salvarani, Carlo

    2016-01-01

    Abstract Background: Thymoma is a T cell neoplasm arising from the thymic epithelium that due to its immunological role, frequently undercover derangements of immunity such a tumors and autoimmune diseases. Methods: Herein, we report, to the best of our knowledge, the first description of an association between thymoma and adult onset Still disease (AOSD) in a 47-year-old man. The first one was occasionally detected 4 years later the diagnosis of AOSD, and surgically removed via right lateral thoracotomy. Histology confirmed an encapsulated thymic tumor (type AB sec. WHO-classification). Results: The AOSD was particularly resistant to the therapy, requiring a combination of immunosuppressant followed by anti-IL1R, that was the only steroids-sparing treatment capable to induce and maintain the remission. The differential diagnosis was particularly challenging because of the severe myasthenic-like symptoms that, with normal laboratory tests, were initially misinterpreted as fibromyalgia. The pathogenic link of this association could be a thymus escape of autoreactive T lymphocytes causing autoimmunity. Conclusion: Clinicians should be always include the possibility of a thymoma in the differential diagnosis of an unusual new onset of weakness and normal laboratories data, in particular once autoimmune disease is present in the medical history. PMID:27603335

  1. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael

    2012-01-01

    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  2. LTRharvest, an efficient and flexible software for de novo detection of LTR retrotransposons

    PubMed Central

    Ellinghaus, David; Kurtz, Stefan; Willhoeft, Ute

    2008-01-01

    Background Transposable elements are abundant in eukaryotic genomes and it is believed that they have a significant impact on the evolution of gene and chromosome structure. While there are several completed eukaryotic genome projects, there are only few high quality genome wide annotations of transposable elements. Therefore, there is a considerable demand for computational identification of transposable elements. LTR retrotransposons, an important subclass of transposable elements, are well suited for computational identification, as they contain long terminal repeats (LTRs). Results We have developed a software tool LTRharvest for the de novo detection of full length LTR retrotransposons in large sequence sets. LTRharvest efficiently delivers high quality annotations based on known LTR transposon features like length, distance, and sequence motifs. A quality validation of LTRharvest against a gold standard annotation for Saccharomyces cerevisae and Drosophila melanogaster shows a sensitivity of up to 90% and 97% and specificity of 100% and 72%, respectively. This is comparable or slightly better than annotations for previous software tools. The main advantage of LTRharvest over previous tools is (a) its ability to efficiently handle large datasets from finished or unfinished genome projects, (b) its flexibility in incorporating known sequence features into the prediction, and (c) its availability as an open source software. Conclusion LTRharvest is an efficient software tool delivering high quality annotation of LTR retrotransposons. It can, for example, process the largest human chromosome in approx. 8 minutes on a Linux PC with 4 GB of memory. Its flexibility and small space and run-time requirements makes LTRharvest a very competitive candidate for future LTR retrotransposon annotation projects. Moreover, the structured design and implementation and the availability as open source provides an excellent base for incorporating novel concepts to further improve

  3. Detective quantum efficiency of photon-counting x-ray detectors

    SciTech Connect

    Tanguay, Jesse; Yun, Seungman; Kim, Ho Kyung; Cunningham, Ian A.

    2015-01-15

    Purpose: Single-photon-counting (SPC) x-ray imaging has the potential to improve image quality and enable novel energy-dependent imaging methods. Similar to conventional detectors, optimizing image SPC quality will require systems that produce the highest possible detective quantum efficiency (DQE). This paper builds on the cascaded-systems analysis (CSA) framework to develop a comprehensive description of the DQE of SPC detectors that implement adaptive binning. Methods: The DQE of SPC systems can be described using the CSA approach by propagating the probability density function (PDF) of the number of image-forming quanta through simple quantum processes. New relationships are developed to describe PDF transfer through serial and parallel cascades to accommodate scatter reabsorption. Results are applied to hypothetical silicon and selenium-based flat-panel SPC detectors including the effects of reabsorption of characteristic/scatter photons from photoelectric and Compton interactions, stochastic conversion of x-ray energy to secondary quanta, depth-dependent charge collection, and electronic noise. Results are compared with a Monte Carlo study. Results: Depth-dependent collection efficiency can result in substantial broadening of photopeaks that in turn may result in reduced DQE at lower x-ray energies (20–45 keV). Double-counting interaction events caused by reabsorption of characteristic/scatter photons may result in falsely inflated image signal-to-noise ratio and potential overestimation of the DQE. Conclusions: The CSA approach is extended to describe signal and noise propagation through photoelectric and Compton interactions in SPC detectors, including the effects of escape and reabsorption of emission/scatter photons. High-performance SPC systems can be achieved but only for certain combinations of secondary conversion gain, depth-dependent collection efficiency, electronic noise, and reabsorption characteristics.

  4. MIL-M-38510/470 test vectors: Fault detection efficiency measurement via hardware fault simulation. [rca 1802 microprocessor

    NASA Technical Reports Server (NTRS)

    Timoc, C. C.

    1980-01-01

    The stuck fault detection efficiency of the test vectors developed for the MIL-M-38510/470 NASA was measured using a hardware stuck fault simulator for the 1802 microprocessor. Thirty-nine stuck faults were not detected out of a total of 874 injected into the combinatorial and sequential parts of the microprocessor. Since undetected faults can create catastrophic errors in equipment designed for high reliability applications, it is recommended that the MIL-M-38510/470 NASA be enhanced with additional test vectors so as to achieve 100% stuck fault detection efficiency.

  5. Interferometric Motion Detection in Atomic Layer 2D Nanostructures: Visualizing Signal Transduction Efficiency and Optimization Pathways

    PubMed Central

    Wang, Zenghui; Feng, Philip X.-L.

    2016-01-01

    Atomic layer crystals are emerging building blocks for enabling new two-dimensional (2D) nanomechanical systems, whose motions can be coupled to other attractive physical properties in such 2D systems. Optical interferometry has been very effective in reading out the infinitesimal motions of these 2D structures and spatially resolving different modes. To quantitatively understand the detection efficiency and its dependence on the device parameters and interferometric conditions, here we present a systematic study of the intrinsic motion responsivity in 2D nanomechanical systems using a Fresnel-law-based model. We find that in monolayer to 14-layer structures, MoS2 offers the highest responsivity among graphene, h-BN, and MoS2 devices and for the three commonly used visible laser wavelengths (633, 532, and 405 nm). We also find that the vacuum gap resulting from the widely used 300 nm-oxide substrate in making 2D devices, fortunately, leads to close-to-optimal responsivity for a wide range of 2D flakes. Our results elucidate and graphically visualize the dependence of motion transduction responsivity upon 2D material type and number of layers, vacuum gap, oxide thickness, and detecting wavelength, thus providing design guidelines for constructing 2D nanomechanical systems with optimal optical motion readout. PMID:27464908

  6. Interferometric Motion Detection in Atomic Layer 2D Nanostructures: Visualizing Signal Transduction Efficiency and Optimization Pathways

    NASA Astrophysics Data System (ADS)

    Wang, Zenghui; Feng, Philip X.-L.

    2016-07-01

    Atomic layer crystals are emerging building blocks for enabling new two-dimensional (2D) nanomechanical systems, whose motions can be coupled to other attractive physical properties in such 2D systems. Optical interferometry has been very effective in reading out the infinitesimal motions of these 2D structures and spatially resolving different modes. To quantitatively understand the detection efficiency and its dependence on the device parameters and interferometric conditions, here we present a systematic study of the intrinsic motion responsivity in 2D nanomechanical systems using a Fresnel-law-based model. We find that in monolayer to 14-layer structures, MoS2 offers the highest responsivity among graphene, h-BN, and MoS2 devices and for the three commonly used visible laser wavelengths (633, 532, and 405 nm). We also find that the vacuum gap resulting from the widely used 300 nm-oxide substrate in making 2D devices, fortunately, leads to close-to-optimal responsivity for a wide range of 2D flakes. Our results elucidate and graphically visualize the dependence of motion transduction responsivity upon 2D material type and number of layers, vacuum gap, oxide thickness, and detecting wavelength, thus providing design guidelines for constructing 2D nanomechanical systems with optimal optical motion readout.

  7. Interferometric Motion Detection in Atomic Layer 2D Nanostructures: Visualizing Signal Transduction Efficiency and Optimization Pathways.

    PubMed

    Wang, Zenghui; Feng, Philip X-L

    2016-07-28

    Atomic layer crystals are emerging building blocks for enabling new two-dimensional (2D) nanomechanical systems, whose motions can be coupled to other attractive physical properties in such 2D systems. Optical interferometry has been very effective in reading out the infinitesimal motions of these 2D structures and spatially resolving different modes. To quantitatively understand the detection efficiency and its dependence on the device parameters and interferometric conditions, here we present a systematic study of the intrinsic motion responsivity in 2D nanomechanical systems using a Fresnel-law-based model. We find that in monolayer to 14-layer structures, MoS2 offers the highest responsivity among graphene, h-BN, and MoS2 devices and for the three commonly used visible laser wavelengths (633, 532, and 405 nm). We also find that the vacuum gap resulting from the widely used 300 nm-oxide substrate in making 2D devices, fortunately, leads to close-to-optimal responsivity for a wide range of 2D flakes. Our results elucidate and graphically visualize the dependence of motion transduction responsivity upon 2D material type and number of layers, vacuum gap, oxide thickness, and detecting wavelength, thus providing design guidelines for constructing 2D nanomechanical systems with optimal optical motion readout.

  8. Al:ZnO thin film: An efficient matrix for cholesterol detection

    NASA Astrophysics Data System (ADS)

    Batra, Neha; Tomar, Monika; Gupta, Vinay

    2012-12-01

    Al doped ZnO thin film (Al:ZnO) has been realized as a potential matrix for the development of efficient cholesterol biosensor. The correlation between the structural and electrical properties of ZnO thin film with varying Al doping concentration (1% to 5%) and their cyclic voltammetric (CV) response has been studied. 2% Al doped ZnO films were found to give the best CV response and were further utilized for immobilization of cholesterol oxidase (ChOx) to detect cholesterol. Amperometric and photometric studies reveal that the prepared bioelectrode based on 2% Al doped ZnO matrix (ChOx/Al:ZnO/Pt/glass) is highly sensitive (sensitivity = 173 μAmM-1 cm-2) to the detection of cholesterol in the wide range from 0.6-12.9 mM (25-500 mg/dl). A relatively low value of enzyme's kinetic parameter (Michaelis menten constant, 2.53 mM) indicates enhanced affinity of the immobilized ChOx toward cholesterol. The prepared bioelectrode is found to be exhibiting high shelf life (10 weeks) having negligible interference with the presence of other biomolecules in human serum indicating promising application of Al doped ZnO thin films for cholesterol biosensing.

  9. Embedding damage detection algorithms in a wireless sensing unit for operational power efficiency

    NASA Astrophysics Data System (ADS)

    Lynch, Jerome Peter; Sundararajan, Arvind; Law, Kincho H.; Kiremidjian, Anne S.; Carryer, Ed

    2004-08-01

    A low-cost wireless sensing unit is designed and fabricated for deployment as the building block of wireless structural health monitoring systems. Finite operational lives of portable power supplies, such as batteries, necessitate optimization of the wireless sensing unit design to attain overall energy efficiency. This is in conflict with the need for wireless radios that have far-reaching communication ranges that require significant amounts of power. As a result, a penalty is incurred by transmitting raw time-history records using scarce system resources such as battery power and bandwidth. Alternatively, a computational core that can accommodate local processing of data is designed and implemented in the wireless sensing unit. The role of the computational core is to perform interrogation tasks of collected raw time-history data and to transmit via the wireless channel the analysis results rather than time-history records. To illustrate the ability of the computational core to execute such embedded engineering analyses, a two-tiered time-series damage detection algorithm is implemented as an example. Using a lumped-mass laboratory structure, local execution of the embedded damage detection method is shown to save energy by avoiding utilization of the wireless channel to transmit raw time-history data.

  10. Improving the accuracy and efficiency of identity-by-descent detection in population data.

    PubMed

    Browning, Brian L; Browning, Sharon R

    2013-06-01

    Segments of indentity-by-descent (IBD) detected from high-density genetic data are useful for many applications, including long-range phase determination, phasing family data, imputation, IBD mapping, and heritability analysis in founder populations. We present Refined IBD, a new method for IBD segment detection. Refined IBD achieves both computational efficiency and highly accurate IBD segment reporting by searching for IBD in two steps. The first step (identification) uses the GERMLINE algorithm to find shared haplotypes exceeding a length threshold. The second step (refinement) evaluates candidate segments with a probabilistic approach to assess the evidence for IBD. Like GERMLINE, Refined IBD allows for IBD reporting on a haplotype level, which facilitates determination of multi-individual IBD and allows for haplotype-based downstream analyses. To investigate the properties of Refined IBD, we simulate SNP data from a model with recent superexponential population growth that is designed to match United Kingdom data. The simulation results show that Refined IBD achieves a better power/accuracy profile than fastIBD or GERMLINE. We find that a single run of Refined IBD achieves greater power than 10 runs of fastIBD. We also apply Refined IBD to SNP data for samples from the United Kingdom and from Northern Finland and describe the IBD sharing in these data sets. Refined IBD is powerful, highly accurate, and easy to use and is implemented in Beagle version 4.

  11. The effects of x-ray beam hardening on detective quantum efficiency and radiation dose.

    PubMed

    Wong, Molly Donovan; Wu, Xizeng; Liu, Hong

    2011-01-01

    The goal of this preliminary study was to investigate the effects of x-ray beam hardening on the detective quantum efficiency (DQE) and the radiation dose of an inline x-ray imaging system. The ability to decrease the risk of harmful radiation to the patient without compromising the detection capability would more effectively balance the tradeoff between image quality and radiation dose, and therefore benefit the fields of diagnostic x-ray imaging, especially mammography. The DQE and the average glandular dose were both calculated under the same experimental conditions for a range of beam hardening levels, corresponding to no added beam hardening and two thicknesses each of Rhodium (Rh) and Molybdenum (Mo) filters. The dose calculation results demonstrate a reduction of 15% to 24% for the range of beam hardening levels. The comparison of all quantities comprising the DQE exhibit very close correlation between the results obtained without added beam hardening to the results corresponding to the range of beam hardening levels. For the specific experimental conditions utilized in this preliminary study, the results are an indication that the use of beam hardening holds the potential to reduce the radiation dose without decreasing the performance of the system. Future studies will seek to apply this method in a clinical environment and perform a comprehensive image quality evaluation, in an effort to further evaluate the potential of beam hardening to balance the tradeoff between dose and image quality.

  12. Rapid and Efficient Method for the Detection of Microplastic in the Gastrointestinal Tract of Fishes.

    PubMed

    Roch, Samuel; Brinker, Alexander

    2017-04-07

    The rising evidence of microplastic pollution impacts on aquatic organisms in both marine and freshwater ecosystems highlights a pressing need for adequate and comparable detection methods. Available tissue digestion protocols are time-consuming (>10 h) and/or require several procedural steps, during which materials can be lost and contaminants introduced. This novel approach comprises an accelerated digestion step using sodium hydroxide and nitric acid in combination to digest all organic material within 1 h plus an additional separation step using sodium iodide which can be used to reduce mineral residues in samples where necessary. This method yielded a microplastic recovery rate of ≥95%, and all tested polymer types were recovered with only minor changes in weight, size, and color with the exception of polyamide. The method was also shown to be effective on field samples from two benthic freshwater fish species, revealing a microplastic burden comparable to that indicated in the literature. As a consequence, the present method saves time, minimizes the loss of material and the risk of contamination, and facilitates the identification of plastic particles and fibers, thus providing an efficient method to detect and quantify microplastics in the gastrointestinal tract of fishes.

  13. Study of the Neutron Detection Efficiency for the CLAS12 Detector

    NASA Astrophysics Data System (ADS)

    Sherman, Keegan; Gilfoyle, Gerard; CLAS Collaboration

    2015-10-01

    One of the central physics goals of Jefferson Lab is to understand how quarks and gluons form nuclei. The 12 GeV upgrade is nearing completion and a new detector, CLAS12, is being built in Hall B. One of the approved experiments will measure the magnetic form factor of the neutron. To make this measurement, we will extract the ratio of electron-neutron (e-n) to electron-proton (e-p) scattering events from deuterium in quasi-elastic kinematics. A major source of systematic uncertainty is the neutron detection efficiency (NDE) of CLAS12. To better understand the NDE we used the Monte Carlo code gemc to simulate quasi-elastic e-n events like those expected in the experiment. We then analyzed the simulated e-n events by using the measured, scattered electron information to predict the neutron's path. The neutron is detected in CLAS12's electromagnetic calorimeter (EC). If the predicted neutron path intersected the fiducial volume of the EC, then we searched for a hit near that point. The NDE is the ratio of the number of neutrons found in the EC to the number of neutrons predicted to hit the EC. The analysis was done using the newly released CLAS12 reconstruction tools. We observe a rapid rise in the NDE at low neutron momentum and a plateau above 60%. Work supported by the University of Richmond and the US Department of Energy.

  14. Fiber-optic integration and efficient detection schemes for optomechanical resonators

    NASA Astrophysics Data System (ADS)

    Cohen, Justin D.

    With the advent of the laser in the year 1960, the field of optics experienced a renaissance from what was considered to be a dull, solved subject to an active area of development, with applications and discoveries which are yet to be exhausted 55 years later. Light is now nearly ubiquitous not only in cutting-edge research in physics, chemistry, and biology, but also in modern technology and infrastructure. One quality of light, that of the imparted radiation pressure force upon reflection from an object, has attracted intense interest from researchers seeking to precisely monitor and control the motional degrees of freedom of an object using light. These optomechanical interactions have inspired myriad proposals, ranging from quantum memories and transducers in quantum information networks to precision metrology of classical forces. Alongside advances in micro- and nano-fabrication, the burgeoning field of optomechanics has yielded a class of highly engineered systems designed to produce strong interactions between light and motion. Optomechanical crystals are one such system in which the patterning of periodic holes in thin dielectric films traps both light and sound waves to a micro-scale volume. These devices feature strong radiation pressure coupling between high-quality optical cavity modes and internal nanomechanical resonances. Whether for applications in the quantum or classical domain, the utility of optomechanical crystals hinges on the degree to which light radiating from the device, having interacted with mechanical motion, can be collected and detected in an experimental apparatus consisting of conventional optical components such as lenses and optical fibers. While several efficient methods of optical coupling exist to meet this task, most are unsuitable for the cryogenic or vacuum integration required for many applications. The first portion of this dissertation will detail the development of robust and efficient methods of optically coupling

  15. Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XVI; Alternative Designs for Future Adult PIT-Tag Detection Studies, 2000 Technical Report.

    SciTech Connect

    Perez-Comas, Jose A.; Skalski, John R.

    2000-09-25

    In the advent of the installation of a PIT-tag interrogation system in the Cascades Island fish ladder at Bonneville Dam (BON), and other CRB dams, this overview describes in general terms what can and cannot be estimated under seven different scenarios of adult PIT-tag detection capabilities in the CRB. Moreover, this overview attempted to identify minimal adult PIT-tag detection configurations required by the ten threatened Columbia River Basin (CRB) chinook and steelhead ESUs. A minimal adult PIT-tag detection configuration will require the installation of adult PIT-tag detection facilities at Bonneville Dam and another dam above BON. Thus, the Snake River spring/summer and fall chinook salmon, and the Snake River steelhead will require a minimum of three dams with adult PIT-tag detection capabilities to guarantee estimates of ''ocean survival'' and at least of one independent, in-river returning adult survival (e.g., adult PIT-tag detection facilities at BON and LGR dams and at any other intermediary dam such as IHR). The Upper Columbia River spring chinook salmon and steelhead will also require a minimum of three dams with adult PIT-tag detection capabilities: BON and two other dams on the BON-WEL reach. The current CRB dam system configuration and BPA's and COE's commitment to install adult PIT-tag detectors only in major CRB projects will not allow the estimation of an ''ocean survival'' and of any in-river adult survival for the Lower Columbia River chinook salmon and steelhead. The Middle Columbia River steelhead ESU will require a minimum of two dams with adult PIT-tag detection capabilities: BON and another upstream dam on the BON-McN reach. Finally, in spite of their importance in terms of releases, PIT-tag survival studies for the Upper Willamette chinook and Upper Willamette steelhead ESUs cannot be perform with the current CRB dam system configuration and PIT-tag detection capabilities.

  16. Association between body mass index and arsenic methylation efficiency in adult women from southwest U.S. and northwest Mexico

    SciTech Connect

    Gomez-Rubio, Paulina; Roberge, Jason; Arendell, Leslie; Harris, Robin B.; O'Rourke, Mary K.; Chen, Zhao; Cantu-Soto, Ernesto; Meza-Montenegro, Maria M.; Billheimer, Dean; Lu Zhenqiang; Klimecki, Walter T.

    2011-04-15

    Human arsenic methylation efficiency has been consistently associated with arsenic-induced disease risk. Interindividual variation in arsenic methylation profiles is commonly observed in exposed populations, and great effort has been put into the study of potential determinants of this variability. Among the factors that have been evaluated, body mass index (BMI) has not been consistently associated with arsenic methylation efficiency; however, an underrepresentation of the upper BMI distribution was commonly observed in these studies. This study investigated potential factors contributing to variations in the metabolism of arsenic, with specific interest in the effect of BMI where more than half of the population was overweight or obese. We studied 624 adult women exposed to arsenic in drinking water from three independent populations. Multivariate regression models showed that higher BMI, arsenic (+ 3 oxidation state) methyltransferase (AS3MT) genetic variant 7388, and higher total urinary arsenic were significantly associated with low percentage of urinary arsenic excreted as monomethylarsonic acid (%uMMA) or high ratio between urinary dimethylarsinic acid and uMMA (uDMA/uMMA), while AS3MT genetic variant M287T was associated with high %uMMA and low uDMA/uMMA. The association between BMI and arsenic methylation efficiency was also evident in each of the three populations when studied separately. This strong association observed between high BMI and low %uMMA and high uDMA/uMMA underscores the importance of BMI as a potential arsenic-associated disease risk factor, and should be carefully considered in future studies associating human arsenic metabolism and toxicity.

  17. Liver Progenitors Isolated from Adult Healthy Mouse Liver Efficiently Differentiate to Functional Hepatocytes In Vitro and Repopulate Liver Tissue.

    PubMed

    Tanimizu, Naoki; Ichinohe, Norihisa; Ishii, Masayuki; Kino, Junichi; Mizuguchi, Toru; Hirata, Koichi; Mitaka, Toshihiro

    2016-12-01

    It has been proposed that tissue stem cells supply multiple epithelial cells in mature tissues and organs. However, it is unclear whether tissue stem cells generally contribute to cellular turnover in normal healthy organs. Here, we show that liver progenitors distinct from bipotent liver stem/progenitor cells (LPCs) persistently exist in mouse livers and potentially contribute to tissue maintenance. We found that, in addition to LPCs isolated as EpCAM(+) cells, liver progenitors were enriched in CD45(-) TER119(-) CD31(-) EpCAM(-) ICAM-1(+) fraction isolated from late-fetal and postnatal livers. ICAM-1(+) liver progenitors were abundant by 4 weeks (4W) after birth. Although their number decreased with age, ICAM-1(+) liver progenitors existed in livers beyond that stage. We established liver progenitor clones derived from ICAM-1(+) cells between 1 and 20W and found that those clones efficiently differentiated into mature hepatocytes (MHs), which secreted albumin, eliminated ammonium ion, stored glycogen, and showed cytochrome P450 activity. Even after long-term culture, those clones kept potential to differentiate to MHs. When ICAM-1(+) clones were transplanted into nude mice after retrorsine treatment and 70% partial hepatectomy, donor cells were incorporated into liver plates and expressed hepatocyte nuclear factor 4α, CCAAT/enhancer binding protein α, and carbamoylphosphate synthetase I. Moreover, after short-term treatment with oncostatin M, ICAM-1(+) clones could efficiently repopulate the recipient liver tissues. Our results indicate that liver progenitors that can efficiently differentiate to MHs exist in normal adult livers. Those liver progenitors could be an important source of new MHs for tissue maintenance and repair in vivo, and for regenerative medicine ex vivo. Stem Cells 2016;34:2889-2901.

  18. Effective detective quantum efficiency for two mammography systems: Measurement and comparison against established metrics

    SciTech Connect

    Salvagnini, Elena; Bosmans, Hilde; Marshall, Nicholas W.; Struelens, Lara

    2013-10-15

    Purpose: The aim of this paper was to illustrate the value of the new metric effective detective quantum efficiency (eDQE) in relation to more established measures in the optimization process of two digital mammography systems. The following metrics were included for comparison against eDQE: detective quantum efficiency (DQE) of the detector, signal difference to noise ratio (SdNR), and detectability index (d′) calculated using a standard nonprewhitened observer with eye filter.Methods: The two systems investigated were the Siemens MAMMOMAT Inspiration and the Hologic Selenia Dimensions. The presampling modulation transfer function (MTF) required for the eDQE was measured using two geometries: a geometry containing scattered radiation and a low scatter geometry. The eDQE, SdNR, and d′ were measured for poly(methyl methacrylate) (PMMA) thicknesses of 20, 40, 60, and 70 mm, with and without the antiscatter grid and for a selection of clinically relevant target/filter (T/F) combinations. Figures of merit (FOMs) were then formed from SdNR and d′ using the mean glandular dose as the factor to express detriment. Detector DQE was measured at energies covering the range of typical clinically used spectra.Results: The MTF measured in the presence of scattered radiation showed a large drop at low spatial frequency compared to the low scatter method and led to a corresponding reduction in eDQE. The eDQE for the Siemens system at 1 mm{sup −1} ranged between 0.15 and 0.27, depending on T/F and grid setting. For the Hologic system, eDQE at 1 mm{sup −1} varied from 0.15 to 0.32, again depending on T/F and grid setting. The eDQE results for both systems showed that the grid increased the system efficiency for PMMA thicknesses of 40 mm and above but showed only small sensitivity to T/F setting. While results of the SdNR and d′ based FOMs confirmed the eDQE grid position results, they were also more specific in terms of T/F selection. For the Siemens system at 20 mm PMMA

  19. Early Detection of Depression and Associated Risk Factors in Adults with Mild/Moderate Intellectual Disability

    ERIC Educational Resources Information Center

    McGillivray, Jane A.; McCabe, Marita P.

    2007-01-01

    The aim of this study was to determine the presentation and risk factors for depression in adults with mild/moderate intellectual disability (ID). A sample of 151 adults (83 males and 68 females) participated in a semi-structured interview. According to results on the Beck Depression Inventory II, 39.1% of participants evinced symptoms of…

  20. Efficient in situ detection of mRNAs using the Chlorella virus DNA ligase for padlock probe ligation.

    PubMed

    Schneider, Nils; Meier, Matthias

    2017-02-01

    Padlock probes are single-stranded DNA molecules that are circularized upon hybridization to their target sequence by a DNA ligase. In the following, the circulated padlock probes are amplified and detected with fluorescently labeled probes complementary to the amplification product. The hallmark of padlock probe assays is a high detection specificity gained by the ligation reaction. Concomitantly, the ligation reaction is the largest drawback for a quantitative in situ detection of mRNAs due to the low affinities of common DNA or RNA ligases to RNA-DNA duplex strands. Therefore, current protocols require that mRNAs be reverse transcribed to DNA before detection with padlock probes. Recently, it was found that the DNA ligase from Paramecium bursaria Chlorella virus 1 (PBCV-1) is able to efficiently ligate RNA-splinted DNA. Hence, we designed a padlock probe assay for direct in situ detection of mRNAs using the PBCV-1 DNA ligase. Experimental single-cell data were used to optimize and characterize the efficiency of mRNA detection with padlock probes. Our results demonstrate that the PBCV-1 DNA ligase overcomes the efficiency limitation of current protocols for direct in situ mRNA detection, making the PBCV-1 DNA ligase an attractive tool to simplify in situ ligation sequencing applications.

  1. Efficient minimum error bounded particle resampling L1 tracker with occlusion detection.

    PubMed

    Mei, Xue; Ling, Haibin; Wu, Yi; Blasch, Erik P; Bai, Li

    2013-07-01

    Recently, sparse representation has been applied to visual tracking to find the target with the minimum reconstruction error from a target template subspace. Though effective, these L1 trackers require high computational costs due to numerous calculations for l1 minimization. In addition, the inherent occlusion insensitivity of the l1 minimization has not been fully characterized. In this paper, we propose an efficient L1 tracker, named bounded particle resampling (BPR)-L1 tracker, with a minimum error bound and occlusion detection. First, the minimum error bound is calculated from a linear least squares equation and serves as a guide for particle resampling in a particle filter (PF) framework. Most of the insignificant samples are removed before solving the computationally expensive l1 minimization in a two-step testing. The first step, named τ testing, compares the sample observation likelihood to an ordered set of thresholds to remove insignificant samples without loss of resampling precision. The second step, named max testing, identifies the largest sample probability relative to the target to further remove insignificant samples without altering the tracking result of the current frame. Though sacrificing minimal precision during resampling, max testing achieves significant speed up on top of τ testing. The BPR-L1 technique can also be beneficial to other trackers that have minimum error bounds in a PF framework, especially for trackers based on sparse representations. After the error-bound calculation, BPR-L1 performs occlusion detection by investigating the trivial coefficients in the l1 minimization. These coefficients, by design, contain rich information about image corruptions, including occlusion. Detected occlusions are then used to enhance the template updating. For evaluation, we conduct experiments on three video applications: biometrics (head movement, hand holding object, singers on stage), pedestrians (urban travel, hallway monitoring), and

  2. Efficiency of MY09/11 consensus PCR in the detection of multiple HPV infections.

    PubMed

    Şahiner, Fatih; Kubar, Ayhan; Gümral, Ramazan; Ardıç, Medine; Yiğit, Nuri; Şener, Kenan; Dede, Murat; Yapar, Mehmet

    2014-09-01

    Human papillomavirus (HPV) DNA testing has become an important component of cervical cancer screening programs. In this study, we aimed to evaluate the efficiency of MY09/11 consensus polymerase chain reaction (PCR) for the detection of multiple HPV infections. For this purpose, MY09/11 PCR was compared to an original TaqMan-based type-specific real-time PCR assay, which can detect 20 different HPV types. Of the 654 samples, 34.1% (223/654) were HPV DNA positive according to at least one method. The relative sensitivities of MY09/11 PCR and type-specific PCR were 80.7% (180/223) and 97.8% (218/223), respectively. In all, 352 different HPV isolates (66 low-risk and 286 high-risk or probable high-risk types) were identified in 218 samples, but 5 samples, which were positive by consensus PCR only, could not be genotyped. The distribution of the 286 high-risk or probable high-risk HPVs were as follows: 24.5% HPV-16, 8.4% HPV-52, 7.7% HPV-51, 6.3% HPV-39, 6.3% HPV-82, 5.6% HPV-35, 5.6% HPV-58, 5.6% HPV-66, 5.2% HPV-18, 5.2% HPV-68, and 19.6% the other 8 types. A single HPV type was detected in 57.3% (125/218) of the genotyped samples, and multiple HPV types were found in the remaining 42.7% (93/218). The false-negative rates of MY09/11 PCR were found to be 17.4% in single infections, 23.3% in multiple infections, and 34.6% in multiple infections that contained 3 or more HPV types, with the condition that the low-risk types HPV-6 and HPV-11 be considered as a monotype. These data suggest that broad-range PCR assays may lead to significant data loss and that type-specific PCR assays can provide accurate and reliable results during cervical cancer screening.

  3. Effectiveness and Efficiency of Peer and Adult Models Used in Video Modeling in Teaching Pretend Play Skills to Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Sani-Bozkurt, Sunagul; Ozen, Arzu

    2015-01-01

    This study aimed to examine whether or not there was any difference in the effectiveness and efficiency of the presentation of video modeling interventions using peer and adult models in teaching pretend play skills to children with ASD and to examine the views of parents about the study. Participants were two boys and one girl, aged 5-6 years…

  4. A robust approach to measuring the detective quantum efficiency of radiographic detectors in a clinical setting

    NASA Astrophysics Data System (ADS)

    McDonald, Michael C.; Kim, H. K.; Henry, J. R.; Cunningham, I. A.

    2012-03-01

    The detective quantum efficiency (DQE) is widely accepted as a primary measure of x-ray detector performance in the scientific community. A standard method for measuring the DQE, based on IEC 62220-1, requires the system to have a linear response meaning that the detector output signals are proportional to the incident x-ray exposure. However, many systems have a non-linear response due to characteristics of the detector, or post processing of the detector signals, that cannot be disabled and may involve unknown algorithms considered proprietary by the manufacturer. For these reasons, the DQE has not been considered as a practical candidate for routine quality assurance testing in a clinical setting. In this article we described a method that can be used to measure the DQE of both linear and non-linear systems that employ only linear image processing algorithms. The method was validated on a Cesium Iodide based flat panel system that simultaneously stores a raw (linear) and processed (non-linear) image for each exposure. It was found that the resulting DQE was equivalent to a conventional standards-compliant DQE with measurement precision, and the gray-scale inversion and linear edge enhancement did not affect the DQE result. While not IEC 62220-1 compliant, it may be adequate for QA programs.

  5. CHARACTERISING THE EOS SLOT-SCANNING SYSTEM WITH THE EFFECTIVE DETECTIVE QUANTUM EFFICIENCY.

    PubMed

    Clavel, A H; Monnin, P; Létang, J M; Verdun, F R; Darbon, A

    2016-06-01

    As opposed to the standard detective quantum efficiency (DQE), effective DQE (eDQE) is a figure of merit that allows comparing the performances of imaging systems in the presence of scatter rejection devices. The geometry of the EOS™ slot-scanning system is such that the detector is self-collimated and rejects scattered radiation. In this study, the EOS system was characterised using the eDQE in imaging conditions similar to those used in clinical practice: with phantoms of different widths placed in the X-ray beam, for various incident air kerma and tube voltages corresponding to the phantom thickness. Scatter fractions in EOS images were extremely low, around 2 % for all configurations. Maximum eDQE values spanned 9-14.8 % for a large range of air kerma at the detector plane from 0.01 to 1.34 µGy. These figures were obtained with non-optimised EOS setting but still over-performed most of the maximum eDQEs recently assessed for various computed radiology and digital radiology systems with antiscatter grids.

  6. Detection efficiency and spatial resolution of the SIRAD ion electron emission microscope

    NASA Astrophysics Data System (ADS)

    Bisello, D.; Giubilato, P.; Kaminsky, A.; Mattiazzo, S.; Nigro, M.; Pantano, D.; Silvestrin, L.; Tessaro, M.; Wyss, J.; Bertazzoni, S.; Mongiardo, L.; Salmeri, M.; Salsano, A.

    2009-06-01

    An axial ion electron emission microscope (IEEM) has been built at the SIRAD irradiation facility at the 15 MV Tandem accelerator of INFN Legnaro National Laboratory (Padova, Italy) to obtain a micrometric sensitivity map to single event effects (SEE) of electronic devices. In this contribution we report on two experiments performed with the IEEM. Si 3N 4 ultra-thin membranes with a gold deposition were placed on the device under test (DUT) to ensure a uniform and abundant secondary electron emission In the first experiment we measured an IEEM ion detection efficiency of 83% with a 58Ni (220 MeV) beam, in good agreement with the expected value. The second experiment allowed us to estimate the lateral resolution of the IEEM. The positions of ion induced single event upsets (SEU) in a synchronous dynamic random access memory (SDRAM), used as a reference target, were compared with the corresponding ion impact points reconstructed by the IEEM. The result (FWHM ˜4.4 μm with a 79Br beam of 214 MeV) is encouraging because of the residual presence of distortions of the image and mechanical vibrations.

  7. Efficient interpretation algorithm for embedded Bragg gratings for damage detection in composites

    NASA Astrophysics Data System (ADS)

    Prabhugoud, Mohanraj; Peters, Kara J.

    2003-07-01

    The goal of a structural health monitoring system is to detect, locate, and identify damages in a structure during its lifetime. The concept of structural health monitoring is particularly important for fiber reinforced composites due to the complexity of the possible failure mechanisms. The goal of this work is to simulate the response of optical fiber Bragg grating sensors to multi-component loading for their implementation in structural health monitoring algorithms for composites. A simulation method is presented to determine the effects of axial, bending and shear loading on an embedded optical fiber Bragg grating sensor. The effect of fiber bending on the Bragg grating sensor is experimentally verified by embedding the sensor in a solid cone, clamped at the base and subjected to a point load at the apex. Next, a numerically efficient method to calculate the response of sensors embedded in a unidirectional composite is developed using both finite element analysis and optimal shear-lag theory and taking into account the above effects. The limitations of the optimal shear-lag theory are derived through comparison with the finite element results. The application of this method is demonstrated through a numerical example, simulating the response of sensors embedded in one fiber layer to a transverse crack.

  8. High-efficiency microarray of 3-D carbon MEMS electrodes for pathogen detection systems

    NASA Astrophysics Data System (ADS)

    Kassegne, Sam; Wondimu, Berhanu; Majzoub, Mohammad; Shin, Jiae

    2008-11-01

    Molecular diagnostic applications for pathogen detections require the ability to separate pathogens such as bacteria, viruses, etc., from a biological sample of blood or saliva. Over the past several years, conventional two-dimensional active microarrays have been used with success for the manipulation of biomolecules including DNA. However, they have a major drawback of inability to process relatively 'largevolume' samples useful in infectious disease diagnostics applications. This paper presents an active microarray of three-dimensional carbon electrodes that exploits electrokinetic forces for transport, accumulation, and hybridization of charged bio-molecules with an added advantage of large volume capability. Tall 3-dimensional carbon microelectrode posts are fabricated using C-MEMS (Carbon MEMS) technology that is emerging as a very exciting research area since carbon has fascinating physical, chemical, mechanical and electrical properties in addition to its low cost. The chip fabricated using CMEMS technology is packaged and its efficiency of separation and accumulation of charged particle established by manipulating negatively charged polycarboxylate 2 μm beads in 50 mM histidine buffer.

  9. Set-up and methods for SiPM Photo-Detection Efficiency measurements

    NASA Astrophysics Data System (ADS)

    Zappalà, G.; Acerbi, F.; Ferri, A.; Gola, A.; Paternoster, G.; Zorzi, N.; Piemonte, C.

    2016-08-01

    In this work, a compact set-up and three different methods to measure the Photo-Detection Efficiency (PDE) of Silicon Photomultipliers (SiPMs) and Single-Photon Avalanche Diodes (SPADs) are presented. The methods, based on either continuous or pulsed light illumination, are discussed in detail and compared in terms of measurement precision and time. For the SiPM, these methods have the feature of minimizing the effect of both the primary and correlated noise on the PDE estimation. The PDE of SiPMs (produced at FBK, Trento, Italy) was measured in a range from UV to NIR, obtaining similar results with all the methods. Furthermore, the advantages of measuring, when possible, the PDE of SPADs (of the same technology and with the same layout of a single SiPM cell) instead of larger devices are also discussed and a direct comparison between measurement results is shown. Using a SPAD, it is possible to reduce the measurement complexity and uncertainty since the correlated noise sources are reduced with respect to the SiPM case.

  10. Optimal Time-Resource Allocation for Energy-Efficient Physical Activity Detection

    PubMed Central

    Thatte, Gautam; Li, Ming; Lee, Sangwon; Emken, B. Adar; Annavaram, Murali; Narayanan, Shrikanth; Spruijt-Metz, Donna; Mitra, Urbashi

    2011-01-01

    The optimal allocation of samples for physical activity detection in a wireless body area network for health-monitoring is considered. The number of biometric samples collected at the mobile device fusion center, from both device-internal and external Bluetooth heterogeneous sensors, is optimized to minimize the transmission power for a fixed number of samples, and to meet a performance requirement defined using the probability of misclassification between multiple hypotheses. A filter-based feature selection method determines an optimal feature set for classification, and a correlated Gaussian model is considered. Using experimental data from overweight adolescent subjects, it is found that allocating a greater proportion of samples to sensors which better discriminate between certain activity levels can result in either a lower probability of error or energy-savings ranging from 18% to 22%, in comparison to equal allocation of samples. The current activity of the subjects and the performance requirements do not significantly affect the optimal allocation, but employing personalized models results in improved energy-efficiency. As the number of samples is an integer, an exhaustive search to determine the optimal allocation is typical, but computationally expensive. To this end, an alternate, continuous-valued vector optimization is derived which yields approximately optimal allocations and can be implemented on the mobile fusion center due to its significantly lower complexity. PMID:21796237

  11. Detective quantum efficiency: a standard test to ensure optimal detector performance and low patient exposures

    NASA Astrophysics Data System (ADS)

    Escartin, Terenz R.; Nano, Tomi F.; Cunningham, Ian A.

    2016-03-01

    The detective quantum efficiency (DQE), expressed as a function of spatial frequency, describes the ability of an x-ray detector to produce high signal-to-noise ratio (SNR) images. While regulatory and scientific communities have used the DQE as a primary metric for optimizing detector design, the DQE is rarely used by end users to ensure high system performance is maintained. Of concern is that image quality varies across different systems for the same exposures with no current measures available to describe system performance. Therefore, here we conducted an initial DQE measurement survey of clinical x-ray systems using a DQE-testing instrument to identify their range of performance. Following laboratory validation, experiments revealed that the DQE of five different systems under the same exposure level (8.0 μGy) ranged from 0.36 to 0.75 at low spatial frequencies, and 0.02 to 0.4 at high spatial frequencies (3.5 cycles/mm). Furthermore, the DQE dropped substantially with decreasing detector exposure by a factor of up to 1.5x in the lowest spatial frequency, and a factor of 10x at 3.5 cycles/mm due to the effect of detector readout noise. It is concluded that DQE specifications in purchasing decisions, combined with periodic DQE testing, are important factors to ensure patients receive the health benefits of high-quality images for low x-ray exposures.

  12. Efficient liver segmentation in CT images based on graph cuts and bottleneck detection.

    PubMed

    Liao, Miao; Zhao, Yu-Qian; Wang, Wei; Zeng, Ye-Zhan; Yang, Qing; Shih, Frank Y; Zou, Bei-Ji

    2016-11-01

    Liver segmentation from abdominal computed tomography (CT) volumes is extremely important for computer-aided liver disease diagnosis and surgical planning of liver transplantation. Due to ambiguous edges, tissue adhesion, and variation in liver intensity and shape across patients, accurate liver segmentation is a challenging task. In this paper, we present an efficient semi-automatic method using intensity, local context, and spatial correlation of adjacent slices for the segmentation of healthy liver regions in CT volumes. An intensity model is combined with a principal component analysis (PCA) based appearance model to exclude complex background and highlight liver region. They are then integrated with location information from neighboring slices into graph cuts to segment the liver in each slice automatically. Finally, a boundary refinement method based on bottleneck detection is used to increase the segmentation accuracy. Our method does not require heavy training process or statistical model construction, and is capable of dealing with complicated shape and intensity variations. We apply the proposed method on XHCSU14 and SLIVER07 databases, and evaluate it by MICCAI criteria and Dice similarity coefficient. Experimental results show our method outperforms several existing methods on liver segmentation.

  13. Practical expressions describing detective quantum efficiency in flat-panel detectors

    NASA Astrophysics Data System (ADS)

    Kim, H. K.

    2011-11-01

    In radiology, image quality excellence is a balance between system performance and patient dose, hence x-ray systems must be designed to ensure the maximum image quality is obtained for the lowest consistent dose. The concept of detective quantum efficiency (DQE) is widely used to quantify, understand, measure, and predict the performance of x-ray detectors and imaging systems. Cascaded linear-systems theory can be used to estimate DQE based on the system design parameters and this theoretical DQE can be utilized for determining the impact of various physical processes, such as secondary quantum sinks, noise aliasing, reabsorption noise, and others. However, the prediction of DQE usually requires tremendous efforts to determine each parameter consisting of the cascaded linear-systems model. In this paper, practical DQE formalisms assessing both the photoconductor- and scintillator-based flat-panel detectors under quantum-noise-limited operation are described. The developed formalisms are experimentally validated and discussed for their limits. The formalisms described in this paper would be helpful for the rapid prediction of the DQE performances of developing systems as well as the optimal design of systems.

  14. The effects of different quantum feedback operator types on the parameter precision of detection efficiency in optimal quantum estimation

    NASA Astrophysics Data System (ADS)

    Ma, Shao-Qiang; Zhu, Han-Jie; Zhang, Guo-Feng

    2017-04-01

    The effects of different quantum feedback types on the estimation precision of the detection efficiency are studied. It is found that the precision can be more effective enhanced by a certain feedback type through comparing these feedbacks and the precision has a positive relation with detection efficiency for the optimal feedback when the system reach the state of dynamic balance. In addition, the bigger the proportion of |1> is the higher the precision is and we will not obtain any information about the parameter to be estimated if |0> is chosen as initial state for the feedback type λσz.

  15. Large-sensitive-area superconducting nanowire single-photon detector at 850 nm with high detection efficiency.

    PubMed

    Li, Hao; Zhang, Lu; You, Lixing; Yang, Xiaoyan; Zhang, Weijun; Liu, Xiaoyu; Chen, Sijing; Wang, Zhen; Xie, Xiaoming

    2015-06-29

    Satellite-ground quantum communication requires single-photon detectors of 850-nm wavelength with both high detection efficiency and large sensitive area. We developed superconducting nanowire single-photon detectors (SNSPDs) on one-dimensional photonic crystals, which acted as optical cavities to enhance the optical absorption, with a sensitive-area diameter of 50 μm. The fabricated multimode fiber coupled NbN SNSPDs exhibited a maximum system detection efficiency (DE) of up to 82% and a DE of 78% at a dark count rate of 100 Hz at 850-nm wavelength as well as a system jitter of 105 ps.

  16. Effects of rainfall events on the occurrence and detection efficiency of viruses in river water impacted by combined sewer overflows.

    PubMed

    Hata, Akihiko; Katayama, Hiroyuki; Kojima, Keisuke; Sano, Shoichi; Kasuga, Ikuro; Kitajima, Masaaki; Furumai, Hiroaki

    2014-01-15

    Rainfall events can introduce large amount of microbial contaminants including human enteric viruses into surface water by intermittent discharges from combined sewer overflows (CSOs). The present study aimed to investigate the effect of rainfall events on viral loads in surface waters impacted by CSO and the reliability of molecular methods for detection of enteric viruses. The reliability of virus detection in the samples was assessed by using process controls for virus concentration, nucleic acid extraction and reverse transcription (RT)-quantitative PCR (qPCR) steps, which allowed accurate estimation of virus detection efficiencies. Recovery efficiencies of poliovirus in river water samples collected during rainfall events (<10%) were lower than those during dry weather conditions (>10%). The log10-transformed virus concentration efficiency was negatively correlated with suspended solid concentration (r(2)=0.86) that increased significantly during rainfall events. Efficiencies of DNA extraction and qPCR steps determined with adenovirus type 5 and a primer sharing control, respectively, were lower in dry weather. However, no clear relationship was observed between organic water quality parameters and efficiencies of these two steps. Observed concentrations of indigenous enteric adenoviruses, GII-noroviruses, enteroviruses, and Aichi viruses increased during rainfall events even though the virus concentration efficiency was presumed to be lower than in dry weather. The present study highlights the importance of using appropriate process controls to evaluate accurately the concentration of water borne enteric viruses in natural waters impacted by wastewater discharge, stormwater, and CSOs.

  17. Improving the efficiency of the detection of gravitational wave signals from inspiraling compact binaries: Chebyshev interpolation

    SciTech Connect

    Mitra, S.; Dhurandhar, S.V.; Finn, L.S.

    2005-11-15

    Inspiraling compact-object binary systems are promising gravitational wave sources for ground and space-based detectors. The time-dependent signature of these sources is a well-characterized function of a relatively small number of parameters; thus, the favored analysis technique makes use of matched filtering and maximum likelihood methods. As the parameters that characterize the source model vary, so do the templates against which the detector data are compared in the matched filter. For small variations in the parameters, the filter responses are closely correlated. Current analysis methodology samples a bank of filters whose parameter values are chosen so that the correlation between successive samples from successive filters in the bank is 97%. Correspondingly, the additional information available with each successive template evaluation is, in a real sense, only 3% of that already provided by the nearby templates. The reason for such a dense coverage of parameter space is to minimize the chance that a real signal, near the detection threshold, will be missed by the parameter space sampling. Here we investigate the use of Chebyshev interpolation for reducing the number of templates that must be evaluated to obtain the same analysis sensitivity. Additionally, rather than focus on the 'loss' of signal-to-noise associated with the finite number of filters in the template bank, we evaluate the receiver operating characteristic (ROC) as a measure of the effectiveness of an analysis technique. The ROC relates the false alarm probability to the false dismissal probability of an analysis, which are the quantities that bear most directly on the effectiveness of an analysis scheme. As a demonstration, we compare the present 'dense sampling' analysis methodology with the 'interpolation' methodology using Chebyshev polynomials, restricted to one dimension of the multidimensional analysis problem by plotting the ROC curves. We find that the interpolated search can be

  18. A computationally efficient order statistics based outlier detection technique for EEG signals.

    PubMed

    Giri, Bapun K; Sarkar, Soumajyoti; Mazumder, Satyaki; Das, Koel

    2015-01-01

    Detecting artifacts in EEG data produced by muscle activity, eye blinks and electrical noise is a common and important problem in EEG applications. We present a novel outlier detection method based on order statistics. We propose a 2 step procedure comprising of detecting noisy EEG channels followed by detection of noisy epochs in the outlier channels. The performance of our method is tested systematically using simulated and real EEG data. Our technique produces significant improvement in detecting EEG artifacts over state-of-the-art outlier detection technique used in EEG applications. The proposed method can serve as a general outlier detection tool for different types of noisy signals.

  19. Molecular detection of Bartonella spp. in deer ked pupae, adult keds and moose blood in Finland.

    PubMed

    Korhonen, E M; Pérez Vera, C; Pulliainen, A T; Sironen, T; Aaltonen, K; Kortet, R; Härkönen, L; Härkönen, S; Paakkonen, T; Nieminen, P; Mustonen, A-M; Ylönen, H; Vapalahti, O

    2015-02-01

    The deer ked (Lipoptena cervi) is a haematophagous ectoparasite of cervids that harbours haemotrophic Bartonella. A prerequisite for the vector competence of the deer ked is the vertical transmission of the pathogen from the mother to its progeny and transstadial transmission from pupa to winged adult. We screened 1154 pupae and 59 pools of winged adult deer keds from different areas in Finland for Bartonella DNA using PCR. Altogether 13 pupa samples and one winged adult deer ked were positive for the presence of Bartonella DNA. The amplified sequences were closely related to either B. schoenbuchensis or B. bovis. The same lineages were identified in eight blood samples collected from free-ranging moose. This is the first demonstration of Bartonella spp. DNA in a winged adult deer ked and, thus, evidence for potential transstadial transmission of Bartonella spp. in the species.

  20. The Genetic Architecture of Arsenic Metabolism Efficiency:A SNP-Based Heritability Study of Bangladeshi Adults

    PubMed Central

    Gao, Jianjun; Tong, Lin; Argos, Maria; Bryan, Molly Scannell; Ahmed, Alauddin; Rakibuz-Zaman, Muhammad; Kibriya, Muhammad G.; Jasmine, Farzana; Slavkovich, Vesna; Graziano, Joseph H.

    2015-01-01

    , Jasmine F, Slavkovich V, Graziano JH, Ahsan H, Pierce BL. 2015. The genetic architecture of arsenic metabolism efficiency: a SNP-based heritability study of Bangladeshi adults. Environ Health Perspect 123:985–992; http://dx.doi.org/10.1289/ehp.1408909 PMID:25768001

  1. Gravitational waves from inspiralling compact binaries: Hexagonal template placement and its efficiency in detecting physical signals

    NASA Astrophysics Data System (ADS)

    Cokelaer, T.

    2007-11-01

    Matched filtering is used to search for gravitational waves emitted by inspiralling compact binaries in data from the ground-based interferometers. One of the key aspects of the detection process is the design of a template bank that covers the astrophysically pertinent parameter space. In an earlier paper, we described a template bank that is based on a square lattice. Although robust, we showed that the square placement is overefficient, with the implication that it is computationally more demanding than required. In this paper, we present a template bank based on an hexagonal lattice, which size is reduced by 40% with respect to the proposed square placement. We describe the practical aspects of the hexagonal template bank implementation, its size, and computational cost. We have also performed exhaustive simulations to characterize its efficiency and safeness. We show that the bank is adequate to search for a wide variety of binary systems (primordial black holes, neutron stars, and stellar-mass black holes) and in data from both current detectors (initial LIGO, Virgo and GEO600) as well as future detectors (advanced LIGO and EGO). Remarkably, although our template bank placement uses a metric arising from a particular template family, namely, stationary phase approximation, we show that it can be used successfully with other template families (e.g., Padé resummation and effective one-body approximation). This quality of being effective for different template families makes the proposed bank suitable for a search that would use several of them in parallel (e.g., in a binary black hole search). The hexagonal template bank described in this paper is currently used to search for nonspinning inspiralling compact binaries in data from the Laser Interferometer Gravitational-Wave Observatory (LIGO).

  2. A novel EPID design for enhanced contrast and detective quantum efficiency

    NASA Astrophysics Data System (ADS)

    Rottmann, Joerg; Morf, Daniel; Fueglistaller, Rony; Zentai, George; Star-Lack, Josh; Berbeco, Ross

    2016-09-01

    Beams-eye-view imaging applications such as real-time soft-tissue motion estimation are hindered by the inherently low image contrast of electronic portal imaging devices (EPID) currently available for clinical use. We introduce and characterize a novel EPID design that provides substantially increased detective quantum efficiency (DQE), contrast-to-noise ratio (CNR) and sensitivity without degradation in spatial resolution. The prototype design features a stack of four conventional EPID layers combined with low noise integrated readout electronics. Each layer consists of a copper plate, a scintillator (\\text{G}{{\\text{d}}2}{{\\text{O}}2}{{\\text{S}}{}}\\text{:Tb} ) and a photodiode/TFT-switch (aSi:H). We characterize the prototype’s signal response to a 6 MV photon beam in terms of modulation transfer function (MTF), DQE and CNR. The presampled MTF is estimated using a slanted slit technique, the DQE is calculated from measured normalized noise power spectra (nNPS) and the MTF and CNR is estimated using a Las Vegas contrast phantom. The prototype has been designed and built to be interchangeable with the current clinical EPID on the Varian TrueBeam platform (AS-1200) in terms of size and data output specifications. Performance evaluation is conducted in absolute values as well as in relative terms using the Varian AS-1200 EPID as a reference detector. A fivefold increase of DQE(0) to about 6.7% was observed by using the four-layered design versus the AS-1200 reference detector. No substantial differences are observed between each layer’s individual MTF and the one for all four layers operating combined indicating that defocusing due to beam divergence is negligible. Also, using four layers instead of one increases the signal to noise ratio by a factor of 1.7.

  3. Recovery efficiency and limit of detection of aerosolized Bacillus anthracis Sterne from environmental surface samples.

    PubMed

    Estill, Cheryl Fairfield; Baron, Paul A; Beard, Jeremy K; Hein, Misty J; Larsen, Lloyd D; Rose, Laura; Schaefer, Frank W; Noble-Wang, Judith; Hodges, Lisa; Lindquist, H D Alan; Deye, Gregory J; Arduino, Matthew J

    2009-07-01

    After the 2001 anthrax incidents, surface sampling techniques for biological agents were found to be inadequately validated, especially at low surface loadings. We aerosolized Bacillus anthracis Sterne spores within a chamber to achieve very low surface loading (ca. 3, 30, and 200 CFU per 100 cm(2)). Steel and carpet coupons seeded in the chamber were sampled with swab (103 cm(2)) or wipe or vacuum (929 cm(2)) surface sampling methods and analyzed at three laboratories. Agar settle plates (60 cm(2)) were the reference for determining recovery efficiency (RE). The minimum estimated surface concentrations to achieve a 95% response rate based on probit regression were 190, 15, and 44 CFU/100 cm(2) for sampling steel surfaces and 40, 9.2, and 28 CFU/100 cm(2) for sampling carpet surfaces with swab, wipe, and vacuum methods, respectively; however, these results should be cautiously interpreted because of high observed variability. Mean REs at the highest surface loading were 5.0%, 18%, and 3.7% on steel and 12%, 23%, and 4.7% on carpet for the swab, wipe, and vacuum methods, respectively. Precision (coefficient of variation) was poor at the lower surface concentrations but improved with increasing surface concentration. The best precision was obtained with wipe samples on carpet, achieving 38% at the highest surface concentration. The wipe sampling method detected B. anthracis at lower estimated surface concentrations and had higher RE and better precision than the other methods. These results may guide investigators to more meaningfully conduct environmental sampling, quantify contamination levels, and conduct risk assessment for humans.

  4. A novel EPID design for enhanced contrast and detective quantum efficiency.

    PubMed

    Rottmann, Joerg; Morf, Daniel; Fueglistaller, Rony; Zentai, George; Star-Lack, Josh; Berbeco, Ross

    2016-09-07

    Beams-eye-view imaging applications such as real-time soft-tissue motion estimation are hindered by the inherently low image contrast of electronic portal imaging devices (EPID) currently available for clinical use. We introduce and characterize a novel EPID design that provides substantially increased detective quantum efficiency (DQE), contrast-to-noise ratio (CNR) and sensitivity without degradation in spatial resolution. The prototype design features a stack of four conventional EPID layers combined with low noise integrated readout electronics. Each layer consists of a copper plate, a scintillator ([Formula: see text]) and a photodiode/TFT-switch (aSi:H). We characterize the prototype's signal response to a 6 MV photon beam in terms of modulation transfer function (MTF), DQE and CNR. The presampled MTF is estimated using a slanted slit technique, the DQE is calculated from measured normalized noise power spectra (nNPS) and the MTF and CNR is estimated using a Las Vegas contrast phantom. The prototype has been designed and built to be interchangeable with the current clinical EPID on the Varian TrueBeam platform (AS-1200) in terms of size and data output specifications. Performance evaluation is conducted in absolute values as well as in relative terms using the Varian AS-1200 EPID as a reference detector. A fivefold increase of DQE(0) to about 6.7% was observed by using the four-layered design versus the AS-1200 reference detector. No substantial differences are observed between each layer's individual MTF and the one for all four layers operating combined indicating that defocusing due to beam divergence is negligible. Also, using four layers instead of one increases the signal to noise ratio by a factor of 1.7.

  5. Investigation of measurement accuracy of factors used for detective quantum efficiency measurement in digital radiography.

    PubMed

    Kunitomo, Hiroshi; Koyama, Shuji; Higashide, Ryo; Ichikawa, Katsuhiro; Hattori, Masumi; Okada, Yoko; Hayashi, Norio; Sawada, Michito

    2014-07-01

    In the detective quantum efficiency (DQE) evaluation of detectors for digital radiography (DR) systems, physical image quality indices such as modulation transfer function (MTF) and normalized noise power spectrum (NNPS) need to be accurately measured to obtain highly accurate DQE evaluations. However, there is a risk of errors in these measurements. In this study, we focused on error factors that should be considered in measurements using clinical DR systems. We compared the incident photon numbers indicated in IEC 62220-1 with those estimated using a Monte Carlo simulation based on X-ray energy spectra measured employing four DR systems. For NNPS, influences of X-ray intensity non-uniformity, tube voltage and aluminum purity were investigated. The effects of geometric magnifications on MTF accuracy were also examined using a tungsten edge plate at distances of 50, 100 and 150 mm from the detector surface at a source-image receptor distance of 2000 mm. The photon numbers in IEC 62220-1 coincided with our estimates of values, with error rates below 2.5%. Tube voltage errors of approximately ±5 kV caused NNPS errors of within 1.0%. The X-ray intensity non-uniformity caused NNPS errors of up to 2.0% at the anode side. Aluminum purity did not affect the measurement accuracy. The maximum MTF reductions caused by geometric magnifications were 3.67% for 1.0-mm X-ray focus and 1.83% for 0.6-mm X-ray focus.

  6. Lateral flow urine lipoarabinomannan assay for detecting active tuberculosis in Hiv-positive adults

    PubMed Central

    Shah, Maunank; Hanrahan, Colleen; Wang, Zhuo Yu; Dendukuri, Nandini; Lawn, Stephen D; Denkinger, Claudia M; Steingart, Karen R

    2016-01-01

    Background Rapid detection of tuberculosis (TB) among people living with human immunodeficiency virus (HIV) is a global health priority. HIV-associated TB may have different clinical presentations and is challenging to diagnose. Conventional sputum tests have reduced sensitivity in HIV-positive individuals, who have higher rates of extrapulmonary TB compared with HIV-negative individuals. The lateral flow urine lipoarabinomannan assay (LF-LAM) is a new, commercially available point-of-care test that detects lipoarabinomannan (LAM), a lipopolysaccharide present in mycobacterial cell walls, in people with active TB disease. Objectives To assess the accuracy of LF-LAM for the diagnosis of active TB disease in HIV-positive adults who have signs and symptoms suggestive of TB (TB diagnosis).To assess the accuracy of LF-LAM as a screening test for active TB disease in HIV-positive adults irrespective of signs and symptoms suggestive of TB (TB screening). Search methods We searched the following databases without language restriction on 5 February 2015: the Cochrane Infectious Diseases Group Specialized Register; MEDLINE (PubMed,1966); EMBASE (OVID, from 1980); Science Citation Index Expanded (SCI-EXPANDED, from 1900), Conference Proceedings Citation Index-Science (CPCI-S, from 1900), and BIOSIS Previews (from 1926) (all three using the Web of Science platform; MEDION; LILACS (BIREME, from 1982); SCOPUS (from 1995); the metaRegister of Controlled Trials (mRCT); the search portal of the World Health Organization International Clinical Trials Registry Platform (WHO ICTRP); and ProQuest Dissertations & Theses A&l (from 1861). Selection criteria Eligible study types included randomized controlled trials, cross-sectional studies, and cohort studies that determined LF-LAM accuracy for TB against a microbiological reference standard (culture or nucleic acid amplification test from any body site). A higher quality reference standard was one in which two or more specimen types were

  7. An efficient probe for rapid detection of cyanide in water at parts per billion levels and naked-eye detection of endogenous cyanide.

    PubMed

    Kumari, Namita; Jha, Satadru; Bhattacharya, Santanu

    2014-03-01

    A new molecular probe based on an oxidized bis-indolyl skeleton has been developed for rapid and sensitive visual detection of cyanide ions in water and also for the detection of endogenously bound cyanide. The probe allows the "naked-eye" detection of cyanide ions in water with a visual color change from red to yellow (Δλmax =80 nm) with the immediate addition of the probe. It shows high selectivity towards the cyanide ion without any interference from other anions. The detection of cyanide by the probe is ratiometric, thus making the detection quantitative. A Michael-type addition reaction of the probe with the cyanide ion takes place during this chemodosimetric process. In water, the detection limit was found to be at the parts per million level, which improved drastically when a neutral micellar medium was employed, and it showed a parts-per-billion-level detection, which is even 25-fold lower than the permitted limits of cyanide in water. The probe could also efficiently detect the endogenously bound cyanide in cassava (a staple food) with a clear visual color change without requiring any sample pretreatment and/or any special reaction conditions such as pH or temperature. Thus the probe could serve as a practical naked-eye probe for "in-field" experiments without requiring any sophisticated instruments.

  8. Effect of signal-temporal uncertainty in children and adults: Tone detection in noise or a random-frequency masker

    PubMed Central

    Bonino, Angela Yarnell; Leibold, Lori J.; Buss, Emily

    2013-01-01

    A cue indicating when in time to listen can improve adults' tone detection thresholds, particularly for conditions that produce substantial informational masking. The purpose of this study was to determine if 5- to 13-yr-old children likewise benefit from a light cue indicating when in time to listen for a masked pure-tone signal. Each listener was tested in one of two continuous maskers: Broadband noise (low informational masking) or a random-frequency, two-tone masker (high informational masking). Using a single-interval method of constant stimuli, detection thresholds were measured for two temporal conditions: (1) Temporally-defined, with the listening interval defined by a light cue, and (2) temporally-uncertain, with no light cue. Thresholds estimated from psychometric functions fitted to the data indicated that children and adults benefited to the same degree from the visual cue. Across listeners, the average benefit of a defined listening interval was 1.8 dB in the broadband noise and 8.6 dB in the random-frequency, two-tone masker. Thus, the benefit of knowing when in time to listen was more robust for conditions believed to be dominated by informational masking. An unexpected finding of this study was that children's thresholds were comparable to adults' in the random-frequency, two-tone masker. PMID:25669256

  9. Oklahoma Lightning Mapping Array: Detection Efficiency, Mapping Large Sets of Data, and the Beginning of a Total Lightning Climatology

    NASA Astrophysics Data System (ADS)

    Weiss, S. A.

    2015-12-01

    The Oklahoma Lightning Mapping Array (OKLMA) has collected the time and location of very
high frequency (VHF) radiation sources produced by all types of lightning in central Oklahoma since the spring of 2003. The detection efficiency of the OKLMA decreases with distance from the center of the LMA, which causes a false maximum in sources over the network when working with very large data sets. Using five months worth of data and assuming a VHF source detection efficiency of 100% over the network, a map of detection efficiency at different ranges is presented. Two methods of eliminating the bias of source detection over the network are explored: a normalization method based on the decreasing VHF power of detected sources with range and a flash-sorting method. Although both methods yield similar results, the flash sorting method is chosen for future climatology studies because it is more readily understood and is already in use throughout the community in case studies and lightning jump algorithms. The first maps and time series of total lightning over central Oklahoma for a 10-year period are presented.

  10. Effort and Potential Efficiencies for Aquatic Non-native Species Early Detection

    EPA Science Inventory

    This manuscript is based on the early aquatic non-native species detection research in the Duluth-Superior harbor. The problem of early detection is essentially that of a "needle in a haystack" - to detect a newly arrived and presumably rare non-native species with a high probabi...

  11. Rapid and efficient pesticide detection via cyclodextrin-promoted energy transfer.

    PubMed

    Serio, Nicole; Roque, John; Badwal, Andrew; Levine, Mindy

    2015-11-21

    Cyclodextrins facilitate non-covalent fluorescence energy transfer from a variety of pesticides to high quantum-yield fluorophores, resulting in a rapid, sensitive detection scheme for these compounds with detection limits as low as two micromolar. Such a facile detection tool has significant potential applications in agriculture and public health research.

  12. An efficient direction field-based method for the detection of fasteners on high-speed railways.

    PubMed

    Yang, Jinfeng; Tao, Wei; Liu, Manhua; Zhang, Yongjie; Zhang, Haibo; Zhao, Hui

    2011-01-01

    Railway inspection is an important task in railway maintenance to ensure safety. The fastener is a major part of the railway which fastens the tracks to the ground. The current article presents an efficient method to detect fasteners on the basis of image processing and pattern recognition techniques, which can be used to detect the absence of fasteners on the corresponding track in high-speed(up to 400 km/h). The Direction Field is extracted as the feature descriptor for recognition. In addition, the appropriate weight coefficient matrix is presented for robust and rapid matching in a complex environment. Experimental results are presented to show that the proposed method is computation efficient and robust for the detection of fasteners in a complex environment. Through the practical device fixed on the track inspection train, enough fastener samples are obtained, and the feasibility of the method is verified at 400 km/h.

  13. An Efficient Direction Field-Based Method for the Detection of Fasteners on High-Speed Railways

    PubMed Central

    Yang, Jinfeng; Tao, Wei; Liu, Manhua; Zhang, Yongjie; Zhang, Haibo; Zhao, Hui

    2011-01-01

    Railway inspection is an important task in railway maintenance to ensure safety. The fastener is a major part of the railway which fastens the tracks to the ground. The current article presents an efficient method to detect fasteners on the basis of image processing and pattern recognition techniques, which can be used to detect the absence of fasteners on the corresponding track in high-speed(up to 400 km/h). The Direction Field is extracted as the feature descriptor for recognition. In addition, the appropriate weight coefficient matrix is presented for robust and rapid matching in a complex environment. Experimental results are presented to show that the proposed method is computation efficient and robust for the detection of fasteners in a complex environment. Through the practical device fixed on the track inspection train, enough fastener samples are obtained, and the feasibility of the method is verified at 400 km/h. PMID:22164022

  14. Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XV; Appraisal of the Relationship between Tag Detection Efficiency at Bonneville Dam and the Precision of In-River Survival Estimates of Returning PIT-Tagged Chinook Salmon, 2000 Technical Report.

    SciTech Connect

    Perez-Comas, Joes A.; Skalski, John R.

    2000-07-01

    In the advent of the installation of a PIT-tag interrogation system in the Cascades Island fish ladder at Bonneville Dam, this report provides guidance on the anticipated precision of in-river survival estimates for returning adult salmonids, between Bonneville and Lower Granite dams, for various levels of system-wide adult detection probability at Bonneville Dam. Precision was characterized by the standard error of the survival estimates and the coefficient of variation of the survival estimates. The anticipated precision of in-river survival estimates for returning adult salmonids was directly proportional to the number of PIT-tagged smolts released and to the system-wide adult detection efficiency at Bonneville Dam, as well as to the in-river juvenile survival above Lower Granite Dam. Moreover, for a given release size and system-wide adult detection efficiency at Bonneville Dam, higher estuarine and marine survival rates also produced more precise survival estimates. With a system-wide detection probability of P{sub BA} = 1 at Bonneville Dam, the anticipated CVs for in-river survival estimate ranged between 9.4 and 20% with release sizes of 10,000 smolts. Moreover, if the system-wide adult detection efficiency at Bonneville Dam is less than maximum (i.e., P{sub BA} < 1), precision of CV {le} 20% could still be attained. For example, for releases of 10,000 PIT-tagged fish a CV of 20% in the estimates of in-river survival for returning adult salmon could be reach with system-wide detection probabilities of 0.2 {le} P{sub BA} {le} 0.6, depending on the tagging scenario.

  15. Simulated Source and Flash Detection Efficiency during the Deep Convective Clouds and Chemistry Field Campaign Using a New Interactive Tool.

    NASA Astrophysics Data System (ADS)

    Chmielewski, V.; Bruning, E. C.

    2015-12-01

    Detailed source and flash detection efficiencies for Lightning Mapping Arrays (LMA) are needed for observational and climatological work with the data. Simulations of the LMAs active during the Deep Convective Clouds and Chemistry campaign (DC3) were performed with a new Monte Carlo interactive tool. As with previous simulations, it propagated emissions from a given source point, added Gaussian observed timing errors to the retrieval times at each station and used a least squared algorithm to find the best solution for the source. This simulation added the ability to account for variable receiver thresholds to restrict the stations contributing to the solution based on received power, which allowed a better examination of the overall impacts of site selection. The average errors were then calculated as has been done previously but with the addition of the probability of detection for a given source location. Based on a 17 month climatology of flashes over the West Texas Lightning Mapping Array (WTLMA), the distribution of flashes by number of sources was used to relate the source detection efficiency from the simulation to the most likely flash detection efficiency. As observed in previous theoretical and observational studies, the average errors in azimuth, range and especially altitude of the source point solutions increased with increasing distance from the center of the network, with the standard deviations of these errors highly dependent on the station configuration and noise thresholds. The source and therefore flash detection efficiency also decreased with range as expected, but its centroid was offset from the center of the WTLMA when variable, observed receiver thresholds were used instead of uniform thresholds across the network. With the observed WTLMA thresholds, 95% of flashes could be detected to approximately 150 km from the center of the network, where average altitude errors were less than 0.4 km but the standard deviation of those errors

  16. Evaluating the influence of laser wavelength and detection stage geometry on optical detection efficiency in a single-particle mass spectrometer

    NASA Astrophysics Data System (ADS)

    Marsden, Nicholas; Flynn, Michael J.; Taylor, Jonathan W.; Allan, James D.; Coe, Hugh

    2016-12-01

    Single-particle mass spectrometry (SPMS) is a useful tool for the online study of aerosols with the ability to measure size-resolved chemical composition with a temporal resolution relevant to atmospheric processes. In SPMS, optical particle detection is used for the effective temporal alignment of an ablation laser pulse with the presence of a particle in the ion source, and it gives the option of aerodynamic sizing by measuring the offset of particle arrival times between two detection stages. The efficiency of the optical detection stage has a strong influence on the overall instrument performance. A custom detection laser system consisting of a high-powered fibre-coupled Nd:YAG solid-state laser with a collimated beam was implemented in the detection stage of a laser ablation aerosol particle time-of-flight (LAAP-TOF) single-particle mass spectrometer without major modifications to instrument geometry. The use of a collimated laser beam permitted the construction of a numerical model that predicts the effects of detection laser wavelength, output power, beam focussing characteristics, light collection angle, particle size, and refractive index on the effective detection radius (R) of the detection laser beam. We compare the model predictions with an ambient data set acquired during the Ice in Clouds Experiment - Dust (ICE-D) project. The new laser system resulted in an order-of-magnitude improvement in instrument sensitivity to spherical particles in the size range 500-800 nm compared to a focussed 405 nm laser diode system. The model demonstrates that the limit of detection in terms of particle size is determined by the scattering cross section (Csca) as predicted by Mie theory. In addition, if light is collected over a narrow collection angle, oscillations in the magnitude of Csca with respect to particle diameter result in a variation in R, resulting in large particle-size-dependent variation in detection efficiency across the particle transmission range

  17. Plate-specific gain map correction for the improvement of detective quantum efficiency in computed radiography

    SciTech Connect

    Schnell, Erich A.; Samei, Ehsan; Dobbins, James T.

    2012-03-15

    Purpose: The purpose of this work is to improve the noise power spectrum (NPS), and thus the detective quantum efficiency (DQE), of computed radiography (CR) images by correcting for spatial gain variations specific to individual imaging plates. CR devices have not traditionally employed gain-map corrections, unlike the case with flat-panel detectors, because of the multiplicity of plates used with each reader. The lack of gain-map correction has limited the DQE(f) at higher exposures with CR. This current work describes a feasible solution to generating plate-specific gain maps. Methods: Ten high-exposure open field images were taken with an RQA5 spectrum, using a sixth generation CR plate suspended in air without a cassette. Image values were converted to exposure, the plates registered using fiducial dots on the plate, the ten images averaged, and then high-pass filtered to remove low frequency contributions from field inhomogeneity. A gain-map was then produced by converting all pixel values in the average into fractions with mean of one. The resultant gain-map of the plate was used to normalize subsequent single images to correct for spatial gain fluctuation. To validate performance, the normalized NPS (NNPS) for all images was calculated both with and without the gain-map correction. Variations in the quality of correction due to exposure levels, beam voltage/spectrum, CR reader used, and registration were investigated. Results: The NNPS with plate-specific gain-map correction showed improvement over the noncorrected case over the range of frequencies from 0.15 to 2.5 mm{sup -1}. At high exposure (40 mR), NNPS was 50%-90% better with gain-map correction than without. A small further improvement in NNPS was seen from carefully registering the gain-map with subsequent images using small fiducial dots, because of slight misregistration during scanning. Further improvement was seen in the NNPS from scaling the gain map about the mean to account for different beam

  18. Analysis of the detective quantum efficiency of a developmental detector for digital mammography.

    PubMed

    Williams, M B; Simoni, P U; Smilowitz, L; Stanton, M; Phillips, W; Stewart, A

    1999-11-01

    We are developing a modular detector for applications in full field digital mammography and for diagnostic breast imaging. The detector is based on a design that has been refined over the past decade for applications in x-ray crystallography [Kalata et al., Proc. SPIE 1345, 270-279 (1990); Phillips et al. ibid. 2009, 133-138 (1993), Phillips et al., Nucl. Instrum. Methods Phys. Rev. A 334, 621-630 (1993)]. The full field mammographic detector, currently undergoing clinical evaluation, is formed from a 19 cm x 28 cm phosphor screen, read out by a 2 x 3 array of butted charge-coupled device (CCD) modules. Each 2k x 2k CCD is optically coupled to the phosphor via a fiber optic taper with dimensions of 9.4 cm x 9.4cm at the phosphor. This paper describes the imaging performance of a two-module prototype, built using a similar design. In this paper we use cascaded linear systems analysis to develop a model for calculating the spatial frequency dependent noise power spectrum (NPS) and detective quantum efficiency (DQE) of the detector using the measured modulation transfer function (MTF). We compare results of the calculation with the measured NPS and DQE of the prototype. Calculated and measured DQEs are compared over a range of clinically relevant x-ray exposures and kVps. We find that for x-ray photon energies between 10 and 28 keV, the detector gain ranges between 2.5 and 3.7 CCD electrons per incident x-ray, or approximately 5-8 electrons per absorbed x ray. Using a Mo/Mo beam and acrylic phantom, over a detector entrance exposure range of approximately 10 to 80 mR, the volume under the measured 2-d NPS of the prototype detector is proportional to the x-ray exposure, indicating quantum limited performance. Substantial agreement between the calculated and measured values was obtained for the frequency and exposure dependent NPS and DQE over a range of tube voltage from 25 to 30 kVp.

  19. Children with Autism Detect Targets at Very Rapid Presentation Rates with Similar Accuracy as Adults

    ERIC Educational Resources Information Center

    Hagmann, Carl Erick; Wyble, Bradley; Shea, Nicole; LeBlanc, Megan; Kates, Wendy R.; Russo, Natalie

    2016-01-01

    Enhanced perception may allow for visual search superiority by individuals with Autism Spectrum Disorder (ASD), but does it occur over time? We tested high-functioning children with ASD, typically developing (TD) children, and TD adults in two tasks at three presentation rates (50, 83.3, and 116.7 ms/item) using rapid serial visual presentation.…

  20. A New Paradigm of Technology Enabled “Vital Signs” for Early Detection of Health Change for Older Adults

    PubMed Central

    Rantz, Marilyn J.; Skubic, Marjorie; Popescu, Mihail; Galambos, Colleen; Koopman, Richelle J.; Alexander, Gregory L.; Phillips, Lorraine J.; Musterman, Katy; Back, Jessica; Miller, Steven J.

    2014-01-01

    Environmentally embedded (non-wearable) sensor technology is in continuous use in elder housing to monitor a new set of “vital signs” that continuously measure the functional status of older adults, detect potential changes in health or functional status, and alert healthcare providers for early recognition and treatment of those changes. Older adult participants’ respiration, pulse, and restlessness are monitored as they sleep. Gait speed, stride length, and stride time are calculated daily, and automatically assess for increasing fall risk. Activity levels are summarized and graphically displayed for easy interpretation. Falls are detected when they occur and alerts are sent immediately to healthcare providers, so time to rescue may be reduced. Automated health alerts are sent to health care staff, based on continuously running algorithms applied to the sensor data, days and weeks before typical signs or symptoms are detected by the person, family members, or health care providers. Discovering these new functional status “vital signs,” developing automated methods for interpreting them, and alerting others when changes occur has the potential to transform chronic illness management and facilitate aging in place through the end of life. Key findings of research in progress at the University of Missouri are discussed in this viewpoint article, as well as obstacles to widespread adoption. PMID:25428525

  1. Blood parasites of two Costa Rican amphibians with comments on detection and microfilaria density associated with adult filarial worm intensity.

    PubMed

    McKenzie, Valerie J; Starks, Hilary A

    2008-08-01

    The 2 objectives of this study were: (1) to compare parasite detectability in blood smears obtained from toe-clips versus the heart from amphibian hosts; and (2) to test whether microfilariae density is correlated with adult filarial worm intensity. We examined blood parasites of 2 species of amphibians, Rana vaillanti (n = 45) and Eleutherodactylus fitzingeri (n = 36), from Costa Rica collected during the summer of 2003. Separate blood smears were obtained from toe-clips and the heart during necrospy. Eight species of blood parasites were identified from R. vaillanti and 1 from E. fitzingeri. Each parasite species was counted in a 2 x 2.2-cm2 area on each blood smear, and the density of host red blood cells (RBCs) was estimated using a sub-sampling approach, allowing parasite infections to be expressed as individuals per RBC. The detection failure rate for toe-cut smears ranged from 71-100% (x = 92.3%) and from 0-9% (x = 2.4%) for heart smears, depending on parasite species. The density of RBCs was significantly higher in smears produced from heart samples and may explain the differences in detectability. Foleyellides striatus microfilariae densities (per RBC) were significantly correlated with adult female worm intensity (R2 = 0.32, P = 0.011).

  2. Combined Detection of Serum IL-10, IL-17, and CXCL10 Predicts Acute Rejection Following Adult Liver Transplantation

    PubMed Central

    Kim, Nayoung; Yoon, Young-In; Yoo, Hyun Ju; Tak, Eunyoung; Ahn, Chul-Soo; Song, Gi-Won; Lee, Sung-Gyu; Hwang, Shin

    2016-01-01

    Discovery of non-invasive diagnostic and predictive biomarkers for acute rejection in liver transplant patients would help to ensure the preservation of liver function in the graft, eventually contributing to improved graft and patient survival. We evaluated selected cytokines and chemokines in the sera from liver transplant patients as potential biomarkers for acute rejection, and found that the combined detection of IL-10, IL-17, and CXCL10 at 1-2 weeks post-operation could predict acute rejection following adult liver transplantation with 97% specificity and 94% sensitivity. PMID:27498551

  3. Hydrodynamics of pulsed jetting in juvenile and adult brief squid Lolliguncula brevis: evidence of multiple jet 'modes' and their implications for propulsive efficiency.

    PubMed

    Bartol, Ian K; Krueger, Paul S; Stewart, William J; Thompson, Joseph T

    2009-06-01

    was detected and there was no apparent speed preference for the jet modes within the speed range considered in this study; however, propulsive efficiency did increase with speed partly because of a reduction in slip and jet angle with speed. Trends in higher slip, lower propulsive efficiency and higher relative lift production were observed for squid <5.0 cm DML compared with squid >/=5.0 cm DML. While these trends were observed when jet mode I and II were equally represented among the size classes, there was also greater relative dependence on jet mode I than jet mode II for squid <5.0 cm DML when all of the available jet sequences were examined. Collectively, these results indicate that approximately 5.0 cm DML is an important ontogenetic transition for the hydrodynamics of pulsed jetting in squids. The significance of our findings is that from early juvenile through to adult life stages, L. brevis is capable of producing a diversity of vortex ring-based jet structures, ranging from efficient short pulses to high-force longer duration pulses. Given that some of these structures had L(omega)/D(omega)s near F, and F represented the delineation between the two primary jet modes observed, fluid dynamics probably played an integral role in the evolution of squid locomotive systems. When this flexibility in jet dynamics is coupled with the highly versatile fins, which are capable of producing multiple hydrodynamic modes as well, it is clear that squid have a locomotive repertoire far more complex than originally thought.

  4. Visual detection technique for efficient screening and isolation of Salmonella based on a novel enrichment assay using chromatography membrane.

    PubMed

    Tang, F; Xiong, Y; Zhang, H; Wu, K; Xiang, Y; Shao, J-B; Ai, H-W; Xiang, Y-P; Zheng, X-L; Lv, J-R; Sun, H; Bao, L-S; Zhang, Z; Hu, H-B; Zhang, J-Y; Chen, L; Lu, J; Liu, W-Y; Mei, H; Ma, Y; Xu, C-F; Fang, A-Y; Gu, M; Xu, C-Y; Chen, Y; Chen, Z; Sun, Z-Y

    2016-03-01

    To detect Salmonella more efficiently and isolate strains more easily, a novel and simple detection method that uses an enrichment assay and two chromogenic reactions on a chromatography membrane was developed. Grade 3 chromatography paper is used as functionalized solid phase support (SPS), which contains specially optimized medium. One reaction for screening is based on the sulfate-reducing capacity of Salmonella. Hydrogen sulfide (H2S) generated by Salmonella reacts with ammonium ferric citrate to produce black colored ferrous sulfide. Another reaction is based on Salmonella C8 esterase that is unique for Enterobacteriaceae except Serratia and interacts with 4-methylumbelliferyl caprylate (MUCAP) to produce fluorescent umbelliferone, which is visible under ultraviolet light. A very low detection limit (10(1) CFU ml(-1)) for Salmonella was achieved on the background of 10(5) CFU ml(-1) Escherichia coli. More importantly, testing with more than 1,000 anal samples indicated that our method has a high positive detection rate and is relatively low cost, compared with the traditional culture-based method. It took only 1 day for the preliminary screening and 2 days to efficiently isolate the Salmonella cells, indicating that the new assay is specific, rapid, and simple for Salmonella detection. In contrast to the traditional culture-based method, this method can be easily used to screen and isolate targeted strains with the naked eye. The results of quantitative and comparative experiments showed that the visual detection technique is an efficient alternative method for the screening of Salmonella spp. in many applications of large-sized samples related to public health surveillance.

  5. Stimulus complexity, EEG abundance gradients, and detection efficiency in a visual recognition task

    ERIC Educational Resources Information Center

    Gale, Anthony; And Others

    1975-01-01

    The work described demonstrated that not only do stimulus parameters have systematic effects upon brain activity as measured by the EEG, but that such effects have functional value and reflect aspects of efficiency. (Editor/RK)

  6. Simple and efficient way to detect small polymorphic bands in plants

    PubMed Central

    Kumar, Manu; Kim, Seong Ryong; Sharma, Prabodh Chander; Pareek, Ashwani

    2015-01-01

    There are many ways to detect polymorphism. In this study we use the microsatellite markers to detect the polymorphism for the salt tolerance. This method has been successfully conducted in Oryza sativa and Brassica juncea. The results are reproducible. In contrast to previous methods, our method is simple and quite accurate for detecting the polymorphic bands. In this study instead of using agarose gel and ethidium bromide staining, we used non-denaturing polyacrylamide gel and a low-cost improved method for silver staining when we compare it to 11 other methods for their ability to detect simple sequence repeat polymorphisms as small as 50 bp in denaturing polyacrylamide gels. All methods detected the same alleles and banding pattern. However, important differences in sensitivity, contrast, time consumption and background were observed. PMID:26484259

  7. [Molecular detection and genotypification of Helicobacter pylori in gastric biopsies from symptomatic adult patients in Santa Fe, Argentina].

    PubMed

    Jiménez, Félix; Barbaglia, Yanina; Bucci, Pamela; Tedeschi, Fabián A; Zalazar, Fabián E

    2013-01-01

    Our goals were: a) to detect Helicobacter pylori in gastric biopsies of symptomatic adults by PCR, b) to detect the presence of the cagA gene as well as of the allelic variants of the vacA gene, and c) to correlate genotypes with the endoscopic diagnoses. H. pylori was detected in 81 % (39/48) of patients by nested PCR for hsp60. The presence of cagA was detected in 15/22 of samples and vacA s1 - m1 was the most frequent allelic combination (15/22). Gastritis, the most frequent diagnosis, was associated with genotype cagA+ in 10/13 of patients. In this group, 9/13 showed the allelic variant vacA s1- m1. The variant vacA s2 - m2 was detected in 3/3 of gastritis cases by H. pylori with the cagA- genotype. These results are the first reported in our region and provide data of epidemiological interest.

  8. Respiratory Viral Detection in Children and Adults: Comparing Asymptomatic Controls and Patients With Community-Acquired Pneumonia

    PubMed Central

    Self, Wesley H.; Williams, Derek J.; Zhu, Yuwei; Ampofo, Krow; Pavia, Andrew T.; Chappell, James D.; Hymas, Weston C.; Stockmann, Chris; Bramley, Anna M.; Schneider, Eileen; Erdman, Dean; Finelli, Lyn; Jain, Seema; Edwards, Kathryn M.; Grijalva, Carlos G.

    2016-01-01

    Background. The clinical significance of viruses detected in patients with community-acquired pneumonia (CAP) is often unclear. Methods. We conducted a prospective study to identify the prevalence of 13 viruses in the upper respiratory tract of patients with CAP and concurrently enrolled asymptomatic controls with real-time reverse-transcriptase polymerase chain reaction. We compared age-stratified prevalence of each virus between patients with CAP and controls and used multivariable logistic regression to calculate attributable fractions (AFs). Results. We enrolled 1024 patients with CAP and 759 controls. Detections of influenza, respiratory syncytial virus, and human metapneumovirus were substantially more common in patients with CAP of all ages than in controls (AFs near 1.0). Parainfluenza and coronaviruses were also more common among patients with CAP (AF, 0.5–0.75). Rhinovirus was associated with CAP among adults (AF, 0.93) but not children (AF, 0.02). Adenovirus was associated with CAP only among children <2 years old (AF, 0.77). Conclusions. The probability that a virus detected with real-time reverse-transcriptase polymerase chain reaction in patients with CAP contributed to symptomatic disease varied by age group and specific virus. Detections of influenza, respiratory syncytial virus, and human metapneumovirus among patients with CAP of all ages probably indicate an etiologic role, whereas detections of parainfluenza, coronaviruses, rhinovirus, and adenovirus, especially in children, require further scrutiny. PMID:26180044

  9. Efficiency calibration and minimum detectable activity concentration of a real-time UAV airborne sensor system with two gamma spectrometers.

    PubMed

    Tang, Xiao-Bin; Meng, Jia; Wang, Peng; Cao, Ye; Huang, Xi; Wen, Liang-Sheng; Chen, Da

    2016-04-01

    A small-sized UAV (NH-UAV) airborne system with two gamma spectrometers (LaBr3 detector and HPGe detector) was developed to monitor activity concentration in serious nuclear accidents, such as the Fukushima nuclear accident. The efficiency calibration and determination of minimum detectable activity concentration (MDAC) of the specific system were studied by MC simulations at different flight altitudes, different horizontal distances from the detection position to the source term center and different source term sizes. Both air and ground radiation were considered in the models. The results obtained may provide instructive suggestions for in-situ radioactivity measurements of NH-UAV.

  10. Spectrally efficient terabit optical transmission with Nyquist 64-QAM half-cycle subcarrier modulation and direct detection.

    PubMed

    Zou, Kaiheng; Zhu, Yixiao; Zhang, Fan; Chen, Zhangyuan

    2016-06-15

    We demonstrate 1.728  Tb/s(16×108  Gb/s) direct-detection wavelength division multiplexing (WDM) transmission over 80 km standard single mode fiber (SSMF) with Nyquist 64-ary quadrature amplitude modulation (64-QAM) and half-cycle subcarrier modulation. Each channel carries single sideband 18 GBaud 64-QAM signal and the channel spacing is 27 GHz. Considering 20% soft-decision forward error correction and frame redundancy, a net spectral efficiency record of 3.25 b/s/Hz is achieved for 100 G single polarization direct-detection WDM transmission.

  11. BlueDetect: An iBeacon-Enabled Scheme for Accurate and Energy-Efficient Indoor-Outdoor Detection and Seamless Location-Based Service.

    PubMed

    Zou, Han; Jiang, Hao; Luo, Yiwen; Zhu, Jianjie; Lu, Xiaoxuan; Xie, Lihua

    2016-02-22

    The location and contextual status (indoor or outdoor) is fundamental and critical information for upper-layer applications, such as activity recognition and location-based services (LBS) for individuals. In addition, optimizations of building management systems (BMS), such as the pre-cooling or heating process of the air-conditioning system according to the human traffic entering or exiting a building, can utilize the information, as well. The emerging mobile devices, which are equipped with various sensors, become a feasible and flexible platform to perform indoor-outdoor (IO) detection. However, power-hungry sensors, such as GPS and WiFi, should be used with caution due to the constrained battery storage on mobile device. We propose BlueDetect: an accurate, fast response and energy-efficient scheme for IO detection and seamless LBS running on the mobile device based on the emerging low-power iBeacon technology. By leveraging the on-broad Bluetooth module and our proposed algorithms, BlueDetect provides a precise IO detection service that can turn on/off on-board power-hungry sensors smartly and automatically, optimize their performances and reduce the power consumption of mobile devices simultaneously. Moreover, seamless positioning and navigation services can be realized by it, especially in a semi-outdoor environment, which cannot be achieved by GPS or an indoor positioning system (IPS) easily. We prototype BlueDetect on Android mobile devices and evaluate its performance comprehensively. The experimental results have validated the superiority of BlueDetect in terms of IO detection accuracy, localization accuracy and energy consumption.

  12. BlueDetect: An iBeacon-Enabled Scheme for Accurate and Energy-Efficient Indoor-Outdoor Detection and Seamless Location-Based Service

    PubMed Central

    Zou, Han; Jiang, Hao; Luo, Yiwen; Zhu, Jianjie; Lu, Xiaoxuan; Xie, Lihua

    2016-01-01

    The location and contextual status (indoor or outdoor) is fundamental and critical information for upper-layer applications, such as activity recognition and location-based services (LBS) for individuals. In addition, optimizations of building management systems (BMS), such as the pre-cooling or heating process of the air-conditioning system according to the human traffic entering or exiting a building, can utilize the information, as well. The emerging mobile devices, which are equipped with various sensors, become a feasible and flexible platform to perform indoor-outdoor (IO) detection. However, power-hungry sensors, such as GPS and WiFi, should be used with caution due to the constrained battery storage on mobile device. We propose BlueDetect: an accurate, fast response and energy-efficient scheme for IO detection and seamless LBS running on the mobile device based on the emerging low-power iBeacon technology. By leveraging the on-broad Bluetooth module and our proposed algorithms, BlueDetect provides a precise IO detection service that can turn on/off on-board power-hungry sensors smartly and automatically, optimize their performances and reduce the power consumption of mobile devices simultaneously. Moreover, seamless positioning and navigation services can be realized by it, especially in a semi-outdoor environment, which cannot be achieved by GPS or an indoor positioning system (IPS) easily. We prototype BlueDetect on Android mobile devices and evaluate its performance comprehensively. The experimental results have validated the superiority of BlueDetect in terms of IO detection accuracy, localization accuracy and energy consumption. PMID:26907295

  13. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in adult bumble bees.

    PubMed

    Maxfield-Taylor, Sarah A; Mujic, Alija B; Rao, Sujaya

    2015-01-01

    Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  14. First Detection of the Larval Chalkbrood Disease Pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in Adult Bumble Bees

    PubMed Central

    Maxfield-Taylor, Sarah A.; Mujic, Alija B.; Rao, Sujaya

    2015-01-01

    Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen. PMID:25885679

  15. Probabilistic monitoring in intrusion detection module for energy efficiency in mobile ad hoc networks

    NASA Astrophysics Data System (ADS)

    De Rango, Floriano; Lupia, Andrea

    2016-05-01

    MANETs allow mobile nodes communicating to each other using the wireless medium. A key aspect of these kind of networks is the security, because their setup is done without an infrastructure, so external nodes could interfere in the communication. Mobile nodes could be compromised, misbehaving during the multi-hop transmission of data, or they could have a selfish behavior to save energy, which is another important constraint in MANETs. The detection of these behaviors need a framework that takes into account the latest interactions among nodes, so malicious or selfish nodes could be detected also if their behavior is changed over time. The monitoring activity increases the energy consumption, so our proposal takes into account this issue reducing the energy required by the monitoring system, keeping the effectiveness of the intrusion detection system. The results show an improvement in the saved energy, improving the detection performance too.

  16. Detecting Primary Signals for Efficient Utilization of Spectrum Using Q-Learning (POSTPRINT)

    DTIC Science & Technology

    2010-06-01

    IEEE Xplore . Restrictions apply. 1 • failure to detect the presence of PU • false detection of PU when user does not exist (enter into the domain...Downloaded on June 23,2010 at 12:31:47 UTC from IEEE Xplore . Restrictions apply. 2 dynamic programming methods. Reinforcement learning (RL) helps in...limited to: AFRL Technical Library. Downloaded on June 23,2010 at 12:31:47 UTC from IEEE Xplore . Restrictions apply. 3 In the second example, we

  17. Cobalt phosphide nanowires: an efficient electrocatalyst for enzymeless hydrogen peroxide detection

    NASA Astrophysics Data System (ADS)

    Liu, Danni; Chen, Tao; Zhu, Wenxin; Cui, Liang; Asiri, Abdullah M.; Lu, Qun; Sun, Xuping

    2016-08-01

    In this letter, we demonstrate for the first time that cobalt phosphide nanowires (CoP NWs) exhibit remarkable catalytic activity toward electrochemical detection of hydrogen peroxide (H2O2). As an enzymeless H2O2 sensor, such CoP NWs show a fast amperometric response within 5 s and a low detection limit of 0.48 μM. In addition, this nonenzymatic sensor displays good selectivity, long-term stability and excellent reproducibility.

  18. High-efficiency scintillation detector for combined detection of thermal and fast neutrons and gamma radiation

    DOEpatents

    Chiles, M.M.; Mihalczo, J.T.; Blakeman, E.D.

    1987-02-27

    A scintillation based radiation detector for the combined detection of thermal neutrons, high-energy neutrons and gamma rays in a single detecting unit. The detector consists of a pair of scintillators sandwiched together and optically coupled to the light sensitive face of a photomultiplier tube. A light tight radiation pervious housing is disposed about the scintillators and a portion of the photomultiplier tube to hold the arrangement in assembly and provides a radiation window adjacent the outer scintillator through which the radiation to be detected enters the detector. The outer scintillator is formed of a material in which scintillations are produced by thermal-neutrons and the inner scintillator is formed of a material in which scintillations are produced by high-energy neutrons and gamma rays. The light pulses produced by events detected in both scintillators are coupled to the photomultiplier tube which produces a current pulse in response to each detected event. These current pulses may be processed in a conventional manner to produce a count rate output indicative of the total detected radiation event count rate. Pulse discrimination techniques may be used to distinguish the different radiations and their energy distribution.

  19. Efficiency of integrated waveguide probes for the detection of light backscattered from weakly scattering media.

    PubMed

    Ismail, Nur; Civitci, Fehmi; Wörhoff, Kerstin; de Ridder, René M; Pollnau, Markus; Driessen, Alfred

    2011-02-20

    A semianalytical model for light collection by integrated waveguide probes is developed by extending previous models used to describe fiber probes. The efficiency of waveguide probes is compared to that of different types of fiber probes for different thicknesses of a weakly scattering sample. The simulation results show that integrated probes have a collection efficiency that is higher than that of small-core fiber probes, and, in the particular case of thin samples, also exceeds the collection efficiency of large-core highly multimode fiber probes. An integrated waveguide probe with one excitation and eight collector waveguides is fabricated and applied to excite and collect luminescence from a ruby rod. The experimental results are in good agreement with the simulation and validate the semianalytical model.

  20. COMPONENTS OF SPEECH PROSODY AND THEIR USE IN DETECTION OF SYNTACTIC STRUCTURE BY OLDER ADULTS

    PubMed Central

    Hoyte, Ken J.; Brownell, Hiram; Wingfield, Arthur

    2009-01-01

    Young and older adults heard sentences in which one character was describing another character (“The doctor said the nurse is thirsty”), where the character being described could be determined only by the prosodic pattern in which the sentence was heard. Using computer editing, the authors generated sentences that were heard with either one (Experiment 1) or two (Experiment 2) of three ordinarily co-occurring prosodic features reduced (pitch variation, amplitude variation, timing variation). For both age groups, timing variation was the most valuable of the three prosodic features. These results add to our understanding of the effective preservation of spoken language comprehension in normal aging. PMID:19173106

  1. Temporal Satellite Images in The Process of Automatic Efficient Detection of Changes of the Baltic Sea Coastal Zone

    NASA Astrophysics Data System (ADS)

    Michalowska, Krystyna; Glowienka, Ewa; Hejmanowska, Beata

    2016-10-01

    The goal of the research was to perform tests aimed at assessing possibilities of utilising multi-temporal Landsat satellite images for automatic efficient detection of changes (e.g. accumulation and erosion) of the sea coastal zone. The research database was composed of Landsat satellite images, and standardized NDVI vegetation indexes from the years 1998 and 2015, as well as multi-temporal vector maps and aerial orthophotomaps. The result map of Change detection allowed to locate areas, in which diametrical changes in land coverage took place. Satellite images reflecting the condition of the examined area for twenty years enabled outlining changes of Baltic coastal zone, and then determining the rate and extent of transformations of examined part of coast (erosion and accumulation), and also made it possible to trace the migration of dunes. The analysis showed the range of shifting dune displacement in the years 1998-2015 amounts to ca. 180 m. On the examined section of seashore (32 km), the process of erosion and accumulation was detected respectively on the length of 21 km and 10 km along the coast. The changes of accumulation and erosion of the sea coast are easily identifiable and clearly visible. Properly conducted workflow of processing the satellite images have allowed the rapid and efficient detection of changes coastline, dunes and vegetation.

  2. Microfluidic paper-based analytical devices for colorimetric detection of urinary tract infection biomarkers on adult diapers.

    PubMed

    Chaohao Chen; Tao Dong

    2015-08-01

    Urinary tract infections (UTI) are common infection diseases in elderly patients. The conventional method of detecting UTI involves the collection of significant urine samples from the elderly patients. However, this is a very difficult and time-consuming procedure. This paper addresses the development of a microfluidic paper-based analytical device (μPAD) to detect UTI from urine collected from adult diapers. The design and fabrication for the μPAD is shown. The fabrication process involves melting solid wax on top of filter paper using a hot plate, followed by pattern transfer using a mold with rubbed wax. To demonstrate the feasibility of the proposed method, the μPAD with deposited nitrite reagent had detected different concentrations of nitrite solutions from 0.5 ppm to 100 ppm spiked in urine samples. A calibration curve was obtained by plotting the gray scale intensity values against the various nitrite concentrations. The results showed that the proposed paper-based device holds great potential as low-cost, disposable solution to sensitively detect UTI markers in urine sampled from diapers.

  3. High-Sensitivity and High-Efficiency Detection of DNA Hydroxymethylation in Genomic DNA by Multiplexing Electrochemical Biosensing.

    PubMed

    Chen, Shixing; Dou, Yanzhi; Zhao, Zhihan; Li, Fuwu; Su, Jing; Fan, Chunhai; Song, Shiping

    2016-04-05

    DNA hydroxymethylation (5-hmC) is a kind of new epigenetic modification, which plays key roles in DNA demethylation, genomic reprogramming, and the gene expression in mammals. For further exploring the functions of 5-hmC, it is necessary to develop sensitive and selective methods for detecting 5-hmC. Herein, we developed a novel multiplexing electrochemical (MEC) biosensor for 5-hmC detection based on the glycosylation modification of 5-hmC and enzymatic signal amplification. The 5-hmC was first glycosylated by T4 β-glucosyltransferase and then oxidated by sodium periodate. The resulting glucosyl-modified 5-hmC (5-ghmC) was incubated with ARP-biotin and was bound to avidin-HRP. The 5-hmC can be detected at the subnanogram level. Finally, we performed 5-hmC detection for mouse tissue samples and cancer cell lines. The limit of detection of the MEC biosensor is 20 times lower than that of commercial kits based on optical meaurement. Also, the biosensor presented high detection specificity because the chemical reaction for 5-hmC modification can not happen at any other unhydroxymethylated nucleic acid bases. Importantly, benefited by its multiplexing capacity, the developed MEC biosensor showed excellent high efficiency, which was time-saving and cost less.

  4. A universal TaqMan-based RT-PCR protocol for cost-efficient detection of small noncoding RNA

    PubMed Central

    Jung, Ulrike; Jiang, Xiaoou; Kaufmann, Stefan H.E.; Patzel, Volker

    2013-01-01

    Several methods for the detection of RNA have been developed over time. For small RNA detection, a stem–loop reverse primer-based protocol relying on TaqMan RT-PCR has been described. This protocol requires an individual specific TaqMan probe for each target RNA and, hence, is highly cost-intensive for experiments with small sample sizes or large numbers of different samples. We describe a universal TaqMan-based probe protocol which can be used to detect any target sequence and demonstrate its applicability for the detection of endogenous as well as artificial eukaryotic and bacterial small RNAs. While the specific and the universal probe-based protocol showed the same sensitivity, the absolute sensitivity of detection was found to be more than 100-fold lower for both than previously reported. In subsequent experiments, we found previously unknown limitations intrinsic to the method affecting its feasibility in determination of mature template RISC incorporation as well as in multiplexing. Both protocols were equally specific in discriminating between correct and incorrect small RNA targets or between mature miRNA and its unprocessed RNA precursor, indicating the stem–loop RT-primer, but not the TaqMan probe, triggers target specificity. The presented universal TaqMan-based RT-PCR protocol represents a cost-efficient method for the detection of small RNAs. PMID:24149841

  5. A universal TaqMan-based RT-PCR protocol for cost-efficient detection of small noncoding RNA.

    PubMed

    Jung, Ulrike; Jiang, Xiaoou; Kaufmann, Stefan H E; Patzel, Volker

    2013-12-01

    Several methods for the detection of RNA have been developed over time. For small RNA detection, a stem-loop reverse primer-based protocol relying on TaqMan RT-PCR has been described. This protocol requires an individual specific TaqMan probe for each target RNA and, hence, is highly cost-intensive for experiments with small sample sizes or large numbers of different samples. We describe a universal TaqMan-based probe protocol which can be used to detect any target sequence and demonstrate its applicability for the detection of endogenous as well as artificial eukaryotic and bacterial small RNAs. While the specific and the universal probe-based protocol showed the same sensitivity, the absolute sensitivity of detection was found to be more than 100-fold lower for both than previously reported. In subsequent experiments, we found previously unknown limitations intrinsic to the method affecting its feasibility in determination of mature template RISC incorporation as well as in multiplexing. Both protocols were equally specific in discriminating between correct and incorrect small RNA targets or between mature miRNA and its unprocessed RNA precursor, indicating the stem-loop RT-primer, but not the TaqMan probe, triggers target specificity. The presented universal TaqMan-based RT-PCR protocol represents a cost-efficient method for the detection of small RNAs.

  6. Pre-hybridisation: an efficient way of suppressing endogenous biotin-binding activity inherent to biotin-streptavidin detection system.

    PubMed

    Ahmed, Raju; Spikings, Emma; Zhou, Shaobo; Thompsett, Andrew; Zhang, Tiantian

    2014-04-01

    Endogenous biotin or biotinylated protein binding activity is a major drawback to biotin-avidin/streptavidin detection system. The avidin/streptavidin conjugate used to detect the complex of the biotinylated secondary antibody and the primary antibody binds to endogenous biotin or biotinylated proteins leading to non-specific signals. In Western blot, the endogenous biotin or biotinylated protein binding activity is usually manifested in the form of ~72kDa, ~75kDa and ~150kDa protein bands, which often mask the signals of interest. To overcome this problem, a method based on prior hybridisation of the biotinylated secondary antibody and the streptavidin conjugate was developed. The method was tested alongside the conventional biotin-streptavidin method on proteins extracted from zebrafish (Danio rerio) embryos. Results showed that the newly developed method efficiently suppresses the endogenous biotin or biotinylated protein binding activity inherent to the biotin-streptavidin detection system.

  7. A highly stable 30 keV proton accelerator for studies of angular detection efficiency on Si detectors

    NASA Astrophysics Data System (ADS)

    Salas Bacci, Americo; Baessler, Stefan; Carr, Peter; Hefele, Thomas; Pocanic, Dinko; Roane, Nicholas; Ross, Aaron; Slater, R.; Smith, Alexander; Toth, Csaba; Warner, Dane; Zamperini, Shawn; Zotev, Panaiot; Nab experiment Collaboration

    2017-01-01

    The Nab experiment at the SNS measures the electron-neutrino correlation parameter and the Fierz interference term in free neutron beta decay by measuring in coincidence the electron energy and proton momentum in a magnetic spectrometer with two Si detectors. These large area, thick, and 127-hexagonal segmented Si detectors have to be carefully characterized for optimal performance and for control of systematic errors. The angular detection efficiency of 30 keV proton incident on Si is an important part of this studies. We will present the design, simulation, operation, and detection of 30 keV H+ and H2+as well as results to control the beam stability by the correlation of both detected ion signals. At present we have reached beam stability of (1.2 +/-1.3)E-7/sec.

  8. Efficient and fast 511-keV γ detection through Cherenkov radiation: the CaLIPSO optical detector

    NASA Astrophysics Data System (ADS)

    Ramos, E.; Kochebina, O.; Yvon, D.; Verrecchia, P.; Sharyy, V.; Tauzin, G.; Mols, J. P.; Starzinski, P.; Desforges, D.; Flouzat, Ch.; Bulbul, Y.; Jan, S.; Mancardi, X.; Canot, C.; Alokhina, M.

    2016-11-01

    The CaLIPSO project aims to develop a high precision brain-scanning PET device with time-of-flight capability. The proposed device uses an innovative liquid, the TriMethyl Bismuth, as the detection medium. It detects simultaneously the ionization and optical signals from the 511 keV gamma conversion. In this paper we present the design, the Monte Carlo simulation, and the tests results for the CaLIPSO optical prototype. In this prototype we demonstrated the ability to detect efficiently the low number of the optical photons produced by the relativistic electron from the gamma conversion through the Cherenkov effect. The time resolution of the current prototype is limited by the moderate time transition spread of the PMT, but should be improved to the level better than 100 ps (FWHM) by using micro-channel-plate PMT according to the Geant 4 simulation.

  9. Handheld Lasers Allow Efficient Detection of Fluorescent Marked Organisms in the Field

    PubMed Central

    Fleischer, Shelby J.; De Moraes, Consuelo M.; Mescher, Mark C.; Tooker, John F.

    2015-01-01

    Marking organisms with fluorescent dyes and powders is a common technique used in ecological field studies that monitor movement of organisms to examine life history traits, behaviors, and population dynamics. External fluorescent marking is relatively inexpensive and can be readily employed to quickly mark large numbers of individuals; however, the ability to detect marked organisms in the field at night has been hampered by the limited detection distances provided by portable fluorescent ultraviolet lamps. In recent years, significant advances in LED lamp and laser technology have led to development of powerful, low-cost ultraviolet light sources. In this study, we evaluate the potential of these new technologies to improve detection of fluorescent-marked organisms in the field and to create new possibilities for tracking marked organisms in visually challenging environments such as tree canopies and aquatic habitats. Using handheld lasers, we document a method that provides a fivefold increase in detection distance over previously available technologies. This method allows easy scouting of tree canopies (from the ground), as well as shallow aquatic systems. This novel detection method for fluorescent-marked organisms thus promises to significantly enhance the use of fluorescent marking as a non-destructive technique for tracking organisms in natural environments, facilitating field studies that aim to document otherwise inaccessible aspects of the movement, behavior, and population dynamics of study organisms, including species with significant economic impacts or relevance for ecology and human health. PMID:26035303

  10. Efficient Forest Fire Detection Index for Application in Unmanned Aerial Systems (UASs)

    PubMed Central

    Cruz, Henry; Eckert, Martina; Meneses, Juan; Martínez, José-Fernán

    2016-01-01

    This article proposes a novel method for detecting forest fires, through the use of a new color index, called the Forest Fire Detection Index (FFDI), developed by the authors. The index is based on methods for vegetation classification and has been adapted to detect the tonalities of flames and smoke; the latter could be included adaptively into the Regions of Interest (RoIs) with the help of a variable factor. Multiple tests have been performed upon database imagery and present promising results: a detection precision of 96.82% has been achieved for image sizes of 960 × 540 pixels at a processing time of 0.0447 seconds. This achievement would lead to a performance of 22 f/s, for smaller images, while up to 54 f/s could be reached by maintaining a similar detection precision. Additional tests have been performed on fires in their early stages, achieving a precision rate of p = 96.62%. The method could be used in real-time in Unmanned Aerial Systems (UASs), with the aim of monitoring a wider area than through fixed surveillance systems. Thus, it would result in more cost-effective outcomes than conventional systems implemented in helicopters or satellites. UASs could also reach inaccessible locations without jeopardizing people’s safety. On-going work includes implementation into a commercially available drone. PMID:27322264

  11. An Efficient Distributed Coverage Hole Detection Protocol for Wireless Sensor Networks

    PubMed Central

    Kumar Sahoo, Prasan; Chiang, Ming-Jer; Wu, Shih-Lin

    2016-01-01

    In wireless sensor networks (WSNs), certain areas of the monitoring region may have coverage holes and serious coverage overlapping due to the random deployment of sensors. The failure of electronic components, software bugs and destructive agents could lead to the random death of the nodes. Sensors may be dead due to exhaustion of battery power, which may cause the network to be uncovered and disconnected. Based on the deployment nature of the nodes in remote or hostile environments, such as a battlefield or desert, it is impossible to recharge or replace the battery. However, the data gathered by the sensors are highly essential for the analysis, and therefore, the collaborative detection of coverage holes has strategic importance in WSNs. In this paper, distributed coverage hole detection algorithms are designed, where nodes can collaborate to detect the coverage holes autonomously. The performance evaluation of our protocols suggests that our protocols outperform in terms of hole detection time, limited power consumption and control packet overhead to detect holes as compared to other similar protocols. PMID:26999143

  12. Handheld lasers allow efficient detection of fluorescent marked organisms in the field.

    PubMed

    Rice, Kevin B; Fleischer, Shelby J; De Moraes, Consuelo M; Mescher, Mark C; Tooker, John F; Gish, Moshe

    2015-01-01

    Marking organisms with fluorescent dyes and powders is a common technique used in ecological field studies that monitor movement of organisms to examine life history traits, behaviors, and population dynamics. External fluorescent marking is relatively inexpensive and can be readily employed to quickly mark large numbers of individuals; however, the ability to detect marked organisms in the field at night has been hampered by the limited detection distances provided by portable fluorescent ultraviolet lamps. In recent years, significant advances in LED lamp and laser technology have led to development of powerful, low-cost ultraviolet light sources. In this study, we evaluate the potential of these new technologies to improve detection of fluorescent-marked organisms in the field and to create new possibilities for tracking marked organisms in visually challenging environments such as tree canopies and aquatic habitats. Using handheld lasers, we document a method that provides a fivefold increase in detection distance over previously available technologies. This method allows easy scouting of tree canopies (from the ground), as well as shallow aquatic systems. This novel detection method for fluorescent-marked organisms thus promises to significantly enhance the use of fluorescent marking as a non-destructive technique for tracking organisms in natural environments, facilitating field studies that aim to document otherwise inaccessible aspects of the movement, behavior, and population dynamics of study organisms, including species with significant economic impacts or relevance for ecology and human health.

  13. Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XIV; Appraisal of the Relationship between Tag Detection Efficiency at Bonneville Dam and the Precision in Estuarine and Marine Survival Estimates on Returning PIT Tagged Chinook Salmon, 2000 Technical Report.

    SciTech Connect

    Perez-Comas, Jose A.; Skalski, John R.

    2000-07-01

    In the advent of the installation of a PIT-tag interrogation system in the Cascades Island fish ladder at Bonneville Dam, this report provides guidance on the anticipated precision of salmonid estuarine and marine survival estimates, for various levels of system-wide adult detection probability at Bonneville Dam. Precision was characterized by the standard error of the survival estimates and the coefficient of variation of the survival estimates. The anticipated precision of salmonid estuarine and marine survival estimates was directly proportional to the number of PIT-tagged smolts released and to the system-wide adult detection efficiency at Bonneville Dam, as well as to the in-river juvenile survival above Lower Granite Dam. Moreover, for a given release size and system-wide adult detection efficiency, higher estuarine and marine survivals did also produce more precise survival estimates. With a system-wide detection probability of P{sub BA} = 1 at Bonneville Dam, the anticipated CVs for the estuarine and marine survival ranged between 41 and 88% with release sizes of 10,000 smolts. Only with the 55,000 smolts being released from sites close to Lower Granite Dam and under high estuarine and marine survival, could CVs of 20% be attained with system detection efficiencies of less than perfect detection (i.e., P{sub BA} < 1).

  14. On the scintillation efficiency of carborane-loaded liquid scintillators for thermal neutron detection

    NASA Astrophysics Data System (ADS)

    Chang, Zheng; Okoye, Nkemakonam C.; Urffer, Matthew J.; Green, Alexander D.; Childs, Kyle E.; Miller, Laurence F.

    2015-01-01

    The scintillation efficiency in response to thermal neutrons was studied by loading different concentrations of carborane (0-8.5 wt%) and naphthalene (0 and 100 g/L) in five liquid organic scintillators. The sample was characterized in Pb and Cd shields under the irradiation of the thermal neutrons from a 252Cf source. A method was developed to extract the net neutron response from the pulse-height spectra. It was found that the order of scintillation efficiencies for both γ-rays and thermal neutrons is as follows: diisopropylnaphthalene>toluene (concentrated solutes)>toluene~pseudocumene~m-xylene. The quench constants, obtained by fitting the Stern-Volmer model to the plots of light output versus carborane concentration, are in the range of 0.35-1.4 M-1 for all the scintillators. The Birks factors, estimated using the specific energy loss profiles of the incident particles, are in the range of 9.3-14 mg cm-2 MeV-1 for all the samples. The light outputs are in the range of 63-86 keV electron equivalents (keVee) in response to thermal neutrons. Loading naphthalene generally promotes the scintillation efficiency of the scintillator with a benzene derivative solvent. Among all the scintillators tested, the diisopropylnaphthalene-based scintillator shows the highest scintillation efficiency, lowest Birks factor, and smallest quench constants. These properties are primarily attributed to the double fused benzene-ring structure of the solvent, which is more efficient to populate to the excited singlet state under ionizing radiation and to transfer the excitation energy to the fluorescent solutes.

  15. Efficient detection of citrus fruits in the tree canopy under variable illumination conditions

    NASA Astrophysics Data System (ADS)

    Lu, Jun; Sang, Nong

    2013-10-01

    This paper focuses on the detection of citrus fruits in the tree canopy under variable illumination and different degree occlusion. We applied a novel segmentation method to detect the visible parts of fruits by fusing the segmentation results of chromatic aberration map, normalized RGB model, and illumination map. This fusion method can detect the highlights, shadows and diffuse zones of fruit targets. The 3-D surface topography of the visible parts of fruits were recovered by the classical algorithm of shade from shading, the fruit targets were recovered by sphere fitting using these point cloud data, and the valid ones were chosen out by validity check. The results showed that the occlusion zones of targets were effectively recovered under various light conditions integrally using the proposed method.

  16. AN EFFICIENT APPROXIMATION TO THE LIKELIHOOD FOR GRAVITATIONAL WAVE STOCHASTIC BACKGROUND DETECTION USING PULSAR TIMING DATA

    SciTech Connect

    Ellis, J. A.; Siemens, X.; Van Haasteren, R.

    2013-05-20

    Direct detection of gravitational waves by pulsar timing arrays will become feasible over the next few years. In the low frequency regime (10{sup -7} Hz-10{sup -9} Hz), we expect that a superposition of gravitational waves from many sources will manifest itself as an isotropic stochastic gravitational wave background. Currently, a number of techniques exist to detect such a signal; however, many detection methods are computationally challenging. Here we introduce an approximation to the full likelihood function for a pulsar timing array that results in computational savings proportional to the square of the number of pulsars in the array. Through a series of simulations we show that the approximate likelihood function reproduces results obtained from the full likelihood function. We further show, both analytically and through simulations, that, on average, this approximate likelihood function gives unbiased parameter estimates for astrophysically realistic stochastic background amplitudes.

  17. Comparison of calculation results of neutron detection efficiency for models with silicon semiconductor detector and plastic scintillator for GAMMA-400 telescope

    NASA Astrophysics Data System (ADS)

    Dedenko, G.; Zin, Thant; Kadilin, V.; Gavrikov, I.; Tyurin, E.; Isakov, S.

    2013-02-01

    Monte Carlo calculations were performed for two models of neutron detector. The first model of the neutron detector includes the layer of polyethylene as a moderator, boron as a target for (n, α) reaction and silicon as a detector of α-particles. The second model consists of polyethylene layers alternating with layers of plastic-boron scintillators. Calculations were performed for parallel neutron flux with evaporation spectrum. The calculation results of neutron detection efficiency for two proposed models were analyzed and compared. The high neutron detection efficiency is attained by using a plastic-boron scintillator. Using natural boron the 10% of detection efficiency is attained and in the case of enriched boron more than 15% of detection efficiency is attained when the detector thickness is 4 cm. The model using silicon detectors provides the detection efficiency about 4%.

  18. Predatory efficiency of the water bug Sphaerodema annulatum on mosquito larvae (Culex quinquefasciatus) and its effect on the adult emergence.

    PubMed

    Aditya, G; Bhattacharyya, S; Kundu, N; Saha, G K; Raut, S K

    2004-11-01

    The daily number of IV instar larva of Culex quinquefasciatus killed, rate of pupation and adult emergence was noted in presence of the predatory water bug Sphaerodema annulatum for a period of seven consecutive days, experimentally, in the laboratory. The rate of IV instar larva killed by the water bugs on an average was 65.17 per day. The rate of pupation ranged between 7.6 and 48 in control while in presence of water bugs it ranged between 6 and 35. The rate of adult emergence in control experiments varied between 1.4 and 4.8 per day, which was reduced to only 0.4-28.8 per day in case of the water bugs. The results clearly indicate that the water bugs on its way of predation reduces the rate of pupation and adult emergence of Cx. quinquefasciatus significantly which calls for an extensive field trials.

  19. Africanized honey bees are efficient at detecting, uncapping and removing dead brood.

    PubMed

    Morais, M M; Francoy, T M; Pereira, R A; De Jong, D; Gonçalves, L S

    2009-01-01

    The hygienic behavior of honey bees is based on a two-step process, including uncapping and removing diseased, dead, damaged, or parasitized brood inside the cell. We evaluated during periods of 1 h the time that hygienic and non-hygienic colonies of Africanized honey bees spend to detect, uncap and remove pin-killed brood using comb inserts with transparent walls placed in observation hives. We observed that hygienic colonies are significantly faster in detecting, uncapping and removing dead brood in the cells (P < 0.001).

  20. Detection, Characterization, and Spontaneous Differentiation In Vitro of Very Small Embryonic-Like Putative Stem Cells in Adult Mammalian Ovary

    PubMed Central

    Parte, Seema; Telang, Jyoti; Daithankar, Vinita; Salvi, Vinita; Zaveri, Kusum; Hinduja, Indira

    2011-01-01

    The present study was undertaken to detect, characterize, and study differentiation potential of stem cells in adult rabbit, sheep, monkey, and menopausal human ovarian surface epithelium (OSE). Two distinct populations of putative stem cells (PSCs) of variable size were detected in scraped OSE, one being smaller and other similar in size to the surrounding red blood cells in the scraped OSE. The smaller 1–3 μm very small embryonic-like PSCs were pluripotent in nature with nuclear Oct-4 and cell surface SSEA-4, whereas the bigger 4–7 μm cells with cytoplasmic localization of Oct-4 and minimal expression of SSEA-4 were possibly the tissue committed progenitor stem cells. Pluripotent gene transcripts of Oct-4, Oct-4A, Nanog, Sox-2, TERT, and Stat-3 in human and sheep OSE were detected by reverse transcriptase–polymerase chain reaction. The PSCs underwent spontaneous differentiation into oocyte-like structures, parthenote-like structures, embryoid body-like structures, cells with neuronal-like phenotype, and embryonic stem cell-like colonies, whereas the epithelial cells transformed into mesenchymal phenotype by epithelial–mesenchymal transition in 3 weeks of OSE culture. Germ cell markers like c-Kit, DAZL, GDF-9, VASA, and ZP4 were immuno-localized in oocyte-like structures. In conclusion, as opposed to the existing view of OSE being a bipotent source of oocytes and granulosa cells, mammalian ovaries harbor distinct very small embryonic-like PSCs and tissue committed progenitor stem cells population that have the potential to develop into oocyte-like structures in vitro, whereas mesenchymal fibroblasts appear to form supporting granulosa-like somatic cells. Research at the single-cell level, including complete gene expression profiling, is required to further confirm whether postnatal oogenesis is a conserved phenomenon in adult mammals. PMID:21291304

  1. Detection, characterization, and spontaneous differentiation in vitro of very small embryonic-like putative stem cells in adult mammalian ovary.

    PubMed

    Parte, Seema; Bhartiya, Deepa; Telang, Jyoti; Daithankar, Vinita; Salvi, Vinita; Zaveri, Kusum; Hinduja, Indira

    2011-08-01

    The present study was undertaken to detect, characterize, and study differentiation potential of stem cells in adult rabbit, sheep, monkey, and menopausal human ovarian surface epithelium (OSE). Two distinct populations of putative stem cells (PSCs) of variable size were detected in scraped OSE, one being smaller and other similar in size to the surrounding red blood cells in the scraped OSE. The smaller 1-3 μm very small embryonic-like PSCs were pluripotent in nature with nuclear Oct-4 and cell surface SSEA-4, whereas the bigger 4-7 μm cells with cytoplasmic localization of Oct-4 and minimal expression of SSEA-4 were possibly the tissue committed progenitor stem cells. Pluripotent gene transcripts of Oct-4, Oct-4A, Nanog, Sox-2, TERT, and Stat-3 in human and sheep OSE were detected by reverse transcriptase-polymerase chain reaction. The PSCs underwent spontaneous differentiation into oocyte-like structures, parthenote-like structures, embryoid body-like structures, cells with neuronal-like phenotype, and embryonic stem cell-like colonies, whereas the epithelial cells transformed into mesenchymal phenotype by epithelial-mesenchymal transition in 3 weeks of OSE culture. Germ cell markers like c-Kit, DAZL, GDF-9, VASA, and ZP4 were immuno-localized in oocyte-like structures. In conclusion, as opposed to the existing view of OSE being a bipotent source of oocytes and granulosa cells, mammalian ovaries harbor distinct very small embryonic-like PSCs and tissue committed progenitor stem cells population that have the potential to develop into oocyte-like structures in vitro, whereas mesenchymal fibroblasts appear to form supporting granulosa-like somatic cells. Research at the single-cell level, including complete gene expression profiling, is required to further confirm whether postnatal oogenesis is a conserved phenomenon in adult mammals.

  2. Conditions for efficient on-chip magnetic bead detection via magnetoresistive sensors.

    PubMed

    Albisetti, E; Petti, D; Cantoni, M; Damin, F; Torti, A; Chiari, M; Bertacco, R

    2013-09-15

    A commonly used figure of merit of magnetoresistive sensors employed to detect magnetic beads labeling biomolecules in lab-on-chip applications is the sensor sensitivity (S0) to external magnetic fields in the linear region of the sensor. In this paper we show that, in case of lock-in detection and bead excitation by a small AC magnetic field, S0 is not the good figure of merit to optimize. Indeed, the highest sensitivity to the magnetic beads is achieved biasing the sensor in the region of its characteristics where the product between the DC bias field and the second derivative of the resistance with respect to the magnetic field is maximum. The validity of this criterion, derived from a phenomenological model of bead detection, is proved in case of magnetic tunneling junction sensors detecting magnetic beads with 250nm diameter. This work paves the way to the development of a new generation of sensors properly designed to maximize the bead sensitivity.

  3. Neural Evidence of Statistical Learning: Efficient Detection of Visual Regularities without Awareness

    ERIC Educational Resources Information Center

    Turk-Browne, Nicholas B.; Scholl, Brian J.; Chun, Marvin M.; Johnson, Marcia K.

    2009-01-01

    Our environment contains regularities distributed in space and time that can be detected by way of statistical learning. This unsupervised learning occurs without intent or awareness, but little is known about how it relates to other types of learning, how it affects perceptual processing, and how quickly it can occur. Here we use fMRI during…

  4. Convolution Comparison Pattern: An Efficient Local Image Descriptor for Fingerprint Liveness Detection.

    PubMed

    Gottschlich, Carsten

    2016-01-01

    We present a new type of local image descriptor which yields binary patterns from small image patches. For the application to fingerprint liveness detection, we achieve rotation invariant image patches by taking the fingerprint segmentation and orientation field into account. We compute the discrete cosine transform (DCT) for these rotation invariant patches and attain binary patterns by comparing pairs of two DCT coefficients. These patterns are summarized into one or more histograms per image. Each histogram comprises the relative frequencies of pattern occurrences. Multiple histograms are concatenated and the resulting feature vector is used for image classification. We name this novel type of descriptor convolution comparison pattern (CCP). Experimental results show the usefulness of the proposed CCP descriptor for fingerprint liveness detection. CCP outperforms other local image descriptors such as LBP, LPQ and WLD on the LivDet 2013 benchmark. The CCP descriptor is a general type of local image descriptor which we expect to prove useful in areas beyond fingerprint liveness detection such as biological and medical image processing, texture recognition, face recognition and iris recognition, liveness detection for face and iris images, and machine vision for surface inspection and material classification.

  5. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    PubMed

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  6. Convolution Comparison Pattern: An Efficient Local Image Descriptor for Fingerprint Liveness Detection

    PubMed Central

    Gottschlich, Carsten

    2016-01-01

    We present a new type of local image descriptor which yields binary patterns from small image patches. For the application to fingerprint liveness detection, we achieve rotation invariant image patches by taking the fingerprint segmentation and orientation field into account. We compute the discrete cosine transform (DCT) for these rotation invariant patches and attain binary patterns by comparing pairs of two DCT coefficients. These patterns are summarized into one or more histograms per image. Each histogram comprises the relative frequencies of pattern occurrences. Multiple histograms are concatenated and the resulting feature vector is used for image classification. We name this novel type of descriptor convolution comparison pattern (CCP). Experimental results show the usefulness of the proposed CCP descriptor for fingerprint liveness detection. CCP outperforms other local image descriptors such as LBP, LPQ and WLD on the LivDet 2013 benchmark. The CCP descriptor is a general type of local image descriptor which we expect to prove useful in areas beyond fingerprint liveness detection such as biological and medical image processing, texture recognition, face recognition and iris recognition, liveness detection for face and iris images, and machine vision for surface inspection and material classification. PMID:26844544

  7. Energy resolution and efficiency of phonon-mediated kinetic inductance detectors for light detection

    NASA Astrophysics Data System (ADS)

    Cardani, L.; Colantoni, I.; Cruciani, A.; Di Domizio, S.; Vignati, M.; Bellini, F.; Casali, N.; Castellano, M. G.; Coppolecchia, A.; Cosmelli, C.; Tomei, C.

    2015-08-01

    The development of sensitive cryogenic light detectors is of primary interest for bolometric experiments searching for rare events like dark matter interactions or neutrino-less double beta decay. Thanks to their good energy resolution and the natural multiplexed read-out, Kinetic Inductance Detectors (KIDs) are particularly suitable for this purpose. To efficiently couple KIDs-based light detectors to the large crystals used by the most advanced bolometric detectors, active surfaces of several cm2 are needed. For this reason, we are developing phonon-mediated detectors. In this paper, we present the results obtained with a prototype consisting of four 40 nm thick aluminum resonators patterned on a 2 × 2 cm2 silicon chip, and calibrated with optical pulses and X-rays. The detector features a noise resolution σE = 154 ± 7 eV and an (18 ± 2)% efficiency.

  8. Toward an Integrated Framwork for Data-Efficient Parametric Adaptive Detection

    DTIC Science & Technology

    2012-02-27

    disturbance covariance matrix has a block- Toeplitz matrix structure, preconditioning methods(e.g., [10, 22, 23]) can be employed, which are very... Toeplitz structure). Finally, as a by-product, we show that the CG algorithm also yields a new and computationally efficient AR model order selection...R̃y, which has a smaller condition number than Ry, and thus a faster convergence rate. For PMF, the disturbance covariance matrix is a block- Toeplitz

  9. A light efficiency uniformity detection system for medical rigid endoscope based on image processing

    NASA Astrophysics Data System (ADS)

    Wang, Yakun; Liu, Ming; Liu, Xiaohua; Zhao, Yuejin; Dong, Liquan; Hui, Mei; Zhai, Xiaohao; Li, Yonghui; Zhou, Peng

    2015-08-01

    Light efficiency uniformity is a very important parameter of medical rigid endoscope. This paper introduces a new system based on image processing to test the light efficiency uniformity of medical rigid endoscope. Employing an electric machinery to reduce the human intervention, so that the precision of measuring and automation degree are improved. We collect the image with a digital CCD camera and display it on the screen of a computer, which can avoid visual fatigue from the direct observation through the rigid endoscope. To perform the image processing on a computer, we adopt a self-developed image processing software, by which the test results can be obtained from PC itself. The processes of our self-developed image processing software include: gray-scale transformation, image pretreatment and image binarization; calculate the center and equivalent radius of the field of view (FOV); plot the curve, through which the ratio of edge and center in different field and the center axisymmetric of light efficiency can be both calculated. It concludes that the relative self-effect of illumination light luminosity is the foremost factor affecting the uniformity, and these endoscopes are all qualified with the max deviation of the center axisymmetric less than 20%. The results of our study prove that this system can test the light efficiency uniformity of medical rigid endoscope quickly, expediently and accurately, and it contains more information instead of only reflecting a particular field of the FOV, what's more, it applies to different types, length and angles of view of medical rigid endoscope.

  10. Comparison of Luminex xTAG® RVP fast assay and real time RT-PCR for the detection of respiratory viruses in adults with community-acquired pneumonia.

    PubMed

    Luchsinger, Vivian; Prades, Yara; Ruiz, Mauricio; Pizarro, Rolando; Rossi, Patricio; Lizama, Luis; Garmendia, María Luisa; Meza, Angela; Larrañaga, Carmen; Avendaño, Luis F

    2016-07-01

    Community-acquired pneumonia (CAP) is the third cause of death worldwide. Viruses are frequently detected in adult CAP. Highly sensitive diagnostic techniques should be used due to poor viral shedding. Different sampling methods can affect viral detection, being necessary to establish the optimal type of sample for identifying respiratory viruses in adults. The detection rates of respiratory viruses by Luminex xTAG® RVP fast assay, real time RT-PCR (rtRT-PCR) (Sacace®), and immunofluorescence assay (IFA) in adult CAP were performed in nasopharyngeal swabs (NPS) and aspirates (NPA) from 179 hospitalized adults. Positivity was 47.5% for Luminex®, 42.5% for rtRT-PCR (P = 0.3), and 2.7% for IFA (2.7%) (P < 0.0). The sensitivity, specificity, and kappa coefficient of xTAG® RVP compared with rtRT-PCR were 84.2%, 79.6%, and 0.62%, respectively. Luminex® and rtRT-PCR detected 65 (58.0%) and 57 (50.9%) viruses in 112 NPA and 35 (34.3%) and 31 (30.4%) in 102 NPS, respectively (P < 0.01). xTAG® RVP is appropriate for detecting respiratory viruses in CAP adults. Both molecular techniques yielded better results with nasopharyngeal aspirate than swabs.

  11. Virological and phylogenetic characterization of attenuated small ruminant lentivirus isolates eluding efficient serological detection.

    PubMed

    Cardinaux, Laure; Zahno, Marie-Luise; Deubelbeiss, Martina; Zanoni, Reto; Vogt, Hans-Rudolf; Bertoni, Giuseppe

    2013-03-23

    Three field isolates of small ruminant lentiviruses (SRLVs) were derived from a mixed flock of goats and sheep certified for many years as free of caprine arthritis encephalitis virus (CAEV). The phylogenetic analysis of pol sequences permitted to classify these isolates as A4 subtype. None of the animals showed clinical signs of SRLV infection, confirming previous observations which had suggested that this particular subtype is highly attenuated, at least for goats. A quantitative real time PCR strategy based on primers and probes derived from a highly variable env region permitted us to classify the animals as uninfected, singly or doubly infected. The performance of different serological tools based on this classification revealed their profound inadequacy in monitoring animals infected with this particular SRLV subtype. In vitro, the isolates showed differences in their cytopathicity and a tendency to replicate more efficiently in goat than sheep cells, especially in goat macrophages. By contrast, in vivo, these viruses reached significantly higher viral loads in sheep than in goats. Both env subtypes infected goats and sheep with equal efficiency. One of these, however, reached significantly higher viral loads in both species. In conclusion, we characterized three isolates of the SRLV subtype A4 that efficiently circulate in a mixed herd of goats and sheep in spite of their apparent attenuation and a strict physical separation between goats and sheep. The poor performance of the serological tools applied indicates that, to support an SRLV eradication campaign, it is imperative to develop novel, subtype specific tools.

  12. Detection of avascular necrosis in adults by single photon emission computed tomography

    SciTech Connect

    Collier, B.D.; Johnston, R.P.; Carrera, G.; Isitman, A.T.; Hellman, R.S.; Zielonka, J.S.

    1984-01-01

    Twenty-one adult patients with the clinical diagnosis of avascular necrosis (AVN) of the femoral head were examined with planar bone scintigraphy (high resolution collimator) and single photon emission computed tomography (SPECT). The duration of hip pain ranged from 1 day to 18 months. Risk factors (including steroids, renal transplantation, alcoholism, and trauma) were present in 17 cases. A final diagnosis of AVN (20 hips), osteochondral facture, or stress fracture, was established for 17 patients. The 4 remaining patients, who were radiographically normal and did not complain of pain 3 months later, were thought to have no significant bone pathology. SPECT and planar bone scintigraphy were reported as positive for AVN only if a photopenic bony defect could be identified. In particular, uniformly increased activity throughout the femoral head was not considered to be diagnostic of AVN. The authors conclude that by identifying a photopenic defect which is not evident on planar bone scintigraphy, SPECT can contribute to accurate diagnosis of AVN.

  13. High Blood Cholesterol in Adults. Report of the Expert Panel on Detection, Evaluation, and Treatment.

    ERIC Educational Resources Information Center

    National Heart, Lung, and Blood Inst. (DHHS/NIH), Bethesda, MD.

    This report offers a patient-based approach to lowering blood cholesterol levels which seeks to identify individuals at high risk who will benefit from intensive intervention efforts. The goal is to establish criteria that define the candidates for medical intervention and to provide guidelines on how to detect, set goals for, treat, and monitor…

  14. Gap Detection in School-Age Children and Adults: Center Frequency and Ramp Duration

    ERIC Educational Resources Information Center

    Buss, Emily; Porter, Heather L.; Hall, Joseph W., III; Grose, John H.

    2017-01-01

    Purpose: The age at which gap detection becomes adultlike differs, depending on the stimulus characteristics. The present study evaluated whether the developmental trajectory differs as a function of stimulus frequency region or duration of the onset and offset ramps bounding the gap. Method: Thresholds were obtained for wideband noise (500-4500…

  15. Balancing the Need for Reliability and Time Efficiency: Short Forms of the Wechsler Adult Intelligence Scale-III

    ERIC Educational Resources Information Center

    Jeyakumar, Sharon L. E.; Warriner, Erin M.; Raval, Vaishali V.; Ahmad, Saadia A.

    2004-01-01

    Tables permitting the conversion of short-form composite scores to full-scale IQ estimates have been published for previous editions of the Wechsler Adult Intelligence Scale (WAIS). Equivalent tables are now needed for selected subtests of the WAIS-III. This article used Tellegen and Briggs's formulae to convert the sum of scaled scores for four…

  16. An Optimized Hidden Node Detection Paradigm for Improving the Coverage and Network Efficiency in Wireless Multimedia Sensor Networks

    PubMed Central

    Alanazi, Adwan; Elleithy, Khaled

    2016-01-01

    Successful transmission of online multimedia streams in wireless multimedia sensor networks (WMSNs) is a big challenge due to their limited bandwidth and power resources. The existing WSN protocols are not completely appropriate for multimedia communication. The effectiveness of WMSNs varies, and it depends on the correct location of its sensor nodes in the field. Thus, maximizing the multimedia coverage is the most important issue in the delivery of multimedia contents. The nodes in WMSNs are either static or mobile. Thus, the node connections change continuously due to the mobility in wireless multimedia communication that causes an additional energy consumption, and synchronization loss between neighboring nodes. In this paper, we introduce an Optimized Hidden Node Detection (OHND) paradigm. The OHND consists of three phases: hidden node detection, message exchange, and location detection. These three phases aim to maximize the multimedia node coverage, and improve energy efficiency, hidden node detection capacity, and packet delivery ratio. OHND helps multimedia sensor nodes to compute the directional coverage. Furthermore, an OHND is used to maintain a continuous node– continuous neighbor discovery process in order to handle the mobility of the nodes. We implement our proposed algorithms by using a network simulator (NS2). The simulation results demonstrate that nodes are capable of maintaining direct coverage and detecting hidden nodes in order to maximize coverage and multimedia node mobility. To evaluate the performance of our proposed algorithms, we compared our results with other known approaches. PMID:27618048

  17. Improvement of antigen detection efficiency with the use of two-dimensional photonic crystal as a substrate

    NASA Astrophysics Data System (ADS)

    Dovzhenko, Dmitriy; Terekhin, Vladimir; Vokhmincev, Kirill; Sukhanova, Alyona; Nabiev, Igor

    2017-01-01

    Multiplex detection of different antigens in human serum in order to reveal diseases at the early stage is of interest nowadays. There are a lot of biosensors, which use the fluorescent labels for specific detection of analytes. For instance, common method for detection of antigens in human serum samples is enzyme-linked immunosorbent assay (ELISA). One of the most effective ways to improve the sensitivity of this detection method is the use of a substrate that could enhance the fluorescent signal and make it easier to collect. Two-dimensional (2D) photonic crystals are very suitable structures for these purposes because of the ability to enhance the luminescent signal, control the light propagation and perform the analysis directly on its surface. In our study we have calculated optimal parameters for 2D-dimensional photonic crystal consisting of the array of silicon nano-rods, fabricated such photonic crystal on a silicon substrate using reactive ion etching and showed the possibility of its efficient application as a substrate for ELISA detection of human cancer antigens.

  18. Folic acid functionalized silver nanoparticles with sensitivity and selectivity colorimetric and fluorescent detection for Hg2+ and efficient catalysis

    NASA Astrophysics Data System (ADS)

    Su, Dongyue; Yang, Xin; Xia, Qingdong; Zhang, Qi; Chai, Fang; Wang, Chungang; Qu, Fengyu

    2014-09-01

    In this research, folic acid functionalized silver nanoparticles (FA-AgNPs) were selected as a colorimetric and a ‘turn on’ fluorescent sensor for detecting Hg2+. After being added into Hg2+, AgNPs can emit stable fluorescence at 440 nm when the excitation wavelength is selected at 275 nm. The absorbance and fluorescence of the FA-AgNPs could reflect the concentration of the Hg2+ ions. Thus, we developed a simple, sensitive analytical method to detect Hg2+ based on the colorimetric and fluorescence enhancement of FA-AgNPs. The sensor exhibits two linear response ranges between absorbance and fluorescence intensity with Hg2+ concentration, respectively. Meanwhile, a detection limit of 1 nM is estimated based on the linear relationship between responses with a concentration of Hg2+. The high specificity of Hg2+ with FA-AgNPs interactions provided the excellent selectivity towards detecting Hg2+ over other metal ions (Pb2+, Mg2+, Zn2+, Ni2+, Cu2+, Co2+, Ca2+, Mn2+, Fe2+, Cd2+, Ba2+, Cr6+ and Cr3+). This will provide a simple, effective and multifunctional colorimetric and fluorescent sensor for on-site and real-time Hg2+ ion detection. The proposed method can be applied to the analysis of trace Hg2+ in lake water. Additionally, the FA-AgNPs can be used as efficient catalyst for the reduction of 4-nitrophenol and potassium hexacyanoferrate (III).

  19. An Optimized Hidden Node Detection Paradigm for Improving the Coverage and Network Efficiency in Wireless Multimedia Sensor Networks.

    PubMed

    Alanazi, Adwan; Elleithy, Khaled

    2016-09-07

    Successful transmission of online multimedia streams in wireless multimedia sensor networks (WMSNs) is a big challenge due to their limited bandwidth and power resources. The existing WSN protocols are not completely appropriate for multimedia communication. The effectiveness of WMSNs varies, and it depends on the correct location of its sensor nodes in the field. Thus, maximizing the multimedia coverage is the most important issue in the delivery of multimedia contents. The nodes in WMSNs are either static or mobile. Thus, the node connections change continuously due to the mobility in wireless multimedia communication that causes an additional energy consumption, and synchronization loss between neighboring nodes. In this paper, we introduce an Optimized Hidden Node Detection (OHND) paradigm. The OHND consists of three phases: hidden node detection, message exchange, and location detection. These three phases aim to maximize the multimedia node coverage, and improve energy efficiency, hidden node detection capacity, and packet delivery ratio. OHND helps multimedia sensor nodes to compute the directional coverage. Furthermore, an OHND is used to maintain a continuous node- continuous neighbor discovery process in order to handle the mobility of the nodes. We implement our proposed algorithms by using a network simulator (NS2). The simulation results demonstrate that nodes are capable of maintaining direct coverage and detecting hidden nodes in order to maximize coverage and multimedia node mobility. To evaluate the performance of our proposed algorithms, we compared our results with other known approaches.

  20. Atom probe tomography evaporation behavior of C-axis GaN nanowires: Crystallographic, stoichiometric, and detection efficiency aspects

    SciTech Connect

    Diercks, David R. Gorman, Brian P.; Kirchhofer, Rita; Sanford, Norman; Bertness, Kris; Brubaker, Matt

    2013-11-14

    The field evaporation behavior of c-axis GaN nanowires was explored in two different laser-pulsed atom probe tomography (APT) instruments. Transmission electron microscopy imaging before and after atom probe tomography analysis was used to assist in reconstructing the data and assess the observed evaporation behavior. It was found that the ionic species exhibited preferential locations for evaporation related to the underlying crystal structure of the GaN and that the species which evaporated from these locations was dependent on the pulsed laser energy. Additionally, the overall stoichiometry measured by APT was significantly correlated with the energy of the laser pulses. At the lowest laser energies, the apparent composition was nitrogen-rich, while higher laser energies resulted in measurements of predominantly gallium compositions. The percent of ions detected (detection efficiency) for these specimens was found to be considerably below that shown for other materials, even for laser energies which produced the expected Ga:N ratio. The apparent stoichiometry variation and low detection efficiency appear to be a result of evaporation of Ga ions between laser pulses at the lowest laser energies and evaporation of neutral N{sub 2} species at higher laser energies. All of these behaviors are tied to the formation of nitrogen-nitrogen bonds on the tip surface, which occurred under all analysis conditions. Similar field evaporation behaviors are therefore expected for other materials where the anionic species readily form a strong diatomic bond.

  1. Atom probe tomography evaporation behavior of C-axis GaN nanowires: Crystallographic, stoichiometric, and detection efficiency aspects

    NASA Astrophysics Data System (ADS)

    Diercks, David R.; Gorman, Brian P.; Kirchhofer, Rita; Sanford, Norman; Bertness, Kris; Brubaker, Matt

    2013-11-01

    The field evaporation behavior of c-axis GaN nanowires was explored in two different laser-pulsed atom probe tomography (APT) instruments. Transmission electron microscopy imaging before and after atom probe tomography analysis was used to assist in reconstructing the data and assess the observed evaporation behavior. It was found that the ionic species exhibited preferential locations for evaporation related to the underlying crystal structure of the GaN and that the species which evaporated from these locations was dependent on the pulsed laser energy. Additionally, the overall stoichiometry measured by APT was significantly correlated with the energy of the laser pulses. At the lowest laser energies, the apparent composition was nitrogen-rich, while higher laser energies resulted in measurements of predominantly gallium compositions. The percent of ions detected (detection efficiency) for these specimens was found to be considerably below that shown for other materials, even for laser energies which produced the expected Ga:N ratio. The apparent stoichiometry variation and low detection efficiency appear to be a result of evaporation of Ga ions between laser pulses at the lowest laser energies and evaporation of neutral N2 species at higher laser energies. All of these behaviors are tied to the formation of nitrogen-nitrogen bonds on the tip surface, which occurred under all analysis conditions. Similar field evaporation behaviors are therefore expected for other materials where the anionic species readily form a strong diatomic bond.

  2. The Effects of Task Design Remediation and Response Efficiency on Work Productivity in Adults with Moderate and Severe Mental Retardation.

    ERIC Educational Resources Information Center

    Belfiore, Phillip J.; And Others

    1994-01-01

    Two studies involving workers with moderate/severe mental retardation analyzed productivity rates on a seated assembly task and analyzed the most efficient means to remediate a custodial vacuuming task. A motion economy-based task design was more efficient than the site-based task design in terms of cleanliness, production rates, and reduction of…

  3. The Bactec FX Blood Culture System Detects Brucella melitensis Bacteremia in Adult Patients within the Routine 1-Week Incubation Period.

    PubMed

    Sagi, Moshe; Nesher, Lior; Yagupsky, Pablo

    2017-03-01

    The performance of the Bactec FX blood culture system for detecting Brucella bacteremia within the routine 1-week incubation period was assessed in a prospective study conducted in an area in southern Israel in which Brucella melitensis is endemic. Aerobic vials (BD Bactec Plus Aerobic/F medium) inoculated with blood specimens obtained from adult patients with positive Rose-Bengal screening test results were monitored for 4 consecutive weeks, and blind subcultures of negative vials were performed on solid media on days 7 and 28. During a 16-month period, a total of 31 (35.2%) of 88 cultures, obtained from 19 (38.0%) of 50 patients, were positive for Brucella melitensis The blood culture instrument identified 30 (96.8%) of 31 positive vials within 7 days of incubation; the single positive vial that was missed by the automated readings was detected only by the blind subculture performed on day 28. It is concluded that the Bactec FX system is able to detect the vast majority of episodes of Brucella bacteremia within the 1-week incubation protocol instituted in most clinical microbiology laboratories and without the need to perform blind subcultures of negative vials, enabling early diagnosis and saving labor and incubation time and space.

  4. An efficient method to detect periodic behavior in botnet traffic by analyzing control plane traffic.

    PubMed

    AsSadhan, Basil; Moura, José M F

    2014-07-01

    Botnets are large networks of bots (compromised machines) that are under the control of a small number of bot masters. They pose a significant threat to Internet's communications and applications. A botnet relies on command and control (C2) communications channels traffic between its members for its attack execution. C2 traffic occurs prior to any attack; hence, the detection of botnet's C2 traffic enables the detection of members of the botnet before any real harm happens. We analyze C2 traffic and find that it exhibits a periodic behavior. This is due to the pre-programmed behavior of bots that check for updates to download them every T seconds. We exploit this periodic behavior to detect C2 traffic. The detection involves evaluating the periodogram of the monitored traffic. Then applying Walker's large sample test to the periodogram's maximum ordinate in order to determine if it is due to a periodic component or not. If the periodogram of the monitored traffic contains a periodic component, then it is highly likely that it is due to a bot's C2 traffic. The test looks only at aggregate control plane traffic behavior, which makes it more scalable than techniques that involve deep packet inspection (DPI) or tracking the communication flows of different hosts. We apply the test to two types of botnet, tinyP2P and IRC that are generated by SLINGbot. We verify the periodic behavior of their C2 traffic and compare it to the results we get on real traffic that is obtained from a secured enterprise network. We further study the characteristics of the test in the presence of injected HTTP background traffic and the effect of the duty cycle on the periodic behavior.

  5. An efficient method to detect periodic behavior in botnet traffic by analyzing control plane traffic

    PubMed Central

    AsSadhan, Basil; Moura, José M.F.

    2013-01-01

    Botnets are large networks of bots (compromised machines) that are under the control of a small number of bot masters. They pose a significant threat to Internet’s communications and applications. A botnet relies on command and control (C2) communications channels traffic between its members for its attack execution. C2 traffic occurs prior to any attack; hence, the detection of botnet’s C2 traffic enables the detection of members of the botnet before any real harm happens. We analyze C2 traffic and find that it exhibits a periodic behavior. This is due to the pre-programmed behavior of bots that check for updates to download them every T seconds. We exploit this periodic behavior to detect C2 traffic. The detection involves evaluating the periodogram of the monitored traffic. Then applying Walker’s large sample test to the periodogram’s maximum ordinate in order to determine if it is due to a periodic component or not. If the periodogram of the monitored traffic contains a periodic component, then it is highly likely that it is due to a bot’s C2 traffic. The test looks only at aggregate control plane traffic behavior, which makes it more scalable than techniques that involve deep packet inspection (DPI) or tracking the communication flows of different hosts. We apply the test to two types of botnet, tinyP2P and IRC that are generated by SLINGbot. We verify the periodic behavior of their C2 traffic and compare it to the results we get on real traffic that is obtained from a secured enterprise network. We further study the characteristics of the test in the presence of injected HTTP background traffic and the effect of the duty cycle on the periodic behavior. PMID:25685512

  6. Energy-Efficient Routing for Signal Detection in Wireless Sensor Networks

    DTIC Science & Technology

    2009-06-01

    under the Neyman-Pearson criterion, apparently lor thellrst time. The joinl optimhatlon of detection and rooting Is earrted out In • fusion Center...feature a fusion -centric approach by assuming that there is a designated fusion center where a final decision will be made, and largely focus on...some sensor nodes are far from the fusion center. Incontrast, both [12] and [13J consider multihop information transmission. although multihop

  7. Photochemical efficiency of adult and young leaves of the neotropical understory shrub Psychotria limonensis (Rubiaceae) in response to changes in the light environment.

    PubMed

    Avalos, Gerardo; Mulkey, Stephen S

    2004-12-01

    We explored the short-term adjustment in photochemical efficiency (Fv/Fm) in adult and young leaves of the understory neotropical shrub Psychotria limonensis Krause (Rubiaceae) in response to rapid changes in the light environment. Leaves were collected from 20 individual plants growing under sun and shade conditions on Gigante Peninsula, Barro Colorado Natural Monument (Republic of Panama), during the wet season of 1996. Leaves were distributed in four sequences of light treatments (AB leaves were expanded under sun and were transferred to shade, BA leaves experienced the opposite transfer, and the controls AA and BB leaves that were expanded and maintained under sun or shade conditions). Adult and young leaves did not differ in overall photochemical efficiency. Instead, differences were found among light environments, for which leaves transferred from shade to sun showed the lowest Fv/Fm ratios. There was no relationship between photochemical efficiency and leaf temperature. In P. limonensis, understory plants are susceptible of photoinhibition independently of the leaf ontogenetic stage. The approach utilized in this experiment allowed the rapid exploration of this capacity, and could be applied to poorly studied understory species.

  8. Improving the efficiency of multisensory integration in older adults: audio-visual temporal discrimination training reduces susceptibility to the sound-induced flash illusion.

    PubMed

    Setti, Annalisa; Stapleton, John; Leahy, Daniel; Walsh, Cathal; Kenny, Rose Anne; Newell, Fiona N

    2014-08-01

    From language to motor control, efficient integration of information from different sensory modalities is necessary for maintaining a coherent interaction with the environment. While a number of training studies have focused on training perceptual and cognitive function, only very few are specifically targeted at improving multisensory processing. Discrimination of temporal order or coincidence is a criterion used by the brain to determine whether cross-modal stimuli should be integrated or not. In this study we trained older adults to judge the temporal order of visual and auditory stimuli. We then tested whether the training had an effect in reducing susceptibility to a multisensory illusion, the sound induced flash illusion. Improvement in the temporal order judgement task was associated with a reduction in susceptibility to the illusion, particularly at longer Stimulus Onset Asynchronies, in line with a more efficient multisensory processing profile. The present findings set the ground for more broad training programs aimed at improving older adults׳ cognitive performance in domains in which efficient temporal integration across the senses is required.

  9. Efficient detection and signal parameter estimation with applications to high dynamic GPS receivers

    NASA Technical Reports Server (NTRS)

    Kumar, R.

    1988-01-01

    A novel technique for simultaneously detecting data and estimating the parameters of a received carrier signal phase modulated by unknown data and experiencing very high Doppler, Doppler rate, etc. is discussed. Such a situation arises, for example, in the case of Global Positioning Systems (DPS) where the signal parameters are directly related to the position, velocity and acceleration of the GPS receiver. The proposed scheme is based upon first estimating the received signal local (data dependent) parameters over two consecutive bit periods, followed by the detection of a possible jump in these parameters. The presence of a detected jump signifies a data transition which is then removed from the received signal. This effectively demodulated signal is then processed to provide the estimates of global (data independent) parameters of the signal related to the position, velocity, etc. of the receiver. One of the key features of the proposed algorithm is the introduction of two different schemes which can provide an improvement of up to 3 dB over the conventional implementation of Kalman filter as applied to phase and frequency estimation, under low to medium signal-to-noise ratio conditions.

  10. High efficiency ring-lens supercritical angle fluorescence (SAF) detection for optimum bioassay performance.

    PubMed

    Kurzbuch, Dirk; Somers, Martin; McDonagh, Colette

    2013-09-23

    We present a polymer biochip with embedded optics which allows the detection of supercritical angle fluorescence (SAF) without losses due to total internal reflection within the substrate. The chip design comprises structured spherical and aspherical optical elements on the bottom, while the top is chemically functionalized for direct binding of biomolecules. Furthermore, this design facilitates integration in lab-on-a-chip systems with appropriate microfluidics. In the confocal optical setup an ellipsoidal mirror is used for collection of SAF light above the critical angle of the water-polymer interface, which is detected by a photon-counting detector. The work presented here represents a proof of concept for performing sensitive and rapid point-of-care testing, using this low-cost, robust and disposable optical biochip platform. The performance of the platform was validated using direct binding DNA and human IgG assays which yielded low limits of detection 10 pM for DNA and 10 pg/ml for human IgG.

  11. Compressive sensing for efficient health monitoring and effective damage detection of structures

    NASA Astrophysics Data System (ADS)

    Jayawardhana, Madhuka; Zhu, Xinqun; Liyanapathirana, Ranjith; Gunawardana, Upul

    2017-02-01

    Real world Structural Health Monitoring (SHM) systems consist of sensors in the scale of hundreds, each sensor generating extremely large amounts of data, often arousing the issue of the cost associated with data transfer and storage. Sensor energy is a major component included in this cost factor, especially in Wireless Sensor Networks (WSN). Data compression is one of the techniques that is being explored to mitigate the effects of these issues. In contrast to traditional data compression techniques, Compressive Sensing (CS) - a very recent development - introduces the means of accurately reproducing a signal by acquiring much less number of samples than that defined by Nyquist's theorem. CS achieves this task by exploiting the sparsity of the signal. By the reduced amount of data samples, CS may help reduce the energy consumption and storage costs associated with SHM systems. This paper investigates CS based data acquisition in SHM, in particular, the implications of CS on damage detection and localization. CS is implemented in a simulation environment to compress structural response data from a Reinforced Concrete (RC) structure. Promising results were obtained from the compressed data reconstruction process as well as the subsequent damage identification process using the reconstructed data. A reconstruction accuracy of 99% could be achieved at a Compression Ratio (CR) of 2.48 using the experimental data. Further analysis using the reconstructed signals provided accurate damage detection and localization results using two damage detection algorithms, showing that CS has not compromised the crucial information on structural damages during the compression process.

  12. Time-frequency texture descriptors of EEG signals for efficient detection of epileptic seizure.

    PubMed

    Şengür, Abdulkadir; Guo, Yanhui; Akbulut, Yaman

    2016-06-01

    Detection of epileptic seizure in electroencephalogram (EEG) signals is a challenging task and requires highly skilled neurophysiologists. Therefore, computer-aided detection helps neurophysiologist in interpreting the EEG. In this paper, texture representation of the time-frequency (t-f) image-based epileptic seizure detection is proposed. More specifically, we propose texture descriptor-based features to discriminate normal and epileptic seizure in t-f domain. To this end, three popular texture descriptors are employed, namely gray-level co-occurrence matrix (GLCM), texture feature coding method (TFCM), and local binary pattern (LBP). The features that are obtained on the GLCM are contrast, correlation, energy, and homogeneity. Moreover, in the TFCM method, several statistical features are calculated. In addition, for the LBP, the histogram is used as a feature. In the classification stage, a support vector machine classifier is employed. We evaluate our proposal with extensive experiments. According to the evaluated terms, our method produces successful results. 100 % accuracy is obtained with LIBLINEAR. We also compare our method with other published methods and the results show the superiority of our proposed method.

  13. PHACK: An Efficient Scheme for Selective Forwarding Attack Detection in WSNs

    PubMed Central

    Liu, Anfeng; Dong, Mianxiong; Ota, Kaoru; Long, Jun

    2015-01-01

    In this paper, a Per-Hop Acknowledgement (PHACK)-based scheme is proposed for each packet transmission to detect selective forwarding attacks. In our scheme, the sink and each node along the forwarding path generate an acknowledgement (ACK) message for each received packet to confirm the normal packet transmission. The scheme, in which each ACK is returned to the source node along a different routing path, can significantly increase the resilience against attacks because it prevents an attacker from compromising nodes in the return routing path, which can otherwise interrupt the return of nodes’ ACK packets. For this case, the PHACK scheme also has better potential to detect abnormal packet loss and identify suspect nodes as well as better resilience against attacks. Another pivotal issue is the network lifetime of the PHACK scheme, as it generates more acknowledgements than previous ACK-based schemes. We demonstrate that the network lifetime of the PHACK scheme is not lower than that of other ACK-based schemes because the scheme just increases the energy consumption in non-hotspot areas and does not increase the energy consumption in hotspot areas. Moreover, the PHACK scheme greatly simplifies the protocol and is easy to implement. Both theoretical and simulation results are given to demonstrate the effectiveness of the proposed scheme in terms of high detection probability and the ability to identify suspect nodes. PMID:26690178

  14. Geographical Variation in Diabetes Prevalence and Detection in China: Multilevel Spatial Analysis of 98,058 Adults

    PubMed Central

    Zhou, Maigeng; Astell-Burt, Thomas; Bi, Yufang; Feng, Xiaoqi; Jiang, Yong; Li, Yichong; Page, Andrew; Wang, Limin; Xu, Yu

    2015-01-01

    OBJECTIVE To investigate the geographic variation in diabetes prevalence and detection in China. RESEARCH DESIGN AND METHODS Self-report and biomedical data were collected from 98,058 adults aged ≥18 years (90.5% response) from 162 areas spanning mainland China. Diabetes status was assessed using American Diabetes Association criteria. Among those with diabetes, detection was defined by prior diagnosis. Choropleth maps were used to visually assess geographical variation in each outcome at the provincial level. The odds of each outcome were assessed using multilevel logistic regression, with adjustment for person- and area-level characteristics. RESULTS Geographic visualization at the provincial level indicated widespread variation in diabetes prevalence and detection across China. Regional prevalence adjusted for age, sex, and urban/rural socioeconomic circumstances (SECs) ranged from 8.3% (95% CI 7.2%, 9.7%) in the northeast to 12.7% (11.1%, 14.6%) in the north. A clear negative gradient in diabetes prevalence was observed from 13.1% (12.0%, 14.4%) in the urban high-SEC to 8.7% (7.8%, 9.6%) in rural low-SEC counties/districts. Adjusting for health literacy and other person-level characteristics only partially attenuated these geographic variations. Only one-third of participants living with diabetes had been previously diagnosed, but this also varied substantively by geography. Regional detection adjusted for age, sex, and urban/rural SEC, for example, spanned from 40.4% (34.9%, 46.3%) in the north to 15.6% (11.7%, 20.5%) in the southwest. Compared with detection of 40.8% (37.3%, 44.4%) in urban high-SEC counties, detection was poorest among rural low-SEC counties at just 20.5% (17.7%, 23.7%). Person-level characteristics did not fully account for these geographic variations in diabetes detection. CONCLUSIONS Strategies for addressing diabetes risk and improving detection require geographical targeting. PMID:25352654

  15. Exploiting Habitat and Gear Patterns for Efficient Detection of Rare and Non-native Benthos and Fish in Great Lakes Coastal ecosystems

    EPA Science Inventory

    There is at present no comprehensive early-detection monitoring for exotic species in the Great Lakes, despite their continued arrival and impacts and recognition that early detection is key to effective management. We evaluated strategies for efficient early-detection monitorin...

  16. Improvements in Boron Plate Coating Technology for Higher Efficiency Neutron Detection and Coincidence Counting Error Reduction

    SciTech Connect

    Menlove, Howard Olsen; Henzlova, Daniela

    2016-08-25

    This informal report presents the measurement data and information to document the performance of the advanced Precision Data Technology, Inc. (PDT) sealed cell boron-10 plate neutron detector that makes use of the advanced coating materials and procedures. In 2015, PDT changed the boron coating materials and application procedures to significantly increase the efficiency of their basic corrugated plate detector performance. A prototype sealed cell unit was supplied to LANL for testing and comparison with prior detector cells. Also, LANL had reference detector slabs from the original neutron collar (UNCL) and the new Antech UNCL with the removable 3He tubes. The comparison data is presented in this report.

  17. A new computationally efficient CAD system for pulmonary nodule detection in CT imagery.

    PubMed

    Messay, Temesguen; Hardie, Russell C; Rogers, Steven K

    2010-06-01

    Early detection of lung nodules is extremely important for the diagnosis and clinical management of lung cancer. In this paper, a novel computer aided detection (CAD) system for the detection of pulmonary nodules in thoracic computed tomography (CT) imagery is presented. The paper describes the architecture of the CAD system and assesses its performance on a publicly available database to serve as a benchmark for future research efforts. Training and tuning of all modules in our CAD system is done using a separate and independent dataset provided courtesy of the University of Texas Medical Branch (UTMB). The publicly available testing dataset is that created by the Lung Image Database Consortium (LIDC). The LIDC data used here is comprised of 84 CT scans containing 143 nodules ranging from 3 to 30mm in effective size that are manually segmented at least by one of the four radiologists. The CAD system uses a fully automated lung segmentation algorithm to define the boundaries of the lung regions. It combines intensity thresholding with morphological processing to detect and segment nodule candidates simultaneously. A set of 245 features is computed for each segmented nodule candidate. A sequential forward selection process is used to determine the optimum subset of features for two distinct classifiers, a Fisher Linear Discriminant (FLD) classifier and a quadratic classifier. A performance comparison between the two classifiers is presented, and based on this, the FLD classifier is selected for the CAD system. With an average of 517.5 nodule candidates per case/scan (517.5+/-72.9), the proposed front-end detector/segmentor is able to detect 92.8% of all the nodules in the LIDC/testing dataset (based on merged ground truth). The mean overlap between the nodule regions delineated by three or more radiologists and the ones segmented by the proposed segmentation algorithm is approximately 63%. Overall, with a specificity of 3 false positives (FPs) per case/patient on

  18. The significance of clinical practice guidelines on adult varicocele detection and management

    PubMed Central

    Shridharani, Anand; Owen, Ryan C; Elkelany, Osama O; Kim, Edward D

    2016-01-01

    Varicoceles are the most common correctable etiology of male factor infertility. However, the detection and management of varicoceles have not been standardized. This has led to decades of debate regarding the effect of varicocele on male infertility and subsequently whether repair leads to an improved fertility status. The current body of evidence investigating the role of varicocele and varicocelectomy is weak and conflicting. The stance taken by the AUA and ASRM suggests that there is insufficient outcomes data to support evidenced-based guidelines, citing evidence used to provide current recommendations are generally of a low quality level. On the other hand, the EAU Guidelines give a level 1a of evidence for management of varicoceles that are clinically palpable, associated with subnormal semen analyses and having otherwise unexplained fertility. Besides aiding with clinical varicocele detection and management, clinical practice opinion statements and guidelines aim to direct and strengthen the infrastructure of future studies. We review the current status of opinion statements and guidelines in varicocele and management detection with focus on their application in practice. PMID:26806081

  19. Efficient Induction of Wheat-Agropyron cristatum 6P Translocation Lines and GISH Detection

    PubMed Central

    Song, Liqiang; Jiang, Lili; Han, Haiming; Gao, Ainong; Yang, Xinming; Li, Lihui; Liu, Weihua

    2013-01-01

    The narrow genetic background restricts wheat yield and quality improvement. The wild relatives of wheat are the huge gene pools for wheat improvement and can broaden its genetic basis. Production of wheat-alien translocation lines can transfer alien genes to wheat. So it is important to develop an efficient method to induce wheat-alien chromosome translocation. Agropyroncristatum (P genome) carries many potential genes beneficial to disease resistance, stress tolerance and high yield. Chromosome 6P possesses the desirable genes exhibiting good agronomic traits, such as high grain number per spike, powdery mildew resistance and stress tolerance. In this study, the wheat-A. cristatum disomic addition was used as bridge material to produce wheat-A. cristatum translocation lines induced by 60Co-γirradiation. The results of genomic in situ hybridization showed that 216 plants contained alien chromosome translocation among 571 self-pollinated progenies. The frequency of translocation was 37.83%, much higher than previous reports. Moreover, various alien translocation types were identified. The analysis of M2 showed that 62.5% of intergeneric translocation lines grew normally without losing the translocated chromosomes. The paper reported a high efficient technical method for inducing alien translocation between wheat and Agropyroncristatum. Additionally, these translocation lines will be valuable for not only basic research on genetic balance, interaction and expression of different chromosome segments of wheat and alien species, but also wheat breeding programs to utilize superior agronomic traits and good compensation effect from alien chromosomes. PMID:23874966

  20. Efficient induction of Wheat-agropyron cristatum 6P translocation lines and GISH detection.

    PubMed

    Song, Liqiang; Jiang, Lili; Han, Haiming; Gao, Ainong; Yang, Xinming; Li, Lihui; Liu, Weihua

    2013-01-01

    The narrow genetic background restricts wheat yield and quality improvement. The wild relatives of wheat are the huge gene pools for wheat improvement and can broaden its genetic basis. Production of wheat-alien translocation lines can transfer alien genes to wheat. So it is important to develop an efficient method to induce wheat-alien chromosome translocation. Agropyroncristatum (P genome) carries many potential genes beneficial to disease resistance, stress tolerance and high yield. Chromosome 6P possesses the desirable genes exhibiting good agronomic traits, such as high grain number per spike, powdery mildew resistance and stress tolerance. In this study, the wheat-A. cristatum disomic addition was used as bridge material to produce wheat-A. cristatum translocation lines induced by (60)Co-γirradiation. The results of genomic in situ hybridization showed that 216 plants contained alien chromosome translocation among 571 self-pollinated progenies. The frequency of translocation was 37.83%, much higher than previous reports. Moreover, various alien translocation types were identified. The analysis of M2 showed that 62.5% of intergeneric translocation lines grew normally without losing the translocated chromosomes. The paper reported a high efficient technical method for inducing alien translocation between wheat and Agropyroncristatum. Additionally, these translocation lines will be valuable for not only basic research on genetic balance, interaction and expression of different chromosome segments of wheat and alien species, but also wheat breeding programs to utilize superior agronomic traits and good compensation effect from alien chromosomes.

  1. Energy resolution and efficiency of phonon-mediated kinetic inductance detectors for light detection

    SciTech Connect

    Cardani, L.; Colantoni, I.; Coppolecchia, A.; Cruciani, A.; Vignati, M.; Bellini, F.; Casali, N.; Cosmelli, C.; Di Domizio, S.; Castellano, M. G.; Tomei, C.

    2015-08-31

    The development of sensitive cryogenic light detectors is of primary interest for bolometric experiments searching for rare events like dark matter interactions or neutrino-less double beta decay. Thanks to their good energy resolution and the natural multiplexed read-out, Kinetic Inductance Detectors (KIDs) are particularly suitable for this purpose. To efficiently couple KIDs-based light detectors to the large crystals used by the most advanced bolometric detectors, active surfaces of several cm{sup 2} are needed. For this reason, we are developing phonon-mediated detectors. In this paper, we present the results obtained with a prototype consisting of four 40 nm thick aluminum resonators patterned on a 2 × 2 cm{sup 2} silicon chip, and calibrated with optical pulses and X-rays. The detector features a noise resolution σ{sub E} = 154 ± 7 eV and an (18 ± 2)% efficiency.

  2. Biological marks of early-life socioeconomic experience is detected in the adult inflammatory transcriptome

    PubMed Central

    Castagné, Raphaële; Kelly-Irving, Michelle; Campanella, Gianluca; Guida, Florence; Krogh, Vittorio; Palli, Domenico; Panico, Salvatore; Sacerdote, Carlotta; Tumino, Rosario; Kleinjans, Jos; de Kok, Theo; Kyrtopoulos, Soterios A.; Lang, Thierry; Stringhini, Silvia; Vermeulen, Roel; Vineis, Paolo; Delpierre, Cyrille; Chadeau-Hyam, Marc

    2016-01-01

    Consistent evidence is accumulating to link lower socioeconomic position (SEP) and poorer health, and the inflammatory system stands out as a potential pathway through which socioeconomic environment is biologically embedded. Using bloodderived genome-wide transcriptional profiles from 268 Italian participants of the European Prospective Investigation into Cancer and Nutrition (EPIC) cohort, we evaluated the association between early life, young and later adulthood SEP and the expression of 845 genes involved in human inflammatory responses. These were examined individually and jointly using several inflammatory scores. Our results consistently show that participants whose father had a manual (as compared to nonmanual) occupation exhibit, later in life, a higher inflammatory score, hence indicating an overall increased level of expression for the selected inflammatory-related genes. Adopting a life course approach, these associations remained statistically significant upon adjustment for later-in-life socioeconomic experiences. Sensitivity analyses indicated that our findings were not affected by the way the inflammatory score was calculated, and were replicated in an independent study. Our study provides additional evidence that childhood SEP is associated with a sustainable upregulation of the inflammatory transcriptome, independently of subsequent socioeconomic experiences. Our results support the hypothesis that early social inequalities impacts adult physiology. PMID:27934951

  3. Detecting Superior Face Recognition Skills in a Large Sample of Young British Adults

    PubMed Central

    Bobak, Anna K.; Pampoulov, Philip; Bate, Sarah

    2016-01-01

    The Cambridge Face Memory Test Long Form (CFMT+) and Cambridge Face Perception Test (CFPT) are typically used to assess the face processing ability of individuals who believe they have superior face recognition skills. Previous large-scale studies have presented norms for the CFPT but not the CFMT+. However, previous research has also highlighted the necessity for establishing country-specific norms for these tests, indicating that norming data is required for both tests using young British adults. The current study addressed this issue in 254 British participants. In addition to providing the first norm for performance on the CFMT+ in any large sample, we also report the first UK specific cut-off for superior face recognition on the CFPT. Further analyses identified a small advantage for females on both tests, and only small associations between objective face recognition skills and self-report measures. A secondary aim of the study was to examine the relationship between trait or social anxiety and face processing ability, and no associations were noted. The implications of these findings for the classification of super-recognizers are discussed. PMID:27713706

  4. A power-efficient analog integrated circuit for amplification and detection of neural signals.

    PubMed

    Borghi, T; Bonfanti, A; Gusmeroli, R; Zambra, G; Spinelli, A S

    2008-01-01

    We present a neural amplifier that optimizes the trade-off between power consumption and noise performance down to the best so far reported. In the perspective of realizing a fully autonomous implantable system we also address the problem of spike detection by using a new simple algorithm and we discuss the implementation with analog integrated circuits. Implemented in 0.35-microm CMOS technology and with total current consumption of about 20 microA, the whole circuit occupies an area of 0.18 mm(2). Reduced power consumption and small area make it suited to be used in chronic multichannel recording systems for neural prosthetics and neuroscience experiments.

  5. New concept using Passive Infrared (PIR) technology for a contactless detection of breathing movement: a pilot study involving a cohort of 169 adult patients.

    PubMed

    Hers, V; Corbugy, D; Joslet, I; Hermant, P; Demarteau, J; Delhougne, B; Vandermoten, G; Hermanne, J P

    2013-10-01

    A pilot study has been conducted to validate the Breath Motion Detecting System (BMDS), a new concept using Passive Infrared (PIR) technology for a contactless detection of respiratory movements. The primary objective of the study was to show if movements detected during sleep by the BMDS were indeed related to breathing. This medical device is not intended to measure the respiratory rate, but in a second step, it will be able to detect pathological central apnea in adults. One hundred and sixty-nine adult patients underwent a full polysomnography in which each respiratory movement was recorded concomitantly through the BMDS. Curves obtained by the BMDS were compared to those of thoracic movements recorded by classical piezoelectric belts and of pressure obtained with nasal cannula. The correlations between the PIR sensors were highly indicative of respiratory movement detection. Since PIR sensors are sensitive only to the exemplification of the rib cage, they did not detect obstructive apnea. Unfortunately, only a few patients in the studied population had a central apnea. Moreover as our sleep laboratory was equipped only with piezoelectric bands, the central apnea respiratory effort data are not a validated signal to be used during sleep recordings. The data recorded by the BMDS demonstrate the ability of the PIR technology to detect respiratory movements in adults. The concept is practical, inexpensive and safe for the patient. Further studies with respiratory inductive plethysmography are needed to investigate the potential of BMDS to detect central apneas.

  6. Efficient live face detection to counter spoof attack in face recognition systems

    NASA Astrophysics Data System (ADS)

    Biswas, Bikram Kumar; Alam, Mohammad S.

    2015-03-01

    Face recognition is a critical tool used in almost all major biometrics based security systems. But recognition, authentication and liveness detection of the face of an actual user is a major challenge because an imposter or a non-live face of the actual user can be used to spoof the security system. In this research, a robust technique is proposed which detects liveness of faces in order to counter spoof attacks. The proposed technique uses a three-dimensional (3D) fast Fourier transform to compare spectral energies of a live face and a fake face in a mathematically selective manner. The mathematical model involves evaluation of energies of selective high frequency bands of average power spectra of both live and non-live faces. It also carries out proper recognition and authentication of the face of the actual user using the fringe-adjusted joint transform correlation technique, which has been found to yield the highest correlation output for a match. Experimental tests show that the proposed technique yields excellent results for identifying live faces.

  7. Design of a polarization-insensitive superconducting nanowire single photon detector with high detection efficiency

    PubMed Central

    Zheng, Fan; Xu, Ruiying; Zhu, Guanghao; Jin, Biaobing; Kang, Lin; Xu, Weiwei; Chen, Jian; Wu, Peiheng

    2016-01-01

    Superconducting nanowire single photon detectors (SNSPDs) deliver superior performance over their competitors in the near-infrared regime. However, these detectors have an intrinsic polarization dependence on the incident wave because of their one-dimensional meander structure. In this paper, we propose an approach to eliminate the polarization sensitivity of SNSPDs by using near-field optics to increase the absorption of SNSPDs under transverse magnetic (TM) illumination. In addition, an optical cavity is added to our SNSPD to obtain nearly perfect absorption of the incident wave. Numerical simulations show that the maximum absorption of a designed SNSPD can reach 96% at 1550 nm, and indicate that the absorption difference between transverse electric (TE) and TM polarization is less than 0.5% across a wavelength window of 300 nm. Our work provides the first demonstration of the possibility of designing a polarization-insensitive and highly efficient SNSPD without performing device symmetry improvements. PMID:26948672

  8. A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

    SciTech Connect

    Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko; Ishikawa, Osamu; Motegi, Sei-ichiro

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primers from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.

  9. Efficient detection of unpaired DNA requires a member of the rad54-like family of homologous recombination proteins.

    PubMed

    Samarajeewa, Dilini A; Sauls, Pegan A; Sharp, Kevin J; Smith, Zachary J; Xiao, Hua; Groskreutz, Katie M; Malone, Tyler L; Boone, Erin C; Edwards, Kevin A; Shiu, Patrick K T; Larson, Erik D; Hammond, Thomas M

    2014-11-01

    Meiotic silencing by unpaired DNA (MSUD) is a process that detects unpaired regions between homologous chromosomes and silences them for the duration of sexual development. While the phenomenon of MSUD is well recognized, the process that detects unpaired DNA is poorly understood. In this report, we provide two lines of evidence linking unpaired DNA detection to a physical search for DNA homology. First, we have found that a putative SNF2-family protein (SAD-6) is required for efficient MSUD in Neurospora crassa. SAD-6 is closely related to Rad54, a protein known to facilitate key steps in the repair of double-strand breaks by homologous recombination. Second, we have successfully masked unpaired DNA by placing identical transgenes at slightly different locations on homologous chromosomes. This masking falls apart when the distance between the transgenes is increased. We propose a model where unpaired DNA detection during MSUD is achieved through a spatially constrained search for DNA homology. The identity of SAD-6 as a Rad54 paralog suggests that this process may be similar to the searching mechanism used during homologous recombination.

  10. A simple and efficient design to improve the detection of biotin-streptavidin interaction with plasmonic nanobiosensors.

    PubMed

    Focsan, Monica; Campu, Andreea; Craciun, Ana-Maria; Potara, Monica; Leordean, Cosmin; Maniu, Dana; Astilean, Simion

    2016-12-15

    In this manuscript we propose a simple and efficient strategy to improve the sensitivity of localized surface plasmon resonance (LSPR) shift-based biosensors using biotin-streptavidin recognition interaction as a proof-of-concept. Specifically, biotin molecules are immobilized on a low-cost plasmonic LSPR biosensor based on annealed self-assembled spherical gold nanoparticles (AuNSs) and successively incubated with increasing concentrations of streptavidin, achieving a limit of detection (LOD) of 5nM. Interestingly, when the detection is performed by the same biotin-functionalized plasmonic AuNSs substrate but against streptavidin previously conjugated to gold nanorods, the LSPR shift is 26-fold enhanced. Moreover, we confirm these results through numerical simulations and demonstrate that the proposed sensing architecture can operate as transducer not only to confirm the adsorption of bioanalyte but also to provide the chemical identity of the capture and targeted molecules from their vibrational Raman fingerprints. Therefore, we are confident that the development of such plasmonic biosensors that use metallic labels for improving the sensitivity of detection could become highly promising for future point-of-care diagnostic assays, pushing sensitivity towards single-molecule detection limit.

  11. Efficient Two-Photon Fluorescent Probe for Nitroreductase Detection and Hypoxia Imaging in Tumor Cells and Tissues.

    PubMed

    Zhang, Jing; Liu, Hong-Wen; Hu, Xiao-Xiao; Li, Jin; Liang, Li-Hui; Zhang, Xiao-Bing; Tan, Weihong

    2015-12-01

    Hypoxia plays an important role in tumor progression, and the development of efficient methods for monitoring hypoxic degree in living systems is of great biomedical importance. In the solid tumors, the nitroreductase level is directly corresponded with the hypoxic status. Many one-photon excited fluorescent probes have been developed for hypoxia imaging in tumor cells via the detection of nitroreductase level. However, two-photon excited probes are more suitable for bioimaging. In this work, a two-photon probe 1 for nitroreductase detection and hypoxic status monitoring in living tumor cells and tissues was reported for the first time. The detection is based on the fact that the nitro-group of probe 1 could be selectively reduced to an amino-group by nitroreductase in the presence of reduced NADH, following by a 1,6-rearrangement-elimination to release the fluorophore, resulting in the enhancement of fluorescence. The probe exhibited both one-photon and two-photon excited remarkable fluorescence enhancement (∼70-fold) for nitroreductase, which afforded a high sensitivity for nitroreductase, with a detection limit of 20 ng/mL observed. Moreover, the applications of the probe for fluorescent bioimaging of hypoxia in living cells and two-photon bioimaging in tissues were carried out, with tissue-imaging depths of 70-160 μm observed, which demonstrates its practical application in complex biosystems.

  12. Analysis of renal diseases detected in renal biopsies of adult patients: A single-center experience.

    PubMed

    Imtiaz, Salman; Drohlia, Murtaza F; Nasir, Kiran; Salman, Beena; Ahmad, Aasim

    2017-01-01

    Renal biopsy is crucial while evaluating for the diagnosis of glomerular, vascular, tubulointerstitial, and genetic diseases. It gives vital information which helps in estimating the disease prognosis, progression, and management. This is the retrospective analysis of all adult patients aged above 18 years, who underwent percutaneous renal biopsy at The Kidney Center Post Graduate Training Institute, Karachi, over a duration of 18 years, i.e., January 1, 1996, to December 2013. Renal graft biopsies and those which were inadequate were excluded from analysis. Of the1962 biopsies performed, we included 1521 biopsies in our assessment. The mean age of the population was 38 ± 15.26 years (range 18-88 years). There were 920 (60.5%) males and 601 (39.5%) females. The most common clinical indication of kidney biopsy was nephrotic syndrome, i.e., 741 (45.7%), followed by chronic kidney disease, 253 (16.6%); acute renal failure, 184; (12.1%) and rapidly progressive glomerulonephritis (GN), 124 (8.2%). Primary GN was found in the majority of the patients, 984 (64.7%), followed by secondary GN in 249 (16.4%), tubulointerstitial disease in 224 (14.7%), and vascular disease in 64 (4.2%). In primary GN, focal segmental glomerulosclerosis was the most common histopathological diagnosis in 297 (19.5%) patients, followed by MGN in 224 (14.7%), chronic GN in 98 (6.4%), crescentic GN in 93 (6.1%), minimal change disease in 87 (5.7%), membranoproliferative glomerulonephritis in 58 (3.8%), and postinfection glomerulonephritis in 53 (3.5%) patients. This study shows that focal segmental glomerulosclerosis is the most common lesion in renal biopsy in the young age group followed by membranous nephropathy. Diabetic nephropathy and chronic interstitial nephritis were dominant secondary pathological lesions in older age group, whereas lupus nephritis was the most common secondary disease in young age females.

  13. Detection of Mycoplasma pneumoniae in the airways of adults with chronic asthma.

    PubMed

    Kraft, M; Cassell, G H; Henson, J E; Watson, H; Williamson, J; Marmion, B P; Gaydos, C A; Martin, R J

    1998-09-01

    Infection with Mycoplasma pneumoniae has been shown to exacerbate asthma in humans. However, the role of M. pneumoniae in the pathogenesis of chronic asthma has not been defined. Eighteen asthmatics with chronic, stable asthma and 11 nonasthmatic control subjects underwent evaluation of the upper and lower airways and serologic analysis to determine the presence of M. pneumoniae, Chlamydia pneumoniae, and seven respiratory viruses through culture, enzyme-linked immunoassay (EIA) and polymerase chain reaction (PCR). M. pneumoniae was detected by PCR in 10 of 18 asthmatics and one of 11 control subjects (p = 0.02). In nine of the 10 patients, the organism was detected in bronchoalveolar lavage or bronchial biopsies. Seven of 18 asthmatics and one of 11 control subjects were also positive for M. fermentans and M. genitalium by PCR. All patients' cultures, EIAs, and serology were negative for M. pneumoniae. All PCR and cultures were negative for C. pneumoniae, and all EIAs for respiratory viruses were negative in all subjects. Nine asthmatics and one control subject exhibited positive serology for C. pneumoniae (p = 0.05). M. pneumoniae was present in the lower airways of chronic, stable asthmatics with greater frequency than control subjects, and may play a role in the pathogenesis of chronic asthma.

  14. Amphiphilic block copolymer-based photonic platform towards efficient protein detection

    NASA Astrophysics Data System (ADS)

    Petropoulou, Afroditi; Gibson, Thomas J.; Themistou, Efrosyni; Pispas, Stergios; Riziotis, Christos

    2016-11-01

    The development of a low complexity fiber optic based protein sensor by functionalizing the surface of silica optical fibers using block copolymers having both hydrophobic poly(methyl methacrylate) (PMMA) and hydrophilic poly[2- (dimethylamino)ethyl methacrylate] (PDMAEMA) blocks is presented here. The amphiphilic thiol-functionalized PMMA117-b-P(DMAEMA17-st-TEMA2) and vinyl-sulfone PMMA117-b-P(DMAEMA17-st-VSTEMA2) block copolymers designed and synthesized in this work contain a cationic hydrophilic PDMAEMA block that can electrostatically bind selected oppositely charged proteins and also appropriate functional groups for reversible or non-reversible protein binding, respectively, leading to a refractive index change of the overlayer and hence, enabling the sensing. The developed PMMA117-b-PDMAEMA16-based platform has been evaluated for bovine serum albumin (BSA) sensing, exhibiting linear response to detected BSA concentrations.

  15. Suggestions for improving the efficiency of ground-based neutron monitors for detecting solar neutrons

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    On the occasion of the June 3, 1982 intense gamma-ray solar flare a significant increase in counting rate due to solar neutrons was observed by the neutron monitors of Junsfraujoch and Lomnicky Stit located at middle latitudes and high altitudes. In spite of a larger detector employed and of the smaller solar zenith angle, the amplitude of the same event observed at Rome was much smaller and the statistical fluctuations of the salactic cosmic ray background higher than the ones registered at the two mountain stations, because of the greater atmospheric depth at which the Rome monitor is located. The effeciency for detecting a solar neutron event by a NM-64 monitor as a function of the Sun zenith angle, atmospheric depth and threshold rigidity of the station was studied.

  16. Copper nanowire coated carbon fibers as efficient substrates for detecting designer drugs using SERS.

    PubMed

    Halouzka, Vladimir; Halouzkova, Barbora; Jirovsky, David; Hemzal, Dusan; Ondra, Peter; Siranidi, Eirini; Kontos, Athanassios G; Falaras, Polycarpos; Hrbac, Jan

    2017-04-01

    Miniature Surface Enhanced Raman Scattering (SERS) sensors were fabricated by coating the carbon fiber microelectrodes with copper nanowires. The coating procedure, based on anodizing the copper wire in ultrapure water followed by cathodic deposition of the anode-derived material onto carbon fiber electrodes, provides a "clean" copper nanowire network. The developed miniature (10µm in diameter and 2mm in length) and nanoscopically rough SERS substrates are applicable in drug sensing, as shown by the detection and resolving of a range of seized designer drugs in trace amounts (microliter volumes of 10(-10)-10(-12)M solutions). The copper nanowire modified carbon microfiber substrates could also find further applications in biomedical and environmental sensing.

  17. Water-soluble Hantzsch ester as switch-on fluorescent probe for efficiently detecting nitric oxide

    NASA Astrophysics Data System (ADS)

    Wang, Hui-Li; Liu, Fu-Tao; Ding, Ai-Xiang; Ma, Su-Fang; He, Lan; Lin, Lan; Lu, Zhong-Lin

    2016-12-01

    A water soluble Hantzsch ester derivative of coumarin, DHPS, was synthesized and successfully applied in the fluorescent sensing nitric oxide (NO) in aqueous solution. The fluorescence of probe DHPS is extremely weak, while its fluorescence was greatly switched on upon the addition of NO solution and showed high selectivity and sensitivity to NO. The limitation of the detection was calculated to be 18 nM. The NO-induced aromatization of dihydropyridine in DHPS to pyridine derivative (PYS) proved to be the switching mechanism for the fluorescent sensing process, which was confirmed through spectra characterization and computation study. Cytotoxicity assay demonstrated both DHPS and PYS are biocompatible, the DHPS was successfully applied to track the endogenously produced NO in the RAW 264.7 cells.

  18. A robust fringe-adjusted joint transform correlator for efficient object detection

    NASA Astrophysics Data System (ADS)

    Sidike, Paheding; Asari, Vijayan K.; Alam, Mohammad S.

    2015-03-01

    The fringe-adjusted joint transform correlation (FJTC) technique has been widely used for real-time optical pattern recognition applications. However, the classical FJTC technique suffers from target distortions due to noise, scale, rotation and illumination variations of the targets in input scenes. Several improvements of the FJTC have been proposed in the literature to accommodate these problems. Some popular techniques such as synthetic discriminant function (SDF) based FJTC was designed to alleviate the problems of scale and rotation variations of the target, whereas wavelet based FJTC has been found to yield better performance for noisy targets in the input scenes. While these techniques integrated with specific features to improve performance of the FJTC, a unified and synergistic approach to equip the FJTC with robust features is yet to be done. Thus, in this paper, a robust FJTC technique based on sequential filtering approach is proposed. The proposed method is developed in such a way that it is insensitive to rotation, scale, noise and illumination variations of the targets. Specifically, local phase (LP) features from monogenic signal is utilized to reduce the effect of background illumination thereby achieving illumination invariance. The SDF is implemented to achieve rotation and scale invariance, whereas the logarithmic fringe-adjusted filter (LFAF) is employed to reduce the noise effect. The proposed technique can be used as a real-time region-of-interest detector in wide-area surveillance for automatic object detection. The feasibility of the proposed technique has been tested on aerial imagery and has observed promising performance in detection accuracy.

  19. Efficiency of different enrichment and isolation procedures for the detection of Salmonella serotypes in edible offal.

    PubMed

    Arroyo, G; Arroyo, J A

    1995-10-01

    Rapid detection systems for Salmonella in foodstuffs are currently being developed. However, existing standards still call for application of traditional methods employing pre-enrichment followed by selective enrichment and isolation. The efficacy of various methods was tested using 264 chicken and lamb organ meats. Pre-enrichment was carried out in Tryptone Soy Broth (TSB) and enrichment in Tetrathionate Brilliant Green Broth (TTB) at 37 degrees C, Selenite Broth with Brilliant Green and Sulphapyridine at 37 degrees C and 43 degrees C, and Rappaport-Vassiliadis Broth (RV 10) at 42 degrees C. The isolation media were Brilliant Green Agar (BGA), Deoxycholate Citrate Agar, Hektoen Enteric Agar (HEA) and Salmonella-Shigella Agar. Enrichment in RV/42 degrees C followed by isolation on BGA as recommended by ISO standard no. 6579 and enrichment in TTB/37 degrees C followed by isolation in HEA, no longer recommended by that standard, produced the best results. Low percentages of positive samples and difficulties in detecting Salmonella are the result of interference by competing organisms (Enterobacteriaceae) and the number of salmonellas present after enrichment. A total of 528 samples (TSB, eggs, lamb liver and chicken liver) were inoculated with Salm. enteritidis, Salm. kapemba and Salm. virchow, and the preceding experiment was repeated. All the TSB and egg samples tested positive, but the percentage of positive samples from the lamb and chicken liver was only 81-92%. Recovery of the salmonellas did not depend upon the method employed or the serotype inoculated but instead on interference by competing flora and the numbers of Salmonella present in the samples.

  20. Multiwavelength time-resolved detection of fluorescence during the inflow of indocyanine green into the adult's brain

    NASA Astrophysics Data System (ADS)

    Gerega, Anna; Milej, Daniel; Weigl, Wojciech; Botwicz, Marcin; Zolek, Norbert; Kacprzak, Michal; Wierzejski, Wojciech; Toczylowska, Beata; Mayzner-Zawadzka, Ewa; Maniewski, Roman; Liebert, Adam

    2012-08-01

    Optical technique based on diffuse reflectance measurement combined with indocyanine green (ICG) bolus tracking is extensively tested as a method for clinical assessment of brain perfusion in adults at the bedside. Methodology of multiwavelength and time-resolved detection of fluorescence light excited in the ICG is presented and advantages of measurements at multiple wavelengths are discussed. Measurements were carried out: 1. on a physical homogeneous phantom to study the concentration dependence of the fluorescence signal, 2. on the phantom to simulate the dynamic inflow of ICG at different depths, and 3. in vivo on surface of the human head. Pattern of inflow and washout of ICG in the head of healthy volunteers after intravenous injection of the dye was observed for the first time with time-resolved instrumentation at multiple emission wavelengths. The multiwavelength detection of fluorescence signal confirms that at longer emission wavelengths, probability of reabsorption of the fluorescence light by the dye itself is reduced. Considering different light penetration depths at different wavelengths, and the pronounced reabsorption at longer wavelengths, the time-resolved multiwavelength technique may be useful in signal decomposition, leading to evaluation of extra- and intracerebral components of the measured signals.

  1. Detection of HTLV-1 by polymerase chain reaction in situ hybridization in adult T-cell leukemia/lymphoma.

    PubMed

    Setoyama, M; Kerdel, F A; Elgart, G; Kanzaki, T; Byrnes, J J

    1998-03-01

    A method for nonradioactive polymerase chain reaction in situ hybridization was developed and used to determine the distribution of human T-lymphotropic virus type I (HTLV-I) proviral DNA in paraffin-embedded surgical specimens of adult T-cell leukemia/lymphoma (ATLL). As controls, we used biopsy samples of five cases of mycosis fungoides, cells of an HTLV-I-infected cell line (MT2), as well as HTLV-1-negative cells (YAS). We successfully detected the amplicon of the HTLV-1 tax sequence in the nuclei of the cutaneous infiltrating lymphoid cells in 90% (9/10) of ATLL cases. Studies also revealed the existence of HTLV-1 provirus DNA in nuclei of sweat gland epithelial cells and vascular endothelial cells as well as lymphoid cells in ATLL patients. Mycosis fungoides and YAS cells were negative for the HTLV-I tax sequence, but MT2 cells were strongly positive. The results indicated that this technique was more sensitive in detecting intracellular amplicons than was the previous in situ hybridization method. Through its use, we were able to easily determine the distribution of HTLV-I-positive cells among the various cells and tissues of paraffin-embedded archival materials.

  2. Multiwavelength time-resolved detection of fluorescence during the inflow of indocyanine green into the adult's brain.

    PubMed

    Gerega, Anna; Milej, Daniel; Weigl, Wojciech; Botwicz, Marcin; Zolek, Norbert; Kacprzak, Michal; Wierzejski, Wojciech; Toczylowska, Beata; Mayzner-Zawadzka, Ewa; Maniewski, Roman; Liebert, Adam

    2012-08-01

    Optical technique based on diffuse reflectance measurement combined with indocyanine green (ICG) bolus tracking is extensively tested as a method for clinical assessment of brain perfusion in adults at the bedside. Methodology of multiwavelength and time-resolved detection of fluorescence light excited in the ICG is presented and advantages of measurements at multiple wavelengths are discussed. Measurements were carried out: 1. on a physical homogeneous phantom to study the concentration dependence of the fluorescence signal, 2. on the phantom to simulate the dynamic inflow of ICG at different depths, and 3. in vivo on surface of the human head. Pattern of inflow and washout of ICG in the head of healthy volunteers after intravenous injection of the dye was observed for the first time with time-resolved instrumentation at multiple emission wavelengths. The multiwavelength detection of fluorescence signal confirms that at longer emission wavelengths, probability of reabsorption of the fluorescence light by the dye itself is reduced. Considering different light penetration depths at different wavelengths, and the pronounced reabsorption at longer wavelengths, the time-resolved multiwavelength technique may be useful in signal decomposition, leading to evaluation of extra- and intracerebral components of the measured signals.

  3. Avoiding incidental predation by mammalian herbivores: accurate detection and efficient response in aphids.

    PubMed

    Gish, Moshe; Dafni, Amots; Inbar, Moshe

    2011-09-01

    Mammalian herbivores eat plants that may also provide food and shelter for insects. The direct trophic effect of the browsing and grazing of mammalian herbivory on insects, which is probably prevalent in terrestrial ecosystems, has been mostly neglected by ecologists. We examined how the aphid Uroleucon sonchi L. deals with the danger of incidental predation by mammalian herbivores. We found that most (76%) of the aphids in a colony survive the ingestion of the plant by a feeding herbivore. They do so by sensing the combination of heat and humidity in the herbivore's breath and immediately dropping off the plant in large numbers. Their ability to sense the herbivore's breath or their tendency to drop off the plant weakens as ambient temperature rises. This could indicate a limitation of the aphids' sensory system or an adaptation that enables them to avoid the hostile conditions on a hot ground. Once on the ground, U. sonchi is highly mobile and capable of locating a new host plant by advancing in a pattern that differs significantly from random movement. The accurate and efficient defense mechanism of U. sonchi emphasizes the significance of incidental predation as a danger to plant-dwelling invertebrates.

  4. Efficient automatic classifiers for the detection of A phases of the cyclic alternating pattern in sleep.

    PubMed

    Mariani, Sara; Manfredini, Elena; Rosso, Valentina; Grassi, Andrea; Mendez, Martin O; Alba, Alfonso; Matteucci, Matteo; Parrino, Liborio; Terzano, Mario G; Cerutti, Sergio; Bianchi, Anna M

    2012-04-01

    This study aims to develop an automatic detector of the A phases of the cyclic alternating pattern, periodic activity that generally occurs during non-REM (NREM) sleep. Eight polysomnographic recordings from healthy subjects were examined. From EEG recordings, five band descriptors, an activity descriptor and a variance descriptor were extracted and used to train different machine-learning algorithms. A visual scoring provided by an expert clinician was used as golden standard. Four alternative mathematical machine-learning techniques were implemented: (1) discriminant classifier, (2) support vector machines, (3) adaptive boosting, and (4) supervised artificial neural network. The results of the classification, compared with the visual analysis, showed average accuracies equal to 84.9 and 81.5% for the linear discriminant and the neural network, respectively, while AdaBoost had a slightly lower accuracy, equal to 79.4%. The SVM leads to accuracy of 81.9%. The performance achieved by the automatic classification is encouraging, since an efficient automatic classifier would benefit the practice in everyday clinics, preventing the physician from the time-consuming activity of the visually scoring of the sleep microstructure over whole 8-h sleep recordings. Finally, the classification based on learning algorithms would provide an objective criterion, overcoming the problems of inter-scorer disagreement.

  5. Avoiding incidental predation by mammalian herbivores: accurate detection and efficient response in aphids

    NASA Astrophysics Data System (ADS)

    Gish, Moshe; Dafni, Amots; Inbar, Moshe

    2011-09-01

    Mammalian herbivores eat plants that may also provide food and shelter for insects. The direct trophic effect of the browsing and grazing of mammalian herbivory on insects, which is probably prevalent in terrestrial ecosystems, has been mostly neglected by ecologists. We examined how the aphid Uroleucon sonchi L. deals with the danger of incidental predation by mammalian herbivores. We found that most (76%) of the aphids in a colony survive the ingestion of the plant by a feeding herbivore. They do so by sensing the combination of heat and humidity in the herbivore's breath and immediately dropping off the plant in large numbers. Their ability to sense the herbivore's breath or their tendency to drop off the plant weakens as ambient temperature rises. This could indicate a limitation of the aphids' sensory system or an adaptation that enables them to avoid the hostile conditions on a hot ground. Once on the ground, U. sonchi is highly mobile and capable of locating a new host plant by advancing in a pattern that differs significantly from random movement. The accurate and efficient defense mechanism of U. sonchi emphasizes the significance of incidental predation as a danger to plant-dwelling invertebrates.

  6. Reduced representation of protein structure: implications on efficiency and scope of detection of structural similarity

    PubMed Central

    2010-01-01

    Background Computational comparison of two protein structures is the starting point of many methods that build on existing knowledge, such as structure modeling (including modeling of protein complexes and conformational changes), molecular replacement, or annotation by structural similarity. In a commonly used strategy, significant effort is invested in matching two sets of atoms. In a complementary approach, a global descriptor is assigned to the overall structure, thus losing track of the substructures within. Results Using a small set of geometric features, we define a reduced representation of protein structure, together with an optimizing function for matching two representations, to provide a pre-filtering stage in a database search. We show that, in a straightforward implementation, the representation performs well in terms of resolution in the space of protein structures, and its ability to make new predictions. Conclusions Perhaps unexpectedly, a substantial discriminating power already exists at the level of main features of protein structure, such as directions of secondary structural elements, possibly constrained by their sequential order. This can be used toward efficient comparison of protein (sub)structures, allowing for various degrees of conformational flexibility within the compared pair, which in turn can be used for modeling by homology of protein structure and dynamics. PMID:20338066

  7. A highly efficient urea detection using flower-like zinc oxide nanostructures.

    PubMed

    Tak, Manvi; Gupta, Vinay; Tomar, Monika

    2015-12-01

    A novel matrix based on flower-like zinc oxide nanostructures (ZnONF) has been fabricated using hydrothermal method and exploited successfully for the development of urea biosensor. Urease (Urs) is physically immobilized onto the ZnO nanostructure matrix synthesized over platinized silicon substrate. The surface morphology and crystallographic structure of the as-grown ZnONF have been characterized using a scanning electron microscope (SEM) and X-ray diffraction (XRD) techniques. The fabricated amperometric biosensor (Urs/ZnONF/Pt/Ti/Si) exhibits a linear sensing response towards urea over the concentration range 1.65 mM to 16.50mM with an enhanced sensitivity (~132 μA/mM/cm(2)) and a fast response time of 4s. The relatively low value of Michaelis-Menten constant (Km) of 0.19 mM confirms the high affinity of the immobilized urease on the nanostructured ZnONF surface towards its analyte (urea). The obtained results demonstrate that flower-like ZnO nanostructures serve as a promising matrix for the realization of efficient amperometric urea biosensor with enhanced response characteristics.

  8. TWO EFFICIENT, NEW TECHNIQUES FOR DETECTING DISPERSED RADIO PULSES WITH INTERFEROMETERS: THE CHIRPOLATOR AND THE CHIMAGEATOR

    SciTech Connect

    Bannister, K. W.; Cornwell, T. J.

    2011-10-01

    Searching for dispersed radio pulses in interferometric data is of great scientific interest, but poses a formidable computational burden. Here, we present two efficient, new antenna-coherent solutions: The Chirpolator and The Chimageator. We describe the equations governing both techniques and propose a number of novel optimizations. We compare the implementation costs of our techniques with classical methods using three criteria: the operation rates (1) before and (2) after the integrate-and-dump stage, and (3) the data rate directly after the integrate-and-dump stage. When compared with classical methods, our techniques excel in the regime of sparse arrays, where they both require substantially lower data rates, and The Chirpolator requires a much lower post-integrator operation rate. In general, our techniques require more pre-integrator operations than the classical ones. We argue that the data and operation rates required by our techniques are better matched to future supercomputer architectures, where the arithmetic capability is outstripping the bandwidth capability. Our techniques are, therefore, viable candidates for deploying on future interferometers such as the Square Kilometer Array.

  9. Joint aperture detection for speckle reduction and increased collection efficiency in ophthalmic MHz OCT

    PubMed Central

    Klein, Thomas; André, Raphael; Wieser, Wolfgang; Pfeiffer, Tom; Huber, Robert

    2013-01-01

    Joint-aperture optical coherence tomography (JA-OCT) is an angle-resolved OCT method, in which illumination from an active channel is simultaneously probed by several passive channels. JA-OCT increases the collection efficiency and effective sensitivity of the OCT system without increasing the power on the sample. Additionally, JA-OCT provides angular scattering information about the sample in a single acquisition, so the OCT imaging speed is not reduced. Thus, JA-OCT is especially suitable for ultra high speed in-vivo imaging. JA-OCT is compared to other angle-resolved techniques, and the relation between joint aperture imaging, adaptive optics, coherent and incoherent compounding is discussed. We present angle-resolved imaging of the human retina at an axial scan rate of 1.68 MHz, and demonstrate the benefits of JA-OCT: Speckle reduction, signal increase and suppression of specular and parasitic reflections. Moreover, in the future JA-OCT may allow for the reconstruction of the full Doppler vector and tissue discrimination by analysis of the angular scattering dependence. PMID:23577296

  10. Detective quantum efficiency measured as a function of energy for two full-field digital mammography systems.

    PubMed

    Marshall, N W

    2009-05-07

    This paper presents detective quantum efficiency (DQE) data measured for a range of x-ray beam qualities for two full-field digital mammography (FFDM) systems: a caesium iodide (CsI) detector-based unit and a system designed around an amorphous selenium (a-Se) x-ray detector. Four beam qualities were studied for each system, covering mean energies from 17.8 keV to 23.4 keV for the CsI system and 17.8 keV to 24.7 keV for the a-Se unit. These were set using 2, 4, 6 and 7 cm polymethylmethacralate (PMMA) and typical tube voltage and target/filter combinations selected by the automatic exposure control (AEC) program used clinically on these systems. Normalized noise power spectra (NNPS) were calculated from flood images acquired at these beam qualities for a target detector air kerma of 100 microGy. Modulation transfer function (MTF) data were acquired at 28 kV and Mo/Mo target/filter setting. The DQE was then calculated from the MTF and NNPS results. For comparison, the quantum detective efficiency (QDE) and energy absorption efficiency (EAE) were calculated from tabulated narrow beam spectral data. With regard to detector response, some energy dependence was noted for pixel value plotted against air kerma at the detector. This amounted to a change in the gradient of the detector response of approximately 15% and 30% per keV for the CsI- and a-Se-based systems, respectively. For the DQE results, a reduction in DQE(0) of 22% was found for the CsI-based unit as beam quality changed from 25 kV Mo/Mo and 2 cm PMMA to 32 kV Rh/Rh and 7 cm PMMA. For the a-Se system, a change in beam quality from 25 kV Mo/Mo and 2 cm PMMA to 34 kV Mo/Rh and 7 cm PMMA led to a reduction in DQE(0) of 8%. Comparing measured data with simple calculations, a reduction in x-ray quantum detection efficiency of 27% was expected for the CsI-based system, while a reduction of 11% was predicted for the a-Se system.

  11. Detective quantum efficiency measured as a function of energy for two full-field digital mammography systems

    NASA Astrophysics Data System (ADS)

    Marshall, N. W.

    2009-05-01

    This paper presents detective quantum efficiency (DQE) data measured for a range of x-ray beam qualities for two full-field digital mammography (FFDM) systems: a caesium iodide (CsI) detector-based unit and a system designed around an amorphous selenium (a-Se) x-ray detector. Four beam qualities were studied for each system, covering mean energies from 17.8 keV to 23.4 keV for the CsI system and 17.8 keV to 24.7 keV for the a-Se unit. These were set using 2, 4, 6 and 7 cm polymethylmethacralate (PMMA) and typical tube voltage and target/filter combinations selected by the automatic exposure control (AEC) program used clinically on these systems. Normalized noise power spectra (NNPS) were calculated from flood images acquired at these beam qualities for a target detector air kerma of 100 µGy. Modulation transfer function (MTF) data were acquired at 28 kV and Mo/Mo target/filter setting. The DQE was then calculated from the MTF and NNPS results. For comparison, the quantum detective efficiency (QDE) and energy absorption efficiency (EAE) were calculated from tabulated narrow beam spectral data. With regard to detector response, some energy dependence was noted for pixel value plotted against air kerma at the detector. This amounted to a change in the gradient of the detector response of approximately 15% and 30% per keV for the CsI- and a-Se-based systems, respectively. For the DQE results, a reduction in DQE(0) of 22% was found for the CsI-based unit as beam quality changed from 25 kV Mo/Mo and 2 cm PMMA to 32 kV Rh/Rh and 7 cm PMMA. For the a-Se system, a change in beam quality from 25 kV Mo/Mo and 2 cm PMMA to 34 kV Mo/Rh and 7 cm PMMA led to a reduction in DQE(0) of 8%. Comparing measured data with simple calculations, a reduction in x-ray quantum detection efficiency of 27% was expected for the CsI-based system, while a reduction of 11% was predicted for the a-Se system.

  12. Change Detection in Naturalistic Pictures among Children with Autism

    ERIC Educational Resources Information Center

    Burack, Jacob A.; Joseph, Shari; Russo, Natalie; Shore, David I.; Porporino, Mafalda; Enns, James T.

    2009-01-01

    Persons with autism often show strong reactions to changes in the environment, suggesting that they may detect changes more efficiently than typically developing (TD) persons. However, Fletcher-Watson et al. (Br J Psychol 97:537-554, 2006) reported no differences between adults with autism and TD adults with a change-detection task. In this study,…

  13. Visual and efficient immunosensor technique for advancing biomedical applications of quantum dots on Salmonella detection and isolation

    NASA Astrophysics Data System (ADS)

    Tang, Feng; Pang, Dai-Wen; Chen, Zhi; Shao, Jian-Bo; Xiong, Ling-Hong; Xiang, Yan-Ping; Xiong, Yan; Wu, Kai; Ai, Hong-Wu; Zhang, Hui; Zheng, Xiao-Li; Lv, Jing-Rui; Liu, Wei-Yong; Hu, Hong-Bing; Mei, Hong; Zhang, Zhen; Sun, Hong; Xiang, Yun; Sun, Zi-Yong

    2016-02-01

    It is a great challenge in nanotechnology for fluorescent nanobioprobes to be applied to visually detect and directly isolate pathogens in situ. A novel and visual immunosensor technique for efficient detection and isolation of Salmonella was established here by applying fluorescent nanobioprobes on a specially-designed cellulose-based swab (a solid-phase enrichment system). The selective and chromogenic medium used on this swab can achieve the ultrasensitive amplification of target bacteria and form chromogenic colonies in situ based on a simple biochemical reaction. More importantly, because this swab can serve as an attachment site for the targeted pathogens to immobilize and immunologically capture nanobioprobes, our mAb-conjugated QD bioprobes were successfully applied on the solid-phase enrichment system to capture the fluorescence of targeted colonies under a designed excitation light instrument based on blue light-emitting diodes combined with stereomicroscopy or laser scanning confocal microscopy. Compared with the traditional methods using 4-7 days to isolate Salmonella from the bacterial mixture, this method took only 2 days to do this, and the process of initial screening and preliminary diagnosis can be completed in only one and a half days. Furthermore, the limit of detection can reach as low as 101 cells per mL Salmonella on the background of 105 cells per mL non-Salmonella (Escherichia coli, Proteus mirabilis or Citrobacter freundii, respectively) in experimental samples, and even in human anal ones. The visual and efficient immunosensor technique may be proved to be a favorable alternative for screening and isolating Salmonella in a large number of samples related to public health surveillance.It is a great challenge in nanotechnology for fluorescent nanobioprobes to be applied to visually detect and directly isolate pathogens in situ. A novel and visual immunosensor technique for efficient detection and isolation of Salmonella was established here

  14. Arrays of Ultrathin CdS Nanoflakes with High-Energy Surface for Efficient Gas Detection.

    PubMed

    Liu, Xiao-Hua; Yin, Peng-Fei; Kulinich, Sergei A; Zhou, Yu-Zhu; Mao, Jing; Ling, Tao; Du, Xi-Wen

    2017-01-11

    It is fascinating and challenging to endow conventional materials with unprecedented properties. For instance, cadmium sulfide (CdS) is an important semiconductor with excellent light response; however, its potential in gas-sensing was underestimated owing to relatively low chemical activity and poor electrical conductivity. Herein, we demonstrate that an ideal architecture, ultrathin nanoflake arrays (NFAs), can improve significantly gas-sensing properties of CdS material. The CdS NFAs are grown directly on the interdigitated electrode to expose large surface area. Their thickness is reduced below the double Debye length of CdS, permitting to achieve a full depletion of carriers. Particularly, the prepared CdS nanoflakes are enclosed with high-energy {0001} facets exposed, which provides more active sites for gas adsorption. Moreover, the NFAs exhibit the light-trapping effect, which further enhances their gas sensitivity. As a result, the as-prepared CdS NFAs demonstrate excellent gas-sensing and light-response properties, thus being capable of dual gas and light detection.

  15. Efficient detection of wound-bed and peripheral skin with statistical colour models.

    PubMed

    Veredas, Francisco J; Mesa, Héctor; Morente, Laura

    2015-04-01

    A pressure ulcer is a clinical pathology of localised damage to the skin and underlying tissue caused by pressure, shear or friction. Reliable diagnosis supported by precise wound evaluation is crucial in order to success on treatment decisions. This paper presents a computer-vision approach to wound-area detection based on statistical colour models. Starting with a training set consisting of 113 real wound images, colour histogram models are created for four different tissue types. Back-projections of colour pixels on those histogram models are used, from a Bayesian perspective, to get an estimate of the posterior probability of a pixel to belong to any of those tissue classes. Performance measures obtained from contingency tables based on a gold standard of segmented images supplied by experts have been used for model selection. The resulting fitted model has been validated on a training set consisting of 322 wound images manually segmented and labelled by expert clinicians. The final fitted segmentation model shows robustness and gives high mean performance rates [(AUC: .9426 (SD .0563); accuracy: .8777 (SD .0799); F-score: 0.7389 (SD .1550); Cohen's kappa: .6585 (SD .1787)] when segmenting significant wound areas that include healing tissues.

  16. Narrowband Light Detection via Internal Quantum Efficiency Manipulation of Organic Photodiodes

    DOE PAGES

    Armin, A.; Jansen-van Vuuren, R. D.; Kopidakis, N.; ...

    2015-02-01

    Spectrally selective light detection is vital for full-colour and near-infrared (NIR) imaging and machine vision. This is not possible with traditional broadband-absorbing inorganic semiconductors without input filtering, and is yet to be achieved for narrowband absorbing organic semiconductors. We demonstrate the first sub-100 nm full-width-at-half-maximum visible-blind red and NIR photodetectors with state-of-the-art performance across critical response metrics. These devices are based on organic photodiodes with optically thick junctions. Paradoxically, we use broadband-absorbing organic semiconductors and utilize the electro-optical properties of the junction to create the narrowest NIR-band photoresponses yet demonstrated. In this context, these photodiodes outperform the encumbent technology (inputmore » filtered inorganic semiconductor diodes) and emerging technologies such as narrow absorber organic semiconductors or quantum nanocrystals. The design concept allows for response tuning and is generic for other spectral windows. Furthermore, it is materialagnostic and applicable to other disordered and polycrystalline semiconductors.« less

  17. Efficiency of a rapid test for detection of tetrodotoxin in puffer fish.

    PubMed

    Thattiyaphong, Aree; Unahalekhaka, Jirapa; Mekha, Nanthawan; Nispa, Wansatip; Kluengklangdon, Panawan; Rojanapantip, Laddawan

    2014-01-01

    The selling and importing of puffer fish species and their products was banned in Thailand in 2002, because of possible neurotoxic effects. However, the sale of their flesh is still happening in Thai markets. Standard methods for toxin quantification (HPLC and LC-MS) have significant limitations, therefore a lateral flow, immuno-chromatographic test (TTX-IC) was developed as a tool for rapid detection of toxin. A total of 750 puffer fishes (387 Lagocephalus lunaris(LL), and 363 Lagocephalus spadiceus (LS)) and 100 edible fishes were caught in Thailand from June 2011-February 2012. Screening of TTX from their flesh by TTX-IC revealed that 69 samples (17.8%) of LL possessed TTX at dangerous levels but LS and edible fishes did not. A selected 339 samples were quantified by LC-MS/MS, showing 50 LL possessed TTX at dangerous levels. Comparison of results with LC-MS/MS showed the TTX-IC to have 94.0% sensitivity and 92.4% specificity. The TTX-IC will be a useful tool for TTX screening of a large number of samples, reducing the testing required by LC-MS/MS, thus reducing costs. All positive cases found should be confirmed by standard methods.

  18. DNA aptamer–micelle as an efficient detection/delivery vehicle toward cancer cells

    PubMed Central

    Wu, Yanrong; Sefah, Kwame; Liu, Haipeng; Wang, Ruowen; Tan, Weihong

    2010-01-01

    We report the design of a self-assembled aptamer–micelle nanostructure that achieves selective and strong binding of otherwise low-affinity aptamers at physiological conditions. Specific recognition ability is directly built into the nanostructures. The attachment of a lipid tail onto the end of nucleic acid aptamers provides these unique nanostructures with an internalization pathway. Other merits include: extremely low off rate once bound with target cells, rapid recognition ability with enhanced sensitivity, low critical micelle concentration values, and dual-drug delivery pathways. To prove the potential detection/delivery application of this aptamer–micelle in biological living systems, we mimicked a tumor site in the blood stream by immobilizing tumor cells onto the surface of a flow channel device. Flushing the aptamer–micelles through the channel demonstrated their selective recognition ability under flow circulation in human whole-blood sample. The aptamer–micelles show great dynamic specificity in flow channel systems that mimic drug delivery in the blood system. Therefore, our DNA aptamer–micelle assembly has shown high potential for cancer cell recognition and for in vivo drug delivery applications. PMID:20080797

  19. Neural Evidence of Statistical Learning: Efficient Detection of Visual Regularities Without Awareness

    PubMed Central

    Turk-Browne, Nicholas B.; Scholl, Brian J.; Chun, Marvin M.; Johnson, Marcia K.

    2009-01-01

    Our environment contains regularities distributed in space and time that can be detected by way of statistical learning. This unsupervised learning occurs without intent or awareness, but little is known about how it relates to other types of learning, how it affects perceptual processing, and how quickly it can occur. Here we use fMRI during statistical learning to explore these questions. Participants viewed statistically structured versus unstructured sequences of shapes while performing a task unrelated to the structure. Robust neural responses to statistical structure were observed, and these responses were notable in four ways: First, responses to structure were observed in the striatum and medial temporal lobe, suggesting that statistical learning may be related to other forms of associative learning and relational memory. Second, statistical regularities yielded greater activation in category-specific visual regions (object-selective lateral occipital cortex and word-selective ventral occipito-temporal cortex), demonstrating that these regions are sensitive to information distributed in time. Third, evidence of learning emerged early during familiarization, showing that statistical learning can operate very quickly and with little exposure. Finally, neural signatures of learning were dissociable from subsequent explicit familiarity, suggesting that learning can occur in the absence of awareness. Overall, our findings help elucidate the underlying nature of statistical learning. PMID:18823241

  20. Efficient Detection of Mediterranean β-Thalassemia Mutations by Multiplex Single-Nucleotide Primer Extension

    PubMed Central

    Atanasovska, Biljana; Bozhinovski, Georgi; Plaseska-Karanfilska, Dijana; Chakalova, Lyubomira

    2012-01-01

    β-Thalassemias and abnormal hemoglobin variants are among the most common hereditary abnormalities in humans. Molecular characterization of the causative genetic variants is an essential part of the diagnostic process. In geographic areas with high hemoglobinopathy prevalence, such as the Mediterranean region, a limited number of genetic variants are responsible for the majority of hemoglobinopathy cases. Developing reliable, rapid and cost-effective mutation-specific molecular diagnostic assays targeting particular populations greatly facilitates routine hemoglobinopathy investigations. We developed a one-tube single-nucleotide primer extension assay for the detection of eight common Mediterranean β-thalassemia mutations: Codon 5 (-CT); CCT(Pro)->C–, Codon 6 (-A); GAG(Glu)->G-G, Codon 8 (-AA); AAG(Lys)->–G, IVS-I-1 (G->A), IVS-I-6 (T->C), IVS-I-110 (G->A), Codon 39 (C->T), and IVS-II-745 (C->G), as well as the hemoglobin S variant beta 6(A3) Glu>Val. We validated the new assay using previously genotyped samples obtaining 100% agreement between independent genotyping methods. Our approach, applicable in a range of Mediterranean countries, offers a combination of high accuracy and rapidity exploiting standard techniques and widely available equipment. It can be further adapted to particular populations by including/excluding assayed mutations. We facilitate future modifications by providing detailed information on assay design. PMID:23110203

  1. Energy efficient data representation and aggregation with event region detection in wireless sensor networks

    NASA Astrophysics Data System (ADS)

    Banerjee, Torsha

    Detection (PERD) for WSNs. When a single event occurs, a child of the tree sends a Flagged Polynomial (FP) to its parent, if the readings approximated by it falls outside the data range defining the existing phenomenon. After the aggregation process is over, the root having the two polynomials, P and FP can be queried for FP (approximating the new event region) instead of flooding the whole network. For multiple such events, instead of computing a polynomial corresponding to each new event, areas with same data range are combined by the corresponding tree nodes and the aggregated coefficients are passed on. Results reveal that a new event can be detected by PERD while error in detection remains constant and is less than a threshold of 10%. As the node density increases, accuracy and delay for event detection are found to remain almost constant, making PERD highly scalable. Whenever an event occurs in a WSN, data is generated by closeby sensors and relaying the data to the base station (BS) make sensors closer to the BS run out of energy at a much faster rate than sensors in other parts of the network. This gives rise to an unequal distribution of residual energy in the network and makes those sensors with lower remaining energy level die at much faster rate than others. We propose a scheme for enhancing network Lifetime using mobile cluster heads (CH) in a WSN. To maintain remaining energy more evenly, some energy-rich nodes are designated as CHs which move in a controlled manner towards sensors rich in energy and data. This eliminates multihop transmission required by the static sensors and thus increases the overall lifetime of the WSN. We combine the idea of clustering and mobile CH to first form clusters of static sensor nodes. A collaborative strategy among the CHs further increases the lifetime of the network. Time taken for transmitting data to the BS is reduced further by making the CHs follow a connectivity strategy that always maintain a connected path to the BS

  2. Narrowband light detection via internal quantum efficiency manipulation of organic photodiodes

    NASA Astrophysics Data System (ADS)

    Armin, Ardalan; Jansen-van Vuuren, Ross D.; Kopidakis, Nikos; Burn, Paul L.; Meredith, Paul

    2015-02-01

    Spectrally selective light detection is vital for full-colour and near-infrared (NIR) imaging and machine vision. This is not possible with traditional broadband-absorbing inorganic semiconductors without input filtering, and is yet to be achieved for narrowband absorbing organic semiconductors. We demonstrate the first sub-100 nm full-width-at-half-maximum visible-blind red and NIR photodetectors with state-of-the-art performance across critical response metrics. These devices are based on organic photodiodes with optically thick junctions. Paradoxically, we use broadband-absorbing organic semiconductors and utilize the electro-optical properties of the junction to create the narrowest NIR-band photoresponses yet demonstrated. In this context, these photodiodes outperform the encumbent technology (input filtered inorganic semiconductor diodes) and emerging technologies such as narrow absorber organic semiconductors or quantum nanocrystals. The design concept allows for response tuning and is generic for other spectral windows. Furthermore, it is material-agnostic and applicable to other disordered and polycrystalline semiconductors.

  3. Narrowband Light Detection via Internal Quantum Efficiency Manipulation of Organic Photodiodes

    SciTech Connect

    Armin, A.; Jansen-van Vuuren, R. D.; Kopidakis, N.; Burn, P. L.; Meredith, P.

    2015-02-01

    Spectrally selective light detection is vital for full-colour and near-infrared (NIR) imaging and machine vision. This is not possible with traditional broadband-absorbing inorganic semiconductors without input filtering, and is yet to be achieved for narrowband absorbing organic semiconductors. We demonstrate the first sub-100 nm full-width-at-half-maximum visible-blind red and NIR photodetectors with state-of-the-art performance across critical response metrics. These devices are based on organic photodiodes with optically thick junctions. Paradoxically, we use broadband-absorbing organic semiconductors and utilize the electro-optical properties of the junction to create the narrowest NIR-band photoresponses yet demonstrated. In this context, these photodiodes outperform the encumbent technology (input filtered inorganic semiconductor diodes) and emerging technologies such as narrow absorber organic semiconductors or quantum nanocrystals. The design concept allows for response tuning and is generic for other spectral windows. Furthermore, it is materialagnostic and applicable to other disordered and polycrystalline semiconductors.

  4. Enhanced efficiency of a capillary-based biosensor over an optical fiber biosensor for detecting calpastatin.

    PubMed

    Bratcher, C L; Grant, S A; Vassalli, J T; Lorenzen, C L

    2008-06-15

    A capillary-based optical biosensor has been developed to detect calpastatin, an indicator of meat tenderness. Longissimus muscle samples (n=11) were extracted from beef carcasses at 0 and 48h post-mortem. These samples were assayed for calpastatin by traditional laboratory methods and with a newly developed capillary tube biosensor as well as for Warner-Bratzler shear force (WBSF) and crude protein and the responses were compared. Additionally, the response from the capillary-based biosensor was compared to a previously developed optical fiber biosensor. When the 0 and 48h sampling periods were combined, the capillary tube biosensor was moderately accurate in predicting calpastatin activity (R(2)=0.6058). There was less variation in the 0h capillary tube biosensor compared to the 0h pre-column (P=0.006) and post-column optical fiber biosensors (P=0.047), therefore the capillary tube biosensor is a more precise system of measurement. This research further advances the development of a calpastatin biosensor and makes online assessment one step closer to reality.

  5. Inhibitory control efficiency in a Piaget-like class-inclusion task in school-age children and adults: a developmental negative priming study.

    PubMed

    Borst, G; Poirel, N; Pineau, A; Cassotti, M; Houdé, O

    2013-07-01

    Most children under 7 years of age presented with 10 daisies and 2 roses fail to indicate that there are more flowers than daisies. Instead of the appropriate comparison of the relative numerosities of the superordinate class (flowers) to its subordinate class (daisies), they perform a direct perceptual comparison of the extensions of the 2 subordinate classes (daisies vs. roses). In our experiment, we investigated whether increasing efficiency in solving the Piagetian class-inclusion task is related to increasing efficiency in the ability to resist (inhibit) this direct comparison of the subordinate classes' extensions. Ten-year-old and young adult participants performed a computerized priming version of a Piaget-like class-inclusion task. The experimental design was such that the misleading perceptual strategy to inhibit on the prime (in which a superordinate class had to be compared with a subordinate class) became a congruent strategy to activate on the probe (in which the two subordinate classes' extensions were directly compared). We found a negative priming effect of 291 ms in children and 129 ms in adults. These results provide evidence for the first time (a) that adults still need to inhibit the comparison of the subordinate classes' extensions in class-inclusion tasks and (b) that the ability to inhibit this heuristic increases with age (resulting in a lower executive cost). Taken together, these findings provide additional support for the neo-Piagetian approach of cognitive development that suggests that the acquisition of increasingly complex knowledge is based on the ability to resist (inhibit) heuristics and previously acquired knowledge.

  6. Differences in EEG power in young and mature healthy adults during an incidental/spatial learning task are related to age and execution efficiency.

    PubMed

    López-Loeza, Elisa; Rangel-Argueta, Ana Rosa; López-Vázquez, Miguel Ángel; Cervantes, Miguel; Olvera-Cortés, María Esther

    2016-04-01

    The differential characteristics of absolute power in the EEG theta (4-8 Hz) and gamma (30-45 Hz) frequency bands have been analysed in young (18-25 years old, n = 14) and mature adults (45-65 years old, n = 12) during the incidental or intentional behavioural conditions of learning and recalling in a visuospatial task. A printed drawing of a maze including eight figures of common objects in specific placements, solved by connecting its entrance and exit points, allowed the subject's performance efficiency to be measured based on the number, position accuracy and/or identity of incidentally or intentionally learned and remembered objects. Meanwhile, EEG recordings from frontal, parietal and temporal derivations were obtained to determine the power values of the theta (4-8 Hz) and gamma (30-45 Hz) bands for each behavioural condition and derivation. Relative to the young adults, the mature adults generally showed lower absolute theta power values, mainly due to their low theta powers under the basal and incidental learning conditions, and higher absolute gamma power values in the frontal and temporal regions. Furthermore, higher theta band power in the frontal regions was related to higher performance efficiency in both incidental and intentional learning, regardless of the subjects' age. A significant negative correlation between the parameters of individual incidental or intentional learning performance and age was also found. Indeed, a differential accuracy of remembered information seems to be associated with age and incidental or intentional learning/memory testing conditions. These data support an increasing vulnerability of visuospatial learning abilities at mature ages and as ageing progresses.

  7. Utility of adding Pneumocystis jirovecii DNA detection in nasopharyngeal aspirates in immunocompromised adult patients with febrile pneumonia.

    PubMed

    Guigue, Nicolas; Alanio, Alexandre; Menotti, Jean; Castro, Nathalie De; Hamane, Samia; Peyrony, Olivier; LeGoff, Jérôme; Bretagne, Stéphane

    2015-04-01

    Detection of viral and bacterial DNA in nasopharyngeal aspirates (NPAs) is now a routine practice in emergency cases of febrile pneumonia. We investigated whether Pneumocystis jirovecii DNA could also be detected in these cases by conducting retrospective screening of 324 consecutive NPAs from 324 adult patients (198 or 61% were immunocompromised) admitted with suspected pulmonary infections during the 2012 influenza epidemic season, using a real-time quantitative polymerase chain reaction (PCR) assay (PjqPCR), which targets the P. jirovecii mitochondrial large subunit ribosomal RNA gene. These NPAs had already been tested for 22 respiratory pathogens (18 viruses and 4 bacteria), but we found that 16 NPAs (4.9%) were PjqPCR-positive, making P. jirovecii the fourth most prevalent of the 23 microorganisms in the screen. Eleven of the 16 PjqPCR-positive patients were immunocompromised, and five had underlying pulmonary conditions. Nine NPAs were also positive for another respiratory pathogen. Six had PjqPCR-positive induced sputa less than 3 days after the NPA procedure, and five were diagnosed with pneumocystis pneumonia (four with chronic lymphoproliferative disorders and one AIDS patient). In all six available pairs quantification of P. jirovecii DNA showed fewer copies in NPA than in induced sputum and three PjqPCR-negative NPAs corresponded to PjqPCR-positive bronchoalveolar lavage fluids, underscoring the fact that a negative PjqPCR screen does not exclude a diagnosis of pneumocystosis. Including P. jirovecii DNA detection to the panel of microorganisms included in screening tests used for febrile pneumonia may encourage additional investigations or support use of anti-pneumocystis pneumonia prophylaxis in immunocompromised patients.

  8. Is a "loss of balance" a control error signal anomaly? Evidence for three-sigma failure detection in young adults.

    PubMed

    Ahmed, Alaa A; Ashton-Miller, James A

    2004-06-01

    Given that a physical definition for a loss of balance (LOB) is lacking, the hypothesis was tested that a LOB is actually a loss of effective control, as evidenced by a control error signal anomaly (CEA). A model-reference adaptive controller and failure-detection algorithm were used to represent central nervous system decision-making based on input and output signals obtained during a challenging whole-body planar balancing task. Control error was defined as the residual generated when the actual system output is compared with the predicted output of the simple first-order polynomial system model. A CEA was hypothesized to occur when the model-generated control error signal exceeded three standard deviations (3sigma) beyond the mean calculated across a 2-s trailing window. The primary hypothesis tested was that a CEA is indeed observable in 20 healthy young adults (ten women) performing the following experiment. Seated subjects were asked to balance a high-backed chair for as long as possible over its rear legs. Each subject performed ten trials. The ground reaction force under the dominant foot, which constituted the sole input to the system, was measured using a two-axis load cell. Angular acceleration of the chair represented the one degree-of-freedom system output. The results showed that the 3sigma algorithm detected a CEA in 94% of 197 trials. A secondary hypothesis was supported in that a CEA was followed in 93% of the trials by an observable compensatory response, occurring at least 100 ms later, and an average of 479 ms, later. Longer reaction times were associated with low velocities at CEA, and vice versa. It is noteworthy that this method of detecting CEA does not rely on an external positional or angular reference, or knowledge of the location of the system's center of mass.

  9. Lysoplex: An efficient toolkit to detect DNA sequence variations in the autophagy-lysosomal pathway

    PubMed Central

    Di Fruscio, Giuseppina; Schulz, Angela; De Cegli, Rossella; Savarese, Marco; Mutarelli, Margherita; Parenti, Giancarlo; Banfi, Sandro; Braulke, Thomas; Nigro, Vincenzo; Ballabio, Andrea

    2015-01-01

    The autophagy-lysosomal pathway (ALP) regulates cell homeostasis and plays a crucial role in human diseases, such as lysosomal storage disorders (LSDs) and common neurodegenerative diseases. Therefore, the identification of DNA sequence variations in genes involved in this pathway and their association with human diseases would have a significant impact on health. To this aim, we developed Lysoplex, a targeted next-generation sequencing (NGS) approach, which allowed us to obtain a uniform and accurate coding sequence coverage of a comprehensive set of 891 genes involved in lysosomal, endocytic, and autophagic pathways. Lysoplex was successfully validated on 14 different types of LSDs and then used to analyze 48 mutation-unknown patients with a clinical phenotype of neuronal ceroid lipofuscinosis (NCL), a genetically heterogeneous subtype of LSD. Lysoplex allowed us to identify pathogenic mutations in 67% of patients, most of whom had been unsuccessfully analyzed by several sequencing approaches. In addition, in 3 patients, we found potential disease-causing variants in novel NCL candidate genes. We then compared the variant detection power of Lysoplex with data derived from public whole exome sequencing (WES) efforts. On average, a 50% higher number of validated amino acid changes and truncating variations per gene were identified. Overall, we identified 61 truncating sequence variations and 488 missense variations with a high probability to cause loss of function in a total of 316 genes. Interestingly, some loss-of-function variations of genes involved in the ALP pathway were found in homozygosity in the normal population, suggesting that their role is not essential. Thus, Lysoplex provided a comprehensive catalog of sequence variants in ALP genes and allows the assessment of their relevance in cell biology as well as their contribution to human disease. PMID:26075876

  10. Development of High Quantum Efficiency UV/Blue Photocathode Epitaxial Semiconductor Heterostructures for Scintillation and Cherenkov Radiation Detection

    NASA Technical Reports Server (NTRS)

    Leopold, Daniel J.

    2002-01-01

    The primary goal of this research project was to further extend the use of advanced heteroepitaxial-semiconductor crystal growth techniques such as molecular beam epitaxy (MBE) and to demonstrate significant gains in UV/blue photonic detection by designing and fabricating atomically-tailored heteroepitaxial GaAlN/GaInN photocathode device structures. This NASA Explorer technology research program has focused on the development of photocathodes for Cherenkov and scintillation radiation detection. Support from the program allowed us to enhance our MBE system to include a nitrogen plasma source and a magnetic bearing turbomolecular pump for delivery and removal of high purity atomic nitrogen during GaAlN/GaInN film growth. Under this program we have also designed, built and incorporated a cesium activation stage. In addition, a connected UHV chamber with photocathode transfer/positioner components as well as a hybrid phototube stage was designed and built to make in-situ quantum efficiency measurements without ever having to remove the photocathodes from UHV conditions. Thus we have constructed a system with the capability to couple atomically-tailored MBE-grown photocathode heterostructures with real high gain readout devices for single photon detection evaluation.

  11. Face Detection in Complex Visual Displays: An Eye-Tracking Study with 3- and 6-Month-Old Infants and Adults

    ERIC Educational Resources Information Center

    Di Giorgio, Elisa; Turati, Chiara; Altoe, Gianmarco; Simion, Francesca

    2012-01-01

    The ability to detect and prefer a face when embedded in complex visual displays was investigated in 3- and 6-month-old infants, as well as in adults, through a modified version of the visual search paradigm and the recording of eye movements. Participants "(N" = 43) were shown 32 visual displays that comprised a target face among 3 or 5…

  12. Gap Detection in School-Age Children and Adults: Effects of Inherent Envelope Modulation and the Availability of Cues across Frequency

    ERIC Educational Resources Information Center

    Buss, Emily; Hall, Joseph W., III; Porter, Heather; Grose, John H.

    2014-01-01

    Purpose: The present study evaluated the effects of inherent envelope modulation and the availability of cues across frequency on behavioral gap detection with noise-band stimuli in school-age children. Method: Listeners were 34 normal-hearing children (ages 5.2-15.6 years) and 12 normal-hearing adults (ages 18.5-28.8 years). Stimuli were…

  13. Nanoscale Au-In alloy-oxide core-shell particles as electrocatalysts for efficient hydroquinone detection

    DOE PAGES

    Sutter, E.; Tong, X.; Medina-Plaza, C.; ...

    2015-10-09

    The presence of hydroquinone (HQ), a phenol ubiquitous in nature and widely used in industry, needs to be monitored because of its toxicity to the environment. Here we demonstrate efficient detection of HQ using simple, fast, and noninvasive electrochemical measurements on indium tin oxide (ITO) electrodes modified with nanoparticles comprising bimetallic Au–In cores and mixed Au–In oxide shells. Whereas bare ITO electrodes show very low activity for the detection of HQ, their modification with Au–In core–shell nanoparticles induces a pronounced shift of the oxidation peak to lower potentials, i.e., facilitated oxidation. The response of the different electrodes was correlated withmore » the initial composition of the bimetallic nanoparticle cores, which in turn determined the amount of Au and In stabilized on the surface of the amorphous Au–In oxide shells available for the electrochemical reaction. While adding core–shell nanostructures with different compositions of the alloy core facilitates the electrocatalytic (reduction-) oxidation of HQ, the activity is highest for particles with AuIn cores (i.e., a Au:In ratio of 1). This optimal system is found to follow a single pathway, the two-electron oxidation of the quinone–hydroquinone couple, which gives rise to high oxidation peaks and is most effective in facilitating the electrode-to-analyte charge transfer and thus detection. The limits of detection (LOD) decreased when increasing the amount of Au exposed on the surface of the amorphous Au–In oxide shells. As a result the LODs were in the range of 10–5 – 10–6 M and were lower than those obtained using bulk Au.« less

  14. Nanoscale Au-In alloy-oxide core-shell particles as electrocatalysts for efficient hydroquinone detection

    SciTech Connect

    Sutter, E.; Tong, X.; Medina-Plaza, C.; Rodriguez-Mendez, M. L.; Sutter, P.

    2015-10-09

    The presence of hydroquinone (HQ), a phenol ubiquitous in nature and widely used in industry, needs to be monitored because of its toxicity to the environment. Here we demonstrate efficient detection of HQ using simple, fast, and noninvasive electrochemical measurements on indium tin oxide (ITO) electrodes modified with nanoparticles comprising bimetallic Au–In cores and mixed Au–In oxide shells. Whereas bare ITO electrodes show very low activity for the detection of HQ, their modification with Au–In core–shell nanoparticles induces a pronounced shift of the oxidation peak to lower potentials, i.e., facilitated oxidation. The response of the different electrodes was correlated with the initial composition of the bimetallic nanoparticle cores, which in turn determined the amount of Au and In stabilized on the surface of the amorphous Au–In oxide shells available for the electrochemical reaction. While adding core–shell nanostructures with different compositions of the alloy core facilitates the electrocatalytic (reduction-) oxidation of HQ, the activity is highest for particles with AuIn cores (i.e., a Au:In ratio of 1). This optimal system is found to follow a single pathway, the two-electron oxidation of the quinone–hydroquinone couple, which gives rise to high oxidation peaks and is most effective in facilitating the electrode-to-analyte charge transfer and thus detection. The limits of detection (LOD) decreased when increasing the amount of Au exposed on the surface of the amorphous Au–In oxide shells. As a result the LODs were in the range of 10–5 – 10–6 M and were lower than those obtained using bulk Au.

  15. Health and Quality of Life Perception in Older Adults: The Joint Role of Cognitive Efficiency and Functional Mobility.

    PubMed

    Forte, Roberta; Boreham, Colin A G; De Vito, Giuseppe; Pesce, Caterina

    2015-09-10

    Cognitive and mobility functions are involved in health-related quality of life (HRQoL). The present cross-sectional study aimed at investigating what facets of efficient cognition and functional mobility interactively contribute to mental and physical HRQoL. Fifty-six healthy older individuals (aged 65-75 years) were evaluated for mental and physical HRQoL, core cognitive executive functions (inhibition, working memory, and cognitive flexibility), and functional mobility (walking) under single and dual task conditions. Multiple regression analyses were run to verify which core executive functions predicted mental and physical HRQoL and whether the ability to perform complex (dual) walking tasks moderated such association. Inhibitory efficiency and the ability to perform physical-mental dual tasks interactively predicted mental HRQoL, whereas cognitive flexibility and the ability to perform physical dual tasks interactively predicted physical HRQoL. Different core executive functions seem relevant for mental and physical HRQoL. Executive function efficiency seems to translate into HRQoL perception when coupled with tangible experience of the ability to walk under dual task conditions that mirror everyday life demands. Implications of these results for supporting the perception of mental and physical quality of life at advanced age are discussed, suggesting the usefulness of multicomponent interventions and environments conducive to walking that jointly aid successful cognitive aging and functional mobility.

  16. A simple but efficient voice activity detection algorithm through Hilbert transform and dynamic threshold for speech pathologies

    NASA Astrophysics Data System (ADS)

    Ortiz P., D.; Villa, Luisa F.; Salazar, Carlos; Quintero, O. L.

    2016-04-01

    A simple but efficient voice activity detector based on the Hilbert transform and a dynamic threshold is presented to be used on the pre-processing of audio signals. The algorithm to define the dynamic threshold is a modification of a convex combination found in literature. This scheme allows the detection of prosodic and silence segments on a speech in presence of non-ideal conditions like a spectral overlapped noise. The present work shows preliminary results over a database built with some political speech. The tests were performed adding artificial noise to natural noises over the audio signals, and some algorithms are compared. Results will be extrapolated to the field of adaptive filtering on monophonic signals and the analysis of speech pathologies on futures works.

  17. Time-resolved singlet-oxygen luminescence detection with an efficient and practical semiconductor single-photon detector

    PubMed Central

    Boso, Gianluca; Ke, Damei; Korzh, Boris; Bouilloux, Jordan; Lange, Norbert; Zbinden, Hugo

    2015-01-01

    In clinical applications, such as PhotoDynamic Therapy, direct singlet-oxygen detection through its luminescence in the near-infrared range (1270 nm) has been a challenging task due to its low emission probability and the lack of suitable single-photon detectors. Here, we propose a practical setup based on a negative-feedback avalanche diode detector that is a viable alternative to the current state-of-the art for different clinical scenarios, especially where geometric collection efficiency is limited (e.g. fiber-based systems, confocal microscopy, scanning systems etc.). The proposed setup is characterized with Rose Bengal as a standard photosensitizer and it is used to measure the singlet-oxygen quantum yield of a new set of photosensitizers for site-selective photodynamic therapy. PMID:26819830

  18. Calculation of detection efficiency of the fiber-optic sensor to measure radioactive contamination using MCNP simulation

    NASA Astrophysics Data System (ADS)

    Joo, Hanyoung; Lee, Arim; Kim, Rinah; Park, Chan Hee; Moon, Joo Hyun

    2015-09-01

    In this paper, a fiber-optic radiation sensor (FORS) was developed to measure gamma rays from the radionuclides frequently found in radioactively contaminated soil. The sensing probe of the FORS was made of an inorganic (Lu,Y)2SiO5:Ce (LYSO:Ce) scintillator, a mixture of epoxy resin and hardener and a plastic fiber. The FORS was applied to measure gamma rays from Cs-137 source (1.1 μCi) in a disk shape. Also, MCNP simulation was performed for the same geometry as that in the experimental setup. Comparison between measurements by the FORS and MCNP simulation showed that the detection efficiency of the fiber-optic sensor was about 19.2%. The FORS is expected to be useful in measuring gamma rays from the radioactive soil at nuclear facility site.

  19. Self-normalizing method to measure the detective quantum efficiency of a wide range of x-ray detectors.

    PubMed

    Stierstorfer, K; Spahn, M

    1999-07-01

    The detective quantum efficiency (DQE) is widely accepted as the most relevant parameter to characterize the image quality of medical x-ray systems. In this article we describe a solid method to measure the DQE. The strength of the method lies in the fact that it is self-normalizing so measurements at very low spatial frequencies are not needed. Furthermore, it works on any system with a response function which is linear in the small-signal approximation. We decompose the DQE into several easily accessible quantities and discuss in detail how they can be measured. At the end we lead the interested reader through an example. Noise equivalent quanta and normalized contrast values are tabulated for standard radiation qualities.

  20. Fluoro Jade-B detection of dying cells in the SVZ and RMS of adult rats after bilateral olfactory bulbectomy.

    PubMed

    Mitrusková, Barbora; Orendácová, Judita; Raceková, Enikö

    2005-12-01

    A novel fluorochrome, Fluoro-Jade B, was used to detect dying precursor cells in the subventricular zone (SVZ) and rostral migratory stream (RMS) of adult rats after bilateral olfactory bulbectomy and in control intact rats. The animals in experimental group were left to survive 3 days and from 3 till 16 months after surgical procedure. 1. In the control animals, Fluoro-Jade B positive cells were visible in the SVZ and within the whole extent of the RMS. The number of Fluoro-Jade B positive cells increased in the elbow in comparison to the rest parts of the RMS. 2. In the experimental animals surviving either 3 days or from 3 till 16 months after bilateral olfactory bulbectomy, Fluoro-Jade B positive cells displayed the similar pattern of distribution as in the control animals. However, some quantitative differences in the labeled cells number along the rostral migratory pathway appeared. 3. The average number of degenerating cells within the control SVZ and RMS was 26.24+/- 0.686. In bulbectomized animals, regardless of survival time, an insignificant increase of Fluoro-Jade B positive cells number occurred. We can conclude that dying of precursor cells is a physiological process running within the SVZ/RMS in both control and experimental animals. Moreover, this physiological process is not influenced by survival period after bilateral olfactory bulbectomy. Our results demonstrate Fluoro-Jade B as a useful marker of dying cells.

  1. Impact of Early Detection of Respiratory Viruses by Multiplex PCR Assay on Clinical Outcomes in Adult Patients

    PubMed Central

    Schuetz, Audrey N.; Jenkins, Stephen G.; Calfee, David P.; Walsh, Thomas J.; Wells, Martin T.; Hollenberg, James P.; Glesby, Marshall J.

    2016-01-01

    Rapid and definitive diagnosis of viral respiratory infections is imperative in patient triage and management. We compared the outcomes for adult patients with positive tests for respiratory viruses at a tertiary care center across two consecutive influenza seasons (winters of 2010-2011 and 2012). Infections were diagnosed by conventional methods in the first season and by multiplex PCR (FilmArray) in the second season. FilmArray decreased the time to diagnosis of influenza compared to conventional methods (median turnaround times of 1.7 h versus 7.7 h, respectively; P = 0.015); FilmArray also decreased the time to diagnosis of non-influenza viruses (1.5 h versus 13.5 h, respectively; P < 0.0001). Multivariate logistic regression found that a diagnosis of influenza by FilmArray was associated with significantly lower odds ratios (ORs) for admission (P = 0.046), length of stay (P = 0.040), duration of antimicrobial use (P = 0.032), and number of chest radiographs (P = 0.005), when controlling for potential confounders. We conclude that the rapid turnaround time, multiplex nature of the test (allowing simultaneous detection of an array of viruses), and superior sensitivity of FilmArray may improve the evaluation and management of patients suspected of having respiratory virus infections. PMID:27225406

  2. Titanium-based transition-edge photon number resolving detector with 98% detection efficiency with index-matched small-gap fiber coupling.

    PubMed

    Fukuda, Daiji; Fujii, Go; Numata, Takayuki; Amemiya, Kuniaki; Yoshizawa, Akio; Tsuchida, Hidemi; Fujino, Hidetoshi; Ishii, Hiroyuki; Itatani, Taro; Inoue, Shuichiro; Zama, Tatsuya

    2011-01-17

    We have realized a high-detection-efficiency photon number resolving detector at an operating wavelength of about 850 nm. The detector consists of a titanium superconducting transition edge sensor in an optical cavity, which is directly coupled to an optical fiber using an approximately 300-nm gap. The gap reduces the sensitive area and heat capacity of the device, leading to high photon number resolution of 0.42 eV without sacrificing detection efficiency or signal response speed. Wavelength dependent efficiency in fiber-coupled devices, which is due to optical interference between the fiber and the device, is also decreased to less than 1% in this configuration. The overall system detection efficiency is 98%±1% at wavelengths of around 850 nm, which is the highest value ever reported in this wavelength range.

  3. Evaluation of the efficiency of biofield diagnostic system in breast cancer detection using clinical study results and classifiers.

    PubMed

    Subbhuraam, Vinitha Sree; Ng, E Y K; Kaw, G; Acharya U, Rajendra; Chong, B K

    2012-02-01

    The division of breast cancer cells results in regions of electrical depolarisation within the breast. These regions extend to the skin surface from where diagnostic information can be obtained through measurements of the skin surface electropotentials using sensors. This technique is used by the Biofield Diagnostic System (BDS) to detect the presence of malignancy. This paper evaluates the efficiency of BDS in breast cancer detection and also evaluates the use of classifiers for improving the accuracy of BDS. 182 women scheduled for either mammography or ultrasound or both tests participated in the BDS clinical study conducted at Tan Tock Seng hospital, Singapore. Using the BDS index obtained from the BDS examination and the level of suspicion score obtained from mammography/ultrasound results, the final BDS result was deciphered. BDS demonstrated high values for sensitivity (96.23%), specificity (93.80%), and accuracy (94.51%). Also, we have studied the performance of five supervised learning based classifiers (back propagation network, probabilistic neural network, linear discriminant analysis, support vector machines, and a fuzzy classifier), by feeding selected features from the collected dataset. The clinical study results show that BDS can help physicians to differentiate benign and malignant breast lesions, and thereby, aid in making better biopsy recommendations.

  4. Heterodyne coherent detection of WDM PDM-QPSK signals with spectral efficiency of 4b/s/Hz.

    PubMed

    Li, Xinying; Dong, Ze; Yu, Jianjun; Yu, Jianguo; Chi, Nan

    2013-04-08

    We experimentally demonstrate heterodyne coherent detection of 8 × 112-Gb/s ultra-density wavelength-division-multiplexing (WDM) polarization-division-multiplexing quadrature-phase-shift-keying (PDM-QPSK) signal after 1120-km single-mode fiber-28 (SMF-28) transmission. The spectral efficiency (SE) is 4b/s/Hz. It is the first time to realize WDM signal transmission with high SE by adopting heterodyne coherent detection. At the heterodyne coherent receiver, intermediate frequency (IF) down conversion is realized in digital frequency domain after analog-to-digital conversion. A digital post filter and 1-bit maximum likelihood sequence estimation (MLSE) adopted after carrier phase estimation (CPE) in the conventional digital-signal-processing (DSP) process is used to suppress the enhanced noise and crosstalk as well as overcome the filtering effects. The bit-error ratio (BER) for all channels is under the forward-error-correction (FEC) limit of 3.8 × 10(-3) after 1120-km SMF-28 transmission.

  5. Preparation of the porphyrin-functionalized cotton fiber for the chromogenic detection and efficient adsorption of Cd(2+) ions.

    PubMed

    Liu, Changkun; Liang, Xiaoyan; Liu, Ji'an; Lei, Xiaobin; Zhao, Xinzhen

    2017-02-15

    In this study, a porphyrin functionalized cotton fiber was prepared and investigated for the visual detection and efficient adsorption of cadmium (Cd(2+)) ions in aqueous solutions. The pristine cotton fiber was first grafted with poly (3-sulfopropyl methacrylate potassium salt) (PSMP) via the surface-initiated atom transfer radical polymerization (SI-ATRP), and subsequently immobilized with 5,10,15,20-tetrakis(1-methy-4-pyridinio)porphyrin tetra(p-toluenesulfonate) (TMPyP), to form the CPT (Cotton-PSMP-TMPyP) material. The CPT was characterized by SEM, FTIR, XPS and elemental analysis, and examined for the detection and adsorption of cadmium ions. The influencing factors such as pH and the initial cadmium ion concentrations on the adsorption performances were investigated. Results showed that the cadmium ion adsorption isotherm was best fitted with the Langmuir isotherm model, with the derived maximum adsorption capacity of 0.8638mmol/g. The thermodynamic study showed the endothermic nature of the adsorption process. In addition, the adsorption kinetics was fast with over 90% of the total cadmium ions adsorbed within 2min. Furthermore, the distinctive color response of the CPT to the cadmium ions in aqueous solutions was clearly displayed. A linear relationship between the light absorbance of CPT-Cd (CPT adsorbed with cadmium ions) and the initial concentrations of cadmium ions was successfully established, which could be used for the fast determination of the cadmium ion concentrations in aqueous solutions.

  6. Efficient training protocol for rapid learning of the two-alternative forced-choice visual stimulus detection task.

    PubMed

    Soma, Shogo; Suematsu, Naofumi; Shimegi, Satoshi

    2014-07-01

    The potential of genetically engineered rodent models has accelerated demand for training procedures of behavioral tasks. Such training is generally time consuming and often shows large variability in learning speed between animals. To overcome these problems, we developed an efficient and stable training system for the two-alternative forced-choice (2AFC) visual stimulus detection task for freely behaving rodents. To facilitate the task learning, we introduced a spout-lever as the operandum and a three-step training program with four ingenuities: (1) a salient stimulus to draw passive attention, (2) a reward-guaranteed trial to keep motivation, (3) a behavior-corrective trial, and (4) switching from a reward-guaranteed trial to a nonguaranteed one to correct behavioral patterns. Our new training system realizes 1-week completion of the whole learning process, during which all rats were able to learn effortlessly the association between (1) lever-manipulation and reward and (2) visual stimulus and reward in a step-by-step manner. Thus, our new system provides an effective and stable training method for the 2AFC visual stimulus detection task. This method should help accelerate the move toward research bridging the visual functions measured in behavioral tasks and the contributing specific neurons/networks that are genetically manipulated or optically controlled.

  7. A novel real-time resource efficient implementation of Sobel operator-based edge detection on FPGA

    NASA Astrophysics Data System (ADS)

    Singh, Sanjay; Saini, Anil K.; Saini, Ravi; Mandal, A. S.; Shekhar, Chandra; Vohra, Anil

    2014-12-01

    A new resource efficient FPGA-based hardware architecture for real-time edge detection using Sobel operator for video surveillance applications has been proposed. The choice of Sobel operator is due to its property to counteract the noise sensitivity of the simple gradient operator. FPGA is chosen for this implementation due to its flexibility to provide the possibility to perform algorithmic changes in later stage of the system development and its capability to provide real-time performance, hard to achieve with general purpose processor or digital signal processor, while limiting the extensive design work, time and cost required for application specific integrated circuit. The proposed architecture uses single processing element for both horizontal and vertical gradient computation for Sobel operator and utilised approximately 38% less FPGA resources as compared to standard Sobel edge detection architecture while maintaining real-time frame rates for high definition videos (1920 × 1080 image sizes). The complete system is implemented on Xilinx ML510 (Virtex-5 FX130T) FPGA board.

  8. Prolonged rest period enables the detection of micronucleated hepatocytes in the liver of young adult rats after a single dose of diethylnitrosamine or mitomycin C.

    PubMed

    Shimada, Keisuke; Yamamoto, Mika; Takashima, Miyuki; Seki, Jiro; Miyamae, Yoichi; Wakata, Akihiro

    2015-09-01

    A repeated-dose micronucleus assay utilizing young adult rat hepatocytes was recently developed to evaluate the genotoxicity. In this assay, accumulation of micronucleated hepatocytes (MNHEPs) induced by repeated dosing of genotoxic chemicals is considered to be a key factor in the detection of micronuclei induction. Then, we hypothesized that the period following chemical exposure enable the detection of MNHEP induction in young adult rats, namely that MNHEPs can be generated from chromosomally damaged cells and accumulate following initiation of chemical exposure until sampling. We therefore measured MNHEP induction at 2 or 4 weeks after a single oral administration of 12.5, 50, or 100mg/kg of diethylnitrosamine (DEN) or an intraperitoneal administration of 0.5, 1.0, or 2.0mg/kg of mitomycin C (MMC) to young adult rats. Results showed a statistically significant, dose-dependent increase in the numbers of MNHEPs in DEN- or MMC-treated rats, indicating that prolonged rest period following a single dose of a genotoxic chemical enables the detection of MNHEP induction in the liver of young adult rats. From these results, a single oral administration of 50mg/kg of DEN with a 2- or 4- week rest period can be used as a positive control in repeated-dose liver micronucleus assays. This procedure is superior in terms of labor saving and animal welfare to repeated dosing of DEN.

  9. Efficiency of a genetic test to detect benzimidazole resistant Haemonchus contortus nematodes in sheep farms in Quebec, Canada.

    PubMed

    Barrère, Virginie; Keller, Kathy; von Samson-Himmelstjerna, Georg; Prichard, Roger K

    2013-10-01

    Haemonchus contortus is a hemophilic nematode which infects sheep and causes anemia and death to lambs. Benzimidazole drugs are used to remove these parasites, but the phenomenon of resistance has arisen worldwide. A sensitive test to detect resistance before treatment would be a useful tool to enable farmers to anticipate the efficiency of the drug before drenching the flock. In this study, we compared a test for benzimidazole resistance based on detection of genetic markers in H. contortus before treatment with the common method of fecal egg count reduction test (FECRT). We recruited 11 farms from different regions of Quebec for this study. Fecal samples from animals were collected per rectum before and after treatment in control and treated groups (10 animals per group). The 10 sheep were treated with fenbendazole at the recommended dose rate. Among the 11 farms participating in the study, we found H. contortus in 8 of them and it was the most predominant nematode species detected by egg count. Using the genetic test, we found benzimidazole resistance in each of these 8 farms. In 5 of these 8 farms there were sufficient sheep with an egg count for H. contortus above 150 eggs per gram to allow the FECRT test to be conducted. Benzimidazole resistance was observed in each of these 5 farms by the FECRT. When we compared the results from the genetic test for samples off pasture and from individual sheep, with the results from the FECRT, we concluded that the genetic test can be applied to samples collected off pasture to estimate benzimidazole resistance levels before treatment for H. contortus infections.

  10. Design of the Neuro-ECAT: A high-resolution, high efficiency positron tomography for imaging the adult head or infant torso

    SciTech Connect

    Williams, C.W.; Burgiss, S.G.; Burke, M.R.; Crabtree, M.C.; Hoffman, E.J.; Keyser, R.M.; Phelps, M.E.

    1981-04-01

    The Neuro-ECAT scanner is a positron emission tomograph designed for high resolution cross-sectional imaging of the adult human head, or the complete torso of a child or small animal. The Neuro-ECAT scanner performs both rectilinear and tomographic scans, in both transmission and emission modes. There are three detector planes, producing five images. Each detector plane contains 88 bismuth germanate detectors, arranged in an octagonal array of 11 detectors per bank. Retained and electrically operated shadow shields provide two choices of reconstructed tomographic resolution, nominally 8.0 and 10.5 mm. Interplane septa, also retained and electrically operated, may be inserted between the detector planes for low noise, highly quantitative measurements, or moved aside for high efficiency scanning of low activity levels. The paper presents the Neuro-ECAT scanner design criteria and a description of the scanner. Data from phantom studies are presented to illustrate system performance.

  11. Reliability and Validity of the SPAID-G Checklist for Detecting Psychiatric Disorders in Adults with Intellectual Disability

    ERIC Educational Resources Information Center

    Bertelli, Marco; Scuticchio, Daniela; Ferrandi, Angela, Lassi, Stefano; Mango, Francesco; Ciavatta, Claudio; Porcelli, Cesare; Bianco, Annamaria; Monchieri, Sergio

    2012-01-01

    SPAID (Psychiatric Instrument for the Intellectually Disabled Adult) is the first Italian tool-package for carrying out psychiatric diagnosis in adults with Intellectual Disabilities (ID). It includes the "G" form, for general diagnostic orientation, and specific checklists for all groups of syndromes stated by the available…

  12. SU-F-207-14: Low Contrast Detectability (LCD) at Different Diagnostic Reference Levels for Adult Abdominal CT Procedures

    SciTech Connect

    Mahmood, U; Erdi, Y

    2015-06-15

    Purpose Using diagnostic reference levels (DRL) to optimize CT protocols has potential to reduce radiation dose and meet regulatory requirements. However, DRL’s tend to be misconstrued as dose limits, are typically designed for specific patient populations, and are assumed to have acceptable image quality (AIQ) associated with them. To determine the image quality that is associated with established DRL’s for adult abdominal CT studies, a LCD phantom study was employed. Methods: A CT phantom (CIRS) containing three columns of 7 spherical targets, ranging from 10mm to 2.4 mm, that are 5, 10, and 20 HU below the background (HUBB) matrix was scanned with a GE HD750 64 slice scanner. The phantom was scanned at the NEXT 2006 25th CTDIvol of 12 mGy, the NCRP 172 achievable dose (AD) CTDIvol of 17 mGy and 75th CTDIvol of 25 mGy and at the ACR recommended CTDIvol of 25 mGy. It was also scanned at a CTDIvol 20% greater than the AD at 20 mGy and the ACR maximum threshold of 30 mGy. Results: At the NEXT 2006 25th percentile CTDIvol of 12 mGy, a 6.3 mm low contrast lesion was detectable in the 20 HUBB; 6.3 mm in the 10 HUBB and 10 mm in the 5 HUBB column. Increasing the CTDIvol to the NCRP 172 AD of 17 mGy, an additional 4.8 mm lesion was visualized in the 20 HUBB column. At 20 mGy, an additional 4.8 mm lesion was detectable in the 10 HUBB column. No further lesions were visible between 20 and 30 mGy. However, conspicuity of all lesions increased with each additional step up in CTDI. Conclusion: Optimizing radiation dose to achieve AIQ is a critical aspect of any dose optimization committee. Hence, judicious monitoring of radiation exposure to patients has to be balanced with diagnostic image quality.

  13. Efficient animal-serum free 3D cultivation method for adult human neural crest-derived stem cell therapeutics.

    PubMed

    Greiner, J F W; Hauser, S; Widera, D; Müller, J; Qunneis, F; Zander, C; Martin, I; Mallah, J; Schuetzmann, D; Prante, C; Schwarze, H; Prohaska, W; Beyer, A; Rott, K; Hütten, A; Gölzhäuser, A; Sudhoff, H; Kaltschmidt, C; Kaltschmidt, B

    2011-12-17

    Due to their broad differentiation potential and their persistence into adulthood, human neural crest-derived stem cells (NCSCs) harbour great potential for autologous cellular therapies, which include the treatment of neurodegenerative diseases and replacement of complex tissues containing various cell types, as in the case of musculoskeletal injuries. The use of serum-free approaches often results in insufficient proliferation of stem cells and foetal calf serum implicates the use of xenogenic medium components. Thus, there is much need for alternative cultivation strategies. In this study we describe for the first time a novel, human blood plasma based semi-solid medium for cultivation of human NCSCs. We cultivated human neural crest-derived inferior turbinate stem cells (ITSCs) within a blood plasma matrix, where they revealed higher proliferation rates compared to a standard serum-free approach. Three-dimensionality of the matrix was investigated using helium ion microscopy. ITSCs grew within the matrix as revealed by laser scanning microscopy. Genetic stability and maintenance of stemness characteristics were assured in 3D cultivated ITSCs, as demonstrated by unchanged expression profile and the capability for self-renewal. ITSCs pre-cultivated in the 3D matrix differentiated efficiently into ectodermal and mesodermal cell types, particularly including osteogenic cell types. Furthermore, ITSCs cultivated as described here could be easily infected with lentiviruses directly in substrate for potential tracing or gene therapeutic approaches. Taken together, the use of human blood plasma as an additive for a completely defined medium points towards a personalisable and autologous cultivation of human neural crest-derived stem cells under clinical grade conditions.

  14. Distributed Denial of Service Attack Source Detection Using Efficient Traceback Technique (ETT) in Cloud-Assisted Healthcare Environment.

    PubMed

    Latif, Rabia; Abbas, Haider; Latif, Seemab; Masood, Ashraf

    2016-07-01

    Security and privacy are the first and foremost concerns that should be given special attention when dealing with Wireless Body Area Networks (WBANs). As WBAN sensors operate in an unattended environment and carry critical patient health information, Distributed Denial of Service (DDoS) attack is one of the major attacks in WBAN environment that not only exhausts the available resources but also influence the reliability of information being transmitted. This research work is an extension of our previous work in which a machine learning based attack detection algorithm is proposed to detect DDoS attack in WBAN environment. However, in order to avoid complexity, no consideration was given to the traceback mechanism. During traceback, the challenge lies in reconstructing the attack path leading to identify the attack source. Among existing traceback techniques, Probabilistic Packet Marking (PPM) approach is the most commonly used technique in conventional IP- based networks. However, since marking probability assignment has significant effect on both the convergence time and performance of a scheme, it is not directly applicable in WBAN environment due to high convergence time and overhead on intermediate nodes. Therefore, in this paper we have proposed a new scheme called Efficient Traceback Technique (ETT) based on Dynamic Probability Packet Marking (DPPM) approach and uses MAC header in place of IP header. Instead of using fixed marking probability, the proposed scheme uses variable marking probability based on the number of hops travelled by a packet to reach the target node. Finally, path reconstruction algorithms are proposed to traceback an attacker. Evaluation and simulation results indicate that the proposed solution outperforms fixed PPM in terms of convergence time and computational overhead on nodes.

  15. The long-term effects of FSH and triiodothyronine administration during the pubertal period on Connexin 43 expression and spermatogenesis efficiency in adult rats.

    PubMed

    Marchlewska, Katarzyna; Slowikowska-Hilczer, Jolanta; Walczak-Jedrzejowska, Renata; Oszukowska, Elzbieta; Filipiak, Eliza; Kula, Krzysztof

    2015-04-01

    Follicle-stimulating hormone (FSH) and triiodothyronine (T3) are known regulatory factors of spermatogenesis initiation. Hyperstimulation of both hormones evokes regressional changes in connexin 43 expression and the seminiferous epithelium in young rats during testicular maturation. However, separate treatments with T3 reduce Sertoli cell number, which seems to be closely connected with the maturation of connexin 43 gap junctions. FSH elevates Sertoli cell number and function, but this effect may take place regardless of the presence of connexin 43-dependent intercellular communication. The aim of the study was to evaluate the later effects of such treatments. Newborn, male Wistar rats were divided randomly into experimental groups receiving daily subcutaneous injections of either 7.5 IU/animal FSH, or 100 mg/kg b.w. T3, or both substances or the same volume of vehicle (control group) until day 15 of life. The animals were sacrificed on day 50. Morphometric analysis and immunohistochemical reactions were performed using antibodies against Vimentin, Proliferating Cell Nuclear Antigen and Connexin 43 in the testis. Sertoli cell count, efficiency of spermatogenesis, and hormonal pattern were examined. Disturbances in the connexin 43 expression reduced the number of Sertoli cells, the efficiency of spermatogenesis and impaired endocrine function of testes in adult rats treated with FSH and T3 during puberty. Stimulation with FSH alone increased Sertoli cell number, but was associated with a negative effect on cell-to-cell connexin 43-dependent communication, with a consequential reduction of spermatogenesis efficiency. J. Exp. Zool. 323A: 256-265, 2015. © 2015 Wiley Periodicals, Inc.

  16. Establishment of a short-term, in vivo screening method for detecting chemicals with juvenile hormone activity using adult Daphnia magna.

    PubMed

    Abe, Ryoko; Watanabe, Haruna; Yamamuro, Masumi; Iguchi, Taisen; Tatarazako, Norihisa

    2015-01-01

    Juvenile hormone (JH) and JH agonists have been shown to induce male offspring production in various daphnids, including Daphnia magna using OECD TG211. The critical period (about 1h) for JH action on ova in the parent's ovary to induce male offspring is existing at 7-8h later from ovulation. Therefore, we considered that adult D. magna could be used to produce a short-term screening method for detecting JH analogs. Using this method, we successfully demonstrated male offspring induction in the second broods after exposure to JH or JH agonists. After investigating the exposure time, the number of repetitions and the exposure concentration, we established a short-term, in vivo screening method for detecting JH analogs using adult D. magna. We examined positive and negative control chemicals using a previously developed method and verified the validity of our new testing method.

  17. Gamma-ray detection efficiency of the microchannel plate installed as an ion detector in the low energy particle instrument onboard the GEOTAIL satellite.

    PubMed

    Tanaka, Y T; Yoshikawa, I; Yoshioka, K; Terasawa, T; Saito, Y; Mukai, T

    2007-03-01

    A microchannel plate (MCP) assembly has been used as an ion detector in the low energy particle (LEP) instrument onboard the magnetospheric satellite GEOTAIL. Recently the MCP assembly has detected gamma rays emitted from an astronomical object and has been shown to provide unique information of gamma rays if they are intense enough. However, the detection efficiency for gamma rays was not measured before launch, and therefore we could not analyze the LEP data quantitatively. In this article, we report the gamma-ray detection efficiency of the MCP assembly. The measured efficiencies are 1.29%+/-0.71% and 0.21%+/-0.14% for normal incidence 60 and 662 keV gamma rays, respectively. The incident angle dependence is also presented. Our calibration is crucial to study high energy astrophysical phenomena by using the LEP.

  18. Calculation of the absolute detection efficiency of a moderated /sup 235/U neutron detector on the Tokamak Fusion Test Reactor

    SciTech Connect

    Ku, L.P.; Hendel, H.W.; Liew, S.L.

    1989-02-01

    Neutron transport simulations have been carried out to calculate the absolute detection efficiency of a moderated /sup 235/U neutron detector which is used on the TFTR as a part of the primary fission detector diagnostic system for measuring fusion power yields. Transport simulations provide a means by which the effects of variations in various shielding and geometrical parameters can be explored. These effects are difficult to study in calibration experiments. The calculational model, benchmarked against measurements, can be used to complement future detector calibrations, when the high level of radioactivity resulting from machine operation may severely restrict access to the tokamak. We present a coupled forward-adjoint algorithm, employing both the deterministic and Monte Carlo sampling methods, to model the neutron transport in the complex tokamak and detector geometries. Sensitivities of the detector response to the major and minor radii, and angular anisotropy of the neutron emission are discussed. A semi-empirical model based on matching the calculational results with a small set of experiments produces good agreement (+-15%) for a wide range of source energies and geometries. 20 refs., 6 figs., 4 tabs.

  19. Wrapping cytochrome c around single-wall carbon nanotube: engineered nanohybrid building blocks for infrared detection at high quantum efficiency.

    PubMed

    Gong, Youpin; Liu, Qingfeng; Wilt, Jamie Samantha; Gong, Maogang; Ren, Shenqiang; Wu, Judy

    2015-06-11

    Biomolecule cytochrome c (Cty c), a small molecule of a chain of amino acids with extraordinary electron transport, was helically wrapped around a semiconductive single-wall carbon nanotube (s-SWCNT) to form a molecular building block for uncooled infrared detection with two uniquely designed functionalities: exciton dissociation to free charge carriers at the heterojunction formed on the s-SWCNT/Cty c interface and charge transport along the electron conducting chain of Cty c (acceptor) and hole conducting channel through s-SWCNT (donor). Such a design aims at addressing the long-standing challenges in exciton dissociation and charge transport in an SWCNT network, which have bottlenecked development of photonic SWCNT-based infrared detectors. Using these building blocks, uncooled s-SWCNT/Cyt c thin film infrared detectors were synthesized and shown to have extraordinary photoresponsivity up to 0.77 A W(-1) due to a high external quantum efficiency (EQE) in exceeding 90%, which represents a more than two orders of magnitude enhancement than the best previously reported on CNT-based infrared detectors with EQE of only 1.72%. From a broad perspective, this work on novel s-SWCNT/Cyt c nanohybrid infrared detectors has developed a successful platform of engineered carbon nanotube/biomolecule building blocks with superior properties for optoelectronic applications.

  20. Detection efficiency of microchannel plates to fluxes of high energy electrons similar to that in the Jupiter environment

    NASA Astrophysics Data System (ADS)

    Tulej, M.; Meyer, S.; Lüthi, M.; Lasi, D.; Galli, A.; Wurz, P.; Desorgher, L.; Wojczuk, K.; Karllsson, S.; Kalla, L.

    2015-10-01

    High-energy high-rate electrons were measured by a multichannel plate (MCP) detector at the PiM1 beam line of the High Intensity Proton Accelerator Facilities located at the Paul Scherrer Institute, Villigen, Switzerland. The measurements provide the absolute detection efficiency of 8.5±0.8 % for e? in the beam momenta range 17.5-345 MeV/c. The pulse height distribution determined from the measurements is close to an exponential function with negative exponent, indicating that the particles penetrated the MCP material before producing the signal somewhere inside the channel. Low charge extraction and modal gains of the MCP detector observed in this study are consistent with the proposed mechanism of the signal formation by penetrating radiation. A very similar MCP ion detector will be used in the NIM mass spectrometer of the PEP experiment currently developed for the JUICE mission of ESA to the Jupiter system, to perform measurements of the chemical composition of the exospheres of the Galilean moons.

  1. Soft X-ray and extreme utraviolet quantum detection efficiency of potassium chloride photocathode layers on microchannel plates

    NASA Technical Reports Server (NTRS)

    Siegmund, Oswald H. W.; Everman, Elaine; Hull, Jeff; Vallerga, John V.; Lampton, Michael

    1988-01-01

    The quantum detection efficiency (QDE) of KCl photocathodes in the 44-1460 A range was investigated. An opaque layer of KCl, about 15,000-A-thick, was evaporated and applied the surface of a microchannel plate (MCP), and the contribution of the photocathode material in the channels (and on the interchannel web) to the QDE was measured using a Z stack MCP detector. It is shown that KCl is a relatively stable photocathode material, with the QDE equal to 30-40 percent in the EUV. At wavelengths above 200 A, the QDE is slightly better than the QDE of CsI, as reported by Siegmund et al. (1986). While the shape of the QDE curve as a function of wavelength is similar to those reported for CsI and KBr, KCl was found to lack the high QDE peak found in the curves of CsI and KBr at about 100 A. A simple QDE model is described, the predictions of which were found to agree with the measurements on the KCl photocathode.

  2. A NIR spectroscopy-based efficient approach to detect fraudulent additions within mixtures of dried porcini mushrooms.

    PubMed

    Casale, Monica; Bagnasco, Lucia; Zotti, Mirca; Di Piazza, Simone; Sitta, Nicola; Oliveri, Paolo

    2016-11-01

    Boletus edulis and allied species (BEAS), known as "porcini mushrooms", represent almost the totality of wild mushrooms placed on the Italian market, both fresh and dehydrated. Furthermore, considerable amounts of these dried fungi are imported from China. The presence of Tylopilus spp. and other extraneous species (i.e., species edible but not belonging to BEAS) within dried porcini mushrooms - mainly from those imported from China and sold in Italy - may represent an evaluable problem from a commercial point of view. The purpose of the present study is to evaluate near-infrared spectroscopy (NIRS) as a rapid and effective alternative to classical methods for identifying extraneous species within dried porcini batches and detecting related commercial frauds. To this goal, 80 dried fungi including BEAS, Tylopilus spp., and Boletus violaceofuscus were analysed by NIRS. For each sample, 3 different parts of the pileus (pileipellis, flesh and hymenium) were analysed and a low-level strategy for data fusion, consisting of combining the signals obtained by the different parts before data processing, was applied. Then, NIR spectra were used to develop reliable and efficient class-models using a novel method, partial least squares density modelling (PLS-DM), and the two most commonly used class-modelling techniques, UNEQ and SIMCA. The results showed that NIR spectroscopy coupled with chemometric class-modelling technique can be suggested as an effective analytical strategy to check the authenticity of dried BEAS mushrooms.

  3. The detective quantum efficiency of photon-counting x-ray detectors using cascaded-systems analyses

    SciTech Connect

    Tanguay, Jesse; Yun, Seungman; Kim, Ho Kyung; Cunningham, Ian A.

    2013-04-15

    Purpose: Single-photon counting (SPC) x-ray imaging has the potential to improve image quality and enable new advanced energy-dependent methods. The purpose of this study is to extend cascaded-systems analyses (CSA) to the description of image quality and the detective quantum efficiency (DQE) of SPC systems. Methods: Point-process theory is used to develop a method of propagating the mean signal and Wiener noise-power spectrum through a thresholding stage (required to identify x-ray interaction events). The new transfer relationships are used to describe the zero-frequency DQE of a hypothetical SPC detector including the effects of stochastic conversion of incident photons to secondary quanta, secondary quantum sinks, additive noise, and threshold level. Theoretical results are compared with Monte Carlo calculations assuming the same detector model. Results: Under certain conditions, the CSA approach can be applied to SPC systems with the additional requirement of propagating the probability density function describing the total number of image-forming quanta through each stage of a cascaded model. Theoretical results including DQE show excellent agreement with Monte Carlo calculations under all conditions considered. Conclusions: Application of the CSA method shows that false counts due to additive electronic noise results in both a nonlinear image signal and increased image noise. There is a window of allowable threshold values to achieve a high DQE that depends on conversion gain, secondary quantum sinks, and additive noise.

  4. Development of a portable instrument for automated measurements of the detective quantum efficiency of x-ray detectors

    NASA Astrophysics Data System (ADS)

    Cunningham, I. A.; Lazarev, S.; Sattarivand, M.; Jankovic, N. D.

    2007-03-01

    The scientific community has generally adopted use of the modulation transfer function (MTF) and detective quantum efficiency (DQE) as primary measures of performance of radiographic detectors. However, measurement of these parameters is generally restricted to experts in laboratory environments due to the required x-ray physics knowledge, specialized instrumentation and computational analyses. We have developed a prototype instrument that automates both the physical measurement and subsequent image analysis to determine the MTF, noise power spectrum (NPS) and DQE of radiographic and mammographic systems. The instrument is placed in the x-ray path directly in front of the detector. A series of images are acquired, saved in "raw" DICOM format and then used to determine the MTF (using the slanted-edge method) and NPS. The number of incident quanta is calculated from measurements of the incident exposure including corrections for air temperature and pressure and ionization chamber spectral response. The primary sources of error are backscatter from the detector and scatter generated within the instrument. These have been minimized to achieve an incident exposure measurement within 2% of a calibrated electrometer and chamber in free space. The MTF and DQE of a commercial CsI-based flat-panel detector were measured over a range of incident exposures from 20 uR to 20 mR per image. Results agreed with both our own laboratory measurements and previously published measurements performed elsewhere with a similar detector within 2% for the MTF and 5% for the DQE. A complete DQE analysis of a clinical digital flat-panel detector is completed in 30 minutes and requires no system modifications.

  5. A Powerful Molecular Engineering Tool Provided Efficient Chlamydomonas Mutants as Bio-Sensing Elements for Herbicides Detection

    PubMed Central

    Lambreva, Maya D.; Giardi, Maria Teresa; Rambaldi, Irene; Antonacci, Amina; Pastorelli, Sandro; Bertalan, Ivo; Husu, Ivan; Johanningmeier, Udo; Rea, Giuseppina

    2013-01-01

    This study was prompted by increasing concerns about ecological damage and human health threats derived by persistent contamination of water and soil with herbicides, and emerging of bio-sensing technology as powerful, fast and efficient tool for the identification of such hazards. This work is aimed at overcoming principal limitations negatively affecting the whole-cell-based biosensors performance due to inadequate stability and sensitivity of the bio-recognition element. The novel bio-sensing elements for the detection of herbicides were generated exploiting the power of molecular engineering in order to improve the performance of photosynthetic complexes. The new phenotypes were produced by an in vitro directed evolution strategy targeted at the photosystem II (PSII) D1 protein of Chlamydomonas reinhardtii, using exposures to radical-generating ionizing radiation as selection pressure. These tools proved successful to identify D1 mutations conferring enhanced stability, tolerance to free-radical-associated stress and competence for herbicide perception. Long-term stability tests of PSII performance revealed the mutants capability to deal with oxidative stress-related conditions. Furthermore, dose-response experiments indicated the strains having increased sensitivity or resistance to triazine and urea type herbicides with I50 values ranging from 6×10−8 M to 2×10−6 M. Besides stressing the relevance of several amino acids for PSII photochemistry and herbicide sensing, the possibility to improve the specificity of whole-cell-based biosensors, via coupling herbicide-sensitive with herbicide-resistant strains, was verified. PMID:23613953

  6. Novel gene targets detected by genomic profiling in a consecutive series of 126 adults with acute lymphoblastic leukemia.

    PubMed

    Safavi, Setareh; Hansson, Markus; Karlsson, Karin; Biloglav, Andrea; Johansson, Bertil; Paulsson, Kajsa

    2015-01-01

    In contrast to acute lymphoblastic leukemia in children, adult cases of this disease are associated with a very poor prognosis. In order to ascertain whether the frequencies and patterns of submicroscopic changes, identifiable with single nucleotide polymorphism array analysis, differ between childhood and adult acute lymphoblastic leukemia, we performed single nucleotide polymorphism array analyses of 126 adult cases, the largest series to date, including 18 paired diagnostic and relapse samples. Apart from identifying characteristic microdeletions of the CDKN2A, EBF1, ETV6, IKZF1, PAX5 and RB1 genes, the present study uncovered novel, focal deletions of the BCAT1, BTLA, NR3C1, PIK3AP1 and SERP2 genes in 2-6% of the adult cases. IKZF1 deletions were associated with B-cell precursor acute lymphoblastic leukemia (P=0.036), BCR-ABL1-positive acute lymphoblastic leukemia (P<0.001), and higher white blood cell counts (P=0.005). In addition, recurrent deletions of RASSF3 and TOX were seen in relapse samples. Comparing paired diagnostic/relapse samples revealed identical changes at diagnosis and relapse in 27%, clonal evolution in 22%, and relapses evolving from ancestral clones in 50%, akin to what has previously been reported in pediatric acute lymphoblastic leukemia and indicating that the mechanisms of relapse may be similar in adult and childhood cases. These findings provide novel insights into the leukemogenesis of adult acute lymphoblastic leukemia, showing similarities to childhood disease in the pattern of deletions and the clonal relationship between diagnostic and relapse samples, but with the adult cases harboring additional aberrations that have not been described in pediatric acute lymphoblastic leukemia.

  7. Target-stimulated metallic HgS nanostructures on a DNA-based polyion complex membrane for highly efficient impedimetric detection of dissolved hydrogen sulfide.

    PubMed

    Zhuang, Junyang; Fu, Libing; Lai, Wenqiang; Tang, Dianping; Chen, Guonan

    2013-12-11

    Target-stimulated metallic HgS nanostructures formed on the DNA-based polyion complex (PIC) membrane were for the first time utilized as an efficient scheme for impedimetric detection of hydrogen sulfide (H2S) by coupling insoluble precipitation with sensitivity enhancement.

  8. Detection and quantification of a very high density lipoprotein in different tissues of Triatoma infestans during the last nymphal and adult stages.

    PubMed

    Rimoldi, O J; Córsico, B; González, M S; Brenner, R R

    1996-07-01

    The presence of a very high density lipoprotein (VHDL), an hexameric protein, was explored in different tissues of Triatoma infestans throughout the last nymphal and adult stages, and in egg extracts by Western blot assays. The VHDL was always detected in both, hemolymph and fat body, during the above mentioned stages and it was also observed in the buffer soluble fraction of testis and egg homogenates. An enzyme-linked immunosorbent assay (ELISA) was used to measure the VHDL titer in these tissues. Hemolymph VHDL reaches a maximum value before the last molt, then it abruptly declines in males and females just after emergence, but during adult life it increases again. Fat body VHDL decreases slowly and continuously during the nymph growth reaching a minimum value prior to molting, and in the first week of adult life the values were even two-fold lower; then, it shows a different cycle of accumulation and depletion in males and females. In adult testis the VHDL undergoes a cycle similar to the one observed in male fat body. This protein increases progressively during embryonic development and, at the time of larval hatching it reaches its maximum value. The hexameric protein presents homologies in its N-terminal sequence with storage hexamerins of Diptera, Lepidoptera and Hymenoptera.

  9. DNA strand breaks detected in embryos of the adult snails, Potamopyrgus antipodarum, and in neonates exposed to genotoxic chemicals.

    PubMed

    Vincent-Hubert, Françoise; Revel, Messika; Garric, Jeanne

    2012-10-15

    We tested the freshwater mudsnail Potamopyrgus antipodarum, which is a species that has already been used for endocrine-disrupting compounds (EDCs) to determine whether early life stages of aquatic organisms are sensitive to genotoxic chemicals. For this purpose, we first developed the alkaline comet assay on adults, embryos, and neonates. The comet assay protocol was validated on both embryonic cells exposed in vitro to hydrogen peroxide and adult snails in the reproducing stage exposed to methyl methane sulfonate. During the latter experiment, DNA strand breaks were investigated on both embryonic cells and on adult gill cells. The second part of this study investigated the stability of DNA strand breaks in adult reproducing snails and neonates exposed to cadmium (Cd) and bisphenol A for 8 days. Hydrogen peroxide-induced DNA strand breaks in vitro in isolated embryonic cells. Exposure of adult reproducing snails to methyl methane sulfonate for 24h induced DNA strand breaks in embryos. Bisphenol A induced a significant increase in the DNA strand-break level in whole embryonic cells and whole neonate cells. Cd was genotoxic for both embryos and neonates during the exposure time and also after 7 days of depuration, suggesting that Cd could inhibit DNA repair enzymes. These preliminary results on this original model have encouraged us to consider the impact of genotoxic environmental contaminants on the F1 generation.

  10. Detection of Simian Immunodeficiency Virus in Semen, Urethra, and Male Reproductive Organs during Efficient Highly Active Antiretroviral Therapy

    PubMed Central

    Matusali, G.; Dereuddre-Bosquet, N.; Le Tortorec, A.; Moreau, M.; Satie, A.-P.; Mahé, D.; Roumaud, P.; Bourry, O.; Sylla, N.; Bernard-Stoecklin, S.; Pruvost, A.; Le Grand, R.

    2015-01-01

    ABSTRACT A number of men receiving prolonged suppressive highly active antiretroviral therapy (HAART) still shed human immunodeficiency virus (HIV) in semen. To investigate whether this seminal shedding may be due to poor drug penetration and/or viral production by long-lived cells within male genital tissues, we analyzed semen and reproductive tissues from macaques chronically infected with simian immunodeficiency virus mac251 (SIVmac251) who were treated for 4 months with HAART, which was intensified over the last 7 weeks with an integrase inhibitor. We showed that a subset of treated animals continued shedding SIV in semen despite efficient HAART. This shedding was not associated with low antiretroviral drug concentrations in semen or in testis, epididymis, seminal vesicles, and prostate. HAART had no significant impact on SIV RNA in the urethra, whereas it drastically reduced SIV RNA levels in the prostate and vas deferens and to a lesser extent in the epididymis and seminal vesicle. The only detectable SIV RNA-positive cells within the male genital tract after HAART were urethral macrophages. SIV DNA levels in genital tissues were not decreased by HAART, suggesting the presence throughout the male genital tract of nonproductively infected cells. In conclusion, our results demonstrate that 4 months of HAART induced variable and limited control of viral infection in the male reproductive organs, particularly in the urethra, and suggest that infected long-lived cells in the male genital tract may be involved in persistent seminal shedding during HAART. These results pave the way for further investigations of male genital organ infection in long-term-treated infected individuals. IMPORTANCE A substantial subset of men receiving prolonged HAART suppressing viral loads in the blood still harbor HIV in semen, and cases of sexual transmission have been reported. To understand the origin of this persistence, we analyzed the semen and male reproductive tissues from SIV

  11. More Cases of Benign Testicular Teratomas are Detected in Adults than in Children. A Clinicopathological Study of 543 Testicular Germ Cell Tumor Cases.

    PubMed

    David, Semjén; András, Farkas; Endre, Kalman; Balint, Kaszas; Árpad, Kovács; Csaba, Pusztai; Karoly, Szuhai; Tamás, Tornóczky

    2016-10-28

    Benign testicular teratomas are always thought to be pediatric neoplasms and previously all the teratoid tumors in the adult testis regarded as malignant. Recently, three publications reported benign testicular teratomas in adulthood and the latest WHO classification refers them as "prepubertal type of teratomas" which rarely appear in adulthood. These neoplasms behave benign and seemingly analogous independently whether they appear in pre- or postpubertal patients. The aim of our study was to investigate the frequency of benign testicular teratomas both in children and adults. 593 cases of testicular neoplasms were found in a period of 17 years ranging from 1998 to 2014 in the archive of our department (Department of Pathology, Medical Center, Pécs University). 543 cases diagnosed as germ cell tumor which have all been further evaluated in conjunction with the clinical data available. Of all germ cell tumor cases 14 (2.5 %) were pure teratomas. Ten out of 14 were the WHO-defined "conventional" teratoma, 4 of the 14 were the "benign or the so called prepubertal type" from which three occurred in adult patients. Only one of the 14 occurred in childhood, indicating that benign prepubertal type teratomas -which are regarded generally as childhood tumors- are more frequently detected in adults than in children. Benign adult testicular teratomas comprised 21 % of all pure teratoma cases in our series. Practicioners in the field have to be aware of its existence also in adulthood to avoid overtreatment and not to expose their patients to unnecessary chemotherapy, retroperitoneal lymphadenectomy (RLA) and the potential complications of these interventions.

  12. RNA-Seq detection of differential gene expression in the rumen of beef steers associated with feed efficiency phenotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The efficient utilization of feedstuffs is an economically important trait in beef production. The rumen is important to the digestive process of steers interacting with feed, microbial populations, and volatile fatty acids indicating it may play a critical role in feed efficiency. To gain an unders...

  13. Breath hydrogen test for detecting lactose malabsorption in infants and children. Prevalence of lactose malabsorption in Japanese children and adults.

    PubMed

    Nose, O; Iida, Y; Kai, H; Harada, T; Ogawa, M; Yabuuchi, H

    1979-06-01

    The breath hydrogen test (BHT) was adapted for use in young infants and children. The diagnostic criterion of sugar malabsorption in the BHT was determined by oral administration of 0.5 g/kg of unabsorbable sugar (lactulose) to 21 healthy infants and children. A maximum increase in breath hydrogen less than 0.05 ml/min per m2 was observed in all subjects. A good correlation between results by the BHT and by the ordinary lactose tolerance test was obtained after oral administration of 2 g/kg lactose to 21 healthy infants and children, 2 congenital lactase-deficient infants, and 7 adults. Using this test, 80 healthy Japanese infants and children (aged between one month and 15 years) and 18 adults were examined for lactose malabsorption after a dose of 1 g/kg lactose. All infants and children under 2-years old absorbed lactose completely. The incidence of lactose malabsorption was 30% in 3-year, 36% in 4-year, 58% in 5-year, and 86% in 6-year-old children, 85% in schoolchildren, and 89% in adults. Thus the incidence of lactase deficiency gradually increases with age from 3 years, and about 90% of all normal Japanese adults are lactase-deficient.

  14. Measuring the Detection Efficiency of the Kepler Pipeline: The First Results from a Simulated Transit Experiment Spanning the Full Observation Baseline

    NASA Astrophysics Data System (ADS)

    Christiansen, Jessie Leigh; Clarke, Bruce; Burke, Christopher; Seader, Shawn; Jenkins, Jon Michael; Twicken, Joseph; smith, jeffrey; Batalha, Natalie; haas, michael; thompson, susan

    2015-08-01

    As the full Kepler dataset is analysed and made available, the Kepler project has published a series of planet candidate lists. In order for both the project and the community to determine the true planet occurrence rates from these candidate lists, we need to measure the detection efficiency of the Kepler pipeline from which the candidates are produced, that is, the rate at which planets are missed in the analysis. We present here the preliminary results from the first empirical measurement of the detection efficiency of the pipeline on the full seventeen quarters of data, extending our previous measurements using one and four quarters of data. For the first time, we are also able to use the identical data products and pipeline versions as those used to generate the Q1-Q17 planet candidate catalogue, and as a consequence, the measured detection efficiency can be used directly in the inference of the planet occurrence rates. In particular, we examine the impact of the large rate of false positives in the Kepler planet candidate lists at periods of 200-400 days, due to temperature-dependent electronic artifacts in the Kepler CCDs, on the detection of real planets at those periods, which are critical to habitable zone occurrence rate calculations.

  15. Contribution of ethyl methanesulfonate vapors to the yield of mutations detected in Drosophila melanogaster when the adult feeding technique is used

    SciTech Connect

    Munoz, E.R.

    1987-01-01

    Ethyl methanesulfonate (EMS) is an alkylating agent widely used in mutation research. In experiments with adult Drosophila melanogaster, EMS is either injected or fed to the flies using different feeding methods that essentially consist of placing the flies in bottles or vials with a piece of tissue paper moistened with a sucrose solution containing the desired concentration of EMS. To determine the extent to which vapors contribute to the mutagenic effect detected in Drosophila when the feeding technique is used, 7-day-old wild-type Samarkand males were fed EMS or were exposed only to its vapors.

  16. Virus-Clip: a fast and memory-efficient viral integration site detection tool at single-base resolution with annotation capability.

    PubMed

    Ho, Daniel W H; Sze, Karen M F; Ng, Irene O L

    2015-08-28

    Viral integration into the human genome upon infection is an important risk factor for various human malignancies. We developed viral integration site detection tool called Virus-Clip, which makes use of information extracted from soft-clipped sequencing reads to identify exact positions of human and virus breakpoints of integration events. With initial read alignment to virus reference genome and streamlined procedures, Virus-Clip delivers a simple, fast and memory-efficient solution to viral integration site detection. Moreover, it can also automatically annotate the integration events with the corresponding affected human genes. Virus-Clip has been verified using whole-transcriptome sequencing data and its detection was validated to have satisfactory sensitivity and specificity. Marked advancement in performance was detected, compared to existing tools. It is applicable to versatile types of data including whole-genome sequencing, whole-transcriptome sequencing, and targeted sequencing. Virus-Clip is available at http://web.hku.hk/~dwhho/Virus-Clip.zip.

  17. An efficient in vitro process for cyclic clonal production of shoots from adult tree of Cassia alata L. and evaluation of genetic stability using DNA-based markers.

    PubMed

    Ahmed, Md Rafique; Anis, Mohammad; Al-Etta, Hashim A

    2014-12-01

    An efficient, cyclic, two-step protocol for clonal in vitro regeneration system of an antiallergenic plant, Cassia alata, has been successfully developed. Nodal explants from a 5-year-old tree were cultured on Murashige and Skoog (MS) medium supplemented with various concentrations (1.0, 2.5, 5.0, 7.5, and 10.0 μM) of thidiazuron (TDZ). TDZ (5.0 μM) was found to be optimal for the formation of maximum shoot induction. Shoot proliferation and elongation increased when the regenerated shoots were subcultured on hormone-free MS medium after 4 weeks of exposure to TDZ. Nodal explants from in vitro regenerated microshoots to developed shoots, thus making the process recurrent. In 6 months duration, owing to the recurring nature of the protocol, large number of shoots could be produced from a single nodal explant from an adult tree. Shoots rooted best on MS supplemented medium with 0.5 μM IBA. Regenerated plantlets were acclimatized and successfully transplanted to the garden soil, where they grew well without any morphological and genetic variations. To confirm the uniformity, the genetic fidelity of in vitro raised C. alata clones was also assessed by using random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers. The present regeneration process not only favored the clonal multiplication but also expressed the regeneration capability of in vitro regenerated microshoots and can be subjugated for catering enough raw materials to various pharma industries by continuous cyclic shoot production.

  18. Detection of Ehrlichia chaffeensis in adult and nymphal stage lone star ticks (Amblyomma americanum) from Long Island, New York

    USGS Publications Warehouse

    Mixson, T.R.; Ginsberg, H.S.; Campbell, S.R.; Sumner, J.W.; Paddock, C.D.

    2004-01-01

    The lone star tick, Amblyomma americanum (L.), has increased in abundance in several regions of the northeastern United States, including areas of Long Island, NY. Adult and nymphal stage A. americanum collected from several sites on Long Island were evaluated for infection with Ehrlichia chaffeensis, the causative agent of human monocytic ehrlichiosis (HME), by using a nested polymerase chain reaction assay. Fifty-nine (12.5%) of ,17.3 adults and eight of 11.3 pools of five nymphs each (estimated minimum prevalence of infection 1.4%) contained DNA of E. chaffeensis. These data, coupled with the documented expansion of lone star tick populations in the northeastern United States, confirm that E. chaffeensis is endemic to many areas of Long Island and that HME should be considered among the differential diagnoses of the many distinct tick-borne diseases that occur in this region.

  19. Rb based alkali antimonide high quantum efficiency photocathodes for bright electron beam sources and photon detection applications

    NASA Astrophysics Data System (ADS)

    Cultrera, L.; Gulliford, C.; Bartnik, A.; Lee, H.; Bazarov, I.

    2017-02-01

    High quantum efficiency alkali antimonide photocathodes have been grown over both stainless steel and glass substrates using sequential evaporation of Sb, K, Rb, and Cs. Quantum efficiencies well above 25% have been measured at 400 nm. A bi-alkali Rb-K-Sb photocathode grown on a stainless steel substrate has been installed in a high voltage DC gun at Cornell University and the intrinsic electron beam emittance was measured at different photon energies.

  20. IBD-Groupon: an efficient method for detecting group-wise identity-by-descent regions simultaneously in multiple individuals based on pairwise IBD relationships

    PubMed Central

    2013-01-01

    Motivation: Detecting IBD tracts is an important problem in genetics. Most of the existing methods focus on detecting pairwise IBD tracts, which have relatively low power to detect short IBD tracts. Methods to detect IBD tracts among multiple individuals simultaneously, or group-wise IBD tracts, have better performance for short IBD tracts detection. Group-wise IBD tracts can be applied to a wide range of applications, such as disease mapping, pedigree reconstruction and so forth. The existing group-wise IBD tract detection method is computationally inefficient and is only able to handle small datasets, such as 20, 30 individuals with hundreds of SNPs. It also requires a previous specification of the number of IBD groups, or partitions of the individuals where all the individuals in the same partition are IBD with each other, which may not be realistic in many cases. The method can only handle a small number of IBD groups, such as two or three, because of scalability issues. What is more, it does not take LD (linkage disequilibrium) into consideration. Results: In this work, we developed an efficient method IBD-Groupon, which detects group-wise IBD tracts based on pairwise IBD relationships, and it is able to address all the drawbacks aforementioned. To our knowledge, our method is the first practical group-wise IBD tracts detection method that is scalable to very large datasets, for example, hundreds of individuals with thousands of SNPs, and in the meanwhile, it is powerful to detect short IBD tracts. Our method does not need to specify the number of IBD groups, which will be detected automatically. And our method takes LD into consideration, as it is based on pairwise IBD tracts where LD can be easily incorporated. Contact: dhe@us.ibm.com PMID:23812980

  1. Indium Nitride: A New Material for High Efficiency, Compact, 1550NM Laser-Based Terahertz Sources in Explosives Detection and Concealed Weapons Imaging

    DTIC Science & Technology

    2006-11-01

    INDIUM NITRIDE: A NEW MATERIAL FOR HIGH EFFICIENCY, COMPACT, 1550NM LASER-BASED TERAHERTZ SOURCES IN EXPLOSIVES DETECTION AND CONCEALED WEAPONS...nitride (InN) is identified as a promising terahertz (THz) emitter based on the optical and electronic properties of high quality In- and N-face...significant improvements in THz emitters. 1. INTRODUCTION The terahertz region of the electromagnetic spectrum, lying between microwave frequencies

  2. Graphene-based high-efficiency surface-enhanced Raman scattering-active platform for sensitive and multiplex DNA detection.

    PubMed

    He, Shijiang; Liu, Keng-Ku; Su, Shao; Yan, Juan; Mao, Xiuhai; Wang, Dongfang; He, Yao; Li, Lain-Jong; Song, Shiping; Fan, Chunhai

    2012-05-15

    We have developed a surface-enhanced Raman scattering (SERS)-active substrate based on gold nanoparticle-decorated chemical vapor deposition (CVD)-growth graphene and used it for multiplexing detection of DNA. Due to the combination of gold nanoparticles and graphene, the Raman signals of dye were dramatically enhanced by this novel substrate. With the gold nanoparticles, DNA capture probes could be easily assembled on the surface of graphene films which have a drawback to directly immobilize DNA. This platform exhibits extraordinarily high sensitivity and excellent specificity for DNA detection. A detection limit as low as 10 pM is obtained. Importantly, two different DNA targets could be detected simultaneously on the same substrate just using one light source.

  3. Immunocytochemical detection of vasoactive intestinal peptide-like and peptide histidine isoleucine-like peptides in the nervous system and the excretory system of adult Nippostrongylus brasiliensis.

    PubMed

    Foster, N

    1998-05-01

    Vasoactive intestinal peptide-like and peptide histidine isoleucine-like immunoreactivities were detected in the excretory duct of adult male and female Nippostrongylus brasiliensis, thus indicating the source of these two physiologically active peptides previously isolated from the excretory/secretory products of adult N. brasiliensis. In the nervous system immunoreactivity to both these peptides was confined to females and was found in the neurons of the ovijector associated ganglion. This is consistent with co-synthesis of vasoactive intestinal peptide-like and peptide histidine isoleucine-like peptides which has also been shown to occur in all mammalian vasoactive intestinal peptid-ergic neurons studied to date. However, in addition to this, and in common to some previous studies on helminth vasoactive intestinal peptide and peptide histidine isoleucine immunoreactivities, co-synthesis of the peptides was not indicated in a pair of branched neurons which projected posteriorly and peripherally from the ganglion associated with the ovijector of females and which terminated in two pairs of ganglia also exhibiting vasoactive intestinal peptide-like immunoreactivity only. The position of these ganglia indicated that they innervate muscles close to the body wall and may be responsible for the muscular contractions required for expulsion of eggs from female Nippostrongylus brasiliensis. This is also the first study to successfully detect these peptides in the excretory system of gastrointestinal nematodes.

  4. DETECTORS AND EXPERIMENTAL METHODS: Measurement of the response function and the detection efficiency of an organic liquid scintillator for neutrons between 1 and 30 MeV

    NASA Astrophysics Data System (ADS)

    Huang, Han-Xiong; Ruan, Xi-Chao; Chen, Guo-Chang; Zhou, Zu-Ying; Li, Xia; Bao, Jie; Nie, Yang-Bo; Zhong, Qi-Ping

    2009-08-01

    The light output function of a varphi50.8 mm × 50.8 mm BC501A scintillation detector was measured in the neutron energy region of 1 to 30 MeV by fitting the pulse height (PH) spectra for neutrons with the simulations from the NRESP code at the edge range. Using the new light output function, the neutron detection efficiency was determined with two Monte-Carlo codes, NEFF and SCINFUL. The calculated efficiency was corrected by comparing the simulated PH spectra with the measured ones. The determined efficiency was verified at the near threshold region and normalized with a Proton-Recoil-Telescope (PRT) at the 8-14 MeV energy region.

  5. Measurements of the response function and the detection efficiency of an NE213 scintillator for neutrons between 20 and 65 MeV

    NASA Astrophysics Data System (ADS)

    Meigo, S.

    1997-02-01

    For neutrons 25, 30 and 65 MeV, the response functions and detection efficiencies of an NE213 liquid scintillator were measured. Quasi-monoenergetic neutrons produced by the 7Li(p,N 0.1) reaction were employed for the measurement and the absolute flux of incident neutrons was determined within 4% accuracy using a proton recoil telescope. Response functions and detection efficiencies calculated with the Monte Carlo codes, CECIL and SCINFUL, were compared with the measured data. It was found that response functions calculated with SCINFUL agreed better with experimental ones than those with CECIL, however, the deuteron light output used in SCINFUL was too low. The response functions calculated with a revised SCINFUL agreed with the experimental ones quite well even for the deuteron bump and peak due to the C(n,d 0) reaction. It was confirmed that the detection efficiencies calculated with the original and the revised SCINFULs agreed with the experimental data within the experimental error, while those with CECIL were about 20% higher in the energy region above 30 MeV.

  6. Acceptability of an intelligent wireless sensor system for the rapid detection of health issues: findings among home-dwelling older adults and their informal caregivers

    PubMed Central

    Cohen, Christine; Kampel, Thomas; Verloo, Henk

    2016-01-01

    Background Aging at home rather than in an institution is now considered the gold standard. Public health figures document an important demographic transition to an increasingly elderly society. At the same time, this is accompanied by the emergence of significant numbers of innovative technologies to help and support home-dwelling older adults in declining health who wish to remain at home. Study aim To explore the acceptability of intelligent wireless sensor system (IWSS) among home-dwelling older adults in rapidly detecting their health issues. Methods Data were sourced from a pilot 3-month randomized clinical trial that involved 34 older patients in the experimental group (EG) using an IWSS to rapidly detect falls and other health issues at home. The effectiveness of the IWSS was assessed by comparing it to participants’ functional and cognitive status, as measured both before and after the trial. The Resident Assessment Instrument for Home Care, Confusion Assessment Method, Cognitive Performance Scale, Geriatric Depression Scale, and Informed Questionnaire on Cognitive Decline in the Elderly were used for the assessments. Acceptability of the IWSS was explored at the end of the study. Results Both older adults and their informal caregivers considered the performance and usefulness of the IWSS intervention to be low to moderate. A majority of the participants were unsatisfied with its ease of use and found multiple obstacles in using and having an intention to use the IWSS. However, their informal caregivers were more satisfied with the program and gave higher scores for usefulness, ease of use, and intention to use IWSS technology. Conclusion The IWSS displayed low-to-moderate acceptability among the older participants and their informal caregivers. We recommend improving and clarifying several components in the IWSS for the development of a design that is user-centered. PMID:27660417

  7. An Efficient Silent Data Corruption Detection Method with Error-Feedback Control and Even Sampling for HPC Applications

    SciTech Connect

    Di, Sheng; Berrocal, Eduardo; Cappello, Franck

    2015-01-01

    The silent data corruption (SDC) problem is attracting more and more attentions because it is expected to have a great impact on exascale HPC applications. SDC faults are hazardous in that they pass unnoticed by hardware and can lead to wrong computation results. In this work, we formulate SDC detection as a runtime one-step-ahead prediction method, leveraging multiple linear prediction methods in order to improve the detection results. The contributions are twofold: (1) we propose an error feedback control model that can reduce the prediction errors for different linear prediction methods, and (2) we propose a spatial-data-based even-sampling method to minimize the detection overheads (including memory and computation cost). We implement our algorithms in the fault tolerance interface, a fault tolerance library with multiple checkpoint levels, such that users can conveniently protect their HPC applications against both SDC errors and fail-stop errors. We evaluate our approach by using large-scale traces from well-known, large-scale HPC applications, as well as by running those HPC applications on a real cluster environment. Experiments show that our error feedback control model can improve detection sensitivity by 34-189% for bit-flip memory errors injected with the bit positions in the range [20,30], without any degradation on detection accuracy. Furthermore, memory size can be reduced by 33% with our spatial-data even-sampling method, with only a slight and graceful degradation in the detection sensitivity.

  8. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  9. A novel in vitro method for detecting undifferentiated human pluripotent stem cells as impurities in cell therapy products using a highly efficient culture system.

    PubMed

    Tano, Keiko; Yasuda, Satoshi; Kuroda, Takuya; Saito, Hirohisa; Umezawa, Akihiro; Sato, Yoji

    2014-01-01

    Innovative applications of cell therapy products (CTPs) derived from human pluripotent stem cells (hPSCs) in regenerative medicine are currently being developed. The presence of residual undifferentiated hPSCs in CTPs is a quality concern associated with tumorigencity. However, no simple in vitro method for direct detection of undifferentiated hPSCs that contaminate CTPs has been developed. Here, we show a novel approach for direct and sensitive detection of a trace amount of undifferentiated human induced pluripotent stem cells (hiPSCs) using a highly efficient amplification method in combination with laminin-521 and Essential 8 medium. Essential 8 medium better facilitated the growth of hiPSCs dissociated into single cells on laminin-521 than in mTeSR1 medium. hiPSCs cultured on laminin-521 in Essential 8 medium were maintained in an undifferentiated state and they maintained the ability to differentiate into various cell types. Essential 8 medium allowed robust hiPSC proliferation plated on laminin-521 at low cell density, whereas mTeSR1 did not enhance the cell growth. The highly efficient culture system using laminin-521 and Essential 8 medium detected hiPSCs spiked into primary human mesenchymal stem cells (hMSCs) or human neurons at the ratio of 0.001%-0.01% as formed colonies. Moreover, this assay method was demonstrated to detect residual undifferentiated hiPSCs in cell preparations during the process of hMSC differentiation from hiPSCs. These results indicate that our highly efficient amplification system using a combination of laminin-521 and Essential 8 medium is able to detect a trace amount of undifferentiated hPSCs contained as impurities in CTPs and would contribute to quality assessment of hPSC-derived CTPs during the manufacturing process.

  10. Biofunctionalized magnetic nanospheres-based cell sorting strategy for efficient isolation, detection and subtype analyses of heterogeneous circulating hepatocellular carcinoma cells.

    PubMed

    Chen, Lan; Wu, Ling-Ling; Zhang, Zhi-Ling; Hu, Jiao; Tang, Man; Qi, Chu-Bo; Li, Na; Pang, Dai-Wen

    2016-11-15

    Hepatocellular carcinoma (HCC) is an awful threat to human health. Early-stage HCC may be detected by isolation of circulating tumor cells (CTCs) from peripheral blood samples, which is beneficial to the diagnosis and therapy. However, the extreme rarity and high heterogeneity of HCC CTCs have been restricting the relevant research. To achieve an efficient isolation, reliable detection and subtype analyses of heterogeneous HCC CTCs, herein, we present a cell sorting strategy based on anti-CD45 antibody-modified magnetic nanospheres. By this strategy, leukocyte depletion efficiency was up to 99.9% within 30min in mimic clinical samples, and the purity of the spiked HCC cells was improved 265-317-fold. Besides, the isolated HCC cells remained viable at 92.3% and could be directly recultured. Moreover, coupling the convenient, fast and effective cell sorting strategy with specific ICC identification via biomarkers AFP and GPC3, HCC CTCs were detectable in peripheral blood samples, showing the potential for HCC CTC detection in clinic. Notably, this immunomagnetic cell sorting strategy enabled isolating more heterogeneous HCC cells compared with the established EpCAM-based methods, and further achieved characterization of three different CTC subtypes from one clinical HCC blood sample, which may assist clinical HCC analyses such as prognosis or personalized treatment.

  11. 3D metal-organic framework as highly efficient biosensing platform for ultrasensitive and rapid detection of bisphenol A.