Science.gov

Sample records for adult epileptic patients

  1. Counselling the Epileptic Patient

    PubMed Central

    Jones, Barry

    1983-01-01

    Today, most epileptics can participate freely in a wide range of activities. However, their epilepsy does create some special problems. The degree to which they participate in sports is governed by their degree of seizure control, as are their employment opportunities and driving privileges. Epilepsy does not appear to be a major stress factor in marriage as long as the spouse is knowledgeable about the condition. Epileptic women usually have normal pregnancies though their relative risks are perhaps double those for the non-epileptic population. Children of epileptic women have about four times the general population's risk of seizure but the absolute level of risk is not high. PMID:21286585

  2. Dental problems in epileptic patients.

    PubMed

    Zioło, Anna; Mielnik-Błaszczak, Maria

    2004-01-01

    On the grounds of literature and own clinical experience, pathological changes in epilepitic patients have been described. Dental management procedures in these patients have also been presented. The unquestionable importance of prophylaxis, which may markedly minimize the impact of epilepsy on the incidence of mouth diseases, has been emphasised. It has also been stated that epileptic patients should receive specialised and integrated dental treatment.

  3. Water intoxication in epileptic patients receiving carbamazepine.

    PubMed Central

    Perucca, E; Garratt, A; Hebdige, S; Richens, A

    1978-01-01

    Plasma sodium and osmolality were determined in 80 adult epileptic patients receiving chronic treatment with carbamazepine and in 50 control patients treated with other anticonvulsant drugs. Mean plasma osmolality was significantly lower in the carbamazepine-treated patients but mean plasma sodium did not differ in the two groups. Hyponatraemia was found in five of the carbamazine-treated patients and hypo-osmolality in six. None of the control patients had hyponatraemia and only one had a borderline low osmolality. Three of the 13 patients receiving carbamazepine alone were hyponatraemic. Plasma sodium concentration correlated negatively with both daily carbamazepine dose and serum carbamazepine level. Free water clearance after an oral water load was determined in six patients on carbamazepine alone and in six normal subjects not receiving drug therapy. The capacity of some of the patients to excrete the water load was found to be grossly impaired. PMID:681958

  4. Nutritional Aspects of Treatment in Epileptic Patients

    PubMed Central

    SOLTANI, Danesh; GHAFFAR POUR, Majid; TAFAKHORI, Abbas; SARRAF, Payam; BITARAFAN, Sama

    2016-01-01

    Epilepsy is a neurological disorder characterized by interruption of normal neuronal functions that is manifested by behavioral disorders, changing of awareness level, and presence of some sensory, autonomic and motor symptoms or signs. It is resulted from many different causes. Many antiepileptic drugs (AEDs) are considered to manage epileptic attacks. Some of them change metabolism and absorption of many nutrients. Therefore, epileptic patients may be in higher risk of nutrient deficiency and its unwelcome effects. In the present paper, we intend to review the relationship between nutrition and epilepsy in two aspects. In one aspect we discuss the nutritional status in epileptic patients, the causes of nutritional deficiencies and the way of compensation of the nutrient deficiencies. It will guide these patients to have a healthy life. In another aspect we explain the role of some nutrients and specific diets in management of epileptic attacks. It can help to better control of epileptic attacks in these patients. PMID:27375750

  5. Nutritional Aspects of Treatment in Epileptic Patients.

    PubMed

    Soltani, Danesh; Ghaffar Pour, Majid; Tafakhori, Abbas; Sarraf, Payam; Bitarafan, Sama

    2016-01-01

    Epilepsy is a neurological disorder characterized by interruption of normal neuronal functions that is manifested by behavioral disorders, changing of awareness level, and presence of some sensory, autonomic and motor symptoms or signs. It is resulted from many different causes. Many antiepileptic drugs (AEDs) are considered to manage epileptic attacks. Some of them change metabolism and absorption of many nutrients. Therefore, epileptic patients may be in higher risk of nutrient deficiency and its unwelcome effects. In the present paper, we intend to review the relationship between nutrition and epilepsy in two aspects. In one aspect we discuss the nutritional status in epileptic patients, the causes of nutritional deficiencies and the way of compensation of the nutrient deficiencies. It will guide these patients to have a healthy life. In another aspect we explain the role of some nutrients and specific diets in management of epileptic attacks. It can help to better control of epileptic attacks in these patients.

  6. Epileptic Encephalopathies in Adults and Childhood

    PubMed Central

    Kural, Zekiye; Ozer, Ali Fahir

    2012-01-01

    Epileptic encephalopathies are motor-mental retardations or cognitive disorders secondary to epileptic seizures or epileptiform activities. Encephalopaties due to brain damage, medications, or systemic diseases are generally not in the scope of this definition, but they may rarely accompany the condition. Appropriate differential diagnosis of epileptic seizures as well as subclinical electroencephalographic discharges are crucial for management of seizures and epileptiform discharges and relative regression of cognitive deterioration in long-term followup. Proper antiepileptic drug, hormonal treatment, or i.v. immunoglobulin choice play major role in prognosis. In this paper, we evaluated the current treatment approaches by reviewing clinical electrophysiological characteristics of epileptic encephalopathies. PMID:23056934

  7. Prosthetic management of an epileptic patient.

    PubMed

    Akeredolu, P A; Temisanren, O T; Danesi, M A

    2005-12-01

    This case report illustrates the problems of tooth loss in an epileptic patient. The patient presented with a broken denture following a seizure. She gave a history of breaking and swallowing her dentures during seizures. Before presentation she had worn five upper removable partial dentures. An upper removable partial denture with increased thickness of the acrylic palatal was fabricated and fitted satisfactorily. The patient was taught how to insert and remove the prosthesis as quickly as possible. Epileptic patients can use dentures but run the risk of frequently breaking and swallowing them during seizures. The risk can be reduced if patients and relatives are taught how to remove the dentures prior to or during seizures.

  8. Psychological approach of non-epileptic to epileptic patients: the dynamics of attitude changes during hospitalization.

    PubMed

    Jedrzejczak, J; Owczarek, K; Majkowski, J

    1999-09-01

    Measures of interpersonal relations of non-epileptic patients to epileptic patients were studied in search of answers to two questions: what is the initial attitude of non-epileptic patients to epileptic patients; and, do any changes in attitude occur during time spent together in hospital? In order to study these personal relations, a formal analysis of preferences was carried out. Twenty-two non-epileptic patients admitted to the Neurology and Epileptology Department, Medical Centre for Postgraduate Education, Warsaw were studied. Subjects were asked to rank-order (from 1 to 9 points) suggested ways of distributing the profits of a hypothetical joint (e.g., with a room-mate) money-earning venture. The experimental procedure for each patient was repeated for all three room-mates. Preferences were assessed three times - the day after admission to hospital, after 11 days and after 21 days in hospital. Following this procedure, it was possible to trace the dynamics of the patients' interpersonal relations. The data were correlated (Spearman's r(s)) and submitted to analysis of variance (MANOVA) with repeated measures. Analysis of the attitudes of patients with non-epileptic neurological disorders towards epileptic patients revealed a dynamic tendency - from negative (measures one and partly two) to positive attitudes after three weeks spent together in hospital (measure three).

  9. Factors associated with hopelessness in epileptic patients

    PubMed Central

    Pompili, Maurizio; Serafini, Gianluca; Innamorati, Marco; Montebovi, Franco; Lamis, Dorian A; Milelli, Mariantonietta; Giuliani, Manuela; Caporro, Matteo; Tisei, Paolo; Lester, David; Amore, Mario; Girardi, Paolo; Buttinelli, Carla

    2014-01-01

    AIM: To investigate factors related to hopelessness in a sample of epileptic patients, including measures of depression and quality of life (QOL). METHODS: Sixty-nine participants were administered the following psychometric instruments: Beck Depression Inventory-II, Beck Hopelessness Scale (BHS), and QOL in Epilepsy (QOLIE)-89. Patients were dichotomized into two categories: those affected by epilepsy with generalized tonic-clonic seizures vs those having epilepsy with partial seizures. RESULTS: The groups differed on the QOLIE Role Limitation/Emotional dimension. Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems than patients with other types of epilepsy (89.57 ± 25.49 vs 72.86 ± 36.38; t63 = -2.16; P < 0.05). All of the respondents reported moderate to severe depression, and 21.7% of patients with generalized seizures and 28.6% of patients with other diagnoses had BHS total scores ≥ 9 indicating a higher suicidal risk. The study did not control for years of the illness. CONCLUSION: Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems compared to patients with other types of seizures. Patients at increased suicide risk as evaluated by the BHS were older than those who had a lower suicidal risk. Future studies are required to further investigate the impact of hopelessness on the outcome of epileptic patients. PMID:25540729

  10. [Clinical approach to the first epileptic crisis in adults].

    PubMed

    Espinosa-Jovel, Camilo Alfonso; Sobrino-Mejía, Fidel Ernesto

    2014-04-16

    Seizures are one of the main reasons for visits to emergency and neurology. Represent a traumatic event with potential medical and social consequences. A first epileptic seizure, can be the initial manifestation of malignancy, systemic disorder or infection, but can also be the first manifestation of epilepsy. The misdiagnosis of symptomatic seizures and unprovoked seizure, significantly affects prognosis and patient outcomes. The aim of this review is to examine the general concepts that enable successful diagnostic and therapeutic approach to the patient presenting with a first epileptic seizure.

  11. Doublecortin expression in the normal and epileptic adult human brain.

    PubMed

    Liu, Y W J; Curtis, M A; Gibbons, H M; Mee, E W; Bergin, P S; Teoh, H H; Connor, B; Dragunow, M; Faull, R L M

    2008-12-01

    Mesial temporal lobe epilepsy (MTLE) is a neurological disorder associated with spontaneous recurrent complex partial seizures and hippocampal sclerosis. Although increased hippocampal neurogenesis has been reported in animal models of MTLE, increased neurogenesis has not been reported in the hippocampus of adult human MTLE cases. Here we showed that cells expressing doublecortin (Dcx), a microtubule-associated protein expressed in migrating neuroblasts, were present in the hippocampus and temporal cortex of the normal and MTLE adult human brain. In particular, increased numbers of Dcx-positive cells were observed in the epileptic compared with the normal temporal cortex. Importantly, 56% of Dcx-expressing cells in the epileptic temporal cortex coexpressed both the proliferative cell marker, proliferating cell nuclear antigen and early neuronal marker, TuJ1, suggesting that they may be newly generated neurons. A subpopulation of Dcx-positive cells in the epileptic temporal cortex also coexpressed the mature neuronal marker, NeuN, suggesting that epilepsy may promote the generation of new neurons in the temporal cortex. This study has identified, for the first time, a novel population of Dcx-positive cells in the adult human temporal cortex that can be upregulated by epilepsy and thus, raises the possibility that these cells may have functional significance in the pathophysiology of epilepsy.

  12. Drug therapy of epileptic seizures among adult epileptic outpatients of University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia

    PubMed Central

    Birru, Eshetie Melese; Shafi, Miftah; Geta, Mestayet

    2016-01-01

    Objective The aim of this study was to assess the practice of pharmacotherapy of epilepsy and its treatment outcomes in adult epileptic outpatients at the University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia. Methods An institution based, retrospective cross-sectional study was conducted from the medical charts of 336 adult epileptic patients at the outpatient epileptic clinic of Neurology Department of University of Gondar Teaching Hospital from May 2014 to April 2015. Reviewing follow-up information from the medical charts was used to evaluate antiepileptic drug (AED) prescribing patterns and treatment outcome. Data were collected by using data collection format and analyzed using SPSS software version 16. Results The most common type of seizure diagnosed was generalized tonic–clonic seizure (n=245, 72.91%). Monotherapy with an AED accounted for 80.35% of the cases, whereas dual therapy and polytherapy with three AED combinations accounted for 16.37% and 3.28%, respectively. The most frequently prescribed AED was phenobarbitone (62.47%) followed by carbamazepine (17.91%). From the total epileptic cases, 277 (82.4%) had well-controlled seizure status in the last three consecutive months. Conclusion Most of the patients were maintained by monotherapy, and largely this was by the older antiepileptic drug, phenobarbitone. Considering the development of pharmacotherapy of epilepsy and other patient related factors, the standard treatment guideline for Ethiopia needs to be revised periodically. PMID:28053533

  13. Quality of life in epileptic patients compared with healthy people

    PubMed Central

    Gholami, Ali; Salarilak, Shaker; Lotfabadi, Pegah; Kiani, Fereshte; Rajabi, Abdolhalim; Mansori, Kamyar; Moosavi Jahromi, Zahra

    2016-01-01

    Background: Epilepsy is a common chronic neurological disorder that has a great impact on people’s lives. Patients with epilepsy are at increased risk for poor Quality of Life (QoL). The objective of this study was to evaluate the QoL of epileptic patients in comparison to healthy persons. Methods: This cross-sectional study was conducted on 52 epileptic patients from Golbu region in Neyshabur (a city in northeast of Iran). Using Short Form Health Survey (SF-36) scale, the data were collected between April and Jun 2012. Every patient were compared with two healthy persons. Epileptic and healthy persons were similar for age, sex and local residence. Pearson’s correlation coefficient and t-independent test applied for data analysis through SPSS v. 16 software. Results: Of 52 epileptic patients, 24 were female (46.2%) and 28 were male (53.8%). The mean±SD age of epileptic patients was 40.92±20.33yr (Rang: 15-86yr). The total mean score of SF- 36 in patient group was 55.88 and in healthy group 68.52and this difference was statistically significant (p<0.001). Among the different subscales of SF-36 in epileptic patients, the highest and the lowest mean scores were found for social functioning and general health subscales, respectively. The mean scores in patient group in comparison to healthy group were lower in all subscales of SF-36 and these differences were statistically significant in all domains (except role limitations due to physical problems domain and role limitations due to emotional problems domain). Conclusion: The study showed that epilepsy disease has an important role in QoL of patients, thus some interventional programs are necessary to improve their QOL. PMID:27493932

  14. Transient epileptic amnesia: clinical report of a cohort of patients.

    PubMed

    Lapenta, Leonardo; Brunetti, Valerio; Losurdo, Anna; Testani, Elisa; Giannantoni, Nadia Mariagrazia; Quaranta, Davide; Di Lazzaro, Vincenzo; Della Marca, Giacomo

    2014-07-01

    Transient epileptic amnesia is a seizure disorder, usually with onset in the middle-elderly and good response to low dosages of antiepileptic drugs. We describe the clinical, electroencephalography (EEG), and neuroimaging features of 11 patients with a temporal lobe epilepsy characterized by amnesic seizures as the sole or the main symptom. We outline the relevance of a detailed clinical history to recognize amnesic seizures and to avoid the more frequent misdiagnoses. Moreover, the response to monotherapy was usually good, although the epileptic disorder was symptomatic of acquired lesions in the majority of patients.

  15. Epileptic drivers--a study of 1,089 patients.

    PubMed

    Beaussart, M; Beaussart-Defaye, J; Lamiaux, J M; Grubar, J C

    1997-01-01

    A longitudinal study of 1,089 epileptic patients followed up by the same specialist between 1965-1991, allowed close observation of the seizures occurring to the patient at the wheel and their consequences and to relate them to detailed epileptological criteria. The results show road accidents caused by epileptic seizures are few and most of them are minor. The repatriation of risks between patients is very uneven. The quality of the neuro-psychic inter-critical state as well as the patients' degree of compliance seem to be more reliable risk indicators than some more traditional criteria like the length of remission between seizures. Although seizures occur more frequently in patients suffering from Complex Partial seizures as opposed to other forms of epileptic seizures, the differences between patients with epilepsy lies mostly in their behaviour and in their own representation of the risks. There is a need for a body of rules and regulations serving as an official framework regulating the driving test. This widely circulated document should take into account the multiplicity of cases, including the small number of patients thought to be dangerous. Its mode of application should allow doctors as well as patients to opt for a realistic attitude based on decision-making criteria involving a thorough knowledge of epilepsy as well as a thorough knowledge of the psychological characteristics of the patient concerned.

  16. Novel STXBP1 mutations in 2 patients with early infantile epileptic encephalopathy.

    PubMed

    Sampaio, Mafalda; Rocha, Ruben; Biskup, Saskia; Leão, Miguel

    2015-04-01

    The authors describe 2 patients with early infantile epileptic encephalopathy caused by 2 novel mutations involving the STXBP1 gene. The authors suggest that in spite of the rarity of STXBP1 mutations, molecular analysis of STXBP1 gene should be performed in patients with early infantile epileptic encephalopathy, after exclusion of ARX mutations in male patients and CDKL5 mutations in female patients. The potential mechanisms explaining the variable clinical phenotypes caused by STXBP1 mutations are discussed and the designation of early-onset epileptic encephalopathies, including an updated genetic classification, is proposed to encompass the epileptic encephalopathies beginning in the first 6 months of life.

  17. Atlanto Axial Rotatory Dislocation in Adults: A Rare Complication of an Epileptic Seizure—Case Report

    PubMed Central

    TARANTINO, Roberto; DONNARUMMA, Pasquale; MAROTTA, Nicola; MISSORI, Paolo; VIOZZI, Ilaria; LANDI, Alessandro; DELFINI, Roberto

    2014-01-01

    Atlanto Axial Rotatory Dislocations (AARDs) are a heterogeneous group of post-traumatic pathologies typical of the pediatric age, and rare in adults. We describe the case of a 34-year-old woman, developing Atlanto Axial Rotatory Fixation (AARF) after a generalized tonic-clonic epileptic seizure, an extremely rare traumatic cause never described in literature. AARF was detected only 1 month after the accident and nonsurgical treatment was attempted at the beginning. The patient underwent surgery only 2 months after the accident. The best treatment should be conservative reduction within 1 month; when it is not possible, it is advisable to perform surgery as soon as possible. C1–C2 fixation with Harm's technique is the gold standard for fixed luxations. Delay of treatment makes intraoperative reduction more difficult and increase the establishment of the chronic permanent change of neck muscles and ligaments. PMID:24201098

  18. [The influence of epileptic predisposition on clinical features of schizophrenia in patients after delirium tremens].

    PubMed

    Dvirskiĭ, A A

    2001-01-01

    153 patients with schizophrenia in combination with alcoholic delirium were examined. Latent epilepsy has been found in 36 patients (23.5%). The basis of the epileptic seizures during alcoholic delirium was hereditary epileptic predisposition. Frequency of the progredient course was high while that of the favourable--recurrent course of schizophrenia was low in these cases.

  19. An improvement in cognitive function following polypharmacy reduction in a group of epileptic patients.

    PubMed

    Ludgate, J; Keating, J; O'Dwyer, R; Callaghan, N

    1985-06-01

    18 epileptic patients on polypharmacy were assessed, using a battery of psychometric tests including the Wechsler Adult Intelligence Scale, Benton Visual Retention Test and Alertness and Concentration tests. The same patients were reassessed one year later following a trial to reduce their polypharmacy. The results for 12 patients whose treatment was reduced to monotherapy were statistically analysed, using the Wilcoxon Matched Pairs Test. Significant changes were found on a number of test scores which included Full Scale WAIS I.Q., W.A.I.S. Performance I.Q., Digit Symbol, Block Design and Object Assembly, Benton Visual Retention Test Error Score and Concentration Test Score. The other tests showed no improvement over baseline. The results point to the improvement in some areas of cognitive function which follows a reduction in polypharmacy to monotherapy.

  20. Treatment with phenobarbital and monitoring of epileptic patients in rural Mali.

    PubMed Central

    Nimaga, K.; Desplats, D.; Doumbo, O.; Farnarier, G.

    2002-01-01

    OBJECTIVE: To assess the efficacy of phenobarbital treatment for epileptic patients in rural Mali. METHODS: Epileptic patients were treated at home with phenobarbital at daily dosages ranging from 50 mg for children to 200 mg for adults and their condition was monitored. Advice was given to patients, their families, and the village authorities in order to achieve compliance. An uninterrupted supply of generic phenobarbital was provided and a rural physician made two follow-up visits to each village to ensure that the drug was taken in the correct doses. The physician gave information to the population, distributed the phenobarbital in sufficient quantities to cover the periods between visits, and monitored the patients' responses to treatment. During the first year the physician visited the patients every two months. The frequency of visits was subsequently reduced to once every four months. FINDINGS: In the six months preceding treatment the average rate of seizures among patients exceeded four per month. After a year of treatment, 80.2% of the patients experienced no seizures for at least five months. A total of 15.7% of patients experienced a reduction in seizures. In many cases no further seizures occurred and there were improvements in physical health, mental health and social status. There were very few side-effects and no cases of poisoning were reported. The cost of treatment per patient per year was 7 US dollars for generic phenobarbital and 8.4 US dollars for logistics. CONCLUSION: Low doses of phenobarbital were very effective against epilepsy. However, there is an urgent need for programmes involving increased numbers of physicians in rural areas and, at the national level, for the inclusion of epilepsy treatment in the activities of health care facilities. Internationally, an epilepsy control programme providing free treatment should be developed. PMID:12163916

  1. Patient-specific connectivity pattern of epileptic network in frontal lobe epilepsy.

    PubMed

    Luo, Cheng; An, Dongmei; Yao, Dezhong; Gotman, Jean

    2014-01-01

    There is evidence that focal epilepsy may involve the dysfunction of a brain network in addition to the focal region. To delineate the characteristics of this epileptic network, we collected EEG/fMRI data from 23 patients with frontal lobe epilepsy. For each patient, EEG/fMRI analysis was first performed to determine the BOLD response to epileptic spikes. The maximum activation cluster in the frontal lobe was then chosen as the seed to identify the epileptic network in fMRI data. Functional connectivity analysis seeded at the same region was also performed in 63 healthy control subjects. Nine features were used to evaluate the differences of epileptic network patterns in three connection levels between patients and controls. Compared with control subjects, patients showed overall more functional connections between the epileptogenic region and the rest of the brain and higher laterality. However, the significantly increased connections were located in the neighborhood of the seed, but the connections between the seed and remote regions actually decreased. Comparing fMRI runs with interictal epileptic discharges (IEDs) and without IEDs, the patient-specific connectivity pattern was not changed significantly. These findings regarding patient-specific connectivity patterns of epileptic networks in FLE reflect local high connectivity and connections with distant regions differing from those of healthy controls. Moreover, the difference between the two groups in most features was observed in the strictest of the three connection levels. The abnormally high connectivity might reflect a predominant attribute of the epileptic network, which may facilitate propagation of epileptic activity among regions in the network.

  2. Recurrent occurrences of CDKL5 mutations in patients with epileptic encephalopathy

    PubMed Central

    Yamamoto, Toshiyuki; Shimojima, Keiko; Kimura, Nobusuke; Mogami, Yukiko; Usui, Daisuke; Takayama, Rumiko; Ikeda, Hiroko; Imai, Katsumi

    2015-01-01

    The cyclin-dependent kinase-like 5 gene (CDKL5) is recognized as one of the genes responsible for epileptic encephalopathy. We identified CDKL5 mutations in five Japanese patients (one male and four female) with epileptic encephalopathy. Although all mutations were of de novo origin, they were located in the same positions as previously reported pathogenic mutations. These recurrent occurrences of de novo mutations in the same loci may indicate hot spots of nucleotide alteration. PMID:27081548

  3. COALESCENCE OF DEEP AND SUPERFICIAL EPILEPTIC FOCI INTO LARGER DISCHARGE UNITS IN ADULT RAT NEOCORTEX

    PubMed Central

    SERAFINI, RUGGERO; ANDRADE, RODRIGO; LOEB, JEFFREY A.

    2016-01-01

    Epilepsy is a disease of neuronal hyper-synchrony that can involve both neocortical and hippocampal brain regions. While much is known about the network properties of the hippocampus little is known of how epileptic neocortical hyper-synchrony develops. We aimed at characterizing the properties of epileptic discharges of a neocortical epileptic focus. We established a multi-electrode-array method to record the spatial patterns of epileptiform potentials in acute adult rat brain slices evoked by 4-Aminopyridine in the absence of magnesium. Locations of discharges mapped to two anatomical regions over the somatosensory cortex and over the lateral convexity separated by a gap at a location matching the dysgranular zone. Focal epileptiform discharges were recorded in superficial and deep neocortical layers but over superficial layers, they exhibited larger surface areas. They were often independent even when closely spaced to one another but they became progressively coupled resulting in larger zones of coherent discharge. The gradual coupling of multiple, independent, closely spaced, spatially restricted, focal discharges between deep and superficial neocortical layers represents a possible mechanism of the development of an epileptogenic zone. PMID:25701714

  4. Oxidative Stress Measurement and Prediction of Epileptic Seizure in Children and Adults With Severe Motor and Intellectual Disabilities

    PubMed Central

    Morimoto, Masahito; Satomura, Shigeko; Hashimoto, Toshiaki; Ito, Etsuro; Kyotani, Shojiro

    2016-01-01

    Background The medical care of severe motor and intellectual disabilities (SMID) depends on the empirical medical care. Epileptic seizure specific to SMID is difficult to suppress using anti-epileptic drugs, and its tendency to persist for long periods poses an issue. The present study was undertaken to evaluate the relationship between epileptic seizure in cases with SMID and oxidative stress in the living body by examining endogenous antioxidants, the degree of oxidation (reactive oxygen metabolites (d-ROMs)), and the biological antioxidant potential (BAP) as indicators. Methods Target patients were 43 SMID epilepsy patients. Blood was sampled before breakfast and medication. As for the specimen, d-ROMs and BAP were measured using the free radical analyzer. Results The present study did not reveal any correlation between endogenous antioxidants (albumin) and the frequency of epileptic seizures. On the other hand, d-ROMs were correlated with the frequency of epileptic seizure. In particular, strong correlations between the frequency of epileptic seizures and the d-ROMs/BAP ratio as well as the BAP/d-ROMs ratio were noted. Conclusions These results indicate that the use of d-ROMs and BAP as biomarkers can provide a tool for predicting the prognosis of epileptic seizures in patients with SMID. PMID:27222671

  5. Synaptic Reorganization of the Perisomatic Inhibitory Network in Hippocampi of Temporal Lobe Epileptic Patients

    PubMed Central

    Wittner, Lucia

    2017-01-01

    GABAergic inhibition and particularly perisomatic inhibition play a crucial role in controlling the firing properties of large principal cell populations. Furthermore, GABAergic network is a key element in the therapy attempting to reduce epileptic activity. Here, we present a review showing the synaptic changes of perisomatic inhibitory neuronal subtypes in the hippocampus of temporal lobe epileptic patients, including parvalbumin- (PV-) containing and cannabinoid Type 1 (CB1) receptor-expressing (and mainly cholecystokinin-positive) perisomatic inhibitory cells, known to control hippocampal synchronies. We have examined the synaptic input of principal cells in the dentate gyrus and Cornu Ammonis region in human control and epileptic hippocampi. Perisomatic inhibitory terminals establishing symmetric synapses were found to be sprouted in the dentate gyrus. Preservation of perisomatic input was found in the Cornu Ammonis 1 and Cornu Ammonis 2 regions, as long as pyramidal cells are present. Higher density of CB1-immunostained terminals was found in the epileptic hippocampus of sclerotic patients, especially in the dentate gyrus. We concluded that both types of (PV- and GABAergic CB1-containing) perisomatic inhibitory cells are mainly preserved or showed sprouting in epileptic samples. The enhanced perisomatic inhibitory signaling may increase principal cell synchronization and contribute to generation of epileptic seizures and interictal spikes. PMID:28116310

  6. Management of a high risk epileptic patient under conscious sedation: A multidisciplinary approach

    PubMed Central

    Chellathurai, Burnice Nalina Kumari; Thiagarajan, Ramakrishnan; Jayakumaran, SelvaKumar; Devadoss, Pradeep; Elavazhagan

    2016-01-01

    Epilepsy, characterized by the risk of recurrent seizures, is a chronic disease that afflicts about 5% of the world's population. The main dental problems associated with epileptic patients include gingival hyperplasia, minor oral injuries, tooth trauma, and prosthodontic problems, which require the dental treatment. Stress and fear are the most common triggering factors for the epilepsy in dental chair. Therefore, a more appropriate method of treating such epileptic patients may be warranted. Conscious sedation is a technique of providing good anesthesia and analgesia to patients, the main advantage of which is the patient's rapid return to presentation levels. Midazolam used as a sedative agent has anticonvulsant properties. This case report highlights a case requiring multiple dental procedures carried out in a high risk epileptic patient under conscious sedation. PMID:27041847

  7. Management of a high risk epileptic patient under conscious sedation: A multidisciplinary approach.

    PubMed

    Chellathurai, Burnice Nalina Kumari; Thiagarajan, Ramakrishnan; Jayakumaran, SelvaKumar; Devadoss, Pradeep; Elavazhagan

    2016-01-01

    Epilepsy, characterized by the risk of recurrent seizures, is a chronic disease that afflicts about 5% of the world's population. The main dental problems associated with epileptic patients include gingival hyperplasia, minor oral injuries, tooth trauma, and prosthodontic problems, which require the dental treatment. Stress and fear are the most common triggering factors for the epilepsy in dental chair. Therefore, a more appropriate method of treating such epileptic patients may be warranted. Conscious sedation is a technique of providing good anesthesia and analgesia to patients, the main advantage of which is the patient's rapid return to presentation levels. Midazolam used as a sedative agent has anticonvulsant properties. This case report highlights a case requiring multiple dental procedures carried out in a high risk epileptic patient under conscious sedation.

  8. Hippocampal body changes in pure partial onset sleep and pure partial onset waking epileptic patients.

    PubMed

    Motamedi, Mahmood; Zandieh, Ali; Hajimirzabeigi, Alireza; Tahsini, Majid; Vakhshiteh, Fatemeh; Rahimian, Elham

    2013-09-01

    The aim of the current study was to evaluate for the first time the hippocampal changes in patients with pure sleep and pure waking epilepsy. A total of 35 patients with pure partial onset sleep epilepsy and 35 patients with pure partial onset waking epilepsy matched for age and sex ratio were enrolled. MR images were analyzed to determine hippocampal body changes. Rounding ratio of hippocampal body was defined as short axis divided by long axis and hippocampal bodies with ratios ≥ 0.70 were considered rounded. Hippocampal sclerosis and atrophy were found in nine (25.7 %) and seven (20.0 %) patients with pure sleep epilepsy, and in 12 (34.3 %) and 11 (31.4 %) patients with pure waking epilepsy, respectively (P > 0.05 for the comparison between sleep and waking epilepsy). However, proportion of subjects with rounded hippocampal bodies (15, 42.9 % vs. 3, 8.6 % for patients with sleep and waking epilepsy, respectively) and rounding ratios of both left and right hippocampal bodies (0.66 ± 0.13 and 0.61 ± 0.12, respectively for left and right hippocampal bodies in sleep epileptic patients vs. 0.57 ± 0.11 and 0.55 ± 0.11, respectively for left and right hippocampal bodies in waking epileptic patients) were increased in patients with sleep epilepsy (P < 0.05). Further, in sleep epileptic patients with left sided hippocampal body rounding, epileptiform discharges were more readily lateralized to the left temporal lobe (P < 0.05). In conclusion, hippocampal sclerosis and atrophy are not different between pure partial onset sleep and waking epileptic patients. However, rounding ratio and frequency of hippocampal body rounding are increased in sleep epileptic patients.

  9. The role of antiepileptic drugs in free radicals generation and antioxidant levels in epileptic patients.

    PubMed

    Eldin, Essam Eldin Mohamed Nour; Elshebiny, Hosam Abdel-Fattah; Mohamed, Tarek Mostafa; Abdel-Aziz, Mohamed Abdel-Azim; El-Readi, Mahmoud Zaki

    2016-01-01

    Many risk factors are encountered during the pathogenesis of epilepsy. In this study, the effect of seizure frequency on free radical generation and antioxidants levels in epileptic patients was evaluated. This study was carried out on 15 healthy controls (GI) and 60 epileptic patients treated with mono- or poly-therapy of carbamazepine, valproic acid, or phenytoin. The treated epileptic patients were divided into 2 main groups according to the seizure frequency: controlled seizure patients GII (n = 30) and uncontrolled seizure patients GIII (n = 30). GII included the GIIA subgroup (n = 15) which had been seizure free for more than 12 months and the GIIB subgroup (n = 15) which had been seizure free for a period from 6 to12 months. GIII included GIIIA (n = 15) and GIIIB (n = 15) for patients which had a seizure frequency of less than and more than four times/month, respectively. In comparison to the control group (GI), the levels of nitric oxide (NO) and malondialdehyde/creatinine ratio were significantly increased in GIIB, GIIIA, and GIIIB, while vitamins A and E levels were significantly decreased in GIIIB. Serum NO levels had significant negative correlations with serum vitamin E in the GIIA and GIIB groups, and with vitamin A in the GIIIA and GIIIB groups. However, serum NO had positive correlation with urinary MDA/Cr ratio. The imbalance between free radical generation and antioxidant system in epileptic patients may be a factor in seizure frequency.

  10. Verbal Memory Compensation: Application to Left and Right Temporal Lobe Epileptic Patients

    ERIC Educational Resources Information Center

    Bresson, Christel; Lespinet-Najib, Veronique; Rougier, Alain; Claverie, Bernard; N'Kaoua, Bernard

    2007-01-01

    This study investigates the compensatory impact of cognitive aids on left and right temporal lobe epileptic patients suffering from verbal memory disorders, who were candidates for surgery. Cognitive aids are defined in the levels-of-processing framework and deal with the depth of encoding, the elaboration of information, and the use of retrieval…

  11. Topiramate-induced paresthesia is more frequently reported by migraine than epileptic patients.

    PubMed

    Sedighi, Behnaz; Shafiei, Kaveh; Azizpour, Iman

    2016-04-01

    Topiramate is an approved and effective drug in migraine prophylaxis. Paresthesia is the most commonly reported side effect. The primary objective of this study was to compare the frequency of topiramate-induced paresthesia in migraine headache to epileptic patients. Patients with migraine without aura and epilepsy were enrolled in this observational study. All cases were interviewed by telephone about their history of paresthesia. Confounding factors were controlled through logistic regression. The odds ratio of developing topiramate-induced paresthesia in migraine compared to epilepsy patients was 3.4. Three factors were independent contributors to developing topiramate-induced paresthesia: female sex (odds ratio 2.1), topiramate dosage (odds ratio 0.3) and duration of therapy. Our findings indicate an independent association between migraine and development of paresthesia. Migraineurs were more likely than epileptic patients to report paresthesia as topiramate adverse effects. Female sex, treatment duration and topiramate dosage contribute significantly to subsequent development of paresthesia.

  12. Mobile phone emission increases inter-hemispheric functional coupling of electroencephalographic α rhythms in epileptic patients.

    PubMed

    Vecchio, Fabrizio; Tombini, Mario; Buffo, Paola; Assenza, Giovanni; Pellegrino, Giovanni; Benvenga, Antonella; Babiloni, Claudio; Rossini, Paolo Maria

    2012-05-01

    It has been reported that GSM electromagnetic fields (GSM-EMFs) of mobile phones modulate - after a prolonged exposure - inter-hemispheric synchronization of temporal and frontal resting electroencephalographic (EEG) rhythms in normal young and elderly subjects (Vecchio et al., 2007, 2010). Here we tested the hypothesis that this can be even more evident in epileptic patients, who typically suffer from abnormal mechanisms governing synchronization of rhythmic firing of cortical neurons. Eyes-closed resting EEG data were recorded in ten patients affected by focal epilepsy in real and sham exposure conditions. These data were compared with those obtained from 15 age-matched normal subjects of the previous reference studies. The GSM device was turned on (45 min) in the "GSM" condition and was turned off (45 min) in the other condition ("sham"). The mobile phone was always positioned on the left side in both patients and control subjects. Spectral coherence evaluated the inter-hemispheric synchronization of EEG rhythms at the following frequency bands: delta (about 2-4 Hz), theta (about 4-6 Hz), alpha1 (about 6-8 Hz), alpha2 (about 8-10 Hz), and alpha3 (about 10-12 Hz). The effects on the patients were investigated comparing the inter-hemispheric EEG coherence in the epileptic patients with the control group of subjects evaluated in the previous reference studies. Compared with the control subjects, epileptic patients showed a statistically significant higher inter-hemispheric coherence of temporal and frontal alpha rhythms (about 8-12 Hz) in the GSM than "Sham" condition. These results suggest that GSM-EMFs of mobile phone may affect inter-hemispheric synchronization of the dominant (alpha) EEG rhythms in epileptic patients. If confirmed by future studies on a larger group of epilepsy patients, the modulation of the inter-hemispheric alpha coherence due to the GSM-EMFs could have clinical implications and be related to changes in cognitive-motor function.

  13. Adult attachment style and childhood interpersonal trauma in non-epileptic attack disorder.

    PubMed

    Holman, Natalie; Kirkby, Antonia; Duncan, Susan; Brown, Richard J

    2008-03-01

    Non-epileptic attack disorder (NEAD) poses a significant clinical problem but is poorly understood. Attachment theory provides a framework for understanding the development and maintenance of NEAD and the contribution of childhood abuse and neglect to these processes. A cross-sectional design was used to study attachment style and early traumatic experiences in individuals with NEAD (N=17) compared to those with epilepsy (N=26). A significant difference in predominant attachment style between the two groups was found, with fearful attachment occurring more frequently in the NEAD group. Abuse and neglect were also significantly more common in the NEAD patients. Both early traumatic experiences and fearful attachment added significantly to the predictive power of a logistic regression equation after controlling for anxiety and dysthymia. The findings suggest a link between disturbed attachment and NEAD and have clinical implications for therapeutic intervention with this group.

  14. Cognitive functions of epileptic patients on monotherapy with phenobarbitone and healthy controls.

    PubMed

    Bigarella, M M; Mäder, M J; Doro, M P; Gorz, A M; Marcourakis, T; Tsanaclis, L; Bittencourt, P R

    1991-06-01

    Quantitative measurements have indicated that heredity, cerebral damage, psycho-social aspects, ictal and inter-ictal phenomena and antiepileptic drugs may interfere in the cognitive dysfunction of epileptic patients. In the present study objective methods included immediate and late recall and recognition of pictures, Stroop test and auditory selection. Twenty patients with symptomatic localized epilepsy aged 17-52 years (27 +/- 10, mean +/- sd) were compared to age and socially matched healthy controls. Patients were on therapeutic serum concentrations (25 +/- 12 mu/ml) of phenobarbitone and had active epilepsy with 1.94 generalized tonic-clonic, 0.85 simple partial and 6.28 complex partial seizures monthly (means). Patients performed worse than controls in all 6 tests (p less than 0.05 to p less than 0.001), indicating a generalized cognitive deficit related to seizures and/or barbiturate therapy. We suggest further studies should be carried out in populations with uniform monotherapeutic regimens and epileptic syndromes in order to isolate factors related to the cognitive dysfunction of epileptic patients.

  15. PRRT2 Mutations Are Related to Febrile Seizures in Epileptic Patients

    PubMed Central

    He, Zheng-Wen; Qu, Jian; Zhang, Ying; Mao, Chen-Xue; Wang, Zhi-Bin; Mao, Xiao-Yuan; Deng, Zhi-Yong; Zhou, Bo-Ting; Yin, Ji-Ye; Long, Hong-Yu; Xiao, Bo; Zhang, Yu; Zhou, Hong-Hao; Liu, Zhao-Qian

    2014-01-01

    Previous studies reported that the proline-rich transmembrane protein 2 (PRRT2) gene was identified to be related to paroxysmal kinesigenic dyskinesia (PKD), infantile convulsions with PKD, PKD with migraine and benign familial infantile epilepsy (BFIE). The present study explores whether the PRRT2 mutation is a potential cause of febrile seizures, including febrile seizures plus (FS+), generalized epilepsy with febrile seizures plus (GEFS+) and Dravet syndrome (DS); thus, it may provide a new drug target for personalized medicine for febrile seizure patients. We screened PRRT2 exons in a cohort of 136 epileptic patients with febrile seizures, including FS+, GEFS+ and DS. PRRT2 genetic mutations were identified in 25 out of 136 (18.4%) febrile seizures in epileptic patients. Five loss-of-function and coding missense mutations were identified: c.649delC (p.R217Efs*12), c.649_650insC (p.R217Pfs*8), c.412C>G (p.Pro138Ala), c.439G>C (p.Asp147His) and c.623C>A (p.Ser208Tyr). PRRT2 variants were probably involved in the etiology of febrile seizures in epileptic patients. PMID:25522171

  16. Epileptic seizure in a patient with an implantable cardioverter-defibrillator: Quo vadis right ventricular lead?

    PubMed

    Wedekind, Horst; Rozhnev, Andrey; Kleine-Katthöfer, Peter; Kranig, Wolfgang

    2016-03-01

    The case of a 77-year-old man admitted for suspected epileptic seizure is reported. Patient history showed implantation of a single-chamber implantable cardioverter-defibrillator (ICD) after cardiac arrest in 2007 with replacement in 2012 due to battery depletion; the patient reported no previous syncope, unconsciousness or seizures. Interrogation records of the ICD showed five ventricular tachyarrhythmia episodes that corresponded to the "seizure". Further examination revealed incorrect position of the RV-lead. Diagnosis was a provoked epileptic seizure due to undersensing of ventricular tachycardia because of improper ICD lead implantation in the coronary sinus. Treatment consisted of implantation of a new device with an additional ICD lead into the right ventricle.

  17. Effects of antiepileptic drugs on the serum folate and vitamin B12 in various epileptic patients.

    PubMed

    Huang, Hong-Li; Zhou, Hao; Wang, Nuan; Yu, Chun-Yu

    2016-10-01

    Epilepsy is a common neurodegenerative disease with an increasing morbidity. Clinical treatment of epilepsy includes symptomatic treatment, etiological treatment, surgery and prevention. The aim of the present study was to determine the effects of antiepileptic drugs (AEDs) on serum folate and vitamin B12 in various epileptic patients, and to examine the correlation between these effects and secondary cerebrovascular events. A total of 68 epileptic patients, diagnosed between May 2012 and May 2014, were included in the present study. The study included 8 cases of autonomic seizures, 10 cases of absence seizures, 13 cases of complex partial seizures, 28 cases of generalized tonic-clonic seizures, and 9 cases of simple partial seizures. The patients received appropriate AED treatment according to the characteristics of epileptic seizure and the treatment guidance. The differences in the serum levels of folate and vitamin B12 in these patients, and the differences in the secondary cerebrovascular events in these patients after 1 year follow-up were analyzed. The difference in the AEDs used by various epileptic patients was statistically significant (P<0.05). The proportion of AED monotherapy in the autonomic seizure group and petit mal group was highest, and the proportion of two AED in combination with the psychomotor seizure, grand mal and simple partial seizure groups was highest. The serum levels of folate and vitamin B12 in these patients following treatment were significantly lower than those prior to treatment (P<0.05). The differences in the serum levels of folate and vitamin B12 in these groups following treatment were not statistically significant (P>0.05). The difference in the incidence of cerebrovascular events in these groups at follow up was not statistically significant (P>0.05). The multifactorial logistic regression analysis revealed that the serum levels of folate and vitamin B12 were the independent risk factors for epilepsy with secondary

  18. Usefulness of MEG magnetometer for spike detection in patients with mesial temporal epileptic focus.

    PubMed

    Enatsu, R; Mikuni, N; Usui, K; Matsubayashi, J; Taki, J; Begum, T; Matsumoto, R; Ikeda, A; Nagamine, T; Fukuyama, H; Hashimoto, N

    2008-07-15

    The present study investigated the sensitivity of magnetoencephalography (MEG) for spikes depending on sensor type in patients with mesial temporal epileptic focus. We recorded MEG in 6 patients with mesial temporal epileptic focus using two sensor types (magnetometer and gradiometer) simultaneously. The number of spikes detected and the corresponding equivalent current dipole (ECD) parameters (distance from the coordinated head center (radius), and dipole moment) were evaluated with respect to sensor type. Among 426 MEG 'consensus spikes' determined by 3 reviewers, 378 spikes satisfied the predetermined criteria for source localization. Comparing ECD parameters, spikes detected by magnetometer alone displayed a smaller radius and larger dipole moment than those detected by gradiometer alone. Spikes estimated in the mesial temporal area were more frequently detected by magnetometer alone (38.5%) than by gradiometer alone (11.5%), whereas spikes in the lateral temporal area were detected less by magnetometer alone (3.7%) than by gradiometer alone (53.9%). The present results suggest that a magnetometer is advantageous for spike detection in patients with mesial temporal epileptic focus. This also implies the higher sensitivity of magnetometer for deep sources.

  19. Non-Attendance of Treatment Review Visits among Epileptic Patients in a Rural District, Zimbabwe

    PubMed Central

    Dewa, Evans; Nyati-Jokomo, Zibusiso; Mafaune, Patron T.; Muteti, Shamiso; Maradzika, Julita

    2014-01-01

    Epilepsy is the most common condition reported through the psychiatric returns surveillance system in Gokwe South District. Review visits attendance is crucial to the successful control of seizures among epilepsy patients. We sought out to establish the attendance pattern of epileptic patients, prevalence of non-attendance and the associated factors. An analytic cross-sectional study was conducted where consenting respondents (N=110) were selected randomly from the district epilepsy register. Interviewer-administered questionnaires were used to collect data. Odds ratios were calculated to determine associations. Logistic regression analysis was done to identify independent risk factors and to control for confounding variables. A total of 110 epileptic patients were included in the study. The patients missed treatment review visits ranging from 1 to 11 of the expected 12 visits between June 2011 and June 2012. Most (70.9%) missed at least 2 visits in a 12month period while 46.4% missed 2 or more consecutive visits. Knowledge of treatment duration [prevalence odds ratio (POR) 0.24 (95% confidence interval (CI) 0.08-0.74)] and high risk perception [POR 0.14 (95% CI: 0.06-0.33)] were associated with a lower likelihood of missing review visits. Barriers such as shortage of drugs [POR 7.09 (95% CI: 3.00-16.72)] and long distances to health facilities [POR 6.63 (95% CI: 2.63-16.76)] were associated with high likelihood of missing two or more review visits consecutively. Shortage of drugs [adjusted odds ratio (AOR) 6.7336 (95% CI: 1.8538-24.4581)] and higher risk perception [AOR 0.1948 (95% CI: 0.0625-0.6071)] remained significant on logistic regression analysis. A high number of epileptic patients miss their review visits mainly owing to shortage of drugs, and long distances from health facilities.

  20. Non-traumatic Thoracic Vertebral Compression Fractures Occurred in a Young Epileptic Patient: A Case Report

    PubMed Central

    Mimata, Yoshikuni; Sato, Kotaro; Oikawa, Ryunosuke; Doita, Minoru

    2016-01-01

    Introduction: The occurrence of non-traumatic vertebral compression fractures (VCFs) in a healthy young male is very rare. We present a rare case of non-traumatic thoracic VCFs in a young epileptic patient. Case Report: A 19-year-old healthy male experienced severe back pain. There had been no significant traumatic event. A radiograph of the spine showed collapsed vertebra at Th6 and Th7 and magnetic resonance image of the spine showed intensity changes at Th6, Th7 and Th8. Bone mineral density (BMD) at the radius was low and urine N-terminal telopeptide (NTx) was very high. The patient was diagnosed with VCFs caused by low BMD. The patient had a medical history of epilepsy and had taken valproate for thirteen years. We instructed the patient to stop taking valproate and to begin taking bisphosphonate. As a result, urine NTx became normal. Conclusion: It was previously reported that valproate reduced BMD in epileptic children and reduction in BMD increased with the duration of valproate therapy. We propose that regular BMD screening and measurement of bone metabolic markers should be conducted for all patients taking long-term antiepileptic drugs to prevent BMD loss and associated fractures. PMID:28116280

  1. K(+)-evoked [(3)H]-norepinephrine release in human brain slices from epileptic and non-epileptic patients is differentially modulated by gabapentin and pinacidil.

    PubMed

    Freiman, Thomas M; Surges, Rainer; Kukolja, Juraj; Heinemeyer, Jan; Klar, Maximilian; van Velthoven, Vera; Zentner, Josef

    2006-06-01

    The modulation of K(+)-evoked [(3)H]-norepinephrine ([(3)H]-NE) release by gabapentin (GBP) and pinacidil (PIN), a known K(ATP) agonist, was examined in human brain slices. We compared the pharmacological effects on NE-release in human epileptic neocortex and epileptic hippocampus to non-epileptic neocortex. GBP (100 microM) decreased [(3)H]-NE release by 22% in non-epileptic neocortical slices, whereas this inhibition was absent in slices from epileptic hippocampus and epileptic neocortex. PIN (10 microM) also reduced [(3)H]-NE release by 30% in non-epileptic neocortical slices and only by 5% in epileptic hippocampal slices. The blockade of voltage-gated calcium channels by omega-conotoxins MVIIA and MVIIC (0.1 microM) reduced [(3)H]-NE release in epileptic and non-epileptic neocortical slices to the same extend. The data show a marked reduction in K(+)-evoked [(3)H]-NE release by GBP and PIN in epileptic hippocampus and neocortex, suggesting an alteration of K(ATP) channel function, whereas the effects of the calcium channel modulators omega-conotoxins MVIIA and MVIIC are similar in both epileptic and non-epileptic neocortex.

  2. [The structural and functional neurovisualization in patients with epileptic seizures in cerebro-vascular diseases].

    PubMed

    Bazilevich, S N; Odinak, M M; Dyskin, D E; Krasakov, I V; Fokin, V A; P'ianov, I V; Dekan, V S; Okol'zin, A V; Pozdniakov, A V; Stanzhevskiĭ, A A

    2008-01-01

    The results of the dynamic study of patients with epileptic seizures in chronic and acute cerebral vascular pathology are presented. Various methods of structural and functional neurovisualization--magnetic resonance tomography using perfusion- and diffusion-weighted imaging, proton magnetic resonance spectroscopy, positron emission tomography, single photon emission computed tomography were used. Based on the results obtained in the study, the authors discuss etiopathogenetic variants of the development of these seizures and new possible approaches to the complex treatment besides the administration of antiepileptic medications.

  3. A patient with epileptic psychosis who had rare acute episodic symptoms☆

    PubMed Central

    Horinouchi, Toru; Oyanagi, Yuka; Umemoto, Yuka; Hosokawa, Yoshiyuki; Honma, Hiroshi; Matsubara, Shigehiro

    2014-01-01

    This is a case report of a 38-year-old woman with temporal lobe epilepsy and epileptic psychoses. The psychoses consisted of three rare symptoms that were “a distortion in the sense of time,” “what should be there disappears,” and “the next scene is supposed to be in a particular way.” There have been few reports that included these symptoms; therefore, we report the course of this patient in detail. PMID:25667891

  4. Thalamocortical relationship in epileptic patients with generalized spike and wave discharges — A multimodal neuroimaging study

    PubMed Central

    Zhang, Clara Huishi; Sha, Zhiyi; Mundahl, John; Liu, Sa; Lu, Yunfeng; Henry, Thomas R.; He, Bin

    2015-01-01

    Unlike focal or partial epilepsy, which has a confined range of influence, idiopathic generalized epilepsy (IGE) often affects the whole or a larger portion of the brain without obvious, known cause. It is important to understand the underlying network which generates epileptic activity and through which epileptic activity propagates. The aim of the present study was to investigate the thalamocortical relationship using non-invasive imaging modalities in a group of IGE patients. We specifically investigated the roles of the mediodorsal nuclei in the thalami and the medial frontal cortex in generating and spreading IGE activities. We hypothesized that the connectivity between these two structures is key in understanding the generation and propagation of epileptic activity in brains affected by IGE. Using three imaging techniques of EEG, fMRI and EEG-informed fMRI, we identified important players in generation and propagation of generalized spike-and-wave discharges (GSWDs). EEG-informed fMRI suggested multiple regions including the medial frontal area near to the anterior cingulate cortex, mediodorsal nuclei of the thalamus, caudate nucleus among others that related to the GSWDs. The subsequent seed-based fMRI analysis revealed a reciprocal cortical and bi-thalamic functional connection. Through EEG-based Granger Causality analysis using (DTF) and adaptive DTF, within the reciprocal thalamocortical circuitry, thalamus seems to serve as a stronger source in driving cortical activity from initiation to the propagation of a GSWD. Such connectivity change starts before the GSWDs and continues till the end of the slow wave discharge. Thalamus, especially the mediodorsal nuclei, may serve as potential targets for deep brain stimulation to provide more effective treatment options for patients with drug-resistant generalized epilepsy. PMID:26448912

  5. Characterization of a de novo SCN8A mutation in a patient with epileptic encephalopathy

    PubMed Central

    de Kovel, Carolien G.F.; Meisler, Miriam H.; Brilstra, Eva H.; van Berkestijn, Frederique M.C.; van ‘t Slot, Ruben; van Lieshout, Stef; Nijman, Isaac J; O'Brien, Janelle E.; Hammer, Michael F.; Estacion, Mark; Waxman, Stephen G.; Dib-Hajj, Sulayman D.; Koeleman, Bobby P.C.

    2015-01-01

    Objective Recently, de novo SCN8A missense mutations have been identified as a rare dominant cause of epileptic encephalopathies. Functional studies on the first described case demonstrated gain-of-function effects of the mutation. We describe a novel de novo mutation of SCN8A in a patient with epileptic encephalopathy, and functional characterization of the mutant protein. Design Whole exome sequencing was used to discover the variant. We generated a mutant cDNA, transfected HEK293 cells, and performed Western blotting to assess protein stability. To study channel functional properties, patch-clamp experiments were carried out in transfected neuronal ND7/23 cells. Results The proband exhibited seizure onset at 6 months of age, diffuse brain atrophy, and more profound developmental impairment than the original case. The mutation p.Arg233Gly in the voltage sensing transmembrane segment D1S4 was present in the proband and absent in both parents. This mutation results in a temperature-sensitive reduction in protein expression as well as reduced sodium current amplitude and density and a relative increased response to a slow ramp stimulus, though this did not result in an absolute increased current at physiological temperatures. Conclusion The new de novo SCN8A mutation is clearly deleterious, resulting in an unstable protein with reduced channel activity. This differs from the gain-of-function attributes of the first SCN8A mutation in epileptic encephalopathy, pointing to heterogeneity of mechanisms. Since Nav1.6 is expressed in both excitatory and inhibitory neurons, a differential effect of a loss-of-function of Nav1.6 Arg223Gly on inhibitory interneurons may underlie the epilepsy phenotype in this patient. PMID:25239001

  6. Biclustering EEG data from epileptic patients treated with vagus nerve stimulation

    NASA Astrophysics Data System (ADS)

    Busygin, Stanislav; Boyko, Nikita; Pardalos, Panos M.; Bewernitz, Michael; Ghacibeh, Georges

    2007-11-01

    We present a pilot study of an application of consistent biclustering to analyze scalp EEG data obtained from epileptic patients undergoing treatment with a vagus nerve stimulator (VNS). The ultimate goal of this study is to develop a physiologic marker for optimal VNS parameters (e.g. output current, signal frequency, etc.) using measures of scalp EEG signals. A time series of STLmax values was computed for each scalp EEG channel recorded from two epileptic patients and used as a feature of the two datasets. The averaged samples from stimulation periods were then separated from averaged samples from non-stimulation periods by feature selection performed within the consistent biclustering routine. The obtained biclustering results allow us to assume that signals from certain parts of the brain consistently change their characteristics when VNS is switched on and could provide a basis for desirable VNS stimulation parameters. A physiologic marker of optimal VNS effect could greatly reduce the cost, time, and risk of calibrating VNS stimulation parameters in newly implanted patients compared to the current method of clinical response.

  7. Correlation between secondary thrombosis in epileptic patients and serum levels of folate and vitamin B12.

    PubMed

    Zhou, Hao; Huang, Hong-Li; Wang, Nuan; Pang, Xiao-Hu

    2016-10-01

    Epilepsy is a chronic brain dysfunction syndrome and nervous system disease whose pathogenesis remains to be determined. The aim of the present study was to analyze the correlation between secondary thrombosis and the serum levels of folate and vitamin B12 in epileptic patients, as well as to determine whether the supplementation of folate and vitamin B12 was associated with a decreased incidence of thrombosis, and provide the basis for novel clinical treatment. A total of 37 patients, diagnosed as epileptic with secondary thrombosis between April 2012 and April 2014, were included in the treatment group. A total of 37 epileptic patients without secondary thrombosis were included in the control group. The serum levels of homocysteine, folate and vitamin B12 in the two groups and in the epileptic patients with intracranial thrombosis or peripheral thrombosis were compared. According to the Guidance of Epilepsy, the patients in the two groups were administered antiepileptic drugs (AEDs) with the supplementation of folate tablet (0.4 mg/day) and vitamin B12 tablet (100 µg/day). These indicators and the incidence of thrombosis in the two groups were compared after 1 year. The serum levels of homocysteine in the two groups were higher than normal, and the levels in the treatment group were significantly higher than those in the control group. The serum levels of folate and vitamin B12 in the treatment group were significantly higher than those in the control group and the difference was statistically significant (P<0.05). The Pearson correlation analysis revealed that the serum levels of folate and vitamin B12 were not associated with the serum level of homocysteine (P>0.05). The logistic regression analysis revealed that the serum levels of folate and vitamin B12 were independent risk factors for epilepsy with secondary thrombosis [folate: odds ratio (OR)=0.635, P=0.038; vitamin B12: OR=0.418, P=0.042]. The differences in the serum levels of homocysteine, folate and

  8. Epileptic homocide: a case report.

    PubMed

    Gunn, J

    1978-05-01

    This case report augments a paper published in 1971 (Gunn and Fenton) in which it was indicated that automatic behaviour is a rare explanation for the crimes of epileptic patients. It was claimed that although two possible "automatic" crimes were committed by two epileptic patients among the 46 male epileptics at Broadmoor there were no such crimes committed by any of the 158 male epileptic prisoners who came into a national sample. Since then it has become clear that one man serving life imprisonment, exluded from the epileptic prisoner sample in 1967 because of a doubt about his diagnosis, is definitely epileptic and probably killed his wife during an epileptic attack or its immediate sequela.

  9. [The role of the nurse in the patient education of young epileptic patients].

    PubMed

    Danse, Marion; Goujon, Estelle

    2015-01-01

    An epileptic seizure in a child is a major source of anxiety and turns the family's everyday life upside down. Through therapeutic education, the nurse guides the families towards the autonomous management of the seizures, antiepileptic treatments, adaptations to daily life and potential comorbidities.

  10. Refractory epileptic seizures due to vitamin B6 deficiency in a patient with Parkinson's disease under duodopa® therapy.

    PubMed

    Skodda, Sabine; Müller, Thomas

    2013-02-01

    Levodopa/carbidopa intestinal gel (LCIG) infusion for the treatment of advanced Parkinson's disease (PD) has been suspected to provoke polyneuropathy in conjunction with vitamin B6, B12 and folate deficiency and elevated homocysteine levels. We describe a PD patient under LCIG therapy developing refractory epileptic seizures obviously promoted by vitamin B6 deficiency.

  11. Dissociative experiences and quality of life in patients with non-epileptic attack disorder.

    PubMed

    Mitchell, James W; Ali, Fizzah; Cavanna, Andrea E

    2012-11-01

    Dissociative experiences are commonly reported by patients with non-epileptic attack disorder (NEAD). This cross-sectional study examined the prevalence and characteristics of dissociative experiences in patients with NEAD and assessed their association with health-related quality of life (HRQoL). Fifty-three patients diagnosed with NEAD were consecutively recruited (70.0% female, mean age=42 years, 22.0% with comorbid epilepsy) from a specialist neuropsychiatric clinic. Our sample reported high levels of dissociative experiences, with 36.7% of patients scoring ≥30 on the Dissociative Experiences Scale (DES). Significant negative correlations were found between total DES scores and HRQoL, as measured by the QOLIE-31 questionnaire (r=-0.64, p<0.001). This association remained significant when accounting for symptoms of depression and anxiety, other psychiatric comorbidities, and attack frequency and severity. These findings suggest a high prevalence of dissociative experiences in this patient population, highlighting the importance of routinely screening patients for dissociative symptoms and their impact on patients' lives.

  12. Seizure, Fit or Attack? The Use of Diagnostic Labels by Patients with Epileptic or Non-Epileptic Seizures

    ERIC Educational Resources Information Center

    Plug, Leendert; Sharrack, Basil; Reuber, Markus

    2010-01-01

    We present an analysis of the use of diagnostic labels such as "seizure", "attack", "fit", and "blackout" by patients who experience seizures. While previous research on patients' preferences for diagnostic terminology has relied on questionnaires, we assess patients' own preferences and their responses to a doctor's use of different labels…

  13. An incident case-referent study of epileptic seizures in adults.

    PubMed

    Forsgren, L; Nyström, L

    1990-01-01

    An epidemiological community-based study of incident cases with non-provoked epileptic seizures, using case-referent methodology, was carried out to explore possible risk factors for epileptic seizures. 83 cases, between 17 and 74 years of age, of whom 67.4% had seizures of localized onset, were compared with 2 age- and sex-matched referents. Higher birth weight, movement disabilities, mental retardation, head trauma, brain tumor, depression, a period of unemployment during the previous 6 months and a history of epilepsy in relatives were more common in cases than in referent subjects. No difference was found in the socioeconomic factors investigated, except that the cases belonged to smaller households. Prematurity, home or hospital birth, parents' age at birth of cases or referents, febrile convulsions in relatives, various infections including meningitis and encephalitis, cerebrovascular disease, and alcohol, tobacco, sleep and nutritional habits were not found to be associated with development of seizures. The recent life events investigated, at home or at work, occurred as often in cases as in referents, except that significantly fewer cases had received any increase in salary during the last 6 months. The relationship between depression and development of seizures should be explored further. Moreover, the possibility of false negative results should be considered because of the sample size.

  14. Assessment of colour vision in epileptic patients exposed to single-drug therapy.

    PubMed

    López, L; Thomson, A; Rabinowicz, A L

    1999-01-01

    Diplopia, blurred vision and colour disturbances are well-known side effects associated with anti-epileptic drugs (AEDs). Farnsworth-Munsell 100-hue colour test (F-100) is an accepted and sensitive tool to detect changes in colour perception. To determine the impact of AEDs upon colour vision, we evaluated 37 consecutive patients with complex partial seizures exposed to monotherapy with phenytoin (PHT, carbamazepine (CBZ) or valproic acid (VPA). All had normal IQ and no congenital disturbances in colour vision or ocular diseases. Twenty normal controls were used for statistical analysis. Thirteen patients were exposed to PHT, 12 to CBZ and 12 to VPA. Visual colour perception was impaired in 30/37 (82%) of the study group. The most significant abnormality was detected in the blue-yellow axis in 10/13 patients exposed to PHT (p < 0.02) and in 8/12 treated with CBZ (p < 0.009). In 8/12 patients taking VPA, no significant abnormality was observed (p < 0.06). None of the studied patients complained of colour vision disturbances. Our findings strongly support the negative effect of AEDs upon colour vision discrimination, most likely due to changes at the retinal processing level. F-100 proved to be very useful to assess early toxicity due to AEDs.

  15. Cerebral perfusion alterations in epileptic patients during peri-ictal and post-ictal phase: PASL vs DSC-MRI.

    PubMed

    Pizzini, Francesca B; Farace, Paolo; Manganotti, Paolo; Zoccatelli, Giada; Bongiovanni, Luigi G; Golay, Xavier; Beltramello, Alberto; Osculati, Antonio; Bertini, Giuseppe; Fabene, Paolo F

    2013-07-01

    Non-invasive pulsed arterial spin labeling (PASL) MRI is a method to study brain perfusion that does not require the administration of a contrast agent, which makes it a valuable diagnostic tool as it reduces cost and side effects. The purpose of the present study was to establish the viability of PASL as an alternative to dynamic susceptibility contrast (DSC-MRI) and other perfusion imaging methods in characterizing changes in perfusion patterns caused by seizures in epileptic patients. We evaluated 19 patients with PASL. Of these, the 9 affected by high-frequency seizures were observed during the peri-ictal period (within 5hours since the last seizure), while the 10 patients affected by low-frequency seizures were observed in the post-ictal period. For comparison, 17/19 patients were also evaluated with DSC-MRI and CBF/CBV. PASL imaging showed focal vascular changes, which allowed the classification of patients in three categories: 8 patients characterized by increased perfusion, 4 patients with normal perfusion and 7 patients with decreased perfusion. PASL perfusion imaging findings were comparable to those obtained by DSC-MRI. Since PASL is a) sensitive to vascular alterations induced by epileptic seizures, b) comparable to DSC-MRI for detecting perfusion asymmetries, c) potentially capable of detecting time-related perfusion changes, it can be recommended for repeated evaluations, to identify the epileptic focus, and in follow-up and/or therapy-response assessment.

  16. Simultaneous impairment of neuronal and metabolic function of mutated gephyrin in a patient with epileptic encephalopathy.

    PubMed

    Dejanovic, Borislav; Djémié, Tania; Grünewald, Nora; Suls, Arvid; Kress, Vanessa; Hetsch, Florian; Craiu, Dana; Zemel, Matthew; Gormley, Padhraig; Lal, Dennis; Myers, Candace T; Mefford, Heather C; Palotie, Aarno; Helbig, Ingo; Meier, Jochen C; De Jonghe, Peter; Weckhuysen, Sarah; Schwarz, Guenter

    2015-12-01

    Synaptic inhibition is essential for shaping the dynamics of neuronal networks, and aberrant inhibition plays an important role in neurological disorders. Gephyrin is a central player at inhibitory postsynapses, directly binds and organizes GABAA and glycine receptors (GABAARs and GlyRs), and is thereby indispensable for normal inhibitory neurotransmission. Additionally, gephyrin catalyzes the synthesis of the molybdenum cofactor (MoCo) in peripheral tissue. We identified a de novo missense mutation (G375D) in the gephyrin gene (GPHN) in a patient with epileptic encephalopathy resembling Dravet syndrome. Although stably expressed and correctly folded, gephyrin-G375D was non-synaptically localized in neurons and acted dominant-negatively on the clustering of wild-type gephyrin leading to a marked decrease in GABAAR surface expression and GABAergic signaling. We identified a decreased binding affinity between gephyrin-G375D and the receptors, suggesting that Gly375 is essential for gephyrin-receptor complex formation. Surprisingly, gephyrin-G375D was also unable to synthesize MoCo and activate MoCo-dependent enzymes. Thus, we describe a missense mutation that affects both functions of gephyrin and suggest that the identified defect at GABAergic synapses is the mechanism underlying the patient's severe phenotype.

  17. The relationship between pharmacokinetic parameters of carbamazepine and therapeutic response in epileptic patients

    PubMed Central

    Hassine, Anis; Laouani, Aicha; Amor, Sana Ben; Nouira, Manel; Ammou, Sofiène Ben

    2016-01-01

    Introduction The prescribed dose and carbamazepine plasma concentration to achieve the optimal therapeutic efficacy are highly variable from one patient to the other. Our study aimed to determine whether biological parameters may be used as plasma markers that can individually adjust the carbamazepine dose necessary to optimize therapeutic efficacy. Material and methods Ninety-four epileptic patients under carbamazepine monotherapy and who have never used combination therapy were recruited from the consecutive admissions at the Department of Neurology “CHU Sahloul” of Sousse Central Hospital in Tunisia from February 2010 to April 2011. The patients were monitored for epilepsy for three years on average. Carbamazepine and 10,11-epoxide-carbamazepine concentrations were analyzed through high-performance liquid chromatography. Simultaneously, therapeutic efficacy was assessed through the annual number of seizures in each patient. Results Our results showed the absence of any significant correlations between specific dose (mg/kg/day), carbamazepine plasma concentrations and therapeutic efficacy (r = 0.0025, p = 0.30; r = 0.1584, p = 0.38 respectively), whereas both plasma 10,11-epoxide-carbamazepine concentration and 10,11-epoxide-carbamazepine to plasma carbamazepine ratio were closely correlated with therapeutic efficacy (r = 0.34, p = 0.03; r = 0.45, p = 0.008 respectively). The optimum therapeutic response was observed among patients who simultaneously had a plasma concentration of 0.8 μg/ml of metabolite and 5.5 μg/ml of carbamazepine. Conclusions The results suggest that plasma levels of both carbamazepine and of 10,11-epoxide-carbamazepine must be set to achieve an optimum therapeutic response.

  18. Progress in autoimmune epileptic encephalitis

    PubMed Central

    Wright, S.; Vincent, A.

    2016-01-01

    Purpose of review Autoimmune epileptic encephalopathy is a potentially treatable neurological syndrome characterized by the coexistence of a neuronal antibody in the CSF and serum. Patients present with combinations of seizures, neuropsychiatric features, movement disorder and cognitive decline, but some patients have isolated seizures either at first presentation or during their illness. This review summarises our current understanding of the roles of specific neuronal antibodies in epilepsy-related syndromes and aims to aid the clinician in diagnosis and treatment. Recent findings Antigen discovery methods in three neuroimmunology centres independently identified antibodies to different subunits of the GABAA receptor; high levels of these antibodies were found mainly in patients with severe refractory seizures. These and other antibodies were also found in a proportion (<10%) of children and adults with epilepsy. A clinical study comparing immunotherapy in patients with autoantibodies or without an identified target antigen found neuroinflammatory features were predictive of a therapeutic response. New in-vitro and in-vivo studies, and spontaneous animal models, have confirmed the pathogenicity and epileptogenicity of neuronal antibodies and their relevance to other mammals. Summary Neuronal antibodies are an important cause of autoimmune epileptic encephalopathy, early recognition is important as there may be an underlying tumour, and early treatment is associated with a better outcome. In the absence of an antibody, the clinician should adopt a pragmatic approach and consider a trial of immunotherapy when other causes have been excluded. PMID:26886357

  19. Epileptic Patients are at Risk of Cardiac Arrhythmias: A Novel Approach using QT-nomogram, Tachogram, and Cardiac Restitution Plots

    PubMed Central

    Al-Nimer, Marwan S.; Al-Mahdawi, Sura A.; Abdullah, Namir M.; Al-Mahdawi, Akram

    2017-01-01

    Background: Sudden death is reported in patients who had a history of epilepsy and some authors believed that is due to cardiac arrhythmias. Objectives: This study aimed to predict that the epileptic patients are at risk of serious cardiac arrhythmias by QT-nomogram, tachogram (Lorenz), and cardiac restitution plots. Methods: A total number of 71 healthy subjects (Group I) and 64 newly diagnosed epileptic patients (Group II) were recruited from Al-Yarmouk and Baghdad Teaching hospitals in Baghdad from March 2015 to July 2015 and included in this study. The diagnosis of epilepsy achieved clinically, electroencephalograph record and radio-images including computerized tomography and magnetic image resonance. At the time of entry into the study, an electrocardiography (ECG) was done, and the determinants of each ECG record were calculated. The QT-nomogram, tachogram, and cardiac restitution plots were used to identify the patients at risk of cardiac arrhythmias. Results: Significant prolonged corrected QT corrected (QTc) and JT corrected intervals were observed in female compared with male at age ≥50 years while the TQ interval was significantly prolonged in males of Group II. Eight patients of Group II had a significant pathological prolonged QTc interval compared with undetectable finding in Group I. QT nomogram did not disclose significant findings while the plots of Lorenz and restitution steepness disclose that the patients of Group II were vulnerable to cardiac arrhythmias. Abnormal ECG findings were observed in the age extremities (≤18 years and ≥50 years) in Group II compared with Group I. Conclusion: Utilization of QT-nomogram, restitution steepness, and tachogram plots is useful tools for detection subclinical vulnerable epileptic patient with cardiac arrhythmias. PMID:28149075

  20. Investigation of Anti-Toxocara Antibodies in Epileptic Patients and Comparison of Two Methods: ELISA and Western Blotting

    PubMed Central

    Zibaei, Mohammad; Firoozeh, Farzaneh; Bahrami, Parviz; Sadjjadi, Seyed Mahmoud

    2013-01-01

    The relationship between Toxocara infection and epilepsy was previously demonstrated by several case-control studies and case reports. These previous studies were often based on the enzyme-linked immunosorbent assay (ELISA) using Toxocara excretory-secretory antigens, which are not specific due to cross-reactivity with other parasitic infections such as ascariasis, trichuriasis, and anisakiasis. An immunoblot analysis is highly specific and can detect low levels of Toxocara antibodies. Therefore, this assay may be useful in the identification of toxocariasis in epileptic patients. We examined patients who had epilepsy and healthy subjects for seropositivity for Toxocara infection by ELISA and Western blotting. Out of 85 epileptic patients, 10 (11.8%) and 3 (3.5%) persons exhibited Toxocara immunoglobulin G (IgG) antibodies responses by ELISA and by both techniques, respectively. Moreover, in the healthy group (n = 85), 3 (3.5%) persons were positive by ELISA, but none was detected by Western blotting. This study indicates that Toxocara infection is a risk factor for epilepsy in Iran. These findings strongly suggest the need to perform Western blotting immunodiagnosis, as well as the ELISA using Toxocara excretory-secretory antigens, to improve diagnosis of human toxocariasis in patients with epilepsy. PMID:23710354

  1. Patient-Specific Detection of Cerebral Blood Flow Alterations as Assessed by Arterial Spin Labeling in Drug-Resistant Epileptic Patients

    PubMed Central

    Boscolo Galazzo, Ilaria; Storti, Silvia Francesca; Del Felice, Alessandra; Pizzini, Francesca Benedetta; Arcaro, Chiara; Formaggio, Emanuela; Mai, Roberto; Chappell, Michael; Beltramello, Alberto; Manganotti, Paolo

    2015-01-01

    Electrophysiological and hemodynamic data can be integrated to accurately and precisely identify the generators of abnormal electrical activity in drug-resistant focal epilepsy. Arterial Spin Labeling (ASL), a magnetic resonance imaging (MRI) technique for quantitative noninvasive measurement of cerebral blood flow (CBF), can provide a direct measure of variations in cerebral perfusion associated with the epileptic focus. In this study, we aimed to confirm the ASL diagnostic value in the identification of the epileptogenic zone, as compared to electrical source imaging (ESI) results, and to apply a template-based approach to depict statistically significant CBF alterations. Standard video-electroencephalography (EEG), high-density EEG, and ASL were performed to identify clinical seizure semiology and noninvasively localize the epileptic focus in 12 drug-resistant focal epilepsy patients. The same ASL protocol was applied to a control group of 17 healthy volunteers from which a normal perfusion template was constructed using a mixed-effect approach. CBF maps of each patient were then statistically compared to the reference template to identify perfusion alterations. Significant hypo- and hyperperfused areas were identified in all cases, showing good agreement between ASL and ESI results. Interictal hypoperfusion was observed at the site of the seizure in 10/12 patients and early postictal hyperperfusion in 2/12. The epileptic focus was correctly identified within the surgical resection margins in the 5 patients who underwent lobectomy, all of which had good postsurgical outcomes. The combined use of ESI and ASL can aid in the noninvasive evaluation of drug-resistant epileptic patients. PMID:25946055

  2. The effects of Mozart's music on interictal activity in epileptic patients: systematic review and meta-analysis of the literature.

    PubMed

    Dastgheib, Samaneh Sadat; Layegh, Parvaneh; Sadeghi, Ramin; Foroughipur, Mohsen; Shoeibi, Ali; Gorji, Ali

    2014-01-01

    Mozart's music has been shown to have promising effects on nervous system functions. In this study, the effects of Mozart's work on epilepsy were reviewed. Articles were obtained from a variety of sources. The results of 12 studies were extracted. Three different meta-analyses were performed to examine (i) the percentage of patients who had changes in their interictal epileptic discharges (IEDs) by music therapy; and the changes of IEDs (ii) during and (iii) after exposure to Mozart's music. Data analysis indicated that 84% of patients listening to Mozart's music showed a significant decrease in IEDs. In addition, IEDs were decreased during (31.24%) and after (23.74%) listening to Mozart's compositions. A noteworthy response to music therapy in patients with a higher intelligence quotient, generalized or central discharges, and idiopathic epilepsy was demonstrated. The effect of Mozart's music on epilepsy seems to be significant. However, more randomized control studies are needed to determine its clinical efficacy.

  3. [ECG characteristics in epilepsy of homo- and heterospecific hereditary origin and schizophrenia with latent epileptic predisposition].

    PubMed

    Dvirskiĭ, A G; Shevtsov, A G; Glasner, A K; Dubrovin, Iu B; Krut'ko, Iu A; Svaĭdan, S

    1991-01-01

    The EEG data were compared among 260 epileptic patients, including 94 patients loaded with schizophrenia, 71 patients loaded with epilepsy, 95 patients without revealed hereditary loading with mental diseases, and among 32 schizophrenics in whom epileptic seizures could be seen during insulin therapy. Hereditary loading with epilepsy or schizophrenia in epileptic patients together with latent epileptic schizophrenia ++predisposition influence the characteristics of the electroencephalogram.

  4. Lateral asymmetry of eye movements in temporal lobe epileptic patients with unilateral foci.

    PubMed

    Sonobe, N; Kanno, M; Ito, M; Uchiyama, M; Takahashi, Y; Yashima, Y; Kumashiro, H

    1991-12-01

    Eye movements in response to visual stimuli (Benton Visual Retention Test) were examined in 22 temporal lobe epileptics (TLEs), 10 primary generalized epileptics (PGEs), and 20 normal controls. In the normal controls, the percent fixation time on the left peripheral figure was higher than that on the right peripheral figure, a tendency also found in the PGEs. In TLEs with right-sided foci, the percent fixation time on the left peripheral figure was higher than that on the right peripheral figure, the direction of asymmetry found in the normal controls and PGEs. However, when calculated as laterality indices (the degree of asymmetry) TLEs with right-sided foci were significantly more negative than those of both the normal controls and PGEs. In TLEs with left sided foci, the percent fixation time on the right peripheral figure tended to be higher than that on the left peripheral figure, an asymmetry which differed significantly from the normal controls, PGEs and the TLEs with right-sided foci. The results here showed that TLEs with unilateral foci had distinct eye movements which varied with the laterality of the lesion in the direction of functional overactivation of the epileptogenic hemisphere.

  5. Altered Expression of CXCL13 and CXCR5 in Intractable Temporal Lobe Epilepsy Patients and Pilocarpine-Induced Epileptic Rats.

    PubMed

    Li, Ruohan; Ma, Limin; Huang, Hao; Ou, Shu; Yuan, Jinxian; Xu, Tao; Yu, Xinyuan; Liu, Xi; Yang, Juan; Chen, Yangmei; Peng, Xi

    2017-02-01

    The mechanisms that underlie the pathogenesis of epilepsy are still unclear. Recent studies have indicated that inflammatory processes occurring in the brain are involved in a common and crucial mechanism in epileptogenesis. C-X-C motif chemokine ligand 13 (CXCL13) and its only receptor, C-X-C motif chemokine receptor 5 (CXCR5), are highly expressed in the central nervous system (CNS) and participate in inflammatory responses. The present study aimed to assess the expression of CXCL13 and CXCR5 in the brain tissues of both patients with intractable epilepsy (IE) and a rat model (lithium-pilocarpine) of temporal lobe epilepsy (TLE) to identify possible roles of the CXCL13-CXCR5 signaling pathway in epileptogenesis. Real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemical, double-labeled immunofluorescence and Western blot analyses were performed in this study. CXCL13 and CXCR5 mRNA expression and protein levels were found to be significantly up-regulated in the TLE patients and TLE rats. Further, CXCL13 and CXCR5 protein levels were altered during the different epileptic phases after onset of status epilepticus (SE) in the pilocarpine model rats, including the acute phase (6, 24, and 72 h), latent phase (7 and 14 days) and chronic phase (30 and 60 days groups). Moreover, double-labeled immunofluorescence analysis revealed that CXCL13 was mainly expressed in the cytomembranes and cytoplasm of neurons and astrocytes, while CXCR5 was mainly expressed in the cytomembranes and cytoplasm of neurons. Thus, the CXCL13-CXCR5 signaling pathway may play a possible pathogenic role in IE. CXCL13 and CXCR5 may represent potential biomarkers of brain inflammation in epileptic patients.

  6. The Investigation of Insulin Resistance in Two Groups of Epileptic Patients Treated with Sodium Valproate and Carbamazepine

    PubMed Central

    Najafi, Mohammad Reza; Bazooyar, Bahareh; Zare, Mohammad; Aghaghazvini, Mohammad Reza; Ansari, Behnaz; Rajaei, Ali; Dashti, Masoumeh

    2017-01-01

    Background: Valproic acid (VPA) is a widely used broad-spectrum antiepileptic drug for therapy of generalized and focal epilepsies. Cross-sectional studies have suggested that valproate treatment may be associated with hyperinsulinemia. We decided to investigate hyperinsulinemia as a health-threatening side effect of VPA in Iranian epileptic patients. Materials and Methods: Body mass index (BMI), lipid profile, fasting serum insulin, fasting blood glucose (FBS), and homeostatic model assessment-insulin resistance (HOMA-IR) were measured in 30 VPA-treated epileptic patients and 30 controls (CBZ-treated). The Chi-square test, t-test, and Pearson correlation test were used. Results: BMI was higher in VPA group than in control group (25.7 ± 3.5 > 21.7 ± 4.1) (0.000 < 0.05). Prevalence of obesity was 16.6% in VPA group that was almost the same and even lower than general Iranian population. Serum triglyceride (TG) (150 ± 77.2) was higher than CBZ group (114 ± 35.2) (P = 0.023 < 0.05). However, serum high-density lipoprotein level was lower in VPA group than controls (45.2 ± 11.7 < 54.4 ± 13.9) (P = 0.008 < 0.05). Serum insulin, FBS, HOMA-IR, cholesterol, and low-density lipoprotein did not demonstrate statistically significant differences between the two groups (P > 0.05). Conclusion: Despite the majority of previous studies that are against VPA and according to our study, VPA could be prescribed safely and it may not cause IR and its complications.

  7. Carbamazepine pharmacokinetics are not affected by zonisamide: in vitro mechanistic study and in vivo clinical study in epileptic patients.

    PubMed

    Ragueneau-Majlessi, Isabelle; Levy, Rene H; Bergen, Donna; Garnett, William; Rosenfeld, William; Mather, Gary; Shah, Jaymin; Grundy, John S

    2004-11-01

    Carbamazepine is metabolized by CYP3A4 and several other cytochrome P450 enzymes. The potential effects of zonisamide on carbamazepine pharmacokinetics (PK) have not been well characterized, with contradictory literature reports. Hence, an in vitro study was designed to evaluate the cytochrome P450 inhibition spectrum of zonisamide using human liver microsomes. Further, an in vivo steady-state study was performed to measure the effect of zonisamide on carbamazepine PK in epileptic patients, and monitor zonisamide PK. In vitro human liver microsomes were incubated with zonisamide (200, 600 or 1000 microM) in the presence of appropriate probe substrates to assess selected cytochrome P450 activities. In vivo, the effect of zonisamide, up to 400 mg/day, on the steady-state PK of carbamazepine and carbamazepine-epoxide (CBZ-E) was studied in 18 epileptic patients. In vitro, zonisamide did not inhibit CYP1A2 and 2D6, and only weakly inhibited CYP2A6, 2C9, 2C19, and 2E1. The estimated Ki for zonisamide inhibition of CYP3A4 was 1076 microM, 12 times higher than typical unbound therapeutic serum zonisamide concentrations. In vivo, no statistically significant differences were observed for mean Cmax, Tmax, and AUC0-12 of total and free carbamazepine and CBZ-E measured before and after zonisamide administration (300-400 mg/day for 14 days). However, CBZ-E renal clearance was significantly (p < 0.05) reduced by zonisamide. The observed mean zonisamide t1/2 (36.3h), relative to approximately 65 h reported in subjects on zonisamide monotherapy, reflects known CYP3A4 induction by carbamazepine. Based on the lack of clinically relevant in vitro and in vivo effects, adjustment of carbamazepine dosing should not be required with concomitant zonisamide administration.

  8. Transient epileptic amnesia: a concise review.

    PubMed

    Asadi-Pooya, Ali A

    2014-02-01

    Transient epileptic amnesia (TEA) is a distinctive syndrome and comprises episodic transient amnesia with an epileptic basis, without impairment of other aspects of cognitive function. Additional interictal memory deficits are common in TEA. An epileptic origin, after other etiologies have been excluded, should be considered and carefully investigated in patients complaining of isolated memory disturbances, particularly with recurrent short-lasting amnesic attacks. In all suspected cases of epilepsy, a detailed clinical history is of paramount importance, but ancillary tests including EEG and MRI could be very helpful. Transient epileptic amnesia is typically a benign and treatable condition. Future studies should investigate the exact mechanism(s) of this unique syndrome.

  9. [A case of a pediatric patient with tuberous sclerosis (Bourneville-Pringle disease) and frequent epileptic seizure for intensive dental treatment under general anesthesia].

    PubMed

    Mimura, Shinichiro; Kikura, Mutsuhito; Itagaki, Taiga; Inokuma, Mie; Iwamoto, Tatsuaki; Kawakubo, Atsushi; Hirano, Kazuhiro; Sato, Shigehito

    2006-04-01

    Tuberous sclerosis (Bourneville-Pringle disease) is a rare disease with a triad of mental retardation, epilepsy, and facial spot. Management of the patients with tuberous sclerosis under general anesthesia has been previously reported. However, there are few case reports about management under general anesthesia of a pediatric patient with tuberous sclerosis with frequent epileptic seizure. Here, we report a case of a pediatric patient with tuberous sclerosis and frequent epileptic seizure who underwent intensive dental treatment under general anesthesia with careful management of epilepsy. The patient was discharged on the day of surgery without any complications. In this case report, we discussed the appropriate assessment of the complications of tuberous sclerosis; such as, of central nervous, circulatory, respiratory, endocrine, and urinary systems including the management of general anesthesia.

  10. Neuropsychological profile of adult patients with nonsymptomatic occipital lobe epilepsies.

    PubMed

    Bilo, Leonilda; Santangelo, Gabriella; Improta, Ilaria; Vitale, Carmine; Meo, Roberta; Trojano, Luigi

    2013-02-01

    To explore the neuropsychological and neurobehavioral profile in adult patients affected by nonsymptomatic (cryptogenic and idiopathic) occipital lobe epilepsy (OLE), with normal intelligence, we enrolled 20 adult patients with nonsymptomatic OLE and 20 age-, sex-, and education-matched healthy subjects. All participants underwent neuropsychiatric assessment scales, and standardized neuropsychological tests tapping memory, executive functions, constructional, visuospatial and visuoperceptual skills. After Bonferroni correction for multiple comparisons, patients performed significantly worse than controls on several tests tapping complex visuospatial skills and frontal lobe functions. The analysis of single patients' performance revealed that a significantly higher number of OLE patients achieved age- and education-adjusted pathological scores on three tests (Benton Judgment of Line Orientation Test, Freehand Copying of Drawings Test, color-word interference task of Stroop test) with respect to controls. Patients did not differ from control subjects on neuropsychiatric aspects. The direct comparison between OLE subtypes showed that cryptogenetic OLE patients tended to achieve lower scores than idiopathic OLE patients on most tests, but no difference between the two groups was fully significant. In summary, patients with nonsymptomatic OLE can be affected by clinically relevant impairments in selected neuropsychological domains: complex visuospatial skills and executive functions. It could be speculated that frontal and visuospatial cognitive deficits might be the result of epileptic activity spreading within a neural network that includes structures far beyond the occipital lobe.

  11. Population pharmacokinetic analysis for 10-monohydroxy derivative of oxcarbazepine in pediatric epileptic patients shows no difference between Japanese and other ethnicities.

    PubMed

    Sugiyama, Ikuo; Bouillon, Thomas; Yamaguchi, Masayuki; Suzuki, Hikoe; Hirota, Takashi; Fink, Martin

    2015-04-01

    Oxcarbazepine is an anti-epileptic drug, which is almost completely metabolized by cytosolic enzymes in the liver to the active 10-monohyroxy metabolite (MHD) following oral administration. The pharmacokinetic (PK) profiles of MHD were evaluated in pediatric epileptic patients and a possible ethnic difference in PK of MHD between Japanese and non-Japanese pediatric patients was assessed. A non-linear mixed effect modeling approach was used to determine the PK of MHD. A one-compartment population model with first-order absorption appropriately described the PK of MHD. No clinically relevant differences were found for using body surface area or weight to explain between-patient variability, therefore the final model included the effects of body weight on apparent clearance (CL/F) and apparent volume of distribution (V/F) of MHD, and in addition, the effect of 3 concomitant anti-epileptic drugs (carbamazepine, phenobarbital and phenytoin) on CL/F of MHD. Inclusion of ethnicity as a covariate in the final model, concluded no ethnic difference with respect to CL/F of MHD between Japanese and non-Japanese patients. Hence, oxcarbazepine can be generally applied using the same dosage and administration for the treatment of partial onset seizures in pediatric patients, regardless of ethnicity.

  12. Novel CDKL5 Mutations in Czech Patients with Phenotypes of Atypical Rett Syndrome and Early-Onset Epileptic Encephalopathy.

    PubMed

    Záhoráková, D; Langová, M; Brožová, K; Laštůvková, J; Kalina, Z; Rennerová, L; Martásek, P

    2016-01-01

    The X-linked CDKL5 gene, which encodes cyclin-dependent kinase-like 5 protein, has been implicated in early-onset encephalopathy and atypical Rett syndrome with early-onset seizures. The CDKL5 protein is a kinase required for neuronal development and morphogenesis, but its precise functions are still largely unexplored. Individuals with CDKL5 mutations present with severe global developmental delay, intractable epilepsy, and Rett-like features. A clear genotype-phenotype correlation has not been established due to an insufficient number of reported cases. The aim of this study was to analyse the CDKL5 gene in Czech patients with early-onset seizures and Rett-like features. We performed mutation screening in a cohort of 83 individuals using high-resolution melting analysis, DNA sequencing and multiplex ligation- dependent probe amplification. Molecular analyses revealed heterozygous pathogenic mutations in three girls with severe intellectual disability and intractable epilepsy starting at the age of two months. All three identified mutations, c.637G>A, c.902_977+29del105, and c.1757_1758delCT, are novel, thus significantly extending the growing spectrum of known pathogenic CDKL5 sequence variants. Our results support the importance of genetic testing of the CDKL5 gene in patients with early-onset epileptic encephalopathy and Rett-like features with early-onset seizures. This is the first study referring to molecular defects of CDKL5 in Czech cases.

  13. Comparison between two scoring systems of the Rey-Osterrieth Complex Figure in left and right temporal lobe epileptic patients.

    PubMed

    Frank, Jean; Landeira-Fernandez, J

    2008-01-01

    The Rey-Osterrieth Complex Figure (ROCF) is probably one of the most popular measurement instruments of visuoconstructional abilities and nonverbal memory. It is frequently part of neuropsychological test protocols in epilepsy surgery centers. In this study we compared the traditional scoring system of the ROCF developed by Taylor (1998) with a qualitative system that assesses spatial-relational errors devised by Loring et al. [Loring, D. W., Lee, G. P., & Meador, K. J. (1988). Revising the Rey-Osterrieth: Rating right hemisphere recall. Archives of Clinical Neuropsychology, 3, 239-247] in a sample of left and right temporal lobe epilepsy patients undergoing pre-surgical evaluation. We investigated whether the relational-spatial scoring system would be more sensitive to right-sided memory deficits than the traditional Taylor version. There was no difference in the copy phase of the ROCF between the clinical and control groups. There was a significant difference between the control and the clinical groups when the 30-min delayed recall drawings were scored with the Taylor system. However, this system failed to find differences between left and right temporal lobe epileptic patients. On the other hand, comparisons with the qualitative scoring criteria used by Loring et al. [Loring, D. W., Lee, G. P., & Meador, K. J. (1988). Revising the Rey-Osterrieth: Rating right hemisphere recall. Archives of Clinical Neuropsychology, 3, 239-247] revealed that right temporal lobe patients made more spatial-relational errors than patients with left-sided foci. Frequency distribution of these scores for all the three groups and sensitivity and specificity to correctly classify right temporal lobe patients are presented. This investigation demonstrated that applying qualitative, material-specific scoring criteria improves temporal lobe epilepsy presurgical protocols.

  14. Influence of Marital Status on the Quality of Life of Chinese Adult Patients with Epilepsy

    PubMed Central

    Wang, Fu-Li; Gu, Xiang-Min; Hao, Bao-Yun; Wang, Shan; Chen, Ze-Jie; Ding, Cheng-Yun

    2017-01-01

    Background: Epilepsy is a chronic disorder characterized by recurrent seizures and has significant psychological and social consequence for everyday living. Epilepsy affects various aspects of ones’ social life. The present study aimed to investigate the influence of marital status on the quality of life of adult Chinese patients with epilepsy. Methods: This study surveyed 805 Chinese adults who have been clinically diagnosed with epilepsy for longer than 1 year in 11 hospitals in Beijing. In this survey, 532 (66.1%) participants were married. All of them completed the case report form with enquiries on demographic data, social factors, and illness. The marriage status of adult epileptic quality of life was the dependent variable, and demographic data and clinical data were independent variables, analyzed through the multiple linear regression analysis methods. The patients’ quality of life was assessed using the Quality of Life in patients with Epilepsy-31 items (QOLIE-31) questionnaire, the Patient Health Questionnaire-9 items (PHQ-9), and the Generalized Anxiety Disorder-7 items (GAD-7). Results: The PHQ-9 and GAD-7 scores in the unmarried group (PHQ-9 = 6.0 and GAD-7 = 5.0) were significantly higher than that of the married group (PHQ-9 = 4.0 and GAD-7 =3.0). The scores of married adult patients with epilepsy on QOLIE (61.8 ± 15.3) and social function (70.9 ± 22.7) were higher than the scores of the unmarried patients aged between 20 and 44 years. The scores of married adult epileptics on the QOLIE (58.4 ± 14.6) and the energy/fatigue (62.1 ± 20.4) were higher than the scores of the unmarried patients (QOLIE = 58.4 ± 14.6 and the energy/fatigue = 62.1 ± 20.4) aged between 45 and 59 years. For the adult epilepsy patients, depression, anxiety, seizures within the last year, disease course, medical expense category, and marriage* age are negatively correlated with the quality of life. Occupation, educational level, and average monthly income are closely

  15. Vagus nerve stimulation balanced disrupted default-mode network and salience network in a postsurgical epileptic patient

    PubMed Central

    Wang, Kailiang; Chai, Qi; Qiao, Hui; Zhang, Jianguo; Liu, Tinghong; Meng, Fangang

    2016-01-01

    Introduction In recent years, treatment of intractable epilepsy has become more challenging, due to an increase in resistance to antiepileptic drugs, as well as diminished success following resection surgery. Here, we present the case of a 19-year old epileptic patient who received vagus nerve stimulation (VNS) following unsuccessful left parietal–occipital lesion-resection surgery, with results indicating an approximate 50% reduction in seizure frequency and a much longer seizure-free interictal phase. Materials and methods Using resting-state functional magnetic resonance imaging, we measured the changes in resting-state brain networks between pre-VNS treatment and 6 months post-VNS, from the perspective of regional and global variations, using regional homogeneity and large-scale functional connectives (seeding posterior cingulate cortex and anterior cingulate cortex), respectively. Results After 6 months of VNS therapy, the resting-state brain networks were slightly reorganized in regional homogeneity, mainly in large-scale functional connectivity, where excessive activation of the salience network was suppressed, while at the same time the suppressed default-mode network was activated. Conclusion With regard to resting-state brain networks, we propose a hypothesis based on this single case study that VNS acts on intractable epilepsy by modulating the balance between salience and default-mode networks through the integral hub of the anterior cingulate cortex. PMID:27785033

  16. Multimodality localization of epileptic foci

    NASA Astrophysics Data System (ADS)

    Desco, Manuel; Pascau, Javier; Pozo, M. A.; Santos, Andres; Reig, Santiago; Gispert, Juan D.; Garcia-Barreno, Pedro

    2001-05-01

    This paper presents a multimodality approach for the localization of epileptic foci using PET, MRI and EEG combined without the need of external markers. Mutual Information algorithm is used for MRI-PET registration. Dipole coordinates (provided by BESA software) are projected onto the MRI using a specifically developed algorithm. The four anatomical references used for electrode positioning (nasion, inion and two preauricular points) are located on the MRI using a triplanar viewer combined with a surface-rendering tool. Geometric transformation using deformation of the ideal sphere used for dipole calculations is then applied to match the patient's brain size and shape. Eight treatment-refractory epileptic patients have been studied. The combination of the anatomical information from the MRI, hipoperfusion areas in PET and dipole position and orientation helped the physician in the diagnosis of epileptic focus location. Neurosurgery was not indicated for patients where PET and dipole results were inconsistent; in two cases it was clinically indicated despite the mismatch, showing a negative follow up. The multimodality approach presented does not require external markers for dipole projection onto the MRI, this being the main difference with previous methods. The proposed method may play an important role in the indication of surgery for treatment- refractory epileptic patients.

  17. Plic-1, a new target in repressing epileptic seizure by regulation of GABAAR function in patients and a rat model of epilepsy.

    PubMed

    Zhang, Yujiao; Li, Zengyou; Gu, Juan; Zhang, Yanke; Wang, Wei; Shen, Hui; Chen, Guojun; Wang, Xuefeng

    2015-12-01

    Dysfunction of γ-aminobutyric acid A (GABAA) receptors (GABAARs) is a prominent factor affecting intractable epilepsy. Plic-1, an ubiquitin-like protein enriched in the inhibitory synapses connecting GABAARs and the ubiquitin protease system (UPS), plays a key role in the modification of GABAAR functions. However, the relationship between Plic-1 and epileptogenesis is not known. In the present study, we aimed to investigate Plic-1 levels in patients with temporal lobe epilepsy, as well as the role of Plic-1 in regulating onset and progression of epilepsy in animal models. We found that Plic-1 expression was significantly decreased in patients with epilepsy as well as pilocarpine- and pentylenetetrazol (PTZ)-induced rat epileptic models. Intrahippocampal injection of the PePα peptide, which disrupts Plic-1 binding to GABAARs, significantly shortened the latency of seizure onset, and increased the seizure severity and duration in these two epileptic models. Overexpressed Plic-1 through lentivirus transfection into a PTZ model resulted in a reduction in both seizure severity and generalized tonic-clonic seizure duration. Whole-cell clamp recordings revealed that the PePα peptide decreased miniature inhibitory postsynaptic currents (mIPSCs) whereas overexpressed Plic-1 increased mIPSCs in the pyramidal neurons of the hippocampus. These effects can be blocked by picrotoxin, a GABAAR inhibitor. Our results indicate that Plic-1 plays an important role in managing epileptic seizures by enhancing seizure inhibition through regulation of GABAARs at synaptic sites.

  18. MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures

    PubMed Central

    Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra

    2014-01-01

    Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR. PMID:25346718

  19. MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures.

    PubMed

    Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra

    2014-01-01

    Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR.

  20. A comparative study of the relative enzyme inducing properties of anticonvulsant drugs in epileptic patients.

    PubMed Central

    Perucca, E; Hedges, A; Makki, K A; Ruprah, M; Wilson, J F; Richens, A

    1984-01-01

    The antipyrine clearance and the urinary excretion of D-glucaric acid (D-GA) were determined in 122 patients receiving chronic anticonvulsant drug treatment and in 21 drug-free control subjects. Patients treated with carbamazepine (CBZ), phenytoin (DPH), primidone (PMD) and phenobarbitone (PB), either alone or in combination, showed higher values of antipyrine clearance and excreted larger amounts of D-GA as compared to controls. While antipyrine clearance values did not differ significantly from one drug group to another, D-GA excretion was significantly higher in patients treated with CBZ than in those treated with DPH. In patients treated with sodium valproate antipyrine clearance did not differ from control values. There was a trend for D-GA excretion to be higher in these patients but the difference was not statistically significant. Significant positive correlations were found between the dosage of CBZ, DPH, PMD and PB and both indices of enzyme induction. These data demonstrate a dose-dependent degree of enzyme induction in patients receiving therapeutic doses of these anticonvulsants. The relative potency at average dose levels for antipyrine clearance was PB (1), DPH (0.92), CBZ (0.84), PMD (0.82) and for log D-GA excretion was PB (1), CBZ (0.96), PMD (0.95), DPH (0.90). PMID:6435654

  1. Real-Time Management of Multimodal Streaming Data for Monitoring of Epileptic Patients.

    PubMed

    Triantafyllopoulos, Dimitrios; Korvesis, Panagiotis; Mporas, Iosif; Megalooikonomou, Vasileios

    2016-03-01

    New generation of healthcare is represented by wearable health monitoring systems, which provide real-time monitoring of patient's physiological parameters. It is expected that continuous ambulatory monitoring of vital signals will improve treatment of patients and enable proactive personal health management. In this paper, we present the implementation of a multimodal real-time system for epilepsy management. The proposed methodology is based on a data streaming architecture and efficient management of a big flow of physiological parameters. The performance of this architecture is examined for varying spatial resolution of the recorded data.

  2. Determining the disease management process for epileptic patients: A qualitative study

    PubMed Central

    Hosseini, Nazafarin; Sharif, Farkhondeh; Ahmadi, Fazlollah; Zare, Mohammad

    2016-01-01

    Background: Epilepsy exposes patients to many physical, social, and emotional challenges. Thus, it seems to portray a complex picture and needs holistic care. Medical treatment and psychosocial part of epilepsy remain central to managing and improving the patient's qualify of life through team efforts. Some studies have shown the dimensions of self-management, but its management process of epilepsy patients, especially in Iran, is not clear. This study aimed to determine the disease management process in patients with epilepsy in Iran. Materials and Methods: This qualitative approach and grounded theory study was conducted from January 2009 to February 2012 in Isfahan city (Iran). Thirty-two participants were recruited by the goal-oriented, and snowball sample selection and theoretical sampling methods. After conducting a total of 43 in-depth interviews with the participants, the researchers reached data saturation. Data were analyzed using Strauss and Corbin method. Results: With a focus on disease management process, researchers found three main themes and seven sub-themes as a psychosocial process (PSP). The main themes were: perception of threat to self-identity, effort to preserve self-identity, and burn out. The psychosocial aspect of the disease generated one main variable “the perception of identity loss” and one central variable “searching for self-identity.” Conclusions: Participants attributed threat to self-identity and burn out to the way their disease was managed requiring efforts to preserve their identity. Recommendations consist of support programs and strategies to improve the public perception of epilepsy in Iran, help patients accept their condition and preserve self-identity, and most importantly, enhance medical management of epilepsy. PMID:26985223

  3. Adherence to Treatment and Factors Affecting Adherence of Epileptic Patients at Yirgalem General Hospital, Southern Ethiopia: A Prospective Cross-Sectional Study

    PubMed Central

    Hasiso, Temesgen Yohannes; Desse, Tigestu Alemu

    2016-01-01

    Background Non adherence of epileptic patients to antiepileptic medication often leads to an increased risk of seizures and worsening of disease, death and increased health care costs. Objective to assess adherence to treatment and factors affecting adherence of epileptic patients at Yirgalem General Hospital, Southern Ethiopia. Methods and Materials We conducted a cross-sectional study on epileptic patients from February 9 to 22, 2015. Data were collected from patients ≥18 years old. Adherence was measured using the eight-item Morisky’s medication adherence scale. All consecutive patients coming to epilepsy clinic during the study period were interviewed until the calculated sample size (210) was obtained. We collected patient demographics, perception about epilepsy and adherence to medication(s). We used chi-square tests and a binary logistic regression model for statistical analysis. Statistical significance was considered at P<0.05. Results out of a total of 210 participants, 194 were willing to participate and were studied. Of the 194 participants, 109 (56.2%) were males. The mean age of the participants was 33.62±11.44 years; range 18 to 66 years. The majority, 123(63.41%), of the participants were taking two antiepileptic medications. Sixty two (32%) of the participants were adherent to their treatment. The most common reported reasons for non-adherence were forgetfulness 49(75.4%) and run out of pills 7(10.8%). Factors that affect medication adherence are epilepsy treatment for <1 year (P = 0.011), epilepsy treatment for 1–3 years (P = 0.002), epilepsy treatment for 3–5 years (P = 0.007), being married (P = 0.006), grade 9–12 education (P = 0.028), college or university education (P = 0.002) and absence of co-morbidity (P = 0.008). Conclusions The rate of adherence observed in this study was low. The most common reason for non- adherence was forgetfulness. Therefore, the hospital should devise strategies to improve adherence of epileptic patients

  4. Fixed Drug Eruption in an Epileptic Patient Previously Receiving Treatment With Phenytoin for Seven Years.

    PubMed

    Smetana, Keaton S; Suda, Katie J; Hamilton, Leslie A

    2013-01-01

    A 52-year-old African American female presented with severe left thigh pain of unknown etiology. She had a past medical history of generalized seizure disorder treated with phenytoin for 7 years without incident. During admission a nurse witnessed a seizure, and consequently loading and maintenance doses of phenytoin were administered to obtain a therapeutic serum concentration. The patient had a history of noncompliance with multiple subtherapeutic phenytoin levels. Subsequently, unifocal blue discolored spots appeared, progressing to a bullous component that was positive for skin sloughing. Drug-induced fixed drug eruption was diagnosed and attributed to phenytoin. Clinicians should be cognizant of drug-induced fixed drug eruption in patients just initiated and those receiving long-term treatment with phenytoin. The administration rate of phenytoin may be associated with the development of fixed drug eruption.

  5. Human fetal brain-derived neural stem/progenitor cells grafted into the adult epileptic brain restrain seizures in rat models of temporal lobe epilepsy.

    PubMed

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  6. Human Fetal Brain-Derived Neural Stem/Progenitor Cells Grafted into the Adult Epileptic Brain Restrain Seizures in Rat Models of Temporal Lobe Epilepsy

    PubMed Central

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  7. Electroencephalographic source imaging: a prospective study of 152 operated epileptic patients

    PubMed Central

    Brodbeck, Verena; Spinelli, Laurent; Lascano, Agustina M.; Wissmeier, Michael; Vargas, Maria-Isabel; Vulliemoz, Serge; Pollo, Claudio; Schaller, Karl; Michel, Christoph M.

    2011-01-01

    Electroencephalography is mandatory to determine the epilepsy syndrome. However, for the precise localization of the irritative zone in patients with focal epilepsy, costly and sometimes cumbersome imaging techniques are used. Recent small studies using electric source imaging suggest that electroencephalography itself could be used to localize the focus. However, a large prospective validation study is missing. This study presents a cohort of 152 operated patients where electric source imaging was applied as part of the pre-surgical work-up allowing a comparison with the results from other methods. Patients (n = 152) with >1 year postoperative follow-up were studied prospectively. The sensitivity and specificity of each imaging method was defined by comparing the localization of the source maximum with the resected zone and surgical outcome. Electric source imaging had a sensitivity of 84% and a specificity of 88% if the electroencephalogram was recorded with a large number of electrodes (128–256 channels) and the individual magnetic resonance image was used as head model. These values compared favourably with those of structural magnetic resonance imaging (76% sensitivity, 53% specificity), positron emission tomography (69% sensitivity, 44% specificity) and ictal/interictal single-photon emission-computed tomography (58% sensitivity, 47% specificity). The sensitivity and specificity of electric source imaging decreased to 57% and 59%, respectively, with low number of electrodes (<32 channels) and a template head model. This study demonstrated the validity and clinical utility of electric source imaging in a large prospective study. Given the low cost and high flexibility of electroencephalographic systems even with high channel counts, we conclude that electric source imaging is a highly valuable tool in pre-surgical epilepsy evaluation. PMID:21975586

  8. Clinical review of genetic epileptic encephalopathies

    PubMed Central

    Noh, Grace J.; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Seizures are a frequently encountered finding in patients seen for clinical genetics evaluations. The differential diagnosis for the cause of seizures is quite diverse and complex, and more than half of all epilepsies have been attributed to a genetic cause. Given the complexity of such evaluations, we highlight the more common causes of genetic epileptic encephalopathies and emphasize the usefulness of recent technological advances. The purpose of this review is to serve as a practical guide for clinical geneticists in the evaluation and counseling of patients with genetic epileptic encephalopathies. Common syndromes will be discussed, in addition to specific seizure phenotypes, many of which are refractory to anti-epileptic agents. Divided by etiology, we overview the more common causes of infantile epileptic encephalopathies, channelopathies, syndromic, metabolic, and chromosomal entities. For each condition, we will outline the diagnostic evaluation and discuss effective treatment strategies that should be considered. PMID:22342633

  9. John Hall and his epileptic patients--epilepsy management in early 17th century England.

    PubMed

    Betts, T; Betts, H

    1998-10-01

    John Hall, a physician, practised in Stratford in the early 17th century and was the son-in-law of William Shakespeare. During his career he kept records of his patients (in Latin) which he may have been preparing for publication when he died. Despite his instruction for them to be destroyed some were later translated into English and published by another physician. The case records were popular and have recently been reprinted with a commentaryl. We have searched the case records for descriptions of epilepsy and examined the treatments offered (and the attitudes to) this condition in early 17th century England. Treatment consisted of standard remedies ('fumes' of hartshorn and extracts of peony) related to the Galenic system of medicine, plus individual remedies. Interestingly, there is no evidence that the condition was stigmatized.

  10. Synchronization analysis of cultured epileptic human astrocytes

    NASA Astrophysics Data System (ADS)

    Balazsi, Gabor; Cornell-Bell, Ann; Neiman, Alexander; Moss, Frank

    2001-03-01

    Astrocyte cultures from severely epileptic patients were cultured, and the fluctuations of the intracellular calcium ion concentration were visualized using the fluorescent dye Fluo-3. The resulting image sequences were analyzed by methods of stochastic synchronization. Increased synchronization was observed in the epileptic tissues, when compared to normal tissues from rats. The more pathological the tissue, the more synchronized the calcium oscillations. The results might lead to a better understanding of intracellular calcium dynamics and could help drug development.

  11. [Lateralization of the epileptic process and psychology].

    PubMed

    Preiss, J; Kristof, M

    1989-04-01

    In a group of 70 patients with a unilateral epileptic process in the temporal limbic structures, localized in the left half of the brain in 38 patients (26 men, 12 women) and in the right half of the brain in 32 patients (17 men, 15 women) the lateralization of motor functions, asymmetry of emotional mimicry, conjugated deviation of the eye bulbs, intellect, memory, psychomotor rate and personality (laterality test of Matĕjcek--Zlab, Wechsler's intellect and memory scale, Benton, Stroop, VAROS, SUPOS, DSF, Washington Psychosocial--Seizure Inventory WPSI was investigated. Patient with a left-sided epileptic process had only insignificantly lower contact with psychiatry (31.6% as compared with 40.6%). Significantly lower contacts with psychiatry were recorded in 35 patients with a predominance of emotional mimicry (while smiling) on the left (25.0% as compared with 47.1%, p less than 0.05) and particularly significantly low in 18 patients with a combination of signs left-sided epileptic process + predominance of emotional mimicry on the left + deviation of the eyeballs on the right (mathematical stimulus) + genotypical righthandedness (16.7% as compared with 42.3%, p less than 0.025). Men with a left-sided epileptic process displayed a significantly greater anxiety, in women this trend was only indicated. Four women with a left-sided epileptic process anticipating regulation of behaviour was typical, for women with a right-sided epileptic process lower autoregulating inhibitions. A left-sided epileptic process had significantly more often a favourable course of epilepsy (in 65.8% as compared with 25.0%, p less than 0.005). In psychological tests, however, the differentiating criteria were much more than the course of the disease invalid pension, contact with psychiatry and subjective need of assistance from a psychiatrist or psychologist.

  12. Cerebrospinal fluid findings after epileptic seizures.

    PubMed

    Chatzikonstantinou, Anastasios; Ebert, Anne D; Hennerici, Michael G

    2015-12-01

    We aimed to evaluate ictally-induced CSF parameter changes after seizures in adult patients without acute inflammatory diseases or infectious diseases associated with the central nervous system. In total, 151 patients were included in the study. All patients were admitted to our department of neurology following acute seizures and received an extensive work-up including EEG, cerebral imaging, and CSF examinations. CSF protein elevation was found in most patients (92; 60.9%) and was significantly associated with older age, male sex, and generalized seizures. Abnormal CSF-to-serum glucose ratio was found in only nine patients (5.9%) and did not show any significant associations. CSF lactate was elevated in 34 patients (22.5%) and showed a significant association with focal seizures with impaired consciousness, status epilepticus, the presence of EEG abnormalities in general and epileptiform potentials in particular, as well as epileptogenic lesions on cerebral imaging. Our results indicate that non-inflammatory CSF elevation of protein and lactate after epileptic seizures is relatively common, in contrast to changes in CSF-to-serum glucose ratio, and further suggest that these changes are caused by ictal activity and are related to seizure type and intensity. We found no indication that these changes may have further-reaching pathological implications besides their postictal character.

  13. Epileptic seizure induced by fennel essential oil.

    PubMed

    Skalli, Souad; Soulaymani Bencheikh, Rachida

    2011-09-01

    An epileptic seizure is reported in a 38-year-old woman, known to be an epileptic patient. Although she was under antiepileptic treatment and had well-controlled epilepsy, she developed a typical generalised tonic-clonic seizure and remained unconscious for 45 minutes following ingestion of a number of cakes containing an unknown quantity of fennel essential oil. Involuntary diarrhoea accompanied her epileptic seizure. This reported case recalls the fact that fennel essential oil can induce seizures and that this oil should probably be avoided by patients with epilepsy. Labelling of products with fennel essential oil should refer to the risk of seizures, particularly for patients with epilepsy. An awareness programme should involve all stakeholders affected by this issue.

  14. Early presentation of de novo high grade glioma with epileptic seizures: electroclinical and neuroimaging findings.

    PubMed

    Rossi, Rosario; Figus, Andrea; Corraine, Simona

    2010-10-01

    We report the clinical, EEG and neuroradiologic findings from three adult patients who developed new-onset seizure disorders as early clinical manifestations of de novo high grade glioma. The malignancies could not be recognised at the time of the first epileptic seizure because of minimal non-specific brain abnormalities, which showed no signs of necrosis or significant contrast enhancement on computed tomography and magnetic resonance imaging. Focal EEG abnormalities were recorded in all cases and appeared consistent with the neuroradiologic findings. The patients regained normal neurological status after the first seizure but rapidly developed space-occupying necrotic lesions. Two patients underwent surgery and received histological diagnoses of the tumours. Another patient was finally diagnosed with a malignant glioma based on the neuroradiologic picture and rapid progression of the cerebral lesion. It should be noted that in adult patients, new-onset epileptic seizures might reveal the presence of malignant gliomas at a very early stage in the tumour formation process. This report indicates that typical anatomoradiologic features of de novo high grade glioma, such as necrosis and rim-contrast enhancement, could be absent at the time of the first epileptic seizure but become clear within a short period after clinical presentation.

  15. Epileptic fits under intravenous midazolam sedation.

    PubMed

    Robb, N D

    1996-09-07

    A case is presented of a patient who suffered from recurrent epileptic fits while being treated under intravenous sedation with midazolam. Those using sedation are advised to beware of the patient who gives a history of fits being provoked in the dental environment.

  16. Successful management of acute respiratory failure with noninvasive mechanical ventilation after drowning, in an epileptic-patient.

    PubMed

    Ruggeri, Paolo; Calcaterra, Salvatore; Bottari, Antonio; Girbino, Giuseppe; Fodale, Vincenzo

    2016-01-01

    Sea drowning is a common cause of accidental death worldwide. Respiratory complications such as acute pulmonary oedema, which is often complicated by acute respiratory distress syndrome, is often seen. Noninvasive ventilation is already widely used as a first approach to treat acute respiratory failure resulting from multiple diseases. We report a case of a 45 year old man with a history of epilepsy, motor and mental handicap who developed acute respiratory failure secondary to sea water drowning after an epileptic crisis. We illustrate successful and rapid management of this case with noninvasive ventilation. We emphasize the advantages and limitations of using noninvasive ventilation to treat acute respiratory failure due to sea water drowning syndrome.

  17. Intractable epileptic spasms in a patient with Pontocerebellar hypoplasia: Severe phenotype of type 2 or another subtype?

    PubMed Central

    Samanta, Debopam; Willis, Erin

    2016-01-01

    Introduction: Pontocerebellar hypoplasia (PCH) involves a diverse range of etiologies including a group of single gene disorders. Mutations in the tRNA splicing endonuclease complex (TSEN) 54 gene can be responsible for PCH type 2, 4 and 5. The more common and less severe PCH 2 phenotype is caused by homozygosity for the common missense mutation A307S, while the severe phenotype seen in type 4 and 5 is caused by compound heterozygosity of the A307S mutation along with a nonsense or splice site mutation. Report: We report a 4- month-old girl who presented with epileptic spasms that remained intractable to several antiepileptic medications. Magnetic Resonance Imaging (MRI) brain showed fairly severe hypoplasia with superimposed atrophy of the cerebellum and brainstem with prominent extra-axial fluid spaces. Extensive metabolic testing was negative. Commercial testing for PCH via TSEN54 gene revealed missense mutation of Ala307Ser. A novel sequence variant, designated c.17_40 del, was also found and was predictive of an in-frame deletion of eight amino acids. Follow-up over 2 years revealed intractable epileptic spasms, progressive microcephaly and development of prominent choreoathetosis. Conclusion: This case report describes a rare case of PCH with overlapping features of the less severe PCH2 and the more severe PCH4/5 phenotype. It also adds another new entity in the list of genetic conditions where West syndrome and pontocerebellar hypoplasia can be seen together, emphasizing the need for further investigations of the genotype-phenotype correlation of mutations in order to advance our understanding of the pathophysiologic mechanism in these rare conditions. PMID:27570394

  18. Harnessing gene expression networks to prioritize candidate epileptic encephalopathy genes.

    PubMed

    Oliver, Karen L; Lukic, Vesna; Thorne, Natalie P; Berkovic, Samuel F; Scheffer, Ingrid E; Bahlo, Melanie

    2014-01-01

    We apply a novel gene expression network analysis to a cohort of 182 recently reported candidate Epileptic Encephalopathy genes to identify those most likely to be true Epileptic Encephalopathy genes. These candidate genes were identified as having single variants of likely pathogenic significance discovered in a large-scale massively parallel sequencing study. Candidate Epileptic Encephalopathy genes were prioritized according to their co-expression with 29 known Epileptic Encephalopathy genes. We utilized developing brain and adult brain gene expression data from the Allen Human Brain Atlas (AHBA) and compared this to data from Celsius: a large, heterogeneous gene expression data warehouse. We show replicable prioritization results using these three independent gene expression resources, two of which are brain-specific, with small sample size, and the third derived from a heterogeneous collection of tissues with large sample size. Of the nineteen genes that we predicted with the highest likelihood to be true Epileptic Encephalopathy genes, two (GNAO1 and GRIN2B) have recently been independently reported and confirmed. We compare our results to those produced by an established in silico prioritization approach called Endeavour, and finally present gene expression networks for the known and candidate Epileptic Encephalopathy genes. This highlights sub-networks of gene expression, particularly in the network derived from the adult AHBA gene expression dataset. These networks give clues to the likely biological interactions between Epileptic Encephalopathy genes, potentially highlighting underlying mechanisms and avenues for therapeutic targets.

  19. Pathophysiology of epileptic encephalopathies.

    PubMed

    Lado, Fred A; Rubboli, Guido; Capovilla, Giuseppe; Capovilla, Pippo; Avanzini, Giuliano; Moshé, Solomon L

    2013-11-01

    The application of metabolic imaging and genetic analysis, and now the development of appropriate animal models, has generated critical insights into the pathogenesis of epileptic encephalopathies. In this article we present ideas intended to move from the lesions associated with epileptic encephalopathies toward understanding the effects of these lesions on the functioning of the brain, specifically of the cortex. We argue that the effects of focal lesions may be magnified through the interaction between cortical and subcortical structures, and that disruption of subcortical arousal centers that regulate cortex early in life may lead to alterations of intracortical synapses that affect a critical period of cognitive development. Impairment of interneuronal function globally through the action of a genetic lesion similarly causes widespread cortical dysfunction manifesting as increased delta slow waves on electroencephalography (EEG) and as developmental delay or arrest clinically. Finally, prolonged focal epileptic activity during sleep (as occurring in the syndrome of continuous spike-wave in slow sleep, or CSWSS) might interfere with local slow wave activity at the site of the epileptic focus, thereby impairing the neural processes and, possibly, the local plastic changes associated with learning and other cognitive functions. Seizures may certainly add to these pathologic processes, but they are likely not necessary for the development of the cognitive pathology. Nevertheless, although seizures may be either a consequence or symptom of the underlying lesion, their effective treatment can improve outcomes as both clinical and experimental studies may suggest. Understanding their substrates may lead to novel, effective treatments for all aspects of the epileptic encephalopathy phenotype.

  20. Cystic fibrosis lung disease in adult patients.

    PubMed

    Vender, Robert L

    2008-04-01

    As the longevity of all patients with cystic fibrosis (CF) continues to increase (median 2005 survival=36.8 years), more adult patients will be receiving their medical care from nonpediatric adult-care providers. Cystic fibrosis remains a fatal disease, with more than 80% of patients dying after the age of 18 years, and most deaths resulting from pulmonary disease. The changing epidemiology requires adult-care providers to become knowledgeable and competent in the clinical management of adults with CF. Physicians must understand the influence of specific genotype on phenotypic disease presentation and severity, the pathogenic factors determining lung disease onset and progression, the impact of comorbid disease factors such as CF-related diabetes and malnutrition upon lung disease severity, and the currently approved or standard accepted therapies used for chronic management of CF lung disease. This knowledge is critical to help alleviate morbidity and improve mortality for the rapidly expanding population of adults with CF.

  1. Diagnosis of Adult Patients with Cystic Fibrosis.

    PubMed

    Nick, Jerry A; Nichols, David P

    2016-03-01

    The diagnosis of cystic fibrosis (CF) is being made with increasing frequency in adults. Patients with CF diagnosed in adulthood typically present with respiratory complaints, and often have recurrent or chronic airway infection. At the time of initial presentation individuals may appear to have clinical manifestation limited to a single organ, but with subclinical involvement of the respiratory tract. Adult-diagnosed patients have a good response to CF center care, and newly available cystic fibrosis transmembrane receptor-modulating therapies are promising for the treatment of residual function mutation, thus increasing the importance of the diagnosis in adults with unexplained bronchiectasis.

  2. [Quantitative evaluation of inhibitory effects of epileptic spikes on theta rhythms in the network of hippocampal CA3 and entorhinal cortex in patients with temporal lobe epilepsy].

    PubMed

    Ge, Man-Ling; Guo, Jun-Dan; Chen, Sheng-Hua; Zhang, Ji-Chang; Fu, Xiao-Xuan; Chen, Yu-Min

    2017-02-25

    Epileptic spike is an indicator of hyper-excitability and hyper-synchrony in the neural networks. The inhibitory effects of spikes on theta rhythms (4-8 Hz) might be helpful to understand the mechanism of epileptic damage on the cognitive functions. To quantitatively evaluate the inhibitory effects of spikes on theta rhythms, intracerebral electroencephalogram (EEG) recordings with both sporadic spikes (SSs) and spike-free transient period between adjacent spikes were selected in 4 patients in the status of rapid eyes movement (REM) sleep with temporal lobe epilepsy (TLE) under the pre-surgical monitoring. The electrodes of hippocampal CA3 and entorhinal cortex (EC) were employed, since CA3 and EC built up one of key loops to investigate cognition and epilepsy. These SSs occurred only in CA3, only in EC, or in both CA3 and EC synchronously. Theta power was respectively estimated around SSs and during the spike-free transient period by Gabor wavelet transform and Hilbert transform. The intermittent extent was then estimated to represent for the loss of theta rhythms during the spike-free transient period. The following findings were obtained: (1) The prominent rhythms were in theta frequency band; (2) The spikes could transiently reduce theta power, and the inhibitory effect was severer around SSs in both CA3 and EC synchronously than that around either SSs only in EC or SSs only in CA3; (3) During the spike-free transient period, theta rhythms were interrupted with the intermittent theta rhythms left and theta power level continued dropping, implying the inhibitory effect was sustained. Additionally, the intermittent extent of theta rhythms was converged to the inhibitory extent around SSs; (4) The average theta power level during the spike-free transient period might not be in line with the inhibitory extent of theta rhythms around SSs. It was concluded that the SSs had negative effects on theta rhythms transiently and directly, the inhibitory effects aroused by

  3. A three phase hollow fiber liquid-phase microextraction for quantification of lamotrigine in plasma of epileptic patients by capillary electrophoresis.

    PubMed

    Barros, Luiza Saldanha Ribeiro; Carrão, Daniel Blascke; Queiroz, Regina Helena Costa; de Oliveira, Anderson Rodrigo Moraes; de Gaitani, Cristiane Masetto

    2016-10-01

    A three phase hollow fiber liquid-phase microextraction technique combined with capillary electrophoresis was developed to quantify lamotrigine (LTG) in plasma samples. The analyte was extracted from 4.0 mL of a basic donor phase (composed of 0.5 mL of plasma and 3.5 mL of sodium phosphate solution pH 9.0) through a supported liquid membrane composed of 1-octanol immobilized in the pores of the hollow fiber, and to an acidic acceptor phase (hydrochloric acid solution pH 4.0) placed in the lumen of the fiber. The extraction was carried out for 30 min at 500 rpm. The eletrophoretic analysis was carried out in 130 mmol/L MES buffer, pH 5.0 with a constant voltage of +15 kV and 20°C. Sample injections were performed for 10 s, at a pressure of 0.5 psi. The detection was performed at 214 nm for both LTG and the internal standard lidocaine. Under the optimized conditions, the method showed a limit of quantification of 1.0 μg/mL and was linear over the plasmatic concentration range of 1.0-20.0 μg/mL. Finally, the validated method was applied for the quantification of LTG in plasma samples of epileptic patients.

  4. [Occupational health problems in epileptics].

    PubMed

    Romankow, Jacek

    2005-01-01

    From the point of view of occupational medicine some questions are important for epileptics; amongst others: falling, behavior during the paroxysm, shift work dependence of attack, behaviour after an epileptic episode. Occupational capacity depends on the process of epileptic episodes and their frequency. The development of neurology has rendered numerous cures from epilepsy, but the the occupational stigma is difficult in many professions--electrical engineering, working with machinery, milling machines and others. In some professions a care must be taken when hiring epileptics--for instance professions with a fall hazard, jobs connected with public transport or involving crane or excavator operation.

  5. [Liposteroid therapy for refractory epileptic spasms].

    PubMed

    Shimono, Kuriko Kagitani; Imai, Katsumi; Idoguchi, Rie; Kamio, Noriko; Okinaga, Takeshi; Ozono, Keiichi

    2003-11-01

    Liposteroid was administered intravenously to 6 patients with refractory epileptic spasms. In one case, the spasms initially disappeared but then reappeared after three months. Another case had a transient and slight decrease of epileptic spasms. In the only patient in whom spasms disappeared, EEG abnormalities were greatly improved with diffuse spikes and waves changing into focal spikes. Two cases displayed hyperexcitability, insomnia and acting out behavior, and the therapy was discontinued in one of them. One case had appetite loss and another showed an increase in tonic seizures. No patient had serious adverse effects such as infection, edema, subdural hematoma and brain shrinkage. Although liposteroid therapy has been recommended as an easy, useful and safe alternative for ACTH, we found considerable adverse effects and only a small effect on refractory spasms, and conclude that the regimen should be modified.

  6. Surgical Treatment of Pediatric Epileptic Encephalopathies

    PubMed Central

    Fridley, J.; Reddy, G.; Curry, D.; Agadi, S.

    2013-01-01

    Pediatric epileptiform encephalopathies are a group of neurologically devastating disorders related to uncontrolled ictal and interictal epileptic activity, with a poor prognosis. Despite the number of pharmacological options for treatment of epilepsy, many of these patients are drug resistant. For these patients with uncontrolled epilepsy, motor and/or neuropsychological deterioration is common. To prevent these secondary consequences, surgery is often considered as either a curative or a palliative option. Magnetic resonance imaging to look for epileptic lesions that may be surgically treated is an essential part of the workup for these patients. Many surgical procedures for the treatment of epileptiform encephalopathies have been reported in the literature. In this paper the evidence for these procedures for the treatment of pediatric epileptiform encephalopathies is reviewed. PMID:24288601

  7. Epileptic seizure after treatment with thiocolchicoside

    PubMed Central

    Giavina-Bianchi, Pedro; Giavina-Bianchi, Mara; Tanno, Luciana Kase; Ensina, Luis Felipe Chiaverini; Motta, Antôno Abílio; Kalil, Jorge

    2009-01-01

    Background: Adverse drug reactions are important determinants of inpatient and outpatient morbidity. Thiocolchicoside is a semisynthetic derivate of naturally occurring colchicoside, which is largely used in humans as a centrally acting muscle relaxant. Epileptic seizures after thiocolchicoside intake have been reported in individuals with a history of epilepsy, acute brain injury or possible blood–brain barrier disruption. Case report: We report the case of a 66-year-old male patient presenting a sudden epileptic seizure temporally related to the intake of thiocolchicoside for muscle contracture and pain. The probably causes of the seizures were thiocolchicoside intake and cerebral microhemorrhages attributed to cerebral amyloid angiopathy. Discussion: Drugs only rarely cause focal seizures. Our case indicates that thiocolchicoside can precipitate seizures in predisposed patients, and that its use should be avoided in patients with brain diseases (and therefore lower seizure thresholds) or blood–brain barrier disruption. This information should be provided in the drug package insert. PMID:19707540

  8. Causative factors for suicide attempts by overdose in epileptics.

    PubMed

    Mendez, M F; Lanska, D J; Manon-Espaillat, R; Burnstine, T H

    1989-10-01

    We investigated possible causative factors for the high epileptic suicide rate by reviewing the cases of 22 patients with idiopathic epilepsy found among 711 patients hospitalized for a suicide attempt by overdose. Suicide attempts occurred with increased seizure activity in one epileptic; otherwise, no relationships were found with seizure-related variables. When matched by age, sex, and race with 44 nonepileptic controls from the same population, the epileptics had more borderline personality disorders with multiple impulsive suicide attempts (45.5% vs 13.6%), more psychotic disturbances, including command hallucinations (31.8% vs 9.1%), fewer adjustment disorders (18.2% vs 45.5%), and a comparable frequency of depression (13.6% vs 25%). We conclude that suicide attempts in epileptics are primarily associated with interictal psychopathologic factors, such as borderline personality disorder and psychosis, rather than with specific psychosocial stressors, seizure variables, or anticonvulsant medications.

  9. Population pharmacokinetics of micafungin in adult patients.

    PubMed

    Gumbo, Tawanda; Hiemenz, John; Ma, Lei; Keirns, James J; Buell, Donald N; Drusano, George L

    2008-03-01

    We performed population pharmacokinetic analysis of micafungin in adult patients treated with doses between 12.5 and 200 mg/day. Our analysis identified a breakpoint patient weight of 66.3 kg above which serum clearance increased by approximately 50%. Patients with weight >66.3 kg may need larger doses to achieve similar exposures to those <66.3 kg. However, the clinical implications are still unknown.

  10. A 1.83 μJ/Classification, 8-Channel, Patient-Specific Epileptic Seizure Classification SoC Using a Non-Linear Support Vector Machine.

    PubMed

    Bin Altaf, Muhammad Awais; Yoo, Jerald

    2016-02-01

    A non-linear support vector machine (NLSVM) seizure classification SoC with 8-channel EEG data acquisition and storage for epileptic patients is presented. The proposed SoC is the first work in literature that integrates a feature extraction (FE) engine, patient specific hardware-efficient NLSVM classification engine, 96 KB SRAM for EEG data storage and low-noise, high dynamic range readout circuits. To achieve on-chip integration of the NLSVM classification engine with minimum area and energy consumption, the FE engine utilizes time division multiplexing (TDM)-BPF architecture. The implemented log-linear Gaussian basis function (LL-GBF) NLSVM classifier exploits the linearization to achieve energy consumption of 0.39 μ J/operation and reduces the area by 28.2% compared to conventional GBF implementation. The readout circuits incorporate a chopper-stabilized DC servo loop to minimize the noise level elevation and achieve noise RTI of 0.81 μ Vrms for 0.5-100 Hz bandwidth with an NEF of 4.0. The 5 × 5 mm (2) SoC is implemented in a 0.18 μm 1P6M CMOS process consuming 1.83 μ J/classification for 8-channel operation. SoC verification has been done with the Children's Hospital Boston-MIT EEG database, as well as with a specific rapid eye-blink pattern detection test, which results in an average detection rate, average false alarm rate and latency of 95.1%, 0.94% (0.27 false alarms/hour) and 2 s, respectively.

  11. The Adult Diabetic Patient: An Education Challenge

    DTIC Science & Technology

    1993-05-01

    finding that he/she, too, must care for sicker patients. To better prepare these patients for life after discharge, patient education must be initiated as...admitted, patient education often begins at the physicians’ office. This paper explores diabetes mellitus in relation to concepts of self-care and adult...betting foj.L eduuation and iio.w, wore ofteni, patient education and follow-up sercvices- a:leL beiny p~rovided on ani outpatient bcdtsis" (p. 36) . Thet

  12. [Transient epileptic amnesia].

    PubMed

    Muramatsu, Kazuhiro; Yoshizaki, Takahito

    2016-03-01

    Transient amnesia is one of common clinical phenomenon of epilepsy that are encountered by physicians. The amnestic attacks are often associated with persistent memory disturbances. Epilepsy is common among the elderly, with amnesia as a common symptom and convulsions relatively uncommon. Therefore, amnesia due to epilepsy can easily be misdiagnosed as dementia. The term 'transient epileptic amnesia (TEA)' was introduced in the early 1990s by Kapur, who highlighted that amnestic attacks caused by epilepsy can be similar to those occurring in 'transient global amnesia', but are distinguished by features brevity and recurrence. In 1998, Zeman et al. proposed diagnostic criteria for TEA.

  13. Understanding Genotypes and Phenotypes in Epileptic Encephalopathies

    PubMed Central

    Helbig, Ingo; Tayoun, Abou Ahmad N.

    2016-01-01

    Epileptic encephalopathies are severe often intractable seizure disorders where epileptiform abnormalities contribute to a progressive disturbance in brain function. Often, epileptic encephalopathies start in childhood and are accompanied by developmental delay and various neurological and non-neurological comorbidities. In recent years, this concept has become virtually synonymous with a group of severe childhood epilepsies including West syndrome, Lennox-Gastaut syndrome, Dravet syndrome, and several other severe childhood epilepsies for which genetic factors are increasingly recognized. In the last 5 years, the field has seen a virtual explosion of gene discovery, raising the number of bona fide genes and possible candidate genes for epileptic encephalopathies to more than 70 genes, explaining 20-25% of all cases with severe early-onset epilepsies that had otherwise no identifiable causes. This review will focus on the phenotypic variability as a characteristic aspect of genetic epilepsies. For many genetic epilepsies, the phenotypic presentation can be broad, even in patients with identical genetic alterations. Furthermore, patients with different genetic etiologies can have seemingly similar clinical presentations, such as in Dravet syndrome. While most patients carry mutations in SCN1A, similar phenotypes can be seen in patients with mutations in PCDH19, CHD2, SCN8A, or in rare cases GABRA1 and STXBP1. In addition to the genotypic and phenotypic heterogeneity, both benign phenotypes and severe encephalopathies have been recognized in an increasing number of genetic epilepsies, raising the question whether these conditions represent a fluid continuum or distinct entities. PMID:27781027

  14. Focal epileptic seizures mimicking sleep paralysis.

    PubMed

    Galimberti, Carlo Andrea; Ossola, Maria; Colnaghi, Silvia; Arbasino, Carla

    2009-03-01

    Sleep paralysis (SP) is a common parasomnia. The diagnostic criteria for SP, as reported in the International Classification of Sleep Disorders, are essentially clinical, as electroencephalography (EEG)-polysomnography (PSG) is not mandatory. We describe a subject whose sleep-related events fulfilled the diagnostic criteria for SP, even though her visual hallucinations were elementary, repetitive and stereotyped, thus differing from those usually reported by patients with SP. Video/EEG-PSG documented the focal epileptic nature of the SP-like episodes.

  15. Upregulation of liprin-α1 protein in the temporal neocortex of intractable epileptic patients and experimental rats.

    PubMed

    Yin, Huan; Wang, Linyuan; Xiao, Fei; Huang, Zuchun; Huang, Yuanyuan; Zhou, Chunlei; Han, Yanbing; Tao, Shuxin; Yang, Hui; Wang, Xuefeng

    2011-08-01

    Intractable epilepsy (IE) patients have synaptic dysfunction. However, the exact mechanism of synaptic function needs further elucidation. The aim of this study was to use immunohistochemistry, immunofluorescence, and Western blotting to investigate the expression of the Liprin-α1 protein, one of the synapse-associated proteins, in human IE brain tissues and experimental rats and to discuss the possible role of Liprin-α1 in IE. We selected 30 temporal neocortical tissue samples from patients with intractable temporal lobe epilepsy (TLE) and 10 histologically normal temporal lobes from controls. Fifty-six Sprague-Dawley rats were divided randomly into seven groups; one control group and six groups with epilepsy induced by lithium-pilocarpine administration. Temporal lobe tissues were taken from controls and from rats at 1, 3, 7, 14, 30, and 60 days postseizure. Liprin-α1 was mainly expressed in neurons of human controls and TLE patients and was significantly higher in TLE patients than in controls. Liprin-α1 was also expressed in neurons of control and experimental rats and it was significantly higher in experimental rats than in the control group. The expression of Liprin-α1 in animals in the experimental group gradually increased from Days 1 to 30 postseizure induction and reached a stable level when spontaneous recurrent seizures (SRS) appeared. These results suggest that an increased expression of Liprin-α1 in the brain may be associated with human IE.

  16. Convulsive Syncope Induced by Ventricular Arrhythmia Masquerading as Epileptic Seizures: Case Report and Literature Review

    PubMed Central

    Sabu, John; Regeti, Kalyani; Mallappallil, Mary; Kassotis, John; Islam, Hamidul; Zafar, Shoaib; Khan, Rafay; Ibrahim, Hiyam; Kanta, Romana; Sen, Shuvendu; Yousif, Abdalla; Nai, Qiang

    2016-01-01

    It is important but difficult to distinguish convulsive syncope from epileptic seizure in many patients. We report a case of a man who presented to emergency department after several witnessed seizure-like episodes. He had a previous medical history of systolic heart failure and automated implantable converter defibrillator (AICD) in situ. The differential diagnoses raised were epileptic seizures and convulsive syncope secondary to cardiac arrhythmia. Subsequent AICD interrogation revealed ventricular tachycardia and fibrillation (v-tach/fib). Since convulsive syncope and epileptic seizure share many similar clinical features, early diagnosis is critical for choosing the appropriate management and preventing sudden cardiac death in patients with presumed epileptic seizure. PMID:27429683

  17. Toward Epileptic Brain Region Detection Based on Magnetic Nanoparticle Patterning

    PubMed Central

    Pedram, Maysam Z.; Shamloo, Amir; Alasty, Aria; Ghafar-Zadeh, Ebrahim

    2015-01-01

    Resection of the epilepsy foci is the best treatment for more than 15% of epileptic patients or 50% of patients who are refractory to all forms of medical treatment. Accurate mapping of the locations of epileptic neuronal networks can result in the complete resection of epileptic foci. Even though currently electroencephalography is the best technique for mapping the epileptic focus, it cannot define the boundary of epilepsy that accurately. Herein we put forward a new accurate brain mapping technique using superparamagnetic nanoparticles (SPMNs). The main hypothesis in this new approach is the creation of super-paramagnetic aggregates in the epileptic foci due to high electrical and magnetic activities. These aggregates may improve tissue contrast of magnetic resonance imaging (MRI) that results in improving the resection of epileptic foci. In this paper, we present the mathematical models before discussing the simulation results. Furthermore, we mimic the aggregation of SPMNs in a weak magnetic field using a low-cost microfabricated device. Based on these results, the SPMNs may play a crucial role in diagnostic epilepsy and the subsequent treatment of this disease. PMID:26402686

  18. Epileptic networks studied with EEG-fMRI.

    PubMed

    Gotman, Jean

    2008-01-01

    It is not easy to determine the location of the cerebral generators and the other brain regions that may be involved at the time of an epileptic spike seen in the scalp EEG. The possibility to combine EEG recording with functional MRI scanning (fMRI) opens the opportunity to uncover the regions of the brain showing changes in metabolism and blood flow in response to epileptic spikes seen in the EEG. These regions are presumably involved in the abnormal neuronal activity at the origin of epileptic discharges. This paper reviews the methodology involved in performing such studies, including the special techniques required for recording the EEG inside the scanner and the statistical issues in analyzing the fMRI signal. We then discuss the results obtained in patients with different types of focal epileptic disorders and in patients with primary generalized epilepsy. The results in general indicate that interictal epileptic discharges may affect brain areas well beyond the presumed region in which they are generated. The noninvasive nature of this method opens new horizons in the investigation of brain regions involved and affected by epileptic discharges.

  19. Constrained fixed-fulcrum reverse shoulder arthroplasty improves functional outcome in epileptic patients with recurrent shoulder instability

    PubMed Central

    Thangarajah, Tanujan; Higgs, Deborah; Bayley, J I L; Lambert, Simon M

    2016-01-01

    AIM: To report the results of fixed-fulcrum fully constrained reverse shoulder arthroplasty for the treatment of recurrent shoulder instability in patients with epilepsy. METHODS: A retrospective review was conducted at a single facility. Cases were identified using a computerized database and all clinic notes and operative reports were reviewed. All patients with epilepsy and recurrent shoulder instability were included for study. Between July 2003 and August 2011 five shoulders in five consecutive patients with epilepsy underwent fixed-fulcrum fully constrained reverse shoulder arthroplasty for recurrent anterior shoulder instability. The mean duration of epilepsy in the cohort was 21 years (range, 5-51) and all patients suffered from grand mal seizures. RESULTS: Mean age at the time of surgery was 47 years (range, 32-64). The cohort consisted of four males and one female. Mean follow-up was 4.7 years (range, 4.3-5 years). There were no further episodes of instability, and no further stabilisation or revision procedures were performed. The mean Oxford shoulder instability score improved from 8 preoperatively (range, 5-15) to 30 postoperatively (range, 16-37) (P = 0.015) and the mean subjective shoulder value improved from 20 (range, 0-50) preoperatively to 60 (range, 50-70) postoperatively (P = 0.016). Mean active forward elevation improved from 71° preoperatively (range, 45°-130°) to 100° postoperatively (range, 80°-90°) and mean active external rotation improved from 15° preoperatively (range, 0°-30°) to 40° (20°-70°) postoperatively. No cases of scapular notching or loosening were noted. CONCLUSION: Fixed-fulcrum fully constrained reverse shoulder arthroplasty should be considered for the treatment of recurrent shoulder instability in patients with epilepsy. PMID:27458554

  20. Increased expression of histone deacetylases 2 in temporal lobe epilepsy: a study of epileptic patients and rat models.

    PubMed

    Huang, Yuanyuan; Zhao, Fenghua; Wang, Liang; Yin, Huan; Zhou, Chunlei; Wang, Xuefeng

    2012-02-01

    Histone deacetylases 2 (HDAC2) is expressed in the central nervous system; it has multiple functions in neural plasticity. However, we do not know if HDAC2 is also involved in the pathology of epilepsy. Here we report that HDAC2 was expressed in the brain tissues of both control and temporal lobe epilepsy (TLE) patients. Results from immunofluorescence and immunohistochemistry showed that HDAC2 was primarily located in the nucleus and that TLE patients exhibit significantly more HDAC2 positive cells than control. Western blotting showed that HDAC2 protein levels were significantly higher in TLE than in control brain. Moreover, in the rat model of TLE, there was a sustained enhancement of HDAC2 expression in rat models of TLE. HDAC2 was significantly increased in both the acute (1 day) and chronic (60 days) animals compared with control group. These results suggest that HDAC2 play an important role in the pathogenesis of human TLE.

  1. Correlation Between IL-10 and microRNA-187 Expression in Epileptic Rat Hippocampus and Patients with Temporal Lobe Epilepsy

    PubMed Central

    Alsharafi, Walid A.; Xiao, Bo; Abuhamed, Mutasem M.; Bi, Fang-Fang; Luo, Zhao-Hui

    2015-01-01

    Accumulating evidence is emerging that microRNAs (miRNAs) are key regulators in controlling neuroinflammatory responses that are known to play a potential role in the pathogenesis of temporal lobe epilepsy (TLE). The aim of the present study was to investigate the dynamic expression pattern of interleukin (IL)-10 as an anti-inflammatory cytokine and miR-187 as a post-transcriptional inflammation-related miRNA in the hippocampus of a rat model of status epilepticus (SE) and patients with TLE. We performed a real-time quantitative PCR and western blot on rat hippocampus 2 h, 7 days, 21 days and 60 days following pilocarpine-induced SE, and on hippocampus obtained from TLE patients and normal controls. To detect the relationship between IL-10 and miR-187 on neurons, lipopolysaccharide (LPS) and IL-10-stimulated neurons were performed. Furthermore, we identified the effect of antagonizing miR-187 by its antagomir on IL-10 secretion. Here, we reported that IL-10 secretion and miR-187 expression levels are inversely correlated after SE. In patients with TLE, the expression of IL-10 was also significantly upregulated, whereas miR-187 expression was significantly downregulated. Moreover, miR-187 expression was significantly reduced following IL-10 stimulation in an IL-10–dependent manner. On the other hand, antagonizing miR-187 promoted the production of IL-10 in hippocampal tissues of rat model of SE. Our findings demonstrate a critical role of miR-187 in the physiological regulation of IL-10 anti-inflammatory responses and elucidate the role of neuroinflammation in the pathogenesis of TLE. Therefore, modulation of the IL-10 / miR-187 axis may be a new therapeutic approach for TLE. PMID:26696826

  2. Giant Intradural Mucocele in a Patient with Adult Onset Seizures

    PubMed Central

    Kechagias, E.; Georgakoulias, N.; Ioakimidou, C.; Kyriazi, S.; Kontogeorgos, G.; Seretis, A.

    2009-01-01

    A rare case of mucopyocele in a patient who presented with epileptic seizures is reported. The computed tomography scan (CT) and the magnetic resonance (MR) imaging revealed an intradural extension of a giant fronto-ethmoidal mucopyocele, eroding the cribriform plate and compressing both frontal lobes. The lesion was removed by craniotomy with elimination of the mass effect and reconstruction of the anterior skull base. An intracranial-intradural mucopyocele is an extremely rare cause of generalized convulsion as a presenting symptom, with only 6 cases reported in the literature. The total removal of the lesion associated with anterior fossa reconstruction is the treatment of choice. PMID:20847833

  3. In vivo detection of epileptic brain tissue using static fluorescence and diffuse reflectance spectroscopy

    NASA Astrophysics Data System (ADS)

    Yadav, Nitin; Bhatia, Sanjiv; Ragheb, John; Mehta, Rupal; Jayakar, Prasanna; Yong, William; Lin, Wei-Chiang

    2013-02-01

    Diffuse reflectance and fluorescence spectroscopy are used to detect histopathological abnormalities of an epileptic brain in a human subject study. Static diffuse reflectance and fluorescence spectra are acquired from normal and epileptic brain areas, defined by electrocorticography (ECoG), from pediatric patients undergoing epilepsy surgery. Biopsy specimens are taken from the investigated sites within an abnormal brain. Spectral analysis reveals significant differences in diffuse reflectance spectra and the ratio of fluorescence and diffuse reflectance spectra from normal and epileptic brain areas defined by ECoG and histology. Using these spectral differences, tissue classification models with accuracy above 80% are developed based on linear discriminant analysis. The differences between the diffuse reflectance spectra from the normal and epileptic brain areas observed in this study are attributed to alterations in the static hemodynamic characteristics of an epileptic brain, suggesting a unique association between the histopathological and the hemodynamic abnormalities in an epileptic brain.

  4. Hypnotic induction of an epileptic seizure: a brief communication.

    PubMed

    Bryant, R A; Somerville, E

    1995-07-01

    This case study investigated the utility of hypnosis to precipitate a seizure in a patient with refractory epilepsy. The patient was twice administered a hypnotic induction and a suggestion to age regress to a day when he was distressed and suffered repeated seizures. The patient did not respond to the first hypnotic suggestion; however, an epileptic seizure was observed in the second hypnotic session. Videorecording and subdural electroencephalograph recording confirmed that he suffered an epileptic seizure. Postexperimental inquiry revealed that the patient used deliberate cognitive strategies to avoid seizure onset in the first session but adopted a more constructive cognitive style in the second session. Findings are discussed in terms of emotions, hypnosis, and cognitive style as mediating factors in the experimental precipitation of epileptic seizures.

  5. Occurrence and clinical features of epileptic and non-epileptic paroxysmal events in five children with Pallister-Killian syndrome.

    PubMed

    Filloux, Francis M; Carey, John C; Krantz, Ian D; Ekstrand, Jeffrey J; Candee, Meghan S

    2012-05-01

    Pallister-Killian syndrome (PKS) is a rare, sporadic genetic disorder caused by tetrasomy 12p mosaicism associated with a supernumerary isochromosome. Craniofacial dysmorphism, learning impairment and seizures are considered characteristic. However, little is known of the seizure and epilepsy patterns seen in PKS. To better define the occurrence and nature of epileptic and non-epileptic paroxysmal events in PKS, we describe our experience with 5 patients and compare their features with data from a larger cohort of PKS patients ascertained via a web-based parental questionnaire. Three of the 5 patients have had definite epileptic seizures, and one other has had paroxysmal events as yet not clarified. Four of the 5 have also had either non-epileptic paroxysmal events or episodes of uncertain nature. In those with epilepsy, all have had some period of relatively refractory seizures, all have required more than one antiepileptic drug, but none experienced status epilepticus. Only one of the patients with epilepsy (the oldest) has gone into remission. In two of the four with non-epileptic events, video-electroencephalographic monitoring has been valuable in clarifying the nature of the events. EEG characteristics include a slow dominant frequency as well as generalized and focal epileptiform features. Brain MRI findings can be normal but are variable. These specific findings correspond well to information reported by parents in a larger cohort of 51 individuals with PKS. Better understanding of the nature of epileptic and non-epileptic events in PKS will result from a more detailed analysis of objective data obtained from this larger cohort, and from deeper understanding of the molecular impact of 12p tetrasomy in selected cell lines.

  6. Occurrence and clinical features of epileptic and non-epileptic paroxysmal events in five children with Pallister–Killian syndrome

    PubMed Central

    Filloux, Francis M.; Carey, John C.; Krantz, Ian D.; Ekstrand, Jeffrey J.; Candee, Meghan S.

    2013-01-01

    Pallister–Killian syndrome (PKS) is a rare, sporadic genetic disorder caused by tetrasomy 12p mosaicism associated with a supernumerary isochromosome. Craniofacial dysmorphism, learning impairment and seizures are considered characteristic. However, little is known of the seizure and epilepsy patterns seen in PKS. To better define the occurrence and nature of epileptic and non-epileptic paroxysmal events in PKS, we describe our experience with 5 patients and compare their features with data from a larger cohort of PKS patients ascertained via a web-based parental questionnaire. Three of the 5 patients have had definite epileptic seizures, and one other has had paroxysmal events as yet not clarified. Four of the 5 have also had either non-epileptic paroxysmal events or episodes of uncertain nature. In those with epilepsy, all have had some period of relatively refractory seizures, all have required more than one antiepileptic drug, but none experienced status epilepticus. Only one of the patients with epilepsy (the oldest) has gone into remission. In two of the four with non-epileptic events, video-electroencephalographic monitoring has been valuable in clarifying the nature of the events. EEG characteristics include a slow dominant frequency as well as generalized and focal epileptiform features. Brain MRI findings can be normal but are variable. These specific findings correspond well to information reported by parents in a larger cohort of 51 individuals with PKS. Better understanding of the nature of epileptic and non-epileptic events in PKS will result from a more detailed analysis of objective data obtained from this larger cohort, and from deeper understanding of the molecular impact of 12p tetrasomy in selected cell lines. PMID:22349688

  7. A Novel Dynamic Update Framework for Epileptic Seizure Prediction

    PubMed Central

    Wang, Minghui; Hong, Xiaojun; Han, Jie

    2014-01-01

    Epileptic seizure prediction is a difficult problem in clinical applications, and it has the potential to significantly improve the patients' daily lives whose seizures cannot be controlled by either drugs or surgery. However, most current studies of epileptic seizure prediction focus on high sensitivity and low false-positive rate only and lack the flexibility for a variety of epileptic seizures and patients' physical conditions. Therefore, a novel dynamic update framework for epileptic seizure prediction is proposed in this paper. In this framework, two basic sample pools are constructed and updated dynamically. Furthermore, the prediction model can be updated to be the most appropriate one for the prediction of seizures' arrival. Mahalanobis distance is introduced in this part to solve the problem of side information, measuring the distance between two data sets. In addition, a multichannel feature extraction method based on Hilbert-Huang transform and extreme learning machine is utilized to extract the features of a patient's preseizure state against the normal state. At last, a dynamic update epileptic seizure prediction system is built up. Simulations on Freiburg database show that the proposed system has a better performance than the one without update. The research of this paper is significantly helpful for clinical applications, especially for the exploitation of online portable devices. PMID:25050381

  8. Impaired picture recognition in transient epileptic amnesia.

    PubMed

    Dewar, Michaela; Hoefeijzers, Serge; Zeman, Adam; Butler, Christopher; Della Sala, Sergio

    2015-01-01

    Transient epileptic amnesia (TEA) is an epileptic syndrome characterized by recurrent, brief episodes of amnesia. Transient epileptic amnesia is often associated with the rapid decline in recall of new information over hours to days (accelerated long-term forgetting - 'ALF'). It remains unknown how recognition memory is affected in TEA over time. Here, we report a systematic study of picture recognition in patients with TEA over the course of one week. Sixteen patients with TEA and 16 matched controls were presented with 300 photos of everyday life scenes. Yes/no picture recognition was tested 5min, 2.5h, 7.5h, 24h, and 1week after picture presentation using a subset of target pictures as well as similar and different foils. Picture recognition was impaired in the patient group at all test times, including the 5-minute test, but it declined normally over the course of 1week. This impairment was associated predominantly with an increased false alarm rate, especially for similar foils. High performance on a control test indicates that this impairment was not associated with perceptual or discrimination deficits. Our findings suggest that, at least in some TEA patients with ALF in verbal recall, picture recognition does not decline more rapidly than in controls over 1week. However, our findings of an early picture recognition deficit suggest that new visual memories are impoverished after minutes in TEA. This could be the result of deficient encoding or impaired early consolidation. The early picture recognition deficit observed could reflect either the early stages of the process that leads to ALF or a separable deficit of anterograde memory in TEA. Lastly, our study suggests that at least some patients with TEA are prone to falsely recognizing new everyday visual information that they have not in fact seen previously. This deficit, alongside their ALF in free recall, likely affects everyday memory performance.

  9. Ab interno trabeculectomy in the adult patient.

    PubMed

    SooHoo, Jeffrey R; Seibold, Leonard K; Kahook, Malik Y

    2015-01-01

    Glaucoma is a potentially blinding disease that affects millions of people worldwide. The mainstay of treatment is lowering of intraocular pressure (IOP) through the use of medications, laser and/or incisional surgery. The trabecular meshwork (TM) is thought to be the site of significant resistance to aqueous outflow in open angle glaucoma. Theoretically, an incision through TM or TM removal should decrease this resistance and lead to a significant reduction in IOP. This approach, commonly referred to as goniotomy or trabeculotomy, has been validated in the pediatric population and has been associated with long-term IOP control. In adults, however, removal of TM tissue has been historically associated with more limited and short-lived success. More recent evidence, reveals that even adult patients may benefit significantly from removal of diseased TM tissue and can lead to a significant reduction in IOP that is long-lasting and safe. In this review, we discuss current evidence and techniques for ab interno trabeculectomy using various devices in the adult patient.

  10. Ab Interno Trabeculectomy in the Adult Patient

    PubMed Central

    SooHoo, Jeffrey R.; Seibold, Leonard K.; Kahook, Malik Y.

    2015-01-01

    Glaucoma is a potentially blinding disease that affects millions of people worldwide. The mainstay of treatment is lowering of intraocular pressure (IOP) through the use of medications, laser and/or incisional surgery. The trabecular meshwork (TM) is thought to be the site of significant resistance to aqueous outflow in open angle glaucoma. Theoretically, an incision through TM or TM removal should decrease this resistance and lead to a significant reduction in IOP. This approach, commonly referred to as goniotomy or trabeculotomy, has been validated in the pediatric population and has been associated with long-term IOP control. In adults, however, removal of TM tissue has been historically associated with more limited and short-lived success. More recent evidence, reveals that even adult patients may benefit significantly from removal of diseased TM tissue and can lead to a significant reduction in IOP that is long-lasting and safe. In this review, we discuss current evidence and techniques for ab interno trabeculectomy using various devices in the adult patient. PMID:25624670

  11. Trauma injury in adult underweight patients

    PubMed Central

    Hsieh, Ching-Hua; Lai, Wei-Hung; Wu, Shao-Chun; Chen, Yi-Chun; Kuo, Pao-Jen; Hsu, Shiun-Yuan; Hsieh, Hsiao-Yun

    2017-01-01

    Abstract The aim of this study was to investigate and compare the injury characteristics, severity, and outcome between underweight and normal-weight patients hospitalized for the treatment of all kinds of trauma injury. This study was based on a level I trauma center Taiwan. The detailed data of 640 underweight adult trauma patients with a body mass index (BMI) of <18.5 kg/m2 and 6497 normal-weight adult patients (25 > BMI ≥ 18.5 kg/m2) were retrieved from the Trauma Registry System between January 1, 2009, and December 31, 2014. Pearson's chi-square test, Fisher's exact test, and independent Student's t-test were performed to compare the differences. Propensity score matching with logistic regression was used to evaluate the effect of underweight on mortality. Underweight patients presented a different bodily injury pattern and a significantly higher rate of admittance to the intensive care unit (ICU) than did normal-weight patients; however, no significant differences in the Glasgow Coma Scale (GCS) score, injury severity score (ISS), in-hospital mortality, and hospital length of stay were found between the two groups. However, further analysis of the patients stratified by two major injury mechanisms (motorcycle accident and fall injury) revealed that underweight patients had significantly lower GCS scores (13.8 ± 3.0 vs 14.5 ± 2.0, P = 0.020), but higher ISS (10.1 ± 6.9 vs 8.4 ± 5.9, P = 0.005), in-hospital mortality (odds ratio, 4.4; 95% confidence interval, 1.69–11.35; P = 0.006), and ICU admittance rate (24.1% vs 14.3%, P = 0.007) than normal-weight patients in the fall accident group, but not in the motorcycle accident group. However, after propensity score matching, logistic regression analysis of well-matched pairs of patients with either all trauma, motorcycle accident, or fall injury did not show a significant influence of underweight on mortality. Exploratory data analysis revealed that underweight patients

  12. Detecting Epileptic Regions Based on Global Brain Connectivity Patterns

    PubMed Central

    Sweet, Andrew; Venkataraman, Archana; Stufflebeam, Steven M.; Liu, Hesheng; Tanaka, Naoro; Madsen, Joseph; Golland, Polina

    2014-01-01

    We present a method to detect epileptic regions based on functional connectivity differences between individual epilepsy patients and a healthy population. Our model assumes that the global functional characteristics of these differences are shared across patients, but it allows for the epileptic regions to vary between individuals. We evaluate the detection performance against intracranial EEG observations and compare our approach with two baseline methods that use standard statistics. The baseline techniques are sensitive to the choice of thresholds, whereas our algorithm automatically estimates the appropriate model parameters and compares favorably with the best baseline results. This suggests the promise of our approach for pre-surgical planning in epilepsy. PMID:24505654

  13. Detecting epileptic regions based on global brain connectivity patterns.

    PubMed

    Sweet, Andrew; Venkataraman, Archana; Stufflebeam, Steven M; Liu, Hesheng; Tanaka, Naoro; Madsen, Joseph; Golland, Polina

    2013-01-01

    We present a method to detect epileptic regions based on functional connectivity differences between individual epilepsy patients and a healthy population. Our model assumes that the global functional characteristics of these differences are shared across patients, but it allows for the epileptic regions to vary between individuals. We evaluate the detection performance against intracranial EEG observations and compare our approach with two baseline methods that use standard statistics. The baseline techniques are sensitive to the choice of thresholds, whereas our algorithm automatically estimates the appropriate model parameters and compares favorably with the best baseline results. This suggests the promise of our approach for pre-surgical planning in epilepsy.

  14. Predicting Epileptic Seizures in Advance

    PubMed Central

    Moghim, Negin; Corne, David W.

    2014-01-01

    Epilepsy is the second most common neurological disorder, affecting 0.6–0.8% of the world's population. In this neurological disorder, abnormal activity of the brain causes seizures, the nature of which tend to be sudden. Antiepileptic Drugs (AEDs) are used as long-term therapeutic solutions that control the condition. Of those treated with AEDs, 35% become resistant to medication. The unpredictable nature of seizures poses risks for the individual with epilepsy. It is clearly desirable to find more effective ways of preventing seizures for such patients. The automatic detection of oncoming seizures, before their actual onset, can facilitate timely intervention and hence minimize these risks. In addition, advance prediction of seizures can enrich our understanding of the epileptic brain. In this study, drawing on the body of work behind automatic seizure detection and prediction from digitised Invasive Electroencephalography (EEG) data, a prediction algorithm, ASPPR (Advance Seizure Prediction via Pre-ictal Relabeling), is described. ASPPR facilitates the learning of predictive models targeted at recognizing patterns in EEG activity that are in a specific time window in advance of a seizure. It then exploits advanced machine learning coupled with the design and selection of appropriate features from EEG signals. Results, from evaluating ASPPR independently on 21 different patients, suggest that seizures for many patients can be predicted up to 20 minutes in advance of their onset. Compared to benchmark performance represented by a mean S1-Score (harmonic mean of Sensitivity and Specificity) of 90.6% for predicting seizure onset between 0 and 5 minutes in advance, ASPPR achieves mean S1-Scores of: 96.30% for prediction between 1 and 6 minutes in advance, 96.13% for prediction between 8 and 13 minutes in advance, 94.5% for prediction between 14 and 19 minutes in advance, and 94.2% for prediction between 20 and 25 minutes in advance. PMID:24911316

  15. Neuropsychological approaches to epileptic encephalopathies.

    PubMed

    Filippini, Melissa; Arzimanoglou, Alexis; Gobbi, Giuseppe

    2013-11-01

    The International League Against Epilepsy (ILAE) Commission report on classification and terminology indicates that "diagnosing an individual as having an encephalopathic course requires demonstration of a failure to develop as expected relative to the same-aged peers or to regress in abilities." In this chapter, basing our discussion on the theoretical framework of neuroconstructivism, on the latest results deriving from functional neuroimaging and on the concept of system epilepsy, we use continuous spike-waves during slow-wave sleep (CSWS) as an example of how non-rapid eye movement (NREM) sleep spikes interfere with the organization and consolidation of neuropsychological networks in the sensitive phase of development, affecting also interconnected systems. Indeed, recent discoveries show that the normal overnight downscaling of slow wave activity (SWA) from the first to the last hours of sleep is absent in electrical status epilepticus during sleep (ESES) patients, thus impairing the neural process and possibly the local plastic changes associated with learning and other cognitive functions. Moreover, specific patterns of spike-induced activation (especially in perisylvian and/or prefrontal areas) and deactivation of default mode network (DMN) have been shown in patients with CSWS. Consequently, to date, we may conceive that the possible mechanisms underlying neuropsychological disorders in encephalopathic epilepsy (EE) may be double, since NREM sleep interictal epileptic discharges (IEDs) induce both a pathologic activation in epileptogenic areas and a pathologic deactivation of DMN beyond the epileptogenic zone. The growing body of literature on the effects of ESES in CSWS provides us with increasing knowledge on the complexity of brain development and a better understanding of plasticity, enlightening the pathogenesis of damage on developing neuropsychological functions. Finally, the need for an individually tailored interpretation of the neuropsychological

  16. The ketogenic diet can be used successfully in combination with corticosteroids for epileptic encephalopathies.

    PubMed

    Ville, Dorothée; Chiron, Catherine; Laschet, Jacques; Dulac, Olivier

    2015-07-01

    Hormonal therapy or ketogenic diet often permits overcoming the challenging periods of many epileptic encephalopathies (West and Lennox-Gastaut syndromes and encephalopathy with continuous spike-waves in slow sleep), but relapse affects over 20% of patients. We report here a monocenter pilot series of 42 consecutive patients in whom we combined oral steroids with the ketogenic diet for corticosteroid-resistant or -dependent epileptic encephalopathy. We retrospectively evaluated the effect on seizure frequency, interictal spike activity, neuropsychological course, and steroid treatment course. Twenty-three patients had West syndrome (WS), 13 had encephalopathy with continuous spike-waves in slow sleep (CSWS), and six others had miscellaneous epileptic encephalopathies. All patients succeeded to reach 0.8 to 1.6g/l ketone bodies in the urine following the usual KD regimen. For at least 6 months, 14/42 responded to the addition of the ketogenic diet: 4/23 with WS, 8/13 with CSWS, and 2/6 with miscellaneous epileptic encephalopathies. The addition of the KD allowed withdrawing steroids in all responders. Among them, 10/15 had been patients with steroid-dependent epileptic encephalopathy and 4/27 patients with steroid-resistant epileptic encephalopathy. Therefore, the ketogenic diet can be used successfully in combination with corticosteroids for epileptic encephalopathies. Patients presenting with steroid-dependent CSWS seem to be the best candidates.

  17. Complex dynamics of epileptic EEG.

    PubMed

    Kannathal, N; Puthusserypady, Sadasivan K; Choo Min, Lim

    2004-01-01

    Electroencephalogram (EEG) - the recorded representation of electrical activity of the brain contain useful information about the state of the brain. Recent studies indicate that nonlinear methods can extract valuable information from neuronal dynamics. We compare the dynamical properties of EEG signals of healthy subjects with epileptic subjects using nonlinear time series analysis techniques. Chaotic invariants like correlation dimension (D2) , largest Lyapunov exponent (lambda1), Hurst exponent (H) and Kolmogorov entropy (K) are used to characterize the signal. Our study showed clear differences in dynamical properties of brain electrical activity of the normal and epileptic subjects with a confidence level of more than 90%. Furthermore to support this claim fractal dimension (FD) analysis is performed. The results indicate reduction in value of FD for epileptic EEG indicating reduction in system complexity.

  18. [Non-epileptic motor paroxysmal phenomena in wakefulness in childhood].

    PubMed

    Ruggieri, Víctor L; Arberas, Claudia L

    2013-09-06

    Paroxysmal events in childhood are a challenge for pediatric neurologists, given its highly heterogeneous clinical manifestations, often difficult to distinguish between phenomena of epileptic seizure or not. The non-epileptic paroxysmal episodes are neurological phenomena, with motor, sensory symptoms, and/or sensory impairments, with or without involvement of consciousness, epileptic phenomena unrelated, so no electroencephalographic correlative expression between or during episodes. From the clinical point of view can be classified into four groups: motor phenomena, syncope, migraine (and associated conditions) and acute psychiatric symptoms. In this paper we analyze paroxysmal motor phenomena in awake children, dividing them according to their clinical manifestations: extrapyramidal episodes (paroxysmal kinesiogenic, non kinesiogenic and not related to exercise dyskinesias, Dopa responsive dystonia) and similar symptoms of dystonia (Sandifer syndrome); manifestations of startle (hyperekplexia); episodic eye and head movements (benign paroxysmal tonic upward gaze nistagmus deviation); episodic ataxia (familial episodic ataxias, paroxysmal benign vertigo); stereotyped and phenomena of self-gratification; and myoclonic events (benign myoclonus of early infancy). The detection of these syndromes will, in many cases, allow an adequate genetic counseling, initiate a specific treatment and avoid unnecessary additional studies. Molecular studies have demonstrated a real relationship between epileptic and non-epileptic basis of many of these entities and surely the identification of the molecular basis and understanding of the pathophysiological mechanisms in many of them allow us, in the near future will benefit our patients.

  19. Astrocytes in the epileptic brain.

    PubMed

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2008-04-24

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development.

  20. Astrocytes in the Epileptic Brain

    PubMed Central

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2014-01-01

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development. PMID:18439402

  1. [Clinical presentation and diagnosis of epileptic auras].

    PubMed

    Barletova, E I; Kremenchugskaia, M R; Mukhin, K Iu; Glukhova, L Iu; Mironov, M B

    2012-01-01

    To define clinical presentations of visual auras and to reveal their clinical, encephalographic and neuroimaging correlates, we examined 23 patients, aged from 5 to 25 years (mean 14±6 years), with focal forms of epilepsy. Patients had visual auras regardless of the etiology of epilepsy which developed immediately before epileptic seizures or were isolated. Patients had simple or complex visual hallucinations, the former occurring more frequently, visual illusions and ictal amaurosis. Positive visual phenomena were noted more frequently than negative ones. In most of the patients, visual hallucinations were associated with the pathological activity in cortical occipital regions of the brain and, in some cases, in temporal and parietal regions. The different pathologies (developmental defects, post-ischemic, atrophic and other disturbances) identified by MRI were found in a half of patients.

  2. Intravenous methylprednisolone pulse therapy for children with epileptic encephalopathy

    PubMed Central

    Pera, Maria Carmela; Randazzo, Giovanna; Masnada, Silvia; Dontin, Serena Donetti; De Giorgis, Valentina; Balottin, Umberto; Veggiotti, Pierangelo

    2015-01-01

    Summary The aim of this retrospective study of children affected by epileptic encephalopathy was to evaluate seizure frequency, electroencephalographic pattern and neuropsychological status, before and after intravenous methylprednisolone therapy. Eleven children with epileptic encephalopathy were administered one cycle of intravenous methylprednisolone (15–30 mg/kg/day for three consecutive days, once a month for four months) in addition to constant dosages of their regular antiepileptic drugs. The treatment resulted in statistically significant reductions of generalized slow spike-and-wave discharges (p<0.0028) and seizure frequency (p<0.013), which persisted even after methylprednisolone pulse therapy was stopped. A globally positive outcome was noted in 9/11 patients (81.8%). This methylprednisolone treatment regimen did not cause significant or persistent adverse effects. We suggest that children with epileptic encephalopathy without an underlying structural lesion could be the best candidates for intravenous methylprednisolone pulse therapy. PMID:26910177

  3. Transient epileptic amnesia--a clinical update and a reformulation.

    PubMed Central

    Kapur, N

    1993-01-01

    While absence attacks and complex partial seizures have been well documented in patients with epilepsy, the delineation of pure episodes of memory loss without additional clinical manifestations remains poorly characterised. The recently described condition of transient epileptic amnesia (TEA) is critically examined, and four new cases are described, in each of which there were episodes of pure memory loss which subsequently proved to be epileptic in origin. The anatomical and pathophysiological basis of TEA is presumed to be similar to transient global amnesia (TGA), that is, it is likely to be primarily hippocampal in origin, but with more variable involvement of limbic and adjacent temporal lobe neocortical structures. PMID:8229029

  4. Detecting and localizing the foci in human epileptic seizures

    NASA Astrophysics Data System (ADS)

    Ben-Jacob, Eshel; Boccaletti, Stefano; Pomyalov, Anna; Procaccia, Itamar; Towle, Vernon L.

    2007-12-01

    We consider the electrical signals recorded from a subdural array of electrodes placed on the pial surface of the brain for chronic evaluation of epileptic patients before surgical resection. A simple and computationally fast method to analyze the interictal phase synchrony between such electrodes is introduced and developed with the aim of detecting and localizing the foci of the epileptic seizures. We evaluate the method by comparing the results of surgery to the localization predicted here. We find an indication of good correspondence between the success or failure in the surgery and the agreement between our identification and the regions actually operated on.

  5. Clinical phenotypes in adult patients with bronchiectasis.

    PubMed

    Aliberti, Stefano; Lonni, Sara; Dore, Simone; McDonnell, Melissa J; Goeminne, Pieter C; Dimakou, Katerina; Fardon, Thomas C; Rutherford, Robert; Pesci, Alberto; Restrepo, Marcos I; Sotgiu, Giovanni; Chalmers, James D

    2016-04-01

    Bronchiectasis is a heterogeneous disease. This study aimed at identifying discrete groups of patients with different clinical and biological characteristics and long-term outcomes.This was a secondary analysis of five European databases of prospectively enrolled adult outpatients with bronchiectasis. Principal component and cluster analyses were performed using demographics, comorbidities, and clinical, radiological, functional and microbiological variables collected during the stable state. Exacerbations, hospitalisations and mortality during a 3-year follow-up were recorded. Clusters were externally validated in an independent cohort of patients with bronchiectasis, also investigating inflammatory markers in sputum.Among 1145 patients (median age 66 years; 40% male), four clusters were identified driven by the presence of chronic infection with Pseudomonas aeruginosaor other pathogens and daily sputum: "Pseudomonas" (16%), "Other chronic infection" (24%), "Daily sputum" (33%) and "Dry bronchiectasis" (27%). Patients in the four clusters showed significant differences in terms of quality of life, exacerbations, hospitalisations and mortality during follow-up. In the validation cohort, free neutrophil elastase activity, myeloperoxidase activity and interleukin-1β levels in sputum were significantly different among the clusters.Identification of four clinical phenotypes in bronchiectasis could favour focused treatments in future interventional studies designed to alter the natural history of the disease.

  6. Assisting sexually abused adults. Practical guide to interviewing patients.

    PubMed Central

    Leach, M. M.; Bethune, C.

    1996-01-01

    Millions of adults have been sexually abused. Patients often confide in their family physicians concerning their abuse. Physicians must understand their own issues surrounding sexual abuse and its sequelae before they attempt to treat sexually abused patients. The PLISSIT model offers a practical guide for assisting abused adult patients. PMID:8924817

  7. Nonlinear analysis of EEG for epileptic seizures

    SciTech Connect

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.; Eisenstadt, M.L.

    1995-04-01

    We apply chaotic time series analysis (CTSA) to human electroencephalogram (EEG) data. Three epoches were examined: epileptic seizure, non-seizure, and transition from non-seizure to seizure. The CTSA tools were applied to four forms of these data: raw EEG data (e-data), artifact data (f-data) via application of a quadratic zero-phase filter of the raw data, artifact-filtered data (g- data) and that was the residual after subtracting f-data from e-data, and a low-pass-filtered version (h-data) of g-data. Two different seizures were analyzed for the same patient. Several nonlinear measures uniquely indicate an epileptic seizure in both cases, including an abrupt decrease in the time per wave cycle in f-data, an abrupt increase in the Kolmogorov entropy and in the correlation dimension for e-h data, and an abrupt increase in the correlation dimension for e-h data. The transition from normal to seizure state also is characterized by distinctly different trends in the nonlinear measures for each seizure and may be potential seizure predictors for this patient. Surrogate analysis of e-data shows that statistically significant nonlinear structure is present during the non-seizure, transition , and seizure epoches.

  8. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, L.M.

    2002-04-19

    This report describes work that was performed under a Cooperative Research and Development Agreement (CRADA) between UT-Battelle, LLC (Contractor) and a commercial participant, VIASYS Healthcare Inc. (formerly Nicolet Biomedical, Inc.). The Contractor has patented technology that forewarns of impending epileptic events via scalp electroencephalograph (EEG) data and successfully demonstrated this technology on 20 datasets from the Participant under pre-CRADA effort. This CRADA sought to bridge the gap between the Contractor's existing research-class software and a prototype medical device for subsequent commercialization by the Participant. The objectives of this CRADA were (1) development of a combination of existing computer hardware and Contractor-patented software into a clinical process for warning of impending epileptic events in human patients, and (2) validation of the epilepsy warning methodology. This work modified the ORNL research-class FORTRAN for forewarning to run under a graphical user interface (GUI). The GUI-FORTRAN software subsequently was installed on desktop computers at five epilepsy monitoring units. The forewarning prototypes have run for more than one year without any hardware or software failures. This work also reported extensive analysis of model and EEG datasets to demonstrate the usefulness of the methodology. However, the Participant recently chose to stop work on the CRADA, due to a change in business priorities. Much work remains to convert the technology into a commercial clinical or ambulatory device for patient use, as discussed in App. H.

  9. Dravet syndrome as epileptic encephalopathy: evidence from long-term course and neuropathology

    PubMed Central

    Catarino, Claudia B.; Liu, Joan Y.W.; Liagkouras, Ioannis; Gibbons, Vaneesha S.; Labrum, Robyn W.; Ellis, Rachael; Woodward, Cathy; Davis, Mary B.; Smith, Shelagh J.; Cross, J. Helen; Appleton, Richard E.; Yendle, Simone C.; McMahon, Jacinta M.; Bellows, Susannah T.; Jacques, Thomas S.; Zuberi, Sameer M.; Koepp, Matthias J.; Martinian, Lillian; Scheffer, Ingrid E.; Thom, Maria

    2011-01-01

    Dravet syndrome is an epilepsy syndrome of infantile onset, frequently caused by SCN1A mutations or deletions. Its prevalence, long-term evolution in adults and neuropathology are not well known. We identified a series of 22 adult patients, including three adult post-mortem cases with Dravet syndrome. For all patients, we reviewed the clinical history, seizure types and frequency, antiepileptic drugs, cognitive, social and functional outcome and results of investigations. A systematic neuropathology study was performed, with post-mortem material from three adult cases with Dravet syndrome, in comparison with controls and a range of relevant paediatric tissue. Twenty-two adults with Dravet syndrome, 10 female, were included, median age 39 years (range 20–66). SCN1A structural variation was found in 60% of the adult Dravet patients tested, including one post-mortem case with DNA extracted from brain tissue. Novel mutations were described for 11 adult patients; one patient had three SCN1A mutations. Features of Dravet syndrome in adulthood include multiple seizure types despite polytherapy, and age-dependent evolution in seizure semiology and electroencephalographic pattern. Fever sensitivity persisted through adulthood in 11 cases. Neurological decline occurred in adulthood with cognitive and motor deterioration. Dysphagia may develop in or after the fourth decade of life, leading to significant morbidity, or death. The correct diagnosis at an older age made an impact at several levels. Treatment changes improved seizure control even after years of drug resistance in all three cases with sufficient follow-up after drug changes were instituted; better control led to significant improvement in cognitive performance and quality of life in adulthood in two cases. There was no histopathological hallmark feature of Dravet syndrome in this series. Strikingly, there was remarkable preservation of neurons and interneurons in the neocortex and hippocampi of Dravet adult post

  10. Fractal Dimension in Epileptic EEG Signal Analysis

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.

    greater speed and the criterion to choose the maximum and minimum values for time intervals. Comparisons with the other waveform fractal dimension algorithms are also demonstrated. In order to discriminate the Healthy and the Epileptic EEGs, an improved method of Multifractal Measure such as Generalized Fractal Dimensions (GFD) is also proposed. Finally we conclude that there are significant differences between the Healthy and Epileptic Signals in the designed method than the GFD through graphical and statistical tools. The improved multifractal measure is very efficient technique to analyze the EEG Signals and to compute the state of illness of the Epileptic patients.

  11. Apneas observed in trisomy 18 neonates should be differentiated from epileptic apneas.

    PubMed

    Fukasawa, Tatsuya; Kubota, Tetsuo; Tanaka, Masaharu; Asada, Hideyuki; Matsusawa, Kaname; Hattori, Tetsuo; Kato, Yuichi; Negoro, Tamiko

    2015-03-01

    Many children with trisomy 18 have apneas from the neonatal period. It has been reported that some children with trisomy 18 have epilepsy, including epileptic apneas. However, no previous report has described epileptic apneas in trisomy 18 neonates. We retrospectively reviewed the clinical records of neonates with trisomy 18 who were born at Anjo Kosei Hospital between July 2004 and October 2013 and investigated whether they had epileptic apneas during the neonatal period and whether antiepileptic drugs (AEDs) were effective for treating them. We identified 16 patients with trisomy 18. Nine patients who died within 3 days of birth were excluded. Five of the remaining seven patients had apneas. All five patients underwent electroencephalograms (EEGs) to assess whether they suffered epileptic apneas. Three of the five patients had EEG-confirmed seizures. In two patients, the apneas corresponded to ictal discharges. In one patient, ictal discharges were recorded when she was under mechanical ventilation, but no ictal discharges that corresponded to apneas were recorded after she was extubated. AEDs were effective for treating the apneas and stabilizing the SpO2 in all three patients. Among neonates with trisomy 18 who lived longer than 3 days, three of seven patients had EEG-confirmed seizures. AEDs were useful for treating their epileptic apneas and stabilizing their SpO2. Physicians should keep epileptic apneas in mind when treating apneas in neonates with trisomy 18.

  12. Altered Intermittent Rhythmic Delta and Theta Activity in the Electroencephalographies of High Functioning Adult Patients with Autism Spectrum Disorder

    PubMed Central

    Endres, Dominique; Maier, Simon; Feige, Bernd; Posielski, Nicole A.; Nickel, Kathrin; Ebert, Dieter; Riedel, Andreas; Philipsen, Alexandra; Perlov, Evgeniy; Tebartz van Elst, Ludger

    2017-01-01

    Background: Autism spectrum disorder (ASD) is often associated with epilepsy. Previous studies have also shown increased rates of electroencephalographic (EEG) alteration in ASD patients without epilepsy. The aim of this study was to compare the rate of intermittent rhythmic delta and theta activity (IRDA/IRTA) events between high-functioning adult patients with ASD and matched healthy controls. Materials and Methods: Routine EEG records of 19 ASD patients and 19 matched controls were screened for IRDA/IRTA using a fully data driven analysis with fixed thresholds. IRDA/IRTA rates before and after hyperventilation (HV) as well as the HV-induced difference in IRDA/IRTA rates (HV difference) were analyzed. For inter-group measures, we used the Wilcoxon rank sum test. Results: Significantly increased HV difference was detected in the ASD group (p = 0.0497). However, the groups showed no difference in IRDA/IRTA rates before HV (p = 0.564) and after HV (p = 0.163). Conclusions: The lack of any group differences regarding IRDA/IRTA before HV might be related to the fact that we only studied non-secondary high-functioning autism in a small sample of epilepsy-free adult patients. A significantly increased HV difference might be regarded as a marker of subtle neuronal network instability possibly causing short-term disturbances via local area network inhibition and long-term effects via epileptic encephalopathy. PMID:28265243

  13. Mozart's music in children with drug-refractory epileptic encephalopathies.

    PubMed

    Coppola, Giangennaro; Toro, Annacarmela; Operto, Francesca Felicia; Ferrarioli, Giuseppe; Pisano, Simone; Viggiano, Andrea; Verrotti, Alberto

    2015-09-01

    Mozart's sonata for two pianos in D major, K448, has been shown to decrease interictal EEG discharges and recurrence of clinical seizures in both adults and young patients. In this prospective, open-label study, we evaluated the effect of listening to a set of Mozart's compositions, according to the Tomatis method, on sleep quality and behavioral disorders, including auto-/hetero-aggression, irritability, and hyperactivity, in a group of children and adolescents with drug-resistant epilepsy. The study group was composed of 11 outpatients (7 males and 4 females), between 1.5years and 21years of age (mean age: 11.9years), all suffering from drug-resistant epileptic encephalopathy (n=11). All of them had a severe/profound intellectual disability associated with cerebral palsy. During the study period, each patient had to listen to a set of Mozart's compositions 2h per day for fifteen days for a total of 30h, which could be distributed over the day depending on the habits and compliance of each patient. The music was filtered by a device preferably delivering higher sound frequencies (>3000Hz) according to the Tomatis principles. The antiepileptic drug therapy remained unchanged throughout the study period. During the 15-day music therapy, 2 out of 11 patients had a reduction of 50-75% in seizure recurrence, and 3 out of 12 patients had a reduction of 75-89%. Overall, 5 (45.4%) out of 11 patients had a ≥50% reduction in the total number of seizures, while the percentage decrease of the total seizure number (11/11) compared with baseline was -51.5% during the 15-day music therapy and -20.7% in the two weeks after the end of treatment. All responders also had an improvement in nighttime sleep and daytime behavior.

  14. Epileptic syndrome in systemic lupus erythematosus and neuronal autoantibody associations.

    PubMed

    Kampylafka, E I; Alexopoulos, H; Fouka, P; Moutsopoulos, H M; Dalakas, M C; Tzioufas, A G

    2016-10-01

    We investigated systemic lupus erythematosus (SLE) patients with epilepsy, a major and organic neurological symptom. Our aim was to test patients for the autoimmune epilepsy-associated antibodies anti-GAD, anti-NMDAR, anti-AMPAR1/2, anti-GABABR and anti-VGKC. We tested sera from ten SLE patients with current or previous episodes of epileptic seizures. In addition, sera were tested for staining on primary hippocampal neurons. The patients' clinical and neuroimaging profile, disease activity and accumulated damage scores and therapeutic regimens administered were recorded, and correlations were evaluated. Patients were negative for all anti-neuronal autoantibodies tested, and showed no staining on primary hippocampal cells, which suggests the absence of autoantibodies against neuronal cell surface antigens. Epileptic seizures were all tonic-clonic, and all patients had high disease activity (mean SLE Damage Acticity Index score 19.3 ± 7.3). Six patients had minor or no brain magnetic resonance imaging findings, and three had major findings. 9/10 patients received immunosuppression for 5 ± 4 months, while anti-convulsive treatment was administered to all patients (4.2 ± 3 years). Our results suggest that the majority of SLE-related epileptic seizures cannot be attributed to the action of a single antibody against neuronal antigens. Studies with larger neuropsychiatric SLE populations and stricter inclusion criteria are necessary to verify these findings.

  15. Selective changes in inhibition as determinants for limited hyperexcitability in the insular cortex of epileptic rats

    PubMed Central

    Bortel, Aleksandra; Longo, Daniela; de Guzman, Philip; Dubeau, François; Biagini, Giuseppe; Avoli, Massimo

    2016-01-01

    The insular cortex (IC) is involved in the generalization of epileptic discharges in temporal lobe epilepsy (TLE), whereas seizures originating in the IC can mimic the epileptic phenotype seen in some patients with TLE. However, few studies have addressed the changes occurring in the IC in TLE animal models. Here, we analyzed the immunohistochemical and electrophysiological properties of IC networks in non-epileptic control and pilocarpine-treated epileptic rats. Neurons identified with a neuron-specific nuclear protein antibody showed similar counts in the two types of tissue but parvalbumin- and neuropeptide Y-positive interneurons were significantly decreased (parvalbumin, approximately −35%; neuropeptide Y, approximately −38%; P < 0.01) in the epileptic IC. Nonadapting neurons were seen more frequently in the epileptic IC during intracellular injection of depolarizing current pulses. In addition, single-shock electrical stimuli elicited network-driven epileptiform responses in 87% of epileptic and 22% of non-epileptic control neurons (P < 0.01) but spontaneous postsynaptic potentials had similar amplitude, duration and intervals of occurrence in the two groups. Finally, pharmacologically isolated, GABAA receptor-mediated inhibitory postsynaptic potentials had more negative reversal potential (P < 0.01) and higher peak conductance (P < 0.05) in epileptic tissue. These data reveal moderate increased network excitability in the IC of pilocarpine-treated epileptic rats. We propose that this limited degree of hyperexcitability originates from the loss of parvalbumin- and neuropeptide Y-positive interneurons that is compensated by an increased drive for GABAA receptor-mediated inhibition. PMID:20497472

  16. Frequency interactions in human epileptic brain.

    PubMed

    Cotic, Marija; Zalay, Osbert; Valiante, Taufik; Carlen, Peter L; Bardakjian, Berj L

    2011-01-01

    We have used two algorithms, wavelet phase coherence (WPC) and modulation index (MI) analysis to study frequency interactions in the human epileptic brain. Quantitative analyses were performed on intracranial electroencephalographic (iEEG) segments from three patients with neocortical epilepsy. Interelectrode coherence was measured using WPC and intraelectrode frequency interactions were analyzed using MI. WPC was performed on electrode pairings and the temporal evolution of phase couplings in the following frequency ranges: 1-4 Hz, 4-8 Hz, 8-13 Hz, 13-30 Hz and 30-100 Hz was studied. WPC was strongest in the 1-4 Hz frequency range during both seizure and non-seizure activities; however, WPC values varied minimally between electrode pairings. The 13-30 Hz band showed the lowest WPC values during seizure activity. MI analysis yielded two prominent patterns of frequency-specific activity, during seizure and non-seizure activities, which were present across all patients.

  17. Epileptic palatal myoclonus

    SciTech Connect

    Tatum, W.O.; Sperling, M.R.; Jacobstein, J.G. )

    1991-08-01

    Palatal myoclonus (PM) is usually caused by lesions of the brainstem. The authors report a case of PM of focal cortical origin in a patient with epilepsia partialis continua. The PM sometimes occurred in isolation, and at other times was accompanied by unilateral face, neck, and arm twitching. This was documented by both EEG and SPECT.

  18. Medical management of epileptic seizures: challenges and solutions

    PubMed Central

    Sarma, Anand K; Khandker, Nabil; Kurczewski, Lisa; Brophy, Gretchen M

    2016-01-01

    Epilepsy is one of the most common neurologic illnesses. This condition afflicts 2.9 million adults and children in the US, leading to an economic impact amounting to $15.5 billion. Despite the significant burden epilepsy places on the population, it is not very well understood. As this understanding continues to evolve, it is important for clinicians to stay up to date with the latest advances to provide the best care for patients. In the last 20 years, the US Food and Drug Administration has approved 15 new antiepileptic drugs (AEDs), with many more currently in development. Other advances have been achieved in terms of diagnostic modalities like electroencephalography technology, treatment devices like vagal nerve and deep-brain stimulators, novel alternate routes of drug administration, and improvement in surgical techniques. Specific patient populations, such as the pregnant, elderly, those with HIV/AIDS, and those with psychiatric illness, present their own unique challenges, with AED side effects, drug interactions, and medical–psychiatric comorbidities adding to the conundrum. The purpose of this article is to review the latest literature guiding the management of acute epileptic seizures, focusing on the current challenges across different practice settings, and it discusses studies in various patient populations, including the pregnant, geriatric, those with HIV/AIDS, comatose, psychiatric, and “pseudoseizure” patients, and offers possible evidence-based solutions or the expert opinion of the authors. Also included is information on newer AEDs, routes of administration, and significant AED-related drug-interaction tables. This review has tried to address only some of these issues that any practitioner who deals with the acute management of seizures may encounter. The document also highlights the numerous avenues for new research that would help practitioners optimize epilepsy management. PMID:26966367

  19. Exploring Adult Care Experiences and Barriers to Transition in Adult Patients with Sickle Cell Disease

    PubMed Central

    Bemrich-Stolz, CJ; Halanych, JH; Howard, TH; Hilliard, LM; Lebensburger, JD

    2015-01-01

    Background Young adults with sickle cell anemia are at high risk for increased hospitalization and death at the time of transition to adult care. This may be related to failure of the transition system to prepare young adults for the adult healthcare system. This qualitative study was designed to identify factors related to transition that may affect the health of adults with sickle cell anemia. Procedure Ten patients currently treated in an adult hematology clinic participated in semi-structured qualitative interviews to describe their experience transitioning from pediatric to adult care and differences in adult and pediatric healthcare systems. Results Participants were generally unprepared for the adult healthcare system. Negative issues experienced by participants included physician mistrust, difficulty with employers, keeping insurance, and stress in personal relationships. Positive issues experienced by participants included improved self efficacy with improved self care and autonomy. Conclusions In the absence of a formalized transition program, adults with sickle cell anemia experience significant barriers to adult care. In addition to medical history review and identification of an adult provider, transition programs should incorporate strategies to navigate the adult medical system, insurance and relationships as well as encouraging self efficacy. PMID:26900602

  20. [Bacterial parotitis in an immunocompromised patient in adult ICU].

    PubMed

    Vassal, O; Bernet, C; Wallet, F; Friggeri, A; Piriou, V

    2013-09-01

    Bacterial parotitis is a common childhood disease with a favorable outcome. Staphylococcus aureus is the most frequently involved pathogen. Clinical presentation in adult patients can be misleading, Onset occurs in patients with multiple comorbidities, making diagnosis difficult--particularly in ICU. Different pathogens are found in adults with worse outcomes observed. We report here the case of a critically ill patient and discuss diagnosis and management of bacterial parotitis.

  1. Mechanisms of physiological and epileptic HFO generation

    PubMed Central

    Jefferys, John G.R.; de la Prida, Liset Menendez; Wendling, Fabrice; Bragin, Anatol; Avoli, Massimo; Timofeev, Igor; Lopes da Silva, Fernando H.

    2016-01-01

    High frequency oscillations (HFO) have a variety of characteristics: band-limited or broad-band, transient burst-like phenomenon or steady-state. HFOs may be encountered under physiological or under pathological conditions (pHFO). Here we review the underlying mechanisms of oscillations, at the level of cells and networks, investigated in a variety of experimental in vitro and in vivo models. Diverse mechanisms are described, from intrinsic membrane oscillations to network processes involving different types of synaptic interactions, gap junctions and ephaptic coupling. HFOs with similar frequency ranges can differ considerably in their physiological mechanisms. The fact that in most cases the combination of intrinsic neuronal membrane oscillations and synaptic circuits are necessary to sustain network oscillations is emphasized. Evidence for pathological HFOs, particularly fast ripples, in experimental models of epilepsy and in human epileptic patients is scrutinized. The underlying mechanisms of fast ripples are examined both in the light of animal observations, in vivo and in vitro, and in epileptic patients, with emphasis on single cell dynamics. Experimental observations and computational modeling have led to hypotheses for these mechanisms, several of which are considered here, namely the role of out-of-phase firing in neuronal clusters, the importance of strong excitatory AMPA-synaptic currents and recurrent inhibitory connectivity in combination with the fast time scales of IPSPs, ephaptic coupling and the contribution of interneuronal coupling through gap junctions. The statistical behaviour of fast ripple events can provide useful information on the underlying mechanism and can help to further improve classification of the diverse forms of HFOs. PMID:22420980

  2. Physical and psychosocial challenges in adult hemophilia patients with inhibitors

    PubMed Central

    duTreil, Sue

    2014-01-01

    Numerous challenges confront adult hemophilia patients with inhibitors, including difficulty in controlling bleeding episodes, deterioration of joints, arthritic pain, physical disability, emotional turmoil, and social issues. High-intensity treatment regimens often used in the treatment of patients with inhibitors also impose significant scheduling, economic, and emotional demands on patients and their families or primary caregivers. A comprehensive multidisciplinary assessment of the physical, emotional, and social status of adult hemophilia patients with inhibitors is essential for the development of treatment strategies that can be individualized to address the complex needs of these patients. PMID:25093002

  3. Approximate Quantification in Young, Healthy Older Adults', and Alzheimer Patients

    ERIC Educational Resources Information Center

    Gandini, Delphine; Lemaire, Patrick; Michel, Bernard Francois

    2009-01-01

    Forty young adults, 40 healthy older adults, and 39 probable AD patients were asked to estimate small (e.g., 25) and large (e.g., 60) collections of dots in a choice condition and in two no-choice conditions. Participants could choose between benchmark and anchoring strategies on each collection of dots in the choice condition and were required to…

  4. EPILEPTIC PSYCHOSIS: A RETROSPECTIVE STUDY

    PubMed Central

    Fernandez, Antony; Khanna, Sumant; Channabasavanna, S.M.

    1988-01-01

    SUMMARY The files of 60 cases who received a diagnosis of epileptic psychosis in the period 1980-1985 were reviewed. Unclassifiable psychosis and paranoid hallucinatory states were the most common presentations. Except for the gap between onset of epilepsy and psychosis, there were no other predictors of type of psychosis. Shorter psychotic episodes tended to be characterised by pressure of speech, inappropriate affect, generalised epilepsy and more past episodes. Memory deficits were more often associated with a longer gap between onset of epilepsy and psychosis, and the presence of hallucinations. PMID:21927290

  5. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Day, C.S.; Lawkins, W.F.

    1999-01-12

    This research discloses methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming. 76 figs.

  6. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1999-01-01

    Methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming.

  7. Metabolic Causes of Epileptic Encephalopathy

    PubMed Central

    Pearl, Phillip L.

    2013-01-01

    Epileptic encephalopathy can be induced by inborn metabolic defects that may be rare individually but in aggregate represent a substantial clinical portion of child neurology. These may present with various epilepsy phenotypes including refractory neonatal seizures, early myoclonic encephalopathy, early infantile epileptic encephalopathy, infantile spasms, and generalized epilepsies which in particular include myoclonic seizures. There are varying degrees of treatability, but the outcome if untreated can often be catastrophic. The importance of early recognition cannot be overemphasized. This paper provides an overview of inborn metabolic errors associated with persistent brain disturbances due to highly active clinical or electrographic ictal activity. Selected diseases are organized by the defective molecule or mechanism and categorized as small molecule disorders (involving amino and organic acids, fatty acids, neurotransmitters, urea cycle, vitamers and cofactors, and mitochondria) and large molecule disorders (including lysosomal storage disorders, peroxisomal disorders, glycosylation disorders, and leukodystrophies). Details including key clinical features, salient electrophysiological and neuroradiological findings, biochemical findings, and treatment options are summarized for prominent disorders in each category. PMID:23762547

  8. Intensive care of the adult patient with congenital heart disease.

    PubMed

    Allan, Catherine K

    2011-01-01

    Prevalence of congenital heart disease in the adult population has increased out of proportion to that of the pediatric population as survival has improved, and adult congenital heart disease patients make up a growing percentage of pediatric and adult cardiac intensive care unit admissions. These patients often develop complex multiorgan system disease as a result of long-standing altered cardiac physiology, and many require reoperation during adulthood. Practitioners who care for these patients in the cardiac intensive care unit must have a strong working knowledge of the pathophysiology of complex congenital heart disease, and a full team of specialists must be available to assist in the care of these patients. This chapter will review some of the common multiorgan system effects of long-standing congenital heart disease (eg, renal and hepatic dysfunction, coagulation abnormalities, arrhythmias) as well as some of the unique cardiopulmonary physiology of this patient population.

  9. [Diagnosis and treatment of non-triggered single epileptic seizures].

    PubMed

    Martinez-Juarez, I E; Moreno, J; Ladino, L D; Castro, N; Hernandez-Vanegas, L; Burneo, J G; Hernandez-Ronquillo, L; Tellez-Zenteno, J F

    2016-08-16

    Epileptic seizures are one of the main reasons for neurological visits in an emergency department. Convulsions represent a traumatic event for the patient and the family, with significant medical and social consequences. Due to their prevalence and impact, the initial management is of vital importance. Although following the first epileptic seizure, early recurrence diminishes after establishing treatment with antiepileptic drugs, the forecast for developing epilepsy and long-term outcomes are not altered by any early intervention. Detailed questioning based on the symptoms of the convulsions, the patient's medical history and a full electroencephalogram and neuroimaging study make it possible to define the risk of recurrence of the seizure and the possible diagnosis of epilepsy. Epileptic abnormalities, the presence of old or new potentially epileptogenic brain lesions, as well as nocturnal seizures, increase the risk of recurrence. Physicians must assess each patient on an individual basis to determine the most suitable treatment, and explain the risk of not being treated versus the risk that exists if treatment with antiepileptic drugs is established.

  10. Transient epileptic amnesia: Update on a slowly emerging epileptic syndrome.

    PubMed

    Felician, O; Tramoni, E; Bartolomei, F

    2015-03-01

    Transient epileptic amnesia (TEA) is a recently individualized, late-onset, pharmaco-sensitive form of mesial temporal lobe epilepsy with recurrent episodes of acute memory loss, but also interictal memory disturbances characterized by autobiographical and topographical memory impairment and a long-term consolidation deficit. In this article, we review the main clinical and electrophysiological characteristics of TEA, discuss its putative neuroanatomical substrate and mechanisms, common features and how it differs from related concepts, with the overall aim to defend the idea that TEA deserves to be recognized as a distinct epilepsy syndrome. While the pathophysiological basis remains largely unknown, emotional and/or dysimmune factors may have a potential influence. Most importantly, the concept of TEA is highly relevant to tertiary epilepsy and memory clinics, but also to routine neurology practice, leading to an adequate diagnosis and management of epilepsy-related, acute and long-standing memory deficits.

  11. Adult-onset amenorrhea: a study of 262 patients.

    PubMed

    Reindollar, R H; Novak, M; Tho, S P; McDonough, P G

    1986-09-01

    A series of 262 patients with amenorrhea of adult onset are reported. Hypothalamic suppression followed by inappropriate positive feedback, and then hyperprolactinemia and ovarian failure are the most frequently encountered etiologies. Other etiologies are diverse and numerically less frequent. Amenorrhea after use of oral contraceptives, or postpill amenorrhea, occurred in 77 (29%) of all patients. The average age of presentation, prior menstrual history, associated morbidity, and subsequent reproductive potential of each diagnostic group are reported. Adult-onset amenorrhea has a less significant impact on future wellbeing than was reported for a similar-sized group of patients whose amenorrhea developed as a result of pubertal aberrancy.

  12. Assortative mixing in functional brain networks during epileptic seizures

    NASA Astrophysics Data System (ADS)

    Bialonski, Stephan; Lehnertz, Klaus

    2013-09-01

    We investigate assortativity of functional brain networks before, during, and after one-hundred epileptic seizures with different anatomical onset locations. We construct binary functional networks from multi-channel electroencephalographic data recorded from 60 epilepsy patients; and from time-resolved estimates of the assortativity coefficient, we conclude that positive degree-degree correlations are inherent to seizure dynamics. While seizures evolve, an increasing assortativity indicates a segregation of the underlying functional network into groups of brain regions that are only sparsely interconnected, if at all. Interestingly, assortativity decreases already prior to seizure end. Together with previous observations of characteristic temporal evolutions of global statistical properties and synchronizability of epileptic brain networks, our findings may help to gain deeper insights into the complicated dynamics underlying generation, propagation, and termination of seizures.

  13. Epileptic encephalopathy with continuous spike-waves during sleep: the need for transition from childhood to adulthood medical care appears to be related to etiology.

    PubMed

    de Saint-Martin, Anne; Rudolf, Gabrielle; Seegmuller, Caroline; Valenti-Hirsch, Maria Paola; Hirsch, Edouard

    2014-08-01

    Epileptic encephalopathy with continuous diffuse spike-waves during slow-wave sleep (ECSWS) presents clinically with infrequent nocturnal focal seizures, atypical absences related to secondary bilateral synchrony, negative myoclonia, and atonic and rare generalized tonic-clonic seizures. The unique electroencephalography (EEG) pattern found in ECSWS consists of continuous, diffuse, bilateral spike-waves during slow-wave sleep. Despite the eventual disappearance of clinical seizures and EEG abnormalities by adolescence, the prognosis is guarded in most cases because of neuropsychological and behavioral deficits. ECSWS has a heterogeneous etiology (genetic, structural, and unknown). Because epilepsy and electroencephalography (EEG) abnormalities in epileptic encephalopathy with continuous diffuse spike-waves during slow-wave sleep (ECSWS) are self-limited and age related, the need for ongoing medical care and transition to adult care might be questioned. For adolescents in whom etiology remains unknown (possibly genetic) and who experience the disappearance of seizures and EEG abnormalities, there is rarely need for long-term neurologic follow-up, because often a relatively normal cognitive and social evolution follows. However, the majority of patients with structural and possibly "genetic syndromic" etiologies will have persistent cognitive deficits and will need suitable socioeducative care. Therefore, the transition process in ECSWS will depend mainly on etiology and its related features (epileptic active phase duration, and cognitive and behavioral evolution) and revolve around neuropsychological and social support rather than medical and pharmacologic follow-up.

  14. Connectivity of epileptic brain regions in wake and sleep.

    PubMed

    Klimes, Petr; Duque, Juliano J; Jurak, Pavel; Halamek, Josef; Worrell, Gregory A

    2015-08-01

    Focal epileptic brain is characterized by a region of pathological tissue seizure onset zone (SOZ) - the pathologic tissue generating seizures. During the interictal period (nonseizure) the SOZ is characterized by epileptiform activity - interictal spikes & high-frequency oscillations (HFO). The SOZ also exhibits hyper-synchrony and functional disconnection from the surrounding areas. Recent studies have described the synchrony inside the SOZ and surrounding tissue for just small sets of patients (2-4) and without any distinction in behavioral states. Wake and sleep cycles can, however, have a significant influence on SOZ activity. Here we show the results of connectivity analysis in three fundamental areas of the epileptic brain - inside SOZ, outside SOZ and bridging areas in 7 patients during wake and sleep. We observed increased synchrony inside SOZ and decreased synchrony on its edges (bridging areas) in specific frequency bands. We also detected significant differences of synchrony levels between wake and sleep periods in HFO frequencies. Our results provide additional insight into the properties of SOZ connectivity. Knowledge of these principles may prove useful for SOZ localization and understanding epileptic brain function in general.

  15. Patterns of human local cerebral glucose metabolism during epileptic seizures

    SciTech Connect

    Engel, J. Jr.; Kuhl, D.E.; Phelps, M.E.

    1982-10-01

    Ictal patterns of local cerebral metabolic rate have been studied in epileptic patients by positron computed tomography with /sup 18/F-labeled 2-fluoro-2-deoxy-D-glucose. Partial seizures were associated with activation of anatomic structures unique to each patient studied. Ictal increases and decreases in local cerebral metabolism were observed. Scans performed during generalized convulsions induced by electroshock demonstrated a diffuse ictal increase and postictal decrease in cerebral metabolism. Petit mal absences were associated with a diffuse increase in cerebral metabolic rate. The ictal fluorodeoxyglucose patterns obtained from patients do not resemble autoradiographic patterns obtained from common experimental animal models of epilepsy.

  16. Acne in the adult female patient: a practical approach.

    PubMed

    Kamangar, Faranak; Shinkai, Kanade

    2012-10-01

    Acne vulgaris is a common reason why adult women present to dermatologists and can be a clinical challenge to treat. It may also be an important sign of an underlying endocrine disease such as Polycystic Ovary Syndrome (PCOS). Although standard acne therapies can be successfully used to treat acne in adult female patients, hormonal treatment is a safe and effective therapeutic option that may provide an opportunity to better target acne in this population, even when other systemic therapies have failed. In this article, a practical approach to the adult female patient with acne will be reviewed to enhance the dermatologist's ability to use hormonal acne therapies and to better identify and evaluate patients with acne in the setting of a possible endocrine disorder.

  17. Focal seizures and epileptic spasms in a child with Down syndrome from a family with a PRRT2 mutation.

    PubMed

    Igarashi, Ayuko; Okumura, Akihisa; Shimojima, Keiko; Abe, Shinpei; Ikeno, Mitsuru; Shimizu, Toshiaki; Yamamoto, Toshiyuki

    2016-06-01

    We describe a girl with Down syndrome who experienced focal seizures and epileptic spasms during infancy. The patient was diagnosed as having trisomy 21 during the neonatal period. She had focal seizures at five months of age, which were controlled with phenobarbital. However, epileptic spasms appeared at seven months of age in association with hypsarrhythmia. Upon treatment with adrenocorticotropic hormone, her epileptic spasms disappeared. Her younger brother also had focal seizures at five months of age. His development and interictal electroencephalogram were normal. The patient's father had had infantile epilepsy and paroxysmal kinesigenic dyskinesia. We performed a mutation analysis of the PRRT2 gene and found a c.841T>C mutation in the present patient, her father, and in her younger brother. We hypothesized that the focal seizures in our patient were caused by the PRRT2 mutation, whereas the epileptic spasms were attributable to trisomy 21.

  18. Lifetime Increased Risk of Adult Onset Atopic Dermatitis in Adolescent and Adult Patients with Food Allergy

    PubMed Central

    Yu, Hsu-Sheng; Tu, Hung-Pin; Hong, Chien-Hui; Lee, Chih-Hung

    2016-01-01

    Food allergy can result in life-threatening anaphylaxis. Atopic dermatitis (AD) causes intense itching and impaired quality of life. Previous studies have shown that patients with classical early-onset AD tend to develop food allergy and that 10% of adults with food allergies have concomitant AD. However, it is not known whether late-onset food allergy leads to adult-onset AD, a recently recognized disease entity. Using an initial cohort of one-million subjects, this study retrospectively followed-up 2851 patients with food allergy (age > 12 years) for 14 years and compared them with 11,404 matched controls. While 2.8% (81) of the 2851 food allergy patients developed AD, only 2.0% (227) of the 11,404 controls developed AD. Multivariate regression analysis showed that food allergy patients were more likely to develop AD (adjusted hazard ratio = 2.49, p < 0.0001). Controls had a 1.99% risk of developing AD, while food allergy patients had a significantly higher risk (7.18% and 3.46% for patients with ≥3 and <3 food allergy claims, respectively) of developing adult-onset AD. This is the first study to describe the chronological and dose-dependent associations between food allergy in adolescence and the development of adult-onset AD. PMID:28035995

  19. Dreaming during anaesthesia in adult patients.

    PubMed

    Leslie, Kate; Skrzypek, Hannah

    2007-09-01

    Dreaming during anaesthesia is defined as any recalled experience (excluding awareness) that occurred between induction of anaesthesia and the first moment of consciousness upon emergence. Dreaming is a commonly-reported side-effect of anaesthesia. The incidence is higher in patients who are interviewed immediately after anaesthesia (approximately 22%) than in those who are interviewed later (approximately 6%). A minority of dreams, which include sensory perceptions obtained during anaesthesia, provide evidence of near-miss awareness. These patients may have risk factors for awareness and this type of dreaming may be prevented by depth of anaesthesia monitoring. Most dreaming however, occurs in younger, fitter patients, who have high home dream recall, who receive propofol-based anaesthesia and who emerge rapidly from anaesthesia. Their dreams are usually short and pleasant, are related to work, family and recreation, are not related to inadequate anaesthesia and probably occur during recovery. Dreaming is a common, fascinating, usually pleasant and harmless phenomenon.

  20. The immunocompromised adult patient and surgery.

    PubMed

    Littlewood, Keith E

    2008-09-01

    The perioperative management of immunosuppressed patients remains relatively unsophisticated. Rational management involves understanding the normal immune response to injury as modified by the preexisting or imposed abnormalities that immunosuppressed patients manifest on the basis of their disease and/or treatment. Patients with cancer, infected with human immunodeficiency virus, and having had an organ transplant are extreme examples of disordered immunity and it is important to understand the effects of their diseases and treatments. In the future, however, more appropriate management will require anticipation and appreciation of frequent preoperative immunotherapy, a more complete understanding of the immunological response to anesthesia and surgery, the ability to assess immune reserve and stratify risk within the context of that profile, and a better knowledge of the immunological effect of anesthetic agents.

  1. [Portable Epileptic Seizure Monitoring Intelligent System Based on Android System].

    PubMed

    Liang, Zhenhu; Wu, Shufeng; Yang, Chunlin; Jiang, Zhenzhou; Yu, Tao; Lu, Chengbiao; Li, Xiaoli

    2016-02-01

    The clinical electroencephalogram (EEG) monitoring systems based on personal computer system can not meet the requirements of portability and home usage. The epilepsy patients have to be monitored in hospital for an extended period of time, which imposes a heavy burden on hospitals. In the present study, we designed a portable 16-lead networked monitoring system based on the Android smart phone. The system uses some technologies including the active electrode, the WiFi wireless transmission, the multi-scale permutation entropy (MPE) algorithm, the back-propagation (BP) neural network algorithm, etc. Moreover, the software of Android mobile application can realize the processing and analysis of EEG data, the display of EEG waveform and the alarm of epileptic seizure. The system has been tested on the mobile phones with Android 2. 3 operating system or higher version and the results showed that this software ran accurately and steadily in the detection of epileptic seizure. In conclusion, this paper provides a portable and reliable solution for epileptic seizure monitoring in clinical and home applications.

  2. Body Composition in Adult Patients with Thalassemia Major.

    PubMed

    Vlychou, Marianna; Alexiou, Evangelos; Thriskos, Paschalis; Fezoulidis, Ioannis; Vassiou, Katerina

    2016-01-01

    Objective. To assess body composition in adult male and female patients with thalassemia major by dual-energy X-ray absorptiometry (DXA) and to compare the findings with a group of healthy age-matched controls. Methods. Our study group included sixty-two patients (27 males, mean age 36 years, and 35 females, mean age 36.4 years) and fifteen age-matched healthy controls. All patients had an established diagnosis of thalassemia major and followed a regular blood transfusion scheme since childhood and chelation treatment. Fat, lean, and bone mineral density (BMD) were assessed with dual-energy X-ray absorptiometry. Ferritin levels and body mass index of all patients and controls were also recorded. Student t-test and Wilcoxon test were performed and statistical significance was set at p < 0.05. Results. BMD and whole body lean mass are lower in both male and female adult patients compared with controls (p < 0.01 in both groups), whereas whole body fat mass was found to have no statistically significant difference compared to controls. Regional trunk fat around the abdomen was found to be lower in male patients compared to controls (p = 0.02). Conclusion. Severe bone loss and diminished lean mass are expected in adult male and female patients with thalassemia major. Fat changes seem to affect mainly male patients.

  3. Body Composition in Adult Patients with Thalassemia Major

    PubMed Central

    Alexiou, Evangelos; Thriskos, Paschalis; Fezoulidis, Ioannis; Vassiou, Katerina

    2016-01-01

    Objective. To assess body composition in adult male and female patients with thalassemia major by dual-energy X-ray absorptiometry (DXA) and to compare the findings with a group of healthy age-matched controls. Methods. Our study group included sixty-two patients (27 males, mean age 36 years, and 35 females, mean age 36.4 years) and fifteen age-matched healthy controls. All patients had an established diagnosis of thalassemia major and followed a regular blood transfusion scheme since childhood and chelation treatment. Fat, lean, and bone mineral density (BMD) were assessed with dual-energy X-ray absorptiometry. Ferritin levels and body mass index of all patients and controls were also recorded. Student t-test and Wilcoxon test were performed and statistical significance was set at p < 0.05. Results. BMD and whole body lean mass are lower in both male and female adult patients compared with controls (p < 0.01 in both groups), whereas whole body fat mass was found to have no statistically significant difference compared to controls. Regional trunk fat around the abdomen was found to be lower in male patients compared to controls (p = 0.02). Conclusion. Severe bone loss and diminished lean mass are expected in adult male and female patients with thalassemia major. Fat changes seem to affect mainly male patients. PMID:27956899

  4. [Diabetes education in adult diabetic patients].

    PubMed

    Weitgasser, Raimund; Clodi, Martin; Cvach, Sarah; Grafinger, Peter; Lechleitner, Monika; Howorka, Kinga; Ludvik, Bernhard

    2016-04-01

    Diabetes education and self management has gained a critical role in diabetes care. Patient empowerment aims to actively influence the course of the disease by self-monitoring and treatment modification, as well as integration of diabetes in patients' daily life to achieve changes in lifestyle accordingly.Diabetes education has to be made accessible for all patients with the disease. To be able to provide a structured and validated education program adequate personal as well as space, organizational and financial background are required. Besides an increase in knowledge about the disease it has been shown that structured diabetes education is able to improve diabetes outcome measured by parameters like blood glucose, HbA1c, blood pressure and body weight in follow-up evaluations. Modern education programs emphasize the ability of patients to integrate diabetes in everyday life and stress physical activity besides healthy eating as a main component of lifestyle therapy and use interactive methods in order to increase the acceptance of personal responsibility.

  5. Intravenous lipids in adult surgical patients.

    PubMed

    Klek, Stanislaw; Waitzberg, Dan L

    2015-01-01

    Parenteral nutrition is considered an essential element of the perioperative management of surgical patients. It is recommended in patients who require nutritional therapy but in whom the enteral route is contraindicated, not recommended or non-feasible. The new generation of lipid emulsions (LEs) based on olive and fish oils are safe and may improve clinical outcome in surgical patients. The increased provision of n-3 polyunsaturated fatty acids in fish oil-containing LEs seems to be associated with fewer infectious complications and shorter ICU and hospital stays following major abdominal surgery. Increased provision of olive oil in the absence of fish oil may also exert beneficial effects, but a clear conclusion on this is limited due to the low number of available studies. Hence, at the moment, the evidence supports the use of n-3-polyunsaturated fatty acid-enriched LEs as a part of the parenteral nutrition regimen for selected groups of patients, such as those with major surgical trauma or those undergoing extended resections or liver transplantation.

  6. Nonlinear times series analysis of epileptic human electroencephalogram (EEG)

    NASA Astrophysics Data System (ADS)

    Li, Dingzhou

    The problem of seizure anticipation in patients with epilepsy has attracted significant attention in the past few years. In this paper we discuss two approaches, using methods of nonlinear time series analysis applied to scalp electrode recordings, which is able to distinguish between epochs temporally distant from and just prior to, the onset of a seizure in patients with temporal lobe epilepsy. First we describe a method involving a comparison of recordings taken from electrodes adjacent to and remote from the site of the seizure focus. In particular, we define a nonlinear quantity which we call marginal predictability. This quantity is computed using data from remote and from adjacent electrodes. We find that the difference between the marginal predictabilities computed for the remote and adjacent electrodes decreases several tens of minutes prior to seizure onset, compared to its value interictally. We also show that these difl'crcnc es of marginal predictability intervals are independent of the behavior state of the patient. Next we examine the please coherence between different electrodes both in the long-range and the short-range. When time is distant from seizure onsets ("interictally"), epileptic patients have lower long-range phase coherence in the delta (1-4Hz) and beta (18-30Hz) frequency band compared to nonepileptic subjects. When seizures approach (''preictally"), we observe an increase in phase coherence in the beta band. However, interictally there is no difference in short-range phase coherence between this cohort of patients and non-epileptic subjects. Preictally short-range phase coherence also increases in the alpha (10-13Hz) and the beta band. Next we apply the quantity marginal predictability on the phase difference time series. Such marginal predictabilities are lower in the patients than in the non-epileptic subjects. However, when seizure approaches, the former moves asymptotically towards the latter.

  7. Clinical profile of patients with adult-onset eosinophilic asthma

    PubMed Central

    Storm, Huib; Amelink, Marijke; de Nijs, Selma B.; Eichhorn, Edwin; Reitsma, Bennie H.; Bel, Elisabeth H.D.; ten Brinke, Anneke

    2016-01-01

    Adult-onset eosinophilic asthma is increasingly recognised as a severe and difficult-to-treat subtype of asthma. In clinical practice, early recognition of patients with this asthma subtype is important because it may have treatment implications. Therefore, physicians need to know the distinct characteristics of this asthma phenotype. The objective of the present study was to determine the characteristic profile of patients with adult-onset eosinophilic asthma. 130 patients with adult-onset (>18 years of age) asthma and high blood eosinophil counts (≥0.3×109 L−1) were compared with 361 adult-onset asthma patients with low (<0.3×109 L−1) blood eosinophils. Measurements included a series of clinical, functional and imaging parameters. Patients with high blood eosinophils were more often male, had less well controlled asthma and higher exacerbation rates, despite the use of higher doses of inhaled corticosteroids. They had higher levels of total IgE without more sensitisation to common inhaled allergens. In addition, these patients had worse lung function, and more often showed fixed airflow limitation, air trapping, nasal polyposis and abnormalities on sinus computed tomography scanning. Chronic rhinosinusitis, air trapping and male sex were three independent factors associated with blood eosinophilia (adjusted OR 3.8 (95% CI 1.7–8.1), 3.0 (95% CI 1.1–8.1) and 2.4 (95% CI 1.3–4.4), respectively). Patients with adult-onset asthma with elevated blood eosinophils exhibit a distinct profile, which can readily be recognised in clinical practice. PMID:27730197

  8. Clinical profile of patients with adult-onset eosinophilic asthma.

    PubMed

    de Groot, Jantina C; Storm, Huib; Amelink, Marijke; de Nijs, Selma B; Eichhorn, Edwin; Reitsma, Bennie H; Bel, Elisabeth H D; Ten Brinke, Anneke

    2016-04-01

    Adult-onset eosinophilic asthma is increasingly recognised as a severe and difficult-to-treat subtype of asthma. In clinical practice, early recognition of patients with this asthma subtype is important because it may have treatment implications. Therefore, physicians need to know the distinct characteristics of this asthma phenotype. The objective of the present study was to determine the characteristic profile of patients with adult-onset eosinophilic asthma. 130 patients with adult-onset (>18 years of age) asthma and high blood eosinophil counts (≥0.3×10(9) L(-1)) were compared with 361 adult-onset asthma patients with low (<0.3×10(9) L(-1)) blood eosinophils. Measurements included a series of clinical, functional and imaging parameters. Patients with high blood eosinophils were more often male, had less well controlled asthma and higher exacerbation rates, despite the use of higher doses of inhaled corticosteroids. They had higher levels of total IgE without more sensitisation to common inhaled allergens. In addition, these patients had worse lung function, and more often showed fixed airflow limitation, air trapping, nasal polyposis and abnormalities on sinus computed tomography scanning. Chronic rhinosinusitis, air trapping and male sex were three independent factors associated with blood eosinophilia (adjusted OR 3.8 (95% CI 1.7-8.1), 3.0 (95% CI 1.1-8.1) and 2.4 (95% CI 1.3-4.4), respectively). Patients with adult-onset asthma with elevated blood eosinophils exhibit a distinct profile, which can readily be recognised in clinical practice.

  9. A case report of stellate ganglion block in the treatment of epileptic pain

    PubMed Central

    Wang, Shengtao; Zhu, Yangzi

    2017-01-01

    Abstract Rationale: Stellate ganglion blocks have been shown to provide effective pain relief in a number of different conditions, but no one had reported stellate ganglion blocks for the treatment of epileptic pain. We describe a case report of the successful use of stellate ganglion block in the treatment of epileptic pain in the patient. Patient concerns: A 8-year-old girl who had experienced severe paroxysmal pain in her right upper limb. Diagnoses: She was diagnosed as drug-resistant partial epilepsy. Interventions: The patient received stellate ganglion blocks with lidocaine for 2 courses with 2 weeks in a course of treatment and oral carbamazepine once a day. Outcomes: Carbamazepine dosage gradually tapered until stop and epileptic pain attacks become less and less, eventually disappear. Lessons: Stellate ganglion block may be an effective treatment of intractable partial epilepsy. However, more research is now needed to verify the validity. PMID:28178147

  10. Movement disorders in adult patients with classical galactosemia.

    PubMed

    Rubio-Agusti, Ignacio; Carecchio, Miryam; Bhatia, Kailash P; Kojovic, Maja; Parees, Isabel; Chandrashekar, Hoskote S; Footitt, Emma J; Burke, Derek; Edwards, Mark J; Lachmann, Robin H L; Murphy, Elaine

    2013-06-01

    Classical galactosemia is an autosomal recessive inborn error of metabolism leading to toxic accumulation of galactose and derived metabolites. It presents with acute systemic complications in the newborn. Galactose restriction resolves these symptoms, but long-term complications, such as premature ovarian failure and neurological problems including motor dysfunction, may occur despite adequate treatment. The objective of the current study was to determine the frequency and phenotype of motor problems in adult patients with classical galactosemia. In this cross-sectional study, adult patients with a biochemically confirmed diagnosis of galactosemia attending our clinic were assessed with an interview and neurological examination and their notes retrospectively reviewed. Patients were classified according to the presence/absence of motor dysfunction on examination. Patients with motor dysfunction were further categorized according to the presence/absence of reported motor symptoms. Forty-seven patients were included. Thirty-one patients showed evidence of motor dysfunction including: tremor (23 patients), dystonia (23 patients), cerebellar signs (6 patients), and pyramidal signs (4 patients). Tremor and dystonia were often combined (16 patients). Thirteen patients reported motor symptoms, with 8 describing progressive worsening. Symptomatic treatment was effective in 4 of 5 patients. Nonmotor neurological features (cognitive, psychiatric, and speech disorders) and premature ovarian failure were more frequent in patients with motor dysfunction. Motor dysfunction is a common complication of classical galactosemia, with tremor and dystonia the most frequent findings. Up to one third of patients report motor symptoms and may benefit from appropriate treatment. Progressive worsening is not uncommon and may suggest ongoing brain damage in a subset of patients.

  11. Nutritional profile of adult patients with celiac disease.

    PubMed

    Abenavoli, L; Delibasic, M; Peta, V; Turkulov, V; De Lorenzo, A; Medić-Stojanoska, M

    2015-11-01

    Celiac disease (CD) is a chronic immune-mediated gluten dependent enteropathy induced by ingestion of gluten, characterized by intestinal malabsorption and subtotals or total atrophy of intestinal villi. The predominant consequence of CD in untreated patients, is malnutrition as a result of malabsorption. Moreover, several and increasing extra-intestinal clinical manifestations have been described in the CD patients. Strict adherence to a gluten-free diet (GFD) improves nutritional status, inducing an increase in fat and bone compartments, but does not completely normalize body composition and nutritional deficiencies. An early and accurate evaluation of nutritional status can be of the pivotal step in the clinical management of the adult CD patients. The aim of this review is to present the most important and recent data on nutritional and metabolic features in the CD adult patients, the related implications and the effects of the GFD on these conditions.

  12. Rhabdomyosarcoma in adolescent and young adult patients: current perspectives

    PubMed Central

    Egas-Bejar, Daniela; Huh, Winston W

    2014-01-01

    Rhabdomyosarcoma (RMS), a malignant tumor of mesenchymal origin, is the third most common extracranial malignant solid tumor in children and adolescents. However, in adults, RMS represents <1% of all solid tumor malignancies. The embryonal and alveolar histologic variants are more commonly seen in pediatric patients, while the pleomorphic variant is rare in children and seen more often in adults. Advances in the research of the embryonal and alveolar variants have improved our understanding of certain genes and biologic pathways that are involved in RMS, but much less is known for the other variants. Multimodality therapy that includes surgery and chemotherapy with or without radiation therapy is the mainstay of treatment for RMS. Improvements in the risk stratification of the pediatric patients based on presurgical (primary tumor site, tumor size, regional lymph node involvement, presence of metastasis) and postsurgical parameters (completeness of resection or presence of residual disease or metastasis) has allowed for the treatment assignment of patients in different studies and therapeutic trials, leading to increases in 5-year survival from 25%–70% over the past 40 years. However, for adult patients, in great part due to rarity of the disease and the lack of consensus on optimal treatment, clinical outcome is still poor. Many factors have been implicated for the differing outcomes between pediatric RMS versus adult RMS, such as the lack of standardized treatment protocols for adult RMS patients and the increased prevalence of advanced presentations. Now that there are increased numbers of survivors, we can appreciate the sequelae from therapy in these patients, such as bone growth abnormalities, endocrinopathies, and infertility. Improvements in risk stratification have led to clinical trials using lower doses of chemotherapy or radiation therapy with the intention of decreasing the incidence of side effects without compromising survival outcome. PMID

  13. A Future for Adult Educators in Patient Education

    ERIC Educational Resources Information Center

    Fleming, Jean E.

    2014-01-01

    Adult education in healthcare comes in several forms: degree and certificate programs aimed at preparing better academic and clinical educators; and community education programs aimed at wellness, rehabilitation, or learning to live with chronic diseases. Patient-centered healthcare, however, is part of something new: coordinated and transitional…

  14. Improvement with Duloxetine in an Adult ADHD Patient

    ERIC Educational Resources Information Center

    Tourjman, Smadar Valerie; Bilodeau, Mathieu

    2009-01-01

    Introduction: Attention-deficit/hyperactivity disorder (ADHD) is a common and disabling disorder among adults and is treated with stimulant and non stimulant medication. Objective: To report the case of a patient with ADHD showing good clinical response to duloxetine, a selective serotonin and norepinephrine reuptake inhibitor (SSNRI). Case…

  15. Patient-specific FDG dosimetry for adult males, adult females, and very low birth weight infants

    NASA Astrophysics Data System (ADS)

    Niven, Erin

    Fluorodeoxyglucose is the most commonly used radiopharmaceutical in Positron Emission Tomography, with applications in neurology, cardiology, and oncology. Despite its routine use worldwide, the radiation absorbed dose estimates from FDG have been based primarily on data obtained from two dogs studied in 1977 and 11 adults (most likely males) studied in 1982. In addition, the dose estimates calculated for FDG have been centered on the adult male, with little or no mention of variations in the dose estimates due to sex, age, height, weight, nationality, diet, or pathological condition. Through an extensive investigation into the Medical Internal Radiation Dose schema for calculating absorbed doses, I have developed a simple patient-specific equation; this equation incorporates the parameters necessary for alterations to the mathematical values of the human model to produce an estimate more representative of the individual under consideration. I have used this method to determine the range of absorbed doses to FDG from the collection of a large quantity of biological data obtained in adult males, adult females, and very low birth weight infants. Therefore, a more accurate quantification of the dose to humans from FDG has been completed. My results show that per unit administered activity, the absorbed dose from FDG is higher for infants compared to adults, and the dose for adult women is higher than for adult men. Given an injected activity of approximately 3.7 MBq kg-1, the doses for adult men, adult women, and full-term newborns would be on the order of 5.5, 7.1, and 2.8 mSv, respectively. These absorbed doses are comparable to the doses received from other nuclear medicine procedures.

  16. Food hypersensitivity among adult patients: epidemiological and clinical aspects.

    PubMed

    Castillo, R; Delgado, J; Quiralte, J; Blanco, C; Carrillo, T

    1996-01-01

    Food hypersensitivity (FH) is lesser frequent among adult patients than in childhood. Foods implicated in hypersensitivity reactions vary with sociocultural and diet habits from a geographic place to other. We studied 142 adult patients sensitized to foods, among 7698 patients visited at our Outpatient Clinic. Hundred and twenty patients referred clinical symptoms after consumption of one or more foods consistently. From the latest, 107 patients (89.2%) were atopics (92 of them sensitizes to dust mites) and 54 (45%) referred atopic familiar background. Most frequent recorded symptoms were: urticaria/angioedema 84 cases (70%), oral syndrome 65 (54%), asthma 48 (37%) and anaphylaxis 33 patients (27.5%). Shellfish sensitization occurred in 50 patients, fresh fruits in 33 and nuts in 29 cases. Shrimp (48 patients), squid (33), kiwi (14), papaya (14), avocado (13) and banana (12 cases) were the most frequent causes of FH. Significant statistical association between foods and inhalants was observed for fresh fruits and latex (p < 0.001), fresh fruits and pollens (p < 0.01), and shellfish and Blatta germanica (p < 0.001). Prevalence of FH among patients at our Area is around 1.6%. Tropical fruits, as other kind of fruits, seem to share common IgE-epitopes to pollens. High prevalence of shellfish and cockroach hypersensitivity could be more easily developed by previous domestic mites sensitization.

  17. [Diagnosis and therapy of adult patients with facial asymmetry].

    PubMed

    Takano-Yamamoto, Teruko; Kuroda, Shingo

    2009-09-01

    The goal of orthodontic treatment is to improve the patient's life by enhancing dental and jaw functions and dentofacial esthetics [Graber TM, et al., Orthodontics current principles and techniques. 4(e) ed. St Louis: Elsevier, 2005.]. Harmonious occlusion is achieved following improvements of malocclusion via orthodontic treatment [Ehmer U and Broll P, Int J Adult Orthod Orthognath Surg 1992;7:153-159. Throckmorton GS, et al., J Prosthet Dent 1984;51:252-261.]. Perfect facial symmetry is extremely rare, and normal faces have a degree of asymmetry. Patients with dentofacial deformity more frequently have asymmetry of the face and jaws. There was a relationship between the type of malocclusion and the prevalence of asymmetry; 28% of the Class III group, but 40% to 42% of the Class I, Class II and long face groups respectively, were asymmetric [Severt TR and Proffit WR, Int J Adult Orthod Orthogn Surg 1997;12:171-176.]; therefore, facial asymmetry is a common complaint among orthodontic patients. Treatment of severe facial asymmetry in adults consists mainly of surgically repositioning the maxilla or the mandible [Bardinet E, et al., Orthod Fr 2002;73:243-315. Guyuron B, Clin Plast Surg 1989;16:795-801. Proffit WR, et al., Contemporary treatment of dentofacial deformity. 2003. St Louis: Mosby, 2003:574-644.], however, new methods, i.e. orthodontic tooth movement with implant anchorage, have recently been introduced [Costa A, et al., Int J Adult Orthod Orthognath Surg 1998;3:201-209. Creekmore TD and Eklund MK, J Clin Orthod 1983;17:266-269. Miyawaki S,et al., Am J Orthod Dentofacial Orthop 2003;124:373-378. Park HS, et al., J Clin Orthod 2001;35:417-422. Roberts WE, et al., Angle Orthod 1989;59:247-256.], and various treatment options can be chosen in patients with facial asymmetry. In this article, we describe the diagnosis and treatment of adult patients with facial asymmetry.

  18. Canine and feline epileptic seizures and the lunar cycle: 2,507 seizures (2000-2008).

    PubMed

    Browand-Stainback, Laura; Levesque, Donald; McBee, Matthew

    2011-01-01

    Epileptic seizures in 211 canine and feline patients diagnosed with idiopathic epilepsy were evaluated for temporal significance in relation to the lunar cycle. Seizure counts were compared among each of the eight individual lunar phases, among each of eight exact lunar phase dates, and by percent of lunar illumination using generalized estimating equations. No statistical significance was found in any of these comparisons excluding a relationship between the onset of epileptic seizures and the phases of the moon. Alteration in anticonvulsant treatment or monitoring of canine and feline patients with idiopathic epilepsy at large was not warranted based on the lunar cycle.

  19. Long-term Effectiveness of Antiepileptic Drug Monotherapy in Partial Epileptic Patients: A 7-year Study in an Epilepsy Center in China

    PubMed Central

    Zhu, Fei; Lang, Sen-Yang; Wang, Xiang-Qing; Shi, Xiao-Bing; Ma, Yun-Feng; Zhang, Xu; Chen, Ya-Nan; Zhang, Jia-Tang

    2015-01-01

    Background: It is important to choose an appropriate antiepileptic drug (AED) to manage partial epilepsy. Traditional AEDs, such as carbamazepine (CBZ) and valproate (VPA), have been proven to have good therapeutic effects. However, in recent years, a variety of new AEDs have increasingly been used as first-line treatments for partial epilepsy. As the studies regarding the effectiveness of new drugs and comparisons between new AEDs and traditional AEDs are few, it is determined that these are areas in need of further research. Accordingly, this study investigated the long-term effectiveness of six AEDs used as monotherapy in patients with partial epilepsy. Methods: This is a retrospective, long-term observational study. Patients with partial epilepsy who received monotherapy with one of six AEDs, namely, CBZ, VPA, topiramate (TPM), oxcarbazepine (OXC), lamotrigine (LTG), or levetiracetam (LEV), were identified and followed up from May 2007 to October 2014, and time to first seizure after treatment, 12-month remission rate, retention rate, reasons for treatment discontinuation, and adverse effects were evaluated. Results: A total of 789 patients were enrolled. The median time of follow-up was 56.95 months. CBZ exhibited the best time to first seizure, with a median time to first seizure of 36.06 months (95% confidential interval: 30.64–44.07). CBZ exhibited the highest 12-month remission rate (85.55%), which was significantly higher than those of TPM (69.38%, P = 0.006), LTG (70.79%, P = 0.001), LEV (72.54%, P = 0.005), and VPA (73.33%, P = 0.002). CBZ, OXC, and LEV had the best retention rate, followed by LTG, TPM, and VPA. Overall, adverse effects occurred in 45.87% of patients, and the most common adverse effects were memory problems (8.09%), rashes (7.76%), abnormal hepatic function (6.24%), and drowsiness (6.24%). Conclusion: This study demonstrated that CBZ, OXC, and LEV are relatively effective in managing focal epilepsy as measured by time to first seizure

  20. Gaussian mixture model for the identification of psychogenic non-epileptic seizures using a wearable accelerometer sensor.

    PubMed

    Kusmakar, Shitanshu; Muthuganapathy, Ramanathan; Yan, Bernard; O'Brien, Terence J; Palaniswami, Marimuthu

    2016-08-01

    Any abnormal hypersynchronus activity of neurons can be characterized as an epileptic seizure (ES). A broad class of non-epileptic seizures is comprised of Psychogenic non-epileptic seizures (PNES). PNES are paroxysmal events, which mimics epileptic seizures and pose a diagnostic challenge with epileptic seizures due to their clinical similarities. The diagnosis of PNES is done using video-electroencephalography (VEM) monitoring. VEM being a resource intensive process calls for alternative methods for detection of PNES. There is now an emerging interest in the use of accelerometer based devices for the detection of seizures. In this work, we present an algorithm based on Gaussian mixture model (GMM's) for the identification of PNES, ES and normal movements using a wrist-worn accelerometer device. Features in time, frequency and wavelet domain are extracted from the norm of accelerometry signal. All events are then classified into three classes i.e normal, PNES and ES using a parametric estimate of the multivariate normal probability density function. An algorithm based on GMM's allows us to accurately model the non-epileptic and epileptic movements, thus enhancing the overall predictive accuracy of the system. The new algorithm was tested on data collected from 16 patients and showed an overall detection accuracy of 91% with 25 false alarms.

  1. Pneumococci Can Persistently Colonize Adult Patients with Chronic Respiratory Disease

    PubMed Central

    Domenech, A.; Balsalobre, L.; Marti, S.; Calatayud, L.; De la Campa, A. G.; Brueggemann, A. B.; Liñares, J.

    2012-01-01

    Streptococcus pneumoniae plays an important role in causing acute exacerbations in patients with chronic respiratory disease. However, few data are available regarding pneumococcal persistence in adult patients with chronic respiratory diseases. Fifty pneumococci recovered from sputum samples (1995 to 2010) from 13 adult patients with ≥3 episodes of acute exacerbation or pneumonia, with the same serotype and pulsed-field gel electrophoresis (PFGE) pattern, were studied. Multilocus sequence typing (MLST) loci, penicillin-binding protein (PBP) genes (pbp2x, pbp1a, pbp2b), and the quinolone-resistant determining regions (QRDRs) of parC, parE, and gyrA were PCR amplified and sequenced. The average time between the first and last episode was 582 days (standard deviation [SD], ±362). All but two patients received multiple courses of β-lactam treatment, and all persistent strains were resistant to penicillin; however, the PBP sequences were stable over time apart from one variable nucleotide in pbp2x, observed among pneumococci isolated from three patients. In contrast, 7/11 patients treated with fluoroquinolones had fluoroquinolone-resistant pneumococci. In three patients, the initially fluoroquinolone-susceptible strain developed resistance after fluoroquinolone therapy, and in the remaining four patients, the persistent strain was fluoroquinolone resistant from the first episode. QRDR changes involved in fluoroquinolone resistance were frequently observed in persistent strains after fluoroquinolone treatment; however, the PBP sequences and MLST genotypes of these strains were stable over time. PMID:23052300

  2. Epileptic activity in Alzheimer's disease: causes and clinical relevance.

    PubMed

    Vossel, Keith A; Tartaglia, Maria C; Nygaard, Haakon B; Zeman, Adam Z; Miller, Bruce L

    2017-04-01

    Epileptic activity is frequently associated with Alzheimer's disease; this association has therapeutic implications, because epileptic activity can occur at early disease stages and might contribute to pathogenesis. In clinical practice, seizures in patients with Alzheimer's disease can easily go unrecognised because they usually present as non-motor seizures, and can overlap with other symptoms of the disease. In patients with Alzheimer's disease, seizures can hasten cognitive decline, highlighting the clinical relevance of early recognition and treatment. Some evidence indicates that subclinical epileptiform activity in patients with Alzheimer's disease, detected by extended neurophysiological monitoring, can also lead to accelerated cognitive decline. Treatment of clinical seizures in patients with Alzheimer's disease with select antiepileptic drugs (AEDs), in low doses, is usually well tolerated and efficacious. Moreover, studies in mouse models of Alzheimer's disease suggest that certain classes of AEDs that reduce network hyperexcitability have disease-modifying properties. These AEDs target mechanisms of epileptogenesis involving amyloid β and tau. Clinical trials targeting network hyperexcitability in patients with Alzheimer's disease will identify whether AEDs or related strategies could improve their cognitive symptoms or slow decline.

  3. The Lombrosian prejudice in medicine. The case of epilepsy. Epileptic psychosis. Epilepsy and aggressiveness.

    PubMed

    Granieri, Enrico; Fazio, Patrik

    2012-02-01

    In the nineteenth century, epilepsy became subject of experimental research. Lombroso established a relationship between epilepsy and criminality believing in the existence of epileptoid traits and atavism. He tried to demonstrate the common origin of epilepsy, criminality, and genius; factors deteriorating the CNS would act upon centers, which control behavior and ethics. This impairment would cause a lack of control on the lower nervous centers, reducing restraints of instincts and criminal behavior. He described developmental frontal cortex lesions in epileptic patients (today Taylor's dysplasia) and these observations supported the erroneous conviction of a relationship between criminality and epilepsy. Neurological, behavioral, and criminological sciences analyzed Lombroso's doctrine, whereas it was controversial that epileptic patients should be prone to violent actions and aggressive behavior. Today, there is an international panel of experts on epilepsy, which suggests five relevant criteria to determine if a crime committed with aggressiveness could result from epileptic seizures.

  4. Amelogenesis imperfecta - lifelong management. Restorative management of the adult patient.

    PubMed

    Patel, M; McDonnell, S T; Iram, S; Chan, M F W-Y

    2013-11-08

    The biggest challenge restorative dentists face in rehabilitating patients with amelogenesis imperfecta (AI) is trying to restore aesthetics, function and occlusal stability while keeping the treatment as conservative as possible. The goals of treatment should be to prolong the life of the patient's own teeth and avoid or delay the need for extractions and subsequent replacement with conventional fixed, removable or implant retained prostheses. In order to achieve these goals a stepwise approach to treatment planning is required starting with the most conservative but aesthetically acceptable treatment. This article discusses the management of AI and presents the various treatment options available for restoring the adult patient who presents to the dentist with AI.

  5. Optimal serum phenylalanine for adult patients with phenylketonuria.

    PubMed

    Okano, Yoshiyuki; Nagasaka, Hironori

    2013-12-01

    High serum phenylalanine in adult patients with phenylketonuria (PKU) causes neuropsychological and psychosocial problems that can be resolved by phenylalanine-restricted diet. Therefore, PKU patients must continue to adhere to phenylalanine-restricted diet for life, although the optimal serum phenylalanine level in later life has yet to be established. The purpose of this review was to establish the optimal serum phenylalanine level in later life of PKU patients. We evaluated oxidative stress status, nitric oxide metabolism, cholesterol-derived oxysterols, vitamin D and bone status, and magnetic resonance imaging (MRI) in adult PKU patients according to serum phenylalanine level. Oxidative stress increased markedly at serum phenylalanine of 700-800 μmol/L. Serum phenylalanine higher than 700-850 μmol/L correlated with the disturbance of nitric oxide regulatory system. Adult PKU patients had poor vitamin D status and exhibited predominance of bone resorption over bone formation. In the brain, the levels of 24S-hydroxycholesterol, a marker of brain cholesterol elimination, were low at serum phenylalanine levels exceeding 650 μmol/L. MRI studies showed high signal intensity in deep white matter on T2-weighted and FLAIR images of PKU patients with serum phenylalanine greater than 500 μmol/L, with decreased apparent diffusion coefficients. Changes in most parameters covering the entire body organs in adult PKU were almost acceptable below 700-800 μmol/L of phenylalanine level. However, the optimal serum phenylalanine level should be 500 μmol/L or less in later life for the brain to be safe.

  6. The Contribution of Raised Intraneuronal Chloride to Epileptic Network Activity

    PubMed Central

    Alfonsa, Hannah; Merricks, Edward M.; Codadu, Neela K.; Cunningham, Mark O.; Deisseroth, Karl; Racca, Claudia

    2015-01-01

    Altered inhibitory function is an important facet of epileptic pathology. A key concept is that GABAergic activity can become excitatory if intraneuronal chloride rises. However, it has proved difficult to separate the role of raised chloride from other contributory factors in complex network phenomena, such as epileptic pathology. Therefore, we asked what patterns of activity are associated with chloride dysregulation by making novel use of Halorhodopsin to load clusters of mouse pyramidal cells artificially with Cl−. Brief (1–10 s) activation of Halorhodopsin caused substantial positive shifts in the GABAergic reversal potential that were proportional to the charge transfer during the illumination and in adult neocortical pyramidal neurons decayed with a time constant of τ = 8.0 ± 2.8s. At the network level, these positive shifts in EGABA produced a transient rise in network excitability, with many distinctive features of epileptic foci, including high-frequency oscillations with evidence of out-of-phase firing (Ibarz et al., 2010). We show how such firing patterns can arise from quite small shifts in the mean intracellular Cl− level, within heterogeneous neuronal populations. Notably, however, chloride loading by itself did not trigger full ictal events, even with additional electrical stimulation to the underlying white matter. In contrast, when performed in combination with low, subepileptic levels of 4-aminopyridine, Halorhodopsin activation rapidly induced full ictal activity. These results suggest that chloride loading has at most an adjunctive role in ictogenesis. Our simulations also show how chloride loading can affect the jitter of action potential timing associated with imminent recruitment to an ictal event (Netoff and Schiff, 2002). PMID:25995461

  7. Coronary Arteriovenous Fistulas in Adult Patients: Surgical Management and Outcomes

    PubMed Central

    Albeyoglu, Sebnem; Aldag, Mustafa; Ciloglu, Ufuk; Sargin, Murat; Oz, Tugba Kemaloglu; Kutlu, Hakan; Dagsali, Sabri

    2017-01-01

    Objective The aim of this study was to describe the demographic, clinical and anatomic characteristics of coronary arteriovenous fistulas in adult patients who underwent open cardiac surgery and to review surgical management and outcomes. Methods Twenty-one adult patients (12 female, 9 male; mean age: 56.1±7.9 years) who underwent surgical treatment for coronary arteriovenous fistulas were retrospectively included in this study. Coronary angiography, chest X-ray, electrocardiography and transthoracic echocardiography were preoperatively performed in all patients. Demographic and clinical data were also collected. Postoperative courses of all patients were monitored and postoperative complications were noted. Results A total of 25 coronary arteriovenous fistulas were detected in 21 patients; the fistulas originated mainly from left anterior descending artery (n=9, 42.8%). Four (19.4%) patients had bilateral fistulas originating from both left anterior descending and right coronary artery. The main drainage site of coronary arteriovenous fistulas was the pulmonary artery (n=18, 85.7%). Twelve (57.1%) patients had isolated coronary arteriovenous fistulas and 4 (19.4%), concomitant coronary artery disease. Twenty (95.3%) of all patients were symptomatic. Seventeen patients were operated on with and 4 without cardiopulmonary bypass. There was no mortality. Three patients had postoperative atrial fibrillation. One patient had pericardial effusion causing cardiac tamponade who underwent reoperation. Conclusion The decision of surgical management should be made on the size and the anatomical location of coronary arteriovenous fistulas and concomitant cardiac comorbidities. Surgical closure with ligation of coronary arteriovenous fistulas can be performed easily with on-pump or off-pump coronary artery bypass grafting, even in asymptomatic patients to prevent fistula related complications with very low risk of mortality and morbidity.

  8. Unique medical issues in adult patients with mucopolysaccharidoses.

    PubMed

    Mitchell, John; Berger, Kenneth I; Borgo, Andrea; Braunlin, Elizabeth A; Burton, Barbara K; Ghotme, Kemel A; Kircher, Susanne G; Molter, David; Orchard, Paul J; Palmer, James; Pastores, Gregory M; Rapoport, David M; Wang, Raymond Y; White, Klane

    2016-10-01

    The mucopolysaccharidoses are a group of inherited metabolic diseases caused by deficiencies in enzymes involved in the sequential degradation of glycosaminoglycans (GAGs) leading to substrate accumulation in various tissues and organs. GAG accumulation can cause growth retardation and progressive damage to respiratory, cardiovascular, musculoskeletal, nervous, gastrointestinal, auditory, and visual systems. In the past, few people with severe phenotypic mucopolysaccharidosis (MPS) reached adulthood. However, better methods for diagnosis, multi-disciplinary care, and new therapies have extended lifespan, leading to an increasing number of patients surviving beyond childhood. The growing number of adult MPS patients poses significant challenges for clinicians who may not be familiar with the clinical manifestations of MPS. In addition, as new interventions have changed the natural history of these disorders, it is difficult to anticipate both the impact on life expectancy and other complications that may occur as these patients age. Because the MPS disorders are multi-organ diseases, their management requires a coordinated multi-disciplinary approach. Here we discuss the unique pattern of medical issues and multi-organ involvement in adult patients with MPS and identify the challenges that are associated with management of MPS. This review is based on information from an expert investigator meeting with MPS specialists held October 2-4, 2014 in Dublin, Ireland, as well as on current literature searches focusing on MPS and adults.

  9. Mitochondrial dysfunction in neurological disorders with epileptic phenotypes.

    PubMed

    Zsurka, Gábor; Kunz, Wolfram S

    2010-12-01

    A broad variety of mutations of the mitochondrial DNA or nuclear genes that lead to the impairment of mitochondrial respiratory chain or mitochondrial ATP synthesis have been associated with epileptic phenotypes. Additionally, evidence for an impaired mitochondrial function in seizure focus of patients with temporal lobe epilepsy and Ammon's horn sclerosis, as well as, animal models of temporal lobe epilepsy has been accumulated. This implies a direct pathogenic role of mitochondrial dysfunction in the process of epileptogenesis and seizure generation in certain forms of epilepsy.

  10. Neuropsychological Assessment of Adult Patients with Shunted Hydrocephalus

    PubMed Central

    Bakar, Emel Erdogan

    2010-01-01

    Objective This study is planned to determine the neurocognitive difficulties of hydrocephalic adults. Methods The research group contained healthy adults (control group, n : 15), and hydrocephalic adults (n : 15). Hydrocephalic group consisted of patients with idiopathic aquaduct stenosis and post-meningitis hydrocephalus. All patients were followed with shunted hydrocephalus and not gone to shunt revision during last two years. They were chosen from either asymptomatic or had only minor symptoms without motor and sensorineural deficit. A neuropsychological test battery (Raven Standart Progressive Matrices, Bender-Gestalt Test, Cancellation Test, Clock Drawing Test, Facial Recognition Test, Line Orientation Test, Serial Digit Learning Test, Stroop Color Word Interference Test-TBAG Form, Verbal Fluency Test, Verbal Fluency Test, Visual-Aural Digit Span Test-B) was applied to all groups. Results Neuropsychological assessment of hydrocephalic patients demonstrated that they had poor performance on visual, semantic and working memory, visuoconstructive and frontal functions, reading, attention, motor coordination and executive function of parietal lobe which related with complex and perseverative behaviour. Eventually, these patients had significant impairment on the neurocognitive functions of their frontal, parietal and temporal lobes. On the other hand, the statistical analyses performed on demographic data showed that the aetiology of the hydrocephalus, age, sex and localization of the shunt (frontal or posterior parietal) did not affect the test results. Conclusion This prospective study showed that adult patients with hydrocephalus have serious neuropsychological problems which might be directly caused by the hydrocephalus; and these problems may cause serious adaptive difficulties in their social, cultural, behavioral and academic life. PMID:20379471

  11. Concepts of Connectivity and Human Epileptic Activity

    PubMed Central

    Lemieux, Louis; Daunizeau, Jean; Walker, Matthew C.

    2011-01-01

    This review attempts to place the concept of connectivity from increasingly sophisticated neuroimaging data analysis methodologies within the field of epilepsy research. We introduce the more principled connectivity terminology developed recently in neuroimaging and review some of the key concepts related to the characterization of propagation of epileptic activity using what may be called traditional correlation-based studies based on EEG. We then show how essentially similar methodologies, and more recently models addressing causality, have been used to characterize whole-brain and regional networks using functional MRI data. Following a discussion of our current understanding of the neuronal system aspects of the onset and propagation of epileptic discharges and seizures, we discuss the most advanced and ambitious framework to attempt to fully characterize epileptic networks based on neuroimaging data. PMID:21472027

  12. Ebstein's anomaly in adult patients over 50 years of age.

    PubMed

    Aoyagi, Shigeaki; Yoshitake, Kiyonobu; Matsuo, Atsutoshi; Tayama, Kei-Ichiro; Hida, Satoru; Mito, Takahiro

    2014-01-01

    Ebstein's anomaly (EA) is a rare congenital heart disease of the tricuspid valve, and less than 5% of patients with EA survive beyond the age of 50. We report two unoperated cases of EA in adult patients aged over 50 years. Two patients, a 70-year-old Japanese woman and a 59-year-old Chinese woman, were referred to us for tachyarrhythmias. Transthoracic echocardiography demonstrated apical displacement (>8 mm/m(2) body surface area) of the septal leaflet of the tricuspid valve from the atrioventricular ring with tricuspid regurgitation in both patients. The former suddenly expired 20 months later after suffering from repetitive supraventricular tachyarrhythmias and/or heart failure, and the latter is alive with minimal signs of heart failure 12 months after the diagnosis of EA. Although the natural history of EA is extremely variable, these two patients are exceptional in that they tolerated EA well for over 50 years without any surgical intervention.

  13. Aspartic acid aminotransferase activity is increased in actively spiking compared with non-spiking human epileptic cortex.

    PubMed Central

    Kish, S J; Dixon, L M; Sherwin, A L

    1988-01-01

    Increased concentration of the excitatory neurotransmitter aspartic acid in actively spiking human epileptic cerebral cortex was recently described. In order to further characterise changes in the aspartergic system in epileptic brain, the behaviour of aspartic acid aminotransferase (AAT), a key enzyme involved in aspartic acid metabolism has now been examined. Electrocorticography performed during surgery was employed to identify cortical epileptic spike foci in 16 patients undergoing temporal lobectomy for intractable seizures. Patients with spontaneously spiking lateral temporal cortex (n = 8) were compared with a non-spiking control group (n = 8) of patients in whom the epileptic lesions were confined to the hippocampus sparing the temporal convexity. Mean activity of AAT in spiking cortex was significantly elevated by 16-18%, with aspartic acid concentration increased by 28%. Possible explanations for the enhanced AAT activity include increased proliferation of cortical AAT-containing astrocytes at the spiking focus and/or a generalised increase in neuronal or extraneuronal metabolism consequent to the ongoing epileptic discharge. It is suggested that the data provide additional support for a disturbance of central excitatory aspartic acid mechanisms in human epileptic brain. PMID:2898010

  14. Infective Dermatitis in an Adult Patient With HTLV-1

    PubMed Central

    Riveros, Rosalba; Medina, Raquel; Morel, Maida

    2015-01-01

    Abstract: Infective dermatitis is a chronic exudative eczematous eruption presenting in human T-lymphotropic virus type 1 (HTLV-1)–infected people. It presents with relapsing erythematous, scaly, and crusted lesions affecting simultaneously the scalp, external ear, retroauricular area, eyelid, paranasal skin, neck axilla, and groin. Superimposed Staphylococcus and Streptococcus infection are common. It mainly affects children and exceptionally adults, and there are only a few published cases. The authors present the first reported case in Paraguay of an adult patient who had symptoms of human T-lymphotropic virus type 1–associated progressive tropical spastic paraparesis, and 6 years after the onset of the neurological symptoms, the patient developed infective dermatitis lesions on the skin, with frequent exacerbations since then. PMID:26588341

  15. [Pulmonary arterial hypertension in adult patients with congenital heart disease].

    PubMed

    Serino, G; Giacomazzi, F

    2010-01-01

    Pulmonary Hypertension (PH) is definited by a mean pulmonary artery pressure (PAPm) >25 mmHg at rest. The Dana Point 2008 Revised Classification System represents the most recent classification system update with respect of various etiologies of PH. About 10 % of adolescents or adults with uncorrected congenital heart disease (CHD) with left-to-right shunt and high pulmonary blood flow develop Pulmonary Arterial Hypertension (PAH) . Progressive vascular remodeling and increase in pulmonary vascular resistance (PVR) may ultimately lead to reversal of the shunt (pulmonary to systemic) causing cyanosis and determining the so-called Eisenmenger Syndrome (ES). Recent advances in the early diagnosis and medical targeted treatment of adult patients with CHD-PAH and ES can improve PAP, PVR and exercise tolerance, together with NYHA Class and survival, and may potentially reverse the vascular remodeling process in selected patients.

  16. Preictal Dynamics of EEG Complexity in Intracranially Recorded Epileptic Seizure

    PubMed Central

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-01-01

    Abstract Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208–217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis. The results show that in comparison to interictal period (at about 8–6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures. PMID:25415671

  17. Modified Fontan Conversion: An Alternative Technique for Adult Patients.

    PubMed

    González-López, María-Teresa; Pita-Fernández, Ana-María; Gil-Jaurena, Juan-Miguel; Pérez-Caballero-Martínez, Ramón; Sánchez-Valenzuela, Diego; Las, Cynthia-Jahavee

    2015-07-01

    A need persists for Fontan conversion that provides alternative approaches for the individual anatomical challenges occurring in these unusual and complex adult patients. The pulmonary arteries present unique variations and the surgical technique needs to be intraoperatively addressed. We describe a technique for Fontan conversion for performing the distal anastomosis of the extracardiac conduit, allowing adequate matching to the pulmonary arteries and preserving an optimal flow into the Fontan circuit.

  18. Hypohidrosis induced by topiramate in an adult patient.

    PubMed

    Karachristianou, Styliani; Papamichalis, Evangelos; Sarantopoulos, Alexandros; Boura, Panagiota; Georgiadis, George

    2013-06-01

    Hypohidrosis is an uncommon and reversible side effect of topiramate treatment, reported mainly in children. This report presents an adult patient with complex partial seizures who was treated with topiramate and developed hypohidrosis coupled with hyperthermia, related to high environmental temperature and physical exercise. Reduced sweat response was confirmed using the Neuropad test. Signs and symptoms ceased after drug discontinuation. During topiramate treatment, it is important to recognise this side effect, although the exact causal mechanism has not yet been clarified.

  19. Relationship of Hemoglobin Concentration in Adult Asthmatic Patients.

    PubMed

    Nasreen, S; Nessa, A; Islam, M F; Husain, M F; Khatun, N; Wahed, F; Zannat, M R; Tajkia, T

    2016-10-01

    Asthma is a chronic inflammatory disorder of the airways, in which many cells and cellular elements play a role. Asthma is one of the most common diseases globally and currently affects 300 million people. The epidemic rise in anemia, asthma, and related allergic disease is a common major public health problem worldwide. Asthma and anemia associated with acute infections occur both in children and adults. This descriptive type of cross sectional study was done to find out the levels of hemoglobin concentration in adult asthmatic patients and carried out in the Department of Physiology, Mymensingh Medical College, Mymensingh, Bangladesh from July 2014 to January 2016. Fifty (50) male and 50 (fifty) female adult asthmatic patients aged 18-60 years were included in the study group. They are enrolled from the Department of Medicine, Mymensingh Medical College, Mymensingh, Bangladesh and also from locality. For comparison age matched 50 male and 50 female apparently healthy persons were also studied as control. Hemoglobin concentration was estimated by Cyanmethemoglobin method. For statistical analysis unpaired student's 't' test was used. Mean hemoglobin concentration was significantly decreased in study group in comparison to control group and the result was statistically significant (p<0.001). The study findings showed a high prevalence of anemia among asthmatic patients than non asthmatic healthy persons.

  20. Stimulus-induced reflex epileptic spasms in 5p- syndrome.

    PubMed

    Shirai, Kentaro; Saito, Yoshiaki; Yokoyama, Atushi; Nishimura, Yoko; Tamasaki, Akiko; Maegaki, Yoshihiro

    2016-02-01

    Here we describe two patients with 5p- syndrome who suffered from epilepsy characterised by stimulus-induced epileptic spasms manifesting as head nodding. In patient 1, a series of spasms were exclusively triggered by eating, and were associated with diffuse high-voltage slow waves on ictal EEG, particularly presenting as a positive slow potential at the left mid-temporal area. Clusters of sharp waves with negative polarity emerged in the same area during the inter-spasm periods during eating. In patient 2, spasms were provoked by either eating or micturition. Ictal EEG of clustered spasms after micturition showed positive slow or triphasic waves, which correlated with each spasm, over the bifrontal and vertex areas. These findings suggest that the focal cortical areas act as trigger regions in reflex epilepsies, and that a spasm-generator responsible for the execution of reflex spasms exists either in other cortical areas or in the subcortical structures. Although epilepsy is an unusual complication of 5p- syndrome, this syndrome may have a propensity to develop reflex epilepsy, particularly epileptic spasms. However, identification of responsible genes and their roles in this phenotype requires further investigations.

  1. Coexistence of Epileptic Nocturnal Wanderings and an Arachnoid Cyst

    PubMed Central

    Jiménez-Genchi, Alejandro; Díaz-Galviz, John L.; García-Reyna, Juan Carlos; Ávila-Ordoñez, Mario U.

    2007-01-01

    Episodic nocturnal wanderings (ENWs) have rarely been associated with gross abnormalities of brain structures. We describe the case of a patient with ENWs in coexistence with an arachnoid cyst (AC). The patient was a 15-year-old boy who presented with nocturnal attacks characterized by complex motor behaviors. An MRI revealed a left temporal cyst and a SPECT Tc99 scan showed left temporal hypoperfusion and bilateral frontal hyperperfusion, more evident on the right side. During an all-night polysomnographic recording with audiovisual monitoring, dystonic posture followed by sleepwalking-like behavior was documented. The sleepwalking-like behavior was preceded by a spike discharge over the left frontocentral region with contralateral projection and secondary generalization during stage 2 sleep. Treatment with levetiracetam produced a striking remission of seizures. This supports a conservative management of an AC, considering that it may be an incidental finding. In epileptic patients, an AC may not necessarily be related to the location of the seizure focus. Citation: Jiménez-Genchi A; Díaz-Galviz JL; García-Reyna JC et al. Coexistence of epileptic nocturnal wanderings and an arachnoid cyst. J Clin Sleep Med 2007;3(4):399-401. PMID:17694730

  2. Organ doses to adult patients for chest CT

    SciTech Connect

    Huda, Walter; Sterzik, Alexander; Tipnis, Sameer; Schoepf, U. Joseph

    2010-02-15

    Purpose: The goal of this study was to estimate organ doses for chest CT examinations using volume computed tomography dose index (CTDI{sub vol}) data as well as accounting for patient weight. Methods: A CT dosimetry spreadsheet (ImPACT CT patient dosimetry calculator) was used to compute organ doses for a 70 kg patient undergoing chest CT examinations, as well as volume computed tomography dose index (CTDI{sub vol}) in a body CT dosimetry phantom at the same CT technique factors. Ratios of organ dose to CTDI{sub vol} (f{sub organ}) were generated as a function of anatomical location in the chest for the breasts, lungs, stomach, red bone marrow, liver, thyroid, liver, and thymus. Values of f{sub organ} were obtained for x-ray tube voltages ranging from 80 to 140 kV for 1, 4, 16, and 64 slice CT scanners from two vendors. For constant CT techniques, we computed ratios of dose in water phantoms of differing diameter. By modeling patients of different weights as equivalent water cylinders of different diameters, we generated factors that permit the estimation of the organ doses in patients weighing between 50 and 100 kg who undergo chest CT examinations relative to the corresponding organ doses received by a 70 kg adult. Results: For a 32 cm long CT scan encompassing the complete lungs, values of f{sub organ} ranged from 1.7 (thymus) to 0.3 (stomach). Organs that are directly in the x-ray beam, and are completely irradiated, generally had f{sub organ} values well above 1 (i.e., breast, lung, heart, and thymus). Organs that are not completely irradiated in a total chest CT scan generally had f{sub organ} values that are less than 1 (e.g., red bone marrow, liver, and stomach). Increasing the x-ray tube voltage from 80 to 140 kV resulted in modest increases in f{sub organ} for the heart (9%) and thymus (8%), but resulted in larger increases for the breast (19%) and red bone marrow (21%). Adult patient chests have been modeled by water cylinders with diameters between

  3. Vaccination of Adult Patients with Systemic Lupus Erythematosus in Portugal

    PubMed Central

    Moraes-Fontes, Maria Francisca; Antunes, Ana Margarida; Gruner, Heidi; Riso, Nuno

    2016-01-01

    In the wake of the Portuguese vaccination program 50th anniversary it seems appropriate to review vaccination in patients with systemic lupus erythematosus. Controversial issues as regards the association between autoimmune diseases, infections, and vaccines are discussed as well as vaccine safety and efficacy issues as regards chronic immunosuppressant (IS) drug therapy. After a brief overview of national policies, specific recommendations are made as regards vaccination for adult patients with SLE with a particular focus on current IS therapy and unmet needs. PMID:27069477

  4. Stepping to stability and fall prevention in adult psychiatric patients.

    PubMed

    Emory, Sara L; Silva, Susan G; Christopher, Eric J; Edwards, Pamela B; Wahl, Leanne E

    2011-12-01

    Fall prevention is a major area of concern in inpatient settings. This article reports on the feasibility of implementing a daily exercise program that features line dancing to promote stability, balance, and flexibility in adult psychiatric patients and describes the impact of that program. Six hundred sixty-five patient charts drawn from before and after the practice change were reviewed. The fall rate after the introduction of line dancing was 2.8% compared with 3.2% before implementation. In a setting that treats both men and women of many ages and with varying levels of mobility, line dancing offers a viable approach to exercise in a secure setting.

  5. Long-term variability of global statistical properties of epileptic brain networks

    NASA Astrophysics Data System (ADS)

    Kuhnert, Marie-Therese; Elger, Christian E.; Lehnertz, Klaus

    2010-12-01

    We investigate the influence of various pathophysiologic and physiologic processes on global statistical properties of epileptic brain networks. We construct binary functional networks from long-term, multichannel electroencephalographic data recorded from 13 epilepsy patients, and the average shortest path length and the clustering coefficient serve as global statistical network characteristics. For time-resolved estimates of these characteristics we observe large fluctuations over time, however, with some periodic temporal structure. These fluctuations can—to a large extent—be attributed to daily rhythms while relevant aspects of the epileptic process contribute only marginally. Particularly, we could not observe clear cut changes in network states that can be regarded as predictive of an impending seizure. Our findings are of particular relevance for studies aiming at an improved understanding of the epileptic process with graph-theoretical approaches.

  6. Complex phase synchronization in epileptic seizures: Evidence for a devil's staircase

    NASA Astrophysics Data System (ADS)

    Perez Velazquez, J. L.; Garcia Dominguez, L.; Wennberg, R.

    2007-01-01

    We describe multifrequency phase synchronization in epileptic seizures. Using magnetoencephalographic recordings from three patients suffering generalized seizures, the evidence is presented that, in addition to the commonly studied 1:1 frequency locking, there exists complex multifrequency coordination that, in some cases, follows a classical “devil’s staircase.” Within the limitations of observing this phenomenon in a clinical experimental setting, these observations reveal that in pathological brain activity, complex frequency locking can be found similar to that identified in certain pathological cardiac re-entrant arrhythmias. This may suggest the existence of similar re-entrant mechanisms active in cerebral neocortex during epileptic seizures.

  7. Epileptic seizure classifications of single-channel scalp EEG data using wavelet-based features and SVM.

    PubMed

    Janjarasjitt, Suparerk

    2017-02-13

    In this study, wavelet-based features of single-channel scalp EEGs recorded from subjects with intractable seizure are examined for epileptic seizure classification. The wavelet-based features extracted from scalp EEGs are simply based on detail and approximation coefficients obtained from the discrete wavelet transform. Support vector machine (SVM), one of the most commonly used classifiers, is applied to classify vectors of wavelet-based features of scalp EEGs into either seizure or non-seizure class. In patient-based epileptic seizure classification, a training data set used to train SVM classifiers is composed of wavelet-based features of scalp EEGs corresponding to the first epileptic seizure event. Overall, the excellent performance on patient-dependent epileptic seizure classification is obtained with the average accuracy, sensitivity, and specificity of, respectively, 0.9687, 0.7299, and 0.9813. The vector composed of two wavelet-based features of scalp EEGs provide the best performance on patient-dependent epileptic seizure classification in most cases, i.e., 19 cases out of 24. The wavelet-based features corresponding to the 32-64, 8-16, and 4-8 Hz subbands of scalp EEGs are the mostly used features providing the best performance on patient-dependent classification. Furthermore, the performance on both patient-dependent and patient-independent epileptic seizure classifications are also validated using tenfold cross-validation. From the patient-independent epileptic seizure classification validated using tenfold cross-validation, it is shown that the best classification performance is achieved using the wavelet-based features corresponding to the 64-128 and 4-8 Hz subbands of scalp EEGs.

  8. [The definition of the medical clown's role with adult patients].

    PubMed

    Scheyer, Rachel; Nuttman-Shwartz, Orit; Ziyoni, Herzel

    2008-01-01

    In recent years, the healthcare system has grown increasingly aware of the need to develop and adopt new models and intervention methods aimed at improving patients' quality of life. As part of this perception, medical clowns have been integrated into hospitals, primarily in work with children. Recently, there have been attempts to integrate clowns into work with adult patients in emergency rooms, but this intervention method has not yet been systematically implemented and studied. This article describes and examines the definition of the medical clown's role as an intervention strategy with adult outpatients suffering from chronic and life-threatening illnesses. The study is qualitative and based on a content analysis of the documentation of the work of two medical clowns over two years. The dominant theme arising from this analysis involves the definition of the clown's role within the medical space of the hospital and includes perspectives on his integration into the hospital's multidisciplinary medical staff and his impact on the staff and on patients and their families. The findings indicate that, from the clowns' point of view, integrated medical clowns as part of the medical team, would contribute to the functioning of both patients and staff. This is in accord with additional studies conducted recently in medical centers around the world. Since this is a pioneering study, there is room to further probe and research the medical clown's contribution to assisting and improving patients' and staff's quality of life and to develop ways of increasing his integration and professionalism.

  9. Study of inhaler technique in asthma patients: differences between pediatric and adult patients

    PubMed Central

    Manríquez, Pablo; Acuña, Ana María; Muñoz, Luis; Reyes, Alvaro

    2015-01-01

    Objective: Inhaler technique comprises a set of procedures for drug delivery to the respiratory system. The oral inhalation of medications is the first-line treatment for lung diseases. Using the proper inhaler technique ensures sufficient drug deposition in the distal airways, optimizing therapeutic effects and reducing side effects. The purposes of this study were to assess inhaler technique in pediatric and adult patients with asthma; to determine the most common errors in each group of patients; and to compare the results between the two groups. Methods: This was a descriptive cross-sectional study. Using a ten-step protocol, we assessed inhaler technique in 135 pediatric asthma patients and 128 adult asthma patients. Results: The most common error among the pediatric patients was failing to execute a 10-s breath-hold after inhalation, whereas the most common error among the adult patients was failing to exhale fully before using the inhaler. Conclusions: Pediatric asthma patients appear to perform most of the inhaler technique steps correctly. However, the same does not seem to be true for adult patients. PMID:26578130

  10. Clofarabine in Adult Patients With Advanced Solid Tumors

    ClinicalTrials.gov

    2014-02-04

    Solid Tumors; Leukemia, Lymphocytic, Acute, Pediatric; Leukemia, Lymphocytic, Acute, Adult; Leukemia, Myelocytic, Acute, Pediatric; Leukemia, Myelocytic, Acute, Adult; Myelodysplastic Syndromes, Adult

  11. Neurophysiological activity underlying altered brain metabolism in epileptic encephalopathies with CSWS.

    PubMed

    De Tiège, Xavier; Trotta, Nicola; Op de Beeck, Marc; Bourguignon, Mathieu; Marty, Brice; Wens, Vincent; Nonclercq, Antoine; Goldman, Serge; Van Bogaert, Patrick

    2013-08-01

    We investigated the neurophysiological correlate of altered regional cerebral glucose metabolism observed in children with epileptic encephalopathy with continuous spike-waves during sleep (CSWS) by using a multimodal approach combining time-sensitive magnetic source imaging (MSI) and positron emission tomography with [(18)F]-fluorodeoxyglucose (FDG-PET). Six patients (4 boys and 2 girls, age range: 4-8 years, 3 patients with Landau-Kleffner syndrome (LKS), 3 patients with atypical rolandic epilepsy (ARE)) were investigated by FDG-PET and MSI at the acute phase of CSWS. In all patients, the onset(s) of spike-waves discharges were associated with significant focal hypermetabolism. The propagation of epileptic discharges to other brain areas was associated with focal hypermetabolism (five patients), hypometabolism (one patient) or the absence of any significant metabolic change (one patient). Interestingly, most of the hypometabolic areas were not involved in the epileptic network per se. This study shows that focal hypermetabolism observed at the acute phase of CSWS are related to the onset or propagation sites of spike-wave discharges. Spike-wave discharges propagation can be associated to other types of metabolic changes, suggesting the occurrence of various neurophysiological mechanisms at the cellular level. Most of the hypometabolic areas are not involved in the epileptic network as such and are probably related to a mechanism of remote inhibition. These findings highlight the critical value of combining FDG-PET with time-sensitive functional neuroimaging approaches such as MSI to assess CSWS epileptic network when surgery is considered as a therapeutic approach.

  12. [Preditive clinical factors for epileptic seizures after ischemic stroke].

    PubMed

    Fukujima, M M; Cardeal, J O; Lima, J G

    1996-06-01

    Preditive clinical factors for epileptic seizures after ischemic stroke. Clinical features of 35 patients with ischemic stroke who developed epilepsy (Group 1) were compared with those of 35 patients with ischemic stroke without epilepsy (Group 2). The age of the patients did not differ between the groups. There were more men than women and more white than other races in both groups. Diabetes melitus, hypertension, transient ischemic attack, previous stroke, migraine, Chagas disease, cerebral embolism of cardiac origin and use of oral contraceptive did not differ between the groups. Smokers and alcohol users were more frequent in Group 1 (p < 0.05). Most patients of Group 1 presented with hemiparesis; none presented cerebellar or brainstem involvement. Perhaps strokes in smokers have some different aspects, that let them more epileptogenic than in non smokers.

  13. [Research advances in circadian rhythm of epileptic seizures].

    PubMed

    Yang, Wen-Qi; Li, Hong

    2017-01-01

    The time phase of epileptic seizures has attracted more and more attention. Epileptic seizures have their own circadian rhythm. The same type of epilepsy has different seizure frequencies in different time periods and states (such as sleeping/awakening state and natural day/night cycle). The circadian rhythm of epileptic seizures has complex molecular and endocrine mechanisms, and currently there are several hypotheses. Clarification of the circadian rhythm of epileptic seizures and prevention and administration according to such circadian rhythm can effectively control seizures and reduce the adverse effects of drugs. The research on the circadian rhythm of epileptic seizures provides a new idea for the treatment of epilepsy.

  14. The epidemiology of adult Rapid Response Team patients in Australia.

    PubMed

    Jones, D

    2014-03-01

    Rapid Response Teams (RRT) are specialised teams that review deteriorating ward patients in an attempt to prevent morbidity and mortality. Most studies have assessed the effect of implementing an RRT into a hospital. There is much less literature on the characteristics and outcomes of RRT patients themselves. This article reviews the epidemiology of adult RRT patients in Australia and proposes three models of RRT syndromes. The number of RRT calls varies considerably in Australian hospitals from 1.35 to 71.3/1000 hospital admissions. Common causes of RRT calls include sepsis, atrial fibrillation, seizures and pulmonary oedema. Approximately 20% of patients to whom an RRT has responded have more than one RRT call, and up to one-third have issues around end-of-life care. Calls are least common overnight. Between 10 to 25% of patients are admitted to a critical care area after the call. The in-hospital mortality for RRT patients is approximately 25% overall but only 15% in patients without a limitation of medical therapy. RRT syndromes can be conceptually described by the trigger for the call (e.g. hypotension) or the clinical condition causing the call (e.g. sepsis). Alternatively, the RRT call can be described by the major theme of the call: "end-of-life care", "requiring critical care" and "stable enough to initially remain on the ward". Based on these themes, education strategies and quality improvement initiatives may be developed to reduce the incidence of RRT calls, further improving patient outcome.

  15. Experimental identification of potential falls in older adult hospital patients.

    PubMed

    Cloutier, Aimee; Yang, James; Pati, Debajyoti; Valipoor, Shabboo

    2016-05-03

    Patient falls within hospitals have been identified as serious but largely preventable incidents, particularly among older adult patients. Previous literature has explored intrinsic factors associated with patient falls, but literature identifying possible extrinsic or situational factors related to falls is lacking. This study seeks to identify patient motions and activities along with associated environmental design factors in a patient bathroom and clinician zone setting that may lead to falls. A motion capture experiment was conducted in a laboratory setting on 27 subjects over the age of seventy using scripted tasks and mockups of the bathroom and clinician zone of a patient room. Data were post-processed using Cortex and Visual3D software. A potential fall was characterized by a set of criteria based on the jerk of the upper body׳s center of mass (COM). Results suggest that only motion-related factors, particularly turning, pushing, pulling, and grabbing, contribute most significantly to potential falls in the patient bathroom, whereas only pushing and pulling contribute significantly in the clinician zone. Future work includes identifying and changing precise environmental design factors associated with these motions for an updated patient room and performing motion capture experiments using the new setup.

  16. [Relational models and psychopathology of epileptics in a group-psychotherapy perspective (author's transl)].

    PubMed

    Bergonzi, P; Ferro, F M; Mazza, S; Zolo, P

    1976-01-01

    Epileptic patients show a large range of psychopathologic manifestations, both from a qualitative point of view (even with an exact reference to the nature and the site of lesion) and from a quantitative point of view (from the so-called characterial attitude to the psychotic developments). Perhaps all these alterations of psychiatric interest have a common denominator because, after all, they arise from the sum of two essential moments: the experience of the critical event on the one hand, and the interactive network between the patient and those who are present to his critical manifestations on the other. In particular this complex relational psychopathology needs several therapeutic interventions which are to be complementary and concordant so that they may give satisfactory results of psychosocial reinsertion. We think that the model of intervention to be preferred for its effectiveness is that drawn from group-psychotherapy tecniques: the model in which "psychoanalysis meets sociology (Foulkes) seems to be particularly specific to this problem because it concerns the microsocial and investigates (and, by means of the conduction, it resolves) distorted ways of communication and conflictual dynamic interactions. We followed some epileptics in the group-community of the neurological department of a general hospital (of course with other mental, not epileptic, patients). These preliminary studies lead us to point out the theoretical reasons and the practical justifications of such possible management of the psychological manifestations of epileptic patients.

  17. Modified ultrafiltration in adult patients undergoing cardiac surgery.

    PubMed

    Zakkar, Mustafa; Guida, Gustavo; Angelini, Gianni D

    2015-03-01

    A best evidence topic in cardiac surgery was written according to a structured protocol. The question addressed was the impact of modified ultrafiltration on adult patients undergoing cardiac surgery in terms of inflammatory and metabolic changes, blood loss and early clinical outcomes. A total of 155 papers were identified using the search as described below. Of these, six papers presented the best evidence to answer the clinical question as they reported data to reach conclusions regarding the issues of interest for this review. The author, date and country of publication, patient group, study type and weaknesses and relevant outcomes were tabulated. Modified ultrafiltration in adult patients undergoing cardiac surgery seems to attenuate the levels of inflammatory molecules associated with surgery, reduces blood loss and blood transfusion and improves cardiac output, index and systemic vascular resistance. However, this was not translated in any reduction in length of stay in intensive care unit or hospital. Most studies were single-centre prospective non-blinded trials that included a small cohort of elective coronary artery bypass grafting patients, which makes it underpowered to provide unbiased evidence regarding clinical outcomes. Properly designed and conducted prospective randomized studies are required to answer whether the beneficial effect of modified ultrafiltration on systemic inflammatory molecules associated with surgery can translate with improvement in clinical outcome.

  18. Magnetoencephalography in pediatric neurology and in epileptic syndromes.

    PubMed

    Verrotti, Alberto; Pizzella, Vittorio; Trotta, Daniela; Madonna, Laura; Chiarelli, Francesco; Romani, Gian Luca

    2003-04-01

    In recent years, great advances in the knowledge of neuromagnetism have permitted the application of Superconducting Quantum Interference Devices to the pathophysiologic study of the human brain. In particular, in pediatric neurology, the integration of biomagnetism with magnetic resonance imaging and other techniques for medical imaging have allowed for precise neuromagnetic measurements of the human brain. The more frequently used technique is magnetoencephalography. Recent data have illustrated the usefulness of magnetoencephalography in mapping activity of sensory and motor areas and in studying the spatiotemporal pattern of brain activation specific to somatosensory function. Moreover, magnetoencephalography is an important tool to localize epileptic activity; magnetic source imaging superimposes magnetoencephalographic localizations on the magnetic resonance imaging and yields improved spatial resolution as compared with surface electroencephalography. The role of magnetoencephalography in evaluating patients with epilepsy continues to evolve; in fact, it seems to be very useful in the localization of the epileptogenic zone in patients with partial epilepsy. This application of magnetoencephalography is essential in the selection of epileptic children candidates to surgical treatment of seizures.

  19. Characterization of ictal slow waves in epileptic spasms.

    PubMed

    Honda, Ryoko; Saito, Yoshiaki; Okumura, Akihisa; Abe, Shinpei; Saito, Takashi; Nakagawa, Eiji; Sugai, Kenji; Sasaki, Masayuki

    2015-12-01

    We characterized the clinico-neurophysiological features of epileptic spasms, particularly focusing on high-voltage slow waves during ictal EEG. We studied 22 patients with epileptic spasms recorded during digital video-scalp EEG, including five individuals who still had persistent spasms after callosotomy. We analysed the duration, amplitude, latency to onset of electromyographic bursts, and distribution of the highest positive and negative peaks of slow waves in 352 spasms. High-voltage positive slow waves preceded the identifiable muscle contractions of spasms. The mean duration of these positive waves was 569±228 m, and the mean latency to electromyographic onset was 182±127 m. These parameters varied markedly even within a patient. The highest peak of the positive component was distributed in variable regions, which was not consistent with the location of lesions on MRI. The peak of the negative component following the positivity was distributed in the neighbouring or opposite areas of the positive peak distribution. No changes were evident in the pre- or post-surgical distributions of the positive peak, or in the interhemispheric delay between both hemispheres, in individuals with callosotomy. Our data imply that ictal positive slow waves are the most common EEG changes during spasms associated with a massive motor component. Plausible explanations for these widespread positive slow waves include the notion that EEG changes possibly reflect involvement of both cortical and subcortical structures.

  20. Epileptic Seizure Prediction Using a New Similarity Index for Chaotic Signals

    NASA Astrophysics Data System (ADS)

    Niknazar, Hamid; Nasrabadi, Ali Motie

    Epileptic seizures are generated by abnormal activity of neurons. The prediction of epileptic seizures is an important issue in the field of neurology, since it may improve the quality of life of patients suffering from drug resistant epilepsy. In this study a new similarity index based on symbolic dynamic techniques which can be used for extracting behavior of chaotic time series is presented. Using Freiburg EEG dataset, it is found that the method is able to detect the behavioral changes of the neural activity prior to epileptic seizures, so it can be used for prediction of epileptic seizure. A sensitivity of 63.75% with 0.33 false positive rate (FPR) in all 21 patients and sensitivity of 96.66% with 0.33 FPR in eight patients were achieved using the proposed method. Moreover, the method was evaluated by applying on Logistic and Tent map with different parameters to demonstrate its robustness and ability in determining similarity between two time series with the same chaotic characterization.

  1. Compulsive versifying after treatment of transient epileptic amnesia

    PubMed Central

    Woollacott, Ione O. C.; Fletcher, Phillip D.; Massey, Luke A.; Pasupathy, Amirtha; Rossor, Martin N.; Caine, Diana; Rohrer, Jonathan D.; Warren, Jason D.

    2015-01-01

    Compulsive production of verse is an unusual form of hypergraphia that has been reported mainly in patients with right temporal lobe seizures. We present a patient with transient epileptic amnesia and a left temporal seizure focus, who developed isolated compulsive versifying, producing multiple rhyming poems, following seizure cessation induced by lamotrigine. Functional neuroimaging studies in the healthy brain implicate left frontotemporal areas in generating novel verbal output and rhyme, while dysregulation of neocortical and limbic regions occurs in temporal lobe epilepsy. This case complements previous observations of emergence of altered behavior with reduced seizure frequency in patients with temporal lobe epilepsy. Such cases suggest that reduced seizure frequency has the potential not only to stabilize or improve memory function, but also to trigger complex, specific behavioral alterations. PMID:25157425

  2. Compulsive versifying after treatment of transient epileptic amnesia.

    PubMed

    Woollacott, Ione O C; Fletcher, Phillip D; Massey, Luke A; Pasupathy, Amirtha; Rossor, Martin N; Caine, Diana; Rohrer, Jonathan D; Warren, Jason D

    2015-01-01

    Compulsive production of verse is an unusual form of hypergraphia that has been reported mainly in patients with right temporal lobe seizures. We present a patient with transient epileptic amnesia and a left temporal seizure focus, who developed isolated compulsive versifying, producing multiple rhyming poems, following seizure cessation induced by lamotrigine. Functional neuroimaging studies in the healthy brain implicate left frontotemporal areas in generating novel verbal output and rhyme, while dysregulation of neocortical and limbic regions occurs in temporal lobe epilepsy. This case complements previous observations of emergence of altered behavior with reduced seizure frequency in patients with temporal lobe epilepsy. Such cases suggest that reduced seizure frequency has the potential not only to stabilize or improve memory function, but also to trigger complex, specific behavioral alterations.

  3. Thyroid gland diseases in adult patients with diabetes mellitus.

    PubMed

    Vondra, K; Vrbikova, J; Dvorakova, K

    2005-12-01

    This review concerns the relation between most frequent thyroid gland diseases and diabetes mellitus in adult patients. Special attention is paid to autoimmune thyroiditis, Graves' disease, thyroid autoimmunity in pregnant diabetic women, and iodine metabolism. We focused on mechanisms leading to coexistence of both endocrine disorders, and on distinctions in the prevalence, diagnosis, clinical course and treatment of thyroid diseases in diabetic patients. The prevalence of thyroid diseases in diabetic patients is 2-3 times higher than in nondiabetic subjects; it raises with age, and is strongly influenced by female gender and autoimmune diabetes. Clinical relevance of thyroid diseases, especially in diabetic patients, significantly increases if it is associated with deteriorated function, which always cause a number problems with metabolic compensation of diabetes. Most serious consequences are increased frequency of hypoglycaemia in hypothyroidism and development of potentially life-threatening ketoacidosis in thyrotoxicosis. In spite of that, little attention is paid to the diagnosis of thyroid diseases in diabetics, as they are diagnosed in only about half of the patients. At the end, we provide recommendations for the thyroid disease screening and diagnosis in patients with diabetes mellitus based on our experience.

  4. Updates in vaccination: Recommendations for adult inflammatory bowel disease patients

    PubMed Central

    Chaudrey, Khadija; Salvaggio, Michelle; Ahmed, Aftab; Mahmood, Sultan; Ali, Tauseef

    2015-01-01

    Treatment regimens for inflammatory bowel disease (IBD) incorporate the use of a variety of immunosuppressive agents that increase the risk of infections. Prevention of many of these infections can be achieved by the timely and judicious use of vaccinations. IBD patients tend to be under-immunized. Some of the contributing factors are lack of awareness regarding the significance of vaccinating IBD patients, misperception about safety of vaccinations in immunocompromised patients, ambiguity about the perceived role of the gastroenterologist in contrast to the primary care physician and unavailability of vaccination guidelines focused on IBD population. In general, immunocompetent IBD patients can be vaccinated using standard vaccination recommendations. However there are special considerations for IBD patients receiving immunosuppressive therapy, IBD travelers and pregnant women with IBD. This review discusses current vaccination recommendations with updates for adult IBD patients. Centers for Disease Control and Prevention 2013 vaccination guidelines with 2014 updates and the Advisory Committee on Immunization Practices recommendations have been highlighted as a primary source of recommendations. PMID:25805924

  5. Transition to adult life in the monogenic epilepsies.

    PubMed

    Scheffer, Ingrid E; Dravet, Charlotte

    2014-08-01

    There are many monogenic disorders associated with epilepsy that begin in childhood and persist into adult life. Each of these disorders raises specific issues for transition, in addition to common issues facing this group of patients as they move from pediatric to adult care. Such comorbidities include psychiatric and movement disorders. Epileptic encephalopathies may be caused by monogenic disorders, with Dravet syndrome being the best characterized. Although some patients have a relatively good adult outcome, others have persisting severe epilepsy complicated by autistic spectrum disorder and problems with gait. When reevaluating a patient as they transition to adult care, a thorough reconsideration of the genetic etiology of their epilepsy should be performed. This should be followed by genetic counseling for the patient and their family members.

  6. Group B streptococcal necrotizing pneumonia in a diabetic adult patient.

    PubMed

    Pacha, Andrea; Luna Cian, Ramiro; Bonofiglio, Laura; Solari, Melisa; Strada, Virginia; Suárez, Mariana; Vigliarolo, Laura; Tersigni, Carina; Mollerach, Marta; Lopardo, Horacio

    2017-03-18

    The aim of this report is to describe a rare case of necrotizing pneumonia due to group B Streptococcus serotype III in a relatively young male adult (48 years old) suffering from diabetes. The organism was isolated from his pleural fluid and was only resistant to tetracycline. The patient first received ceftazidime (2g/8h i.v.)+clindamycin (300mg/8h) for 18 days and then he was discharged home and orally treated with amoxicillin clavulanic acid (1g/12h) for 23 days with an uneventful evolution. As in the cases of invasive infection by Streptococcus pyogenes, clindamycin could prevent streptococcal toxic shock syndrome.

  7. Is visualising ureter before pyeloplasty necessary in adult patients?

    PubMed

    Cakan, M; Yalçinkaya, F; Demirel, F; Satir, A

    2000-01-01

    In this study, we aimed to detect whether or not visualising ureter and ureteropelvic junction (UPJ) preoperatively is necessary in adult patients who have primer UPJ obstruction. Between January 1995 to June 1999, 46 renal units in 45 patients with primer UPJ obstruction were evaluated. The patients were separated into 2 groups. In group 1, intravenous pyelography (IVP) and renal scintigraphy were performed to 17 renal units preoperatively. In group 2, in addition to these methods, either retrograde pyelography (RGP) or antegrade pyelography (AGP) were performed to 29 renal units. Renal/bladder sonogram was used in patients with poor renal function in IVP or in renal scintigraphy. All the operations were performed through a flank incision. In group 2, additional information was gained for 8 (27.5%) of the renal units preoperatively. No additional information for this group found intraoperatively. In group 1, we found additional information in 4 (23.53%) of the units intraoperatively. All the pathologies in both groups were corrected intraoperatively. Double-J (D-J) stent was used in 6 (35.29%) of the units in group 1 and 8 (27.58%) of the units in group 2 intraoperatively (p > 0.05). In group 2, 4 (13.79%) preoperative complications were seen due to RGP and they were treated either medically or conservatively. In the early postoperative period, a complication observed in 1 (5.88%) of the patients in group 1 and 1 of the patients in group 2 (3.44%) (p > 0.05). The first patient was treated with inserting D-J and the latter one was treated conservatively. In the 3rd postoperative month, success rate was found to be 94.11% in group 1 and 96.55% in group 2 (p > 0.05). Additional pathologies in adult patients with primer UPJ obstruction can be corrected intraoperatively through a flank incision. Therefore, imaging of ureter and UPJ may not be necessary in these patients.

  8. The quantitative measurement of consciousness during epileptic seizures.

    PubMed

    Nani, Andrea; Cavanna, Andrea E

    2014-01-01

    The assessment of consciousness is a fundamental element in the classification of epileptic seizures. It is, therefore, of great importance for clinical practice to develop instruments that enable an accurate and reliable measurement of the alteration of consciousness during seizures. Over the last few years, three psychometric scales have been specifically proposed to measure ictal consciousness: the Ictal Consciousness Inventory (ICI), the Consciousness Seizure Scale (CSS), and the Responsiveness in Epilepsy Scale--versions I and II (RES-I and RES-II). The ICI is a self-report psychometric instrument which retrospectively assesses ictal consciousness along the dimensions of the level/arousal and contents/awareness. The CSS has been used by clinicians to quantify the impairment of consciousness in order to establish correlations with the brain mechanisms underlying alterations of consciousness during temporal lobe seizures. The most recently developed observer-rated instrument is the RES-I, which has been used to assess responsiveness during epileptic seizures in patients undergoing video-EEG. The implementation of standardized psychometric tools for the assessment of ictal consciousness can complement clinical observations and contribute to improve accuracy in seizure classification.

  9. Facilitation of epileptic activity during sleep is mediated by high amplitude slow waves.

    PubMed

    Frauscher, Birgit; von Ellenrieder, Nicolás; Ferrari-Marinho, Taissa; Avoli, Massimo; Dubeau, François; Gotman, Jean

    2015-06-01

    Epileptic discharges in focal epilepsy are frequently activated during non-rapid eye movement sleep. Sleep slow waves are present during this stage and have been shown to include a deactivated ('down', hyperpolarized) and an activated state ('up', depolarized). The 'up' state enhances physiological rhythms, and we hypothesize that sleep slow waves and particularly the 'up' state are the specific components of non-rapid eye movement sleep that mediate the activation of epileptic activity. We investigated eight patients with pharmaco-resistant focal epilepsies who underwent combined scalp-intracerebral electroencephalography for diagnostic evaluation. We analysed 259 frontal electroencephalographic channels, and manually marked 442 epileptic spikes and 8487 high frequency oscillations during high amplitude widespread slow waves, and during matched control segments with low amplitude widespread slow waves, non-widespread slow waves or no slow waves selected during the same sleep stages (total duration of slow wave and control segments: 49 min each). During the slow waves, spikes and high frequency oscillations were more frequent than during control segments (79% of spikes during slow waves and 65% of high frequency oscillations, both P ∼ 0). The spike and high frequency oscillation density also increased for higher amplitude slow waves. We compared the density of spikes and high frequency oscillations between the 'up' and 'down' states. Spike and high frequency oscillation density was highest during the transition from the 'up' to the 'down' state. Interestingly, high frequency oscillations in channels with normal activity expressed a different peak at the transition from the 'down' to the 'up' state. These results show that the apparent activation of epileptic discharges by non-rapid eye movement sleep is not a state-dependent phenomenon but is predominantly associated with specific events, the high amplitude widespread slow waves that are frequent, but not

  10. Localization of focal epileptic discharges using functional connectivity magnetic resonance imaging

    PubMed Central

    Stufflebeam, Steven M.; Liu, Hesheng; Sepulcre, Jorge; Tanaka, Naoaki; Buckner, Randy L.; Madsen, Joseph R.

    2011-01-01

    Object In patients with medically refractory epilepsy the accurate localization of the seizure onset zone is critical for successful surgical treatment. The object of this study was to investigate whether the degree of coupling of spontaneous brain activity as measured with functional connectivity MR imaging (fcMR imaging) can accurately identify and localize epileptic discharges. Methods The authors studied 6 patients who underwent fcMR imaging presurgical mapping and subsequently underwent invasive electroencephalography. Results Focal regions of statistically significant increases in connectivity were identified in 5 patients when compared with an ad hoc normative sample of 300 controls. The foci identified by fcMR imaging overlapped the epileptogenic areas identified by invasive encephalography in all 5 patients. Conclusions These results suggest that fcMR imaging may provide an effective high–spatial resolution and noninvasive method of localizing epileptic discharges in patients with refractory epilepsy. PMID:21351832

  11. Ileal function in patients with untreated adult coeliac disease.

    PubMed Central

    Silk, D B; Kumar, P J; Webb, J P; Lane, A E; Clark, M L; Dawson, A M

    1975-01-01

    A double-lumen perfusion technique has been used to investigate jejunal and ileal absorption of glucose, water, and electrolytes in a group of patients with untreated adult coeliac disease. Correct positioning of the tube was confirmed by measuring the differential jejunal and ileal handling of bicarbonate. Eight control subjects and eight patients with coeliac disease were perfused with an isotonic electrolyte solution containing 50 mM glucose and 25 mM bicarbonate. The group of coeliac patients had impaired jejunal absorption of glucose (P less than 0.001), water (P less than 0.01), sodium (P less than 0.02), and chloride (P greater than 0.05) compared with the control group. In contrast the group of coeliac patients had normal ileal glucose and water absorption and increased ileal sodium (P greater than 0.01) and chloride (P greater than 0.05) absorption compared with the controls. Evidence for ileal adaptation was found in three individual patients who had absorptive values outside 2SD of the normal mean. The results indicate that the distal small intestine in coeliac disease has the ability to adopt to the damage and loss of absorptive capacity in the proximal small intestine. PMID:1132801

  12. A comprehensive Fabry-related pain questionnaire for adult patients.

    PubMed

    Üçeyler, Nurcan; Magg, Barbara; Thomas, Phillip; Wiedmann, Silke; Heuschmann, Peter; Sommer, Claudia

    2014-11-01

    Pain may be the earliest symptom in Fabry disease and presents with a distinct phenotype including triggerable pain attacks, evoked pain, pain crises, and chronic pain. Current pain questionnaires do not reflect the special phenotype of Fabry disease-associated pain, which hampers its systematic evaluation as the basis of correct diagnosis and effective treatment. A questionnaire specifically designed to assess Fabry disease-associated pain is thus urgently needed. At the Würzburg Fabry Center for Interdisciplinary Therapy (FAZIT), Germany, we developed and validated the first face-to-face Fabry Pain Questionnaire (FPQ) for adult patients. The initial version of the FPQ was tested in a pilot study with 20 consecutive Fabry disease patients. The performance of the revised FPQ was assessed in a first (n=56) and second (n=20) validation phase in consecutive Fabry disease patients. For this, patients were interviewed at baseline and 2 weeks later. We determined the test-retest reliability and validity of the FPQ in comparison to data obtained with the Neuropathic Pain Symptom Inventory. The FPQ contains 15 questions on the 4 pain phenotypes of Fabry disease (pain attacks, pain crises, evoked pain, chronic pain) in childhood and adulthood, on pain development during life with and without enzyme replacement therapy, and on everyday life impairment due to pain. This first disease-specific questionnaire is a valuable tool for baseline and follow-up assessment of pain in Fabry disease patients and may guide treatment in this distinct pain phenotype.

  13. Neural networks with periodogram and autoregressive spectral analysis methods in detection of epileptic seizure.

    PubMed

    Kiymik, M Kemal; Subasi, Abdulhamit; Ozcalik, H Riza

    2004-12-01

    Approximately 1% of the people in the world suffer from epilepsy. Careful analyses of the electroencephalograph (EEG) records can provide valuable insight and improved understanding of the mechanisms causing epileptic disorders. Predicting the onset of epileptic seizure is an important and difficult biomedical problem, which has attracted substantial attention of the intelligent computing community over the past two decades. The purpose of this work was to investigate the performance of the periodogram and autoregressive (AR) power spectrum methods to extract classifiable features from human electroencephalogram (EEG) by using artificial neural networks (ANN). The feedforward ANN system was trained and tested with the backpropagation algorithm using a large data set of exemplars. We present a method for the automatic comparison of epileptic seizures in EEG, allowing the grouping of seizures having similar overall patterns. Each channel of the EEG is first broken down into segments having relatively stationary characteristics. Features are then calculated for each segment, and all segments of all channels of the seizures of a patient are grouped into clusters of similar morphology. This clustering allows labeling of every EEG segment. Examples from 5 patients with scalp electrodes illustrate the ability of the method to group seizures of similar morphology. It was observed that ANN classification of EEG signals with AR preprocessing gives better results, and these results can also be used for the deduction of epileptic seizure.

  14. Ictal epileptic headache: a review of current literature and differentiation from migralepsy and other epilepsies.

    PubMed

    Saitowitz, Zacharry; Flamini, Robert; Berenson, Frank

    2014-10-01

    Ictal headaches are increasingly becoming the focus of research as more data demonstrate headaches existing as a sole manifestation of an epileptic event. Due to the difficulty in diagnosing the event as an epileptic phenomenon as opposed to a migraine, the condition is often misdiagnosed. This paper seeks to review the current published literature on ictal epileptic headaches as well as provide differentiation between ictal headaches and similarly presenting conditions. In doing so, we hope to improve the diagnosis of ictal headaches and thus improve patient care. We review two case studies that exemplify the potential of multiple conditions with comparable symptoms to ictal headaches, and discuss how to differentiate the variable diagnoses. As of the writing of this paper, there is no universally agreed upon set of features of ictal headaches; however, reviewing the current literature, there do seem to be several features that should be noted when treating patients. More research on the pathophysiology of ictal epileptic headaches needs to be done before the condition can be fully understood.

  15. Unexplained lymphadenopathies: autoimmune lymphoproliferative syndrome in an adult patient

    PubMed Central

    Leal-Seabra, Fatima; Costa, Gonçalo Sarmento; Coelho, Henrique Pereira; Oliveira, Agripino

    2016-01-01

    Autoimmune lymphoproliferative syndrome (ALPS) is characterised by massive enlargement of the lymphoid organs, autoimmune cytopenias and a predisposition to develop lymphoid malignancies. The basic defect is a disturbance of the lymphocyte apoptosis, and a high number of circulating TCRab CD3+CD4−CD8− T-cells (double-negative T cells (DNT cells)). We describe a case of a 41-year-old man with fever, hepatosplenomegaly, multiple lymphadenopathy, autoimmune haemolytic anaemia and severe thrombocytopenia. Peripheral blood immunophenotyping revealed elevation of the characteristic DNT cells in 8% and high levels of interleukin 10. Histopathological analysis of lymph nodes showed lymphadenitis with paracortical hyperplasia. It was assumed as a probable diagnosis of ALPS, and the procedure was to medicate the patient with steroids. As a result, a significant clinical improvement was achieved, and he has been in remission for 2 years. To our knowledge, this is the first case reported in a Portuguese adult patient. PMID:27979843

  16. Unexplained lymphadenopathies: autoimmune lymphoproliferative syndrome in an adult patient.

    PubMed

    Leal-Seabra, Fatima; Costa, Gonçalo Sarmento; Coelho, Henrique Pereira; Oliveira, Agripino

    2016-12-15

    Autoimmune lymphoproliferative syndrome (ALPS) is characterised by massive enlargement of the lymphoid organs, autoimmune cytopenias and a predisposition to develop lymphoid malignancies. The basic defect is a disturbance of the lymphocyte apoptosis, and a high number of circulating TCRab CD3(+)CD4(-)CD8(-) T-cells (double-negative T cells (DNT cells)). We describe a case of a 41-year-old man with fever, hepatosplenomegaly, multiple lymphadenopathy, autoimmune haemolytic anaemia and severe thrombocytopenia. Peripheral blood immunophenotyping revealed elevation of the characteristic DNT cells in 8% and high levels of interleukin 10. Histopathological analysis of lymph nodes showed lymphadenitis with paracortical hyperplasia. It was assumed as a probable diagnosis of ALPS, and the procedure was to medicate the patient with steroids. As a result, a significant clinical improvement was achieved, and he has been in remission for 2 years. To our knowledge, this is the first case reported in a Portuguese adult patient.

  17. Recommended vaccinations for asplenic and hyposplenic adult patients

    PubMed Central

    Grazzini, Maddalena; Niccolai, Giuditta; Paolini, Diana; Varone, Ornella; Bartoloni, Alessandro; Bartalesi, Filippo; Santini, Maria Grazia; Baretti, Simonetta; Bonito, Carlo; Zini, Paola; Mechi, Maria Teresa; Niccolini, Fabrizio; Magistri, Lea; Pulci, Maria Beatrice; Bechini, Angela

    2017-01-01

    ABSTRACT Asplenic or hyposplenic (AH) individuals are particularly vulnerable to invasive infections caused by encapsulated bacteria. Such infections have often a sudden onset and a fulminant course. Infectious diseases (IDs) incidence in AH subjects can be reduced by preventive measures such as vaccination. The aim of our work is to provide updated recommendations on prevention of infectious diseases in AH adult patients, and to supply a useful and practical tool to healthcare workers for the management of these subjects, in hospital setting and in outpatients consultation. A systematic literature review on evidence based measures for the prevention of IDs in adult AH patients was performed in 2015. Updated recommendations on available vaccines were consequently provided. Vaccinations against S. pneumoniae, N. meningitidis, H. influenzae type b and influenza virus are strongly recommended and should be administered at least 2 weeks before surgery in elective cases or at least 2 weeks after the surgical intervention in emergency cases. In subjects without evidence of immunity, 2 doses of live attenuated vaccines against measles-mumps-rubella and varicella should be administered 4–8 weeks apart from each other; a booster dose of tetanus, diphtheria and pertussis vaccine should be administered also to subjects fully vaccinated, and a 3-dose primary vaccination series is recommended in AH subjects with unknown or incomplete vaccination series (as in healthy people). Evidence based prevention data support the above recommendations to reduce the risk of infection in AH individuals. PMID:27929751

  18. Pallister-Killian syndrome: an unusual cause of epileptic spasms.

    PubMed

    Sánchez-Carpintero, Rocio; McLellan, Ailsa; Parmeggiani, Lucio; Cockwell, Annette E; Ellis, Richard J; Cross, J Helen; Eckhardt, Susan; Guerrini, Renzo

    2005-11-01

    Pallister-Killian syndrome (PKS) is a rare, sporadic, genetic disorder characterized by dysmorphic features, learning disability, and epilepsy. It is caused by a mosaic supernumerary isochromosome 12p (i[12p]). The i(12p) is rarely found in peripheral blood but it is present in skin fibroblasts. Recognition is essential for cytogenetic diagnosis. We describe a male aged 2 years 6 months and a female aged 11 years with PKS and epileptic spasms (ES). This type of seizure is not unusual in patients with brain malformations and with severe developmental delay, but it is sometimes difficult to recognize without video-electroencephalogram studies and could be mistaken for other types of seizure or behavioural manifestations. In these two patients with PKS, spasms had late onset, persisted beyond infancy, and were drug resistant. Clinicians should be aware of this possibility in PKS, which appears to be a rare cause of ES.

  19. Anomalous systemic arterial supply of pulmonary sequestration in adult patients

    PubMed Central

    Hou, Xiaomeng; Li, Ji; Li, Jing; Cai, Baiqiang

    2017-01-01

    OBJECTIVES: This study described the characteristics of the systemic arterial supply of pulmonary sequestration (PS) in an attempt to better distinguish PS from other acquired lesions. METHODS: We identified 25 patients hospitalized at the Peking Union Medical College Hospital during January 2013 to December 2015 with the assistance of medical catalogers. Twenty-three patients with a definite diagnosis of “pulmonary sequestration” clinically or pathologically were included in the study. The medical records, imaging information, and pathological data were reviewed retrospectively. The general characteristics of the patients and the features of the anomalous arteries were summarized. RESULTS: Aberrant arterial supply of PS was found in all 23 (100%) cases. Among them, twenty patients received surgery, including 14 (70%) with aberrant arterial supply found before surgery, and the other 6 (30%) found during surgery. Nineteen (82.6%) patients had a single systematic arterial supply, with a median diameter of 8 mm. More than one arterial supplies were found in four (17.4%) cases. In 21 (91.3%) cases, the anomalous systemic artery originated from the descending thoracic aorta just adjacent to the sequestrated lung which it supplied, without the presence of accompanying bronchi. In twenty (87.0%) patients who received the surgical intervention, samples of 12 (85.7%) were proved to have elastic vessel walls, out of the 14 samples in which the anomalous systemic arteries were available for analysis. CONCLUSIONS: There are no certain pathology diagnostic criteria for the diagnosis of PS. The detecting of the aberrant systematic artery and distinguishing it from the bronchial arteries corresponded to certain lung abnormalities are the keys to the accurate diagnosis of pulmonary sequestration in adult patients. We propose that the characteristic features of the anomalous arteries include: Originating from aorta and its main branches, adjacent to the sequestrated area

  20. Vitamin-Responsive Epileptic Encephalopathies in Children

    PubMed Central

    Agadi, Satish; Quach, Michael M.

    2013-01-01

    Untreated epileptic encephalopathies in children may potentially have disastrous outcomes. Treatment with antiepileptic drugs (AEDs) often may not control the seizures, and even if they do, this measure is only symptomatic and not specific. It is especially valuable to identify potential underlying conditions that have specific treatments. Only a few conditions have definitive treatments that can potentially modify the natural course of disease. In this paper, we discuss the few such conditions that are responsive to vitamin or vitamin derivatives. PMID:23984056

  1. Resetting of brain dynamics: epileptic versus psychogenic nonepileptic seizures.

    PubMed

    Krishnan, Balu; Faith, Aaron; Vlachos, Ioannis; Roth, Austin; Williams, Korwyn; Noe, Katie; Drazkowski, Joe; Tapsell, Lisa; Sirven, Joseph; Iasemidis, Leon

    2011-12-01

    We investigated the possibility of differential diagnosis of patients with epileptic seizures (ES) and patients with psychogenic nonepileptic seizures (PNES) through an advanced analysis of the dynamics of the patients' scalp EEGs. The underlying principle was the presence of resetting of brain's preictal spatiotemporal entrainment following onset of ES and the absence of resetting following PNES. Long-term (days) scalp EEGs recorded from five patients with ES and six patients with PNES were analyzed. It was found that: (1) Preictal entrainment of brain sites was reset at ES (P<0.05) in four of the five patients with ES, and not reset (P=0.28) in the fifth patient. (2) Resetting did not occur (p>0.1) in any of the six patients with PNES. These preliminary results in patients with ES are in agreement with our previous findings from intracranial EEG recordings on resetting of brain dynamics by ES and are expected to constitute the basis for the development of a reliable and supporting tool in the differential diagnosis between ES and PNES. Finally, we believe that these results shed light on the electrophysiology of PNES by showing that occurrence of PNES does not assist patients in overcoming a pathological entrainment of brain dynamics. This article is part of a Supplemental Special Issue entitled The Future of Automated Seizure Detection and Prediction.

  2. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  3. Are Adult Patients More Tolerant of Treatment Risks Than Parents of Juvenile Patients?

    PubMed Central

    Johnson, F. Reed; Özdemir, Semra; Mansfield, Carol; Hass, Steven; Siegel, Corey A.; Sands, Bruce E.

    2010-01-01

    Understanding patient-specific differences in risk tolerance for new treatments that offer improved efficacy can assist in making difficult regulatory and clinical decisions for new treatments that offer both the potential for greater effectiveness in relieving disease symptoms, but also risks of disabling or fatal side effects. The aim of this study is to elicit benefit-risk trade-off preferences for hypothetical treatments with varying efficacy and risk levels using a stated-choice (SC) survey. We derive estimates of “maximum acceptable risk” (MAR) that can help decisionmakers identify welfare-enhancing alternatives. In the case of children, parent caregivers are responsible for treatment decisions and their risk tolerance may be quite different than adult patients' own tolerance for treatment-related risks. We estimated and compared the willingness of Crohn's disease (CD) patients and parents of juvenile CD patients to accept serious adverse event (SAE) risks in exchange for symptom relief. The analyzed data were from 345 patients over the age of 18 and 150 parents of children under the age of 18. The estimation results provide strong evidence that adult patients and parents of juvenile patients are willing to accept tradeoffs between treatment efficacy and risks of SAEs. Parents of juvenile CD patients are about as risk tolerant for their children as adult CD patients are for themselves for improved treatment efficacy. SC surveys provide a systematic method for eliciting preferences for benefit-risk tradeoffs. Understanding patients' own risk perceptions and their willingness to accept risks in return for treatment benefits can help inform risk management decision making. PMID:18826414

  4. Respiratory pattern in an adult population of dystrophic patients.

    PubMed

    D'Angelo, M G; Romei, M; Lo Mauro, A; Marchi, E; Gandossini, S; Bonato, S; Comi, G P; Magri, F; Turconi, A C; Pedotti, A; Bresolin, N; Aliverti, A

    2011-07-15

    We studied respiratory function and Chest Wall kinematics in a large population of adult patients affected by slow course muscular dystrophies such as Limb-Girdle Muscular Dystrophy (LGMD, n=38), Becker Muscular Dystrophy (BMD, n=20) and Facio-Scapulo Humeral Dystrophy (FSHD, n=30), through standard spirometry and through the Optoelectronic Plethysmography, to measure the thoraco-abdominal motion during Quiet Breathing and Slow Vital Capacity maneuvers. Within the restrictive pulmonary syndrome characterizing LGMD and FSHD, several different thoraco-abdominal patterns compared to those of healthy subjects were present in the more advanced stages of the disease. These differences were present in the seated position, during the execution of a maximal maneuver such as Slow Vital Capacity. A global respiratory (both inspiratory and expiratory) muscle involvement was more pronounced in the LGMD and FSHD than in the BMD patients, and a significant reduction of abdominal contribution in wheelchair bound patients was observed. In conclusion, OEP technique is able to reveal mild initial modifications in the respiratory muscles in FSHD and LGMD patients, which could be helpful for functional and new therapeutic strategy evaluation.

  5. Interpretation of multiple isolate urine cultures in adult male patients.

    PubMed Central

    Khalifa, M. A.; Abdoh, A. A.; Silva, F. G.; Flournoy, D. J.

    1995-01-01

    A retrospective analytical study examined the records of 220 adult males (mean age 64.9 years) to determine the relative probability that multiple urine culture isolates (MUI) represent urinary tract infection (UTI) versus contamination or colonization. Nonculture laboratory data were used to determine the likelihood of UTI. Patients were classified into three categories: group 1 (those with single isolate cultures; n = 110), group 2 (those with MUI and either symptomatic UTI or an underlying pathologic condition; n = 71) and group 3 (those with MUI and either surgically altered urinary passages or absence of UTI symptoms; n = 39). Nonculture laboratory data suggested UTI in 48.2% of patients in group 1, 46.5% in group 2, and 23.1% in group 3. Patients in groups 1 or 2 with cultures yielding isolate counts of 10(5) colony forming units/mL were 6.2 times more likely to be classified as having a UTI (by nonculture laboratory data) compared with patients having only one or more of these two criteria. This study proposes a more objective approach to interpretation of MUI cultures using the results of nonculture laboratory data, clinical profiles, and colony counts. PMID:7897687

  6. The spectrum of psychogenic non-epileptic seizures and comorbidities seen in an epilepsy monitoring unit.

    PubMed

    Seneviratne, Udaya; Briggs, Belinda; Lowenstern, David; D'Souza, Wendyl

    2011-03-01

    We sought to study characteristics of patients presenting with psychogenic non-epileptic seizures (PNES), with and without major psychiatric comorbidity. A total of 39 patients who were diagnosed with PNES in a tertiary care setting were studied, and those patients with and without axis I psychiatric disorders in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) were compared. The mean time in confirming the diagnosis was 9 years. More than half the patients were taking anti-epileptic medications when they presented for video-electroencephalographic monitoring. The mean monitoring time required to capture a PNES was 0.6 days. Comorbid chronic medical conditions were found in 38.5% and axis I-psychiatric diagnoses in 48.7%. There were no significant differences in characteristics between those with and without major psychiatric comorbidities.

  7. The epileptic spectrum in the congenital bilateral perisylvian syndrome. CBPS Multicenter Collaborative Study.

    PubMed

    Kuzniecky, R; Andermann, F; Guerrini, R

    1994-03-01

    We studied the frequency, clinical and EEG characteristics, and outcome of the epileptic syndrome in 31 patients with a congenital neurologic syndrome characterized by pseudobulbar palsy, cognitive deficits, and bilateral perisylvian polymicrogyria. Seizures were present in 27 of 31 patients (87%) and usually began between the ages of 4 and 12 years; they commonly consisted of atypical absence, atonic/tonic, and generalized tonic-clonic seizures. Partial attacks were present in 26%. EEG demonstrated generalized spike and wave abnormalities and, less frequently, multifocal discharges, predominantly in centro-parietal regions. Seizures were poorly controlled in 65%, with the remaining patients well controlled. Seven patients underwent callosotomy, which resulted in seizure improvement. This study indicates that the epileptic spectrum in this syndrome is broad but follows predictable patterns. Callosotomy is a valuable treatment strategy in those with intractable drop attacks.

  8. Systematic review of surgical treatment techniques for adult and pediatric patients with pectus excavatum

    PubMed Central

    2014-01-01

    This compares outcome measures of current pectus excavatum (PEx) treatments, namely the Nuss and Ravitch procedures, in pediatric and adult patients. Original investigations that stratified PEx patients based on current treatment and age (pediatric = 0–21; adult 17–99) were considered for inclusion. Outcome measures were: operation duration, analgesia duration, blood loss, length of stay (LOS), outcome ratings, complications, and percentage requiring reoperations. Adult implant patients (18.8%) had higher reoperation rates than adult Nuss or Ravitch patients (5.3% and 3.3% respectively). Adult Nuss patients had longer LOS (7.3 days), more strut/bar displacement (6.1%), and more epidural analgesia (3 days) than adult Ravitch patients (2.9 days, 0%, 0 days). Excluding pectus bar and strut displacements, pediatric and adult Nuss patients tended to have higher complication rates (pediatric - 38%; adult - 21%) compared to pediatric and adult Ravitch patients (12.5%; 8%). Pediatric Ravitch patients clearly had more strut displacements than adult Ravitch patients (0% and 6.4% respectively). These results suggest significantly better results in common PEx surgical repair techniques (i.e. Nuss and Ravitch) than uncommon techniques (i.e. Implants and Robicsek). The results suggest slightly better outcomes in pediatric Nuss procedure patients as compared with all other groups. We recommend that symptomatic pediatric patients with uncomplicated PEx receive the Nuss procedure. We suggest that adult patients receive the Nuss or Ravitch procedure, even though the long-term complication rates of the adult Nuss procedure require more investigation. PMID:24506826

  9. Diagnosis and Management of Epileptic Encephalopathies in Children

    PubMed Central

    Jain, Puneet; Tripathi, Manjari

    2013-01-01

    Epileptic encephalopathies refer to a group of disorders in which the unremitting epileptic activity contributes to severe cognitive and behavioral impairments above and beyond what might be expected from the underlying pathology alone, and these can worsen over time leading to progressive cerebral dysfunction. Several syndromes have been described based on their electroclinical features (age of onset, seizure type, and EEG pattern). This review briefly describes the clinical evaluation and management of commonly encountered epileptic encephalopathies in children. PMID:23970964

  10. Orthodontics in the adult patient, with special reference to the periodontally compromised patient.

    PubMed

    Johal, A; Ide, M

    1999-04-01

    There is increasing demand from adult patients for orthodontic treatment, either purely for aesthetics, to improve aesthetics or function following previous disease, or to facilitate the stabilization, restoration or replacement of teeth. Orthodontics may have a major role in the rehabilitation of patients suffering the effects of advanced periodontal disease, but there are a number of important factors to be considered in the management of such patients if the optimal outcome is to be obtained. This paper summarizes important aspects of treatment and the potential complications and how to avoid them.

  11. Epileptic Seizure Detection in Eeg Signals Using Multifractal Analysis and Wavelet Transform

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.; Easwaramoorthy, D.

    2013-06-01

    This paper explores the three different methods to explicitly recognize the healthy and epileptic EEG signals: Modified, Improved, and Advanced forms of Generalized Fractal Dimensions (GFD). The newly proposed scheme is based on GFD and the discrete wavelet transform (DWT) for analyzing the EEG signals. First EEG signals are decomposed into approximation and detail coefficients using DWT and then GFD values of the original EEGs, approximation and detail coefficients are computed. Significant differences are observed among the GFD values of the healthy and epileptic EEGs allowing us to classify seizures with high accuracy. It is shown that the classification rate is very less accurate without DWT as a preprocessing step. The proposed idea is illustrated through the graphical and statistical tools. The EEG data is further tested for linearity by using normal probability plot and we proved that epileptic EEG had significant nonlinearity whereas healthy EEG distributed normally and similar to Gaussian linear process. Therefore, we conclude that the GFD and the wavelet decomposition through DWT are the strong indicators of the state of illness of epileptic patients.

  12. Modeling epileptic brain states using EEG spectral analysis and topographic mapping.

    PubMed

    Direito, Bruno; Teixeira, César; Ribeiro, Bernardete; Castelo-Branco, Miguel; Sales, Francisco; Dourado, António

    2012-09-30

    Changes in the spatio-temporal behavior of the brain electrical activity are believed to be associated to epileptic brain states. We propose a novel methodology to identify the different states of the epileptic brain, based on the topographic mapping of the time varying relative power of delta, theta, alpha, beta and gamma frequency sub-bands, estimated from EEG. Using normalized-cuts segmentation algorithm, points of interest are identified in the topographic mappings and their trajectories over time are used for finding out relations with epileptogenic propagations in the brain. These trajectories are used to train a Hidden Markov Model (HMM), which models the different epileptic brain states and the transition among them. Applied to 10 patients suffering from focal seizures, with a total of 30 seizures over 497.3h of data, the methodology shows good results (an average point-by-point accuracy of 89.31%) for the identification of the four brain states--interictal, preictal, ictal and postictal. The results suggest that the spatio-temporal dynamics captured by the proposed methodology are related to the epileptic brain states and transitions involved in focal seizures.

  13. Preference for One or Two Hearing Aids among Adult Patients

    PubMed Central

    Cox, Robyn M; Schwartz, Kathryn S.; Noe, Colleen M.; Alexander, Genevieve C.

    2010-01-01

    Objectives Most practitioners believe that use of two hearing aids is the ideal fitting for adults with bilateral symmetrical hearing loss. However, previous research has consistently shown that a substantial proportion of these patients actually prefer to use only one hearing aid. The current study explored whether this pattern of preferences is seen with technologically advanced hearing aids. In addition, a selection of variables that were available pre-fitting were used to attempt to predict which patients will prefer one hearing aid rather than two. Design The study was designed as a 12-week field trial including structured and unstructured use of one and two hearing aids. Ninety-four subjects with mild to moderate bilaterally symmetrical hearing loss were bilaterally fit with 2005-2007 era hearing aids. Potential predictors included demographic, audiometric, auditory lifestyle, personality, and binaural processing variables. After the field trial, each subject stated his/her preference for one or two hearing aids and completed three self-report outcome questionnaires for their preferred fitting. Results Previous research was confirmed with modern technology hearing aids: after the field trial 46% of the subjects preferred to use one hearing aid rather than two. Subjects who preferred two hearing aids tended to report better real-world outcomes than those who preferred one. Subjects who reported more hearing problems in daily life, who experienced more binaural loudness summation, and whose ears were more equivalent in dichotic listening were more likely to prefer to use two hearing aids. Contrary to conventional wisdom (ideas that are generally accepted as true), audiometric hearing loss and auditory lifestyle were not predictive of aiding preference. However, the best predictive approach from these data yielded accurate predictions for only two-thirds of subjects. Conclusions Evidence-based practice calls for a conscientious melding of current evidence

  14. Epileptic laughter: 2 case reports.

    PubMed

    Talvik, Inga; Vibo, Riina; Liik, Maarika; Haldre, Sulev; Talvik, Tiina

    2012-01-01

    Two cases of gelastic epilepsy in a 6-year-old girl with attacks of mirthful laughter and a 38-year-old male patient with episodes of laughter without any positive emotions are presented. Temporal lobe epilepsy was diagnosed in the first case and possible frontal lobe epilepsy in the second case. It is concluded that that this rare form of epilepsy can be difficult to diagnose and treat, and can clinically be accompanied by urinary incontinence.

  15. Scrotal tuberculosis in adult patients: a 10-year clinical experience.

    PubMed

    Lee, Ing-Kit; Yang, Wen-Chou; Liu, Jien-Wei

    2007-10-01

    Twenty-nine adults (mean age, 59.9 +/- 13.5 years) with scrotal tuberculosis (TB) were retrospectively analyzed. The mean interval from emergence of symptoms suggestive of scrotal TB to diagnosis established was 142.44 +/- 227.66 days. Scrotal TB was initially suspected in only five (17.2%) patients, and infection caused by bacteria other than Mycobacterium tuberculosis (55.2%) was the leading presumptive diagnosis. Of 28 patients with chest radiographs available, 7 (25%) disclosed active pulmonary TB, and 9 (32.1%) showed a TB scar. All patients received anti-TB chemotherapy; 20 (69%) additionally underwent surgery. Pathologic examination of resected tissue at therapeutic surgery, biopsy, or polymerase chain reaction assay of urine led to rapid diagnosis of scrotal TB. Although evidence of scrotal TB was easily obtainable, the lack of alertness made clinicians avert from the appropriate diagnostic approaches and rendered a delayed diagnosis. Our report underscores the urgent need for improving clinicians' awareness of scrotal TB.

  16. Staphylococcus aureus isolated from tonsillectomized adult patients with recurrent tonsillitis.

    PubMed

    Katkowska, Marta; Garbacz, Katarzyna; Stromkowski, Józef

    2017-01-01

    The aim of this study was to analyze the prevalence and antibiotic resistance of Staphylococcus aureus strains from 118 tonsillectomized adults due to recurrent tonsillitis (RT). The study included strains isolated from the tonsillar surface prior to tonsillectomy, recovered from the tonsillar core at the time of surgery, and from the posterior throat 2-4 weeks after the procedure. Susceptibility of isolates to 19 antibiotics was tested in line with the Clinical and Laboratory Standards Institute recommendations. Irrespective of the stage, the most commonly isolated bacteria were gram-positive cocci, and among them S. aureus. The tonsillar core was the most common site of S. aureus isolation (30.5%), followed by the tonsillar surface (10.8%) and the posterior pharynx (5.9%). This difference turned out to be statistically significant (p < 0.001). Beta-hemolytic streptococci, most often Streptococcus pyogenes (5.1%), were isolated from 2.5% to 10.2% of patients. Staphylococcal isolates were susceptible to most tested antibiotics (except from penicillin and ampicillin) and rarely showed methicillin resistance (n = 1). Staphylococcus aureus seems to be the most common pathogen isolated from patients tonsillectomized due to RT. Staphylococcal isolates associated with RT are present mostly within the tonsillar core and susceptible to most antibiotics. They are typically isolated from patients between 21 and 30 years of age. Tonsillectomy results in less frequent isolation of S. aureus strains.

  17. Cephalometric appraisal of posttreatment vertical changes in adult orthodontic patients.

    PubMed

    Ahn, J G; Schneider, B J

    2000-10-01

    The purpose of this study was to evaluate vertical facial changes in adult orthodontic patients and to evaluate the stability of these changes. Thirty-three patients (8 males and 25 females) were examined. The patients had been treated with full fixed edgewise appliance mechanics and exhibited at least 1.0 degrees of clockwise rotation of the mandible during treatment. Mandibular rotation was determined by the angular change in the Y-axis to the Frankfort plane. Twelve angular and 14 linear skeletal and dental measurements and 3 skeletal ratios were derived from pretreatment (T1), posttreatment (T2), and postretention (T3) cephalometric radiographs. Paired t tests were used to compare vertical changes that occurred as a result of orthodontic treatment and their stability or relapse tendency during the retention and postretention periods. Twenty-five percent (P <.001) of the opening rotation of the mandible recovered during the posttreatment period, resulting in a significant overall rotation that was maintained. Both treatment and posttreatment changes in the Y-axis angle showed a high correlation with the horizontal position of pogonion (r = -0.797 and -0.889, respectively). Only overjet showed a low correlation between treatment changes and posttreatment changes in the Y-axis angle. Stepwise regression analysis of pretreatment variables and treatment changes failed to predict the behavior of the Y-axis angle change.

  18. Trichotillomania and Non-Epileptic Seizures as Sleep-Related Dissociative Phenomena

    PubMed Central

    Angulo-Franco, Melina; Bush-Martínez, Alejandra; Nenclares-Portocarrero, Alejandro; Jiménez-Genchi, Alejandro

    2015-01-01

    The occurrence of non-epileptic seizures (NES) and trichotillomania during sleep is rare. We describe the case of an adult woman with a personal history of childhood maltreatment and psychiatric morbidity (major depression, trichotillomania, and conversion disorder), who was referred to the sleep unit because of nocturnal hair-pulling and psychomotor agitation during sleep. An all-night PSG recording with audiovisual monitoring documented seven episodes of trichotillomania and one NES, all of which arose from unequivocal wakefulness. Improvement of nocturnal behaviors was observed after long-term psychotherapy. This case illustrates that nocturnal trichotillomania and NES may be symptoms of a sleep-related dissociative disorder. Citation: Angulo-Franco M, Bush-Martínez A, Nenclares-Portocarrero A, Jiménez-Genchi A. Trichotillomania and non-epileptic seizures as sleep-related dissociative phenomena. J Clin Sleep Med 2015;11(3):271–273. PMID:25515284

  19. Humidification during Mechanical Ventilation in the Adult Patient

    PubMed Central

    Al Ashry, Haitham S.; Modrykamien, Ariel M.

    2014-01-01

    Humidification of inhaled gases has been standard of care in mechanical ventilation for a long period of time. More than a century ago, a variety of reports described important airway damage by applying dry gases during artificial ventilation. Consequently, respiratory care providers have been utilizing external humidifiers to compensate for the lack of natural humidification mechanisms when the upper airway is bypassed. Particularly, active and passive humidification devices have rapidly evolved. Sophisticated systems composed of reservoirs, wires, heating devices, and other elements have become part of our usual armamentarium in the intensive care unit. Therefore, basic knowledge of the mechanisms of action of each of these devices, as well as their advantages and disadvantages, becomes a necessity for the respiratory care and intensive care practitioner. In this paper, we review current methods of airway humidification during invasive mechanical ventilation of adult patients. We describe a variety of devices and describe the eventual applications according to specific clinical conditions. PMID:25089275

  20. Amplitude suppression and chaos control in epileptic EEG signals.

    PubMed

    Majumdar, Kaushik; Myers, Mark H

    2006-03-01

    In this paper we have proposed a novel amplitude suppression algorithm for EEG signals collected during epileptic seizure. Then we have proposed a measure of chaoticity for a chaotic signal, which is somewhat similar to measuring sensitive dependence on initial conditions by measuring Lyapunov exponent in a chaotic dynamical system. We have shown that with respect to this measure the amplitude suppression algorithm reduces chaoticity in a chaotic signal (EEG signal is chaotic). We have compared our measure with the estimated largest Lyapunov exponent measure by the largelyap function, which is similar to Wolf's algorithm. They fit closely for all but one of the cases. How the algorithm can help to improve patient specific dosage titration during vagus nerve stimulation therapy has been outlined.

  1. Resolution of epileptic encephalopathy following treatment with transdermal nicotine.

    PubMed

    Zerem, Ayelet; Nishri, Daniella; Yosef, Yael; Blumkin, Lubuv; Lev, Dorit; Leshinsky-Silver, Esther; Kivity, Sara; Lerman-Sagie, Tally

    2013-01-01

    We report resolution of an epileptic encephalopathy by administration of transdermal nicotine patches in an adolescent with severe nonlesional refractory frontal lobe epilepsy. The 18.5-year-old female patient had refractory epilepsy from the age of 11. Recurrent electroencephalography (EEG) recordings showed mostly generalized activity, albeit with right frontal predominance. Almost all antiepileptic medications failed to provide benefit. She developed an encephalopathic state with cognitive decline. The nonlesional frontal lobe epilepsy and a family history of a cousin with nocturnal epilepsy with frontal origin suggested genetic etiology. Transdermal nicotine patches brought complete resolution of the seizures, normalization of the EEG, and a significant improvement in her thinking process and speech organization. Sequencing of the CHRNB2 and CHRNA4 genes did not detect a mutation. Transdermal nicotine patches should be considered in severe pharmacoresistant frontal lobe epilepsy.

  2. Population Pharmacokinetics of Benznidazole in Adult Patients with Chagas Disease

    PubMed Central

    Aldasoro, E.; Guerrero, L.; Posada, E.; Serret, N.; Mejía, T.; Urbina, J. A.; Gascón, J.

    2015-01-01

    The aim of the present study was to build a population pharmacokinetic (popPK) model to characterize benznidazole (BNZ) pharmacokinetics in adults with chronic Chagas disease. This study was a prospective, open-label, single-center clinical trial approved by the local ethics committee. Patients received BNZ at 2.5 mg/kg of body weight/12 h (Abarax, Elea Laboratory, Argentina) for 60 days. Plasma BNZ samples were taken several times during the study and analyzed by high-performance liquid chromatography with UV-visible detection (HPLC-UV). The popPK analysis was done with NONMEMv.7.3. Demographic and biological data were tested as covariates. Intraindividual, interoccasion, and residual variabilities were modeled. Internal and external validations were completed to assess the robustness of the model. Later on, simulations were performed to generate BNZ concentration-time course profiles for different dosage regimens. A total of 358 plasma BNZ concentrations from 39 patients were included in the analysis. A one-compartment PK model characterized by clearance (CL/F) and the apparent volume of distribution (V/F), with first-order absorption (Ka) and elimination, adequately described the data (CL/F, 1.73 liters/h; V/F, 89.6 liters; and Ka, 1.15 h−1). No covariates were found to be significant for CL/F and V/F. Internal and external validations of the final model showed adequate results. Data from simulations revealed that a dose of 2.5 mg/kg/12 h might lead to overexposure in most patients. A lower dose (2.5 mg/kg/24 h) was able to achieve trough BNZ plasma concentrations within the accepted therapeutic range of 3 to 6 mg/liter. In summary, we developed a population PK model for BNZ in adults with chronic Chagas disease. Dosing simulations showed that a BNZ dose of 2.5 mg/kg/24 h will adequately keep BNZ trough plasma concentrations within the recommended target range for the majority of patients. (This study has been registered at EudraCT under number 2011

  3. Concordance of Epileptic Networks Associated with Epileptic Spikes Measured by High-Density EEG and Fast fMRI

    PubMed Central

    Jäger, Vera; Dümpelmann, Matthias; LeVan, Pierre; Ramantani, Georgia; Mader, Irina; Schulze-Bonhage, Andreas; Jacobs, Julia

    2015-01-01

    Objective The present study aims to investigate whether a newly developed fast fMRI called MREG (magnetic resonance encephalography) measures metabolic changes related to interictal epileptic discharges (IED). For this purpose BOLD changes are correlated with the IED distribution and variability. Methods Patients with focal epilepsy underwent EEG-MREG using a 64 channel cap. IED voltage maps were generated using 32 and 64 channels and compared regarding their correspondence to the BOLD response. The extents of IEDs (defined as number of channels with >50% of maximum IED negativity) were correlated with the extents of positive and negative BOLD responses. Differences in inter-spike variability were investigated between interictal epileptic discharges (IED) sets with and without concordant positive or negative BOLD responses. Results 17 patients showed 32 separate IED types. In 50% of IED types the BOLD changes could be confirmed by another independent imaging method. The IED extent significantly correlated with the positive BOLD extent (p = 0.04). In 6 patients the 64-channel EEG voltage maps better reflected the positive or negative BOLD response than the 32-channel EEG; in all others no difference was seen. Inter-spike variability was significantly lower in IED sets with than without concordant positive or negative BOLD responses (with p = 0.04). Significance Higher density EEG and fast fMRI seem to improve the value of EEG-fMRI in epilepsy. The correlation of positive BOLD and IED extent could suggest that widespread BOLD responses reflect the IED network. Inter-spike variability influences the likelihood to find IED concordant positive or negative BOLD responses, which is why single IED analysis may be promising. PMID:26496480

  4. Reducing the Cost of the Diagnostic Odyssey in Early Onset Epileptic Encephalopathies

    PubMed Central

    Mansilla, M. Adela; Campbell, Colleen A.

    2016-01-01

    Whole exome sequencing (WES) has revolutionized the way we think about and diagnose epileptic encephalopathies. Multiple recent review articles discuss the benefits of WES and suggest various algorithms to follow for determining the etiology of epileptic encephalopathies. Incorporation of WES in these algorithms is leading to the discovery of new genetic diagnoses of early onset epileptic encephalopathies (EOEEs) at a rapid rate; however, WES is not yet a universally utilized diagnostic tool. Clinical WES may be underutilized due to provider discomfort in ordering the test or perceived costliness. At our hospital WES is not routinely performed for patients with EOEE due to limited insurance reimbursement. In fact for any patient with noncommercial insurance (Medicaid) the institution does not allow sending out WES as this is not “established”/“proven to be highly useful and cost effective”/“approved test” in patients with epilepsy. Recently, we performed WES on four patients from three families and identified novel mutations in known epilepsy genes in all four cases. These patients had State Medicaid as their insurance carrier and were followed up for several years for EOEE while being worked up using the traditional/approved testing methods. Following a recently proposed diagnostic pathway, we analyzed the cost savings (US dollars) that could be accrued if WES was performed earlier in the diagnostic odyssey. This is the first publication that addresses the dollar cost of traditional testing in EOEE as performed in these four cases versus WES and the potential cost savings. PMID:27243033

  5. Epileptic Activity Increases Cerebral Amino Acid Transport Assessed by 18F-Fluoroethyl-l-Tyrosine Amino Acid PET: A Potential Brain Tumor Mimic.

    PubMed

    Hutterer, Markus; Ebner, Yvonne; Riemenschneider, Markus J; Willuweit, Antje; McCoy, Mark; Egger, Barbara; Schröder, Michael; Wendl, Christina; Hellwig, Dirk; Grosse, Jirka; Menhart, Karin; Proescholdt, Martin; Fritsch, Brita; Urbach, Horst; Stockhammer, Guenther; Roelcke, Ulrich; Galldiks, Norbert; Meyer, Philipp T; Langen, Karl-Josef; Hau, Peter; Trinka, Eugen

    2017-01-01

    O-(2-(18)F-fluoroethyl)-l-tyrosine ((18)F-FET) PET is a well-established method increasingly used for diagnosis, treatment planning, and monitoring in gliomas. Epileptic activity, frequently occurring in glioma patients, can influence MRI findings. Whether seizures also affect (18)F-FET PET imaging is currently unknown. The aim of this retrospective analysis was to investigate the brain amino acid metabolism during epileptic seizures by (18)F-FET PET and to elucidate the pathophysiologic background.

  6. Relationship between perceived sleep and polysomnography in older adult patients

    PubMed Central

    dos Santos Silva, Mayra; Bazzana, Caroline Moreira; de Souza, Altay Lino; Ramos, Luiz Roberto; Tufik, Sergio; Lucchesi, Lígia M.; Lopes, Guiomar Silva

    2015-01-01

    Background and aims Aging is a multifactorial process that elicits changes in the duration and quality of sleep. Polysomnography is considered to be the standard examination for the analysis of sleep and consists of the simultaneous recording of selected physiological variables during sleep. Objective The objective of this study was to use polysomnography to compare sleep reported by senior citizens. Methods We selected 40 patients, both male and female, with ages ranging from 64 to 89 years from the Center for the Study of Aging at the Federal University of São Paulo. Patients answered questions about sleep on the Comprehensive Geriatric Assessment and underwent polysomnography. Results The results were compared, and agreement between perceived sleep and polysomnography was found in several areas. There was an association between difficulty sleeping and sleep onset latency (p=0.015), waking up at night with sleep onset latency (p=0.005), total sleep time with daytime sleepiness (0.005) and snoring (0.027), sleep efficiency with sleepiness (0.004), snoring (0.033) and pause in breathing (p=0.024), awakenings with snoring (p=0.012) and sleep apnea with pauses in breathing (p=0.001). Conclusion These results suggest that the older adult population have a good perception of their sleep. The questionnaires aimed at this population should be used as an alternative to polysomnography. PMID:26483948

  7. Metabolic aspects of adult patients with nonalcoholic fatty liver disease

    PubMed Central

    Abenavoli, Ludovico; Milic, Natasa; Di Renzo, Laura; Preveden, Tomislav; Medić-Stojanoska, Milica; De Lorenzo, Antonino

    2016-01-01

    Nonalcoholic fatty liver disease (NAFLD) is a major cause of chronic liver disease and it encompasses a spectrum from simple steatosis to steatohepatitis, fibrosis, or cirrhosis. The mechanisms involved in the occurrence of NAFLD and its progression are probably due to a metabolic profile expressed within the context of a genetic predisposition and is associated with a higher energy intake. The metabolic syndrome (MS) is a cluster of metabolic alterations associated with an increased risk for the development of cardiovascular diseases and diabetes. NAFLD patients have more than one feature of the MS, and now they are considered the hepatic components of the MS. Several scientific advances in understanding the association between NAFLD and MS have identified insulin resistance (IR) as the key aspect in the pathophysiology of both diseases. In the multi parallel hits theory of NAFLD pathogenesis, IR was described to be central in the predisposition of hepatocytes to be susceptible to other multiple pathogenetic factors. The recent knowledge gained from these advances can be applied clinically in the prevention and management of NAFLD and its associated metabolic changes. The present review analyses the current literature and highlights the new evidence on the metabolic aspects in the adult patients with NAFLD. PMID:27610012

  8. Patient knowledge and pulmonary medication adherence in adult patients with cystic fibrosis

    PubMed Central

    Lin, Ann Hsu-An; Kendrick, Jennifer G; Wilcox, Pearce G; Quon, Bradley S

    2017-01-01

    Background and objectives Patient knowledge of lung function (ie, forced expiratory volume in 1 s [FEV1]% predicted) and the intended benefits of their prescribed pulmonary medications might play an important role in medication adherence, but this relationship has not been examined previously in patients with cystic fibrosis (CF). Methods All patients diagnosed with CF and without prior lung transplantation were invited to complete knowledge and self-reported medication adherence questionnaires during routine outpatient visits to the Adult CF Clinic, St Paul’s Hospital, Vancouver, Canada from June 2013 to August 2014. Results A total of 142 out of 167 (85%) consecutive adults attending CF clinic completed patient knowledge and medication adherence survey questionnaires. Sixty-four percent of the patients recalled their last FEV1% predicted value within 5%, and 70% knew the intended benefits of all their prescribed medications. Self-reported adherence rates were highest for inhaled antibiotics (81%), azithromycin (87%), and dornase alpha (76%) and lowest for hypertonic saline (47%). Individuals who knew their FEV1% predicted value within 5% were more likely to self-report adherence to dornase alpha (84% vs 62%, P=0.06) and inhaled antibiotics (88% vs 64%, P=0.06) compared to those who did not, but these associations were not statistically significant. There were no significant associations observed between patient knowledge of intended medication benefits and self-reported medication adherence. Conclusion Contrary to our hypothesis, disease- and treatment-related knowledge was not associated with self-reported medication adherence. This suggests other barriers to medication adherence should be targeted in future studies aiming to improve medication adherence in adults with CF.

  9. [Non-epileptic paroxysmal sleep disorders].

    PubMed

    Malagón-Valdez, Jorge

    2013-09-06

    Non-epileptic paroxysmal disorders during sleep are a great challenge for the clinician. It is important to know the various clinical manifestations for appropriate differential diagnosis, since alterations in sleep, mostly motor, are part of these disorders. Our paper describes the normal sleep stages and electroencephalographic characteristics and polysomnography basic data. The confusions especially with nocturnal frontal lobe epilepsy are frequent and cause unnecessary drugs administered, the emotional burden of the parents or caretakers, which is the diagnosis of epilepsy. We discuss the possible causes of diagnostic errors.

  10. [Some aspects of the orthodontic-prosthetic approach for adult patients. A case report].

    PubMed

    Fábián, G; Gáspár, J; Fábián, T K

    2000-08-01

    Authors present a case report of an adult patient treated with the combination of orthodontic and prosthetic treatment methods. The importance of periodontal and psychological management of such patients is pointed out.

  11. Antioxidants as a Preventive Treatment for Epileptic Process: A Review of the Current Status

    PubMed Central

    Martinc, Boštjan; Grabnar, Iztok; Vovk, Tomaž

    2014-01-01

    Epilepsy is known as one of the most frequent neurological diseases, characterized by an enduring predisposition to generate epileptic seizures. Oxidative stress is believed to directly participate in pathways leading to neurodegeneration, which serves as the most important propagating factor, leading to the epileptic condition and cognitive decline. Moreover, there is also a growing body of evidence showing the disturbance of antioxidant system balance and consequently increased production of reactive species in patients with epilepsy. A meta-analysis, conducted in the present review confirms an association between epilepsy and increased lipid peroxidation. Furthermore, it was also shown that some of the antiepileptic drugs could potentially be responsible for additionally increased lipid peroxidation. Therefore, it is reasonable to propose that during the epileptic process neuroprotective treatment with antioxidants could lead to less sever structural damages, reduced epileptogenesis and milder cognitive deterioration. To evaluate this hypothesis studies investigating the neuroprotective therapeutic potential of various antioxidants in cells, animal seizure models and patients with epilepsy have been reviewed. Numerous beneficial effects of antioxidants on oxidative stress markers and in some cases also neuroprotective effects were observed in animal seizure models. However, despite these encouraging results, till now only a few antioxidants have been further applied to patients with epilepsy as an add-on therapy. Based on the several positive findings in animal models, a strong need for more carefully planned, randomized, double-blind, cross-over, placebo-controlled clinical trials for the evaluation of antioxidants efficacy in patients with epilepsy is warranted. PMID:25977679

  12. A comprehensive oral and dental management of an epileptic and intellectually deteriorated adolescent

    PubMed Central

    Joshi, Sourabh Ramesh; Pendyala, Gowri Swaminatham; Saraf, Veena; Choudhari, Shantanu; Mopagar, Viddyasagar

    2013-01-01

    Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. PMID:24130597

  13. A comprehensive oral and dental management of an epileptic and intellectually deteriorated adolescent.

    PubMed

    Joshi, Sourabh Ramesh; Pendyala, Gowri Swaminatham; Saraf, Veena; Choudhari, Shantanu; Mopagar, Viddyasagar

    2013-07-01

    Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office.

  14. Rasch Measurement in the Assessment of Growth Hormone Deficiency in Adult Patients.

    ERIC Educational Resources Information Center

    Prieto, Luis; Roset, Montse; Badia, Xavier

    2001-01-01

    Tested the metric properties of a Spanish version of the Assessment of Growth Hormone Deficiency in Adults (AGHDA) questionnaire through Rasch analysis with a sample of 356 adult patients in Spain. Results suggest that the Spanish AGHDA could be a useful complement of the clinical evaluation of growth hormone deficiency patients at group and…

  15. Warming up Improves Speech Production in Patients with Adult Onset Myotonic Dystrophy

    ERIC Educational Resources Information Center

    de Swart, B.J.M.; van Engelen, B.G.M.; Maassen, B.A.M.

    2007-01-01

    This investigation was conducted to study whether warming up decreases myotonia (muscle stiffness) during speech production or causes adverse effects due to fatigue or exhaustion caused by intensive speech activity in patients with adult onset myotonic dystrophy. Thirty patients with adult onset myotonic dystrophy (MD) and ten healthy controls…

  16. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

    PubMed

    Xi, Zhiqin; Deng, Wanni; Wang, Liang; Xiao, Fei; Li, Jie; Wang, Zhihua; Wang, Xin; Mi, Xiujuan; Wang, Na; Wang, Xuefeng

    2015-11-01

    Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

  17. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.

    1998-04-28

    Methods and apparatus are disclosed for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence. 76 figs.

  18. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1998-01-01

    Methods and apparatus for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence.

  19. Epileptic spasms in paediatric post-traumatic epilepsy at a tertiary referral centre.

    PubMed

    Park, Jun T; Chugani, Harry T

    2017-03-17

    To recognize epileptic spasms (ES) as a seizure type after traumatic brain injury (TBI), accidental or non-accidental, in infants and children. In the process, we aim to gain some insight into the mechanisms of epileptogenesis in ES. A retrospective electronic chart review was performed at the Children's Hospital of Michigan from 2002 to 2012. Electronic charts of 321 patients were reviewed for evidence of post-traumatic epilepsy. Various clinical variables were collected including age at TBI, mechanism of trauma, severity of brain injury, electroencephalography/neuroimaging data, and seizure semiology. Six (12.8%) of the 47 patients diagnosed with post-traumatic epilepsy (PTE) had ES. Epileptic spasms occurred between two months to two years after TBI. All patients with ES had multiple irritative zones, manifesting as multifocal epileptiform discharges, unilateral or bilateral. Cognitive delay and epileptic encephalopathy were seen in all six patients, five of whom were free of spasms after treatment with vigabatrin or adrenocorticotropic hormone. The risk of PTE is 47/321(14.6%) and the specific risk of ES after TBI is 6/321 (1.8%). The risk of ES appears to be high if the age at which severe TBI occurred was during infancy. Non-accidental head trauma is a risk factor of epileptic spasms. While posttraumatic epilepsy (not ES) may start 10 years after the head injury, ES starts within two years, according to our small cohort. The pathophysiology of ES is unknown, however, our data support a combination of previously proposed models in which the primary dysfunction is a focal or diffuse cortical abnormality, coupled with its abnormal interaction with the subcortical structures and brainstem at a critical maturation stage.

  20. Epileptic Seizure Detection and Warning Device

    SciTech Connect

    Elarton, J.K.; Koepsel, K.L.

    1999-06-21

    Flint Hills Scientific, L.L.C. (FHS) has invented what is believed to be the first real-time epileptic seizure detection and short-term prediction method in the world. They have demonstrated an IBM PC prototype with a multi-channel EEG monitoring configuration. This CRADA effort applied AlliedSignal FM and T hardware design, manufacturing miniaturization, and high quality manufacturing expertise in converting the prototype into a small, portable, self-contained, multi-channel EEG epileptic seizure detection and warning device. The purpose of this project was to design and build a proof-of-concept miniaturized prototype of the FHS-developed PC-based prototype. The resultant DSP prototype, measuring 4'' x 6'' x 2'', seizure detection performance compared favorably with the FHS PC prototype, thus validating the DSP design goals. The very successful completion of this project provided valuable engineering information for FHS for future prototype commercialization as well as providing AS/FM and T engineers DSP design experience.

  1. Localized Tetanus in an Adult Patient: Case Report

    PubMed Central

    Gulamhussein, Mohamed Amirali; Li, Yueyang; Guha, Abhijit

    2016-01-01

    Introduction: Tetanus is a severe and potentially fatal infection caused by the bacterium Clostridium tetani. Of all the cases described in literature, generalized tetanus is by far the most common presentation, but it may also present as neonatal tetanus, cephalic tetanus, and localized tetanus, the latter two being much rarer. In this case report, we present the rare form of this disease, i.e., localized tetanus in an adult male with a history of minimal trauma as well as a late, unusual mode of presentation. Case Report: A 35-year-old Caucasian male presented with an acutely painful, swollen right thumb associated with a small superficial collection on the dorsal aspect of the base of the thumb. A formal wound exploration and washout were carried out in theater, however, at the time of tourniquet inflation, the right hand went into a carpopedal spasm and remained in that position until an infusion of a muscle relaxant was given. The findings were consistent with a case of localized tetanus. The patient was treated with human immunoglobulin and tetanus toxoid and safely discharged home 48 h later without any complications. Conclusion: This case report emphasizes the importance of the recognition of a rare form of this fatal infectious disease, which may present with prodromal symptoms before the generalized form shows its clinical effects. Moreover, the astute clinician should be aware of the variable presentations of this infectious disease, with early identification greatly reducing the associated risks of morbidity and mortality. PMID:28164065

  2. Antibiotic prophylaxis against infective endocarditis in adult and child patients

    PubMed Central

    Al-Fouzan, Afnan F.; Al-Shinaiber, Rafif M.; Al-Baijan, Refal S.; Al-Balawi, Mohammed M.

    2015-01-01

    Objectives: To evaluate dentists’ knowledge regarding the prevention of infective endocarditis in Saudi Arabia and their implementation of the 2007 American Heart Association guidelines. Methods: In this cross-sectional study, in March 2014, 801 dentists who practice in different regions of Saudi Arabia completed a questionnaire regarding the need for antibiotic prophylaxis for specific cardiac conditions and specific dental procedures, prophylaxis regimens in adults and children, and recommendations for patients on chronic antibiotics, and in dental emergencies. The data were analyzed using one-way analyses of variance (ANOVAs) and independent t-tests, and a p-value <0.05 was considered statistically significant. Results: The total knowledge level regarding antibiotic prophylaxis among all participants was 52.2%, with a significant difference between dentists who graduated before and after 2007. Comparing the level of knowledge among different dental specialists, surgeons and periodontists had the highest level of knowledge regarding the use of antibiotic prophylaxis. Amoxicillin was prescribed as the drug of choice by 63.9% of the participants. Conclusion: This study emphasized the need for continuous education and for formal inclusion of the guidelines in the students’ curriculum, as well as for strategic placement of the guidelines in locations throughout dental clinics. PMID:25935175

  3. Brain Graph Topology Changes Associated with Anti-Epileptic Drug Use.

    PubMed

    Haneef, Zulfi; Levin, Harvey S; Chiang, Sharon

    2015-06-01

    Neuroimaging studies of functional connectivity using graph theory have furthered our understanding of the network structure in temporal lobe epilepsy (TLE). Brain network effects of anti-epileptic drugs could influence such studies, but have not been systematically studied. Resting-state functional MRI was analyzed in 25 patients with TLE using graph theory analysis. Patients were divided into two groups based on anti-epileptic medication use: those taking carbamazepine/oxcarbazepine (CBZ/OXC) (n=9) and those not taking CBZ/OXC (n=16) as a part of their medication regimen. The following graph topology metrics were analyzed: global efficiency, betweenness centrality (BC), clustering coefficient, and small-world index. Multiple linear regression was used to examine the association of CBZ/OXC with graph topology. The two groups did not differ from each other based on epilepsy characteristics. Use of CBZ/OXC was associated with a lower BC. Longer epilepsy duration was also associated with a lower BC. These findings can inform graph theory-based studies in patients with TLE. The changes observed are discussed in relation to the anti-epileptic mechanism of action and adverse effects of CBZ/OXC.

  4. Mental health care Monitor Older adults (MEMO): monitoring patient characteristics and outcome in Dutch mental health services for older adults.

    PubMed

    Veerbeek, Marjolein; Oude Voshaar, Richard; Depla, Marja; Pot, Anne Margriet

    2013-06-01

    Information on which older adults attend mental health care and whether they profit from the care they receive is important for policy-makers. To assess this information in daily practice, the "Mental health care Monitor Older adults" (MEMO) was developed in the Netherlands. The aim of this paper is to describe MEMO and the older adults who attend outpatient mental health care regarding their predisposing and enabling characteristics and need for care. In MEMO all patients referred to the division of old age psychiatry of the participating mental health care organisations are assessed at baseline and monitored at 4, 8 and 12-month follow-up. Primary outcomes are mental and social functioning, consumer satisfaction, and type of treatment provided (MEMO Basic). Over the years, MEMO Basic is repeated. In each cycle, additional information on specific patient groups is added (e.g. mood disorders). Data collection is supported by a web-based system for clinicians, including direct feedback to monitor patients throughout treatment. First results at baseline showed that the majority of patients that entered the division of old age psychiatry was female (69%), had low education (83%), lived alone (53%), was depressed (42%) and had a comorbid condition (82%). It seemed that older immigrants were not sufficiently reached. The current study is the first in the Netherlands to evaluate patient characteristics and outcome in mental health care provided for older adults in day-to-day practice. If MEMO works out successfully, the method should be extended to other target groups.

  5. Synaptic vesicle protein2A decreases in amygdaloid-kindling pharmcoresistant epileptic rats.

    PubMed

    Shi, Jing; Zhou, Feng; Wang, Li-kun; Wu, Guo-feng

    2015-10-01

    Synaptic vesicle protein 2A (SV2A) involvement has been reported in the animal models of epilepsy and in human intractable epilepsy. The difference between pharmacosensitive epilepsy and pharmacoresistant epilepsy remains poorly understood. The present study aimed to observe the hippocampus SV2A protein expression in amygdale-kindling pharmacoresistant epileptic rats. The pharmacosensitive epileptic rats served as control. Amygdaloid-kindling model of epilepsy was established in 100 healthy adult male Sprague-Dawley rats. The kindled rat model of epilepsy was used to select pharmacoresistance by testing their seizure response to phenytoin and phenobarbital. The selected pharmacoresistant rats were assigned to a pharmacoresistant epileptic group (PRE group). Another 12 pharmacosensitive epileptic rats (PSE group) served as control. Immunohistochemistry, real-time PCR and Western blotting were used to determine SV2A expression in the hippocampus tissue samples from both the PRE and the PSE rats. Immunohistochemistry staining showed that SV2A was mainly accumulated in the cytoplasm of the neurons, as well as along their dendrites throughout all subfields of the hippocampus. Immunoreactive staining level of SV2A-positive cells was 0.483 ± 0.304 in the PRE group and 0.866 ± 0.090 in the PSE group (P < 0.05). Real-time PCR analysis demonstrated that 2(-ΔΔCt) value of SV2A mRNA was 0.30 ± 0.43 in the PRE group and 0.76 ± 0.18 in the PSE group (P < 0.05). Western blotting analysis obtained the similar findings (0.27 ± 0.21 versus 1.12 ± 0.21, P < 0.05). PRE rats displayed a significant decrease of SV2A in the brain. SV2A may be associated with the pathogenesis of intractable epilepsy of the amygdaloid-kindling rats.

  6. Age-Dependency of Location of Epileptic Foci in "Continuous Spike-and-Waves during Sleep": A Parallel to the Posterior-Anterior Trajectory of Slow Wave Activity.

    PubMed

    Heinzle, Bigna Katrin Bölsterli; Bast, Thomas; Critelli, Hanne; Huber, Reto; Schmitt, Bernhard

    2017-02-01

    Background Epileptic encephalopathy with continuous spike-and-waves during sleep (CSWS) occurs during childhood and is characterized by an activation of spike wave complexes during slow wave sleep. The location of epileptic foci is variable, as is etiology. A relationship between the epileptic focus and age has been shown in various focal epilepsies following a posterior-anterior trajectory, and a link to brain maturation has been proposed.We hypothesize that in CSWS, maximal spike wave activity, corresponding to the epileptic focus, is related to age and shows a posterior-anterior evolution. Findings In a retrospective cross-sectional study on CSWS (22 EEGs of 22 patients aged 3.1-13.5 years), the location of the epileptic focus is related to age and follows a posterior-anterior course. Younger patients are more likely to have posterior foci than older ones. Conclusions We propose that the posterior-anterior trajectory of maximal spike waves in CSWS might reflect maturational changes of maximal expression of sleep slow waves, which follow a comparable course. Epileptic spike waves, that is, "hyper-synchronized slow waves" may occur at the place where the highest and therefore most synchronized slow waves meet brain tissue with an increased susceptibility to synchronization.

  7. Personality Traits and Common Psychiatric Conditions in Adult Patients with Acne Vulgaris

    PubMed Central

    Çölgeçen, Emine

    2015-01-01

    Background We believe that instances of neuroticism and common psychiatric disorders are higher in adults with acne vulgaris than the normal population. Objective Instances of acne in adults have been increasing in frequency in recent years. The aim of this study was to investigate personality traits and common psychiatric conditions in patients with adult acne vulgaris. Methods Patients who visited the dermatology outpatient clinic at Bozok University Medical School with a complaint of acne and who volunteered for this study were included. The Symptom Checklist 90-Revised (SCL 90-R) Global Symptom Index (GSI), somatization, depression, and anxiety subscales and the Eysenck Personality Questionnaire-Revised Short Form (EPQ-RSF) were administered to 40 patients who fulfilled the inclusion criteria before treatment. The results were compared with those of a control group. Results Of the 40 patients included in this study, 34 were female and 6 were male. The GSI and the somatization, depression, and anxiety subscales of the SCL 90-R were evaluated. Patients with adult acne had statistically significant higher scores than the control group on all of these subscales. In addition, patients with adult acne had statistically significantly higher scores on the neuroticism subscale of the EPQ-RSF. Conclusion Our results show that common psychiatric conditions are frequent in adult patients with acne. More importantly, neurotic personality characteristics are observed more frequently in these patients. These findings suggest that acne in adults is a disorder that has both medical and psychosomatic characteristics and requires a multi-disciplinary approach. PMID:25673931

  8. Distribution entropy analysis of epileptic EEG signals.

    PubMed

    Li, Peng; Yan, Chang; Karmakar, Chandan; Liu, Changchun

    2015-01-01

    It is an open-ended challenge to accurately detect the epileptic seizures through electroencephalogram (EEG) signals. Recently published studies have made elaborate attempts to distinguish between the normal and epileptic EEG signals by advanced nonlinear entropy methods, such as the approximate entropy, sample entropy, fuzzy entropy, and permutation entropy, etc. Most recently, a novel distribution entropy (DistEn) has been reported to have superior performance compared with the conventional entropy methods for especially short length data. We thus aimed, in the present study, to show the potential of DistEn in the analysis of epileptic EEG signals. The publicly-accessible Bonn database which consisted of normal, interictal, and ictal EEG signals was used in this study. Three different measurement protocols were set for better understanding the performance of DistEn, which are: i) calculate the DistEn of a specific EEG signal using the full recording; ii) calculate the DistEn by averaging the results for all its possible non-overlapped 5 second segments; and iii) calculate it by averaging the DistEn values for all the possible non-overlapped segments of 1 second length, respectively. Results for all three protocols indicated a statistically significantly increased DistEn for the ictal class compared with both the normal and interictal classes. Besides, the results obtained under the third protocol, which only used very short segments (1 s) of EEG recordings showed a significantly (p <; 0.05) increased DistEn for the interictal class in compassion with the normal class, whereas both analyses using relatively long EEG signals failed in tracking this difference between them, which may be due to a nonstationarity effect on entropy algorithm. The capability of discriminating between the normal and interictal EEG signals is of great clinical relevance since it may provide helpful tools for the detection of a seizure onset. Therefore, our study suggests that the Dist

  9. Comparison of five directed graph measures for identification of leading interictal epileptic regions

    PubMed Central

    Amini, Ladan; Jutten, Christian; Achard, Sophie; David, Olivier; Kahane, Philippe; Vercueil, Laurent; Minotti, Lorella; Hossein-Zadeh, Gh. Ali; Soltanian-Zadeh, Hamid

    2010-01-01

    Directed graphs (digraphs) derived from interictal periods of intracerebral EEG (iEEG) recordings can be used to estimate the leading interictal epileptic regions for presurgery evaluations. For this purpose, quantification of the emittance contribution of each node to the rest of digraph is important. However, the usual digraph measures are not very well suited for this quantification. Here we compare the efficiency of recently introduced local information measure LI and a new measure called total global efficiency with classical measures like global efficiency, local efficiency and node degree. For evaluation, the estimated leading interictal epileptic regions based on five measures are compared with seizure onset zones obtained by visual inspection of epileptologists for five patients. The comparison revealed the superior performance of LI measure. We showed efficiency of different digraph measures for the purpose of source and sink node identification. PMID:20952817

  10. Sleep-related epileptic behaviors and non-REM-related parasomnias: Insights from stereo-EEG.

    PubMed

    Gibbs, Steve A; Proserpio, Paola; Terzaghi, Michele; Pigorini, Andrea; Sarasso, Simone; Lo Russo, Giorgio; Tassi, Laura; Nobili, Lino

    2016-02-01

    During the last decade, many clinical and pathophysiological aspects of sleep-related epileptic and non-epileptic paroxysmal behaviors have been clarified. Advances have been achieved in part through the use of intracerebral recording methods such as stereo-electroencephalography (S-EEG), which has allowed a unique "in vivo" neurophysiological insight into focal epilepsy. Using S-EEG, the local features of physiological and pathological EEG activity in different cortical and subcortical structures have been better defined during the entire sleep-wake spectrum. For example, S-EEG has contributed to clarify the semiology of sleep-related seizures as well as highlight the specific epileptogenic networks involved during ictal activity. Moreover, intracerebral EEG recordings derived from patients with epilepsy have been valuable to study sleep physiology and specific sleep disorders. The occasional co-occurrence of NREM-related parasomnias in epileptic patients undergoing S-EEG investigation has permitted the recordings of such events, highlighting the presence of local electrophysiological dissociated states and clarifying the underlying pathophysiological substrate of such NREM sleep disorders. Based on these recent advances, the authors review and summarize the current and relevant S-EEG literature on sleep-related hypermotor epilepsies and NREM-related parasomnias. Finally, novel data and future research hypothesis will be discussed.

  11. Surgical Treatment for Refractory Epileptic Spasms: The Detroit Series

    PubMed Central

    Chugani, Harry T; Ilyas, Mohammed; Kumar, Ajay; Juhász, Csaba; Kupsky, William J; Sood, Sandeep; Asano, Eishi

    2015-01-01

    Objective We reviewed our experience of surgery for epileptic spasms (ES) with or without history of infantile spasms. Methods Data were reviewed from 65 (33 males) ES patients who underwent surgery between 1993–2014; palliative cases were excluded. Results Mean age at surgery was 5.1 (range: 0.2–19) years, with mean post-surgical follow-up of 45.3 (6–120) months. Mean number of anticonvulsants used pre-operatively was 4.2 (2–8) which decreased to 1.2 (0–4) post-operatively (p<0.0001). Total hemispherectomy was the most commonly performed surgery (n=20), followed by subtotal hemispherectomy (n=17), multilobar resection (n=13), lobectomy (n=7), tuberectomy (n=6) and lobectomy+tuberectomy (n=2), with ILAE class-I outcome in 20, 10, 7, 6, 3 and 0 patients, respectively (total=46/65 (71%); 22 off medication). Shorter duration of epilepsy (p=0.022) and presence of MRI lesion (p=0.026) were independently associated with class-I outcome. Of 34 patients operated <3 years after seizure onset, 30 (88%) achieved class-I outcome. 37/47 patients with lesional MRI (79%) had class-I outcome, whereas 9/18 with normal MRI (50%) had class-I outcome. PET scan was abnormal in almost all patients [61/63 (97%) with lateralizing/localizing findings in 56/61 (92%) patients, thus helping in surgical decision-making and guiding subdural grid placements, particularly in patients with non-lesional MRI. Fifteen had post-operative complications, mostly minor. Significance Curative epilepsy surgery in ES patients, with or without history of infantile spasms, is best accomplished at an early age and in those with lesional abnormalities on MRI with EEG concordance. Good outcomes can be achieved even when there is no MRI lesion but positive PET localization. PMID:26522016

  12. Epileptic EEG: a comprehensive study of nonlinear behavior.

    PubMed

    Daneshyari, Moayed; Kamkar, L Lily; Daneshyari, Matin

    2010-01-01

    In this study, the nonlinear properties of the electroencephalograph (EEG) signals are investigated by comparing two sets of EEG, one set for epileptic and another set for healthy brain activities. Adopting measures of nonlinear theory such as Lyapunov exponent, correlation dimension, Hurst exponent, fractal dimension, and Kolmogorov entropy, the chaotic behavior of these two sets is quantitatively computed. The statistics for the two groups of all measures demonstrate the differences between the normal healthy group and epileptic one. The statistical results along with phase-space diagram verify that brain under epileptic seizures possess limited trajectory in the state space than in healthy normal state, consequently behaves less chaotically compared to normal condition.

  13. Unsupervised EEG analysis for automated epileptic seizure detection

    NASA Astrophysics Data System (ADS)

    Birjandtalab, Javad; Pouyan, Maziyar Baran; Nourani, Mehrdad

    2016-07-01

    Epilepsy is a neurological disorder which can, if not controlled, potentially cause unexpected death. It is extremely crucial to have accurate automatic pattern recognition and data mining techniques to detect the onset of seizures and inform care-givers to help the patients. EEG signals are the preferred biosignals for diagnosis of epileptic patients. Most of the existing pattern recognition techniques used in EEG analysis leverage the notion of supervised machine learning algorithms. Since seizure data are heavily under-represented, such techniques are not always practical particularly when the labeled data is not sufficiently available or when disease progression is rapid and the corresponding EEG footprint pattern will not be robust. Furthermore, EEG pattern change is highly individual dependent and requires experienced specialists to annotate the seizure and non-seizure events. In this work, we present an unsupervised technique to discriminate seizures and non-seizures events. We employ power spectral density of EEG signals in different frequency bands that are informative features to accurately cluster seizure and non-seizure events. The experimental results tried so far indicate achieving more than 90% accuracy in clustering seizure and non-seizure events without having any prior knowledge on patient's history.

  14. De novo mutations in the classic epileptic encephalopathies

    PubMed Central

    2013-01-01

    Epileptic encephalopathies (EE) are a devastating group of severe childhood epilepsy disorders for which the cause is often unknown. Here, we report a screen for de novo mutations in patients with two classical EE: infantile spasms (IS, n=149) and Lennox-Gastaut Syndrome (LGS, n=115). We sequenced the exomes of 264 probands, and their parents, and confirmed 329 de novo mutations. A likelihood analysis showed a significant excess of de novo mutations in the ~4,000 genes that are the most intolerant to functional genetic variation in the human population (p=2.9 × 10−3). Among these are GABRB3 with de novo mutations in four patients and ALG13 with the same de novo mutation in two patients; both genes show clear statistical evidence of association. Given the relevant site-specific mutation rates, the probabilities of these outcomes occurring by chance are p=4.1 × 10−10 and p=7.8 × 10−12, respectively. Other genes with de novo mutations in this cohort include: CACNA1A, CHD2, FLNA, GABRA1, GRIN1, GRIN2B, HDAC4, HNRNPU, IQSEC2, MTOR, and NEDD4L. Finally, we show that the de novo mutations observed are enriched in specific gene sets including genes regulated by the Fragile X protein (p<10−8), as was reported for autism spectrum disorders (ASD)1. PMID:23934111

  15. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, LM

    2001-02-05

    Nicolet Biomedical Inc. (NBI) is collaborating with Oak Ridge National Laboratory (ORNL) under a Cooperative Research and Development Agreement (CRADA) to convert ORNL.s patented technology for forewarning of epileptic seizures to a clinical prototype. This technical report describes the highlights of the first year.s effort. The software requirements for the clinical device were specified from which the hardware specifications were obtained. ORNL's research-class FORTRAN was converted to run under a graphical user interface (GUI) that was custom-built for this application by NBI. The resulting software package was cloned to desktop computers that are being tested in five different clinical sites. Two hundred electroencephalogram (EEG) datasets from those clinical sites were provided to ORNL for detailed analysis and improvement of the forewarning methodology. Effort under this CRADA is continuing into the second year as planned.

  16. Occupational Outcome in Adult ADHD: Impact of Symptom Profile, Comorbid Psychiatric Problems, and Treatment--A Cross-Sectional Study of 414 Clinically Diagnosed Adult ADHD Patients

    ERIC Educational Resources Information Center

    Halmoy, Anne; Fasmer, Ole Bernt; Gillberg, Christopher; Haavik, Jan

    2009-01-01

    Objective: To determine the effects of symptom profile, comorbid psychiatric problems, and treatment on occupational outcome in adult ADHD patients. Method: Adult ADHD patients (N = 414) responded to questionnaires rating past and present symptoms of ADHD, comorbid conditions, treatment history, and work status. Results: Of the patients, 24%…

  17. Transient epileptic amnesia in dementia: a treatable unrecognized cause of episodic amnestic wandering.

    PubMed

    Rabinowicz, A L; Starkstein, S E; Leiguarda, R C; Coleman, A E

    2000-01-01

    The authors present two patients with dementia who displayed recurrent transient episodes of amnestic wandering and disorientation characterized by getting lost in familiar environments. At other times these patients did not wander or become disoriented. The inability to recall any information during these episodes, and the marked difference of the episodic amnesia exacerbations from the progressive amnesia characteristic of Alzheimer disease seen in these patients led to their evaluation. These clinical episodes and the bilateral interictal epileptiform electroencephalographic changes found in both patients led to the diagnosis of transient epileptic amnesia, a syndrome that can be diagnostically elusive. These transient amnestic wandering events subsided after treatment with antiepileptic drugs in both patients. The authors suggest that transient wandering of this type may be caused by ictal events or postictal confusional states. This report emphasizes the importance of recognizing transient epileptic amnesia as an easily treatable cause of episodic behavioral abnormalities responsive to antiepileptic therapy, especially in those patients who have a markedly inconsistent pattern of wandering, disorientation in familiar settings, and amnesia exacerbation manifested by no recall of the emotional stress of getting lost or of any information during these episodes. Recognition of this type of behavioral disruption and its proper treatment can lead to improved quality of life for these patients, maintain these patients in their homes and out of chronic care institutions longer, and facilitate the community's and caretaker's interactive roles with the patient.

  18. Symptoms and socio-economic impact of ependymoma on adult patients: results of the Adult Ependymoma Outcomes Project 2.

    PubMed

    Walbert, Tobias; Mendoza, Tito R; Vera-Bolaños, Elizabeth; Acquaye, Alvina; Gilbert, Mark R; Armstrong, Terri S

    2015-01-01

    Ependymoma is a rare central nervous system tumor of adults. Reports of patient symptoms, interference patterns and costs encountered by patients and families are limited. Adult ependymoma patients completed the online Ependymoma Outcomes Questionnaire II. The survey assesses disease and functional status as well as socio-economic factors. Descriptive statistics were used to report disease characteristics as well as economic and social impact. Independent samples t test was used to test if differences exist between high- and low-income groups in terms of symptom severity. Correlations were calculated between symptoms and cost estimates. 86 international patients participated (male = 50 %). The economic analysis focused on 78 respondents from the US. 48 % were employed and 55 % earned ≥$60,000. Tumors were located in the brain (44 %), spine (44 %) or both (12 %). Spine patients compared to brain patients reported significantly worse pain (4.4 versus 2.2, p < .003), numbness (5.3 versus 2.2, p < .001), fatigue (5.1 versus 3.6, p < .03), changes in bowel patterns (3.8 versus 1.4, p < .003) and weakness (4.2 versus 2.1, p < .006). Brain patients compared with spine patients had increased lack of appetite (.4 versus 2, p < .014). Patients with lower income (≤$59,999) had more problems concentrating (p < .024) and worse cognitive module severity scores (p < .024). Estimated average monthly out-of-pocket spending was $168 for medical co-pays and $59 for prescription medication. Patients with ependymoma are highly affected by their symptoms. Spinal patients report higher severity of symptoms. Patients in the lower income group report significantly higher severity of cognitive symptoms independent of disease site.

  19. Neurogenesis in a young dog with epileptic seizures.

    PubMed

    Borschensky, C M; Woolley, J S; Kipar, A; Herden, C

    2012-09-01

    Epileptic seizures can lead to various reactions in the brain, ranging from neuronal necrosis and glial cell activation to focal structural disorganization. Furthermore, increased hippocampal neurogenesis has been documented in rodent models of acute convulsions. This is a report of hippocampal neurogenesis in a dog with spontaneous epileptic seizures. A 16-week-old epileptic German Shepherd Dog had marked neuronal cell proliferation (up to 5 mitotic figures per high-power field and increased immunohistochemical expression of proliferative cell nuclear antigen) in the dentate gyrus accompanied by microglial and astroglial activation. Some granule cells expressed doublecortin, a marker of immature neurons; mitotically active cells expressed neuronal nuclear antigen. No mitotic figures were found in the brain of age-matched control dogs. Whether increased neurogenesis represents a general reaction pattern of young epileptic dogs should be investigated.

  20. Do energy drinks cause epileptic seizure and ischemic stroke?

    PubMed

    Dikici, Suber; Saritas, Ayhan; Besir, Fahri Halit; Tasci, Ahmet Hakan; Kandis, Hayati

    2013-01-01

    Energy drinks are popular among young individuals and marketed to college students, athletes, and active individuals between the ages of 21 and 35 years. We report a case that had ischemic stroke and epileptic seizure after intake of energy drink with alcohol. To the best of our knowledge, the following case is the first report of ischemic stroke after intake of energy drink. A previously healthy 37-year-old man was brought to the emergency department after a witnessed tonic-clonic seizure. According to his wife's testimony, just before loss of consciousness, the patient had been drinking 3 boxes of energy drinks (Redbull, Istanbul, Turkey, 250 mL) with vodka on an empty stomach. He did not have a history of seizures, head trauma, or family history of seizures or another disease. In cranial diffusion magnetic resonance imaging, there were hyperintense signal changes in bilateral occipital area (more pronounced in the left occipital lobe), right temporal lobe, frontal lobe, and posterior parietal lobe. All tests associated with possible etiologic causes of ischemic stroke in young patients were negative. Herein, we want to attract attention to adverse effect of energy drink usage.

  1. Focal autobiographical amnesia in association with transient epileptic amnesia.

    PubMed

    Manes, F; Hodges, J R; Graham, K S; Zeman, A

    2001-03-01

    Although problems with remembering significant events from the past (e.g. holidays, weddings, etc.) have been reported previously in patients with transient epileptic amnesia (TEA), to date there have been no detailed studies of autobiographical memory in patients with this disorder. To investigate this issue, a 68-year-old right-handed man (R.G.) who suffered from TEA and reported significant autobiographical memory problems was tested on a battery of neuropsychological tests of anterograde and remote memory. Tests of autobiographical memory revealed that R.G. was unable to evoke detailed autobiographical recollections from a substantial part of his life. By contrast, he performed well on tests of new learning and general knowledge and possessed good personal semantic information about his past. In summary, a distinct form of autobiographical amnesia, which is characterized by loss of experiential remembering of significant events, may be associated with TEA. It is proposed that the autobiographical memory deficit seen in the disorder may result from the progressive erasure of cortically based memory representations. This case adds to growing evidence for a dissociation between mechanisms subserving anterograde memory and those required to evoke remote episodic memories.

  2. Comprehensive presurgical functional MRI language evaluation in adult patients with epilepsy.

    PubMed

    Szaflarski, Jerzy P; Holland, Scott K; Jacola, Lisa M; Lindsell, Christopher; Privitera, Michael D; Szaflarski, Magdalena

    2008-01-01

    Functional magnetic resonance imaging (fMRI) has the potential to replace the intracarotid amobarbital procedure (IAP) in presurgical evaluation of patients with epilepsy. In this study, we compared fMRI verb generation (VG) and semantic decision/tone decision (SDTD) tasks and the IAP in their ability to localize language functions in patients with epilepsy undergoing presurgical evaluation. We enrolled 50 healthy controls to establish normal language activation patterns for VG and SDTD tasks at 3 or 4 T, and to design language regions of interest (ROIs) that were later applied to 38 patients with epilepsy (28 of 38 also underwent the IAP). We calculated laterality indices (LIs) for each task for each subject based on the ROIs, and we used general linear modeling to analyze the fMRI data. All healthy and epileptic subjects activated language areas with both fMRI tasks. We found significant correlations in language lateralization between the fMRI tasks (r=0.495, P<0.001) and between VG and IAP (r=0.652, P<0.001) and SDTD and IAP (r=0.735, P<0.001). The differences in LIs between SDTD and VG tasks were small and not affected by age, gender, epilepsy status, handedness, or performance. SDTD and VG tasks combined explained approximately 58.4% in the variability of the IAP/language. In the general linear modeling, only the SDTD task significantly contributed to the determination of language lateralization in patients with epilepsy undergoing presurgical evaluation. Results indicate a moderate convergent validity between both fMRI language tasks and between IAP and fMRI tasks. The results of this study indicate that either of these fMRI tasks can be used for language lateralization in patients with epilepsy undergoing presurgical evaluation, but that the SDTD task is likely to provide more information regarding language lateralization than the VG task.

  3. Determination of epileptic focus side in mesial temporal lobe epilepsy using long-term noninvasive fNIRS/EEG monitoring for presurgical evaluation

    PubMed Central

    Rizki, Edmi Edison; Uga, Minako; Dan, Ippeita; Dan, Haruka; Tsuzuki, Daisuke; Yokota, Hidenori; Oguro, Keiji; Watanabe, Eiju

    2015-01-01

    Abstract. Noninvasive localization of an epileptogenic zone is a fundamental step for presurgical evaluation of epileptic patients. Here, we applied long-term simultaneous functional near-infrared spectroscopy (fNIRS)/electroencephalogram (EEG) monitoring for focus diagnosis in patients with mesial temporal lobe epilepsy (MTLE). Six MTLE patients underwent long-term (8–16 h per day for 4 days) fNIRS/EEG monitoring for the occurrence of spontaneous seizures. Four spontaneous seizures were successfully recorded out of the six patients. To determine oxy-Hb amplitude, the period-average values of oxy-Hb across 20 s from the EEG- or clinically defined epileptic onset were calculated for both hemispheres from the simultaneously recorded fNIRS data. The average oxy-Hb values for the temporal lobe at the earlier EEG- or clinically defined epileptic onsets were greater for the epileptic side than for the contralateral side after EEG activity suppression, spike train, and clinical seizure in all four cases. The true laterality was determined based on the relief of seizures by selective amygdalo-hippocampectomy. Thus, oxy-Hb amplitude could be a reliable measure for determining the epileptic focus side. Long-term simultaneous fNIRS/EEG measurement serves as an effective tool for recording spontaneous seizures. Cerebral hemodynamic measurement by fNIRS would serve as a valuable supplementary noninvasive measurement method for presurgical evaluation of MTLE. PMID:26158007

  4. De novo loss- or gain-of-function mutations in KCNA2 cause epileptic encephalopathy.

    PubMed

    Syrbe, Steffen; Hedrich, Ulrike B S; Riesch, Erik; Djémié, Tania; Müller, Stephan; Møller, Rikke S; Maher, Bridget; Hernandez-Hernandez, Laura; Synofzik, Matthis; Caglayan, Hande S; Arslan, Mutluay; Serratosa, José M; Nothnagel, Michael; May, Patrick; Krause, Roland; Löffler, Heidrun; Detert, Katja; Dorn, Thomas; Vogt, Heinrich; Krämer, Günter; Schöls, Ludger; Mullis, Primus E; Linnankivi, Tarja; Lehesjoki, Anna-Elina; Sterbova, Katalin; Craiu, Dana C; Hoffman-Zacharska, Dorota; Korff, Christian M; Weber, Yvonne G; Steinlin, Maja; Gallati, Sabina; Bertsche, Astrid; Bernhard, Matthias K; Merkenschlager, Andreas; Kiess, Wieland; Gonzalez, Michael; Züchner, Stephan; Palotie, Aarno; Suls, Arvid; De Jonghe, Peter; Helbig, Ingo; Biskup, Saskia; Wolff, Markus; Maljevic, Snezana; Schüle, Rebecca; Sisodiya, Sanjay M; Weckhuysen, Sarah; Lerche, Holger; Lemke, Johannes R

    2015-04-01

    Epileptic encephalopathies are a phenotypically and genetically heterogeneous group of severe epilepsies accompanied by intellectual disability and other neurodevelopmental features. Using next-generation sequencing, we identified four different de novo mutations in KCNA2, encoding the potassium channel KV1.2, in six isolated patients with epileptic encephalopathy (one mutation recurred three times independently). Four individuals presented with febrile and multiple afebrile, often focal seizure types, multifocal epileptiform discharges strongly activated by sleep, mild to moderate intellectual disability, delayed speech development and sometimes ataxia. Functional studies of the two mutations associated with this phenotype showed almost complete loss of function with a dominant-negative effect. Two further individuals presented with a different and more severe epileptic encephalopathy phenotype. They carried mutations inducing a drastic gain-of-function effect leading to permanently open channels. These results establish KCNA2 as a new gene involved in human neurodevelopmental disorders through two different mechanisms, predicting either hyperexcitability or electrical silencing of KV1.2-expressing neurons.

  5. De novo loss- or gain-of-function mutations in KCNA2 cause epileptic encephalopathy

    PubMed Central

    Müller, Stephan; Møller, Rikke S.; Maher, Bridget; Hernandez-Hernandez, Laura; Synofzik, Matthis; Caglayan, Hande S.; Arslan, Mutluay; Serratosa, José M.; Nothnagel, Michael; May, Patrick; Krause, Roland; Löffler, Heidrun; Detert, Katja; Dorn, Thomas; Vogt, Heinrich; Krämer, Günter; Schöls, Ludger; Mullis, Primus E.; Linnankivi, Tarja; Lehesjoki, Anna-Elina; Sterbova, Katalin; Craiu, Dana C.; Hoffman-Zacharska, Dorota; Korff, Christian M.; Weber, Yvonne G.; Steinlin, Maja; Gallati, Sabina; Bertsche, Astrid; Bernhard, Matthias K.; Merkenschlager, Andreas; Kiess, Wieland; Gonzalez, Michael; Züchner, Stephan; Palotie, Aarno; Suls, Arvid; De Jonghe, Peter; Helbig, Ingo; Biskup, Saskia; Wolff, Markus; Maljevic, Snezana; Schüle, Rebecca; Sisodiya, Sanjay M.; Weckhuysen, Sarah; Lerche, Holger; Lemke, Johannes R.

    2015-01-01

    Epileptic encephalopathies are a phenotypically and genetically heterogeneous group of severe epilepsies accompanied by intellectual disability and other neurodevelopmental features1-6. Using next generation sequencing, we identified four different de novo mutations in KCNA2, encoding the potassium channel KV1.2, in six patients with epileptic encephalopathy (one mutation recurred three times independently). Four individuals presented with febrile and multiple afebrile, often focal seizure types, multifocal epileptiform discharges strongly activated by sleep, mild-moderate intellectual disability, delayed speech development and sometimes ataxia. Functional studies of the two mutations associated with this phenotype revealed an almost complete loss-of-function with a dominant-negative effect. Two further individuals presented with a different and more severe epileptic encephalopathy phenotype. They carried mutations inducing a drastic gain-of-function effect leading to permanently open channels. These results establish KCNA2 as a novel gene involved in human neurodevelopmental disorders by two different mechanisms, predicting either hyperexcitability or electrical silencing of KV1.2-expressing neurons. PMID:25751627

  6. Exploring the Epileptic Brain Network using Time-Variant Effective Connectivity and Graph Theory.

    PubMed

    Storti, Silvia; Boscolo Galazzo, Ilaria; Khan, Sehresh; Manganotti, Paolo; Menegaz, Gloria

    2016-09-09

    The application of time-varying measures of causality between source time series can be very informative to elucidate the direction of communication among the regions of an epileptic brain. The aim of the study was to identify the dynamic patterns of epileptic networks in focal epilepsy by applying multivariate adaptive directed transfer function (ADTF) analysis and graph-theory to high-density electroencephalographic (hdEEG) recordings. The cortical network was modeled after source reconstruction and topology modulations were detected during interictal spikes. First a distributed linear inverse solution, constrained to the individual grey matter, was applied to the averaged spikes and the mean source activity over 112 regions, as identified by the Harvard-Oxford Atlas, was calculated. Then, ADTF, a dynamic measure of causality, was used to quantify the connectivity strength between pairs of regions acting as nodes in the graph, and the measure of node centrality was derived. The proposed analysis was effective in detecting the focal regions as well as in characterizing the dynamics of the spike propagation, providing evidence of the fact that node centrality is a reliable feature for the identification of the epileptogenic zones. Validation was performed by multi-modal analysis as well as from surgical outcomes. In conclusion, the time-variant connectivity analysis applied to the epileptic patients can distinguish the generator of the abnormal activity from the propagation spread and identify the connectivity pattern over time.

  7. Phenotypic spectrum of GNAO1 variants: epileptic encephalopathy to involuntary movements with severe developmental delay

    PubMed Central

    Saitsu, Hirotomo; Fukai, Ryoko; Ben-Zeev, Bruria; Sakai, Yasunari; Mimaki, Masakazu; Okamoto, Nobuhiko; Suzuki, Yasuhiro; Monden, Yukifumi; Saito, Hiroshi; Tziperman, Barak; Torio, Michiko; Akamine, Satoshi; Takahashi, Nagahisa; Osaka, Hitoshi; Yamagata, Takanori; Nakamura, Kazuyuki; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Miyake, Noriko; Shiina, Masaaki; Ogata, Kazuhiro; Matsumoto, Naomichi

    2016-01-01

    De novo GNAO1 variants have been found in four patients including three patients with Ohtahara syndrome and one patient with childhood epilepsy. In addition, two patients showed involuntary movements, suggesting that GNAO1 variants can cause various neurological phenotypes. Here we report an additional four patients with de novo missense GNAO1 variants, one of which was identical to that of the previously reported. All the three novel variants were predicted to impair Gαo function by structural evaluation. Two patients showed early-onset epileptic encephalopathy, presenting with migrating or multifocal partial seizures in their clinical course, but the remaining two patients showed no or a few seizures. All the four patients showed severe intellectual disability, motor developmental delay, and involuntary movements. Progressive cerebral atrophy and thin corpus callosum were common features in brain images. Our study demonstrated that GNAO1 variants can cause involuntary movements and severe developmental delay with/without seizures, including various types of early-onset epileptic encephalopathy. PMID:25966631

  8. Optimizing Management of Patients with Adult T Cell Leukemia-Lymphoma

    PubMed Central

    Yared, Jean A.; Kimball, Amy S.

    2015-01-01

    Adult T cell leukemia-lymphoma is a rare disease with a high mortality rate, and is challenging for the clinician. Early allogeneic stem cell transplant can confer durable remission. As novel therapeutic agents become available to treat T cell malignancies, it is increasingly important that medical oncologists, hematologists, and hematopathologists recognize and accurately diagnose adult T cell leukemia-lymphoma. There is no uniform standard of treatment of adult T cell leukemia-lymphoma, and clinical trials remain critical to improving outcomes. Here we present one management approach based on the recent advances in treatment for adult T cell leukemia-lymphoma patients. PMID:26610571

  9. Focal Epileptogenic Lesions in Adult Patients with Epilepsy and Generalized Epileptiform Discharges

    PubMed Central

    Kim, Dong Wook; Lee, Seo-Young; Lee, Sang Kun

    2016-01-01

    Background and Purpose There are reports of successful resective epilepsy surgery for pediatric patients with epilepsy and generalized epileptiform discharges when they had focal epileptogenic lesions identified by MRI. However, there is limited information regarding adult patients with epilepsy who have both generalized epileptiform discharges and focal epileptogenic lesions. Methods To investigate the incidence and characteristics of adult patients who have both generalized epileptiform discharges and potentially epileptogenic lesions, we retrospectively analyzed data of clinical features and results of EEG and MRI of all patients with adult-onset epilepsy in a tertiary referral hospital. Results While 1315 patients were classified as having partial seizures, 207 patients were classified as having generalized seizures. Five of 207 patients (2.4%) with generalized seizures had potentially epileptogenic lesions. All the epileptogenic lesions were congenital or acquired during early life, such as focal cortical dysplasia, dysembryoplastic neuroepithelial tumor, and cerebromalacic change because of perinatal injury. Conclusions The presence of epileptogenic lesions in adult patients with generalized epileptiform discharges may be an incidental finding, but it has been suggested that some adult-onset epilepsy with generalized epileptiform discharges may actually have focal onset, which may have significant clinical implications for the choice of appropriate treatment. PMID:28101478

  10. Sinonasal characteristics and quality of life by SNOT-22 in adult patients with cystic fibrosis.

    PubMed

    Kang, Suzie Hyeona; Meotti, Camila Degen; Bombardelli, Karine; Piltcher, Otávio Bejzman; de Tarso Roth Dalcin, Paulo

    2017-04-01

    The prevalence of chronic sinus disease in cystic fibrosis (CF) has gradually increased. Sinonasal involvement may have influence on pulmonary exacerbations and can have a negative impact on the quality of life. To evaluate nasal characteristics and quality of life in adult patients with CF; to establish an association and determine the predictors in SNOT-22 questionnaire. Cross- sectional study with prospective data collection was performed to evaluate adult CF patients. Patients underwent clinical evaluation, lung function tests, nasal endoscopy, and paranasal sinuses CT scan. All the patients answered the SNOT-22 questionnaire.

  11. [Effect of sleep deprivation on visual evoked potentials and brain stem auditory evoked potentials in epileptics].

    PubMed

    Urumova, L T; Kovalenko, G A; Tsunikov, A I; Sumskiĭ, L I

    1984-01-01

    The article reports on the first study of the evoked activity of the brain in epileptic patients (n = 20) following sleep deprivation. An analysis of the data obtained has revealed a tendency to the shortening of the peak latent intervals of visual evoked potentials in the range of 100-200 mu sec and the V component and the interpeak interval III-V of evoked auditory trunk potentials in patients with temporal epilepsy. The phenomenon may indicate the elimination of stabilizing control involving the specific conductive pathways and, possibly, an accelerated conduction of a specific sensor signal.

  12. Functional Modularity of Background Activities in Normal and Epileptic Brain Networks

    NASA Astrophysics Data System (ADS)

    Chavez, M.; Valencia, M.; Navarro, V.; Latora, V.; Martinerie, J.

    2010-03-01

    We analyze the connectivity structure of weighted brain networks extracted from spontaneous magnetoencephalographic signals of healthy subjects and epileptic patients (suffering from absence seizures) recorded at rest. We find that, for the activities in the 5-14 Hz range, healthy brains exhibit a sparse connectivity, whereas the brain networks of patients display a rich connectivity with a clear modular structure. Our results suggest that modularity plays a key role in the functional organization of brain areas during normal and pathological neural activities at rest.

  13. Adult Day Care for Alzheimer's Patients and Their Families.

    ERIC Educational Resources Information Center

    Sands, Dan; Suzuki, Thelma

    1983-01-01

    Harbor Area Adult Day Care Center has operated for two years with a primary purpose of providing respite care to families caring for a relative with Alzheimer's disease or related disorders. The rationale, history, program, staffing, funding, and experience for the first two years of the project are provided. (Author/RC)

  14. Rules for improving pharmacotherapy in older adult patients: part 2 (rules 6-10).

    PubMed

    Wooten, James M

    2015-03-01

    The population of older adult patients in the United States is growing each year. Appropriate pharmacotherapy has allowed many older patients to live longer and maintain healthy lives. Unfortunately, the inappropriate utilization of medications can be harmful to older adult patients. Inappropriate pharmacotherapy may lead to overusing medications and polypharmacy. Polypharmacy can contribute to a higher incidence of adverse effects, increase the risk of dangerous drug interactions, cause noncompliance with appropriate medication use, and significantly increase the cost of health care. The polypharmacy issue with geriatric patients has been described as an epidemic and this issue must be addressed. This review provides objective rules that may help prevent polypharmacy. Consideration of these rules when prescribing, dispensing, and caring for older adult patients will improve the overall pharmacotherapy regimens instituted by healthcare providers.

  15. Rules for improving pharmacotherapy in older adult patients: part 1 (rules 1-5).

    PubMed

    Wooten, James M

    2015-02-01

    The population of older adult patients in the United States is growing each year. Appropriate pharmacotherapy has allowed many older patients to live longer and maintain healthy lives. Unfortunately, the inappropriate utilization of medications can be harmful to older adult patients. Inappropriate pharmacotherapy may lead to overusing medications and polypharmacy. Polypharmacy can contribute to a higher incidence of adverse effects, increase the risk of dangerous drug interactions, cause noncompliance with appropriate medication use, and significantly increase the cost of health care. The polypharmacy issue with geriatric patients has been described as an epidemic and this issue must be addressed. This review provides objective rules that may help prevent polypharmacy. Consideration of these rules when prescribing, dispensing, and caring for older adult patients will improve the overall pharmacotherapy regimens instituted by healthcare providers.

  16. Efficacy of mizoribine and prednisolone combination therapy in adult patients with IgA vasculitis.

    PubMed

    Mima, Akira

    2017-03-02

    Immunoglobulin (Ig)A vasculitis (IgAV), formerly known as Henoch-Schönlein purpura, is one of the most common vasculitis caused by an IgA-mediated immune complex. It occurs most frequently in childhood and less commonly in adulthood. As for the treatment of IgAV in adults, there are few studies dealing with the administration and efficacy of intravenous pulse steroid therapy or combination therapy using prednisolone (PSL) and immunosuppressive drugs. Mizoribine (MZB) is a newly developed immunosuppressive drug with few adverse effects; however, there are currently few studies using MZB in adult patients with IgAV. In this study, we evaluated the efficacy of MZB combined with a course of PSL in adult patients with IgAV. Five patients with adult onset IgAV were enrolled in the study. All patients received oral PSL (initial dose 30-50 mg/day), and MZB was administered orally at a single morning dose of 150 mg. We investigated the clinical manifestations and prognosis of these patients receiving the combination therapy of MZB and PSL retrospectively. All patients showed complete or partial remission of proteinuria and microscopic hematuria with the combination therapy of MZB and PSL. Furthermore, no significant adverse effects were observed. Although this study had an uncontrolled small group, our results indicate that the combination of MZB with PSL could be a possible new treatment for adult patients with IgAV.

  17. Low Literacy Levels in Adults: Implications for Patient Education.

    ERIC Educational Resources Information Center

    Fisher, Evelyn

    1999-01-01

    Health-education materials often require reading levels higher than that of many patients. Nurses need awareness of the prevalence of low literacy and the ability to assess reading levels so they can develop appropriate patient-education materials. (SK)

  18. Epileptic Seizures From Abnormal Networks: Why Some Seizures Defy Predictability

    PubMed Central

    Azhar, Feraz; Kudela, Pawel; Bergey, Gregory K.; Franaszczuk, Piotr J.

    2011-01-01

    Summary Seizure prediction has proven to be difficult in clinically realistic environments. Is it possible that fluctuations in cortical firing could influence the onset of seizures in an ictal zone? To test this, we have now used neural network simulations in a computational model of cortex having a total of 65,536 neurons with intercellular wiring patterned after histological data. A spatially distributed Poisson driven background input representing the activity of neighboring cortex affected 1% of the neurons. Gamma distributions were fit to the interbursting phase intervals, a non-parametric test for randomness was applied, and a dynamical systems analysis was performed to search for period-1 orbits in the intervals. The non-parametric analysis suggests that intervals are being drawn at random from their underlying joint distribution and the dynamical systems analysis is consistent with a nondeterministic dynamical interpretation of the generation of bursting phases. These results imply that in a region of cortex with abnormal connectivity analogous to a seizure focus, it is possible to initiate seizure activity with fluctuations of input from the surrounding cortical regions. These findings suggest one possibility for ictal generation from abnormal focal epileptic networks. This mechanism additionally could help explain the difficulty in predicting partial seizures in some patients. PMID:22169211

  19. Chronic alcohol use and first symptomatic epileptic seizures

    PubMed Central

    Leone, M; Tonini, C; Bogliun, G; Monaco, F; Mutani, R; Bottacchi, E; Gambaro, P; Rocci, E; Tassinari, T; Cavestro, C; Beghi, E

    2002-01-01

    Objective: To establish whether chronic alcoholism and alcohol consumption are risk factors for developing a first symptomatic epileptic seizure. Methods: Multicentre case-control study of 293 patients (160 men, 133 women) with a first seizure symptomatic (either acute or remote) of head trauma, stroke, or brain tumour, matched to 444 hospital controls for centre, sex, age (±5 years), and underlying pathology. Results: The risk of first seizure in alcoholics was no higher than in non-alcoholics for men (odds ratio 1.2, 95% confidence interval 0.4 to 3.2) or women (1.5, 0.1 to 54.4). The odds ratio (both sexes) was 1.2 (0.8 to 1.7) for an average intake of absolute alcohol of 1–25 g/day, 0.9 (0.5 to 1.5) for 26–50 g/day, 1.6 (0.8 to 3.0) for 51–100 g/day, and 1.4 (0.5 to 3.5) for >100 g/day. Conclusions: We found no evidence of an association between alcohol use or alcoholism and a first symptomatic seizure. PMID:12397140

  20. Music and its association with epileptic disorders.

    PubMed

    Maguire, Melissa

    2015-01-01

    The association between music and epileptic seizures is complex and intriguing. Musical processing within the human brain recruits a network which involves many cortical areas that could activate as part of a temporal lobe seizure or become hyperexcitable on musical exposure as in the case of musicogenic epilepsy. The dichotomous effect of music on seizures may be explained by modification of dopaminergic circuitry or counteractive cognitive and sensory input in ictogenesis. Research has explored the utility of music as a therapy in epilepsy and while limited studies show some evidence of an effect on seizure activity; further work is required to ascertain its clinical potential. Sodium channel-blocking antiepileptic drugs, e.g., carbamazepine and oxcarbazepine, appear to effect pitch perception particularly in native-born Japanese, a rare but important adverse effect, particularly if a professional musician. Temporal lobe surgery for right lateralizing epilepsy has the capacity to effect all facets of musical processing, although risk and correlation to resection area need further research. There is a need for the development of investigative tools of musical processing that could be utilized along the surgical pathway. Similarly, work is also required in devising a musical paradigm as part of electroencephalography to improve surveillance of musicogenic seizures. These clinical applications could aid the management of epilepsy and preservation of musical ability.

  1. Asynchronous electrical activity in epileptic seizures

    NASA Astrophysics Data System (ADS)

    Holman, Katherine; Lim, Eugene; Gliske, Stephen; Stacey, William; Fink, Christian

    High-frequency oscillations (HFOs) have been postulated to be potential biomarkers for focal epileptic seizures, with fast ripples (>250 Hz) as the most interesting candidate. The mechanisms underlying the generation of fast ripples, however, are not well understood. In this study, we draw upon results from previous computational studies on HFOs to develop a new mathematical model from first principles describing the generation of HFOs through asynchronous neuronal firing. Asynchrony in the model is obtained with the introduction of two parameters of heterogeneity: variability in the inter-spike interval (ISI) and jitter. The model predicts the generation of harmonic narrow-band oscillations if the heterogeneity-governing parameters do not differ from the predefined ISI by more than 20%. Comparisons against results from a separately constructed computational model verify the accuracy of the model in study. These results provide us with a rigorous framework in which we may investigate the mechanisms driving the generation of abnormal HFOs, and may serve as groundwork for future research in epileptogenesis. Nsf Grant 1003992, Ohio Wesleyan University SSRP.

  2. Conservative and surgical management of pancreatic trauma in adult patients

    PubMed Central

    Menahem, Benjamin; Lim, Chetana; Lahat, Eylon; Salloum, Chady; Osseis, Michael; Lacaze, Laurence; Compagnon, Philippe; Pascal, Gerard

    2016-01-01

    Background The management of pancreatic trauma is complex. The aim of this study was to report our experience in the management of pancreatic trauma. Methods All patients hospitalized between 2005 and 2013 for pancreatic trauma were included. Traumatic injuries of the pancreas were classified according to the American Association for Surgery of Trauma (AAST) in five grades. Mortality and morbidity were analyzed. Results A total of 30 patients were analyzed (mean age: 38±17 years). Nineteen (63%) patients had a blunt trauma and 12 (40%) had pancreatic injury ≥ grade 3. Fifteen patients underwent exploratory laparotomy and the other 15 patients had nonoperative management (NOM). Four (13%) patients had a partial pancreatectomy [distal pancreatectomy (n=3) and pancreaticoduodenectomy (n=1)]. Overall, in hospital mortality was 20% (n=6). Postoperative mortality was 27% (n=4/15). Mortality of NOM group was 13% (n=2/15) in both cases death was due to severe head injury. Among the patients who underwent NOM, three patients had injury ≥ grade 3, one patient had a stent placement in the pancreatic duct and two patients underwent endoscopic drainage of a pancreatic pseudocyst. Conclusions Operative management of pancreatic trauma leads to a higher mortality. This must not be necessarily related to the pancreas injury alone but also to the associated injuries including liver, spleen and vascular trauma which may cause impaired outcome more than pancreas injury. PMID:28124001

  3. Renal concentration capacity in adult patients with urinary tract infections.

    PubMed

    Sterner, G

    1991-01-01

    The maximal urine concentration capacity was studied in patients with acute pyelonephritis and in patients with clinically diagnosed acute cystitis. In the former group renal concentration ability was reduced in 16 of 22 patients and improved in all but two patients. Among patients with symptoms of acute cystitis 6 of 22 had a concentration capacity below 2 SD of normal values. Several of these patients had raised acute phase proteins and increased their urine osmolality at follow-up indicating that cases of acute pyelonephritis could have been included. It is concluded that the wide overlap between the groups makes the maximal urinary concentration capacity a method of limited value for level diagnosis in acute UTI infection. The test should be reserved for follow-up to reveal permanent renal damage.

  4. Effects of neurofeedback on adult patients with psychiatric disorders in a naturalistic setting.

    PubMed

    Cheon, Eun-Jin; Koo, Bon-Hoon; Seo, Wan-Seok; Lee, Jun-Yeob; Choi, Joong-Hyeon; Song, Shin-Ho

    2015-03-01

    Few well-controlled studies have considered neurofeedback treatment in adult psychiatric patients. In this regard, the present study investigates the characteristics and effects of neurofeedback on adult psychiatric patients in a naturalistic setting. A total of 77 adult patients with psychiatric disorders participated in this study. Demographic data and neurofeedback states were retrospectively analyzed, and the effects of neurofeedback were evaluated using clinical global impression (CGI) and subjective self-rating scales. Depressive disorders were the most common psychiatric disorders (19; 24.7 %), followed by anxiety disorders (18; 23.4 %). A total of 69 patients (89.6 %) took medicine, and the average frequency of neurofeedback was 17.39 ± 16.64. Neurofeedback was applied to a total of 39 patients (50.6 %) more than 10 times, and 48 patients (62.3 %) received both β/SMR and α/θ training. The discontinuation rate was 33.8 % (26 patients). There was significant difference between pretreatment and posttreatment CGI scores (<.001), and the self-rating scale also showed significant differences in depressive symptoms, anxiety, and inattention (<.001). This is a naturalistic study in a clinical setting, and has several limitations, including the absence of a control group and a heterogenous sample. Despite these limitations, the study demonstrates the potential of neurofeedback as an effective complimentary treatment for adult patients with psychiatric disorders.

  5. Non-motor symptoms in patients with adult-onset focal dystonia: Sensory and psychiatric disturbances.

    PubMed

    Conte, Antonella; Berardelli, Isabella; Ferrazzano, Gina; Pasquini, Massimo; Berardelli, Alfredo; Fabbrini, Giovanni

    2016-01-01

    Dystonia is characterized by the presence of involuntary muscle contractions that cause abnormal movements and posture. Adult onset focal dystonia include cervical dystonia, blepharospasm, arm dystonia and laryngeal dystonia. Besides motor manifestations, patients with focal dystonia frequently also display non-motor signs and symptoms. In this paper, we review the evidence of sensory and psychiatric disturbances in adult patients with focal dystonia. Clinical studies and neurophysiological investigations consistently show that the sensory system is involved in dystonia. Several studies have also demonstrated that neuropsychiatric disorders, particularly depression and anxiety, are more frequent in patients with focal dystonia, whereas data on obsessive compulsive disorders are more contrasting.

  6. Late-onset epileptic spasms in children with Pallister-Killian syndrome: a report of two new cases and review of the electroclinical aspects.

    PubMed

    Cerminara, Caterina; Compagnone, Eliana; Bagnolo, Valentina; Galasso, Cinzia; Lo-Castro, Adriana; Brinciotti, Mario; Curatolo, Paolo

    2010-02-01

    Pallister-Killian syndrome is a rare syndrome of multiple congenital anomalies attributable to the presence of a mosaic supernumerary isochromosome (12p). Although the clinical manifestations of Pallister-Killian syndrome are variable, the most common anomalies include craniofacial dysmorphisms, limb deformities, progressive psychomotor development delay, severe hypotonia, and epilepsy. Standard karyotype is nearly always normal, but the isochromosome (12p) is present in a high percentage of skin fibroblasts. In this article, we report the case of 2 boys with Pallister-Killian syndrome having late-onset, drug-resistant epileptic spasms. Seizures have been reported in 40% of patients with Pallister-Killian syndrome but are poorly described. Epileptic spasms are not unusual in patients with brain malformations, chromosomal aberrations, and genetic syndromes, but epileptic spasms could be easily mistaken for behavioral manifestations. A better electroclinical characterization of epileptic seizures in Pallister-Killian syndrome using appropriate polygraphic tests (video-electroencephalography, electromyography) may lead to an early diagnosis and specific treatment for this form of epileptic spasms caused by this rare syndrome.

  7. Behavioral state classification in epileptic brain using intracranial electrophysiology

    NASA Astrophysics Data System (ADS)

    Kremen, Vaclav; Duque, Juliano J.; Brinkmann, Benjamin H.; Berry, Brent M.; Kucewicz, Michal T.; Khadjevand, Fatemeh; Van Gompel, Jamie; Stead, Matt; St. Louis, Erik K.; Worrell, Gregory A.

    2017-04-01

    Objective. Automated behavioral state classification can benefit next generation implantable epilepsy devices. In this study we explored the feasibility of automated awake (AW) and slow wave sleep (SWS) classification using wide bandwidth intracranial EEG (iEEG) in patients undergoing evaluation for epilepsy surgery. Approach. Data from seven patients (age 34+/- 12 , 4 women) who underwent intracranial depth electrode implantation for iEEG monitoring were included. Spectral power features (0.1–600 Hz) spanning several frequency bands from a single electrode were used to train and test a support vector machine classifier. Main results. Classification accuracy of 97.8  ±  0.3% (normal tissue) and 89.4  ±  0.8% (epileptic tissue) across seven subjects using multiple spectral power features from a single electrode was achieved. Spectral power features from electrodes placed in normal temporal neocortex were found to be more useful (accuracy 90.8  ±  0.8%) for sleep-wake state classification than electrodes located in normal hippocampus (87.1  ±  1.6%). Spectral power in high frequency band features (Ripple (80–250 Hz), Fast Ripple (250–600 Hz)) showed comparable performance for AW and SWS classification as the best performing Berger bands (Alpha, Beta, low Gamma) with accuracy  ⩾90% using a single electrode contact and single spectral feature. Significance. Automated classification of wake and SWS should prove useful for future implantable epilepsy devices with limited computational power, memory, and number of electrodes. Applications include quantifying patient sleep patterns and behavioral state dependent detection, prediction, and electrical stimulation therapies.

  8. Driving regulations and psychogenic non-epileptic seizures: perspectives from the United Kingdom.

    PubMed

    Morrison, Ian; Razvi, Saif S M

    2011-03-01

    The Driver and Vehicle Licensing Agency (DVLA) in the United Kingdom provides guidance on fitness to drive for patients with a number of medical illnesses, including epilepsy and psychogenic non-epileptic seizures (PNES). The Association of British Neurologists circulates a monthly electronic newsletter to its membership by email. We used this newsletter to survey its recipients on the driving advice they offer patients with PNES, and their awareness of current DVLA guidelines. 54 replies were received (19/54 were epilepsy specialists). 11/54 respondents were unaware of any DVLA guidance regarding PNES. Of 43/54 aware of DVLA guidance, only 7% felt that it was sufficient. 40% of respondents did not recommend any driving restriction. 68% of epilepsy specialists recommended driving restriction as compared to 54% of non-epilepsy specialists. 2 respondents reported patients with PNES who had an accident as a consequence of a non-epileptic attack. The risk of motor vehicle accidents in patients with PNES needs further study. Until the establishment of evidence-based guidelines, there is a need to seek consensus and provide sufficient guidance regarding driving for both patients with PNES and their clinicians.

  9. Childhood sexual abuse in adult patients with borderline personality disorder

    PubMed Central

    Menon, Preethi; Chaudhari, Bhushan; Saldanha, Daniel; Devabhaktuni, Spandana; Bhattacharya, Labanya

    2016-01-01

    Background: Researchers have found elevated rates of childhood sexual abuse (CSA) in borderline personality disorder (BPD) patients. They have also implicated the role of CSA later in BPD. However, there has been a scarcity of studies regarding this in Indian population. Objectives: To profile the occurrence of CSA and its parameters in BPD patients and to document symptomatology of BPD associated with CSA. Materials and Methods: Thirty-six consecutive patients with BPD were administered with a two-staged semi-structured interview by different interviewers with the first stage for collecting sociodemographic details and confirming BPD diagnosis and the second stage for collecting information about CSA. Results: Of 36 BPD patients, 16 (44.44%) reported a history of definite CSA. The majority of CSA associated with BPD were having characteristics of onset at 7–12 years, <10 occasions of abuse, perpetrator being a close relative or a close acquaintance and genital type of CSA. Identity disturbances (P = 0.0354), recurrent suicidal/self-harm behavior (P = 0.0177), and stress-related paranoid/dissociative symptoms (P = 0.0177) were significantly associated with the presence of CSA while unstable interpersonal relationships (P = 0.001) were significantly associated with the absence of CSA. Conclusion: Significant proportion of BPD patients reported CSA. The specific symptom profile of BPD patients can be used to predict the presence of CSA in these patients, which has a direct implication in the treatment of these patients. PMID:28163415

  10. Benefits of preoperative education for adult elective surgery patients.

    PubMed

    Kruzik, Nancy

    2009-09-01

    Patient education is a major concern for perioperative nurses in an ambulatory surgery setting. It has proven difficult to develop formal preoperative teaching programs in this environment, but research has shown that preoperative education can improve patient outcomes and satisfaction with the surgical experience. Typical patient education consists of pamphlets that are given to the patient before surgery and verbal instructions from the physicians and nurses on the day of surgery. Ideally, preoperative patient education should begin in the surgeon's office, continue through preadmission testing, and be completed at admission. Having a well-designed preoperative education program enables perioperative nurses in ambulatory surgery centers to provide a thoughtful approach to perioperative teaching in a limited time. AORN J 90 (September 2009) 381-387. (c) AORN, Inc, 2009.

  11. Need for Prophylactic Treatment in Adult Haemophilia A Patients

    PubMed Central

    Siegmund, Berthold; Richter, Heinrich; Pollmann, Hartmut

    2009-01-01

    Summary Background and Methods A single centre study including 52 German patients aged ≥16 years with severe haemophilia A was performed to compare the amount of clotting factor and outcome between on-demand therapy (26 patients) and continuous prophylaxis (26 patients) over 1 year. Results Prophylaxis reduced the number of bleeds significantly. Compared to on-demand treatment (20.5 ± 3.0 bleeds/year/patient), under prophylaxis 7.8 ± 1.3 bleeds/year/patient were observed. Joint bleeds were reduced from 12.2 ± 1.5 to 4.7 ± 1.0/year/ patient. In the on-demand group 38% of the patients suffered from more than 2 bleeds/month, whereas in the prophylaxis group no patient was found with more than 2 bleeds/month. Mean annual factor VIII (FVIII) consumption increased from 767 ± 110 IU/kg body weight under on-demand treatment to 2,841 ± 341 IU/kg body weight under continuous prophylaxis, displaying a nearly fourfold increase in FVIII consumption. Furthermore, prophylaxis implies a more than four-fold increase in treatment days which escalated from a mean weekly injection rate of 0.56 ± 0.08 FVIII injections/week when bleeds were treated on demand to 2.52 ± 0.30 FVIII injections/week during prophylaxis. Conclusion Even though the results reflect a benefit also for prophylactically treated patients regarding their bleeding frequency, one has to take into account a substantial increase of the costs for coagulation concentrates when all patients with severe haemophilia A switch to continuous prophylaxis. PMID:20877667

  12. Laparoscopic Nephroureterectomy for Adult Patient with Primary Obstructive Megaureter

    PubMed Central

    Makiyama, Kazuhide; Ohtake, Shinji; Yamanaka, Hiroyuki; Sano, Futoshi; Nakaigawa, Noboru; Kubota, Yoshinobu

    2013-01-01

    A 29-year-old female with a complaint of abdominal distension was referred to our hospital. She had a history of being treated for pyelonephritis three times. By computed tomography and retrograde pyelography, she was diagnosed with adult left primary megaureter. Her left renal function was severely deteriorated. She hoped for surgical intervention before becoming pregnant. Laparoscopic nephroureterectomy for megaureters seems to be difficult due to the large size. By sucking urine from an inserted ureteral catheter and setting trocar positions, we successfully performed laparoscopic nephroureterectomy for megaureter. PMID:24455395

  13. Parental substance abuse, reports of chronic pain and coping in adult patients with sickle cell disease.

    PubMed Central

    Edwards, Christopher; Whitfield, Keith; Sudhakar, Shiv; Pearce, Michele; Byrd, Goldie; Wood, Mary; Feliu, Miriam; Leach-Beale, Brittani; DeCastro, Laura; Whitworth, Elaine; Abrams, Mary; Jonassaint, Jude; Harrison, M. Ojinga; Mathis, Markece; Scott, Lydia; Johnson, Stephanie; Durant, Lauren; Holmes, Anita; Presnell, Katherine; Bennett, Gary; Shelby, Rebecca; Robinson, Elwood

    2006-01-01

    There is increasing interest from a social learning perspective in understanding the role of parental factors on adult health behaviors and health outcomes. Our review revealed no studies, to date, that have evaluated the effects of parental substance abuse on reports of chronic pain and coping in adult patients with sickle cell disease (SCD). We explored the effects of parental substance (alcohol or drug) abuse on reports of the sensory, affective and summary indices of pain in 67 adult patients, mean age 38.9 (13.5), with SCD. We also explored the effects of parental substance abuse on psychopathology associated with pain and active coping. Twenty-four percent of patients reported that their parent(s) abused substances. Patients whose parent(s) were characterized as substance abusers reported greater sensory (p=0.02), affective (p=0.01) and summary (VAS; p=0.02) indices of pain as compared to their counterparts, whose parent(s) were not characterized as substance abusers. Patients did not differ in average age, education or the propensity to respond in a socially acceptable manner. There was a significant trend towards patients who characterized their parents as abusers scoring higher than their counterparts on active coping. We propose a Social Learning Theory to explain the current findings and suggest a need for additional prospective research to simultaneously explore biological (genetic) and social factors that influence the interpretation, experience and reporting of chronic pain in adult patients with chronic disease. PMID:16573309

  14. Influence of striatal dopamine transporter availability on the response to methylphenidate in adult patients with ADHD.

    PubMed

    Krause, Johanna; la Fougere, Christian; Krause, Klaus-Henning; Ackenheil, Manfred; Dresel, Stefan H

    2005-12-01

    In this study, we investigated whether availability of striatal dopamine transporter (DAT) may have an influence on the response of adult patients with attention deficit hyperactivity disorder (ADHD) on methylphenidate (MPH). In 18 non-smoking and non-medicated adult patients with ADHD, availability of DAT was measured with [(99m)Tc] TRODAT-1 SPECT. Then, the patients received methylphenidate (MPH), individually titrated up to 60 mg per day. Ten weeks later, clinical improvement was rated by Clinical Global Impressions scale. In all, 6 patients were classified as non-responders, and 12 responded to MPH. From the non-responders, 5 presented with a DAT availability below that of normal controls of the same age, whereas in the group of responders all patients had elevated DAT availability. There was a significant negative correlation between values for global clinical improvement and striatal DAT availability. In conclusion, ADHD patients with low DAT availability seem not to respond to therapy with MPH.

  15. [Acute cerebral ischemia: an unusual clinical presentation of isolated left ventricular noncompaction in an adult patient].

    PubMed

    Fiorencis, Andrea; Quadretti, Laura; Bacich, Daniela; Chiodi, Elisabetta; Mele, Donato; Fiorencis, Roberto

    2013-01-01

    Isolated left ventricular noncompaction in adults is uncommon. The most frequent clinical manifestations are heart failure due to left ventricular systolic dysfunction and supraventricular and ventricular arrhythmias, which may be sustained and associated with sudden death. Thromboembolic complications are also possible. We report the case of an adult patient with isolated left ventricular noncompaction who came to our observation because of acute cerebral ischemia, an initial presentation of the disease only rarely described.

  16. Management of adult Jehovah's Witness patients with acute bleeding.

    PubMed

    Berend, Kenrick; Levi, Marcel

    2009-12-01

    Because of the firm refusal of transfusion of blood and blood components by Jehovah's Witnesses, the management of Jehovah's Witness patients with severe bleeding is often complicated by medical, ethical, and legal concerns. Because of a rapidly growing and worldwide membership, physicians working in hospitals should be prepared to manage these patients. Appropriate management of a Jehovah's Witness patient with severe bleeding entails understanding of the legal and ethical issues involved, and meticulous medical management, including treatment of hypovolemic shock, local hemostatic interventions, and administration of prohemostatic agents, when appropriate. In addition, high-dose recombinant erythropoietin in combination with supplemental iron may enhance the speed of hemoglobin synthesis.

  17. Optimizing Survival Outcomes For Adult Patients With Nontraumatic Cardiac Arrest.

    PubMed

    Jung, Julianna

    2016-10-01

    Patient survival after cardiac arrest can be improved significantly with prompt and effective resuscitative care. This systematic review analyzes the basic life support factors that improve survival outcome, including chest compression technique and rapid defibrillation of shockable rhythms. For patients who are successfully resuscitated, comprehensive postresuscitation care is essential. Targeted temperature management is recommended for all patients who remain comatose, in addition to careful monitoring of oxygenation, hemodynamics, and cardiac rhythm. Management of cardiac arrest in circumstances such as pregnancy, pulmonary embolism, opioid overdose and other toxicologic causes, hypothermia, and coronary ischemia are also reviewed.

  18. [Preoperative tests recommendations in adult patients for ambulatory surgery].

    PubMed

    Zaballos, M; López-Álvarez, S; Argente, P; López, A

    2015-01-01

    Anesthetic assessment traditionally included a series of laboratory tests intended to detect undiagnosed diseases, and to ensure that the patient undergoes surgery following safety criteria. These tests, without a specific clinical indication, are expensive, of questionable diagnostic value and often useless. In the context of outpatient surgery, recent evidence suggests that patients of any age without significant comorbidity, ASA physical status gradei and grade ii, do not need additional preoperative tests routinely. The aim of the present recommendations is to determine the general indications in which these tests should be performed in ASA gradei and grade ii patients undergoing ambulatory surgery.

  19. Sabril® registry 5-year results: Characteristics of adult patients treated with vigabatrin.

    PubMed

    Krauss, Gregory; Faught, Edward; Foroozan, Rod; Pellock, John M; Sergott, Robert C; Shields, W Donald; Ziemann, Adam; Dribinsky, Yekaterina; Lee, Deborah; Torri, Sarah; Othman, Feisal; Isojarvi, Jouko

    2016-03-01

    Vigabatrin (Sabril®), approved in the US in 2009, is currently indicated as adjunctive therapy for refractory complex partial seizures (rCPS) in patients ≥ 10 years old who have responded inadequately to several alternative treatments and as monotherapy for infantile spasms (IS) in patients 1 month to 2 years of age. Because of reports of vision loss following vigabatrin exposure, FDA approval required a risk evaluation mitigation strategy (REMS) program. Vigabatrin is only available in the US through Support, Help, And Resources for Epilepsy (SHARE), which includes a mandated registry. This article describes 5 years of demographic and treatment exposure data from adult patients (≥ 17 years old) in the US treated with vigabatrin and monitored in the ongoing Sabril® registry. Registry participation is mandatory for all US Sabril® prescribers and patients. A benefit-risk assessment must be documented by the physician for a patient to progress to maintenance therapy, defined as 1 month of vigabatrin treatment for patients with IS and 3 months for patients with rCPS. Ophthalmologic assessments must be documented during and after completion of therapy. As of August 26, 2014, a total of 6823 patients were enrolled in the registry, of which 1200 were adults at enrollment. Of these patients, 1031 (86%) were naïve to vigabatrin. The majority of adult patients (n=783, 65%) had previously been prescribed ≥ 4 AEDs, and 719 (60%) were receiving ≥ 3 concomitant AEDs at vigabatrin initiation. Prescribers submitted an initial ophthalmological assessment form for 863 patients; an ophthalmologic exam was not completed for 300 (35%) patients and thus, were considered exempted from vision testing. Of these patients, 128 (43%) were exempted for neurologic disabilities. Clinicians discontinued treatment in 8 patients because of visual field deficits (VFD) (5 patients naïve to vigabatrin and 3 patients previously exposed). Based on Kaplan-Meier survival estimates, it is

  20. Expression of human epileptic temporal lobe neurotransmitter receptors in Xenopus oocytes: An innovative approach to study epilepsy

    PubMed Central

    Palma, Eleonora; Esposito, Vincenzo; Mileo, Anna Maria; Di Gennaro, Giancarlo; Quarato, Pierpaolo; Giangaspero, Felice; Scoppetta, Ciriaco; Onorati, Paolo; Trettel, Flavia; Miledi, Ricardo; Eusebi, Fabrizio

    2002-01-01

    Poly(A+) RNA was extracted from the temporal lobe (TL) of medically intractable epileptic patients which underwent surgical TL resection. Injection of this mRNA into Xenopus oocytes led to the expression of ionotropic receptors for γ-aminobutyric acid (GABA), kainate (KAI) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA). Membrane currents elicited by GABA inverted polarity at −15 mV, close to the oocyte's chloride equilibrium potential, were inhibited by bicuculline, and were potentiated by pentobarbital and flunitrazepam. These basic characteristics were also displayed by GABA currents elicited in oocytes injected with mRNAs isolated from human TL glioma (TLG) or from mouse TL. However, the GABA receptors expressed by the epileptic TL mRNA exhibited some unusual properties, consisting in a rapid current run-down after repetitive GABA applications and a large EC50 (125 μM). AMPA alone evoked very small or nil currents, whereas KAI induced larger currents. Nevertheless, upon cyclothiazide treatment, AMPA elicited substantial currents that, like the KAI currents, were inhibited by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Furthermore, the glutamate receptor 5 (GluR5) agonist, ATPA, failed to evoke an obvious current although both RT-PCR and Western blot analyses showed GluR5 expression in the epileptic TL. Oocytes injected with mouse TL or human TLG mRNAs generated KAI and AMPA currents similar to those evoked in oocytes injected with epileptic TL mRNA but, in contrast to these, the mouse TL and human TLG oocytes were also responsive to ATPA. Our findings are in accord with the concept that both a depression of GABA inhibition and a dysfunction of the KAI-receptor system maintain a high neuronal excitability that results in epileptic seizures. PMID:12409614

  1. Molecular epidemiology of Pseudomonas aeruginosa in adult patients with cystic fibrosis in Northern Ireland.

    PubMed

    Clarke, L; Moore, J E; Millar, B C; Crowe, M; Xu, J; Goldsmith, C E; Murphy, R G; Dooley, J S G; Rendall, J; Elborn, J S

    2008-01-01

    Isolates (n = 51) of Pseudomonas aeruginosa obtained from the sputa of 29 adult patients attending the Regional Cystic Fibrosis Centre in Northern Ireland were compared using an enterobacterial repetitive intergenic consensus sequence (ERIC2) primer in a random amplification of polymorphic DNA (RAPD) polymerase chain reaction (PCR) method. Resulting banding patterns showed a high degree of genetic heterogeneity among all isolates from the patients examined, suggesting a non-clonal relationship between isolates from these patients, when employing this genotyping technique.

  2. Use of Patient Portals for Personal Health Information Management: The Older Adult Perspective

    PubMed Central

    Turner, Anne M.; Osterhage, Katie; Hartzler, Andrea; Joe, Jonathan; Lin, Lorelei; Kanagat, Natasha; Demiris, George

    2015-01-01

    The personal health information management (PHIM) practices and needs of older adults are poorly understood. We describe initial results from the UW SOARING project (Studying Older Adults & Researching Information Needs and Goals), a participatory design investigation of PHIM in older adults (60 years and older). We conducted in-depth interviews with older adults (n=74) living in a variety of residential settings about their management of personal health information. A surprising 20% of participants report using patient portals and another 16% reported prior use or anticipated use of portals in the future. Participants cite ease of access to health information and direct communication with providers as valuable portal features. Barriers to the use of patient portals include a general lack of computer proficiency, high internet costs and security concerns. Design features based on consideration of needs and practices of older adults will facilitate appeal and maximize usability; both are elements critical to adoption of tools such as patient portals that can support older adults and PHIM. PMID:26958263

  3. Transition Readiness in Adolescents and Emerging Adults with Diabetes: The Role of Patient-Provider Communication

    PubMed Central

    Hilliard, Marisa; Sweenie, Rachel; Riekert, Kristin

    2013-01-01

    Transition from pediatric to adult care represents a high risk period for adolescents and emerging adults with diabetes. Fundamental differences between pediatric and adult care delivery models may contribute to increased risk for poor health outcomes. This review provides a brief overview of models of care in pediatric and adult settings and focuses on patient-provider communication content and quality as potential points of intervention to improve transition-related outcomes. This review also highlights disparities in transition and communication for adolescents and emerging adults from racial/ethnic minority groups and discusses recent changes in health care legislation that have significant implications for the transition process. Intervention opportunities include programs to enhance developmentally-appropriate patient-provider interactions and increased attention to promoting transition readiness skills. Improving patient-provider communication may hasten the development of vital self-advocacy skills needed in adult health care systems and, thus, help establish a lasting pattern of positive diabetes self-care. PMID:24014075

  4. Preoperative Assessment of Adult Patients for Intracranial Surgery

    PubMed Central

    Sivanaser, Vanitha; Manninen, Pirjo

    2010-01-01

    The preoperative assessment of the patient for neurosurgical and endovascular procedures involves the understanding of the neurological disease and its systemic presentation, and the requirements of the procedure. There is a wide spectrum of different neurosurgical disorders and procedures. This article provides an overview of the preoperative evaluation of these patients with respect to general principles of neuroanesthesia, and considerations for specific intracranial and vascular neurosurgical and interventional neuroradiological procedures. PMID:20700431

  5. Dysnatremias and Survival in Adult Burn Patients: A Retrospective Analysis

    DTIC Science & Technology

    2013-01-11

    hyponatre- mia occurred in 6.8% (n = 134) with mortality rates of 33.5 and 13.8%, respectively. Patients without a dysnatremia had Received: July 14...A multiple logistic regression analysis was performed to ana - lyze the relationship between independent variables of age, gen- der, %TBSA, %FT...15] . Of the 194 patients with hypernatre- mia , only 6 had concurrent head trauma for which an elevated sodium level was recommended by neurosur

  6. Caring for adult patients who require nasogastric feeding tubes.

    PubMed

    Curtis, Kristine

    Nasogastric tubes provide a safe means of delivering nutrition support to many patients in hospital and the community. Insertion and care of these tubes will be familiar to many nurses. Evidence has shown that misplaced tubes, either on insertion or during use, can cause serious harm or even death to patients. This article explores the safety challenges posed during the insertion and maintenance of nasogastric tubes. Guidance and evidence should provide nurses with the knowledge, skills and reassurance to manage these tubes safely.

  7. Brain network dynamics characterization in epileptic seizures. Joint directed graph and pairwise synchronization measures

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. C.; Machado, B. S.; Florence, G.; Hamad, A. P.; Sakamoto, A. C.; Fujita, A.; Baccalá, L. A.; Amaro, E.; Sameshima, K.

    2014-12-01

    Here we propose and evaluate a new approach to analyse multichannel mesial temporal lobe epilepsy EEG data from eight patients through complex network and synchronization theories. The method employs a Granger causality test to infer the directed connectivity graphs and a wavelet transform based phase synchronization measure whose characteristics allow studying dynamical transitions during epileptic seizures. We present a new combined graph measure that quantifies the level of network hub formation, called network hub out-degree, which closely reflects the level of synchronization observed during the ictus.

  8. Combined EEG-fMRI and tractography to visualise propagation of epileptic activity

    PubMed Central

    Hamandi, K; Powell, H W R; Laufs, H; Symms, M R; Barker, G J; Parker, G J M; Lemieux, L; Duncan, J S

    2008-01-01

    In a patient with refractory temporal lobe epilepsy, EEG-fMRI showed activation in association with left anterior temporal interictal discharges, in the left temporal, parietal and occipital lobes. Dynamic causal modelling suggested propagation of neural activity from the temporal focus to the area of occipital activation. Tractography showed connections from the site of temporal lobe activation to the site of occipital activation. This demonstrates the principle of combining EEG-fMRI and tractography to delineate the pathways of propagation of epileptic activity. PMID:18096681

  9. [Perspectives in the management of congenital heart defects in adult patients].

    PubMed

    Hartyánszky, István; Varga, Sándor; Havasi, Kálmán; Babik, Barna; Katona, Márta; Bogáts, Gábor

    2015-01-18

    Due to improving results in congenital heart surgery, the number of adult patients with congenital heart defect is increasing. The question is: what kind of problems can be managed in this patient-group? The authors review the different problems of management of congenital heart defects in adults based on national and international literature data. Simple defects recognised in adults, postoperative residual problems, changing of small grafts and valves, correction of primary or operated coarctation aortae can be usually managed without problems. A very close follow-up is necessary to establish the correct period for heart transplantation in patients with transposition of great arteries with Senning/Mustard operation, and univentricular heart corrected with "Fontan-circulation" type surgical procedure. The authors conclude that although the number of patients increases, only a few congenital heart diseases may cause problems. It seems important (1) to monitor asymptomatic patient who underwent operation (Fallot-IV, Ross procedure, etc.), (2) follow up regularly patients who underwent Senning/Mustard procedure (magnetic resonance imaging, echocardiography, brain natriuretic peptide measurement), (3) define the proper period of preparation for heart transplantation of patients with a univentricular heart, with special attention to the possibility of multiorgan (lung, liver, etc.) failure. Due to the improvement of foetal diagnosis of congenital heart defects, the number of patients with complex congenital heart defects is decreasing. The standard management of these patients could be primary heart transplantation in infancy.

  10. Anaphylaxis: lack of hospital doctors' knowledge of adrenaline (epinephrine) administration in adults could endanger patients' safety.

    PubMed

    Droste, J; Narayan, N

    2012-06-01

    Adrenaline (epinephrine) is the first line drug to be given in anaphylaxis and can save patients' lives. Conversely, incorrect administration of adrenaline in anaphylaxis has caused patients serious harm, including death. We compared the survey results of doctors' knowledge of adrenaline administration in adults of two District General Hospitals Trusts in England and found, that from 284 Hospital Doctors, 14.4% (n = 41) would administer adrenaline as recommended by published anaphylaxis guidelines. This survey comparison shows that a significant number of hospital doctors, regardless of seniority and specialty, have an educational deficit regarding correct administration of adrenaline (epinephrine) administration in adults with anaphylaxis. Multilevel strategies to educate doctors and prevent patient harm are needed. We propose a mnemonic for remembering the recommended treatment for anaphylaxis in the adult: "A Thigh 500" forAdrenaline into the antero-lateral thigh, 500 micrograms.

  11. Patient safety in the rehabilitation of the adult with an amputation.

    PubMed

    Latlief, Gail; Elnitsky, Christine; Hart-Hughes, Stephanie; Phillips, Samuel L; Adams-Koss, Laurel; Kent, Robert; Highsmith, M Jason

    2012-05-01

    This article reviews and summarizes the literature on patient safety issues in the rehabilitation of adults with an amputation. Safety issues in the following areas are discussed; the prosthesis, falls, wound care, pain, and treatment of complex patients. Specific recommendations for further research and implementation strategies to prevent injury and improve safety are also provided. Communication between interdisciplinary team members and patient and caregiver education are crucial to executing a safe treatment plan. The multidisciplinary rehabilitation team members should feel comfortable discussing safety issues with patients and be able to recommend preventive approaches to patients as appropriate.

  12. Social Anxiety Level in Adult Patients With Epilepsy and Their First-Degree Cohabiting Relatives.

    PubMed

    Altintas, Ebru; Yerdelen, V Deniz; Taskintuna, Nilgün

    2015-01-01

    Epilepsy affects not only the patient but also the patient's cohabiting relatives, to various degrees. This study investigated state and trait anxiety, depression, and social fear and avoidance levels in 48 adult patients with epilepsy and 48 family members, compared with 43 healthy control subjects, using the Beck Anxiety Inventory, the Beck Depression Inventory, the State-Trait Anxiety Inventory, and the Liebowitz Social Anxiety Scale. The results suggested that the patients and their first-degree relatives had higher levels of depression, state and trait anxiety, and avoidance compared with healthy subjects. The mothers of patients with epilepsy had the highest level of depression and anxiety.

  13. Problems in the organization of care for patients with adult congenital heart disease.

    PubMed

    Meijboom, Folkert; Mulder, Barbara

    2010-01-01

    The prevalence of congenital heart disease among adults in Europe, or in any country in Europe, is not known. This is due to a lack of agreement on the incidence of congenital heart disease, with estimations varying from four per 1000 births to 50 per 1000 births, and it is not known how many patients with congenital heart disease have died. Based on several studies that estimated and calculated the number of adult patients with congenital heart disease, the number of patients should be much higher than the number of patients that are actually seen in specialized centres throughout Europe. This implies that either a large proportion of adult patients with congenital heart disease do not receive appropriate medical care, or that the calculations and estimations are grossly wrong. A combination of the two is also possible. A substantial expansion of the number and size of specialized centres for adult congenital heart disease is advocated, but since setting up (and running) a service for this disease is a costly affair, and because uncertainty remains about the actual number of patients needing specialized care, this has been difficult to realize in most European countries in the past few years.

  14. Investigation of attention deficit and hyperactivity disorder in adult patients with atopic dermatitis.

    PubMed

    Cicek, Demet; Kandi, Basak; Dertlioglu, Selma Bakar; Gunay, Sennur; Halisdemir, Nurhan; Turgay, Atilla; Colak, Cemil

    2009-01-01

    Background. Atopic dermatitis (AD) is a common chronic inflammatory disease that is associated with significant psychosocial morbidity and a decrease in health-related quality of life. Attention deficit hyperactivity disorder may be present in atopic dermatitis patients. Objective. The present study aims to investigate the co-presence of ADHD in adult patients with AD. Material and method. The study registered 60 adult patients with AD (48 females and 12 males) and 50 non-atopic control subjects (38 females and 12 males). The AD patient group and the control group were assessed using the Turgay adult Attention-Deficit/Hyperactivity Disorder (ADD/ADHD) DSM-IV-Based Diagnostic Screening and Rating Scale (Turkish Version), which was studied by a team of psychologists and psychiatrists in Turkey for validity, reliability and norms. The scale covers three dimensions of the disease, namely inattention, hyperactivity and impulsivity, and associated features of ADHD. The groups were compared and contrasted in terms of their similarities and differences in ADD/ADHD symptoms. Results. Three sub-dimensions of ADD/ADHD scale (Attention Deficit, Hyperactivity/ Impulsivity and Problem subdivisions) in AD patients were found statistically significantly elevated relative to controls (P<0.001, P<0.001, P<0.001, respectively). Conclusions. In conclusion we established the co-presence of ADHD in AD patients in the adult age group.

  15. A novel genetic programming approach for epileptic seizure detection.

    PubMed

    Bhardwaj, Arpit; Tiwari, Aruna; Krishna, Ramesh; Varma, Vishaal

    2016-02-01

    The human brain is a delicate mix of neurons (brain cells), electrical impulses and chemicals, known as neurotransmitters. Any damage has the potential to disrupt the workings of the brain and cause seizures. These epileptic seizures are the manifestations of epilepsy. The electroencephalograph (EEG) signals register average neuronal activity from the cerebral cortex and label changes in activity over large areas. A detailed analysis of these electroencephalograph (EEG) signals provides valuable insights into the mechanisms instigating epileptic disorders. Moreover, the detection of interictal spikes and epileptic seizures in an EEG signal plays an important role in the diagnosis of epilepsy. Automatic seizure detection methods are required, as these epileptic seizures are volatile and unpredictable. This paper deals with an automated detection of epileptic seizures in EEG signals using empirical mode decomposition (EMD) for feature extraction and proposes a novel genetic programming (GP) approach for classifying the EEG signals. Improvements in the standard GP approach are made using a Constructive Genetic Programming (CGP) in which constructive crossover and constructive subtree mutation operators are introduced. A hill climbing search is integrated in crossover and mutation operators to remove the destructive nature of these operators. A new concept of selecting the Globally Prime offspring is also presented to select the best fitness offspring generated during crossover. To decrease the time complexity of GP, a new dynamic fitness value computation (DFVC) is employed to increase the computational speed. We conducted five different sets of experiments to evaluate the performance of the proposed model in the classification of different mixtures of normal, interictal and ictal signals, and the accuracies achieved are outstandingly high. The experimental results are compared with the existing methods on same datasets, and these results affirm the potential use of

  16. Symptoms and aetiology of delirium: a comparison of elderly and adult patients.

    PubMed

    Grover, S; Agarwal, M; Sharma, A; Mattoo, S K; Avasthi, A; Chakrabarti, S; Malhotra, S; Kulhara, P; Bas, D

    2013-06-01

    OBJECTIVE. To compare the symptoms of delirium as assessed by the Delirium Rating Scale-Revised-98 (DRS-R-98) and associated aetiologies in adult and elderly patients seen in a consultation-liaison service. METHODS. A total of 321 consecutive patients with a DSM-IV-TR diagnosis of delirium were assessed on the DRS-R-98 and a study-specific aetiology checklist. RESULTS. Of the 321 patients, 245 (76%) aged 18 to 64 years formed the adult group, while 76 (24%) formed the elderly group (≥ 65 years). The prevalence and severity of various symptoms of delirium as assessed using the DRS-R-98 were similar across the 2 groups, except for the adult group having statistically higher prevalence and severity scores for thought process abnormalities and lability of affect. For both groups and the whole sample, factor analysis yielded a 3-factor model for the phenomenology. In the 2 groups, the DRS-R-98 item loadings showed subtle differences across various factors. The 2 groups were similar for the mean number of aetiologies associated with delirium, the mean number being 3. However, the 2 groups differed with respect to hepatic derangement, substance intoxication, withdrawal, and postpartum causes being more common in the adult group, in contrast lung disease and cardiac abnormalities were more common in the elderly group. CONCLUSION. Adult and elderly patients with delirium are similar with respect to the distribution of various symptoms, motor subtypes, and associated aetiologies.

  17. Towards a new conceptualization of depression in older adult cancer patients: a review of the literature

    PubMed Central

    Saracino, Rebecca M.; Rosenfeld, Barry; Nelson, Christian J.

    2016-01-01

    Objectives Identifying depression in older adults with cancer presents a set of unique challenges, as it combines the confounding influences of cancer and its treatment with the developmental changes associated with aging. This paper reviews the phenomenology of depression in older adults, and individuals diagnosed with cancer. Method PsychInfo, PubMed, Web of Science, and Google Scholar databases were searched for English-language studies addressing the phenomenology, symptoms, or assessment of depression in older adults and those with cancer. Results The Diagnostic and Statistical Manual for Mental Disorders (DSM) criteria that appear to be relevant to both older adults and cancer patients are anhedonia, concentration difficulties, sleep disturbances, psychomotor retardation/agitation, and loss of energy. Possible alternative criteria that may be important considerations included constructs such as loss of purpose, loneliness, and irritability in older adults. Among cancer patients, tearfulness, social withdrawal, and not participating in treatment despite ability to do so were identified as potentially important symptoms. Conclusions Current DSM criteria may not adequately assess depression in older cancer patients and alternative criteria may be important to inform the understanding and identification of depression in this population. Enhancing diagnostic accuracy of depression is important as both the over-diagnosis and under-diagnosis is accompanied with significant costs. Thus, continued research exploring the phenomenology and identifying effective indicators of depression in older cancer patients is needed. PMID:26312455

  18. Adherence to pressure garment therapy in adult burn patients.

    PubMed

    Ripper, S; Renneberg, B; Landmann, C; Weigel, G; Germann, G

    2009-08-01

    Pressure garment therapy (PGT) is a generally accepted procedure to prevent hypertrophic scarring after severe burns. Wearing pressure garments is uncomfortable and challenging for the patient and, consequently adherence is low. In order to improve adherence, precise knowledge about the advantages and disadvantages of PGT is necessary. In this study we investigated specific aspects which inhibit or reinforce the application of PGT on the patients' part. Twenty-one patients participated in a semi-structured interview concerning their experiences with PGT. The complaints most frequently mentioned were 'physical and functional limitations' caused by the garments, 'additional effort' created by the need to care for garments and 'perceived deficiencies' of the treatment. At the same time, most of the patients reported coping strategies used to persevere with the therapy. Coping can be categorised into 'behavioural' and 'cognitive coping strategies'. Besides the 'expectation of success', 'emotional' as well as 'practical support' and experiencing 'good outcome' were motivating factors for the patients. Based on the analyses of limitations and resources, recommendations for future interventions enhancing adherence are outlined.

  19. Percutaneous Endovascular Treatment of Hepatic Artery Stenosis in Adult and Pediatric Patients After Liver Transplantation

    SciTech Connect

    Maruzzelli, Luigi; Miraglia, Roberto Caruso, Settimo; Milazzo, Mariapina; Mamone, Giuseppe; Gruttadauria, Salvatore; Spada, Marco; Luca, Angelo; Gridelli, Bruno

    2010-12-15

    The purpose of this study was to evaluate the efficacy of percutaneous endovascular techniques for the treatment of hepatic artery stenosis (HAS) occurring after liver transplantation (LT) in adult and pediatrics patients. From February 2003 to March 2009, 25 patients (15 adults and 10 children) whose developed HAS after LT were referred to our interventional radiology unit. Technical success was achieved in 96% (24 of 25) of patients. Percutaneous transluminal angioplasty (PTA) was performed in 13 patients (7 children), and stenting was performed in 11 patients (2 children). After the procedure, all patients were followed-up with liver function tests, Doppler ultrasound, and/or computed tomography. Mean follow-up was 15.8 months (range 5 days to 58 months). Acute hepatic artery thrombosis occurred immediately after stent deployment in 2 patients and was successfully treated with local thrombolysis. One patient developed severe HA spasm, which reverted after 24 h. After the procedure, mean trans-stenotic pressure gradient decreased from 30.5 to 6.2 mmHg. Kaplan-Meyer curve of HA primary patency was 77% at 1 and 2 years. During the follow-up period, 5 patients (20%) had recurrent stenosis, and 2 patients (8.3%) had late thrombosis. Two of 7 patients with stenosis/thrombosis underwent surgical revascularization (n = 1) and liver retransplantation (n = 1). Six (25%) patients died during follow-up, but overall mortality was not significantly different when comparing patients having patent hepatic arteries with those having recurrent stenosis/thrombosis. There were no significant differences in recurrent stenosis/thrombosis and mortality comparing patients treated by PTA versus stenting and comparing adult versus pediatric status. Percutaneous interventional treatment of HAS in LT recipients is safe and effective and decreases the need for surgical revascularization and liver retransplantation. However, the beneficial effects for survival are not clear, probably because

  20. Clinical relevance of multiple respiratory virus detection in adult patients with acute respiratory illness.

    PubMed

    Choi, Seong-Ho; Chung, Jin-Won; Kim, Hye Ryoun

    2015-04-01

    Because increasing numbers of nasopharyngeal swab specimens from adult patients with acute respiratory illness (ARI) are being tested by respiratory virus (RV) multiplex reverse transcriptase PCR (RVM-RT-PCR), multiple RV detection (MRVD) is being encountered more frequently. However, the clinical relevance of MRVD in adult patients has rarely been evaluated. The clinical characteristics of hospitalized adult patients with ARI and MRVD by RVM-RT-PCR tests were compared to those of patients with single RV detection (SRVD) during a single year at a tertiary care center. MRVD was observed in 26 of the 190 adult patients (13.7%). The patients with MRVD had a higher incidence of chronic lung disease than the patients with SRVD (34.6% versus 15.9%, crude odds ratio [OR]=2.81, 95% confidence interval [CI]=1.13 to 6.98, P=0.03). Although the former were more likely than the latter to receive mechanical ventilation (19.2% versus 6.7%, crude OR=3.31, 95% CI=1.05 to 10.47, P=0.049), the length of hospital stay (median, 7 versus 6.5 days; P=0.66), and the in-hospital mortality rate (7.7% versus 4.3%, crude OR=1.87, 95% CI=0.37 to 9.53, P=0.35) were not different between the two groups. In multivariate analysis, chronic lung disease was associated with MRVD (adjusted OR=3.08, 95% CI=1.12 to 8.46, P=0.03). In summary, it was not uncommon to encounter adult patients with ARI and MRVD by RVM-RT-PCR tests of nasopharyngeal swab specimens. MRVD was associated with chronic lung disease rather than the severity of the ARI.

  1. Perioperative Hemoglobin Trajectory in Adult Cardiac Surgical Patients

    PubMed Central

    Scott, David A.; Tung, Hon-Ming Andrew; Slater, Reuben

    2015-01-01

    Abstract: Preoperative anemia and nadir hemoglobin (Hb) during cardiopulmonary bypass (CPB) have been identified as significant risk factors for blood transfusion during cardiac surgery. The aim of this study was to confirm the association between preoperative anemia, perioperative fluid management, and blood transfusion. In addition, the proportion of elective cardiac surgery patients presenting for surgery with anemia was identified to examine whether the opportunity exists for timely diagnosis and intervention. Data from referral until hospital discharge were comprehensively reviewed over a 12-month period for all nonemergency cardiac surgical patients operated on in our institution. Of the 342 patients identified, elective cases were referred a median of 35 days before preoperative clinic and operated on a median of 14 days subsequently. Subacute cases had a median of 3 days from referral to surgery. As per the World Health Organization (WHO) criteria for anemia, 24.2% of elective and 29.6% of subacute patients were anemic. Blood transfusion was administered to 46.2% of patients during their admission. Transfusion was more likely in patients who were female (odds ratio [OR]: 2.45, 95%confidence interval [CI]: 1.28–4.70), had a low body mass index (BMI) (OR: .89, 95% CI: .84–.94), preoperative anemia (OR: 5.15, 95% CI: 2.59–10.24), or renal impairment (OR: 5.44, 95% CI: 2.42–12.22). Hemodilution minimization strategies reduced the Hb fall during CPB, but not transfusion rates. This study identifies a high prevalence of preoperative anemia with sufficient time for elective referrals to undergo appropriate diagnosis and interventions. It also confirms that low red cell mass (anemia and low BMI) and renal impairment are predictors of perioperative blood transfusion. Perfusion strategies to reduce hemodilution are effective at minimizing the intraoperative fall in Hb concentration but did not influence transfusion rate. PMID:26543251

  2. Similarities and differences between pediatric and adult patients with systemic lupus erythematosus.

    PubMed

    Tarr, T; Dérfalvi, B; Győri, N; Szántó, A; Siminszky, Z; Malik, A; Szabó, A J; Szegedi, G; Zeher, M

    2015-07-01

    Systemic lupus erythematosus (SLE) is a multifactorial autoimmune disease with highest prevalence among women of childbearing age. However, children younger than 16 years also can develop SLE (childhood-onset lupus/juvenile-type SLE). The aim of our study was to compare the clinical course of adult and pediatric-onset SLE. Data from 342 adult patients followed at the University of Debrecen, Hungary, and 79 children documented in the Hungarian National Pediatric SLE registry were analyzed using hospital medical records. Organ manifestations, laboratory parameters, and immunoserological characteristics were reviewed and the results were evaluated using SPSS for Windows software.Gender distribution was not significantly different between groups with disease starting in childhood vs adulthood. The prevalence of the following manifestations was significantly higher for pediatric than for adult-onset disease including: lupus nephritis (43% pediatric vs 26.4% for adult-onset), hematological disorders (57% vs 36.4%), photosensitivity (20% vs 9%), butterfly rash (61% vs 35.5%) and mucosal ulceration (11.4% vs 4%). For adult-onset SLE, neurological symptoms (30% vs 6%) and polyarthritis (86% vs 68%) occurred significantly more frequently than in children. Anti-SSA, anti-SSB and antiphospholipid antibodies were detected at significantly higher levels in adult-onset patients compared to those in pediatrics. Children were more commonly given high-dose intravenous immunoglobulin treatment (6.3% vs 0.6%) and mycophenolate mofetil (15.2% vs 5.3%) than adults.These results suggest that pediatric and adult-onset SLE differ in multiple aspects, and it is important to recognize these differences for optimal treatment and prognosis of these patients.

  3. Underdiagnosis of Attention-Deficit/Hyperactivity Disorder in Adult Patients: A Review of the Literature

    PubMed Central

    Quintero, Javier; Anand, Ernie; Casillas, Marta; Upadhyaya, Himanshu P.

    2014-01-01

    Objective: To raise awareness of attention-deficit/hyperactivity disorder (ADHD) as an underdiagnosed, undertreated, often comorbid, and debilitating condition in adults. Data Sources: PubMed was searched using combinations of keywords, including ADHD, adult, diagnosis, identify, prevalence, and comorbid, to find articles published between 1976 and 2013. Study Selection: In total, 99 articles were selected for inclusion on the basis of their relevance to the objective and importance to and representation of ADHD research, including international guidelines for adults with ADHD. Results: In a large proportion of children with ADHD, symptoms persist into adulthood. However, although adults with ADHD often experience chaotic lifestyles, with impaired educational and vocational achievement and higher risks of substance abuse and imprisonment, many remain undiagnosed and/or untreated. ADHD is usually accompanied by other psychiatric comorbidities (such as major depressive disorder, anxiety disorder, and alcohol abuse). Indeed, adults with ADHD are more likely to present to a psychiatric clinic for treatment of their comorbid disorders than for ADHD, and their ADHD symptoms are often mistaken for those of their comorbidities. Untreated ADHD in adults with psychiatric comorbidities leads to poor clinical and functional outcomes for the patient even if comorbidities are treated. Effective treatment of adults’ ADHD improves symptoms, emotional lability, and patient functioning, often leading to favorable outcomes (eg, safer driving, reduced criminality). A few medications have now been approved for use in adults with ADHD, while a multimodal approach involving psychotherapy has also shown promising results. Conclusions General psychiatrists should familiarize themselves with the symptoms of ADHD in adults in order to diagnose and manage ADHD and comorbidities appropriately in these patients. PMID:25317367

  4. Traumatic rupture of sternocleidomastoid muscle following an epileptic seizure.

    PubMed

    Wooles, Nicola Rachel; Bell, Philip Robert; Korda, Marian

    2014-11-19

    A 29-year-old man, a known epileptic, presented to an accident and emergency department following a tonic-clonic seizure, suffering a second seizure in the department. Subsequently, he reported neck pain, swelling and stiffness. An otorhinolaryngology neck examination revealed a tender left side with two palpable masses and a reduced range of movement. Ultrasound confirmed a ruptured middle third of the left sternocleidomastoid muscle, which was successfully treated non-surgically with analgaesia and intensive physiotherapy. Uncommonly, sternocleidomastoid muscle rupture has been reported following high-velocity trauma, but to the best of our knowledge this is the first case described in the literature following an epileptic seizure.

  5. Electroencephalogram of Age-Dependent Epileptic Encephalopathies in Infancy and Early Childhood

    PubMed Central

    Wong-Kisiel, Lily C.; Nickels, Katherine

    2013-01-01

    Epileptic encephalopathy syndromes are disorders in which the epileptiform abnormalities are thought to contribute to a progressive cerebral dysfunction. Characteristic electroencephalogram findings have an important diagnostic value in classification of epileptic encephalopathy syndromes. In this paper, we focus on electroencephalogram findings of childhood epileptic encephalopathy syndromes and provide sample illustrations. PMID:24024028

  6. Increased phase synchronization of spontaneous calcium oscillations in epileptic human versus normal rat astrocyte cultures

    NASA Astrophysics Data System (ADS)

    Balázsi, Gábor; Cornell-Bell, Ann H.; Moss, Frank

    2003-06-01

    Stochastic synchronization analysis is applied to intracellular calcium oscillations in astrocyte cultures prepared from epileptic human temporal lobe. The same methods are applied to astrocyte cultures prepared from normal rat hippocampus. Our results indicate that phase-repulsive coupling in epileptic human astrocyte cultures is stronger, leading to an increased synchronization in epileptic human compared to normal rat astrocyte cultures.

  7. Capparis ovata modulates brain oxidative toxicity and epileptic seizures in pentylentetrazol-induced epileptic rats.

    PubMed

    Nazıroğlu, Mustafa; Akay, Mehmet Berk; Çelik, Ömer; Yıldırım, Muhammed İkbal; Balcı, Erdinç; Yürekli, Vedat Ali

    2013-04-01

    It has been widely suggested that oxidative stress products play an important role in the pathophysiology of epilepsy. Capparis ovata (C. ovata) may useful treatment of epilepsy because it contains antioxidant flavonoids. The current study was designed to determine the effects of C. ovata on lipid peroxidation, antioxidant levels and electroencephalography (EEG) records in pentylentetrazol (PTZ)-induced epileptic rats. Thirty-two rats were randomly divided into four groups. First group was used as control although second group was PTZ group. Oral 100 and 200 mg/kg C. ovata were given to rats constituting the third and fourth groups for 7 days before PTZ administration. Second, third and forth groups received 60 mg/kg PTZ for induction of epilepsy. Three hours after administration of PTZ, EEG records, brain cortex and blood samples were taken all groups. The lipid peroxidation levels of the brain cortex, number of spikes and epileptiform discharges of EEG were higher in PTZ group than in control and C. ovata group whereas they were decreased by C. ovata administration. Vitamin A, vitamin C, vitamin E and β-carotene concentrations of brain cortex and latency to first spike of EEG were decreased by the PTZ administration although the brain cortex and plasma vitamin concentrations, and brain cortex and erythrocyte glutathione and glutathione peroxidase values were increased in PTZ + 100 and PTZ + 200 mg C. ovata groups. In conclusion, C. ovata administration caused protection against the PTZ-induced brain oxidative toxicity by inhibiting free radical and epileptic seizures, and supporting antioxidant redox system.

  8. Preictal dynamics of EEG complexity in intracranially recorded epileptic seizure: a case report.

    PubMed

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-11-01

    Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208-217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis.The results show that in comparison to interictal period (at about 8-6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures.

  9. A snapshot of the adult spina bifida patient – high incidence of urologic procedures

    PubMed Central

    Liu, Joceline S.; Greiman, Alyssa; Casey, Jessica T.; Mukherjee, Shubhra

    2016-01-01

    Introduction To describe the urologic outcomes of contemporary adult spina bifida patients managed in a multidisciplinary clinic. Material and methods A retrospective chart review of patients seen in our adult spina bifida clinic from January 2004 to November 2011 was performed to identify urologic management, urologic surgeries, and co-morbidities. Results 225 patients were identified (57.8% female, 42.2% male). Current median age was 30 years (IQR 27, 36) with a median age at first visit of 25 years (IQR 22, 30). The majority (70.7%) utilized clean intermittent catheterization, and 111 patients (49.3%) were prescribed anticholinergic medications. 65.8% had urodynamics performed at least once, and 56% obtained appropriate upper tract imaging at least every other year while under our care. 101 patients (44.9%) underwent at least one urologic surgical procedure during their lifetime, with a total of 191 procedures being performed, of which stone procedures (n = 51, 26.7%) were the most common. Other common procedures included continence procedures (n = 35, 18.3%) and augmentation cystoplasty (n = 29, 15.2%). Only 3.6% had a documented diagnosis of chronic kidney disease and 0.9% with end-stage renal disease. Conclusions Most adult spina bifida patient continue on anticholinergic medications and clean intermittent catheterization. A large percentage of patients required urologic procedures in adulthood. Patients should be encouraged to utilize conservative and effective bladder management strategies to reduce their risk of renal compromise. PMID:27123330

  10. Allogeneic hematopoietic cell transplantation in adult patients with acute lymphoblastic leukemia.

    PubMed

    Marks, David I; Alonso, Laura; Radia, Rohini

    2014-12-01

    This review discusses the use of prognostic factors, patient and donor selection, choice of conditioning regimens, and timing of transplant. It also describes the management of Philadelphia-positive acute lymphocytic leukemia (ALL) and central nervous system disease. All aggressively treated adults with ALL should be considered for allogeneic transplantation and tissue typed at diagnosis. We further suggest that eligible patients be entered into clinical trials (that incorporate transplantation); these unselected prospective outcome data are essential to evaluate the true value of allogeneic transplantation in adults with ALL.

  11. Simultaneous premaxillary repositioning and cheiloplasty in adult patients with unrepaired bilateral cleft lip and palate.

    PubMed

    Lee, Ui-Lyong; Cho, Jun-Bum; Choung, Pill-Hoon

    2013-03-01

    Primary cheiloplasty in adult patients with unrepaired complete bilateral cleft lip and palate is quite challenging due to severe premaxillary anterior projection. To get the best repair results, the author carried out repositioning of the premaxilla and repair of the lip deformity in a single stage. Positive results for the primary lip repair and appropriate repositioning of the premaxilla were achieved. No avascular necrosis of the premaxilla was observed. Repositioning of the premaxilla and repair of the lip deformity in a single operation appears to be a reliable method for treating adult patients with previously unrepaired or poorly repaired bilateral cleft lip and palate.

  12. What graph theory actually tells us about resting state interictal MEG epileptic activity.

    PubMed

    Niso, Guiomar; Carrasco, Sira; Gudín, María; Maestú, Fernando; Del-Pozo, Francisco; Pereda, Ernesto

    2015-01-01

    Graph theory provides a useful framework to study functional brain networks from neuroimaging data. In epilepsy research, recent findings suggest that it offers unique insight into the fingerprints of this pathology on brain dynamics. Most studies hitherto have focused on seizure activity during focal epilepsy, but less is known about functional epileptic brain networks during interictal activity in frontal focal and generalized epilepsy. Besides, it is not clear yet which measures are most suitable to characterize these networks. To address these issues, we recorded magnetoencephalographic (MEG) data using two orthogonal planar gradiometers from 45 subjects from three groups (15 healthy controls (7 males, 24 ± 6 years), 15 frontal focal (8 male, 32 ± 16 years) and 15 generalized epileptic (6 male, 27 ± 7 years) patients) during interictal resting state with closed eyes. Then, we estimated the total and relative spectral power of the largest principal component of the gradiometers, and the degree of phase synchronization between each sensor site in the frequency range [0.5-40 Hz]. We further calculated a comprehensive battery of 15 graph-theoretic measures and used the affinity propagation clustering algorithm to elucidate the minimum set of them that fully describe these functional brain networks. The results show that differences in spectral power between the control and the other two groups have a distinctive pattern: generalized epilepsy presents higher total power for all frequencies except the alpha band over a widespread set of sensors; frontal focal epilepsy shows higher relative power in the beta band bilaterally in the fronto-central sensors. Moreover, all network indices can be clustered into three groups, whose exemplars are the global network efficiency, the eccentricity and the synchronizability. Again, the patterns of differences were clear: the brain network of the generalized epilepsy patients presented greater efficiency and lower

  13. [Cell signaling in the epileptic hippocampus].

    PubMed

    Ferrer, I

    Cell signaling commanding death or survival in human epileptic hippocampus is difficult to trace because of the long interval between the beginning of symptoms and the sampling of damaged cerebral tissue for neuropathological examination. Intraperitoneal injection of the glutamate analogue kainic acid (KA) is a useful tool to analyze the effects of seizures and the excitotoxic damage in the rodent hippocampus. KA acts on NMDA and KA receptors, whereas it has little impact on AMPA receptors. Neurons of the hilus and CA3 neurons are primary targets of KA, although parvalbumin containing GABAergic neurons are less vulnerable than glutamatergic neurons. Immediate responses to KA are hsp 70 mRNA induction and HSP 70/72 protein expression, as well as c fos and c jun mRNA, and c Fos and c Jun protein expression in the hippocampus. Yet increased c Fos and c Jun expression is not a predictor of cell death or cell survival. In contrast, the tissular plasminogen activator (tPA) and the membrane Fas/Fas L signaling pathway probably have a role in facilitating cell death following KA injection. The involvement of other pathways remains controversial. Increased expression of the pro apoptotic Bax together with decreased Bcl 2 suggests Bax mediated apoptosis. Activation of the mitochondrial pathway includes leakage of citochrome c to the cytosol and activation of the caspase cascade leading to apoptosis. However, other studies have emphasized the limited expression of caspase 3, the main executioner of apoptosis, and the relevance of necrosis as the main form of cell death following KA excitotoxicity. Phosphorylation dependent activation of several kinases, including MAPK, p 38 and JNK/SAPK, and their substrates has been found in KA treated animals. Decreased CREBp expression is associated with cell death whereas increased ATF 2P and Elk 1P are associated with cell survival. Trophic factors probably do not play a significant role during the early stages of hippocanmpal damage but

  14. Ecstatic Epileptic Seizures: A Glimpse into the Multiple Roles of the Insula

    PubMed Central

    Gschwind, Markus; Picard, Fabienne

    2016-01-01

    Ecstatic epileptic seizures are a rare but compelling epileptic entity. During the first seconds of these seizures, ecstatic auras provoke feelings of well-being, intense serenity, bliss, and “enhanced self-awareness.” They are associated with the impression of time dilation, and can be described as a mystic experience by some patients. The functional neuroanatomy of ecstatic seizures is still debated. During recent years several patients presenting with ecstatic auras have been reported by others and us (in total n = 52); a few of them in the setting of presurgical evaluation including electrical brain stimulation. According to the recently recognized functions of the insula, and the results of nuclear brain imaging and electrical stimulation, the ecstatic symptoms in these patients seem to localize to a functional network centered around the anterior insular cortex, where we thus propose to locate this rare ictal phenomenon. Here we summarize the role of the multiple sensory, autonomic, affective, and cognitive functions of the insular cortex, which are integrated into the creation of self-awareness, and we suggest how this system may become dysfunctional on several levels during ecstatic aura. PMID:26924970

  15. With or without spikes: localization of focal epileptic activity by simultaneous electroencephalography and functional magnetic resonance imaging.

    PubMed

    Grouiller, Frédéric; Thornton, Rachel C; Groening, Kristina; Spinelli, Laurent; Duncan, John S; Schaller, Karl; Siniatchkin, Michael; Lemieux, Louis; Seeck, Margitta; Michel, Christoph M; Vulliemoz, Serge

    2011-10-01

    In patients with medically refractory focal epilepsy who are candidates for epilepsy surgery, concordant non-invasive neuroimaging data are useful to guide invasive electroencephalographic recordings or surgical resection. Simultaneous electroencephalography and functional magnetic resonance imaging recordings can reveal regions of haemodynamic fluctuations related to epileptic activity and help localize its generators. However, many of these studies (40-70%) remain inconclusive, principally due to the absence of interictal epileptiform discharges during simultaneous recordings, or lack of haemodynamic changes correlated to interictal epileptiform discharges. We investigated whether the presence of epilepsy-specific voltage maps on scalp electroencephalography correlated with haemodynamic changes and could help localize the epileptic focus. In 23 patients with focal epilepsy, we built epilepsy-specific electroencephalographic voltage maps using averaged interictal epileptiform discharges recorded during long-term clinical monitoring outside the scanner and computed the correlation of this map with the electroencephalographic recordings in the scanner for each time frame. The time course of this correlation coefficient was used as a regressor for functional magnetic resonance imaging analysis to map haemodynamic changes related to these epilepsy-specific maps (topography-related haemodynamic changes). The method was first validated in five patients with significant haemodynamic changes correlated to interictal epileptiform discharges on conventional analysis. We then applied the method to 18 patients who had inconclusive simultaneous electroencephalography and functional magnetic resonance imaging studies due to the absence of interictal epileptiform discharges or absence of significant correlated haemodynamic changes. The concordance of the results with subsequent intracranial electroencephalography and/or resection area in patients who were seizure free after

  16. With or without spikes: localization of focal epileptic activity by simultaneous electroencephalography and functional magnetic resonance imaging

    PubMed Central

    Grouiller, Frédéric; Thornton, Rachel C.; Groening, Kristina; Spinelli, Laurent; Duncan, John S.; Schaller, Karl; Siniatchkin, Michael; Lemieux, Louis; Seeck, Margitta; Michel, Christoph M.

    2011-01-01

    In patients with medically refractory focal epilepsy who are candidates for epilepsy surgery, concordant non-invasive neuroimaging data are useful to guide invasive electroencephalographic recordings or surgical resection. Simultaneous electroencephalography and functional magnetic resonance imaging recordings can reveal regions of haemodynamic fluctuations related to epileptic activity and help localize its generators. However, many of these studies (40–70%) remain inconclusive, principally due to the absence of interictal epileptiform discharges during simultaneous recordings, or lack of haemodynamic changes correlated to interictal epileptiform discharges. We investigated whether the presence of epilepsy-specific voltage maps on scalp electroencephalography correlated with haemodynamic changes and could help localize the epileptic focus. In 23 patients with focal epilepsy, we built epilepsy-specific electroencephalographic voltage maps using averaged interictal epileptiform discharges recorded during long-term clinical monitoring outside the scanner and computed the correlation of this map with the electroencephalographic recordings in the scanner for each time frame. The time course of this correlation coefficient was used as a regressor for functional magnetic resonance imaging analysis to map haemodynamic changes related to these epilepsy-specific maps (topography-related haemodynamic changes). The method was first validated in five patients with significant haemodynamic changes correlated to interictal epileptiform discharges on conventional analysis. We then applied the method to 18 patients who had inconclusive simultaneous electroencephalography and functional magnetic resonance imaging studies due to the absence of interictal epileptiform discharges or absence of significant correlated haemodynamic changes. The concordance of the results with subsequent intracranial electroencephalography and/or resection area in patients who were seizure free after

  17. Comparison of human growth hormone products' cost in pediatric and adult patients. A budgetary impact model.

    PubMed

    Bazalo, Gary R; Joshi, Ashish V; Germak, John

    2007-09-01

    We assessed the economic impact to the United States payer of recombinant human growth hormone (rhGH) utilization, comparing the relative dosage efficiency of marketed pen-based and vial-based products in a pediatric and in an adult population. A budgetary impact model calculated drug costs based on product waste and cost. Waste was the difference between prescribed dose, based on patient weight, and actual delivered dose, based on dosing increments and maximum deliverable dose for pens and a fixed-percent waste as derived from the literature for vials. Annual wholesale acquisition costs were calculated based upon total milligrams delivered, using a daily dose of 0.03 mg/kg for pediatric patients and 0.016 mg/kg for adults. Total annual drug costs were compared for two scenarios: 1) a product mix based on national market share and 2) restricting use to the product with lowest waste. Based on the literature, waste for each vial product was 23 percent. Among individual pens, waste was highest for Humatrope 24 mg (19.5 percent pediatric, 14.3 percent adult) and lowest for Norditropin Nordi-Flex 5 mg (1.1 percent pediatric, 1 percent adult). Restricting use to the brand with least waste (Norditropin), compared to national product share mix, resulted in a 10.2 percent reduction in annual pediatric patient cost from $19,026 to $17,089 and an 8 percent reduction in annual adult patient cost from $24,099 to $22,161. We concluded that pen delivery systems result in less waste than vial and syringe. Considering all approved delivery systems, Norditropin resulted in the least product waste and lower annual patient cost for both pediatric and adult populations.

  18. Modern treatment of adult short bowel syndrome patients.

    PubMed

    Efsen, E; Jeppesen, P B

    2011-12-01

    By definition, intestinal failure prevails when oral compensation is no longer feasible and parenteral support is necessary to maintain nutritional equilibrium. In the past, conventional treatment has mainly focused on "making the most of what the short bowel syndrome patient still had" by optimizing remnant intestinal function through dietary interventions, antidiarrheals and antisecretory agents. However, modern treatment options are in the near horizon, and the increased understanding of the mediators for intestinal adaptation will lead to the expansion of the limited treatment armamentarium in short bowel syndrome patients with intestinal failure. The clinical meaningfulness and implications of the observed effects of growth hormone, glutamine, glucagon-like peptide 2 (GLP-2) and the dipeptidyl peptidase-4 degradation resistant analog, teduglutide, is presented in this review and balanced against treatment related adverse events and possible unfavourable effects of long-term, possibly lifelong, treatments.

  19. Enterocolitis without diarrhoea in an adult patient: a clinical dilemma.

    PubMed

    Vaidya, Gaurang Nandkishor; Sharma, Amit; Khorasani-Zadeh, Arman; John, Savio

    2014-03-04

    Campylobacter jejuni is one of the most common causes of bloody diarrhoea in the USA. We report a case of a young woman who presented with a clinical picture reminiscent of acute appendicitis. Ultrasonography and CT of the abdomen performed subsequently revealed evidence of colitis. Quite unexpectedly, she had no symptoms of diarrhoea and the stool Gram stain and culture were negative. Nevertheless, due to high clinical suspicion of infectious colitis, appendectomy was deferred. Blood culture was later reported positive for Campylobacter species and the patient responded to quinolones. With this case report we try to highlight one of the unusual presentations of C jejuni infection, closely mimicking acute appendicitis in the absence of classical symptoms of bacterial enteritis. In such cases, a high index of suspicion, astute history taking skills and the proper use of imaging studies can save the patient from the surgical knife.

  20. Nutritional Recommendations for Adult Bariatric Surgery Patients: Clinical Practice.

    PubMed

    Sherf Dagan, Shiri; Goldenshluger, Ariela; Globus, Inbal; Schweiger, Chaya; Kessler, Yafit; Kowen Sandbank, Galit; Ben-Porat, Tair; Sinai, Tali

    2017-03-01

    Bariatric surgery is currently the most effective treatment for morbid obesity and its associated metabolic complications. To ensure long-term postoperative success, patients must be prepared to adopt comprehensive lifestyle changes. This review summarizes the current evidence and expert opinions with regard to nutritional care in the perioperative and long-term postoperative periods. A literature search was performed with the use of different lines of searches for narrative reviews. Nutritional recommendations are divided into 3 main sections: 1) presurgery nutritional evaluation and presurgery diet and supplementation; 2) postsurgery diet progression, eating-related behaviors, and nutritional therapy for common gastrointestinal symptoms; and 3) recommendations for lifelong supplementation and advice for nutritional follow-up. We recognize the need for uniform, evidence-based nutritional guidelines for bariatric patients and summarize recommendations with the aim of optimizing long-term success and preventing complications.

  1. What is the impact of electromagnetic waves on epileptic seizures?

    PubMed Central

    Cinar, Nilgun; Sahin, Sevki; Erdinc, Oguz O.

    2013-01-01

    Background The effects of electromagnetic waves (EMWs) on humans and their relationship with various disorders have been investigated. We aimed to investigate the effects of exposure to different frequencies of EMWs in various durations in a mouse epilepsy model induced by pentylenetetrazole (PTZ). Material/Methods A total of 180 4-week-old male mice weighing 25–30 g were used in this study. Each experimental group consisted of 10 mice. They were exposed to 900, 700, 500, 300, and 100 MHz EMWs for 20 hours, 12 hours and 2 hours. Following electromagnetic radiation exposure, 60 mg/kg of PTZ was injected intraperitoneally to all mice. Each control was also injected with PTZ without any exposure to EMW. The latency of initial seizure and most severe seizure onset were compared with controls. Results The shortest initial seizure latency was noted in the 12-hour group, followed by the 700 MHz. The mean initial seizure latencies in the 2-hour EMW exposed group was significantly shorter compared to that in the 12- and 20-hour groups. There was no significant difference between 12- and 20-hour EMW exposed groups. There was a significant difference between control and 2- and 10-hour EMW exposed groups. No statistically significant differences were noted in mean latencies of the most severe seizure latency, following 20-, 12-, and 2- hour EMW exposed groups and control groups. Conclusions Our findings suggest that acute exposure to EMW may facilitate epileptic seizures, which may be independent of EMW exposure time. This information might be important for patients with epilepsy. Further studies are needed. PMID:23676765

  2. Is the medical home for adult patients with sickle cell disease a reality or an illusion?

    PubMed

    Ballas, Samir K; Vichinsky, Elliott P

    2015-01-01

    Recently, the patient-centered medical home (PCMH) emerged as a viable method to improve delivery of medical care. Due to all the promotion about the effectiveness of the PCMH, patients with sickle cell disease, their families and the community hoped that this could be a possible solution to the problems that arise in the treatment of adult patients with sickle cell disease. Review of the literature and review of the criteria for the establishment of a PCMH show that the PCMH is not an ideal model for patients with sickle cell disease because finding a personal physician, which is the first criteria of a functional PCMH, is a major problem in the process of transitioning the care of patients with sickle cell disease from pediatrics to adult care. Moreover, garnering hospital support to defray the initial costs to establish a PCMH for adults with sickle cell disease is unlikely given the already high costs of care for patients with sickle cell disease. Moreover, recent studies have shown insufficient evidence to determine the presumed beneficial effects of the PCMH, especially in patients with chronic disease.

  3. Loss of olfactory function and nutritional status in vital older adults and geriatric patients.

    PubMed

    Toussaint, Nicole; de Roon, Margot; van Campen, Jos P C M; Kremer, Stefanie; Boesveldt, Sanne

    2015-03-01

    The aim of this cross-sectional study was to assess the association of olfactory function and nutritional status in vital older adults and geriatric patients. Three hundred forty-five vital (mean age 67.1 years) and 138 geriatric older adults (mean age 80.9 years) were included. Nutritional status was assessed using the mini nutritional assessment-short form. The Sniffin' Sticks was used to measure olfactory function. Eleven percentage of the vital older adults were at risk of malnutrition, whereas 60% of the geriatric participants were malnourished or at risk. Only 2% of the vital older adults were anosmic, compared with 46% of the geriatric participants. Linear regression demonstrated a significant association (P = 0.015) between olfactory function and nutritional status in the geriatric subjects. However, this association became insignificant after adjustment for confounders. Both crude and adjusted analysis in the vital older adults did not show a significant association. The results indicate that, in both groups of elderly, there is no direct relation between olfactory function and nutritional status. We suggest that a decline in olfactory function may still be considered as one of the risk-factors for malnutrition in geriatric patients-once co-occurring with other mental and/or physical problems that are more likely to occur in those patients experience.

  4. Upper and Lower Urinary Tract Outcomes in Adult Myelomeningocele Patients: A Systematic Review

    PubMed Central

    Veenboer, Paul W.; Bosch, J. L. H. Ruud; van Asbeck, Floris W. A.; de Kort, Laetitia M. O.

    2012-01-01

    Background The introduction of sophisticated treatment of bladder dysfunction and hydrocephalus allows the majority of SB patients to survive into adulthood. However, no systematic review on urological outcome in adult SB patients is available and no follow-up schemes exist. Objectives To systematically summarize the evidence on outcome of urinary tract functioning in adult SB patients. Methods A literature search in PubMed and Embase databases was done. Only papers published in the last 25 years describing patients with open SB with a mean age >18 years were included. We focused on finding differences in the treatment strategies, e.g., clean intermittent catheterization and antimuscarinic drugs versus early urinary diversion, with regard to long-term renal and bladder outcomes. Results A total of 13 articles and 5 meeting abstracts on urinary tract status of adult SB patients were found describing a total of 1564 patients with a mean age of 26.1 years (range 3–74 years, with a few patients <18 years). All were retrospective cohort studies with relatively small and heterogeneous samples with inconsistent reporting of outcome; this precluded the pooling of data and meta-analysis. Total continence was achieved in 449/1192 (37.7%; range 8–85%) patients. Neurological level of the lesion and hydrocephalus were associated with incontinence. Renal function was studied in 1128 adult patients. In 290/1128 (25.7%; range 3–81.8%) patients some degree of renal damage was found and end-stage renal disease was seen in 12/958 (1.3%) patients. Detrusor-sphincter dyssynergy and detrusor-overactivity acted as adverse prognostic factors for the development of renal damage. Conclusions These findings should outline follow-up schedules for SB patients, which do not yet exist. Since renal and bladder deterioration continues beyond adolescence, follow-up of these individuals is needed. We recommend standardization in reporting the outcome of urinary tract function in adult SB

  5. Caries and Candida colonisation in adult patients in Basque Country (Spain).

    PubMed

    De-la-Torre, Janire; Marichalar-Mendia, Xabier; Varona-Barquin, Aketza; Marcos-Arias, Cristina; Eraso, Elena; Aguirre-Urizar, José Manuel; Quindós, Guillermo

    2016-01-12

    Candida albicans is one of the most frequent pathogens of the oral cavity, as a major cause of opportunistic disease. Moreover, Candida could be a cofactor of common oral diseases, such as dental caries. The aim of this study was to analyse the oral yeast colonisation in adults with dental caries and to evaluate its relationship with this clinical entity. We studied 190 patients distributed into controls (58 patients) and patients with caries (132 patients). Oral samples were collected by oral rinse and cultured in a chromogenic agar. C. albicans was the most prevalent species isolated from oral specimens in both groups. Patients with caries had a greater Candida colonisation (74 patients, 56.1%), than persons without caries (18 patients, 31%, P < 0.01). Patients with caries were significantly more colonised by non-C. albicans species than individuals without caries (P = 0.006). Moreover, the diversity of Candida species was richer in patients suffering from caries. The odds ratio of the colonisation of patients with caries was 3.144 (95% CI 1.525-5.478). There is a significant clinical correlation between dental caries and oral Candida colonisation in adults.

  6. [Diagnosis and treatment of opportunistic infections in HIV/AIDS adult patients].

    PubMed

    Lasso B, Martín

    2011-10-01

    The following guidelines for the diagnosis and treatment of opportunistic infections (OI) in adult HIV/AIDS patients represent the first approach to standardize the management of this patient group in Chile. The guidelines are based on scientific evidence. They intend to serve as a practical and easy-to-use tool for physicians during the process of selecting appropriate diagnostic tests and effective treatments for their patients. They also include the local experience in Chile related to OI in HIV/AIDS patients. Regular up-dates to include new scientific knowledge are proposed.

  7. Multidimensional Clinical Phenotyping of an Adult Cystic Fibrosis Patient Population

    PubMed Central

    Conrad, Douglas J.; Bailey, Barbara A.

    2015-01-01

    Background Cystic Fibrosis (CF) is a multi-systemic disease resulting from mutations in the Cystic Fibrosis Transmembrane Regulator (CFTR) gene and has major manifestations in the sino-pulmonary, and gastro-intestinal tracts. Clinical phenotypes were generated using 26 common clinical variables to generate classes that overlapped quantiles of lung function and were based on multiple aspects of CF systemic disease. Methods The variables included age, gender, CFTR mutations, FEV1% predicted, FVC% predicted, height, weight, Brasfield chest xray score, pancreatic sufficiency status and clinical microbiology results. Complete datasets were compiled on 211 subjects. Phenotypes were identified using a proximity matrix generated by the unsupervised Random Forests algorithm and subsequent clustering by the Partitioning around Medoids (PAM) algorithm. The final phenotypic classes were then characterized and compared to a similar dataset obtained three years earlier. Findings Clinical phenotypes were identified using a clustering strategy that generated four and five phenotypes. Each strategy identified 1) a low lung health scores phenotype, 2) a younger, well-nourished, male-dominated class, 3) various high lung health score phenotypes that varied in terms of age, gender and nutritional status. This multidimensional clinical phenotyping strategy identified classes with expected microbiology results and low risk clinical phenotypes with pancreatic sufficiency. Interpretation This study demonstrated regional adult CF clinical phenotypes using non-parametric, continuous, ordinal and categorical data with a minimal amount of subjective data to identify clinically relevant phenotypes. These studies identified the relative stability of the phenotypes, demonstrated specific phenotypes consistent with published findings and identified others needing further study. PMID:25822311

  8. Comparison of epileptic and nonepileptic cases with centrotemporal spikes in view of clinical findings and electroencephalographic characteristics.

    PubMed

    Tombul, Temel; Anlar, Omer; Caksen, Hüseyin

    2006-03-01

    The morphological features of centrotemporal spike discharges (CTSD) and relationship of them with clinical diagnosis in cases with benign epilepsy of childhood with centrotemporal spikes (BECTS) and the other epileptic syndromes of childhood as well as some nonconvulsive neurological disorders were detected in the routine patient population who referred to the authors' EEG laboratory. Thirty-six cases (21 males, 15 females; 8 months-14 years old), in which awake and/or sleep EEGs revealed CTSD were included in this study. The cases were divided into two groups as epileptic and nonepileptic. The cases with seizure were divided into BECTS and the other epilepsies. Of the epileptic cases, 14 (38.8%) patients had typical rolandic seizures. In five cases, there were partial or secondary generalized seizures. Two cases had myoclonic seizures. In the nonepileptic group, there was mental retardation/behavioral disturbances in five cases; there were periodic syndromes of childhood such as migraine and equivalents of migraine in three cases; febrile convulsion in three cases, breath-holding spells in two cases, and primary enuresis nocturna in two cases. In the nonepileptic group, the discharges were significantly fewer than the other groups (p = .014). More frequent discharges occuring for shorter periods were more significantly observed in BECTS group (64%). Typically isolated spike and slow-waves in T3/T4 and C3/C4 location were significantly more common (86%) in rolandic epilepsy group (p = .01). The EEGs of cases with BECTS had more frequency in the cluster of discharges than the other groups (p = .018). Multifocal discharges were observed in 28.5% of cases with BECTS, in 20% of nonepileptic group, and in 71.4% of other epileptics in the trial. Although these epileptic and nonepileptic conditions have some differences in view of frequency and morphology and location, CTSDs could be manifested in the group without seizure. It was concluded that the similar focal

  9. Diaphragm plication following phrenic nerve injury: a comparison of paediatric and adult patients

    PubMed Central

    Simansky, D; Paley, M; Refaely, Y; Yellin, A

    2002-01-01

    Background: A study was undertaken to evaluate whether adults differ from children in the indications and outcome of diaphragmatic plication following phrenic nerve injury. Methods: A retrospective study was performed of 21 patients, 10 below the age of 5 and 11 older than 37 years. The indication for surgery for all the children was failure to wean from ventilatory support. The indications for surgery in the adult group were ventilator dependency (n=4) and symptomatic dyspnoea (n=7). All patients had at least one imaging study confirming diaphragmatic paralysis. The American Thoracic Society (ATS) dyspnoea scale, pulmonary function tests, and quantitative pulmonary perfusion scans were used as evaluation parameters. At surgery the diaphragm was centrally plicated. Results: One child died immediately after surgery due to irreversible heart failure and two children died within 2 months of surgery from ongoing complications of their original condition. These three patients were considered as selection failures. Seven children were weaned from ventilatory support within a median of 4 days (range 2–140). Only one of four ventilated adults was successfully weaned. Seven adults who underwent surgery for chronic symptoms had a marked subjective improvement of 2–3 levels in the ATS dyspnoea scale. Pulmonary function studies in the seven symptomatic adults showed a 40% improvement above baseline. Severely asymmetrical perfusion scans reverted to a normal pattern after plication. Conclusions: Diaphragmatic plication offers a significant benefit to children with diaphragmatic paralysis and should be performed early to facilitate weaning from mechanical ventilation. While plication is of limited benefit in weaning ventilated adults, it results in significant subjective and objective lifetime improvement in non-ventilated symptomatic adults. PMID:12096205

  10. Readability of online patient education materials on adult reconstruction Web sites.

    PubMed

    Polishchuk, Daniil L; Hashem, Jenifer; Sabharwal, Sanjeev

    2012-05-01

    Recommended readability of patient education materials is sixth-grade level or lower. Readability of 212 patient education materials pertaining to adult reconstruction topics available from the American Academy of Orthopaedic Surgeons, American Association of Hip and Knee Surgeons, and 3 other specialty and private practitioner Web sites was assessed using the Flesch-Kincaid grade formula. The mean Flesch-Kincaid score was 11.1 (range, 3-26.5). Only 5 (2%) articles had a readability level of sixth grade or lower. Readability of most of the articles for patient education on adult reconstruction Web sites evaluated may be too advanced for a substantial portion of patients. Further studies are needed to assess the optimal readability level of health information on the Internet.

  11. Design Considerations for Patient Portal Adoption by Low-Income, Older Adults

    PubMed Central

    Latulipe, Celine; Gatto, Amy; Nguyen, Ha T.; Miller, David P.; Quandt, Sara A.; Bertoni, Alain G.; Smith, Alden; Arcury, Thomas A.

    2016-01-01

    This paper describes the results of an interview study investigating facilitators and barriers to adoption of patient portals among low-income, older adults in rural and urban populations in the southeastern United States. We describe attitudes of this population of older adults and their current level of technology use and patient portal use. From qualitative analysis of 36 patient interviews and 16 caregiver interviews within these communities, we derive themes related to benefits of portals, barriers to use, concerns and desired features. Based on our initial findings, we present a set of considerations for designing the patient portal user experience, aimed at helping healthcare clinics to meet U.S. federally-mandated ‘meaningful use’ requirements. PMID:27077140

  12. Ordinal patterns in epileptic brains: Analysis of intracranial EEG and simultaneous EEG-fMRI

    NASA Astrophysics Data System (ADS)

    Rummel, C.; Abela, E.; Hauf, M.; Wiest, R.; Schindler, K.

    2013-06-01

    Epileptic seizures are associated with high behavioral stereotypy of the patients. In the EEG of epilepsy patients characteristic signal patterns can be found during and between seizures. Here we use ordinal patterns to analyze EEGs of epilepsy patients and quantify the degree of signal determinism. Besides relative signal redundancy and the fraction of forbidden patterns we introduce the fraction of under-represented patterns as a new measure. Using the logistic map, parameter scans are performed to explore the sensitivity of the measures to signal determinism. Thereafter, application is made to two types of EEGs recorded in two epilepsy patients. Intracranial EEG shows pronounced determinism peaks during seizures. Finally, we demonstrate that ordinal patterns may be useful for improving analysis of non-invasive simultaneous EEG-fMRI.

  13. Relationship between anxiety, depression, and morbidity in adult asthma patients

    PubMed Central

    Rimington, L; Davies, D; Lowe, D; Pearson, M

    2001-01-01

    BACKGROUND—Symptoms of disease reported by patients reflect the effects of the disease process within the individual and the person's physical and mental ability to tolerate or otherwise cope with the limitations on their functioning. This study examines the relationship between asthma symptoms, disease severity, and psychological status in patients being managed in routine primary healthcare settings.
METHODS—One hundred and fourteen subjects from four GP practices, two inner city and two suburban, were studied. Symptoms were assessed by means of the Asthma Quality of Life questionnaire (AQLQ) and a locally devised Q score, and psychological status with the Hospital Anxiety and Depression (HAD) scale. Spirometric values and details of current asthma treatment (BTS asthma guidelines treatment step) were recorded as markers of asthma severity.
RESULTS—Symptoms as measured by AQLQ correlated with peak expiratory flow (rS = 0.40) and with BTS guidelines treatment step (rS =0.25). Similarly, the Q score correlated with peak expiratory flow (rS = 0.44) and with BTS guidelines treatment step (rS =0.42). Similar levels of correlation of forced expiratory volume in one second (FEV1) with symptoms were reported. HAD anxiety and depression scores also correlated to a similar extent with these two symptom scores, but there was hardly any correlation with lung function. Logistic regression analysis showed that HAD scores help to explain symptom scores over and above the effects of lung function and BTS guidelines treatment step. Symptoms, depression, and anxiety were higher for inner city patients while little difference was observed in objective measures of asthma.
CONCLUSIONS—Asthma guidelines suggest that changing levels of symptoms should be used to monitor the effectiveness of treatment. These data suggest that reported symptoms may be misleading and unreliable because they may reflect non-asthma factors that cannot be expected to respond to changes in

  14. [Diagnosis and treatment of urea cycle disorders in adult patients].

    PubMed

    Maillot, F; Blasco, H; Lioger, B; Bigot, A; Douillard, C

    2016-10-01

    Urea cycle disorders (UCDs) are inborn errors of metabolism in which the clinical picture is mostly due to ammonia intoxication. UCD onset may be observed at any age. Acute decompensations of UCDs include neuro-psychiatric symptoms such as headache, confusion, convulsions, ataxia, agitation or delirium, as well as digestive symptoms, namely nausea and vomiting along with abdominal pain. Acute decompensations may lead to an irreversible coma in the absence of specific therapy. The first step is to measure promptly ammonemia in such patients, and start appropriate therapy on an emergency basis.

  15. Modulation of epileptic activity by deep brain stimulation: a model-based study of frequency-dependent effects

    PubMed Central

    Mina, Faten; Benquet, Pascal; Pasnicu, Anca; Biraben, Arnaud; Wendling, Fabrice

    2013-01-01

    A number of studies showed that deep brain stimulation (DBS) can modulate the activity in the epileptic brain and that a decrease of seizures can be achieved in “responding” patients. In most of these studies, the choice of stimulation parameters is critical to obtain desired clinical effects. In particular, the stimulation frequency is a key parameter that is difficult to tune. A reason is that our knowledge about the frequency-dependant mechanisms according to which DBS indirectly impacts the dynamics of pathological neuronal systems located in the neocortex is still limited. We address this issue using both computational modeling and intracerebral EEG (iEEG) data. We developed a macroscopic (neural mass) model of the thalamocortical network. In line with already-existing models, it includes interconnected neocortical pyramidal cells and interneurons, thalamocortical cells and reticular neurons. The novelty was to introduce, in the thalamic compartment, the biophysical effects of direct stimulation. Regarding clinical data, we used a quite unique data set recorded in a patient (drug-resistant epilepsy) with a focal cortical dysplasia (FCD). In this patient, DBS strongly reduced the sustained epileptic activity of the FCD for low-frequency (LFS, < 2 Hz) and high-frequency stimulation (HFS, > 70 Hz) while intermediate-frequency stimulation (IFS, around 50 Hz) had no effect. Signal processing, clustering, and optimization techniques allowed us to identify the necessary conditions for reproducing, in the model, the observed frequency-dependent stimulation effects. Key elements which explain the suppression of epileptic activity in the FCD include: (a) feed-forward inhibition and synaptic short-term depression of thalamocortical connections at LFS, and (b) inhibition of the thalamic output at HFS. Conversely, modeling results indicate that IFS favors thalamic oscillations and entrains epileptic dynamics. PMID:23882212

  16. Are daily routine chest radiographs necessary after pulmonary surgery in adult patients?

    PubMed Central

    Reeb, Jeremie; Falcoz, Pierre-Emmanuel; Olland, Anne; Massard, Gilbert

    2013-01-01

    A best evidence topic was constructed according to a structured protocol. The question addressed was whether daily routine (DR) chest radiographs (CXRs) are necessary after pulmonary surgery in adult patients. Of the 66 papers found using a report search, seven presented the best evidence to answer the clinical question. Four of these seven studies specifically addressed post-cardiothoracic adult patients. Three of these seven studies addressed intensive care unit (ICU) patients and included post-cardiothoracic adult patients in well-designed studies. Six of these seven studies compared the DR CXRs strategy to the clinically indicated, on-demand (OD) CXRs strategy. Another study analysed the clinical impact of ceasing to perform the DR, postoperative, post-chest tubes removal CXRs. The authors, journal, date and country of publication, study type, group studied, relevant outcomes and results of these papers are given. We conclude that, on the whole, the seven studies are unanimously in favour of forgoing DR CXRs after lung resection and advocate OD CXRs. One study suggested that hypoxic patients could benefit from a DR CXRs strategy, while other studies failed to identify any subgroup for whom performing DR CXRs was beneficial. Indeed, DR CXRs, commonly taken after thoracic surgery, have poor diagnostic and therapeutic value. Eliminating them for adult patients having undergone thoracic surgery significantly decreases the number of CXRs per patient without increasing mortality rates, length of hospital stays (LOSs), readmission rates and adverse events. Hence, current evidence shows that DR CXRs could be forgone after lung resection because OD CXRs, recommended by clinical monitoring, have a better impact on management and have not been proved to negatively affect patient outcomes. Moreover, an OD CXRs strategy lowers the cost of care. Nevertheless, an OD CXRs strategy requires close clinical monitoring by experienced surgeons and dedicated intensivists. However

  17. Automated Inhaled Nitric Oxide Alerts for Adult Extracorporeal Membrane Oxygenation Patient Identification

    DTIC Science & Technology

    2014-09-01

    Automated inhaled nitric oxide alerts for adult extracorporeal membrane oxygenation patient identification Slava M. Belenkiy, MD, Andriy I...Josè Salinas, PhD, and Jeremy W. Cannon, MD, San Antonio, Texas BACKGROUND: Recently, automated alerts have been used to identify patients with...initiating ECMO. This case series summarizes our experience with using automated electronic alerts for ECMO team activation focused particularly on an

  18. Evaluating patient-centered care: feasibility of electronic data collection in hospitalized older adults.

    PubMed

    Duffy, Joanne R; Kooken, Wendy Carter; Wolverton, Cheryl L; Weaver, Michael T

    2012-01-01

    Evaluating patient-centered care (PCC) is crucial to its improvement. This pilot study tested the feasibility of an electronic format to assess PCC during hospitalization. Using a validated indicator of PCC embedded on a mobile device, 86 older adults evaluated its delivery by registered nurses. Patients older than 85 years rated PCC poorer than those who were younger (r = -0.22; P = .04). The electronic format was appraised as feasible; it performed well and took on average 30 minutes to complete.

  19. [Epileptic attacks in cerebral arterial pathology. Clinical findings].

    PubMed

    Rohmer, F; Collard, M; Kurtz, D; Warter, J M; Coquillat, G

    1975-09-01

    The authors analyse, with reference to 107 cases, the incidence of epileptic attacks in different types of non-traumatic arterial pathology of the brain. They describe their various clinical and evolutive aspects and attempt to isolate those peculiar to critical manifestations of this type occurring in the course of cerebral vascular accidents.

  20. Epileptic Hypergraphia: The Impact of Prolific Writing on Language Creativity

    ERIC Educational Resources Information Center

    Ammari, Elham H.

    2012-01-01

    Catalyzed academic concerns have been shown so far to tackle the issue of temporal lobe epileptic hypergraphia and the extent of its creativity. Temporal lobe epilepsy hence, (TLE) as a neurological brain disorder, has captured the attention of concerned scholars ever since. A constellation of TLE and its cohorts have baffled scientists,…

  1. Epidemiology of adult-onset hydrocephalus: institutional experience with 2001 patients.

    PubMed

    Bir, Shyamal C; Patra, Devi Prasad; Maiti, Tanmoy K; Sun, Hai; Guthikonda, Bharat; Notarianni, Christina; Nanda, Anil

    2016-09-01

    OBJECTIVE Adult-onset hydrocephalus is not commonly discussed in the literature, especially regarding its demographic distribution. In contrast to pediatric hydrocephalus, which is related to a primary CSF pathway defect, its development in adults is often secondary to other pathologies. In this study, the authors investigated the epidemiology of adult-onset hydrocephalus as it pertains to different etiologies and in reference to age, sex, and race distributions. METHODS The authors retrospectively reviewed the clinical notes of 2001 patients with adult-onset hydrocephalus who presented to Louisiana State University Health Sciences Center within a 25-year span. Significant differences between the groups were analyzed by a chi-square test; p < 0.05 was considered significant. RESULTS The overall mean (± SEM) incidence of adult hydrocephalus in this population was 77 ± 30 per year, with a significant increase in incidence in the past decade (55 ± 3 [1990-2003] vs 102 ± 6 [2004-2015]; p < 0.0001). Hydrocephalus in a majority of the patients had a vascular etiology (45.5%) or was a result of a tumor (30.2%). The incidence of hydrocephalus in different age groups varied according to various pathologies. The incidence was significantly higher in males with normal-pressure hydrocephalus (p = 0.03) or head injury (p = 0.01) and higher in females with pseudotumor cerebri (p < 0.0001). In addition, the overall incidence of hydrocephalus was significantly higher in Caucasian patients (p = 0.0002) than in those of any other race. CONCLUSIONS Knowledge of the demographic variations in adult-onset hydrocephalus is helpful in achieving better risk stratification and better managing the disease in patients. For general applicability, these results should be validated in a large-scale meta-analysis based on a national population database.

  2. The contribution of adult attachment and perceived social support to depressive symptoms in patients with HIV.

    PubMed

    Hinnen, Chris; Schreuder, Imke; Jong, Eefje; van Duijn, Miranda; Dahmen, Rutger; van Gorp, Eric C M

    2012-01-01

    The present study investigated the relationship between adult attachment style and depressive symptomatology in patients with HIV. Moreover, perceived social support was investigated as a potential mediator between adult attachment and depressive symptoms. A sample of 233 HIV-infected patients (90% male) completed questionnaires assessing adult attachment style (Relationship Questionnaire), depressive symptoms (Beck Depression Inventory), and perceived social support (Medical Outcomes Study Social Support Survey). After controlling for demographic and medical variables, an insecure adult attachment style was found to be strongly related with depressive symptoms. Half of the insecurely attached patients reported clinically elevated levels of distress, while one in nine securely attached patients reported elevated levels of distress (χ(2)=32.25, p=0.001). Moreover, the association between attachment style and depressive symptomatology was found to be partly mediated through perceived social support. This study strongly supports the notion that an insecure attachment style is a vulnerability factor for developing depressive symptoms that would warrant clinical attention when confronted with a chronic illness such as HIV. The clinical implications of these findings are discussed.

  3. The relationships among separation anxiety disorder, adult attachment style and agoraphobia in patients with panic disorder.

    PubMed

    Pini, Stefano; Abelli, Marianna; Troisi, Alfonso; Siracusano, Alberto; Cassano, Giovanni B; Shear, Katherine M; Baldwin, David

    2014-12-01

    Epidemiological studies indicate that separation anxiety disorder occurs more frequently in adults than children. It is unclear whether the presence of adult separation anxiety disorder (ASAD) is a manifestation of anxious attachment, or a form of agoraphobia, or a specific condition with clinically significant consequences. We conducted a study to examine these questions. A sample of 141 adult outpatients with panic disorder participated in the study. Participants completed standardized measures of separation anxiety, attachment style, agoraphobia, panic disorder severity and quality of life. Patients with ASAD (49.5% of our sample) had greater panic symptom severity and more impairment in quality of life than those without separation anxiety. We found a greater rate of symptoms suggestive of anxious attachment among panic patients with ASAD compared to those without ASAD. However, the relationship between ASAD and attachment style is not strong, and adult ASAD occurs in some patients who report secure attachment style. Similarly, there is little evidence for the idea that separation anxiety disorder is a form of agoraphobia. Factor analysis shows clear differentiation of agoraphobic and separation anxiety symptoms. Our data corroborate the notion that ASAD is a distinct condition associated with impairment in quality of life and needs to be better recognized and treated in patients with panic disorder.

  4. Successful treatment of ileocolic intussusception with air enema reduction in an adult patient.

    PubMed

    Matsui, Satoshi; Kanemura, Takashi; Yokouchi, Yukako; Kamiichi, Hideo; Kiriu, Nobuaki; Koike, Yuji

    2014-05-01

    Intussusception is a rare condition in adults, representing only 1% of all bowel obstructions. In adult cases, operative explorations are recommended to treat the bowel obstruction and to diagnose underlying diseases. The objective of the current case report was to describe the successful treatment of ileocolic intussusception with air enema reduction in an adult patient. A previously healthy 21-year-old woman had a 20-hour history of colicky abdominal pain and vomiting and was diagnosed as having idiopathic ileocolic intussusception by abdominal computed tomography. We treated the patient with air enema reduction under fluoroscopic guidance instead of an operative procedure. She received oxygen and intravenous midazolam to provide some degree of pain relief. Air was carefully pumped manually into the rectum, and the air pressure was monitored with a manometer. Because of air leakage from the rectum through the void to the outside the body, we continued to provide air to maintain the air pressure between 40 and 60 mm Hg. Three minutes after initiation of the air enema, when the patient experienced increasing abdominal pain and vomiting, the pressure was temporarily increased to greater than 100 mm Hg, and the air reached the terminal ileum. We considered the reduction successful and confirmed it with an abdominal ultrasound examination. We believe that air enema reduction is effective for treating idiopathic intussusception within 24 hours of symptom onset in young, previously healthy adult patients.

  5. A Case of Giant Cowper's Gland Syringocele in an Adult Male Patient

    PubMed Central

    Surana, Santosh; Elshazly, Mohamed; Allam, Adel; Jayappa, Sateesh; AlRefai, Deena

    2015-01-01

    Cowper's gland syringocele is an uncommon, underdiagnosed cystic dilatation of Cowper's gland ducts showing various radiological patterns. Herein we report a rare case of giant Cowper's gland syringocele in an adult male patient, with description of MRI findings and management outcome. PMID:26413368

  6. Adults Living with Limited Literacy and Chronic Illness: Patient Education Experiences

    ERIC Educational Resources Information Center

    King, Judy; Taylor, Maurice C.

    2010-01-01

    The purpose of this study was to investigate how Canadian adults living with limited literacy and chronic illness made meaning of their patient education experiences. The study used a hermeneutic phenomenological research design and employed three data sources over a nine-month period. Data was interpreted and analyzed as it was collected,…

  7. Long term renal toxicity of ifosfamide in adult patients--5 year data.

    PubMed

    Farry, James K; Flombaum, Carlos D; Latcha, Sheron

    2012-06-01

    Ifosfamide is indicated as first line treatment in a variety of solid tumours in adults. It is known to be nephrotoxic and is often used following therapy with, or as concomitant therapy with other potent nephrotoxins. To date, there are sparse case reports on the incidence of acute kidney injury (AKI) or chronic kidney disease (CKD) in adults exposed to ifosfamide. The available data on the long term renal complications for patients exposed to ifosfamide are thus based entirely on the paediatric population. The aim of this study was to assess the long term effects of ifosfamide exposure on renal function in an adult population and to determine if there are any treatment or patient specific factors that contribute to long term nephrotoxicity. The mean decline in estimated glomerular filtration rate (eGFR) following the first cycle of ifosfamide was 15 ml/min/1.73 m(2). Thereafter, there was a slower but steady decline in eGFR. No patient progressed to end stage renal disease (ESRD). Patient age and concomitant exposure to carboplatin were the only two factors which significantly affected eGFR. This represents the only long term study on the nephrotoxicity of ifosfamide in adults.

  8. An Examination of Intimate Partner Violence and Psychological Stressors in Adult Abortion Patients

    ERIC Educational Resources Information Center

    Ely, Gretchen E.; Otis, Melanie D.

    2011-01-01

    The purpose of this article is to describe an exploratory study examining the relationship between intimate partner violence and psychological stressors in a sample of 188 adult abortion patients. Results indicate the almost 15% of respondents report a history of abuse by the coconceiving partner. In addition, women who reported having had one or…

  9. Adult/Patient Nutrition Education Materials. January 1982-October 1989. Quick Bibliography Series.

    ERIC Educational Resources Information Center

    Updegrove, Natalie A.

    This publication contains abstracts of books, articles, and research studies on the subject of adult patient nutrition. The materials offer dietary guidelines for mature individuals with a variety of ailments. The citations in this bibliography were entered in the "Agricola" database between January, 1979 and October, 1989. (JD)

  10. Outcomes for adult scoliosis patients receiving chiropractic rehabilitation: a 24-month retrospective analysis

    PubMed Central

    Morningstar, Mark W.

    2011-01-01

    Objectives The purpose of this study was to retrospectively report the results of patients who completed an exercise-based chiropractic program and its potential to alter the natural progression of adult scoliosis at 24 months after the clinic portion of treatment was concluded. Methods A retrospective chart review was conducted at 2 spine clinics in Michigan, USA. Each clinic uses the same chiropractic rehabilitation program to treat patients with adult scoliosis. Multidimensional patient outcomes included radiographic, respiratory, disability, and pain parameters. Outcomes were measured at baseline, at end of active treatment, and at long-term follow-up. Results A total of 28 patients fit the inclusion criteria for the study. The average beginning primary Cobb angle was 44° ± 6°. Patients received the same chiropractic rehabilitation program for approximately 6 months. At the end of active treatment, improvements were recorded in Cobb angle, pain scores, spirometry, and disability rating. All radiographic findings were maintained at 24-month follow-up. Conclusion This report is among the first to demonstrate sustained radiographic, self-rated, and physiologic benefits after treatment ceased. After completion of a multimodal chiropractic rehabilitation treatment, a retrospective cohort of 28 adult scoliosis patients reported improvements in pain, Cobb angle, and disability immediately following the conclusion of treatment and 24 months later. PMID:22014907

  11. Basilar impression of the skull in patients with adult coeliac disease and after gastric surgery.

    PubMed

    Hurwitz, L J; Banerji, N K

    1972-02-01

    Chamberlain's, McGregor's and Bull's angle measurements for basilar impression of the skull were made on 22 adult patients with idiopathic steatorrhoea (probable gluten enteropathy), 24 patients who had had previous gastric surgery, and 48 control subjects. For each of the three measurements a value greater than the mean plus two standard deviations was taken as the upper limit of normal. In seven patients with adult steatorrhoea all three measurements were abnormal suggesting basilar impression, while basilar impression was probable in only one patient who had gastric surgery. The trend towards abnormal measurements was significant in the steatorrhoea patients but not in those who had gastric surgery. Basilar impression also was present in patients who did not have rickets or present evidence of osteomalacia. It was argued that this study could support a hypothesis that some cases of primary basilar impression of the skull are secondary to bone softening associated with malabsorption in early life, the evidence of which may have disappeared in adult life.

  12. Best Practices in Adolescent and Young Adult Patients with Acute Lymphoblastic Leukemia: A Focus on Asparaginase.

    PubMed

    Boissel, Nicolas; Sender, Leonard S

    2015-09-01

    The inclusion of asparaginase in chemotherapy regimens to treat acute lymphoblastic leukemia (ALL) has had a positive impact on survival in pediatric patients. Historically, asparaginase has been excluded from most treatment protocols for adolescent and young adult (AYA) patients because of perceived toxicity in this population, and this is believed to have contributed to poorer outcomes in these patients. However, retrospective analyses over the past 12 years have shown that 2-, 5-, and 7-year overall survival of AYA patients is significantly improved with pediatric versus adult protocols. The addition of asparaginase to adult protocols yielded high rates of first remission and improved survival. However, long-term survival remains lower compared with what has been seen in pediatrics. The notion that asparaginase is poorly tolerated by AYA patients has been challenged in multiple studies. In some, but not all, studies, the incidences of hepatic and pancreatic toxicities were higher in AYA patients, whereas the rates of hypersensitivity reactions did not appear to differ with age. There is an increased risk of venous thromboembolic events, and management with anti-coagulation therapy is recommended. Overall, the risk of therapy-related mortality is low. Together, this suggests that high-intensity pediatric protocols offer an effective and tolerable approach to treating ALL in the AYA population.

  13. Selective dorsal rhizotomy for spastic diplegia secondary to stroke in an adult patient

    PubMed Central

    Eppinger, Melissa Ann; Berman, Casey Melissa; Mazzola, Catherine Anne

    2015-01-01

    Background: Selective dorsal rhizotomy (SDR) is often recommended for children with spastic paraparesis and cerebral palsy. SDR reduces spasticity in the lower extremities for these children with spastic paraplegia. However, SDR is infrequently recommended for adults with spasticity. Spastic diplegia in adult patients can be due to stroke, brain or spinal cord injury from trauma, infection, toxic-metabolic disorders, and other causes. Although rarely considered, SDR is an option for adult patients with spastic diplegia as well. Case Description: The authors describe a patient who underwent a SDR with a successful postoperative outcome. This man suffered a hypertensive and hemorrhagic stroke secondary to intravenous drug abuse at age 46. A SDR was performed after two failed intrathecal baclofen pump placements due to recurrent infections, likely resulting from his immunocompromised status. The patient underwent lumbar laminectomies and dorsal rhizotomies at levels L1-S1 bilaterally. Postoperatively, the patient's spasticity was significantly reduced. His Ashworth spasticity score decreased from 4/5 to 1/5, and the reduction in tone has been durable over 3 years. Conclusion: SDR in older patients with spastic paraparesis may be considered as a treatment option. PMID:26167363

  14. Changes in Quality of Life in 7 Older Adult Patients Receiving Activator Methods Chiropractic Technique

    PubMed Central

    Russell, David G.; Kimura, Melissa N.; Cowie, Harriet R.; de Groot, Caroline M.M.; McMinn, Elise A.P.; Sherson, Matthew W.

    2016-01-01

    Objective The purpose of this case series is to report on symptomatic and quality of life (QoL) changes in 7 older adult chiropractic patients who were receiving care using Activator Methods Chiropractic Technique (AMCT). Clinical Features Seven patients were selected from 2 chiropractic offices in Auckland, New Zealand. Patients were included if they were older adults receiving AMCT care and for whom at least 2 QoL assessments had been performed. The patients, aged 69-80 years, primarily received care for a variety of musculoskeletal complaints. Intervention and Outcomes The patients reported improvements in their presenting complaints as well as a number of nonmusculoskeletal symptoms. Each patient demonstrated clinical improvements in their RAND 36-Item Short Form Health Survey (SF-36) results. The average improvement in QoL measured using a SF-36 questionnaire was 8.0 points in the physical component and 4.1 points in the mental component. Four cases had a second progress evaluation using the SF-36 and showed an overall improvement of 5.2 in the physical and 9.8 in the mental components from baseline. Conclusion This case series describes an improvement in QoL, as measured by the SF-36 instrument, as well as subjectively reported improvements in both musculoskeletal and nonmusculoskeletal symptoms in 7 older adults receiving chiropractic care. PMID:27069434

  15. Splenic Doppler resistive index for early detection of occult hemorrhagic shock after polytrauma in adult patients.

    PubMed

    Corradi, Francesco; Brusasco, Claudia; Garlaschi, Alessandro; Santori, Gregorio; Vezzani, Antonella; Moscatelli, Paolo; Pelosi, Paolo

    2012-11-01

    The objective of this study was to evaluate whether direct assessment of splenic circulation by splenic Doppler resistive index (Doppler RI) is a clinically useful noninvasive method for an early detection of occult hemorrhagic shock after polytrauma in adult patients. Splenic Doppler RI was measured in 49 hemodynamically stable adult patients admitted to the emergency department because of polytrauma. Renal Doppler RI was also determined in 20 patients. Spleen size, Injury Severity Score, systolic blood pressure, heart rate, blood lactate, standard base excess, pH, hemoglobin, and inferior vena cava diameter values were recorded at admission and at 24 h. Patients were grouped according to whether signs of hemorrhagic shock did (n = 22) or did not (n = 27) occur within the first 24 h from admission. Patients who developed hemorrhagic shock had significantly higher splenic and renal Doppler RI, higher Injury Severity Score, and lower standard base excess at admission. By multivariate logistic regression, splenic Doppler RI resulted to be a predictor of hemorrhagic shock development within the first 24 h from admission. Splenic Doppler RI may represent a clinically useful noninvasive method for early detection of occult hemorrhagic shock and persistent occult hypoperfusion after polytrauma in adult patients.

  16. Weighted and directed interactions in evolving large-scale epileptic brain networks.

    PubMed

    Dickten, Henning; Porz, Stephan; Elger, Christian E; Lehnertz, Klaus

    2016-10-06

    Epilepsy can be regarded as a network phenomenon with functionally and/or structurally aberrant connections in the brain. Over the past years, concepts and methods from network theory substantially contributed to improve the characterization of structure and function of these epileptic networks and thus to advance understanding of the dynamical disease epilepsy. We extend this promising line of research and assess-with high spatial and temporal resolution and using complementary analysis approaches that capture different characteristics of the complex dynamics-both strength and direction of interactions in evolving large-scale epileptic brain networks of 35 patients that suffered from drug-resistant focal seizures with different anatomical onset locations. Despite this heterogeneity, we find that even during the seizure-free interval the seizure onset zone is a brain region that, when averaged over time, exerts strongest directed influences over other brain regions being part of a large-scale network. This crucial role, however, manifested by averaging on the population-sample level only - in more than one third of patients, strongest directed interactions can be observed between brain regions far off the seizure onset zone. This may guide new developments for individualized diagnosis, treatment and control.

  17. Differential Effect of Neuropeptides on Excitatory Synaptic Transmission in Human Epileptic Hippocampus.

    PubMed

    Ledri, Marco; Sørensen, Andreas T; Madsen, Marita G; Christiansen, Søren H; Ledri, Litsa Nikitidou; Cifra, Alessandra; Bengzon, Johan; Lindberg, Eva; Pinborg, Lars H; Jespersen, Bo; Gøtzsche, Casper R; Woldbye, David P D; Andersson, My; Kokaia, Merab

    2015-07-01

    Development of novel disease-modifying treatment strategies for neurological disorders, which at present have no cure, represents a major challenge for today's neurology. Translation of findings from animal models to humans represents an unresolved gap in most of the preclinical studies. Gene therapy is an evolving innovative approach that may prove useful for clinical applications. In animal models of temporal lobe epilepsy (TLE), gene therapy treatments based on viral vectors encoding NPY or galanin have been shown to effectively suppress seizures. However, how this translates to human TLE remains unknown. A unique possibility to validate these animal studies is provided by a surgical therapeutic approach, whereby resected epileptic tissue from temporal lobes of pharmacoresistant patients are available for neurophysiological studies in vitro. To test whether NPY and galanin have antiepileptic actions in human epileptic tissue as well, we applied these neuropeptides directly to human hippocampal slices in vitro. NPY strongly decreased stimulation-induced EPSPs in dentate gyrus and CA1 (up to 30 and 55%, respectively) via Y2 receptors, while galanin had no significant effect. Receptor autoradiographic binding revealed the presence of both NPY and galanin receptors, while functional receptor binding was only detected for NPY, suggesting that galanin receptor signaling may be impaired. These results underline the importance of validating findings from animal studies in human brain tissue, and advocate for NPY as a more appropriate candidate than galanin for future gene therapy trials in pharmacoresistant TLE patients.

  18. Weighted and directed interactions in evolving large-scale epileptic brain networks

    NASA Astrophysics Data System (ADS)

    Dickten, Henning; Porz, Stephan; Elger, Christian E.; Lehnertz, Klaus

    2016-10-01

    Epilepsy can be regarded as a network phenomenon with functionally and/or structurally aberrant connections in the brain. Over the past years, concepts and methods from network theory substantially contributed to improve the characterization of structure and function of these epileptic networks and thus to advance understanding of the dynamical disease epilepsy. We extend this promising line of research and assess—with high spatial and temporal resolution and using complementary analysis approaches that capture different characteristics of the complex dynamics—both strength and direction of interactions in evolving large-scale epileptic brain networks of 35 patients that suffered from drug-resistant focal seizures with different anatomical onset locations. Despite this heterogeneity, we find that even during the seizure-free interval the seizure onset zone is a brain region that, when averaged over time, exerts strongest directed influences over other brain regions being part of a large-scale network. This crucial role, however, manifested by averaging on the population-sample level only – in more than one third of patients, strongest directed interactions can be observed between brain regions far off the seizure onset zone. This may guide new developments for individualized diagnosis, treatment and control.

  19. Weighted and directed interactions in evolving large-scale epileptic brain networks

    PubMed Central

    Dickten, Henning; Porz, Stephan; Elger, Christian E.; Lehnertz, Klaus

    2016-01-01

    Epilepsy can be regarded as a network phenomenon with functionally and/or structurally aberrant connections in the brain. Over the past years, concepts and methods from network theory substantially contributed to improve the characterization of structure and function of these epileptic networks and thus to advance understanding of the dynamical disease epilepsy. We extend this promising line of research and assess—with high spatial and temporal resolution and using complementary analysis approaches that capture different characteristics of the complex dynamics—both strength and direction of interactions in evolving large-scale epileptic brain networks of 35 patients that suffered from drug-resistant focal seizures with different anatomical onset locations. Despite this heterogeneity, we find that even during the seizure-free interval the seizure onset zone is a brain region that, when averaged over time, exerts strongest directed influences over other brain regions being part of a large-scale network. This crucial role, however, manifested by averaging on the population-sample level only – in more than one third of patients, strongest directed interactions can be observed between brain regions far off the seizure onset zone. This may guide new developments for individualized diagnosis, treatment and control. PMID:27708381

  20. The dynamics of the epileptic brain reveal long-memory processes.

    PubMed

    Cook, Mark J; Varsavsky, Andrea; Himes, David; Leyde, Kent; Berkovic, Samuel Frank; O'Brien, Terence; Mareels, Iven

    2014-01-01

    The pattern of epileptic seizures is often considered unpredictable and the interval between events without correlation. A number of studies have examined the possibility that seizure activity respects a power-law relationship, both in terms of event magnitude and inter-event intervals. Such relationships are found in a variety of natural and man-made systems, such as earthquakes or Internet traffic, and describe the relationship between the magnitude of an event and the number of events. We postulated that human inter-seizure intervals would follow a power-law relationship, and furthermore that evidence for the existence of a long-memory process could be established in this relationship. We performed a post hoc analysis, studying eight patients who had long-term (up to 2 years) ambulatory intracranial EEG data recorded as part of the assessment of a novel seizure prediction device. We demonstrated that a power-law relationship could be established in these patients (β = - 1.5). In five out of the six subjects whose data were sufficiently stationary for analysis, we found evidence of long memory between epileptic events. This memory spans time scales from 30 min to 40 days. The estimated Hurst exponents range from 0.51 to 0.77 ± 0.01. This finding may provide evidence of phase-transitions underlying the dynamics of epilepsy.

  1. Dynamic Causal Modelling of epileptic seizure propagation pathways: a combined EEG-fMRI study.

    PubMed

    Murta, Teresa; Leal, Alberto; Garrido, Marta I; Figueiredo, Patrícia

    2012-09-01

    Simultaneous EEG-fMRI offers the possibility of non-invasively studying the spatiotemporal dynamics of epileptic activity propagation from the focus towards an extended brain network, through the identification of the haemodynamic correlates of ictal electrical discharges. In epilepsy associated with hypothalamic hamartomas (HH), seizures are known to originate in the HH but different propagation pathways have been proposed. Here, Dynamic Causal Modelling (DCM) was employed to estimate the seizure propagation pathway from fMRI data recorded in a HH patient, by testing a set of clinically plausible network connectivity models of discharge propagation. The model consistent with early propagation from the HH to the temporal-occipital lobe followed by the frontal lobe was selected as the most likely model to explain the data. Our results demonstrate the applicability of DCM to investigate patient-specific effective connectivity in epileptic networks identified with EEG-fMRI. In this way, it is possible to study the propagation pathway of seizure activity, which has potentially great impact in the decision of the surgical approach for epilepsy treatment.

  2. Clinical approach to renal tubular acidosis in adult patients.

    PubMed

    Reddy, P

    2011-03-01

    Renal tubular acidosis (RTA) is a group of disorders observed in patients with normal anion gap metabolic acidosis. There are three major forms of RTA: A proximal (type II) RTA and two types of distal RTAs (type I and type IV). Proximal (type II) RTA originates from the inability to reabsorb bicarbonate normally in the proximal tubule. Type I RTA is associated with inability to excrete the daily acid load and may present with hyperkalaemia or hypokalaemia. The most prominent abnormality in type IV RTA is hyperkalaemia caused by hypoaldosteronism. This article extensively reviews the mechanism of hydrogen ion generation from metabolism of normal diet and various forms of RTA leading to disruptions of normal acid-base handling by the kidneys.

  3. Interdisciplinary treatment of an adult patient with old extraction sites.

    PubMed

    Taner, Tülin Ugur; Germec, Derya; Er, Nuray; Tulunoglu, Ibrahim

    2006-11-01

    This case report describes the interdisciplinary treatment of a 31-year-old female patient showing a protrusive profile, maxillary constriction, mandibular crowding, a Class III canine relationship complicated with multiple missing teeth, old atrophic extraction sites, and periodontal defects. The lower dental arch irregularity was eliminated by air-rotor stripping (ARS). The upper extraction site was opened for prosthetic rehabilitation, whereas closure of the lower extraction space was preferred. The narrow alveolar crest of the atrophic bone was augmented with the use of autogenous bone, beta-tricalcium phosphate (Cerasorb), and autogenous platelet-rich plasma. A functional and esthetic occlusion in an improved facial profile was established at the end of orthodontic treatment combined with ARS technique, surgery, and prosthodontics.

  4. Dietary Intake In Adult Female Coeliac Disease Patients In Slovenia

    PubMed Central

    Mičetić-Turk, Dušanka

    2016-01-01

    Abstract Objectives The aim of the study was to assess dietary intake of coeliac disease (CD) patients and to determine if they are meeting the dietary reference values for a balanced diet. Subjects/Methods 40 women with CD, aged from 23 to 76 participated in our study. Total daily intake was assessed by a three-day food diary. Resting metabolic rate (RMR) was calculated using Harris-Benedict equation. Considering physical activity level (PAL) 1.4, the recommended total energy expenditure (TEE) value was determined. The data was evaluated with professional evaluation software Prodi and statistically analysed. Results 40 participants returned the food diary. The average energy intake was significantly too low to ensure the meeting of all-day energy needs (p<0.05). The meals contained a recommended proportion of protein, but a statistically significantly higher proportion of fat (p<0.05), lower proportion of carbohydrates and a significantly lower intake of dietary fibre (p<0.05). Regarding macro-, micro- elements and vitamins, there was a significant lack in the intake of calcium and iodine, folic acid, vitamin D and vitamin A (p<0.05), meanwhile iron intake was at the lower limit of the recommended intake, whereas zinc, potassium and vitamin K intake were significantly higher according to the recommended values, but were comparable with the intake of the general population in the Central European area. Conclusion Even in subjects with adequate or low daily energy intake, their meals contained too much fat, too few carbohydrates and dietary fibre as well as inorganic substances. The patients with CD should get regular nutritional monitoring and education on the quality and balance of a gluten-free diet. PMID:27284377

  5. Comorbidity of Adult Attention Deficit and Hyperactivity Disorder in Bipolar and Unipolar Patients

    PubMed Central

    HARMANCI, Hatice; ÇAM ÇELİKEL, Feryal; ETİKAN, İlker

    2016-01-01

    Introduction The co-occurrence of attention deficit hyperactivity disorder (ADHD) in affective disorder patients is considerably high. The aims of the present study were to search for the frequency and impact of ADHD co-occurrence on the clinical features of affective disorders and to examine the relationship between the dominant affective temperaments and ADHD. Methods In total, 100 patients with bipolar disorder (BD), 100 patients with major depressive disorder (MDD), and 100 healthy controls (HC) were included. All diagnoses were assigned according to DSM-IV-TR criteria. The Adult Attention Deficit and Hyperactivity Self-Report Scale (ASRS); Wender Utah Rating Scale (WURS); and Temperament Evaluation of Memphis, Pisa, Paris, and San Diego Autoquestionnaire (TEMPS-A) were applied to all participants. Results The percentage of BD patients meeting the criteria for a diagnosis of current ADHD was 48% compared with the percentage of MDD patients and HCC subjects, i.e., 25% and 12%, respectively. ADHD was significantly more frequent in bipolar adults than in not only HC but also depressive patients. In the BD group, patients with a comorbid ADHD diagnosis had significantly more suicidal history than those without ADHD. The scores of the temperament traits, namely depressive, cyclothymic, irritable, and anxious, were significantly higher in subjects with ADHD in all groups, including in HC. Conclusion The most important findings of the present study were the observations that (1) the frequency of ADHD is considerably high among bipolar patients; (2) the frequency of suicide attempts is high in the bipolar patient group with comorbid ADHD; and (3) depressive, cyclothymic, irritable, and anxious temperaments are significantly associated with ADHD comorbidity in bipolar and depressive patients as well as in HC. The high comorbidity and chronic course of ADHD and its possible negative influence on the course of both disorders increase the importance of screening for adult

  6. Molecular Diagnostic Experience of Whole-Exome Sequencing in Adult Patients

    PubMed Central

    Posey, Jennifer E.; Rosenfeld, Jill A.; James, Regis A.; Bainbridge, Matthew; Niu, Zhiyv; Wang, Xia; Dhar, Shweta; Wiszniewski, Wojciech; Akdemir, Zeynep H.C.; Gambin, Tomasz; Xia, Fan; Person, Richard E.; Walkiewicz, Magdalena; Shaw, Chad A.; Sutton, V. Reid; Beaudet, Arthur L.; Muzny, Donna; Eng, Christine M.; Yang, Yaping; Gibbs, Richard A.; Lupski, James R.; Boerwinkle, Eric; Plon, Sharon E.

    2015-01-01

    Purpose Whole exome sequencing (WES) is increasingly used as a diagnostic tool in medicine, but prior reports focus on predominantly pediatric cohorts with neurologic or developmental disorders. We describe the diagnostic yield and characteristics of whole exome sequencing in adults. Methods We performed a retrospective analysis of consecutive WES reports for adults from a diagnostic laboratory. Phenotype composition was determined using Human Phenotype Ontology terms. Results Molecular diagnoses were reported for 17.5% (85/486) of adults, lower than a primarily pediatric population (25.2%; p=0.0003); the diagnostic rate was higher (23.9%) in those 18–30 years of age compared to patients over 30 years (10.4%; p=0.0001). Dual Mendelian diagnoses contributed to 7% of diagnoses, revealing blended phenotypes. Diagnoses were more frequent among individuals with abnormalities of the nervous system, skeletal system, head/neck, and growth. Diagnostic rate was independent of family history information, and de novo mutations contributed to 61.4% of autosomal dominant diagnoses. Conclusion Early WES experience in adults demonstrates molecular diagnoses in a substantial proportion of patients, informing clinical management, recurrence risk and recommendations for relatives. A positive family history was not predictive, consistent with molecular diagnoses often revealed by de novo events, informing the Mendelian basis of genetic disease in adults. PMID:26633545

  7. Urinary tract infections in adult general practice patients.

    PubMed Central

    Hummers-Pradier, Eva; Kochen, Michael M

    2002-01-01

    Urinary tract infections (UTIs) are symptomatic infections of the urinary tract, mainly caused by the bacterium Escherichia coli. One in two women suffers from a UTI at least once in her life. The young and sexually active are particulaly affected, but it is also seen in elderly, postmenopausal women. The likelihood of recurrence is high. Diagnosis is made with regard to typical complaints and the presence of leucocytes and nitrites in the urine. A culture is unnecessary in most cases. Uncomplicated UTI should be distinguished from complicated UTI, which has a risk of severe illness. The treatment of choice--short-term therapy with trimethoprim or nitrofurantoin--is successful in over 80% of the cases. Co-trimoxazol fluoroquinolones or cephalsporins are not considered first-choice drugs. There are indications that general practitioners' (GPs') management of UTI is not always optimal, specifically concerning diagnostic tests, the application of second-choice antibiotics, and the length of prescribed treatment courses. Many points relevant to GPs requirefurther research, such as epidemiology and resistance of urinary pathogens in the community and natural history of UTI, as well as optimal management in elderly or complicated patients and men. PMID:12236281

  8. A novel epileptic encephalopathy mutation in KCNB1 disrupts Kv2.1 ion selectivity, expression, and localization

    PubMed Central

    Thiffault, Isabelle; Speca, David J.; Austin, Daniel C.; Cobb, Melanie M.; Eum, Kenneth S.; Safina, Nicole P.; Grote, Lauren; Farrow, Emily G.; Miller, Neil; Soden, Sarah; Kingsmore, Stephen F.

    2015-01-01

    The epileptic encephalopathies are a group of highly heterogeneous genetic disorders. The majority of disease-causing mutations alter genes encoding voltage-gated ion channels, neurotransmitter receptors, or synaptic proteins. We have identified a novel de novo pathogenic K+ channel variant in an idiopathic epileptic encephalopathy family. Here, we report the effects of this mutation on channel function and heterologous expression in cell lines. We present a case report of infantile epileptic encephalopathy in a young girl, and trio-exome sequencing to determine the genetic etiology of her disorder. The patient was heterozygous for a de novo missense variant in the coding region of the KCNB1 gene, c.1133T>C. The variant encodes a V378A mutation in the α subunit of the Kv2.1 voltage-gated K+ channel, which is expressed at high levels in central neurons and is an important regulator of neuronal excitability. We found that expression of the V378A variant results in voltage-activated currents that are sensitive to the selective Kv2 channel blocker guangxitoxin-1E. These voltage-activated Kv2.1 V378A currents were nonselective among monovalent cations. Striking cell background–dependent differences in expression and subcellular localization of the V378A mutation were observed in heterologous cells. Further, coexpression of V378A subunits and wild-type Kv2.1 subunits reciprocally affects their respective trafficking characteristics. A recent study reported epileptic encephalopathy-linked missense variants that render Kv2.1 a tonically activated, nonselective cation channel that is not voltage activated. Our findings strengthen the correlation between mutations that result in loss of Kv2.1 ion selectivity and development of epileptic encephalopathy. However, the strong voltage sensitivity of currents from the V378A mutant indicates that the loss of voltage-sensitive gating seen in all other reported disease mutants is not required for an epileptic encephalopathy

  9. Giardia Assemblages A and B in Diarrheic Patients: A Comparative Study in Egyptian Children and Adults.

    PubMed

    El Basha, Noussa R; Zaki, Mayssa M; Hassanin, Omayma M; Rehan, Mohamed K; Omran, Dalia

    2016-02-01

    Giardia duodenalis is considered the most common intestinal parasite in humans worldwide. Children are especially affected, with more severe consequences than adults. The present study was designed to determine the distribution of assemblages A and B Giardia infection in children and adults, with the use of light microscopy and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) as diagnostic procedures, and to investigate its associations with clinical and epidemiological data collected from children and adult groups. This cross-sectional study was conducted from October 2012 to October 2013 by collecting fecal samples from 200 children and 200 adults complaining of diarrhea. Samples were subjected to parasitological examination by direct wet smear and formol-ether methods. Genotyping of G. doudenalis samples was conducted by PCR-RFLP analysis. Giardia duodenalis infection caused by assemblages A and B was identified in 60 samples, 34 from children and 26 from adults. Assemblage B was detected in 38 patients (63.34%), and assemblage A was detected in 22 patients (36.66%). Assemblage A was significantly more frequent in children with age range 2-8 yr, and assemblage B was higher in children with age range 6-16 yr old. Diarrhea frequency/day and recurrences per month affected patients infected with assemblage A (P value < 0.001) more frequently. Children infected with assemblage A presented significantly more severe diarrhea and dehydration than those infected with assemblage B (P value < 0.001). Although both Giardia assemblages A and B were identified in children and adults, assemblage A infected younger children more frequently and was more closely related to severe clinical manifestations than assemblage B.

  10. Impaired dendritic inhibition leads to epileptic activity in a computer model of CA3.

    PubMed

    Sanjay, M; Neymotin, Samuel A; Krothapalli, Srinivasa B

    2015-11-01

    Temporal lobe epilepsy (TLE) is a common type of epilepsy with hippocampus as the usual site of origin. The CA3 subfield of hippocampus is reported to have a low epileptic threshold and hence initiates the disorder in patients with TLE. This study computationally investigates how impaired dendritic inhibition of pyramidal cells in the vulnerable CA3 subfield leads to generation of epileptic activity. A model of CA3 subfield consisting of 800 pyramidal cells, 200 basket cells (BC) and 200 Oriens-Lacunosum Moleculare (O-LM) interneurons was used. The dendritic inhibition provided by O-LM interneurons is reported to be selectively impaired in some TLEs. A step-wise approach is taken to investigate how alterations in network connectivity lead to generation of epileptic patterns. Initially, dendritic inhibition alone was reduced, followed by an increase in the external inputs received at the distal dendrites of pyramidal cells, and finally additional changes were made at the synapses between all neurons in the network. In the first case, when the dendritic inhibition of pyramidal cells alone was reduced, the local field potential activity changed from a theta-modulated gamma pattern to a prominently gamma frequency pattern. In the second case, in addition to this reduction of dendritic inhibition, with a simultaneous large increase in the external excitatory inputs received by pyramidal cells, the basket cells entered a state of depolarization block, causing the network to generate a typical ictal activity pattern. In the third case, when the dendritic inhibition onto the pyramidal cells was reduced and changes were simultaneously made in synaptic connectivity between all neurons in the network, the basket cells were again observed to enter depolarization block. In the third case, impairment of dendritic inhibition required to generate an ictal activity pattern was lesser than the two previous cases. Moreover, the ictal like activity began earlier in the third case

  11. Serum adipocytokine profile and metabolic syndrome in young adult female dermatomyositis patients

    PubMed Central

    Silva, Marilda Guimarães; Borba, Eduardo Ferreira; de Mello, Suzana Beatriz Veríssimo; Shinjo, Samuel Katsuyuki

    2016-01-01

    OBJECTIVES: To analyse the frequency of metabolic syndrome in young adult female dermatomyositis patients and its possible association with clinical and laboratory dermatomyositis-related features and serum adipocytokines. METHOD: This cross-sectional study included 35 dermatomyositis patients and 48 healthy controls. Metabolic syndrome was defined according to the 2009 Joint Interim Statement. RESULTS: Patient age was comparable in the dermatomyositis and control groups, and the median disease duration was 1.0 year. An increased prevalence of metabolic syndrome was detected in the dermatomyositis group (34.3% vs. 6.3%; p=0.001). In addition, increased serum adiponectin and resistin levels were noted in contrast to lower leptin levels. In dermatomyositis patients, adipocytokine levels were correlated with the levels of total cholesterol, low-density cholesterol, triglycerides and muscle enzymes. A comparison of dermatomyositis patients with (n=12) and without (n=23) syndrome metabolic revealed that adipocytokine levels were also correlated with age, and that dermatomyositis patients with metabolic syndrome tended to have more disease activity despite similar adipocytokine levels. CONCLUSIONS: Metabolic syndrome is highly prevalent in young adult female dermatomyositis patients and is related to age and disease activity. Moreover, increased serum adiponectin and resistin levels were detected in dermatomyositis patients, but lower serum leptin levels were observed. PMID:28076515

  12. Multiple pathogens in adult patients admitted with community-acquired pneumonia: a one year prospective study of 346 consecutive patients.

    PubMed Central

    Lieberman, D.; Schlaeffer, F.; Boldur, I.; Lieberman, D.; Horowitz, S.; Friedman, M. G.; Leiononen, M.; Horovitz, O.; Manor, E.; Porath, A.

    1996-01-01

    BACKGROUND: The purpose of this study was to assess the causes of community-acquired pneumonia in adult patients admitted to hospital. METHODS: A prospective study was performed on 346 consecutive adult patients (54% men) of mean (SD) 49.3 (19.5) years (range 17-94) admitted to a university affiliated regional hospital in southern Israel with community-acquired pneumonia over a period of one year. Convalescent serum samples were obtained from 308 patients (89%). The aetiological diagnosis for community-acquired pneumonia was based on positive blood cultures and/or significant changes in antibody titres to Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, respiratory viruses, Coxiella burnetii, Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella sp. RESULTS: The aetiology of community-acquired pneumonia was identified in 279 patients (80.6%). The distribution of causal agents was as follows: S pneumoniae, 148 patients (42.8%); M pneumoniae, 101 (29.2%); C pneumoniae, 62 (17.9%); Legionella sp, 56 (16.2%); respiratory viruses, 35 (10.1%); C burnetii, 20 (5.8%); H influenzae 19 (5.5%); and other causes, 21 patients (6.0%). In patients above the age of 55 years C pneumoniae was the second most frequent aetiological agent (25.5%). In 133 patients (38.4%) more than one causal agent was found. CONCLUSIONS: The causal agents for community-acquired pneumonia in Israel are different from those described in other parts of the world. In many of the patients more than one causal agent was found. In all these patients treatment should include a macrolide antibiotic, at least in the first stage of their illness. PMID:8711652

  13. Total corpus callosotomy for epileptic spasms after acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) in a case with tuberous sclerosis complex.

    PubMed

    Okanishi, Tohru; Fujimoto, Ayataka; Motoi, Hirotaka; Kanai, Sotaro; Nishimura, Mitsuyo; Yamazoe, Tomohiro; Takagi, Atsushi; Yamamoto, Takamichi; Enoki, Hideo

    2016-12-03

    Corpus callosotomy is a palliative therapy for refractory epilepsy, including West syndrome, without a resectable epileptic focus. The surgical outcome of corpus callosotomy is relatively favorable in cryptogenic (non-lesional) West syndrome. Tuberous sclerosis complex (TSC) is a disorder that frequently leads to the development of refractory seizures by multiple cortical tubers. The multiple cortical tubers cause multiple or wide epileptic networks in these cases. Most of West syndrome cases in TSC with multiple tubers need additional resective surgery after corpus callosotomy. We describe a case of TSC in a boy aged 4years and 8months. He had multiple cortical tubers on his brain and developed epileptic spasms. The seizures were controlled with valproate. At the age of 1year and 4months, he presented with acute encephalopathy with biphasic seizures and late reduced diffusion (AESD), and had relapsed epileptic spasms one month after the onset of the encephalopathy. The seizures were refractory to multiple antiepileptic drugs. A total corpus callosotomy was performed at the age of 3years and 8months. The patient did not show any seizures after the surgery. During 12months of the follow-up, the patient was free from any seizures. Even in cases of symptomatic WS with multiple lesions, total corpus callosotomy may be a good strategy if the patients have secondary diffuse brain insults.

  14. A survey on patient perception of reduced-intensity transplantation in adults with sickle cell disease.

    PubMed

    Chakrabarti, S; Bareford, D

    2007-04-01

    The development of reduced-intensity conditioning (RIC) and the success of BMT for paediatric sickle cell disease (SCD) have raised the possibility of revisiting this prospect in adults as well. In a chronic debilitating disorder managed with supportive therapy, the patients' perception is critical in the advancement of any potential curative therapy. To explore this aspect, we undertook a questionnaire-based survey on 30 adults with SCD. Sixty two per cent of the patients were ready to accept a transplant-related mortality (TRM) >10%; 30% of them a TRM >30%. A risk of graft failure (GF) >10% was acceptable to 64%, with a risk >30% acceptable to 41%. Infertility was acceptable to only 50%. Chronic graft-versus-host disease (GVHD) was unacceptable to the majority (80%). Seventy six per cent% of patients had a full sibling and 60% were willing to participate in a clinical trial of RIC transplantation. This survey suggests that the majority of adults with SCD might be willing to consider a curative option such as RIC transplantation even with a high TRM or GF. The major concerns relate to chronic GVHD and infertility. There is an urgent need to explore RIC transplants in SCD patients within the framework of a clinical trial, considering patient perception regarding cure and complications.

  15. Role of allogeneic stem cell transplantation in adult patients with Ph-negative acute lymphoblastic leukemia.

    PubMed

    Dhédin, Nathalie; Huynh, Anne; Maury, Sébastien; Tabrizi, Reza; Beldjord, Kheira; Asnafi, Vahid; Thomas, Xavier; Chevallier, Patrice; Nguyen, Stéphanie; Coiteux, Valérie; Bourhis, Jean-Henri; Hichri, Yosr; Escoffre-Barbe, Martine; Reman, Oumedaly; Graux, Carlos; Chalandon, Yves; Blaise, Didier; Schanz, Urs; Lhéritier, Véronique; Cahn, Jean-Yves; Dombret, Hervé; Ifrah, Norbert

    2015-04-16

    Because a pediatric-inspired Group for Research on Adult Acute Lymphoblastic Leukemia (GRAALL) protocol yielded a markedly improved outcome in adults with Philadelphia chromosome-negative ALL, we aimed to reassess the role of allogeneic stem cell transplantation (SCT) in patients treated in the GRAALL-2003 and GRAALL-2005 trials. In all, 522 patients age 15 to 55 years old and presenting with at least 1 conventional high-risk factor were candidates for SCT in first complete remission. Among these, 282 (54%) received a transplant in first complete remission. At 3 years, posttransplant cumulative incidences of relapse, nonrelapse mortality, and relapse-free survival (RFS) were estimated at 19.5%, 15.5%, and 64.7%, respectively. Time-dependent analysis did not reveal a significant difference in RFS between SCT and no-SCT cohorts. However, SCT was associated with longer RFS in patients with postinduction minimal residual disease (MRD) ≥10(-3) (hazard ratio, 0.40) but not in good MRD responders. In B-cell precursor ALL, SCT also benefitted patients with focal IKZF1 gene deletion (hazard ratio, 0.42). This article shows that poor early MRD response, in contrast to conventional ALL risk factors, is an excellent tool to identify patients who may benefit from allogeneic SCT in the context of intensified adult ALL therapy. Trial GRAALL-2003 was registered at www.clinicaltrials.gov as #NCT00222027; GRAALL-2005 was registered as #NCT00327678.

  16. Comorbidities and inhibitors in adult patients with haemophilia: issues, costs and management strategies.

    PubMed

    Berntorp, Erik; Mauser-Bunschoten, Evelien; Jiménez-Yuste, Víctor; Spears, Jeffrey B

    2015-11-01

    Along with greater life expectancy in patients with haemophilia has been an increase in associated haemophilia-related (arthropathy, osteoporosis, viral infections) and age-related (cardiovascular disease, renal disease, cancer and others) comorbidities, many of which are only just emerging as the population ages. At present, experience in managing these comorbidities is limited. As the demographic shift continues, haemophilia care centres can expect to encounter more patients with greater levels of complexity. In the absence of evidence-based information to guide the management of adult patients with haemophilia, it is important that the scientific position be reviewed on a regular basis. To this end, several topics relevant to the clinical management of adult patients with haemophilia were examined in a symposium entitled Comorbidities and inhibitors in adult patients with haemophilia: issues, costs and management strategies held on 11 February 2015 in Helsinki, Finland, in conjunction with the 8th Annual Congress of the European Association for Haemophilia and Allied Disorders. This article is a summary of that event.

  17. Haemodynamic correlates and prognostic significance of serum uric acid in adult patients with Eisenmenger syndrome

    PubMed Central

    Oya, H; Nagaya, N; Satoh, T; Sakamaki, F; Kyotani, S; Fujita, M; Nakanishi, N; Miyatake, K

    2000-01-01

    OBJECTIVE—To assess haemodynamic correlates and prognostic significance of serum uric acid in adult patients with Eisenmenger syndrome.
DESIGN—Retrospective observational study.
SETTING—Tertiary referral centre.
PATIENTS—94 adult patients with Eisenmenger syndrome who were diagnosed between September 1982 and July 1998.
MAIN OUTCOME MEASURES—Serum uric acid was measured in all patients, together with clinical and haemodynamic variables related to mortality.
RESULTS—Serum uric acid was raised in patients with Eisenmenger syndrome compared with age and sex matched control subjects (7.0 v 4.7 mg/dl, p < 0.0001) and increased in proportion to the severity of New York Heart Association functional class. Serum uric acid was positively correlated with mean pulmonary arterial pressure (r = 0.30, p = 0.0052) and total pulmonary resistance index (r = 0.55, p < 0.0001), and negatively correlated with cardiac index (r = −0.50, p < 0.0001). During a mean follow up period of 97 months, 38 patients died of cardiopulmonary causes. Among various clinical, echocardiographic, and laboratory variables, serum uric acid remained predictive in multivariate analysis. Kaplan-Meier survival curves based on median serum uric acid showed that patients with high values had a significantly worse survival rate than those with low values (log-lank test: p = 0.0014 in male patients, p = 0.0034 in female patients).
CONCLUSIONS—Serum uric acid increases in proportion to haemodynamic severity in adult patients with Eisenmenger syndrome and is independently associated with long term mortality.


Keywords: Eisenmenger syndrome; prognosis; uric acid; haemodynamics PMID:10862589

  18. MRI in adult patients with aortic coarctation: diagnosis and follow-up.

    PubMed

    Shepherd, B; Abbas, A; McParland, P; Fitzsimmons, S; Shambrook, J; Peebles, C; Brown, I; Harden, S

    2015-04-01

    Aortic coarctation is a disease that usually presents in infancy; however, a proportion of patients present for the first time in adulthood. These lesions generally require repair with either surgery or interventional techniques. The success of these techniques means that increasing numbers of patients are presenting for follow-up imaging in adulthood, whether their coarctation was initially repaired in infancy or as adults. Thus, the adult presenting to the radiologist for assessment of possible coarctation or follow-up of coarctation repair is not an uncommon scenario. In this review, we present details of the MRI protocols and MRI findings in these patients so that a confident and accurate assessment can be made.

  19. Associations between adult attachment characteristics, medical burden, and life satisfaction among older primary care patients.

    PubMed

    Kirchmann, Helmut; Nolte, Tobias; Runkewitz, Kristin; Bayerle, Lisa; Becker, Simone; Blasczyk, Verena; Lindloh, Julia; Strauss, Bernhard

    2013-12-01

    We investigated whether attachment security, measured by the Adult Attachment Prototype Rating (AAPR), was correlated with life satisfaction, independent of sociodemographic characteristics, medical burden, and age-related coping strategies in a sample of 81 patients (69-73 years) recruited from the register of a general primary care practice. Furthermore, we examined whether patients classified as AAPR-secure reported better adjustment to medical burden in terms of higher life satisfaction than did insecure patients. Attachment security was independently related to life satisfaction. Moreover, the association between medical burden and lower life satisfaction was significantly stronger for insecure than for secure participants. Our findings indicate that interventions to improve attachment security or coping processes related to attachment could help older adults retain life satisfaction.

  20. Theory of mind deficit in adult patients with congenital heart disease.

    PubMed

    Chiavarino, Claudia; Bianchino, Claudia; Brach-Prever, Silvia; Riggi, Chiara; Palumbo, Luigi; Bara, Bruno G; Bosco, Francesca M

    2015-10-01

    This article provides the first assessment of theory of mind, that is, the ability to reason about mental states, in adult patients with congenital heart disease. Patients with congenital heart disease and matched healthy controls were administered classical theory of mind tasks and a semi-structured interview which provides a multidimensional evaluation of theory of mind (Theory of Mind Assessment Scale). The patients with congenital heart disease performed worse than the controls on the Theory of Mind Assessment Scale, whereas they did as well as the control group on the classical theory-of-mind tasks. These findings provide the first evidence that adults with congenital heart disease may display specific impairments in theory of mind.

  1. Differential diagnosis and treatment planning for the adult nonsurgical orthodontic patient.

    PubMed

    Alexander, R G; Sinclair, P M; Goates, L J

    1986-02-01

    Increasing numbers of adult patients are seeking orthodontic care and some, despite significant skeletal malocclusions, elect not to have combined orthodontic-surgical treatment. The purpose of this article is to outline some of the diagnostic and therapeutic principles that can be used in the adult nonsurgical orthodontic patient. The importance of realistic goal setting in the face of compromised occlusions is emphasized. Diagnosis should include evaluation of all three dimensions and recognize the limitations of therapy in each dimension for the nongrowing patient. Periodontal considerations, extraction decisions, and retention regimens are of vital importance to the achievement and maintenance of an optimum result. Clinical records will demonstrate four commonly seen problems and their resolution.

  2. Gender differences among young adult cancer patients: a study of blogs.

    PubMed

    Kim, Bora; Gillham, David

    2015-01-01

    The Internet has increasing relevance and practical use as a tool to support cancer care. For example, health support Web sites are now widely used to connect specific groups of patients who may otherwise have remained isolated, and understanding their health-related online behaviors will help in the development of more effective health support Web sites. This article examined blogs written by young adults affected by cancer and in particular examined the gender differences in these blog entries through content analysis. The results showed there is little difference in blog content between genders. This suggests that the blog environment could lessen the gender-typical behaviors often expected by society and may provide an outlet for young adult cancer patients to more freely share their cancer-related experiences, at the same time providing an opportunity for social connection. This is particularly significant for male patients who are known to inhibit their emotions as well as the expression of their health concerns.

  3. Concomitant therapies (glucocorticoids and sex hormones) in adult patients with growth hormone deficiency.

    PubMed

    Scaroni, C; Ceccato, F; Rizzati, S; Mantero, F

    2008-09-01

    Adult-onset GH deficiency (GHD), mostly due to organic lesions of the pituitary-hypothalamic region, is frequently associated with multiple anterior pituitary deficiencies that need long-term substitutive treatment. The GH-IGF-I axis may play an important role in modulating peripheral metabolism of hormones (adrenal, thyroid, and sex hormones) and these interactions may have clinically significant implications on the phenotypes of adult GHD patients and on the effects of the combined replacement hormonal treatment of this condition. By accelerating the peripheral metabolism of cortisol, GH therapy may precipitate adrenal insufficiency in susceptible hypopituitary patients; estrogen replacement blunts the response to GH in women whereas in men with androgen substitution the responsivity increases over time. Endocrinologists should be mindful of these phenomena when starting patients with hypopituitarism on GH replacement therapy.

  4. Bone mineral density and body composition in adult patients with cystic fibrosis.

    PubMed Central

    Grey, A B; Ames, R W; Matthews, R D; Reid, I R

    1993-01-01

    BACKGROUND--Cystic fibrosis is a multisystem disease characterised by chronic pulmonary sepsis and malnutrition. To ascertain whether osteoporosis is a feature of cystic fibrosis in adult patients, total body and regional bone mineral density (BMD) was measured in a group of eight men and eight women aged 17-42 years. METHODS--Total body and regional BMD (lumbar spine L2-L4, femoral neck, trochanteric, and Ward's triangle), as well as total body fat and lean mass, were measured by dual energy x ray absorptiometry. A range of biochemical, lifestyle, and anthropometric variables was also assessed. RESULTS--Patients with cystic fibrosis had significantly reduced bone density at all sites compared with normal young adults. The mean reductions ranged from 7% at Ward's triangle to 13% at the trochanter. Body mass index (BMI) was positively correlated with BMD at four sites and disease severity negatively correlated with BMD at two sites. Other biochemical and anthropometric variables were not predictive of bone density. Total body fat mass was reduced by 30% compared with normal young adults. CONCLUSIONS--Bone density is decreased in adult patients with cystic fibrosis and BMI and disease severity are independent predictors of bone density. PMID:8346485

  5. Pneumococcal vaccination among HIV-infected adult patients in the era of combination antiretroviral therapy

    PubMed Central

    Lee, Kuan-Yeh; Tsai, Mao-Song; Kuo, Kuang-Che; Tsai, Jen-Chih; Sun, Hsin-Yun; Cheng, Aristine C; Chang, Sui-Yuan; Lee, Chen-Hsiang; Hung, Chien-Ching

    2014-01-01

    HIV-infected patients remain at higher risk for pneumococcal disease than the general population despite immune reconstitution and suppression of HIV replication with combination antiretroviral therapy. Vaccination with 23-valent pneumococcal polysaccharide vaccine (PPV23) composed of T-cell-independent antigens has been recommended to reduce the risk of pneumococcal disease in HIV-infected adults. However, given the heterogeneity of study design, execution and subjects enrolled, studies examining serological responses to PPV23 yielded conflicting results and observational studies of clinical effectiveness only provided moderate evidence to support the routine use of PPV23 in HIV-infected adults. Pneumococcal conjugate vaccine (PCV), with conjugation of the capsular polysaccharide to a protein carrier, is more immunogenic than PPV23 and has been demonstrated to protect against pneumococcal disease in HIV-infected children and recurrent invasive pneumococcal disease in HIV-infected adolescents and adults. Guidelines have recently been revised to recommend that HIV-infected patients aged 19 y or older receive one dose of 13-valent pneumococcal conjugate vaccine (PCV13) followed by a booster vaccination with PPV23. In this paper, we review the studies using different vaccination strategies to improve immunogenicity among HIV-infected adult patients. PMID:25483681

  6. Occurrence of hepatitis and hepatitis B surface antigen in adult patients with acute leukemia.

    PubMed Central

    Cowan, D. H.; Kouroupis, G. M.; Leers, W. D.

    1975-01-01

    Fifty-eight adult patients with acute leukemia were screened at the onset of the disease for hepatitis B antigen (HBSAg) in the serum, and during the course of the disease for the development of hepatitis B. One patient had a positive test for HBSAg by the radioimmunoassay technique only at the time leukemia was diagnosed; this patient had received transfusions some years before. In six patients icteric hepatitis B developed; five recovered completely and one died of leukemia during the course of hepatitis. All patients in whom hepatitis developed had received transfusions as a part of supportive therapy for leukemia. The hepatitis risk for patients who received transfusions of blood found to be negative for HBSAg by counterimmunoelectrophoresis was 0.26 percent per unit of blood administered. PMID:1054615

  7. New Guidelines for Assessment of Malnutrition in Adults: Obese Critically Ill Patients.

    PubMed

    Mauldin, Kasuen; O'Leary-Kelley, Colleen

    2015-08-01

    Recently released recommendations for detection and documentation of malnutrition in adults in clinical practice define 3 types of malnutrition: starvation related, acute disease or injury related, and chronic disease related. The first 2 are more easily recognized, but the third may be more often unnoticed, particularly in obese patients. Critical care patients tend to be at high risk for malnutrition and thus require a thorough nutritional assessment. Compared with patients of earlier times, intensive care unit patients today tend to be older, have more complex medical and comorbid conditions, and often are obese. Missed or delayed detection of malnutrition in these patients may contribute to increases in hospital morbidity and longer hospital stays. Critical care nurses are in a prime position to screen patients at risk for malnutrition and to work with members of the interprofessional team in implementing nutritional intervention plans.

  8. A Population Pharmacokinetic Model for Vancomycin in Adult Patients Receiving Extracorporeal Membrane Oxygenation Therapy

    PubMed Central

    Healy, JR; Thoma, BN; Peahota, MM; Ahamadi, M; Schmidt, L; Cavarocchi, NC; Kraft, WK

    2016-01-01

    The literature on the pharmacokinetics of vancomycin in patients undergoing extracorporeal membrane oxygenation (ECMO) therapy is sparse. A population pharmacokinetic (PK) model for vancomycin in ECMO patients was developed using a nonlinear mixed effects modeling on the concentration–time profiles of 14 ECMO patients who received intravenous vancomycin. Model selection was based on log‐likelihood criterion, goodness of fit plots, and scientific plausibility. Identification of covariates was done using a full covariate model approach. The pharmacokinetics of vancomycin was adequately described with a two‐compartment model. Parameters included clearance of 2.83 L/hr, limited central volume of distribution 24.2 L, and low residual variability 0.67%. Findings from the analysis suggest that standard dosing recommendations for vancomycin in non‐ECMO patients are adequate to achieve therapeutic trough concentrations in ECMO patients. This further shows that ECMO minimally affects the PK of vancomycin in adults including in higher‐weight patients. PMID:27639260

  9. Comprehensive orthodontic treatment of adult patient with cleft lip and palate.

    PubMed

    Leiva Villagra, Noemí; Muñoz Domon, Miguel; Véliz Méndez, Sebastian

    2014-01-01

    The aim of the paper is to present full orthodontic treatment of an operated cleft lip adult patient. Case Report. An 18-year-old patient consulted for severe crowded teeth. He comes from a poor family. At that time he already had four operations (velum, palate, lip, and myringotomy). Treatment included maxillary expansion, tooth extraction, and fixed orthodontic, as well as kinesiology and speech therapy treatment. A multidisciplinary approach allowed us to achieve successfully an excellent result for this patient and gave him a harmonic smile and an optimal function without orthognathic surgery. Two years after treatment, occlusion remains stable.

  10. Abiotrophia defectiva endarteritis with infective spondylodiscitis in an adult patient with patent ductus arteriosus.

    PubMed

    Miraclin, Angel T; Perumalla, Susmitha K; Daniel, Jaifrin; Sathyendra, Sowmya

    2017-04-07

    Endarteritis is a major complication in patients with patent ductus arteriosus, causing significant morbidity and mortality. We report an adult patient with asymptomatic patent ductus arteriosus and endarteritis involving the main pulmonary artery and secondary infective spondylodiscitis at the L5-S1 intervertebral disc caused by Abiotrophia defectivaA. defectiva, commonly referred to as nutritionally variant streptococci, cannot be identified easily by conventional blood culture techniques from clinical specimens. Its isolation was confirmed by 16S ribosomal RNA sequencing. The patient was successfully managed with a combination of penicillin G and gentamicin, pending surgical repair of the patent ductus arteriosus.

  11. Radiotherapy in Gorlin Syndrome: Can It Be Safe and Effective in Adult Patients?

    PubMed

    Baker, Sarah; Joseph, Kurian; Tai, Patricia

    2016-01-01

    Gorlin syndrome, also known as nevoid basal cell carcinoma syndrome, is a rare autosomal dominant disorder with multiple manifestations including early onset of cutaneous basal cell carcinomas (BCCs). Radiotherapy has traditionally been contraindicated due to reports of BCC induction. We describe here a patient treated successfully with radiotherapy with no tumour induction at 57 months of follow-up. A comprehensive literature review of radiotherapy outcomes in patients with Gorlin syndrome suggests radiotherapy may be a feasible treatment option for adult patients with treatment refractory lesions or surgical contraindication.

  12. Surgical repair of chronic complete hamstring tendon rupture in the adult patient.

    PubMed

    Cross, M J; Vandersluis, R; Wood, D; Banff, M

    1998-01-01

    Complete rupture of the hamstring tendons in the adult is a rare injury. This report discusses complete rupture of the hamstring tendons in nine patients treated by late operative repair. All patients were referred from outside centers for a second opinion after failed nonoperative treatment. The diagnosis was made quite easily on clinical grounds and was confirmed at surgery. Surgical treatment in all cases consisted of reattachment of the hamstring tendons to the origin on the ischium, and in all cases it was necessary to perform neurolysis of the sciatic nerve. Good results were achieved in all cases, at follow-up all patients were satisfied with the surgery.

  13. Comprehensive Orthodontic Treatment of Adult Patient with Cleft Lip and Palate

    PubMed Central

    Leiva Villagra, Noemí; Muñoz Domon, Miguel; Véliz Méndez, Sebastian

    2014-01-01

    The aim of the paper is to present full orthodontic treatment of an operated cleft lip adult patient. Case Report. An 18-year-old patient consulted for severe crowded teeth. He comes from a poor family. At that time he already had four operations (velum, palate, lip, and myringotomy). Treatment included maxillary expansion, tooth extraction, and fixed orthodontic, as well as kinesiology and speech therapy treatment. A multidisciplinary approach allowed us to achieve successfully an excellent result for this patient and gave him a harmonic smile and an optimal function without orthognathic surgery. Two years after treatment, occlusion remains stable. PMID:25544903

  14. Screening adult tuberculosis patients for diabetes mellitus in Ebeye, Republic of the Marshall Islands.

    PubMed

    Nasa, J N; Brostrom, R; Ram, S; Kumar, A M V; Seremai, J; Hauma, M; Paul, I A; Langidrik, J R

    2014-06-21

    A retrospective cohort study was conducted to evaluate the screening of adult TB patients for diabetes (DM) using glycated haemoglobin (HbA1C) in Ebeye, Republic of the Marshall Islands. Of 62 patients registered between July 2010 and December 2012, 28 (45%) had DM. The only significant difference in baseline characteristics between those with and those without DM was higher age in those with DM. Two-month sputum smears and cultures were also not different between the two groups. Despite the limited sample size, this study shows that screening TB patients for DM in Ebeye is feasible and worthwhile and that it should be continued.

  15. [Screening for attention deficit hyperactivity disorder in adult patients in primary care].

    PubMed

    Aragonès, Enric; Cañisá, Anna; Caballero, Antònia; Piñol-Moreso, Josep Lluís

    2013-05-01

    AIMS. To estimate the proportion of adult patients in primary care with a positive screening test for attention deficit hyper-activity disorder (ADHD) and to analyse their characteristics. PATIENTS AND METHODS. A cross-sectional descriptive study was performed in nine primary care clinics in the province of Tarragona. The sample consisted of 432 consecutive patients in primary care who visited for any reason, with ages ranging from 18 to 55 years. Screening for ADHD was carried out by means of the Adult ADHD Self-Report Scale (ASRS). Data about functional impact (Sheehan Disability Inventory) were obtained and a review of the patient records provided data concerning psychiatric comorbidity and the consumption of psychopharmaceuticals. RESULTS. The percentage of positive results in the screening tests was 19.9% (95% CI = 16.4-23.9%). Taking into account the sensitivity and specificity of the ASRS, the 'real' prevalence was estimated to be 12.5% (95% CI = 8.2-16.8%). None of these patients were diagnosed or treated for ADHD. Positive screening tests are associated with occupational, social and familial dysfunction, and greater perceived stress. There is also a higher level of comorbidity with affective disorders and substance abuse, as well as greater use of psychopharmaceuticals. CONCLUSIONS. Screening for ADHD in adult patients in primary care gives rise to a notably high proportion of positive screening test results, which suggests that there could be a significant prevalence of patients with ADHD. These data contrast with the absence of this diagnosis in the patient records. Further research is needed to determine the usefulness of the diagnosis of ADHD and the possible role that must be played by primary care.

  16. Social determinants and health-related dimensions of quality of life in adult patients with haemophilia.

    PubMed

    Dolatkhah, R; Fakhari, A; Pezeshki, M Z; Shabanlouei, R; Tavassoli, N; Gholchin, M

    2014-05-01

    The availability of safe and effective factor replacement therapies, in persons with haemophilia (PWH), has in some countries answered the basic need for treatment of these patients. The findings suggest that adult patients who have always been on prophylaxis reported significantly better physical functioning, and thus better quality of life. This study is designed to evaluate the QoL in adult PWH, by focusing on social determinants of QoL and their relationship with health-related dimensions, in Tabriz, Iran. The survey instrument was a self-report 36 items questionnaire, 'A36 Hemofilia - QoL', which is a disease-specific questionnaire for the assessment of the health-related QoL in adults living with haemophilia. A total of 100 haemophilia A and B patients, aged over 17 years participated in this study within 1 year. QoL total score was 71.88 (±26.89 SD). Patients who treat in our Hemophilia Treatment Center, had better QoL score (P = 0.000), and education has a significant impact on the social aspects of QoL (P = 0.18). The QoL was very poor in urban area in contrast to patients who lived in the city (54.45 vs. 74.21 respectively). Single patients have a better QoL than married patients (76.56 vs. 68.50 respectively). Our results showed that low education and lack of awareness of the diseases among PWH lead to reduce of QoL and more disease complications. More and wider treatment and psychological care for improving quality of life of these patients are seriously recommended.

  17. Clinical Profile and Quality of Life of Adult Patients After the Fontan Procedure.

    PubMed

    Bordin, Giulia; Padalino, Massimo Antonio; Perentaler, Sonja; Castaldi, Biagio; Maschietto, Nicola; Michieli, Pierantonio; Crepaz, Roberto; Frigo, Anna Chiara; Vida, Vladimiro Lorenzo; Milanesi, Ornella

    2015-08-01

    Increasingly, more patients with univentricular heart reach adulthood. Therefore, long-term psychological features are an important concern. The aim of this study was to evaluate the clinical and psychological profile of post-Fontan adult patients and to identify the most significant determinants of quality of life. In this retrospective cross-sectional study, we reviewed the surgical and medical history of post-Fontan adult patients. Patients underwent a 24-h electrocardiogram, echocardiography and exercise testing. Self-report questionnaires were used to assess the Work Ability Index, quality of life (Satisfaction with Life Scale), perceived health status (SF-36 questionnaire), coping strategies (Brief Cope questionnaire) and presence of mood disorders (Hospital Anxiety and Depression Scale). Thirty-nine patients aged between 18 and 48 years (mean 27.5 years) were enrolled. The mean follow-up was 21.5 years. Most patients were unmarried (82.9 %), had a high school diploma (62.9 %) and were employed (62.9 %). Twenty-nine patients (82.3 %) had at least one long-term complication. The median single ventricle ejection fraction was 57 %, and the median maximal oxygen consumption was 26.8 ml/min/kg. This population tended to be anxious and to use adaptive coping strategies. Quality of life was perceived as excellent or good in 57.2 % of cases and was not related to either cardiac function or exercise capacity. Both quality of life and SF-36 domains were related to the Work Ability Index. This cohort of post-Fontan adult patients enjoyed a good quality of life irrespective of disease severity.

  18. Nutritional Status and Nosocomial Infections among Adult Elective Surgery Patients in a Mexican Tertiary Care Hospital

    PubMed Central

    Rodríguez-García, Judith; Gamiño-Iriarte, Astrid; Rodea-Montero, Edel Rafael

    2015-01-01

    Background Controversy exists as to whether obesity constitutes a risk-factor or a protective-factor for the development of nosocomial Infection (NI). According to the obesity-paradox, there is evidence that moderate obesity is a protective-factor. In Mexico few studies have focused on the nutritional status (NS) distribution in the hospital setting. Objectives The aim of this study was to estimate the distribution of NS and the prevalence of nosocomial infection NI among adult elective surgery (ES) patients and to compare the clinical and anthropometric characteristics and length of stays (LOS) between obese and non-obese patients and between patients with and without NI. Methods We conducted a cross-sectional study with a sample (n = 82) adult ES patients (21–59 years old) who were recruited from a tertiary-care hospital. The prevalences of each NS category and NI were estimated, the assessments were compared between groups (Mann-Whitney, Chi-squared or the Fisher's-exact-test), and the association between preoperative risk-factors and NI was evaluated using odds ratios. Results The distribution of subjects by NS category was: underweight (3.66%), normal-weight (28.05%), overweight (35.36%), and obese (32.93%). The prevalence of NI was 14.63%. The LOS was longer (p<0.001) for the patients who developed NI. The percentages of NI were: 33.3% in underweight, 18.52% in obese, 17.39% in normal-weight, and 6.90% in overweight patients. Conclusion The prevalence of overweight and obesity in adult ES patients is high. The highest prevalence of NI occurred in the underweight and obese patients. The presence of NI considerably increased the LOS, resulting in higher medical care costs. PMID:25803860

  19. Morbidity and mortality of adult patients with congenital dyserythropoietic anemia type I.

    PubMed

    Shalev, Hanna; Al-Athamen, Kaid; Levi, Itai; Levitas, Aviva; Tamary, Hannah

    2017-01-01

    Congenital dyserythropoietic anemia type I (CDAI) is a rare autosomal recessive disease characterized by macrocytic anemia, ineffective erythropoiesis, and secondary hemochromatosis. To better define the natural history of the disease among adult patients, we studied 32 Bedouin patients (median age 34 yr; range 21-60) all carrying the same CDAN1 founder mutation. Follow-up studies included complete blood count, blood chemistry, abdominal ultrasound, echocardiography, and T2*MRI. Main complications were due to anemia and ineffective erythropoiesis [osteoporosis (8/9, 89%), cholelithiasis (21/30, 70%), pulmonary arterial hypertension (PAH) (6/25, 24%)] and iron overload [hypothyroidism (9/24, 38%), and diabetes mellitus (6/32, 19%)]. T2* MRI revealed increased liver iron but no cardiac iron (13/13). Anemia improved in the majority of patients who underwent splenectomy (5/6). Three patients died (9%) at the age of 46-56 due to PAH (1) and sepsis (2). All previously underwent splenectomy. Analyzing both our patients and the 21 patients previously described by Heimpel et al. (Blood 107:334, 2006), we conclude that adults with CDA I suffer significant morbidity and mortality. Careful monitoring of iron overload and prompt iron chelation therapy is mandatory. Due to possible complications and inconsistent response to splenectomy α-interferon, transfusion therapy or stem cell transplantation should be considered as alternatives to this procedure in severely affected patients.

  20. Comorbidity of Adult Attention Deficit and Hyperactivity Disorder in Bipolar Patients: Prevalence, Sociodemographic and Clinical Correlates

    PubMed Central

    BERKOL, Tonguç Demir; YARGIÇ, İlhan; ÖZYILDIRIM, İlker; YAZICI, Olcay

    2014-01-01

    Introduction The aims of this study were to determine the frequency of adult attention deficit and hyperactivity disorder (ADHD) comorbidity in bipolar patients and to investigate the influence of this comorbidity on the clinical characteristics of bipolar disorder (BD). Method A total of 135 patients with BD type I and II and BD not otherwise specified were included in this study. First, the Adult ADD/ADHD DSM-IV-Based Diagnostic Screening and Rating Scale (ADHD scale) was administered to all patients, and all of the patients were also interviewed for the diagnosis. Patients who were diagnosed as having ADHD comorbidity (n=23) on the basis of DSM-IV and those who were not diagnosed to have ADHD comorbidity (n=32) were compared in terms of sociodemographic and clinical correlates. Results Twenty-three of 135 patients (17%) were found to have ADHD comorbidity. In the ADHD comorbidity group, the level of education and the number of suicide attempts were higher (p=.011 and .043, respectively). Although not significant, subthreshold depressive symptoms in interepisodic periods, the lifetime history of antidepressant use and the total number of lifetime depressive episodes tended to be more frequent in bipolar disorder with ADHD comorbidity group than in the control group. Conclusion Bipolar disorder has a frequent comorbidity with ADHD, and contrary to expectations, it might be related to the depressive aspect, rather than the manic aspect, of bipolar disorder. Early diagnosis of ADHD comorbidity in bipolar patients might help to prevent serious risk factors.

  1. Hepatic resection for giant haemangioma in a patient with a contemporaneous adult polycystic liver disease.

    PubMed

    Levi Sandri, G B; Lai, Q; Melandro, F; Guglielmo, N; Garofalo, M; Morabito, V; Cirelli, C; Lucatelli, P; Di Laudo, M; Rossi, M; Berloco, P B

    2012-01-01

    Hepatic resection for giant haemangioma in a patient with a contemporaneous adult polycystic liver disease. According to Gigot classification, and to the characteristics of haemangioma surgery in these patients can be considered safe. We report the case of a 55 year-old man affected by an adult polycystic liver disease (PCLD) and a contemporaneous symptomatic haemangioma of the III segment. At the preoperative imaging scans, APCLD was classified in a type II grading according to Gigot classification. The patient underwen