Sample records for adult female elk

  1. Survival of adult female elk in yellowstone following wolf restoration

    USGS Publications Warehouse

    Evans, S.B.; Mech, L.D.; White, P.J.; Sargeant, G.A.


    Counts of northern Yellowstone elk (Cervus elaphus) in northwestern Wyoming and adjacent Montana, USA, have decreased at an average rate of 6-8% per year since wolves (Canis lupus) were reintroduced in 1995. Population growth rates of elk are typically sensitive to variations in adult female survival; populations that are stable or increasing exhibit high adult female survival. We used survival records for 85 radiocollared adult female elk 1-19 years old to estimate annual survival from March 2000 to February 2004. Weighted average annual survival rates were approximately 0.83 (95% CI = 0.77-0.89) for females 1-15 years old and 0.80 (95% CI = 0.73-0.86) for all females. Our estimates were much lower than the rate of 0.99 observed during 1969-1975 when fewer elk were harvested by hunters, wolves were not present, and other predators were less numerous. Of 33 documented deaths included in our analysis, we attributed 11 to hunter harvest, 14 to predation (10 wolf, 2 unknown, 1 cougar [Puma concolor], and 1 bear [Ursus sp.]), 6 to unknown causes, and 2 to winter-kill. Most deaths occurred from December through March. Estimates of cause-specific annual mortality rates were 0.09 (0.05-0.14) for all predators, 0.08 (0.04-0.13) for hunting, and 0.07 (0.03-0.11) for wolves specifically. Wolf-killed elk were typically older (median = 12 yr) than hunter-killed elk (median = 9 yr, P = 0.03). However, elk that winter outside the park where they were exposed to hunting were also younger (median = 7 yr) than elk that we did not observe outside the park (median = 9 yr, P < 0.01). Consequently, differences in ages of elk killed by wolves and hunters may reflect characteristics of elk exposed to various causes of mortality, as well as differences in susceptibility. Unless survival rates of adult females increase, elk numbers are likely to continue declining. Hunter harvest is the only cause of mortality that is amenable to management at the present time.

  2. Relative influence of human harvest, carnivores, and weather on adult female elk survival across western North America

    USGS Publications Warehouse

    Brodie, Jedediah; Johnson, Heather; Mitchell, Michael; Zager, Peter; Proffitt, Kelly; Hebblewhite, Mark; Kauffman, Matthew; Johnson, Bruce; Bissonette, John; Bishop, Chad; Gude, Justin; Herbert, Jeff; Hersey, Kent; Hurley, Mark; Lukacs, Paul M.; McCorquodale, Scott; McIntire, Eliot; Nowak, Josh; Sawyer, Hall; Smith, Douglas; White, P.J.


    Well-informed management of harvested species requires understanding how changing ecological conditions affect demography and population dynamics, information that is lacking for many species. We have limited understanding of the relative influence of carnivores, harvest, weather and forage availability on elk Cervus elaphus demography, despite the ecological and economic importance of this species. We assessed adult female survival, a key vital rate for population dynamics, from 2746 radio-collared elk in 45 populations across western North America that experience wide variation in carnivore assemblage, harvest, weather and habitat conditions. Proportional hazard analysis revealed that 'baseline' (i.e. not related to human factors) mortality was higher with very high winter precipitation, particularly in populations sympatric with wolves Canis lupus. Mortality may increase via nutritional stress and heightened vulnerability to predation in snowy winters. Baseline mortality was unrelated to puma Puma concolor presence, forest cover or summer forage productivity. Cause-specific mortality analyses showed that wolves and all carnivore species combined had additive effects on baseline elk mortality, but only reduced survival by <2%. When human factors were included, ‘total’ adult mortality was solely related to harvest; the influence of native carnivores was compensatory. Annual total mortality rates were lowest in populations sympatric with both pumas and wolves because managers reduced female harvest in areas with abundant or diverse carnivores. Mortality from native carnivores peaked in late winter and early spring, while harvest-induced mortality peaked in autumn. The strong peak in harvest-induced mortality during the autumn hunting season decreased as the number of native carnivore species increased. Synthesis and applications. Elevated baseline adult female elk mortality from wolves in years with high winter precipitation could affect elk abundance as

  3. Relationships between nutritional condition of adult females and relative carrying capacity for rocky mountain Elk

    USGS Publications Warehouse

    Piasecke, J.R.; Bender, L.C.


    Lactation can have significant costs to individual and population-level productivity because of the high energetic demands it places on dams. Because the difference in condition between lactating and dry Rocky Mountain elk (Cervus elaphus nelsoni) cows tends to disappear as nutritional quality rises, the magnitude of that difference could be used to relate condition to habitat quality or the capability of habitats to support elk. We therefore compared nutritional condition of ???2.5-yr-old lactating and dry cows from six free-ranging RockyMountain elk populations throughout the United States.Our goal was to quantify differential accrual of body fat (BF) reserves to determine whether the condition of dry and lactating cows could be used to define relevant management thresholds of habitat quality (i.e., relative carrying capacity) and consequently potential performance of elk populations. Levels of BF that lactating cows were able to accrue in autumn and the proportional difference in BF between dry and lactating cows in autumn were related (F 1-2,10???16.2, P<0.001). Models indicated that elk experienced no negative effects of reproduction on condition when lactating cows were able to accrue ???13.7%BF in autumn.When lactating cows are accruing ???7.9%BF, elk are in a nutritionally stressed condition, which may be limiting population performance. Using the logistic model to predict relative proximity to ecological carrying capacity (ECC), our population-years ranged from3-97%ofECCand proportion of the population lactating (an index of calf survival) was negatively related to proportion of ECC. Results indicate that the proportional difference in accrual of BF between lactating and dry cows can provide a sensitive index to where elk populations reside relative to the quality of their range.

  4. Female elk contacts are neither frequency nor density dependent

    USGS Publications Warehouse

    Cross, Paul C.; Creech, Tyler G.; Ebinger, Michael R.; Manlove, Kezia R.; Irvine, Kathryn M.; Henningsen, John C.; Rogerson, Jared D.; Scurlock, Brandon M.; Creely, Scott


    Identifying drivers of contact rates among individuals is critical to understanding disease dynamics and implementing targeted control measures. We studied the interaction patterns of 149 female elk (Cervus canadensis) distributed across five different regions of western Wyoming over three years, defining a contact as an approach within one body length (∼2 m). Using hierarchical models that account for correlations within individuals, pairs, and groups, we found that pairwise contact rates within a group declined by a factor of three as group sizes increased 33-fold. Per capita contact rates, however, increased with group size according to a power function, such that female elk contact rates fell in between the predictions of density- or frequency-dependent disease models. We found similar patterns for the duration of contacts. Our results suggest that larger elk groups are likely to play a disproportionate role in the disease dynamics of directly transmitted infections in elk. Supplemental feeding of elk had a limited impact on pairwise interaction rates and durations, but per capita rates were more than two times higher on feeding grounds. Our statistical approach decomposes the variation in contact rate into individual, dyadic, and environmental effects, and provides insight into factors that may be targeted by disease control programs. In particular, female elk contact patterns were driven more by environmental factors such as group size than by either individual or dyad effects.

  5. Female elk contacts are neither frequency nor density dependent.


    Cross, P C; Creech, T G; Ebinger, M R; Manlove, K; Irvine, K; Henningsen, J; Rogerson, J; Scurlock, B M; Creel, S


    Identifying drivers of contact rates among individuals is critical to understanding disease dynamics and implementing targeted control measures. We studied the interaction patterns of 149 female elk (Cervus canadensis) distributed across five different regions of western Wyoming over three years, defining a contact as an approach within one body length (-2 min). Using hierarchical models that account for correlations within individuals, pairs, and groups, we found that pairwise contact rates within a group declined by a factor of three as group sizes increased 33-fold. Per capita contact rates, however, increased with group size according to a power function, such that female elk contact rates fell in between the predictions of density- or frequency-dependent disease models. We found similar patterns for the duration of contacts. Our results suggest that larger elk groups are likely to play a disproportionate role in the disease dynamics of directly transmitted infections in elk. Supplemental feeding of elk had a limited impact on pairwise interaction rates and durations, but per capita rates were more than two times higher on feeding grounds. Our statistical approach decomposes the variation in contact rate into individual, dyadic, and environmental effects, and provides insight into factors that may be targeted by disease control programs. In particular, female elk contact patterns were driven more by environmental factors such as group size than by either individual or dyad effects. PMID:24279278

  6. The expression of ELK transcription factors in adult DRG: Novel isoforms, antisense transcripts and upregulation by nerve damage.


    Kerr, Niall; Pintzas, Alexander; Holmes, Fiona; Hobson, Sally-Ann; Pope, Robert; Wallace, Mark; Wasylyk, Christine; Wasylyk, Bohdan; Wynick, David


    ELK transcription factors are known to be expressed in a number of regions in the nervous system. We show by RT-PCR that the previously described Elk1, Elk3/Elk3b/Elk3c and Elk4 mRNAs are expressed in adult dorsal root ganglia (DRG), together with the novel alternatively spliced isoforms Elk1b, Elk3d and Elk4c/Elk4d/Elk4e. These isoforms are also expressed in brain, heart, kidney and testis. In contrast to Elk3 protein, the novel Elk3d isoform is cytoplasmic, fails to bind ETS binding sites and yet can activate transcription by an indirect mechanism. The Elk3 and Elk4 genes are overlapped by co-expressed Pctk2 (Cdk17) and Mfsd4 genes, respectively, with the potential formation of Elk3/Pctaire2 and Elk4/Mfsd4 sense-antisense mRNA heteroduplexes. After peripheral nerve injury the Elk3 mRNA isoforms are each upregulated approximately 2.3-fold in DRG (P<0.005), whereas the natural antisense Pctaire2 isoforms show only a small increase (21%, P<0.01) and Elk1 and Elk4 mRNAs are unchanged. PMID:20304071

  7. Roosevelt elk density and social segregation: Foraging behavior and females avoiding larger groups of males

    USGS Publications Warehouse

    Weckerly, F.; McFarland, K.; Ricca, M.; Meyer, K.


    Intersexual social segregation at small spatial scales is prevalent in ruminants that are sexually dimorphic in body size. Explaining social segregation, however, from hypotheses of how intersexual size differences affects the foraging process of males and females has had mixed results. We studied whether body size influences on forage behavior, intersexual social incompatibility or both might influence social segregation in a population of Roosevelt elk (Cervus elaphus roosevelt) that declined 40% over 5 y. Most males and females in the population occurred in the same forage patches, meadows, but occupied different parts of meadows and most groups were overwhelming comprised of one sex. The extent of segregation varied slightly with changing elk density. Cropping rate, our surrogate of forage ingestion, of males in mixed-sex groups differed from males in male-only groups at high, but not low, elk density. In a prior study of intersexual social interactions it was shown that females avoided groups containing ???6 males. Therefore, we predicted that females should avoid parts of meadows where groups of males ???6 were prevalent. Across the 5 y of study this prediction held because ???5% of all females were found in parts of meadows where median aggregation sizes of males were ???6. Social segregation was coupled to body size influences on forage ingestion at high density and social incompatibility was coupled to social segregation regardless of elk density.

  8. Migration of northern yellowstone elk: Implications of spatial structuring

    USGS Publications Warehouse

    White, P.J.; Proffitt, K.M.; Mech, L.D.; Evans, S.B.; Cunningham, J.A.; Hamlin, K.L.


    Migration can enhance survival and recruitment of mammals by increasing access to higher-quality forage or reducing predation risk, or both. We used telemetry locations collected from 140 adult female elk during 20002003 and 20072008 to identify factors influencing the migration of northern Yellowstone elk. Elk wintered in 2 semidistinct herd segments and migrated 10140 km to at least 12 summer areas in Yellowstone National Park (YNP) and nearby areas of Montana. Spring migrations were delayed after winters with increased snow pack, with earlier migration in years with earlier vegetation green-up. Elk wintering at lower elevations outside YNP migrated an average of 13 days earlier than elk at higher elevations. The timing of autumn migrations varied annually, but elk left their summer ranges at about the same time regardless of elevation, wolf numbers, or distance to their wintering areas. Elk monitored for multiple years typically returned to the same summer (96 fidelity, n 52) and winter (61 fidelity, n 41) ranges. Elk that wintered at lower elevations in or near the northwestern portion of the park tended to summer in the western part of YNP (56), and elk that wintered at higher elevations spent summer primarily in the eastern and northern parts of the park (82). Elk did not grossly modify their migration timing, routes, or use areas after wolf restoration. Elk mortality was low during summer and migration (8 of 225 elk-summers). However, spatial segregation and differential mortality and recruitment between herd segments on the northern winter range apparently contributed to a higher proportion of the elk population wintering outside the northwestern portion of YNP and summering in the western portion of the park. This change could shift wolf spatial dynamics more outside YNP and increase the risk of transmission of brucellosis from elk to cattle north of the park. ?? 2010 American Society of Mammalogists.

  9. Elk3 deficiency causes transient impairment in post-natal retinal vascular development and formation of tortuous arteries in adult murine retinae.


    Weinl, Christine; Wasylyk, Christine; Garcia Garrido, Marina; Sothilingam, Vithiyanjali; Beck, Susanne C; Riehle, Heidemarie; Stritt, Christine; Roux, Michel J; Seeliger, Mathias W; Wasylyk, Bohdan; Nordheim, Alfred


    Serum Response Factor (SRF) fulfills essential roles in post-natal retinal angiogenesis and adult neovascularization. These functions have been attributed to the recruitment by SRF of the cofactors Myocardin-Related Transcription Factors MRTF-A and -B, but not the Ternary Complex Factors (TCFs) Elk1 and Elk4. The role of the third TCF, Elk3, remained unknown. We generated a new Elk3 knockout mouse line and showed that Elk3 had specific, non-redundant functions in the retinal vasculature. In Elk3(-/-) mice, post-natal retinal angiogenesis was transiently delayed until P8, after which it proceeded normally. Interestingly, tortuous arteries developed in Elk3(-/-) mice from the age of four weeks, and persisted into late adulthood. Tortuous vessels have been observed in human pathologies, e.g. in ROP and FEVR. These human disorders were linked to altered activities of vascular endothelial growth factor (VEGF) in the affected eyes. However, in Elk3(-/-) mice, we did not observe any changes in VEGF or several other potential confounding factors, including mural cell coverage and blood pressure. Instead, concurrent with the post-natal transient delay of radial outgrowth and the formation of adult tortuous arteries, Elk3-dependent effects on the expression of Angiopoietin/Tie-signalling components were observed. Moreover, in vitro microvessel sprouting and microtube formation from P10 and adult aortic ring explants were reduced. Collectively, these results indicate that Elk3 has distinct roles in maintaining retinal artery integrity. The Elk3 knockout mouse is presented as a new animal model to study retinal artery tortuousity in mice and human patients. PMID:25203538

  10. Elk3 Deficiency Causes Transient Impairment in Post-Natal Retinal Vascular Development and Formation of Tortuous Arteries in Adult Murine Retinae

    PubMed Central

    Weinl, Christine; Wasylyk, Christine; Garcia Garrido, Marina; Sothilingam, Vithiyanjali; Beck, Susanne C.; Riehle, Heidemarie; Stritt, Christine; Roux, Michel J.; Seeliger, Mathias W.; Wasylyk, Bohdan; Nordheim, Alfred


    Serum Response Factor (SRF) fulfills essential roles in post-natal retinal angiogenesis and adult neovascularization. These functions have been attributed to the recruitment by SRF of the cofactors Myocardin-Related Transcription Factors MRTF-A and -B, but not the Ternary Complex Factors (TCFs) Elk1 and Elk4. The role of the third TCF, Elk3, remained unknown. We generated a new Elk3 knockout mouse line and showed that Elk3 had specific, non-redundant functions in the retinal vasculature. In Elk3(−/−) mice, post-natal retinal angiogenesis was transiently delayed until P8, after which it proceeded normally. Interestingly, tortuous arteries developed in Elk3(−/−) mice from the age of four weeks, and persisted into late adulthood. Tortuous vessels have been observed in human pathologies, e.g. in ROP and FEVR. These human disorders were linked to altered activities of vascular endothelial growth factor (VEGF) in the affected eyes. However, in Elk3(−/−) mice, we did not observe any changes in VEGF or several other potential confounding factors, including mural cell coverage and blood pressure. Instead, concurrent with the post-natal transient delay of radial outgrowth and the formation of adult tortuous arteries, Elk3-dependent effects on the expression of Angiopoietin/Tie-signalling components were observed. Moreover, in vitro microvessel sprouting and microtube formation from P10 and adult aortic ring explants were reduced. Collectively, these results indicate that Elk3 has distinct roles in maintaining retinal artery integrity. The Elk3 knockout mouse is presented as a new animal model to study retinal artery tortuousity in mice and human patients. PMID:25203538

  11. Elk and deer studies related to the Basalt Waste Isolation Project

    SciTech Connect

    Eberhardt, L.E.; McCorquodale, S.M.; Sargeant, G.A.


    A study of elk (Cervus elaphus) and deer (Odocoileus hemionus) was conducted in the vicinity of planned site characterization activities for the Basalt Waste Isolation Project (BWIP). Both species are known to be sensitive to disturbance and are considered important species because they are recreationally and/or commercially valuable. The principal objectives of the study were to (1) estimate pre-activity (site characterization) recruitment of deer and elk, (2) characterize deer and elk use of limited habitats critical to their survival (e.g., riparian areas), (3) describe preferential habitat use by deer and elk during critical seasons (i.e., winter and summer), and (4) document pre-activity distributions of seasonal home range centers of deer and elk. Early termination of BWIP prevented some of the objectives from being fully addressed. Fifteen adult elk (11 females and 4 males) and 19 female deer equipped with radio transmitters were studied on the Arid Lands Ecology (ALE) Reserve from February through December 1987. More than 1800 relocations of the marked elk and deer were made during aerial and ground tracking sessions. Deer confined their activities to within 2 km of water sources. In contrast, elk used 6-12 times the average area used by deer. As with deer, female elk were closely associated with available water sources during the summer and fall, presumably because of the physiological demands of lactation. However, during the winter, female elk showed no preference for areas near water, as did male elk throughout the study. Riparian areas, which are scarce on the arid Hanford Site, are particularly valuable habitat to both elk and deer because they provide drinking water and succulent forage during the dry summer and early fall months.

  12. Dynamics of newly established elk populations

    USGS Publications Warehouse

    Sargeant, G.A.; Oehler, M.W., Sr.


    The dynamics of newly established elk (Cervus elaphus) populations can provide insights about maximum sustainable rates of reproduction, survival, and increase. However, data used to estimate rates of increase typically have been limited to counts and rarely have included complementary estimates of vital rates. Complexities of population dynamics cannot be understood without considering population processes as well as population states. We estimated pregnancy rates, survival rates, age ratios, and sex ratios for reintroduced elk at Theodore Roosevelt National Park, North Dakota, USA; combined vital rates in a population projection model; and compared model projections with observed elk numbers and population ratios. Pregnancy rates in January (early in the second trimester of pregnancy) averaged 54.1% (SE = 5.4%) for subadults and 91.0% (SE = 1.7%) for adults, and 91.6% of pregnancies resulted in recruitment at 8 months. Annual survival rates of adult females averaged 0.96 (95% CI = 0.94-0.98) with hunting included and 0.99 (95% CI = 0.97-0.99) with hunting excluded from calculations. Our fitted model explained 99.8% of past variation in population estimates and represents a useful new tool for short-term management planning. Although we found no evidence of temporal variation in vital rates, variation in population composition caused substantial variation in projected rates of increase (??=1.20-1.36). Restoring documented hunter harvests and removals of elk by the National Park Service led to a potential rate of ?? = 1.26. Greater rates of increase substantiated elsewhere were within the expected range of chance variation, given our model and estimates of vital rates. Rates of increase realized by small elk populations are too variable to support inferences about habitat quality or density dependence.

  13. Body weight and rumen-reticulum capacity in tule elk and mule deer

    USGS Publications Warehouse

    Weckerly, F.W.; Bleich, V.C.; Chetkiewicz, C.-L.B.; Ricca, M.A.


    The relationship between body size and rumen-reticulum capacity among conspecific individuals is predicted to be isometric. We examined whether the relationship between body weight and rumen-reticulum capacity was isometric in adult male and female rule elk (Cervus elaphus nannodes) and in adult female mule deer (Odocoileus hemionus). We detected no effect of sex on this relationship in elk, and the slope of the regression was 1.0 for one measure of rumen-reticulum capacity and <1.0 for another. Among deer, the slope of the relationship was <1.0 in one measure of rumen-reticulum capacity, and we detected no relationship with the other.

  14. Mapping brucellosis increases relative to elk density using hierarchical Bayesian models

    USGS Publications Warehouse

    Cross, Paul C.; Heisey, Dennis M.; Scurlock, Brandon M.; Edwards, William H.; Brennan, Angela; Ebinger, Michael R.


    The relationship between host density and parasite transmission is central to the effectiveness of many disease management strategies. Few studies, however, have empirically estimated this relationship particularly in large mammals. We applied hierarchical Bayesian methods to a 19-year dataset of over 6400 brucellosis tests of adult female elk (Cervus elaphus) in northwestern Wyoming. Management captures that occurred from January to March were over two times more likely to be seropositive than hunted elk that were killed in September to December, while accounting for site and year effects. Areas with supplemental feeding grounds for elk had higher seroprevalence in 1991 than other regions, but by 2009 many areas distant from the feeding grounds were of comparable seroprevalence. The increases in brucellosis seroprevalence were correlated with elk densities at the elk management unit, or hunt area, scale (mean 2070 km2; range = [95–10237]). The data, however, could not differentiate among linear and non-linear effects of host density. Therefore, control efforts that focus on reducing elk densities at a broad spatial scale were only weakly supported. Additional research on how a few, large groups within a region may be driving disease dynamics is needed for more targeted and effective management interventions. Brucellosis appears to be expanding its range into new regions and elk populations, which is likely to further complicate the United States brucellosis eradication program. This study is an example of how the dynamics of host populations can affect their ability to serve as disease reservoirs.

  15. Mapping Brucellosis Increases Relative to Elk Density Using Hierarchical Bayesian Models

    PubMed Central

    Cross, Paul C.; Heisey, Dennis M.; Scurlock, Brandon M.; Edwards, William H.; Ebinger, Michael R.; Brennan, Angela


    The relationship between host density and parasite transmission is central to the effectiveness of many disease management strategies. Few studies, however, have empirically estimated this relationship particularly in large mammals. We applied hierarchical Bayesian methods to a 19-year dataset of over 6400 brucellosis tests of adult female elk (Cervus elaphus) in northwestern Wyoming. Management captures that occurred from January to March were over two times more likely to be seropositive than hunted elk that were killed in September to December, while accounting for site and year effects. Areas with supplemental feeding grounds for elk had higher seroprevalence in 1991 than other regions, but by 2009 many areas distant from the feeding grounds were of comparable seroprevalence. The increases in brucellosis seroprevalence were correlated with elk densities at the elk management unit, or hunt area, scale (mean 2070 km2; range  = [95–10237]). The data, however, could not differentiate among linear and non-linear effects of host density. Therefore, control efforts that focus on reducing elk densities at a broad spatial scale were only weakly supported. Additional research on how a few, large groups within a region may be driving disease dynamics is needed for more targeted and effective management interventions. Brucellosis appears to be expanding its range into new regions and elk populations, which is likely to further complicate the United States brucellosis eradication program. This study is an example of how the dynamics of host populations can affect their ability to serve as disease reservoirs. PMID:20428240

  16. Relationships between in vivo microdamage and the remarkable regional material and strain heterogeneity of cortical bone of adult deer, elk, sheep and horse calcanei.


    Skedros, John G; Sybrowsky, Christian L; Anderson, Wm Erick; Chow, Frank


    Natural loading of the calcanei of deer, elk, sheep and horses produces marked regional differences in prevalent/predominant strain modes: compression in the dorsal cortex, shear in medial-lateral cortices, and tension/shear in the plantar cortex. This consistent non-uniform strain distribution is useful for investigating mechanisms that mediate the development of the remarkable regional material variations of these bones (e.g. collagen orientation, mineralization, remodeling rates and secondary osteon morphotypes, size and population density). Regional differences in strain-mode-specific microdamage prevalence and/or morphology might evoke and sustain the remodeling that produces this material heterogeneity in accordance with local strain characteristics. Adult calcanei from 11 animals of each species (deer, elk, sheep and horses) were transversely sectioned and examined using light and confocal microscopy. With light microscopy, 20 linear microcracks were identified (deer: 10; elk: six; horse: four; sheep: none), and with confocal microscopy substantially more microdamage with typically non-linear morphology was identified (deer: 45; elk: 24; horse: 15; sheep: none). No clear regional patterns of strain-mode-specific microdamage were found in the three species with microdamage. In these species, the highest overall concentrations occurred in the plantar cortex. This might reflect increased susceptibility of microdamage in habitual tension/shear. Absence of detectable microdamage in sheep calcanei may represent the (presumably) relatively greater physical activity of deer, elk and horses. Absence of differences in microdamage prevalence/morphology between dorsal, medial and lateral cortices of these bones, and the general absence of spatial patterns of strain-mode-specific microdamage, might reflect the prior emergence of non-uniform osteon-mediated adaptations that reduce deleterious concentrations of microdamage by the adult stage of bone development. PMID

  17. Relationships between in vivo microdamage and the remarkable regional material and strain heterogeneity of cortical bone of adult deer, elk, sheep and horse calcanei

    PubMed Central

    Skedros, John G; Sybrowsky, Christian L; Anderson, Wm Erick; Chow, Frank


    Natural loading of the calcanei of deer, elk, sheep and horses produces marked regional differences in prevalent/predominant strain modes: compression in the dorsal cortex, shear in medial–lateral cortices, and tension/shear in the plantar cortex. This consistent non-uniform strain distribution is useful for investigating mechanisms that mediate the development of the remarkable regional material variations of these bones (e.g. collagen orientation, mineralization, remodeling rates and secondary osteon morphotypes, size and population density). Regional differences in strain-mode-specific microdamage prevalence and/or morphology might evoke and sustain the remodeling that produces this material heterogeneity in accordance with local strain characteristics. Adult calcanei from 11 animals of each species (deer, elk, sheep and horses) were transversely sectioned and examined using light and confocal microscopy. With light microscopy, 20 linear microcracks were identified (deer: 10; elk: six; horse: four; sheep: none), and with confocal microscopy substantially more microdamage with typically non-linear morphology was identified (deer: 45; elk: 24; horse: 15; sheep: none). No clear regional patterns of strain-mode-specific microdamage were found in the three species with microdamage. In these species, the highest overall concentrations occurred in the plantar cortex. This might reflect increased susceptibility of microdamage in habitual tension/shear. Absence of detectable microdamage in sheep calcanei may represent the (presumably) relatively greater physical activity of deer, elk and horses. Absence of differences in microdamage prevalence/morphology between dorsal, medial and lateral cortices of these bones, and the general absence of spatial patterns of strain-mode-specific microdamage, might reflect the prior emergence of non-uniform osteon-mediated adaptations that reduce deleterious concentrations of microdamage by the adult stage of bone development. PMID

  18. Ecdysteroid receptors in Drosophila melanogaster adult females

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ecdysteroid receptors were identified and partially characterized from total cell extracts of whole animals and dissected tissues from Drosophila melanogaster adult females. Binding studies indicated the presence of two ecdysteroid binding components having high affinity and specificity consistent w...

  19. Understanding the Burden of Adult Female Acne

    PubMed Central

    Kawata, Ariane K.; Daniels, Selena R.; Yeomans, Karen; Burk, Caroline T.; Callender, Valerie D.


    Objective: Typically regarded as an adolescent condition, acne among adult females is also prevalent. Limited data are available on the clinical characteristics and burden of adult female acne. The study objective was to describe clinical characteristics and psychosocial impact of acne in adult women. Design: Cross-sectional, web-based survey. Setting: Data were collected from a diverse sample of United States females. Participants: Women ages 25 to 45 years with facial acne (≥25 visible lesions). Measurements: Outcomes included sociodemographic and clinical characteristics, perceptions, coping behaviors, psychosocial impact of acne (health-related quality of life using acne-specific Quality of Life questionnaire and psychological status using Patient Health Questionnaire), and work/productivity. Results: A total of 208 women completed the survey (mean age 35±6 years), comprising White/Caucasian (51.4%), Black/African American (24.5%), Hispanic/Latino (11.1%), Asian (7.7%), and Other (5.3%). Facial acne presented most prominently on cheeks, chin, and forehead and was characterized by erythema, postinflammatory hyperpigmentation, and scarring. Average age of adult onset was 25±6 years, and one-third (33.7%) were diagnosed with acne as an adult. The majority (80.3%) had 25 to 49 visible facial lesions. Acne was perceived as troublesome and impacted self-confidence. Makeup was frequently used to conceal acne. Facial acne negatively affected health-related quality of life, was associated with mild/moderate symptoms of depression and/or anxiety, and impacted ability to concentrate on work or school. Conclusion: Results highlight the multifaceted impact of acne and provide evidence that adult female acne is under-recognized and burdensome. PMID:24578779

  20. The Spiritual Journey: Black Female Adult Learners in Higher Education

    ERIC Educational Resources Information Center

    Jones Tinner, LaShanta Y.


    This study explored the experience of Black female adult learners and how spirituality influenced their academic journeys. Research concerning Black female adult learners in higher education is ostensibly partial. These data offered an extended understanding of Black female adult learners' academic experiences, while also investigating common…

  1. Behavioral responses of north American Elk to recreational activity

    USGS Publications Warehouse

    Naylor, L.M.; Wisdom, M.J.; Anthony, R.G.


    Off-road recreation on public lands in North America has increased dramatically in recent years. Wild ungulates are sensitive to human activities, but the effect of off-road recreation, both motorized and nonmotorized, is poorly understood. We measured responses of elk (Cervus elaphus) to recreational disturbance in northeast Oregon, USA, from April to October, 2003 and 2004. We subjected elk to 4 types of recreational disturbance: all-terrain vehicle (ATV) riding, mountain biking, hiking, and horseback riding. Motion sensors inside radiocollars worn by 13 female elk recorded resting, feeding, and travel activities at 5-minute intervals throughout disturbance and control periods. Elk fed and rested during control periods, with little time spent traveling. Travel time increased in response to all 4 disturbances and was highest in mornings. Elk travel time was highest during ATV exposure, followed by exposure to mountain biking, hiking, and horseback riding. Feeding time decreased during ATV exposure and resting decreased when we subjected elk to mountain biking and hiking disturbance in 2003. Our results demonstrated that activities of elk can be substantially affected by off-road recreation. Mitigating these effects may be appropriate where elk are a management priority. Balancing management of species like elk with off-road recreation will become increasingly important as off-road recreational uses continue to increase on public lands in North America.

  2. Satellite and ground radiotracking of elk

    NASA Technical Reports Server (NTRS)

    Craighead, F. C., Jr.; Craighead, J. J.; Cote, C. E.; Buechner, H. K.


    Radiotracking and monitoring of free-living animals in natural environments is providing an effective new technique for acquiring information on biological processes, including animal orientation and navigation. To test the practicability of extending the technique by using satellite systems for tracking animals, a female elk was instrumented with an electronic collar. It contained both the Interrogation Recording Location System (IRLS) transponder and a Craighead-Varney ground-tracking transmitter. The elk was successfully tracked and monitored by satellite during month of April 1970. This was the first time an animal had been tracked by satellite on the surface of the earth.

  3. Nutrition for optimal predatory performance of adult female Orius insidiosus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Reproduction in a female predator, Orius insidiosus, is a nutritionally stringent process. Adult females acquire the nutrition needed for egg development from their prey, and rates of egg development are dependent on nutrients acquired in that life stage. When released as a biological control agen...

  4. Biotelemetry studies on elk

    SciTech Connect

    White, G.C.


    The movements of Rocky Mountain elk (Cervus elaphus nelsoni) in the eastern Jemez Mountains in north-central New Mexico were studied from 1978 to 1980. Thirty-six elk were trapped, marked, and released, and 30 of these animals were radio-collared. The June 1977 la Mesa fire created a wintering habit at that was used heavily by the radio-collared elk. The 10-year-old clear cuts on Cerro del Medio on the Baca Land and Cattle Company property were used for calving and nursing areas. In general, radio-collared elk used in an early successional state, and they did not use areas at the Los Alamos National Laboratory where there was human activity.

  5. Hispanic adults' beliefs, attitudes, and intentions regarding the female condom.


    Bogart, L M; Cecil, H; Pinkerton, S D


    The present study used the theory of planned behavior (TPB) (Ajzen, 1985) augmented by AIDS knowledge to investigate factors influencing intentions of Hispanic adults to use the female condom. A total of 146 persons (75 women and 71 men; mean age, 27 years) recruited from community-based organizations completed an anonymous survey regarding intentions to use the female condom with their main sex partner. The TPB model had greater predictive utility for women's, than for men's, female condom use intentions. For men, attitudes and norms did not predict female condom use intentions, but greater AIDS knowledge was related to lower intentions to use the female condom, above and beyond the TPB constructs. Perceived behavioral control, operationalized as self-efficacy, significantly increased the predictive utility of the TPB model for women's female condom use intentions but not for men's. Behavior change strategies to increase female condom use are discussed in light of these findings. PMID:10833679

  6. Separation-Individuation in Female Adult Development.

    ERIC Educational Resources Information Center

    Mullins, Deborah

    This study examined separation-individuation development issues for young adult women, from the perspective of object-relations theory. Its purpose was to explore a woman's perception of her relationship with mother as it is affected by age and request for psychotherapy as well as the relationship between mother-daughter bond and personality…

  7. Moral dilemmas in females: children are more utilitarian than adults

    PubMed Central

    Bucciarelli, Monica


    Influential theories on moral judgments propose that they rely either on emotions or on innate moral principles. In contrast, the mental model theory postulates that moral judgments rely on reasoning, either intuition or deliberation. The theory allows for the possibility that intuitions lead to utilitarian judgments. This paper reports two experiments involving fifth-grade children, adolescents, and adults; the results revealed that children reason intuitively to resolve moral dilemmas in which action and inaction lead to different outcomes. In particular, the results showed female children to be more utilitarian than female adults in resolving classical moral dilemmas: they preferred an action that achieved a good outcome for a greater number of people. Within the mental model theory's framework there is no reason to expect that females and males differ in their ability to reason, but at the moment the results for females cannot be generalized to males who were not properly represented in the adults groups of the two experiments. The result revealing that (female) children are more utilitarian than (female) adults, which is hard to explain via many current theories, was predicted by the mental model theory. PMID:26441722

  8. Moral dilemmas in females: children are more utilitarian than adults.


    Bucciarelli, Monica


    Influential theories on moral judgments propose that they rely either on emotions or on innate moral principles. In contrast, the mental model theory postulates that moral judgments rely on reasoning, either intuition or deliberation. The theory allows for the possibility that intuitions lead to utilitarian judgments. This paper reports two experiments involving fifth-grade children, adolescents, and adults; the results revealed that children reason intuitively to resolve moral dilemmas in which action and inaction lead to different outcomes. In particular, the results showed female children to be more utilitarian than female adults in resolving classical moral dilemmas: they preferred an action that achieved a good outcome for a greater number of people. Within the mental model theory's framework there is no reason to expect that females and males differ in their ability to reason, but at the moment the results for females cannot be generalized to males who were not properly represented in the adults groups of the two experiments. The result revealing that (female) children are more utilitarian than (female) adults, which is hard to explain via many current theories, was predicted by the mental model theory. PMID:26441722

  9. Mouse Elk oncogene maps to chromosome X and a novel Elk oncogene (Elk3) maps to chromosome 10.


    Tamai, Y; Taketo, M; Nozaki, M; Seldin, M F


    The Elk protein is a member of the Ets family found in both vertebrates and invertebrates. Human ELK1 encoded by ELK1 binds alone or together with serum response factor to DNA and regulates gene expression in a variety of biological processes. Using a panel of interspecific backcross mice, we have mapped the Elk oncogene (Elk) and a novel type Elk oncogene (Elk3), closely related to ELK1. Elk maps to Chr X, and Elk3 maps to the proximal region of Chr 10. PMID:7601474

  10. Mouse Elk oncogene maps to chromosome X and a novel Elk oncogene (Elk3) maps to chromosome 10

    SciTech Connect

    Tamai, Yoshitaka; Taketo, Makoto; Nozaki, Masami


    The Elk protein is a member of the Ets family found in both vertebrates and invertebrates. Human ELK1 encoded by ELK1 binds alone or together with serum response factor to DNA and regulates gene expression in a variety of biological processes. Using a panel of interspecific backcross mice, we have mapped the Elk oncogene (Elk) and a novel type Elk oncogene (Elk3), closely related to ELK1. Elk maps to Chr X, and Elk3 maps to the proximal region of Chr 10. 18 refs., 1 fig., 1 tab.

  11. Elk (Cervus Canadensis) preference for feeds varying in selenium concentration.


    Pfister, J A; Davis, T Z; Hall, J O; Stegelmeier, B L; Panter, K E


    Selenium-accumulator plants are reputed to be unpalatable to large ungulates. Elk (Cervus canadensis) populations in southeastern Idaho overlap with populations of Se-rich plants, but there is no information on the influence of plant Se concentration on elk dietary preferences. The objective of this study was to determine, under controlled conditions, the preference of elk for feeds varying in Se concentrations. Seven yearling female elk (128 ± 5 kg) were purchased from a commercial elk farm in southeastern Idaho and adapted to low-Se alfalfa pellets. Three feeding trials using pellets with predetermined Se concentrations were conducted. Alfalfa pellets were commercially made with the addition of Symphyotrichum ascendens (western aster) so that the pellets contained 0.4, 5, 20, 50, or 100 mg/kg (DM basis) Se. In trial 1, 5 Se-containing alfalfa pellets (0.4, 5, 20, 50, and 100 mg/kg Se) were offered for 10 d; trial 2 used 4 Se-containing alfalfa pellet choices (0.4, 20, 50, and 100 mg/kg), and trial 3 used 3 pellet choices (0.4, 50, and 100 mg/kg) for 6 d. In trial 1, consumption of the control pellets by elk was greater than each of the other pellet choices (P < 0.001). Similarly, consumption of the 5-mg/kg Se pellet differed from control pellet and all other Se-containing pellets (P < 0.0001). There were no differences (P > 0.50) in consumption of the 20-, 50-, or 100-mg/kg Se pellets. In trial 2, elk consumed more (P < 0.0001) of the control pellet than the 20-, 50-, and 100-mg/kg Se pellets. Similarly, elk consumed more (P < 0.0001) of the 20-mg/kg Se pellet than the 50- and 100-mg/kg Se pellets. There were no differences (P > 0.99) in elk consumption of the 50- and 100-mg/kg Se pellets. In trial 3, elk consumption of the control and 50- and 100-mg/kg Se pellets differed (P ≤ 0.03) from one another each day except that on d 1 and 2, where elk consumption of the 50- and 100-mg/kg Se pellets did not differ (P ≥ 0.32). Elk clearly discriminated against

  12. Sexuality of Deviant Females: Adolescent and Adult Correlates.

    ERIC Educational Resources Information Center

    Vitaliano, Peter Paul; And Others


    Suggests an association between negative sexual experiences in adolescents, low self-image, and subsequent deviant adult life styles. Results of a survey of prostitutes and a corresponding sample of female offenders showed that the prostitutes reported significantly more negative sexual experiences in adolescence. (Author/JAC)

  13. Acne in the adult female patient: a practical approach.


    Kamangar, Faranak; Shinkai, Kanade


    Acne vulgaris is a common reason why adult women present to dermatologists and can be a clinical challenge to treat. It may also be an important sign of an underlying endocrine disease such as Polycystic Ovary Syndrome (PCOS). Although standard acne therapies can be successfully used to treat acne in adult female patients, hormonal treatment is a safe and effective therapeutic option that may provide an opportunity to better target acne in this population, even when other systemic therapies have failed. In this article, a practical approach to the adult female patient with acne will be reviewed to enhance the dermatologist's ability to use hormonal acne therapies and to better identify and evaluate patients with acne in the setting of a possible endocrine disorder. PMID:22994662

  14. Resource selection by elk in an agro-forested landscape of northwestern Nebraska.


    Baasch, David M; Fischer, Justin W; Hygnstrom, Scott E; VerCauteren, Kurt C; Tyre, Andrew J; Millspaugh, Joshua J; Merchant, James W; Volesky, Jerry D


    In recent years, elk have begun recolonizing areas east of the Rocky Mountains that are largely agro-forested ecosystems composed of privately owned land where management of elk is an increasing concern due to crop and forage depredation and interspecific disease transmission. We used a Geographic Information System, elk use locations (n = 5013), random locations (n = 25,065), discrete-choice models, and information-theoretic methods to test hypotheses about elk resource selection in an agro-forested landscape located in the Pine Ridge region of northwestern Nebraska, USA. Our objectives were to determine landscape characteristics selected by female elk and identify publicly owned land within the Pine Ridge for potential redistribution of elk. We found distance to edge of cover influenced selection of resources by female elk most and that in areas with light hunting pressure, such as ours, this selection was not driven by an avoidance of roads. Female elk selected resources positioned near ponderosa pine cover types during all seasons, exhibited a slight avoidance of roads during spring and fall, selected areas with increased slope during winter and spring, and selected north- and east-facing aspects over flat areas and areas with south-facing slopes during winter months. We used our models to identified a potential elk redistribution area that had a higher proportion of landcover with characteristics selected by elk in our study area than the current herd areas and more landcover that was publicly owned. With appropriate management plans, we believe elk within the Potential Elk Redistribution Area would predominantly occupy publicly owned land, which would help minimize crop and forage damage on privately owned lands. PMID:20872141

  15. Childhood maltreatment in adult female psychiatric outpatients with eating disorders.


    Fosse, Gunilla Klensmeden; Holen, Are


    To explore possible relations between maltreatment in childhood and subsequent eating disorders in adult life, 107 consecutive adult psychiatric female outpatients were screened for eating disorders. They also completed questionnaires about harassment by adults and bullying by peers in childhood. The Childhood Trauma Questionnaire measured childhood abuse by parents or other adults, and the Parental Bonding Instrument captured parental coldness and overprotection. Bullying by peers was measured by an inventory used in schools. Outpatients who met the criteria for bulimia nervosa reported far more bullying by peers, more coldness and overprotection from fathers, and more childhood emotional, physical and sexual abuse. The findings suggest associations between childhood maltreatment, especially bullying by peers, and bulimia nervosa. PMID:17056418

  16. Population dynamics of tule elk at point Reyes National Seashore, California

    USGS Publications Warehouse

    Howell, J.A.; Brooks, G.C.; Semenoff-Irving, M.; Greene, C.


    The presence of locally abundant wildlife raises questions about natural regulation and ecological consequences of overpopulation. We sought to establish precise information about population size, structure, and productivity to examine the role of natural regulation in a closed tule elk (Cervus elaphus nannodes) population at Point Reyes National Seashore, California, USA. We estimated an instantaneous exponential growth rate of 0.19 with an adjusted R2 = 0.98 during 1998, 20 years after the elk were introduced. We estimated annual survival for adult cows of nearly 0.95. Calf survival from birth through the rut ending during October-November was 0.85. Male calves exhibited higher mortality than female calves. Cow mortality was associated with the calving season. We measured a 42% increase in cow:calf density from 0.733 ha-1 to 1.043 ha-1 during 1996-1998. We observed a density-correlated reduction in the rate of increase and in the cow:calf ratios prior to high precipitation El Nin??o Southern Oscillation years, 1993, 1996, and 1997, precipitation >1.23 m year-1. Given the high population growth rate and model evaluation of management scenarios, park managers will need to use a suite of approaches, such as contraception and removal, to maintain the elk population at levels at or near the closed-range carrying capacity for years between El Nin??o events.

  17. Adult female of Strongyloides stercoralis in respiratory secretions

    PubMed Central

    Bava, Bava Amadeo Javier; Cecilia, Domínguez; Alcides, Troncoso


    Objective To communicate the presence of adult females, rabditoid larvae and eggs of Strongyloides stercoralis (S. stercoralis) in the respiratory secretions obtained by tracheal aspirate from a HIV-negative patient who was suffering from polymyositis, and treated with corticoids and amethopterin and assisted by pneumonia. Methods The respiratory secretions submitted to the Parasitology Laboratory of the Muñiz Hospital were made more concentrated by centrifugation (1 500 r/min for 15 seconds). Wet mount microscopy was performed with the pellet. Results It revealed adult females, rabditoid larvae and eggs of S. stercoralis. Further parasitological studies performed after the start of the treatment with ivermectin on fresh fecal samples, gastric lavages and tracheal aspirates showed scanty mobile filariform and rabditoid larvae of the same parasite. Conclusions The presence of adult female S. stercoralis which has never been observed before in the clinical samples submitted to our Laboratory for investigation can be considered as an indirect marker of the severe immunosupression of the patient. PMID:23620857

  18. Female Adult Mouse Cardiomyocytes Are Protected Against Oxidative Stress

    PubMed Central

    Wang, Fangfei; He, Quan; Sun, Ying; Dai, Xiangguo; Yang, Xiao-Ping


    Premenopausal women have less cardiovascular disease and lower cardiovascular morbidity and mortality than men the same age. Our previous studies showed that female mice have lower mortality and better preserved cardiac function after myocardial infarction. However, the precise cellular and molecular mechanisms responsible for such a sex difference are not well established. Using cultured adult mouse cardiomyocytes (ACMs), we tested the hypothesis that the survival advantage of females stems from activated estrogen receptors (ER) and Akt survival signaling pathways. ACMs were isolated from male and female C57BL/6J mice and treated with hydrogen peroxide (H2O2, 100 μM) for 30 min. Cell survival was indicated by rod ratio (rod shaped cells/total cells) and cell death by lactate dehydrogenase (LDH) release and positive staining of Annexin-V (AV+, a marker for apoptosis) and propidium iodide (PI+, a marker for necrosis). In response to H2O2, female ACMs exhibited a higher rod ratio, lower LDH release and fewer AV+ and PI+ cells compared to males. Phospho-Akt was greater in females both at baseline and after H2O2 stimulation. The downstream molecule of Akt, phosphor-GSK-3β (inactivation), was also higher while caspase-3 activity was lower in females in response to H2O2. Bcl-2 did not differ between genders. ERα was the dominant isoform in females, whereas ERβ was low but similar in both genders. Our findings demonstrate that female ACMs have a greater survival advantage when challenged with oxidative stress-induced cell death. This may be attributable to activation of Akt and inhibition of GSK-3β and caspase-3 through an ERα-mediated mechanism. PMID:20212261

  19. Heightened airway responsiveness in normal female children compared with adults.


    Tepper, R S; Stevens, J; Eigen, H


    Studies have suggested that airway responsiveness declines with maturation; however, studies comparing infants, children, and adults are confounded by differences in size as well as maturation. Therefore, to determine whether maturation has a significant affect on airway responsiveness, we compared normal female children (n = 9; mean age = 13.6 yr) and adults (n = 7; mean age = 42.4 yr) who were matched for body size. Bronchial challenge tests were performed with increasing methacholine concentrations to a maximum of 30 mg/ml. At baseline, there were no significant differences between the two groups in lung volumes (TGV, RV, TLC) or flow-volume curves (FEV1, average forced expiratory flow rate between 25% and 75% of the vital capacity [FEF25-75], FVC). All subjects but one adolescent completed the challenge (30 mg/ml). The children had a greater percentage decline from baseline in FEV1 than the adults (17 versus 7%, p < 0.03). The percentage decline in FEF25-75 was greater for the children than for the adults, but the difference was not statistically significant (35 versus 20%, p < 0.10). Compared with the children, the adults more often demonstrated a plateau in their dose-response curves for FEV1 (22 versus 86%) and for FEF25-75 (33 versus 100%). We conclude that normal female children have a greater airway responsiveness to inhaled methacholine than do adults, and that this difference is not related to baseline lung size, airway caliber, or delivered methacholine dose. PMID:8118636

  20. Motivational and mindfulness intervention for young adult female marijuana users

    PubMed Central

    de Dios, Marcel A.; Herman, Debra S.; Britton, Willoughby B.; Hagerty, Claire E.; Anderson, Bradley J.; Stein, Michael D.


    This pilot study tested the efficacy of a brief intervention using motivational interviewing (MI) plus mindfulness meditation (MM) to reduce marijuana use among young adult female. Thirty-four female marijuana users between the ages of 18–29 were randomized to either the intervention group (n = 22), consisting of 2 sessions of MI-MM or an assessment-only control group (n = 12). Participants’ marijuana use was assessed at baseline, 1, 2, and 3 months post-treatment. Fixed-effects regression modeling was used to analyze treatment effects. Participants randomized to the intervention group were found to use marijuana on 6.15 (z = −2.42, p=.015), 7.81 (z = −2.78, p=.005), and 6.83 (z = −2.23, p=.026) fewer days at months 1, 2, and 3, respectively, than controls. Findings from this pilot study provide preliminary evidence for the feasibility and effectiveness of a brief MI-MM for young adult female marijuana users. PMID:21940136

  1. Effects of black bear relocation on elk calf recruitment at Great Smoky Mountains National Park

    USGS Publications Warehouse

    Yarkovich, J.; Clark, J.D.; Murrow, J.L.


    Previous research from 2001 to 2006 on an experimentally released elk (Cervus elaphus) population at Great Smoky Mountains National Park (GSMNP or Park) indicated that calf recruitment (i.e., calves reaching 1 yr of age per adult female elk) was low (0.306, total SE = 0.090) resulting in low or negative population growth (λ = 0.996, 95% CI = 0.945–1.047). Black bear (Ursus americanus) predation was the primary calf mortality factor. From 2006 to 2008, we trapped and relocated 49 bears (30 of which were radiocollared) from the primary calving areas in the Park and radiomonitored 67 (28 M:39 F) adult elk and 42 calves to compare vital rates and population growth with the earlier study. A model with annual calf recruitment rate correlating with the number of bears relocated each year was supported (ΔAICc = 0.000; β = 0.070, 95% CI = 0.028–0.112) and a model with annual calf recruitment differing from before to during bear relocation revealed an increase to 0.544 (total SE = 0.098; β = −1.092, 95% CI = −1.180 to −0.375). Using vital rates and estimates of process standard errors observed during our study, 25-yr simulations maintained a mean positive growth rate in 100% of the stochastic trials with λ averaging 1.118 (95% CI = 1.096–1.140), an increase compared with rates before bear relocation. A life table response experiment revealed that increases in population growth were mostly (67.1%) due to changes in calf recruitment. We speculate that behavioral adaptation of the elk since release also contributed to the observed increases in recruitment and population growth. Our results suggest that managers interested in elk reintroduction within bear range should consider bear relocation as a temporary means of increasing calf recruitment.

  2. Litter Size Predicts Adult Stereotypic Behavior in Female Laboratory Mice

    PubMed Central

    Bechard, Allison; Nicholson, Anthony; Mason, Georgia


    Stereotypic behaviors are repetitive invariant behaviors that are common in many captive species and potentially indicate compromised welfare and suitability as research subjects. Adult laboratory mice commonly perform stereotypic bar-gnawing, route-tracing, and back-flipping, although great individual variation in frequency occurs. Early life factors (for example, level of maternal care received) have lasting effects on CNS functioning and abilities to cope with stress and therefore may also affect stereotypic behavior in offspring. Access to maternal resources and care are influenced by the number of pups in a litter; therefore, we examined both litter size and its potential correlate, weight at weaning, as early environmental predictors of adult stereotypic behavior in laboratory mice. Further, we assessed the effects on offspring stereotypic behavior of delaying the separation of mother and pups (weaning) beyond the standard 21 d of age. Analyzing stereotypic behavior in 3 different mouse colonies composed of 2 inbred strains (C57BL/6N and C57BL/6J) and an outbred stock (CD1[ICR]) revealed significant positive correlation between litter size and stereotypic behavior in female, but not male, mice. Weight and age at weaning did not significantly affect levels of stereotypy in either sex. Litter size therefore may be a useful indicator of individual predisposition to stereotypic behavior in female laboratory mice. PMID:23043805

  3. Could adult female acne be associated with modern life?


    Albuquerque, R G R; Rocha, M A D; Bagatin, E; Tufik, S; Andersen, M L


    In recent years, the prevalence of adult female acne has increased, but the reason for this increase remains unclear. Acne is one of the most common skin disorders. It can be triggered or worsened by endogenous and exogenous factors, including genetic predisposition, hormone concentrations, diet, smoke and stress; although the interaction with this last factor is not well understood. Modern life presents many stresses including urban noises, socioeconomic pressures and light stimuli. Women are especially affected by stress during daily routine. The recent insertion in the labor market is added to the duties of the mother and wife. Women also have a higher risk of developing psychiatric disorders such as depression and anxiety. Sleep restriction is added to these factors, with several negative consequences on health, including on hormonal secretion and the immune system. This is further complicated by the natural variation in sleep architecture across the menstrual cycle. Recent studies have brought new data about the mechanisms and possible factors involved. This review aims to establish a connection between stress, sleep deprivation and adult female acne. PMID:24952024

  4. Habitual use of vocal fry in young adult female speakers.


    Wolk, Lesley; Abdelli-Beruh, Nassima B; Slavin, Dianne


    The purpose of this study was to examine the use of vocal fry in young adult Standard American-English (SAE) speakers. This was a preliminary attempt (1) to determine the prevalence of the use of this register in young adult college-aged American speakers and (2) to describe the acoustic characteristics of vocal fry in these speakers. Subjects were 34 female college students. They were native SAE speakers aged 18-25 years. Data collection procedures included high quality recordings of two speaking conditions, (1) sustained isolated vowel /a/ and (2) sentence reading task. Data analyses included both perceptual and acoustic evaluations. Results showed that approximately two-thirds of this population used vocal fry and that it was most likely to occur at the end of sentences. In addition, statistically significant differences between vocal fry and normal register were found for mean F(0) minimum, F(0) maximum, F(0) range, and jitter local. Preliminary findings were taken to suggest that use of the vocal fry register may be common in some adult SAE speakers. PMID:21917418

  5. Nutritional condition of elk in rocky mountain national park

    USGS Publications Warehouse

    Bender, L.C.; Cook, J.G.


    We tested the hypothesis that elk in Rocky Mountain National Park (RMNP) were at ecological carrying capacity by determining herd-specific levels of nutritional condition and fecundity. Ingesta-free body fat levels in adult cows that were lactating were 10.6% (s = 1.7; range = 6.2-15.4) and 7.7% (s = 0.5; range = 5.9-10.1) in November 2001 for the Horseshoe and Moraine Park herds, respectively. Cows that were not lactating were able to accrue significantly more body fat: 14.0% (s = 1.1; range = 7.7-19.3) and 11.5% (s = 0.8; range = 8.6-15.1) for the Horseshoe and Moraine Park herds, respectively. Cow elk lost most of their body fat over winter (April 2002 levels were 3.9% [s = 0.4] and 2.9% [s = 0.4] for the Horseshoe and Moraine Park herds, respectively). Nutritional condition indicated that both Horseshoe Park and Moraine Park elk were well below condition levels elk can achieve on very good-excellent nutrition (i.e., >15% body fat; Cook et al. 2004) and were comparable to other free-ranging elk populations. However, condition levels were higher than those expected at a "food-limited" carrying capacity, and a proportion of elk in each herd were able to achieve condition levels indicative of very good-excellent nutrition. Elk in RMNP are likely regulated and/or limited by a complex combination of density-independent (including significant heterogeneity in forage conditions across RMNP's landscape) and density-dependent processes, as condition levels contradict a simple density-dependent model of a population at ecological carrying capacity.

  6. Elk use of wallows and potential chronic wasting disease transmission.


    Vercauteren, Kurt C; Burke, Patrick W; Phillips, Gregory E; Fischer, Justin W; Seward, Nathan W; Wunder, Bruce A; Lavelle, Michael J


    Deposition of prions into the environment by infected animals may contribute to transmission and spread of chronic wasting disease (CWD) among free-ranging cervids, and identification of such environmental sources may provide an avenue for managing CWD. We evaluated the role that wallow use by elk (Cervus elaphus) may play in CWD transmission by monitoring wallows with animal-activated cameras throughout their period of use. We monitored 39 wallows from 5 August 2005 to 14 October 2005. Elk visited 20 sites; we recorded 22 events when only male elk wallowed and 374 additional events when male and female elk had naso-oral contact with wallow contents. Because wallows are foci of male elk activity, behaviors at wallows could potentially contribute to the maintenance and transmission of CWD. Our findings, however, suggest that because wallows are only used an average of one or two times a season they may not be important in CWD transmission. The data also suggest that mineral licks could be more important in CWD transmission because they were used more frequently and by three species that contract CWD. PMID:17984281

  7. Relations between nutritional condition and survival of North American elk Cervus elaphus

    USGS Publications Warehouse

    Bender, L.C.; Cook, J.G.; Cook, R.C.; Hall, P.B.


    We related annual and seasonal survival of four populations of elk Cervus elaphus in the Pacific Northwest, USA, to measures and indices of individual nutritional condition. Among populations, for all mortality (human and non-human causes) sources inclusive, annual survival of adult females was correlated with a rump body condition score (rs = 0.627, P = 0.071), and survival over spring-summer-autumn (SSA) was correlated with mean ingesta-free body fat (IFBF; rs = 0.567, P = 0.088) and rump body condition score (rBCS; rs = 0.615, P = 0.050). For non-human mortality sources only, survival through SSA was correlated with IFBF (rs = 0.567, P = 0.088) and rBCS (rs = 0.615, P = 0.050), and survival over winter was correlated with withers body condition score (rs = 0.677, P = 0.045). For human-caused mortality sources only, survival over SSA was correlated with rBCS (rs = 0.696, P = 0.036) and IFBF (rs = 0.696, P = 0.036). For individuals, logistic analysis found that individual likelihood of dying from all mortality sources inclusive was best predicted (??2 = 8.3, P = 0.004, ?? = -1.24) by longissimus dorsi (loin) muscle thickness, a measure of protein catabolism. For only non-human mortality sources, a model (??2 = 16.1, P = 0.0003) containing both loin muscle thickness (??2 = 5.7, P = 0.017, ??= -1.02) and percent ingesta-free body fat (??2 = 4.9, P = 0.027, ?? = -0.35) best predicted individual susceptibility to mortality. Odds ratios indicated that odds of dying increased approximately 3X for each centimeter of loin muscle catabolized and 1.4X for each percent less body fat. No condition indices at the individual level were related to survival from human-caused mortality sources. Our study populations were characterized by low-marginal condition (i.e. mean ingesta-free body fat levels of 5.9-12.3% for lactating cows in late autumn); this likely increased the prominence of measures of muscle catabolism relative to fat accretion in influencing individual elk survival

  8. The northern Yellowstone elk: density dependence and climatic conditions

    USGS Publications Warehouse

    Taper, Mark L.; Gogan, Peter J.P.


    We analyzed a time series of estimates of elk (Cervus elaphus) numbers on the northern Yellowstone winter range from 1964 to 1979 and 1986 to 1995 using a variety of discrete time stochastic population dynamic models. These models included adjustments for density, an increase in the area of winter range used by elk, lagged effects of the weather covariates of spring precipitation, snow depth and winter temperature, and the impacts of the 1988 drought and fires. An information-criteria-based model-selection process strongly supported evidence of density dependence. The best model, a Ricker model, distinguished between the 2 time periods. The bulk of the difference between the 2 periods is attributed to an increase in the amount of winter range used by elk. Inclusion of the covariates spring precipitation and spring precipitation squared greatly improved the model fit. We detected a short-lived increase in elk population growth rate following the 1988 drought and fires. Fertility and survivorship of adults appeared to have different density-dependent forms that together result in a biphasic relationships between population growth rate and density. This study confirms the presence of density-dependent regulation in the norther Yellowstone elk herd, and enhances our understanding of population dynamics of these ungulates.

  9. Predictors of urinary cadmium levels in adult females.


    McElroy, Jane A; Shafer, Martin M; Hampton, John M; Newcomb, Polly A


    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration. PMID:17544058

  10. A spontaneous depressive pattern in adult female rhesus macaques

    PubMed Central

    Qin, Dongdong; Rizak, Joshua; Chu, Xunxun; Li, Zhifei; Yang, Shangchuan; Lü, Longbao; Yang, Lichuan; Yang, Qing; Yang, Bo; Pan, Lei; Yin, Yong; Chen, Lin; Feng, Xiaoli; Hu, Xintian


    Non-human primates offer unique opportunities to study the development of depression rooted in behavioral and physiological abnormalities. This study observed adult female rhesus macaques within social hierarchies and aimed to characterize the physiological and brain abnormalities accompanying depressive-like behavior. The behaviors of 31 female rhesus macaques from 14 different breeding groups were video recorded, and the footage was analyzed using the focal animal technique. There were 13 monkeys who never displayed huddling behavior (non-huddlers). The remaining 18 monkeys were divided into two groups according the mean time spent in the huddle posture. Four monkeys were designated as high huddlers, whereas the other 14 monkeys were low huddlers. An inverse relationship was discovered between social rank and depression. High huddlers spent more time engaging in physical contact and in close proximity to other monkeys, as well as less time spontaneously and reactively locomoting, than low huddlers and/or non-huddlers. Cortisol levels measured from the hair were elevated significantly in high huddlers compared with low huddlers and non-huddlers, and the measured cortisol levels were specifically higher in high huddlers than subordinate or dominant control monkeys. Regional cerebral blood flow data revealed significant and widespread decreases in high huddlers compared with non-huddlers. PMID:26059851

  11. A spontaneous depressive pattern in adult female rhesus macaques.


    Qin, Dongdong; Rizak, Joshua; Chu, Xunxun; Li, Zhifei; Yang, Shangchuan; Lü, Longbao; Yang, Lichuan; Yang, Qing; Yang, Bo; Pan, Lei; Yin, Yong; Chen, Lin; Feng, Xiaoli; Hu, Xintian


    Non-human primates offer unique opportunities to study the development of depression rooted in behavioral and physiological abnormalities. This study observed adult female rhesus macaques within social hierarchies and aimed to characterize the physiological and brain abnormalities accompanying depressive-like behavior. The behaviors of 31 female rhesus macaques from 14 different breeding groups were video recorded, and the footage was analyzed using the focal animal technique. There were 13 monkeys who never displayed huddling behavior (non-huddlers). The remaining 18 monkeys were divided into two groups according the mean time spent in the huddle posture. Four monkeys were designated as high huddlers, whereas the other 14 monkeys were low huddlers. An inverse relationship was discovered between social rank and depression. High huddlers spent more time engaging in physical contact and in close proximity to other monkeys, as well as less time spontaneously and reactively locomoting, than low huddlers and/or non-huddlers. Cortisol levels measured from the hair were elevated significantly in high huddlers compared with low huddlers and non-huddlers, and the measured cortisol levels were specifically higher in high huddlers than subordinate or dominant control monkeys. Regional cerebral blood flow data revealed significant and widespread decreases in high huddlers compared with non-huddlers. PMID:26059851

  12. Evidence of Uncultivated Bacteria in the Adult Female Bladder

    PubMed Central

    Wolfe, Alan J.; Toh, Evelyn; Shibata, Noriko; Rong, Ruichen; Kenton, Kimberly; FitzGerald, MaryPat; Mueller, Elizabeth R.; Schreckenberger, Paul; Dong, Qunfeng; Nelson, David E.


    Clinical urine specimens are usually considered to be sterile when they do not yield uropathogens using standard clinical cultivation procedures. Our aim was to test if the adult female bladder might contain bacteria that are not identified by these routine procedures. An additional aim was to identify and recommend the appropriate urine collection method for the study of bacterial communities in the female bladder. Consenting participants who were free of known urinary tract infection provided urine samples by voided, transurethral, and/or suprapubic collection methods. The presence of bacteria in these samples was assessed by bacterial culture, light microscopy, and 16S rRNA gene sequencing. Bacteria that are not or cannot be routinely cultivated (hereinafter called uncultivated bacteria) were common in voided urine, urine collected by transurethral catheter (TUC), and urine collected by suprapubic aspirate (SPA), regardless of whether the subjects had urinary symptoms. Voided urine samples contained mixtures of urinary and genital tract bacteria. Communities identified in parallel urine samples collected by TUC and SPA were similar. Uncultivated bacteria are clearly present in the bladders of some women. It remains unclear if these bacteria are viable and/or if their presence is relevant to idiopathic urinary tract conditions. PMID:22278835

  13. Antler anomalies in tule elk

    USGS Publications Warehouse

    Gogan, Peter J.P.; Jessup, David A.; Barrett, Reginald H.


    Antler anomalies were evident in tule elk (Cervus elaphus nannodes) within 1 yr of reintroduction to Point Reyes, California (USA). These anomalies are consistent with previously described mineral deficiency-induced anomalies in cervids. The elk were judged deficient in copper. Low levels of copper in soils and vegetation at the release site, exacerbated by possible protein deficiency due to poor range conditions, are postulated as likely causes of the antler anomalies.

  14. Psychiatric and Addictive Symptoms of Young Adult Female Indoor Tanners

    PubMed Central

    Heckman, Carolyn J.; Cohen-Filipic, Jessye; Darlow, Susan; Kloss, Jacqueline D.; Manne, Sharon L.; Munshi, Teja


    Purpose Indoor tanning (IT) increases risk for melanoma and is particularly common among young adult women. IT has also been linked with some psychiatric symptoms, and frequent tanning may indicate tanning dependence (addiction) associated with endorphin release during ultraviolet (UV) radiation exposure. The objective of the current study was to investigate associations between IT, tanning dependence, and psychiatric and substance use symptoms in young adult women. Design Cross-sectional survey and psychiatric interview. Setting Online, except for the MINI International Neuropsychiatric Interview (MINI) that was completed over the telephone. Subjects Participants were 306 female university students aged 18–25 years. Measures MINI, Seasonal Scale Index, tanning dependence scales, reporting ever having used a tanning bed or booth with tanning lamps (single item), reporting smoking a cigarette in the last 30 days (single item). Analysis Descriptive statistics, chi square analysis, multivariate logistic regression. Results Forty-six percent of the sample reported a history of IT, and 25% were classified as tanning dependent. Multivariate logistic regression analyses showed that IT was significantly associated with symptoms of alcohol use disorders, generalized anxiety, and not having social anxiety. Tanning dependence was associated with symptoms of alcohol use disorders. Conclusion Tanning is of concern not only for its association with skin cancer but for its association with psychiatric and substance use symptoms. Young women with certain psychological problems may seek relief from their symptoms by IT. These findings suggest that indoor tanners may benefit from health behavior and other psychosocial interventions. PMID:23621780

  15. Patient-specific FDG dosimetry for adult males, adult females, and very low birth weight infants

    NASA Astrophysics Data System (ADS)

    Niven, Erin

    Fluorodeoxyglucose is the most commonly used radiopharmaceutical in Positron Emission Tomography, with applications in neurology, cardiology, and oncology. Despite its routine use worldwide, the radiation absorbed dose estimates from FDG have been based primarily on data obtained from two dogs studied in 1977 and 11 adults (most likely males) studied in 1982. In addition, the dose estimates calculated for FDG have been centered on the adult male, with little or no mention of variations in the dose estimates due to sex, age, height, weight, nationality, diet, or pathological condition. Through an extensive investigation into the Medical Internal Radiation Dose schema for calculating absorbed doses, I have developed a simple patient-specific equation; this equation incorporates the parameters necessary for alterations to the mathematical values of the human model to produce an estimate more representative of the individual under consideration. I have used this method to determine the range of absorbed doses to FDG from the collection of a large quantity of biological data obtained in adult males, adult females, and very low birth weight infants. Therefore, a more accurate quantification of the dose to humans from FDG has been completed. My results show that per unit administered activity, the absorbed dose from FDG is higher for infants compared to adults, and the dose for adult women is higher than for adult men. Given an injected activity of approximately 3.7 MBq kg-1, the doses for adult men, adult women, and full-term newborns would be on the order of 5.5, 7.1, and 2.8 mSv, respectively. These absorbed doses are comparable to the doses received from other nuclear medicine procedures.

  16. Human selection of elk behavioural traits in a landscape of fear.


    Ciuti, Simone; Muhly, Tyler B; Paton, Dale G; McDevitt, Allan D; Musiani, Marco; Boyce, Mark S


    Among agents of selection that shape phenotypic traits in animals, humans can cause more rapid changes than many natural factors. Studies have focused on human selection of morphological traits, but little is known about human selection of behavioural traits. By monitoring elk (Cervus elaphus) with satellite telemetry, we tested whether individuals harvested by hunters adopted less favourable behaviours than elk that survived the hunting season. Among 45 2-year-old males, harvested elk showed bolder behaviour, including higher movement rate and increased use of open areas, compared with surviving elk that showed less conspicuous behaviour. Personality clearly drove this pattern, given that inter-individual differences in movement rate were present before the onset of the hunting season. Elk that were harvested further increased their movement rate when the probability of encountering hunters was high (close to roads, flatter terrain, during the weekend), while elk that survived decreased movements and showed avoidance of open areas. Among 77 females (2-19 y.o.), personality traits were less evident and likely confounded by learning because females decreased their movement rate with increasing age. As with males, hunters typically harvested females with bold behavioural traits. Among less-experienced elk (2-9 y.o.), females that moved faster were harvested, while elk that moved slower and avoided open areas survived. Interestingly, movement rate decreased as age increased in those females that survived, but not in those that were eventually harvested. The latter clearly showed lower plasticity and adaptability to the local environment. All females older than 9 y.o. moved more slowly, avoided open areas and survived. Selection on behavioural traits is an important but often-ignored consequence of human exploitation of wild animals. Human hunting could evoke exploitation-induced evolutionary change, which, in turn, might oppose adaptive responses to natural and sexual

  17. Human selection of elk behavioural traits in a landscape of fear

    PubMed Central

    Ciuti, Simone; Muhly, Tyler B.; Paton, Dale G.; McDevitt, Allan D.; Musiani, Marco; Boyce, Mark S.


    Among agents of selection that shape phenotypic traits in animals, humans can cause more rapid changes than many natural factors. Studies have focused on human selection of morphological traits, but little is known about human selection of behavioural traits. By monitoring elk (Cervus elaphus) with satellite telemetry, we tested whether individuals harvested by hunters adopted less favourable behaviours than elk that survived the hunting season. Among 45 2-year-old males, harvested elk showed bolder behaviour, including higher movement rate and increased use of open areas, compared with surviving elk that showed less conspicuous behaviour. Personality clearly drove this pattern, given that inter-individual differences in movement rate were present before the onset of the hunting season. Elk that were harvested further increased their movement rate when the probability of encountering hunters was high (close to roads, flatter terrain, during the weekend), while elk that survived decreased movements and showed avoidance of open areas. Among 77 females (2–19 y.o.), personality traits were less evident and likely confounded by learning because females decreased their movement rate with increasing age. As with males, hunters typically harvested females with bold behavioural traits. Among less-experienced elk (2–9 y.o.), females that moved faster were harvested, while elk that moved slower and avoided open areas survived. Interestingly, movement rate decreased as age increased in those females that survived, but not in those that were eventually harvested. The latter clearly showed lower plasticity and adaptability to the local environment. All females older than 9 y.o. moved more slowly, avoided open areas and survived. Selection on behavioural traits is an important but often-ignored consequence of human exploitation of wild animals. Human hunting could evoke exploitation-induced evolutionary change, which, in turn, might oppose adaptive responses to natural and

  18. Impacts of surface mining on calving elk

    SciTech Connect

    Johnson, T.K.


    Due to concern over potential impact of surface coal mining on a traditional elk calving ground, Colorado Yampa Coal Company conducted a six and one half year study from 1981 to 1987 to monitor elk calving behavior in connection habitat disturbance resulting from mining. The specific objectives were to: (1) determine if productivity of elk is changed as they are displaced from a traditional calving area; (2) determining what fidelity they exhibit to calving areas; and (3) describe the physical and vegetation characteristics of elk calving areas. During the study, 448 elk captures were recorded, 294 individual elk were tagged, 75 of which received radio transmitters. The radio transmitter collared elk were relocated 4,583 times. Telemetry work on the 75 individual elk revealed no negative impacts on elk using the mine site. Productivity, calving home range size and fidelity, and habitat utilization patterns between elk using the mine site and control elk were not significantly different. There has been no indication that elk are abandoning mine areas. Aspen habitats directly adjacent to active mining continue to be selected for during the late spring and summer. Reclaimed sites are used in proportion to their availability during spring and summer and are selected for during the fall and early winter. In addition, a large amount of information on cow elk mortality, summer and winter ranges, migration patterns and habitat utilization was obtained.

  19. Japanese macaque (Macaca fuscata) mothers huddle with their young offspring instead of adult females for thermoregulation.


    Ueno, Masataka; Nakamichi, Masayuki


    It is unclear whom animals select to huddle with for thermoregulation. In this study, we investigated whom Japanese macaque (Macaca fuscata) mothers huddled with-their young offspring or other adult group members-when there is need for thermoregulation. We used a focal-animal sampling method, targeting 17 females at Katsuyama, Okayama Prefecture, Japan. A majority of huddling among adult females was recorded during winter season (December, January, and February). Females who had young (0- or 1-year-old) offspring huddled less frequently with other adult females compared to females who did not have young offspring in winter. However, including young offspring, the frequency of huddling with any other individuals did not differ by whether females had young offspring. Moreover, the females who did not have young offspring huddled with other adult females more often in cloudy than in sunny weather during winter season. In contrast, females who had young offspring increased huddling with their young offspring in cloudy than in sunny weather, but did not do so with other adult females. This study indicates that Japanese macaque mothers huddle with their young offspring instead of other adult females when there is need for thermoregulation. PMID:27262980

  20. Ecosystem scale declines in elk recruitment and population growth with wolf colonization: a before-after-control-impact approach.


    Christianson, David; Creel, Scott


    The reintroduction of wolves (Canis lupus) to Yellowstone provided the unusual opportunity for a quasi-experimental test of the effects of wolf predation on their primary prey (elk--Cervus elaphus) in a system where top-down, bottom-up, and abiotic forces on prey population dynamics were closely and consistently monitored before and after reintroduction. Here, we examined data from 33 years for 12 elk population segments spread across southwestern Montana and northwestern Wyoming in a large scale before-after-control-impact analysis of the effects of wolves on elk recruitment and population dynamics. Recruitment, as measured by the midwinter juvenile∶female ratio, was a strong determinant of elk dynamics, and declined by 35% in elk herds colonized by wolves as annual population growth shifted from increasing to decreasing. Negative effects of population density and winter severity on recruitment, long recognized as important for elk dynamics, were detected in uncolonized elk herds and in wolf-colonized elk herds prior to wolf colonization, but not after wolf colonization. Growing season precipitation and harvest had no detectable effect on recruitment in either wolf treatment or colonization period, although harvest rates of juveniles∶females declined by 37% in wolf-colonized herds. Even if it is assumed that mortality due to predation is completely additive, liberal estimates of wolf predation rates on juvenile elk could explain no more than 52% of the total decline in juvenile∶female ratios in wolf-colonized herds, after accounting for the effects of other limiting factors. Collectively, these long-term, large-scale patterns align well with prior studies that have reported substantial decrease in elk numbers immediately after wolf recolonization, relatively weak additive effects of direct wolf predation on elk survival, and decreased reproduction and recruitment with exposure to predation risk from wolves. PMID:25028933

  1. Ecosystem Scale Declines in Elk Recruitment and Population Growth with Wolf Colonization: A Before-After-Control-Impact Approach

    PubMed Central

    Christianson, David; Creel, Scott


    The reintroduction of wolves (Canis lupus) to Yellowstone provided the unusual opportunity for a quasi-experimental test of the effects of wolf predation on their primary prey (elk – Cervus elaphus) in a system where top-down, bottom-up, and abiotic forces on prey population dynamics were closely and consistently monitored before and after reintroduction. Here, we examined data from 33 years for 12 elk population segments spread across southwestern Montana and northwestern Wyoming in a large scale before-after-control-impact analysis of the effects of wolves on elk recruitment and population dynamics. Recruitment, as measured by the midwinter juvenile∶female ratio, was a strong determinant of elk dynamics, and declined by 35% in elk herds colonized by wolves as annual population growth shifted from increasing to decreasing. Negative effects of population density and winter severity on recruitment, long recognized as important for elk dynamics, were detected in uncolonized elk herds and in wolf-colonized elk herds prior to wolf colonization, but not after wolf colonization. Growing season precipitation and harvest had no detectable effect on recruitment in either wolf treatment or colonization period, although harvest rates of juveniles∶females declined by 37% in wolf-colonized herds. Even if it is assumed that mortality due to predation is completely additive, liberal estimates of wolf predation rates on juvenile elk could explain no more than 52% of the total decline in juvenile∶female ratios in wolf-colonized herds, after accounting for the effects of other limiting factors. Collectively, these long-term, large-scale patterns align well with prior studies that have reported substantial decrease in elk numbers immediately after wolf recolonization, relatively weak additive effects of direct wolf predation on elk survival, and decreased reproduction and recruitment with exposure to predation risk from wolves. PMID:25028933

  2. Impact Mitigation and Monitoring of the BPA 500 KV Garrison-Taft Transmission Line : Effects on Elk Security and Hunter Opportunity : Annual Progress Report for 1986.

    SciTech Connect

    Thompson, Michael J.; Dickson, David C.


    The objectives were: (1) to determine the effectiveness of the mitigation measures employed in the Garrison-Taft Project to minimize impacts on elk; (2) to determine the nature and magnitude of the Project impacts on elk summer-fall habitat use, distribution, use of security areas, and harvest, with emphasis on the adult male segment of the population; (3) to identify and recommend protection for important elk security areas remaining in areas adjacent to the Project; (4) to assess Project impacts on hunter opportunity and on hunters' perceptions of hunting as related to the transmission line, right-of-way, and road systems; (5) to reduce to the extent possible the net Project impacts on elk and elk hunter opportunity; and (6) to determine appropriate measures for offsetting unmitigated impacts. This involved assessing Project-caused changes along the entire route and comparing these with documented impacts on elk and elk hunting within the study areas.

  3. Transcriptome of the adult female malaria mosquito vector Anopheles albimanus

    PubMed Central


    Background Human Malaria is transmitted by mosquitoes of the genus Anopheles. Transmission is a complex phenomenon involving biological and environmental factors of humans, parasites and mosquitoes. Among more than 500 anopheline species, only a few species from different branches of the mosquito evolutionary tree transmit malaria, suggesting that their vectorial capacity has evolved independently. Anopheles albimanus (subgenus Nyssorhynchus) is an important malaria vector in the Americas. The divergence time between Anopheles gambiae, the main malaria vector in Africa, and the Neotropical vectors has been estimated to be 100 My. To better understand the biological basis of malaria transmission and to develop novel and effective means of vector control, there is a need to explore the mosquito biology beyond the An. gambiae complex. Results We sequenced the transcriptome of the An. albimanus adult female. By combining Sanger, 454 and Illumina sequences from cDNA libraries derived from the midgut, cuticular fat body, dorsal vessel, salivary gland and whole body, we generated a single, high-quality assembly containing 16,669 transcripts, 92% of which mapped to the An. darlingi genome and covered 90% of the core eukaryotic genome. Bidirectional comparisons between the An. gambiae, An. darlingi and An. albimanus predicted proteomes allowed the identification of 3,772 putative orthologs. More than half of the transcripts had a match to proteins in other insect vectors and had an InterPro annotation. We identified several protein families that may be relevant to the study of Plasmodium-mosquito interaction. An open source transcript annotation browser called GDAV (Genome-Delinked Annotation Viewer) was developed to facilitate public access to the data generated by this and future transcriptome projects. Conclusions We have explored the adult female transcriptome of one important New World malaria vector, An. albimanus. We identified protein-coding transcripts involved in

  4. Bone status of adult female butyrylcholinesterase gene-deficient mice.


    Haupt, Malte; Kauschke, Vivien; Sender, Jonas; Kampschulte, Marian; Kovtun, Anna; Dürselen, Lutz; Heiss, Christian; Lips, Katrin Susanne


    Butyrylcholinesterase (BChE) degrades acetylcholine in addition to acetylcholinesterase (AChE) which is involved in embryonic development of limbs. Since BChE is expressed by osteoblast-like cells we asked whether it is functional in adult bone remodeling. We addressed this issue by analyzing BChE gene-deficient mice (BChE-KO). Bones were extracted from 16-week old female BChE-KO and corresponding wild type mice (WT). Femoral bones were used for biomechanical testing and μCT evaluation of cancellous and cortical bone. Also vertebrae Th12 and L1 were investigated with μCT while L3 was used for tartrate-resistant acidic phosphatase (TRAP) histomorphometry and Th10 for gene expression analysis by means of real-time RT-PCR. BChE-KO did not reveal significant differences in biomechanical bone strength and bone mineral density determined by μCT. Microarchitecture of cancellous and cortical bone showed an increase in μCT parameters like trabecular thickness, trabecular separation, and relative cortical bone area of femoral BChE-KO bone compared to WT. In vertebrae no changes of microstructure and mRNA expression were detected. However, osteoclast histomorphometry with TRAP stained sections demonstrated a significant increase in relative osteoclast number. In conclusion, in adult murine bone the role of BChE is limited to bone specific changes in microarchitecture and to an increase in relative number of bone resorbing osteoclasts whereas the main collagen resorbing enzyme Cathepsin-K (CtsK) was stably expressed. Besides, AChE might be able to compensate the lack of BChE. Thus, further analyses using bone tissue specific AChE BChE cre-lox double knockout mice would be helpful. PMID:26138460

  5. The Child's Expectations of Differences in Adult Male and Female Interactions.

    ERIC Educational Resources Information Center

    Fagot, Beverly I.


    Two-year-olds and four-year-olds were placed with male and female adults in a play situation where the children were forced to control the choice of toys and mode of interaction. The four-year-olds elicited different types of play behaviors from male and female adults; the younger children did not. (Author/KH)

  6. Adult female hamsters avoid interspecific mating after exposure to heterospecific males

    PubMed Central

    delBarco-Trillo, Javier; McPhee, M. E.; Johnston, Robert E.


    When females mate with a heterospecific male, they do not usually produce viable offspring. Thus, there is a selective pressure for females to avoid interspecific mating. In many species, females innately avoid heterospecific males; females can also imprint on their parents to avoid later sexual interactions with heterospecific males. However, it was previously unknown whether adult females can learn to discriminate against heterospecific males. We tested the hypothesis that adult females previously unable to avoid interspecific mating learn to avoid such mating after being exposed to heterospecific males. Syrian hamster (Mesocricetus auratus) females not previously exposed to Turkish hamster (Mesocricetus brandti) males can discriminate between odors of conspecific and heterospecific males, but they mate with either type of male. However, when we exposed adult females to both a conspecific male and a heterospecific male through wire-mesh barriers for 8 days, and then paired them sequentially with the two males, females were more receptive to conspecific males and more aggressive to heterospecific males. When females were paired with the heterospecific male first and the conspecific male second, no female was receptive and all were aggressive to heterospecific males. When females were paired with the conspecific male first, only 43% of females were then aggressive toward the heterospecific male. That is, interactions with conspecific males may decrease a female’s ability to properly avoid heterospecific males. Our study clearly shows for the first time that females can learn during adulthood to avoid interspecific mating just by being exposed to stimuli from heterospecific males. PMID:20676390

  7. Rett Syndrome Symptomatology of Institutionalized Adults with Mental Retardation: Comparison of Males and Females.

    ERIC Educational Resources Information Center

    Burd, Larry; And Others


    The study of 297 institutionalized adults with mental retardation found no symptom of Rett syndrome occurred more frequently in males than in females and no single cluster of symptoms appeared to differentiate males from females. Only females were found to meet the necessary criteria for diagnosis of Rett syndrome. (Author/DB)

  8. Balancing Act: A Phenomenological Study of Female Adult Learners Who Successfully Persisted in Graduate Studies

    ERIC Educational Resources Information Center

    Shepherd, Jeff; Nelson, Barbara Mullins


    A study was conducted utilizing Cross' (1981) barriers to adult learning as a framework to better understand how adults successfully complete their graduate studies. Participants in the study were solicited via Facebook and LinkedIn. Three female adult learners who persisted in their graduate studies while balancing demands outside academics…

  9. Stature estimation from craniofacial anthropometry in Bangladeshi Garo adult females.


    Akhter, Z; Banu, L A; Alam, M M; Rahman, M F


    Estimation of stature is an important tool in forensic examination especially in unknown, highly decomposed, fragmentary and mutilated human remains. When the evidences are skeletal remains; forensic anthropology has put forward means to estimate the stature from the skeletal and even from fragmentary bones. Sometimes, craniofacial remains are brought in for forensic and postmortem examination. In such a situation, estimation of stature becomes equally important along with other parameters like age, sex, race, etc. Today, anthropometry plays an important role in industrial design, clothing design, ergonomics and architecture where statistical data about the distribution of body dimensions in the population are used to optimize products. It is well established that a single standard of craniofacial aesthetics is not appropriate for application to diverse racial and ethnic groups. Bangladesh is a country not only for the Bengalis; the country harbours many cultures and people of different races because of the colonial rules of the past regimes. Like other ethnic groups, the Garos (study subjects) have their own set of language, social structure, cultures and economic activities and religious values. In the above context, the present study was attempted to establish ethnic specific anthropometric data for the Bangladeshi Garo adult females. The study also attempted to find out the correlation of the craniofacial dimensions with stature and to determine multiplication factors. The study was an observational, cross-sectional and primarily descriptive in nature with some analytical components. The study was carried out with a total number of one hundred Garo adult females, aged between 25-45 years. Craniofacial dimension such as head circumference, head length, facial height from 'nasion' to 'gnathion', bizygomatic breadth and stature were measured using a measuring tape, spreading caliper, steel plate and steel tape and sliding caliper. The data were then statistically

  10. Oestradiol modulation of cognition in adult female marmosets (Callithrix jacchus)

    PubMed Central

    Lacreuse, Agnès; Chang, Jeemin; Metevier, Christina M.; LaClair, Matthew; Meyer, Jerrold S.; Ferris, Craig M.


    The common marmoset (Callithrix jacchus) provides many advantages over traditional rodent and macaque species as a model for human aging and may be very valuable to study the effects of sex steroids on cognitive and brain aging. We present the first study examining the effects of oestrogens on cognitive function in female marmosets. Adult monkeys (3-5 years of age) were trained to a specific learning criterion on a battery of cognitive tasks preoperatively (object discrimination, delayed response with increasing delays and detour reaching with opaque box) and tested on different versions of these tasks (object reversals, delayed response with randomised delays and detour reaching with clear box) following ovariectomy and simultaneous implantation with 17β-oestradiol (E2, n=6) or blank (n=6) Silastic capsules. Acquisition of a delayed matching-to-position task with a 1s delay was also administered following completion of these tests. E2-treated monkeys were significantly impaired on the second Reversal and showed an increase in perseverative responding from Reversals 1 to 3. Their performance also tended to be worse than that of control monkeys on the Delayed Response task. Performance acquisition on the DMP tended to be better in E2-treated relative to control monkeys, but the group difference did not reach statistical significance. No effect of treatment was detected for Detour Reaching or affiliative behaviours. Overall, the findings indicate that E2 compromises performance on prefrontally-mediated tasks. The suggestion that E2 may improve acquisition on tasks dependent on the hippocampus will require further validation. These results are discussed in the context of dopaminergic and serotonergic signaling. We conclude that the marmoset is a useful new primate model to examine the effects of oestrogens on cognitive function. PMID:24617856

  11. Meat-eating by adult female Sumatran orangutans (Pongo pygmaeus abelii).


    Utami, S S; Van Hooff, J A


    Information about meat-eating behavior by wild orangutans (Pongo pygmaeus) is scant. The first article about such a case dates from 1981. Since 1989, seven incidents of adult female Sumatran orangutans eating slow lorises (Nycticebus coucang) have been witnessed. Three females from two study sites were involved. In three cases the females were seen catching the prey. There are too few cases to conclude whether this behavior is typically female. PMID:9327098

  12. Female children with incarcerated adult family members at risk for lifelong neurological decline.


    Brewer-Smyth, Kathleen; Pohlig, Ryan T; Bucurescu, Gabriel


    A secondary analysis of data from adult female prison inmates in the mid-Atlantic United States defined relationships between having incarcerated adult family members during childhood and neurological outcomes. Of 135 inmates, 99 (60%) had one or more incarcerated adult family members during childhood. Regression analyses revealed that having incarcerated adult family members was related to greater frequency and severity of childhood abuse and higher incidence of neurological deficits in adulthood, especially related to traumatic brain injuries, compared to those without incarcerated adult family members. Along with being role models, adult family members impact the neurological health of children throughout their life-span. PMID:26788781

  13. Comparison of helicopter and ground surveys for North American elk Cervus elaphus and mule deer Odocoileus hemionus population composition

    USGS Publications Warehouse

    Bender, L.C.; Myers, W.L.; Gould, W.R.


    Both ground and helicopter surveys are commonly used to collect sex and age composition data for ungulates. Little attention has been paid, however, to whether data collected by each technique are similar. We compared helicopter and ground composition data for both elk Cervus elaphus and mule deer Odocoileus hemionus across a variety of habitats in the state of Washington, USA. We found that ground and helicopter counts differed (P's < 0.002) consistently in male age structure estimates for elk, and that the two survey methods differed in estimates of adult sex ratios for mule deer (P = 0.023). Counts from helicopters provided larger sample sizes, tended to be more consistent annually in their results, and were corroborated by other demographic studies of the test populations. We conclude that helicopter and ground surveys differ for male age structure and perhaps male:female ratios, but are similar for young:female ratios. Managers should maintain a standardized technique using the same survey vehicle for trend analysis of composition data.

  14. Aspen, elk, and fire in Northern Yellowstone National Park

    SciTech Connect

    Romme, W.H.; Turner, M.G.; Wallace, L.L.


    Most strands of trembling aspen in northern Yellowstone National Park appear to have become established between 1870 and 1890, with little regeneration since 1900. There has been controversy regarding the relative roles of browsing by elk and fire suppression in preventing aspen regeneration. Fires in 1988 burned 22% of the northern ungulate winter range, and created an unusual opportunity investigate interactions between fire, ungulate browsing, and aspen regeneration. We tested two hypotheses. (1) The fires would stimulate such prolific sprouting of new aspen stems in burned stands that many stems would escape ungulate browsing and regenerate a canopy of large aspen stems. (2) Browsing pressure would be so intense that it would inhibit aspen canopy regeneration in the burned stands, despite prolific sprouting, but increased forage production in the burned areas would attract elk so that they would not seek out remote aspen stands, and hence, aspen regeneration would occur in unburned aspen stands remote from the burned areas. There were no significant differences in browsing intensity in 1990 or 1991 among burned, unburned close, or unburned remote stands, nor were there difference in relation to growth form (juvenile vs. adult sprouts). Unbrowsed sprouts generally were lower than the depth of the snowpack, suggesting that elk browsed nearly all sprouts that were accessible. The age distribution of 15 aspen stands across the northern winter range indicated that regeneration of large canopy stems had been episodic even prior to 1872. During the period 1870-1890 populations of elk and other browsers were low, climate was relatively wet, extensive fires had recently occurred, and large mammalian predators of elk were present. This combination has not recurred since 1900. The recent paucity of aspen regeneration in northern Yellowstone National Park cannot be explained by any single factor but involves a complex interaction among factors. 56 refs., 7 figs.

  15. Juvenile play conditions sexual partner preference in adult female rats.


    Paredes-Ramos, Pedro; Miquel, Marta; Manzo, Jorge; Coria-Avila, Genaro A


    Rats can display a conditioned partner preference for individuals that bear an odor previously associated with sexual reward. Herein we tested the possibility that odors associated with the reward induced by social play in prepubescent rats would induce a conditioned partner preference in adulthood. Two groups of 31-day-old, single-housed female rats were formed, and were given daily 30-min periods of social play with scented females. In one group, almond scent was paired with juvenile play during conditioning trials, whereas lemon scent functioned as a novel odor in the final test. The counterbalanced group received the opposite association. At age 42, females were tested for play partner preference with two males, one almond-scented and one lemon-scented. In both groups females displayed a play partner preference only for males scented with the paired odor. They were ovariectomized, hormone-primed, and at age 55 were tested for sexual partner preference with two scented stud males. Females displayed a sexual preference towards males scented with the paired odor as observed with more visits, solicitations, hops and darts, intromissions and ejaculations. These results indicate that olfactory stimuli paired with juvenile play affects later partner choice for play as well as for sex in female rats. PMID:21777597

  16. Elk monitoring in Lewis and Clark National Historical Park: 2008-2012 synthesis report

    USGS Publications Warehouse

    Griffin, Paul C.; Jenkins, Kurt J.; Cole, Carla; Clatterbuck, Chris; Boetsch, John; Beirne, Katherine


    along four routes that totaled 32 km. We examined bimonthly trends in the numbers of elk groups seen, the total number of elk seen, and the observed composition ratios for those six months of the year. The average number of elk groups seen per survey ranged from 0.75 (+/- 0.32 SE) during February to a peak of 1.95 (+/- 0.36 SE) during June. Despite this seasonal variation in numbers of elk groups seen, the average total number of elk seen per morning was less variable. The average ratios of antlered elk to antlerless adult elk (i.e., bulls:cows) and calves to antlerless adult elk (i.e. calves:cows) varied seasonally, with the highest of both average ratios observed in August. We detected no significant trends in the average number of elk groups and total numbers of elk seen per survey from 2008-2012. Similarly, ratios of calves and antlered elk per antlerless elk did not differ over time. Elk groups were frequently seen from January to August in the southeast region of the Fort Clatsop unit, in the vicinity of Colewort Creek. Outside of NPS lands, we observed elk most frequently in open areas near the Astoria regional airport, in the pastures and forests immediately north of the Fort Clatsop unit and, prior to the construction of a residential development, in a pasture northwest of the Fort Clatsop unit. Elk monitoring at Lewis and Clark NHP is still in its initial years and additional monitoring will be required to verify trends that appear to be emerging. For example, the initial monitoring suggested incipient declining trends in both pellet group density and proportion of plots with pellets present, as well as, potentially, a small shift in elk distribution away from a new trail that was recently constructed in the southeast portion of the Fort Clatsop unit. Continued monitoring will aid in determining whether this local change in distribution persists (or, alternatively, resulted from short-term random variation), and whether there will be any positive or negative

  17. Resurrection and redescription of Varestrongylus alces (Nematoda; Protostrongylidae), a lungworm of Eurasian elk (Alces alces), with a report on associated pathology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Varestrongylus alces Demidova & Naumitscheva, 1953 is resurrected for protostrongylid nematodes of Eurasian elk in Europe. Descriptions of males (11.36-16.95 mm) and females (16.25- 21.52 mm) are based on specimens collected from the terminal bronchioles in the lungs of Eurasian elk, Alces alces (L...

  18. A Comparison of the Abuse Experiences of Male and Female Adults Molested as Children.

    ERIC Educational Resources Information Center

    Kendall-Tackett, Kathleen A.; Simon, Arthur F.

    To determine whether the molestation experiences of boys and girls differ, this study analyzed data from 365 adults (40 male and 325 female) molested as children, and compared findings for males and females on the identity of the perpetrator, age at onset and end of molestation, duration of molestation, type of sexual acts, and whether the…

  19. Depressive Symptoms in Older Female Carers of Adults with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Chou, Y. C.; Pu, C-Y.; Fu, L-Y.; Kroger, T.


    Background: This survey study aims to examine the prevalence and factors associated with depressive symptoms among primary older female family carers of adults with intellectual disabilities (ID). Method: In total, 350 female family carers aged 55 and older took part and completed the interview in their homes. The survey package contained…

  20. Intrapersonal and Interpersonal Functioning among Middle-Aged Female Adult Children of Alcoholics.

    ERIC Educational Resources Information Center

    Domenico, Donna; Windle, Michael


    Examined differences among middle-aged, middle-class female adult children of alcoholics (ACOAs) and female non-ACOAs with regard to interpersonal and intrapersonal functioning. ACOAs report higher levels of depression, marital conflict, and parental role distress; lower levels of self-esteem, perceived social support, family cohesion, marital…

  1. Elk Monitoring Report for Calendar Year 2012

    SciTech Connect

    Lindsey, Cole T.; Nugent, John J.; Wilde, Justin W.; Tiller, B


    Four complete surveys were conducted during 2012. The surveys were conducted on April 5, June 19, October 25, and December 18. During the first survey, conducted on April 5, the aerial survey crew detected 26 elk while the ground survey crew detected zero. For the June 19 survey, the aerial survey detected four elk not detected by the ground crew, while the ground crew detected 13 elk not detected by the aerial crew. A total of 17 elk were detected on June 19, 2012. On October 25, surveyors detected two herds of elk. Both the aerial and ground crews detected one herd of six, while only the ground crew detected the other herd of four. No elk were observed during the final survey, conducted on December 18.

  2. [Morphophysiological and Behavioral Adaptations of Elk to Wintering].


    Glushkov, V M; Kuznetsov, G V


    This paper studies morphometric parameters (body weight, weight of internal organs, body size, etc.) in 170 elk of various sex and age obtained in the Vyatka taiga area in winter. A number of physiological parameters (specific metabolism and thermal conductivity, heat loss rate, etc.) characterizing the metabolic rate and energy balance in the body were calculated for model animals (calf, male, and female). It is noted that in the transition from the first to the second half of winter the specific metabolism in model animals decreased from 20.6, 16.9, and 15.9 to 18.7, 15.4, and 14.5 kcal/(kg day), respectively. It is shown that changes in the rhythm of motor activity of elk are synchronized with the daily air temperature and the maximum flight distance depends on the amount of energy received by the body with food. PMID:26415285

  3. Synthesis and characterization of biologically active recombinant elk and horse FSH.


    Fachal, María Victoria; Furlan, Mike; Clark, Rena; Card, Claire E; Chedrese, P Jorge


    The objective of this investigation was to clone and express the elk and horse common alpha-subunit and FSH beta-subunit cDNAs, and to produce recombinant FSH from both species in vitro. The RNAs extracted from elk and horse pituitary glands were reverse-transcribed and amplified by polymerase chain reaction. The cDNAs corresponding to both subunits of elk and horse were cloned into the expression vector pBudCE4.1 and transfected into CRL-9096 cells. Expression of both genes was determined in the transfected cells by Northern and Western blot analysis. Recombinant elk and horse FSH secreted in culture media were characterized by an in vitro bioassay and RIA. When the recombinant products were assessed as activity over mass of FSH measured by RIA, the horse product was 5.6 times more potent than the elk product. The recombinant products injected to immature female Wistar rats stimulated ovarian growth. The results suggest that the products obtained correspond to recombinant versions of the native elk and horse FSH. The availability of these recombinant products may aid in the development of more predictable and efficient techniques of ovarian stimulation in cervids, equids, and other species as well. PMID:19500922

  4. Differences in dentofacial characteristics of Class I malocclusion between Saudi and Japanese adult females

    PubMed Central

    Abbassy, Mona A; Abushal, Amal


    Objectives: The objective was to compare dentofacial characteristics of Class I malocclusion in Saudi and Japanese adult females. Materials and Methods: Lateral cephalograms of 50 Saudi adult female and 50 Japanese adult female (18–35-year-old) were obtained. All patients were skeletal Class I, angle Class I malocclusion, arch length discrepancy (−10–10 mm), overjet (1–5 mm), overbite (1–5 mm), absence of congenital anomalies, or significant facial asymmetries or congenitally missing tooth other than the 3rd molar and absence of temporomandibular joint problems. Patient cephalograms were traced and digitized. 16 angular measurements and 13 linear measurements of facial form were used. Results: A comparison of the vertical dimension showed that the Saudi females had a significantly larger gonial angle, a significantly larger facial angle and longer lower face height compared to the Japanese females. Dentally, Saudi females had more protruded incisors with increased distances of the posterior teeth to the palatal plane. For the soft tissue dimension, the Saudi subjects had a significantly more prominent nose, retruded lip and a more protruded chin compared with Japanese. Conclusions: There were significant differences in dentofacial morphology between Saudi and Japanese adult females. Both Asian countries have distinct cephalometric features, which should be considered as a reference in treating patients of varying ethnic backgrounds to optimize the final results. PMID:26229950

  5. Animal migration amid shifting patterns of phenology and predation: lessons from a Yellowstone elk herd.


    Middleton, Arthur D; Kauffman, Matthew J; McWhirter, Douglas E; Cook, John G; Cook, Rachel C; Nelson, Abigail A; Jimenez, Michael D; Klaver, Robert W


    Migration is a striking behavioral strategy by which many animals enhance resource acquisition while reducing predation risk. Historically, the demographic benefits of such movements made migration common, but in many taxa the phenomenon is considered globally threatened. Here we describe a long-term decline in the productivity of elk (Cervus elaphus) that migrate through intact wilderness areas to protected summer ranges inside Yellowstone National Park, USA. We attribute this decline to a long-term reduction in the demographic benefits that ungulates typically gain from migration. Among migratory elk, we observed a 21-year, 70% reduction in recruitment and a 4-year, 19% depression in their pregnancy rate largely caused by infrequent reproduction of females that were young or lactating. In contrast, among resident elk, we have recently observed increasing recruitment and a high rate of pregnancy. Landscape-level changes in habitat quality and predation appear to be responsible for the declining productivity of Yellowstone migrants. From 1989 to 2009, migratory elk experienced an increasing rate and shorter duration of green-up coincident with warmer spring-summer temperatures and reduced spring precipitation, also consistent with observations of an unusually severe drought in the region. Migrants are also now exposed to four times as many grizzly bears (Ursus arctos) and wolves (Canis lupus) as resident elk. Both of these restored predators consume migratory elk calves at high rates in the Yellowstone wilderness but are maintained at low densities via lethal management and human disturbance in the year-round habitats of resident elk. Our findings suggest that large-carnivore recovery and drought, operating simultaneously along an elevation gradient, have disproportionately influenced the demography of migratory elk. Many migratory animals travel large geographic distances between their seasonal ranges. Changes in land use and climate that disparately influence

  6. Animal migration amid shifting patterns of phenology and predation: Lessons from a Yellowstone elk herd

    USGS Publications Warehouse

    Middleton, Arthur D.; Kauffman, Matthew J.; McWhirter, Douglas E.; Cook, John G.; Cook, Rachel C.; Nelson, Abigail A.; Jimenez, Michael D.; Klaver, Robert W.


    Migration is a striking behavioral strategy by which many animals enhance resource acquisition while reducing predation risk. Historically, the demographic benefits of such movements made migration common, but in many taxa the phenomenon is considered globally threatened. Here we describe a long-term decline in the productivity of elk (Cervus elaphus) that migrate through intact wilderness areas to protected summer ranges inside Yellowstone National Park, USA. We attribute this decline to a long-term reduction in the demographic benefits that ungulates typically gain from migration. Among migratory elk, we observed a 21-year, 70% reduction in recruitment and a 4-year, 19% depression in their pregnancy rate largely caused by infrequent reproduction of females that were young or lactating. In contrast, among resident elk, we have recently observed increasing recruitment and a high rate of pregnancy. Landscape-level changes in habitat quality and predation appear to be responsible for the declining productivity of Yellowstone migrants. From 1989 to 2009, migratory elk experienced an increasing rate and shorter duration of green-up coincident with warmer spring–summer temperatures and reduced spring precipitation, also consistent with observations of an unusually severe drought in the region. Migrants are also now exposed to four times as many grizzly bears (Ursus arctos) and wolves (Canis lupus) as resident elk. Both of these restored predators consume migratory elk calves at high rates in the Yellowstone wilderness but are maintained at low densities via lethal management and human disturbance in the year-round habitats of resident elk. Our findings suggest that large-carnivore recovery and drought, operating simultaneously along an elevation gradient, have disproportionately influenced the demography of migratory elk. Many migratory animals travel large geographic distances between their seasonal ranges. Changes in land use and climate that disparately influence

  7. Predicting Adolescent and Adult Antisocial Behavior among Adjudicated Delinquent Females

    ERIC Educational Resources Information Center

    Cernkovich, Stephen A.; Lanctot, Nadine; Giordano, Peggy C.


    Studies identifying the mechanisms underlying the causes and consequences of antisocial behavior among female delinquents as they transit to adulthood are scarce and have important limitations: Most are based on official statistics, they typically are restricted to normative samples, and rarely do they gather prospective data from samples of…

  8. Perceived Family Influence on Undergraduate Adult Female Students

    ERIC Educational Resources Information Center

    Plageman, Paula M.; Sabina, Chiara


    Adult women's decisions to attend college and persist toward degree attainment are likely influenced by family members from both family of origin and current family. This study was designed to examine (a) rated support of family members within the family of origin and current family to attend and persist in college, (b) specific attitudes of both…

  9. Effects of testosterone on sexual behavior and morphology in adult female leopard geckos, Eublepharis macularius.


    Rhen, T; Ross, J; Crews, D


    The leopard gecko, Eublepharis macularius, is a species in which testosterone (T) is the primary circulating sex hormone in adults of both sexes. There are, however, sex differences in T physiology. Whereas males have prolonged periods with high T levels, T levels cycle in accord with follicular development in females. Specifically, T concentration increases during vitellogenesis, drops after ovulation, and then remains at previtellogenic levels until eggs are laid and the next follicular cycle begins. To determine the function of T in females, we manipulated both the level and the duration of T elevation using Silastic implants in intact, adult female leopard geckos. Females had low ( approximately 1 ng/ml), medium ( approximately 100 ng/ml), or high ( approximately 200 ng/ml) T levels for either a short (8 days) or a long (35 days) duration. Behavior tests with males were conducted on days 1-5 in the short-duration group or on days 29-33 in the long-duration group. For both short- and long-duration groups, T treatment decreased attractivity in females with medium and high T levels compared to females with low T levels. In contrast, females with a medium T level were more receptive than females with a low T level in the short-duration group. Females in the long-duration group were unreceptive regardless of T level. Females treated for a long duration also displayed more aggression toward and evoked more aggression from males than short duration females. Short-duration T treatment had no masculinizing effect on female morphology, whereas medium and high T levels for a long duration induced development of hemipenes. Overall, these results suggest that T can both increase and decrease sexual behaviors in the female leopard gecko. PMID:10506536

  10. Tuberculosis: will it infect wild elk?

    USGS Publications Warehouse

    Roffe, T.J.; Smith, B.


    Tuberculosis! Just the name conjures up images of a devastating, chronic, debilitating disease. And so it is in both humans and animals. Tuberculosis (TB) is not known to be present to any significant degree in the free-ranging elk herds of North America. But increasing reports of TB in deer species-including elk-on game ranches prompt grave concern.

  11. Nutritional condition of Northern Yellowstone Elk

    USGS Publications Warehouse

    Cook, R.C.; Cook, J.G.; Mech, L.D.


    Ultrasonography and body condition scoring was used to estimate nutritional condition of northern Yellowstone elk in late winter. Probability of pregnancy was related to body fat, and lactating cows had 50% less fat than non-lactating cows. For mild to normal winters, most of the elk were in good condition.

  12. Female Reproductive Health After Childhood, Adolescent, and Young Adult Cancers: Guidelines for the Assessment and Management of Female Reproductive Complications

    PubMed Central

    Metzger, Monika L.; Meacham, Lillian R.; Patterson, Briana; Casillas, Jacqueline S.; Constine, Louis S.; Hijiya, Nobuko; Kenney, Lisa B.; Leonard, Marcia; Lockart, Barbara A.; Likes, Wendy; Green, Daniel M.


    Purpose As more young female patients with cancer survive their primary disease, concerns about reproductive health related to primary therapy gain relevance. Cancer therapy can often affect reproductive organs, leading to impaired pubertal development, hormonal regulation, fertility, and sexual function, affecting quality of life. Methods The Children's Oncology Group Long-Term Follow-Up Guidelines for Survivors of Childhood, Adolescent, and Young Adult Cancer (COG-LTFU Guidelines) are evidence-based recommendations for screening and management of late effects of therapeutic exposures. The guidelines are updated every 2 years by a multidisciplinary panel based on current literature review and expert consensus. Results This review summarizes the current task force recommendations for the assessment and management of female reproductive complications after treatment for childhood, adolescent, and young adult cancers. Experimental pretreatment as well as post-treatment fertility preservation strategies, including barriers and ethical considerations, which are not included in the COG-LTFU Guidelines, are also discussed. Conclusion Ongoing research will continue to inform COG-LTFU Guideline recommendations for follow-up care of female survivors of childhood cancer to improve their health and quality of life. PMID:23382474

  13. Evidence of female sex pheromones and characterization of the cuticular lipids of unfed, adult male versus female blacklegged ticks, Ixodes scapularis.


    Carr, Ann L; Sonenshine, Daniel E; Strider, John B; Roe, R Michael


    Copulation in Ixodes scapularis involves physical contact between the male and female (on or off the host), male mounting of the female, insertion/maintenance of the male chelicerae in the female genital pore (initiates spermatophore production), and the transfer of the spermatophore by the male into the female genital pore. Bioassays determined that male mounting behavior/chelicerae insertion required direct contact with the female likely requiring non-volatile chemical cues with no evidence of a female volatile sex pheromone to attract males. Unfed virgin adult females and replete mated adult females elicited the highest rates of male chelicerae insertion with part fed virgin adult females exhibiting a much lower response. Whole body surface hexane extracts of unfed virgin adult females and males, separately analyzed by GC-MS, identified a number of novel tick surface associated compounds: fatty alcohols (1-hexadecanol and 1-heptanol), a fatty amide (erucylamid), aromatic hydrocarbons, a short chain alkene (1-heptene), and a carboxylic acid ester (5β-androstane). These compounds are discussed in terms of their potential role in female-male communication. The two most abundant fatty acid esters found were butyl palmitate and butyl stearate present in ratios that were sex specific. Only 6 n-saturated hydrocarbons were identified in I. scapularis ranging from 10 to 18 carbons. PMID:26864785

  14. Effects of open-entry spike-bull, limited-entry branched-bull harvesting on elk composition in Washington

    USGS Publications Warehouse

    Bender, L.C.; Fowler, P.E.; Bernatowicz, J.A.; Musser, J.L.; Stream, L.E.


    The Washington Department of Fish and Wildlife implemented an open-entry spike-bull, limited-entry branched-bull elk (Cervus elaphus) harvest strategy in the Blue Mountains (1989), Yakima (1994), and Colockum (1994) herd areas of Washington state with goals of increasing numbers of adult bulls to increase breeding efficiency and possibly calf recruitment. Numbers of total bulls/100 cows (x??=5.4) and branched bulls/100 cows (x??=5.3) increased with the change in harvest strategy, while yearling bulls/100 cows remained unchanged; calves/100 cows declined (x??=-8.6). Calves/100 cows were always negatively correlated with both total bulls/100 cows and branched bulls/100 cows in each area; correlations were significant in 5 of 9 comparisons with total-bull ratios and 5 of 9 comparisons with branched-bull ratios. Open-entry spike-bull, limited-entry branched-bull harvesting can be used to increase total-bull and branched-bulls ratios in hunted elk populations. However, the increased ratios of bulls and branched bulls were unimportant in influencing calf recruitment, likely because of the importance of female condition on production and survival of young.

  15. Asthma in an Adult Female Vervet Monkey (Chlorocebus sabaeus).


    Köster, Liza S; Simon, Bradley; Rawlins, Gilda; Beierschmitt, Amy


    A 9-y-old, colony-bred, female vervet monkey (Chlorocebus sabaeus) presented with a 6-y history of open-mouth breathing, tachypnea, and sibilant wheezing. These symptoms did not significantly affect her activity or quality of life. Thoracic radiographs and results of bronchoalveolar lavage supported the diagnosis of asthma. Treatment comprising intramuscular prednisolone (tapered over 2 mo from twice daily to every other day), inhaled salmeterol-fluticasone (25 μg-250 μg per actuation twice daily) by mask, and a metered dose inhaler was successful in restoring a normal respiratory pattern. Despite the availability of several primate models of human asthma, this case represents the first report of spontaneous asthma in a NHP. PMID:26884413

  16. Asthma in an Adult Female Vervet Monkey (Chlorocebus sabaeus)

    PubMed Central

    Köster, Liza S; Simon, Bradley; Rawlins, Gilda; Beierschmitt, Amy


    A 9-y-old, colony-bred, female vervet monkey (Chlorocebus sabaeus) presented with a 6-y history of open-mouth breathing, tachypnea, and sibilant wheezing. These symptoms did not significantly affect her activity or quality of life. Thoracic radiographs and results of bronchoalveolar lavage supported the diagnosis of asthma. Treatment comprising intramuscular prednisolone (tapered over 2 mo from twice daily to every other day), inhaled salmeterol–fluticasone (25 µg–250 µg per actuation twice daily) by mask, and a metered dose inhaler was successful in restoring a normal respiratory pattern. Despite the availability of several primate models of human asthma, this case represents the first report of spontaneous asthma in a NHP. PMID:26884413

  17. Comparative Efficacy and Tolerability of Dapsone 5% Gel in Adult Versus Adolescent Females with Acne Vulgaris

    PubMed Central

    Kircik, Leon; Gallagher, Conor J.


    Objective: To determine whether the response to dapsone 5% gel was similar in adolescent girls and adult women with facial acne vulgaris. Design and setting: Subgroup analysis of female subjects with acne vulgaris receiving active treatment enrolled in two randomized, double-blind Phase 3 clinical trials. Treatment: Twice-daily applications of dapsone 5% gel over 12 weeks. Participants: Adolescent (12-17 years of age) and adult (≥18 years of age) females. Measurements: At baseline and at Weeks 2,4,6,8, and 12, subjects were evaluated using the global acne assessment score and by counts of inflammatory, noninflammatory, and total acne vulgaris lesions. Adverse events were monitored. Results: A total of 347 adolescent and 434 adult women were included in the subgroup analysis. At Week 12, dapsone 5% gel significantly reduced mean global acne assessment score in both subgroups (p<0.001); however, the proportion of subjects with clinical success (no or minimal acne based on global acne assessment score) at Week 12 was greater in adult women (53.5%) versus adolescent females (45.3%, p=0.022). Significantly greater percentage reductions in both noninflammatory (p<0.0001) and total lesion counts (p=0.0008) were observed in the adult group as compared to the adolescent group. Percentage reductions from baseline in inflammatory lesions were similar in both groups. No major safety issues and no previously unrecognized safety signals were noted. Conclusion: This subgroup analysis of female patients indicates that dapsone 5% gel twice daily is effective in reducing inflammatory and noninflammatory acne vulgaris lesions in both adolescent and adult women, and is safe in these subgroups. Overall, these data suggest that efficacy of dapsone 5% gel twice daily for facial acne vulgaris may be greater in the adult female population. PMID:25610522

  18. Postnatal masculinization alters the HPA axis phenotype in the adult female rat

    PubMed Central

    Seale, JV; Wood, SA; Atkinson, HC; Harbuz, MS; Lightman, SL


    The ability of postnatal testosterone propionate (TP) to masculinize both behaviour and gonadal cyclicity in the female rat is well documented. We have investigated whether postnatal androgen also has an organizational effect on another sexually dimorphic neuroendocrine system – the hypothalamo-pituitary-adrenal (HPA) axis. Female rats were exposed to a single injection of testosterone propionate (TP) or oil within 24 h of birth. As adults, rats were either ovariectomized and given 17β-oestradiol replacement (OVXE2) or sham ovariectomized with cholesterol implants (SHOVX). An automated sampling system collected blood from unanaesthetized adult female rats every 10 min over a 24-h period, during a mild psychological stress (noise) and following an immunological lipopolysaccharide stress (LPS). Neonatal TP-treated SHOVX rats had a significant reduction in the number, height, frequency and amplitude of corticosterone pulses over the basal 24-h period, compared to both the neonatal oil-treated and TP-treated OVXE2 animals. The corticosterone response to both noise and LPS was also significantly decreased for the TP-treated SHOVX females. Three hours post-LPS administration, TP females had significantly lower values of paraventricular nucleus (PVN) corticotrophin releasing hormone (CRH), arginine vasopressin (AVP) and anterior pituitary proopiomelanocortin (POMC) mRNAs and greater PVN glucocorticoid receptor (GR) mRNA expression compared to the oil-treated controls. E2 replacement in adult TP rats normalized all the mRNA levels, except for PVN GR mRNA which did fall towards the levels of the oil-control animals. A single injection of TP within 24 h of birth disrupts the development of the characteristic female pattern of corticosterone secretion and the normal female HPA response to stress, resulting in a pattern similar to that seen in males. These effects can be reversed by E2 treatment in the adult TP female rat. PMID:15611026

  19. Serotonin signaling in the brain of adult female mice is required for sexual preference

    PubMed Central

    Zhang, Shasha; Liu, Yan; Rao, Yi


    A role for serotonin in male sexual preference was recently uncovered by our finding that male mutant mice lacking serotonin have lost sexual preference. Here we show that female mouse mutants lacking either central serotonergic neurons or serotonin prefer female over male genital odors when given a choice, and displayed increased female–female mounting when presented either with a choice of a male and a female target or only with a female target. Pharmacological manipulations and genetic rescue experiments showed that serotonin is required in adults. Behavioral changes caused by deficient serotonergic signaling were not due to changes in plasma concentrations of sex hormones. We demonstrate that a genetic manipulation reverses sexual preference without involving sex hormones. Our results indicate that serotonin controls sexual preference. PMID:23716677

  20. Implications of chronic wasting disease, cougar predation, and reduced recruitment for elk management

    USGS Publications Warehouse

    Sargeant, G.A.; Weber, D.C.; Roddy, D.E.


    Emerging diseases and expanding carnivore populations may have profound implications for ungulate harvest management and population regulation. To better understand effects of chronic wasting disease (CWD) and cougar (Puma concolor) predation, we studied mortality and recruitment of elk (Cervus elaphus) at Wind Cave National Park (WICA) during 2005-2009. We marked 202 elk (83 subadult M and 119 subadult and ad F) with Global Positioning System (GPS) collars, observed 28 deaths during 74,220 days of monitoring, and investigated 42 additional deaths of unmarked elk found dead. Survival rates were similar for males and females and averaged 0.863 (SE = 0.025) annually. Leading causes of mortality included hunting (0.065, SE = 0.019), CWD (0.034, SE = 0.012), and cougar predation (0.029, SE = 0.012). Marked elk killed by hunters and cougars typically were in good physical condition and not infected with CWD. Effects of mortality on population growth were exacerbated by low rates of pregnancy (subadults = 9.5%, SE = 6.6%; ad = 76.9%, SE = 4.2%) and perinatal survival (0.49, SE = 0.085 from 1 Feb to 1 Sep). Chronic wasting disease, increased predation, and reduced recruitment reduced the rate of increase for elk at WICA to approximately ?? = 1.00 (SE = 0.027) during the past decade. Lower rates of increase are mitigating effects of elk on park vegetation, other wildlife, and neighboring lands and will facilitate population control, but may reduce opportunities for elk hunting outside the park. ?? 2011 The Wildlife Society.

  1. Early prenatal androgenization results in diminished ovarian reserve in adult female rhesus monkeys

    PubMed Central

    Dumesic, D.A.; Patankar, M.S.; Barnett, D.K.; Lesnick, T.G.; Hutcherson, B.A.; Abbott, D.H.


    BACKGROUND Early prenatal androgenization (PA) accelerates follicle differentiation and impairs embryogenesis in adult female rhesus monkeys (Macaca mulatta) undergoing FSH therapy for IVF. To determine whether androgen excess in utero affects follicle development over time, this study examines whether PA exposure, beginning at gestational days 40–44 (early treated) or 100–115 (late treated), alters the decline in serum anti-Mullerian hormone (AMH) levels with age in adult female rhesus monkeys and perturbs their ovarian response to recombinant human FSH (rhFSH) therapy for IVF. METHODS Thirteen normal (control), 11 early-treated and 6 late-treated PA adult female monkeys had serum AMH levels measured at random times of the menstrual cycle or anovulatory period. Using some of the same animals, basal serum AMH, gonadotrophins and steroids were also measured in six normal, five early-treated and three late-treated PA female monkeys undergoing FSH therapy for IVF during late-reproductive life (>17 years); serum AMH also was measured on day of HCG administration and at oocyte retrieval. RESULTS Serum AMH levels in early-treated PA females declined with age to levels that were significantly lower than those of normal (P ≤ 0.05) and late-treated PA females (P ≤ 0.025) by late-reproductive life. Serum AMH levels positively predicted numbers of total/mature oocytes retrieved, with early-treated PA females having the lowest serum AMH levels, fewest oocytes retrieved and lowest percentage of females with fertilized oocytes that cleaved. CONCLUSIONS Based on these animals, early PA appears to program an exaggerated decline in ovarian reserve with age, suggesting that epigenetically induced hormonal factors during fetal development may influence the cohort size of ovarian follicles after birth. PMID:19740899

  2. Correlates of Serious Suicidal Ideation and Attempts in Female Adult Sexual Assault Survivors

    ERIC Educational Resources Information Center

    Ullman, Sarah E.; Najdowski, Cynthia J.


    Relations between (a) serious suicidal ideation and attempts and (b) demographics, trauma history, assault characteristics, post-assault outcomes, and psychosocial variables were examined among female adult sexual assault survivors. Younger, minority, and bisexual survivors reported greater ideation. More traumas, drug use, and assault disclosure…

  3. Prevalence and Correlates of Suicidal Behavior among Adult Female Victims of Intimate Partner Violence

    ERIC Educational Resources Information Center

    Cavanaugh, Courtenay E.; Messing, Jill Theresa; Del-Colle, Melissa; O'Sullivan, Chris; Campbell, Jacquelyn C.


    The prevalence and correlates of suicidal threats and attempts among 662 racially and ethnically diverse adult female victims of intimate partner violence (IPV) were studied. One in five women had threatened or attempted suicide during her lifetime. They observed that multiple logistic regression results indicated that women at greater risk of…

  4. Positive Adult Support and Depression Symptoms in Adolescent Females: The Partially Mediating Role of Eating Disturbances

    ERIC Educational Resources Information Center

    Linville, Deanna; O'Neil, Maya; Huebner, Angela


    This study examined linkages between depression symptoms (DEP) and positive adult support (PAS) in female adolescents and the partially mediating influence of eating disturbances (ED). Structural equation modeling was used to establish measurement models for each of the latent constructs, determine the relationships among the latent constructs,…

  5. New Insights into the Comorbidity between ADHD and Major Depression in Adolescent and Young Adult Females

    ERIC Educational Resources Information Center

    Biederman, Joseph; Ball, Sarah W.; Monuteaux, Michael C.; Mick, Eric; Spencer, Thomas J.; McCreary, Michelle; Cote, Michelle; Faraone, Stephen V.


    The association between attention-deficit/hyperactivity disorder (ADHD) and major depression (MD) in adolescent and young adult females is evaluated. Findings indicate that MD emerging in the context of ADHD is an impairing and severe comorbidity that needs to be considered further clinically and scientifically.

  6. When Your "Problem" Becomes Mine: Adult Female Siblings' Perspectives of Having a Brother with a Disability

    ERIC Educational Resources Information Center

    Pompeo, Michelle N.


    This study is a retrospective look at adult female siblings' perspectives of their childhoods and present identities based on having a brother with a disability. This paper focuses on siblings' experiences within educational and public domains, and how such experiences have shaped their personalities and career choices. Qualitative findings were…

  7. Understanding and Counseling Self-Mutilation in Female Adolescents and Young Adults.

    ERIC Educational Resources Information Center

    Zila, Laurie MacAniff; Kiselica, Mark S.


    Examines the syndrome of self-mutilation in female adolescents and young adults. Discusses causes, symptoms, types, definitions, and treatments. Includes an explanation of the lexical and conceptual confusion that accompanies self-mutilation. Addresses implications and recommendations for counselors. (Contains 31 references.) (Author/GCP)

  8. Nutritional manipulation of adult female Orius pumilio (Hemiptera: Anthocoridae) enhances initial predatory performance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Commercial shipments of Orius insidiosus Say (Hemiptera:Anthocoridae) commonly include water and protein, the latter typically supplied by eggs from a moth such as Ephestia kuehniella Zeller. To determine whether alternative dietary conditions for young adult females might improve predation, O. in...

  9. Factor Structure Invariance of the Kaufman Adolescent and Adult Intelligence Test across Male and Female Samples

    ERIC Educational Resources Information Center

    Immekus, Jason C.; Maller, Susan J.


    Multisample confirmatory factor analysis (MCFA) and latent mean structures analysis (LMS) were used to test measurement invariance and latent mean differences on the Kaufman Adolescent and Adult Intelligence Scale[TM] (KAIT) across males and females in the standardization sample. MCFA found that the parameters of the KAIT two-factor model were…

  10. The Experiences and Needs of Female Adults with High-Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Baldwin, Susanna; Costley, Debra


    There is limited large-scale research into the lived experiences of female adults who have an autism spectrum disorder with no co-occurring intellectual disability. Drawing on the findings of an Australia-wide survey, this report presents self-report data from n = 82 women with high-functioning autism spectrum disorder in the areas of health,…

  11. Isolation of Bartonella capreoli from elk

    USGS Publications Warehouse

    Bai, Y.; Cross, P.C.; Malania, L.; Kosoy, M.


    The aim of the present study was to investigate the presence of Bartonella infections in elk populations. We report the isolation of four Bartonella strains from 55 elk blood samples. Sequencing analysis demonstrated that all four strains belong to Bartonella capreoli, a bacterium that was originally described in the wild roe deer of Europe. Our finding first time demonstrated that B. capreoli has a wide geographic range, and that elk may be another host for this bacterium. Further investigations are needed to determine the impact of this bacterium on wildlife.

  12. The ecology of elk in an arid environment: An overview of the Hanford elk project

    SciTech Connect

    McCorquodale, S.M . Wildlife Resource Management); Eberhardt, L.E. )


    We studied elk (Cerves elaphus) in Washington's shrub-steppe region from 1982 to the present. The population originated from a small number of colonizers that took up residence on the Hanford Site in winter 1972--73. Rapid population growth was facilitated by high reproductive and survival rates. Elk showed strong preferences for bedding in sagebrush (Artemisia tridentata) stands, the only vegetative cover available. Foraging elk typically selected previously burned habitats that no longer supported sagebrush. Elk limited their major diurnal activity, favoring dusk-to-dawn foraging with relatively high nocturnal activity levels. Elk diets were dominated by grasses from winter through early summer and by forbs during the summer drought period. High reproductive success and survival and superior antler growth relative to elk occupying more mesic environments suggested that these elk were effectively utilizing the shrub-steppe environment. Mild, short winters in the shrub-steppe were hypothesized to contribute to reduced winter energy deficits common in temperate herbivores, partly facilitating the observed high fitness. We also hypothesize that in the absence of a significant overstory, the proportion of the range of these elk that would be considered foraging habitat exceeded that typical of elk occupying coniferous forests. Thus, the quantity of foraging areas may have compensated for reduced productivity typical of this region. 29 refs., 3 figs., 2 tabs.

  13. The Role of Hox Genes in Female Reproductive Tract Development, Adult Function, and Fertility.


    Du, Hongling; Taylor, Hugh S


    HOX genes convey positional identity that leads to the proper partitioning and adult identity of the female reproductive track. Abnormalities in reproductive tract development can be caused by HOX gene mutations or altered HOX gene expression. Diethylstilbestrol (DES) and other endocrine disruptors cause Müllerian defects by changing HOX gene expression. HOX genes are also essential regulators of adult endometrial development. Regulated HOXA10 and HOXA11 expression is necessary for endometrial receptivity; decreased HOXA10 or HOXA11 expression leads to decreased implantation rates. Alternation of HOXA10 and HOXA11 expression has been identified as a mechanism of the decreased implantation associated with endometriosis, polycystic ovarian syndrome, leiomyoma, polyps, adenomyosis, and hydrosalpinx. Alteration of HOX gene expression causes both uterine developmental abnormalities and impaired adult endometrial development that prevent implantation and lead to female infertility. PMID:26552702

  14. Sexual interactions with unfamiliar females reduce hippocampal neurogenesis among adult male rats.


    Spritzer, M D; Curtis, M G; DeLoach, J P; Maher, J; Shulman, L M


    Recent experiments have shown that sexual interactions prior to cell proliferation cause an increase in neurogenesis in adult male rats. Because adult neurogenesis is critical for some forms of memory, we hypothesized that sexually induced changes in neurogenesis may be involved in mate recognition. Sexually naive adult male rats were either exposed repeatedly to the same sexual partner (familiar group) or to a series of novel sexual partners (unfamiliar group), while control males never engaged in sexual interactions. Ovariectomized female rats were induced into estrus every four days. Males were given two injections of 5-bromo-2'-deoxyuridine (BrdU) (200mg/kg) to label proliferating cells, and the first sexual interactions occurred three days later. Males in the familiar and unfamiliar groups engaged in four, 30-min sexual interactions at four-day intervals, and brain tissue was collected the day after the last sexual interaction. Immunohistochemistry followed by microscopy was used to quantify BrdU-labeled cells. Sexual interactions with unfamiliar females caused a significant reduction in neurogenesis in the dentate gyrus compared to males that interacted with familiar females and compared to the control group. The familiar group showed no difference in neurogenesis compared to the control group. Males in the familiar group engaged in significantly more sexual behavior (ejaculations and intromissions) than did males in the unfamiliar group, suggesting that level of sexual activity may influence neurogenesis levels. In a second experiment, we tested whether this effect was unique to sexual interactions by replicating the entire procedure using anestrus females. We found that interactions with unfamiliar anestrus females reduced neurogenesis relative to the other groups, but this effect was not statistically significant. In combination, these results indicate that interactions with unfamiliar females reduce adult neurogenesis and the effect is stronger for sexual

  15. Radionuclide concentrations in elk that winter on Los Alamos National Laboratory lands

    SciTech Connect

    Fresquez, P.R.; Armstrong, D.A.; Salazar, J.G.


    Elk spend the winter in areas at Los Alamos National Laboratory (LANL) that may contain radioactivity above natural and/or worldwide fallout levels. This study was initiated to determine the levels of {sup 90}Sr, {sup 137}Cs, {sup 238}Pu, {sup 239}Pu, and total uranium in various tissues (brain, hair, heart, jawbone, kidneys, leg bone, liver, and muscle) of adult cow elk that use LANL lands during the fall/winter months. No significant differences in radionuclide contents were detected in any of the tissue samples collected from elk on LANL lands as compared with elk collected from off-site locations. The total effective (radiation) dose equivalent a person would receive from consuming 3.2 lb of heart, 5.6 lb of liver, and 226 lb of muscle from elk that winter on LANL lands, after natural background has been subtracted, was 0.00008, 0.0001, and 0.008 mrem/yr, respectively. The highest dose was less than 0.01% of the International Commission of Radiological Protection permissible dose limit for protecting the public.

  16. Radionuclide concentrations in elk that winter on Los Alamos National Laboratory lands. Revision

    SciTech Connect

    Fresquez, P.R.; Armstrong, D.A.; Salazar, J.G.


    Elk spend the winter in areas at Los Alamos National Laboratory (LANL) that may contain radioactivity above natural and/or worldwide fallout levels. This study was initiated to determine the levels of {sup 90}Sr, {sup 137}Cs, {sup 238}Pu, {sup 239}Pu, and total uranium in various tissues (brain, hair, heart, jawbone, kidneys, leg bone, liver, and muscle) of adult cow elk that use LANL lands during the fall/winter months. No significant differences in radionuclide contents were detected in any of the tissue samples collected from elk on LANL lands as compared with elk collected from off-site locations. The total effective (radiation) dose equivalent a person would receive from consuming 3.2 lb of heart, 5.6 lb of liver, and 226 lb of muscle from elk that winter on LANL lands, after natural background has been subtracted, was 0.00008, 0.0001, and 0.008 mrem/yr, respectively. The highest dose was less than 0.01% of the International Commission on Radiological Protection permissible dose limit for protecting the public.

  17. Elk River Watershed - Flood Study

    NASA Astrophysics Data System (ADS)

    Barnes, C. C.; Byrne, J. M.; MacDonald, R. J.; Lewis, D.


    Flooding has the potential to cause significant impacts to economic activities as well as to disrupt or displace populations. Changing climate regimes such as extreme precipitation events increase flood vulnerability and put additional stresses on infrastructure. Potential flooding from just under 100 (2009 NPRI Reviewed Facility Data Release, Environment Canada) toxic tailings ponds located in Canada increase risk to human safety and the environment. One such geotechnical failure spilt billions of litres of toxic tailings into the Fraser River watershed, British Columbia, when a tailings pond dam breach occurred in August 2014. Damaged and washed out roadways cut access to essential services as seen by the extensive floods that occurred in Saskatchewan and Manitoba in July 2014, and in Southern Alberta in 2013. Recovery efforts from events such as these can be lengthy, and have substantial social and economic impacts both in loss of revenue and cost of repair. The objective of this study is to investigate existing conditions in the Elk River watershed and model potential future hydrological changes that can increase flood risk hazards. By analyzing existing hydrology, meteorology, land cover, land use, economic, and settlement patterns a baseline is established for existing conditions in the Elk River watershed. Coupling the Generate Earth Systems Science (GENESYS) high-resolution spatial hydrometeorological model with flood hazard analysis methodology, high-resolution flood vulnerability base line maps are created using historical climate conditions. Further work in 2015 will examine possible impacts for a range of climate change and land use change scenarios to define changes to future flood risk and vulnerability.

  18. Prenatal methamphetamine differentially alters myocardial sensitivity to ischemic injury in male and female adult hearts.


    Rorabaugh, Boyd R; Seeley, Sarah L; Bui, Albert D; Sprague, Lisanne; D'Souza, Manoranjan S


    Methamphetamine is one of the most common illicit drugs abused during pregnancy. The neurological effects of prenatal methamphetamine are well known. However, few studies have investigated the potential effects of prenatal methamphetamine on adult cardiovascular function. Previous work demonstrated that prenatal cocaine exposure increases sensitivity of the adult heart to ischemic injury. Methamphetamine and cocaine have different mechanisms of action, but both drugs exert their effects by increasing dopaminergic and adrenergic receptor stimulation. Thus the goal of this study was to determine whether prenatal methamphetamine also worsens ischemic injury in the adult heart. Pregnant rats were injected with methamphetamine (5 mg·kg(-1)·day(-1)) or saline throughout pregnancy. When pups reached 8 wk of age, their hearts were subjected to ischemia and reperfusion by means of a Langendorff isolated heart system. Prenatal methamphetamine had no significant effect on infarct size, preischemic contractile function, or postischemic recovery of contractile function in male hearts. However, methamphetamine-treated female hearts exhibited significantly larger infarcts and significantly elevated end-diastolic pressure during recovery from ischemia. Methamphetamine significantly reduced protein kinase Cε expression and Akt phosphorylation in female hearts but had no effect on these cardioprotective proteins in male hearts. These data indicate that prenatal methamphetamine differentially affects male and female sensitivity to myocardial ischemic injury and alters cardioprotective signaling proteins in the adult heart. PMID:26683901

  19. Prevalence of adult ADHD in an all-female prison unit.


    Farooq, Romana; Emerson, Lisa-Marie; Keoghan, Sue; Adamou, Marios


    There is increasing evidence suggesting a link between ADHD and criminality, including a strong association between ADHD symptoms and the likelihood of being on probation or in prison. Most studies investigating the prevalence of ADHD in prison populations have focused on adult male offenders. In the current study, 69 female prisoners were screened for both childhood and adult ADHD symptoms using the Barkley Adult ADHD Rating Scale-IV. The results indicate that 41 % of the prisoners met the diagnostic criteria for ADHD in childhood and continued to meet criteria for ADHD as adults. More importantly, young female prisoners (aged 18-25) were significantly more likely to report symptoms of ADHD than older prisoners. Prisoners who reported symptoms of ADHD also reported high levels of impairment associated with these symptoms. A better understanding of the prevalence of ADHD in female prison units can highlight specific areas for intervention during rehabilitation, as well as the management of serious incidents within prison. PMID:26650925

  20. Social bonds in the dispersing sex: partner preferences among adult female chimpanzees

    PubMed Central

    Foerster, Steffen; McLellan, Karen; Schroepfer-Walker, Kara; Murray, Carson M.; Krupenye, Christopher; Gilby, Ian C.; Pusey, Anne E.


    In most primate societies, strong and enduring social bonds form preferentially among kin, who benefit from cooperation through direct and indirect fitness gains. Chimpanzees, Pan troglodytes, differ from most species by showing consistent female-biased dispersal and strict male philopatry. In most East African populations, females tend to forage alone in small core areas and were long thought to have weak social bonds of little biological significance. Recent work in some populations is challenging this view. However, challenges remain in quantifying the influence of shared space use on association patterns, and in identifying the drivers of partner preferences and social bonds. Here, we use the largest data set on wild chimpanzee behaviour currently available to assess potential determinants of female association patterns. We quantify pairwise similarities in ranging, dyadic association and grooming for 624 unique dyads over 38 years, including 17 adult female kin dyads. To search for social preferences that could not be explained by spatial overlap alone, we controlled for expected association based on pairwise kernel volume intersections of core areas. We found that association frequencies among females with above-average overlap correlated positively with grooming rates, suggesting that associations reflected social preferences in these dyads. Furthermore, when available, females preferred kin over nonkin partners for association and grooming, and variability was high among nonkin dyads. While variability in association above and below expected values was high, on average, nonkin associated more frequently if they had immature male offspring, while having female offspring had the opposite effect. Dominance rank, an important determinant of reproductive success at Gombe, influenced associations primarily for low-ranking females, who associated preferentially with each other. Our findings support the hypothesis that female chimpanzees form well

  1. Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain.

    PubMed Central

    Goldman, S A; Nottebohm, F


    The vocal control nucleus designated HVc (hyperstriatum ventrale, pars caudalis) of adult female canaries expands in response to systemic testosterone administration, which also induces the females to sing in a male-like manner. We became interested in the possibility of neurogenesis as a potential basis for this phenomenon. Intact adult female canaries were injected with [3H]thymidine over a 2-day period. Some birds were given testosterone implants at various times before thymidine. The birds were sacrificed 5 wk after hormone implantation, and their brains were processed for autoradiography. In parallel control experiments, some birds were given implants of cholesterol instead of testosterone. All birds showed considerable numbers of labeled neurons, glia, endothelia, and ventricular zone cells in and around HVc. Ultrastructural analysis confirmed the identity of these labeled neurons. Cholesterol- and testosterone-treated birds had similar neuronal labeling indices, which ranged from 1.8% to 4.0% in HVc. Thus, neurogenesis occurred in these adults independently of exogenous hormone treatment. Conversely, both glial and endothelial proliferation rates were markedly stimulated by exogenous testosterone treatment. We determined the origin of the thymidine-incorporating neurons by sacrificing two thymidine-treated females soon after their thymidine injections, precluding any significant migration of newly labeled cells. Analysis of these brains revealed no cells of neuronal morphology present in HVc but a very heavily labeled ventricular zone overlying HVc. We conclude that neuronal precursors exist in the HVc ventricular zone that incorporate tritiated thymidine during the S phase preceding their mitosis; after division these cells migrate into, and to some extent beyond, HVc. This ventricular zone neurogenesis seems to be a normally occurring phenomenon in intact adult female canaries. Images PMID:6572982

  2. Liquid fructose in pregnancy exacerbates fructose-induced dyslipidemia in adult female offspring.


    Rodríguez, Lourdes; Panadero, María I; Rodrigo, Silvia; Roglans, Núria; Otero, Paola; Álvarez-Millán, Juan J; Laguna, Juan C; Bocos, Carlos


    Fructose intake from added sugars correlates with the epidemic rise in metabolic syndrome and related events. Nevertheless, consumption of beverages sweetened with fructose is not regulated in gestation. Previously, we found that maternal fructose intake produces in the progeny, when fetuses, impaired leptin signaling and hepatic steatosis and then impaired insulin signaling and hypoadiponectinemia in adult male rats. Interestingly, adult females from fructose-fed mothers did not exhibit any of these disturbances. However, we think that, actually, these animals keep a programmed phenotype hidden. Fed 240-day-old female progeny from control, fructose- and glucose-fed mothers were subjected for 3weeks to a fructose supplementation period (10% wt/vol in drinking water). Fructose intake provoked elevations in insulinemia and adiponectinemia in the female progeny independently of their maternal diet. In accordance, the hepatic mRNA levels of several insulin-responsive genes were similarly affected in the progeny after fructose intake. Interestingly, adult progeny of fructose-fed mothers displayed, in response to the fructose feeding, augmented plasma triglyceride and NEFA levels and hepatic steatosis versus the other two groups. In agreement, the expression and activity for carbohydrate response element binding protein (ChREBP), a lipogenic transcription factor, were higher after the fructose period in female descendants from fructose-fed mothers than in the other groups. Furthermore, liver fructokinase expression that has been indicated as one of those responsible for the deleterious effects of fructose ingestion was preferentially augmented in that group. Maternal fructose intake does influence the adult female offspring's response to liquid fructose and so exacerbates fructose-induced dyslipidemia and hepatic steatosis. PMID:27142744

  3. Educating adult females for leadership roles in an informal science program for girls

    NASA Astrophysics Data System (ADS)

    McCreedy, Dale

    The purpose of this study is to gain an understanding of and an evidentiary warrant for, how a community of practice focused on informal science learning, can engage and promote active participation that offers adult female members and the community opportunities for legitimacy and transformation. This study is a qualitative, ethnographic research study that documents how adult female volunteers, historically inexperienced and/or excluded from traditional practices of science, come to engage in science activities through an informal, community-based context that helps them to appreciate science connections in their lives that are ultimately empowering and agentic. I begin to understand the ways in which such informal contexts, often thought to be marginal to dominant educational beliefs and practices, can offer adults outside of the field of science, education, or both, an entree into science learning and teaching that facilitate female's participation in legitimate and empowering ways. Using descriptive analyses, I first identify the characteristics of peripheral and active program participants. Through phenomenological analyses, I then develop an understanding of participation in an informal science program by focusing on three adult female members' unique trajectories of participation leading to core member status. Each draws on different aspects of the program that they find most salient, illustrating how different elements can serve as motivators for participation, and support continuation along the trajectory of participation reflecting personal and political agency. Through a purposeful ethnographic case-study analysis, I then explore one core member's transformation, evidenced by her developing identities as someone who enjoys science, engages in science activities, and, enacts a role as community old timer and door opener to science learning. This study: (1) contributes to the limited knowledge base in fields of informal learning, science education, and

  4. Differentiation in boron distribution in adult male and female rats' normal brain: a BNCT approach.


    Goodarzi, Samereh; Pazirandeh, Ali; Jameie, Seyed Behnamedin; Khojasteh, Nasrin Baghban


    Boron distribution in adult male and female rats' normal brain after boron carrier injection (0.005 g Boric Acid+0.005 g Borax+10 ml distilled water, pH: 7.4) was studied in this research. Coronal sections of control and trial animal tissue samples were irradiated with thermal neutrons. Using alpha autoradiography, significant differences in boron concentration were seen in forebrain, midbrain and hindbrain sections of male and female animal groups with the highest value, four hours after boron compound injection. PMID:22484141

  5. Hybrid Computational Phantoms Representing the Reference Adult Male and Adult Female: Construction and Applications for Retrospective Dosimetry

    PubMed Central

    Hurtado, Jorge L.; Lee, Choonsik; Lodwick, Daniel; Goede, Timothy; Williams, Jonathan L.; Bolch, Wesley E.


    Currently, two classes of the computational phantoms have been developed for dosimetry calculation: (1) stylized (or mathematical) and (2) voxel (or tomographic) phantoms describing human anatomy through mathematical surface equations and 3D voxel matrices, respectively. Mathematical surface equations in stylized phantoms are flexible but the resulting anatomy is not as realistic. Voxel phantoms display far better anatomical realism, but they are limited in terms of their ability to alter organ shape, position, and depth, as well as body posture. A new class of computational phantoms - called hybrid phantoms - takes advantage of the best features of stylized and voxel phantoms - flexibility and anatomical realism, respectively. In the current study, hybrid computational phantoms representing the adult male and female reference anatomy and anthropometry are presented. These phantoms serve as the starting framework for creating patient or worker sculpted whole-body phantoms for retrospective dose reconstruction. Contours of major organs and tissues were converted or segmented from computed tomography images of a 36-year Korean volunteer and a 25-year U.S. female patient, respectively, with supplemental high-resolution CT images for the cranium. Polygon mesh models for the major organs and tissues were reconstructed and imported into Rhinoceros™ for non-uniform rational B-spline (NURBS) surface modeling. The resulting NURBS/polygon mesh models representing body contour and internal anatomy were matched to anthropometric data and reference organ mass data provided by Centers for Disease Control and Prevention (CDC) and International Commission on Radiation Protection (ICRP), respectively. Finally, two hybrid adult male and female phantoms were completed where a total of 8 anthropometric data categories were matched to standard values within 4% and organ volumes matched to ICRP data within 1% with the exception of total skin. The hybrid phantoms were voxelized from

  6. Hybrid computational phantoms representing the reference adult male and adult female: construction and applications for retrospective dosimetry.


    Hurtado, Jorge L; Lee, Choonsik; Lodwick, Daniel; Goede, Timothy; Williams, Jonathan L; Bolch, Wesley E


    Currently, two classes of computational phantoms have been developed for dosimetry calculation: (1) stylized (or mathematical) and (2) voxel (or tomographic) phantoms describing human anatomy through mathematical surface equations and 3D voxel matrices, respectively. Mathematical surface equations in stylized phantoms are flexible, but the resulting anatomy is not as realistic. Voxel phantoms display far better anatomical realism, but they are limited in terms of their ability to alter organ shape, position, and depth, as well as body posture. A new class of computational phantoms called hybrid phantoms takes advantage of the best features of stylized and voxel phantoms-flexibility and anatomical realism, respectively. In the current study, hybrid computational phantoms representing the adult male and female reference anatomy and anthropometry are presented. These phantoms serve as the starting framework for creating patient or worker sculpted whole-body phantoms for retrospective dose reconstruction. Contours of major organs and tissues were converted or segmented from computed tomography images of a 36-y-old Korean volunteer and a 25-y-old U.S. female patient, respectively, with supplemental high-resolution CT images of the cranium. Polygon mesh models for the major organs and tissues were reconstructed and imported into Rhinoceros™ for non-uniform rational B-spline (NURBS) surface modeling. The resulting NURBS/polygon mesh models representing body contour and internal anatomy were matched to anthropometric data and reference organ mass data provided by Centers for Disease Control and Prevention and International Commission on Radiation Protection, respectively. Finally, two hybrid adult male and female phantoms were completed where a total of eight anthropometric data categories were matched to standard values within 4% and organ volumes matched to ICRP data within 1% with the exception of total skin. The hybrid phantoms were voxelized from the NURBS phantoms

  7. Locations of the ets subfamily members net, elk1, and sap1 (ELK3, ELK1, and ELK4) on three homologous regions of the mouse and human genomes.


    Giovane, A; Sobieszczuk, P; Mignon, C; Mattei, M G; Wasylyk, B


    Net, Elk1, and Sap1 are related members of the Ets oncoprotein family. We show by in situ hybridization on banded chromosomes with specific cDNA probes that their map positions on mouse and human chromosomes (respectively) are net, 10C-D1 and 12q22-q23 (now called ELK3), sap1, 1E3-G and 1q32 (ELK4), and elk1, XA1-A3 and Xp11.2-p11.1 (ELK1), as well as a second locus 14q32 (ELK2) unique to the human genome. The results for the mouse net, sap1, and elk1 and human ELK3 genes are new. The human elk1 mapping confirms a previous study. The human ELK4 localization agrees with data published during the preparation of the manuscript. Human ELK3 colocalizes with sap2, and we confirm that they are identical. These results firmly establish for the first time that Net, Elk1, and Sap1 are distinct gene products with different chromosomal localizations in both the mouse and the human genomes. Net, Elk1, and Sap1 are conserved and map to homologous regions of the mouse and human chromosomes. PMID:8575773

  8. Locations of the ets subfamily members net, elk1, and sap1 (ELK3, ELK1, and ELK4) on three homologous regions of the mouse and human genomes

    SciTech Connect

    Giovane, A.; Sobieszczuk, P.; Mignon, C.; Mattei, M.G.; Wasylyk, B.


    Net, Elk1, and Sap1 are related members of the Ets oncoprotein family. We show by in situ hybridization on banded chromosomes with specific cDNA probes that their map positions on mouse and human chromosomes (respectively) are net, 10C-D1 and 12q22-q23 (now called ELK3), sap1, 1E3-G and 1q32 (ELK4), and elk1, XA1-A3 and Xp11.2-p11.1 (ELK1), as well as a second locus 14q32 (ELK2) unique to the human genome. The results for the mouse net, sap1, and elk1 and human ELK3 genes are new. The human elk1 mapping confirms a previous study. The human ELK4 localization agrees with data published during the preparation of the manuscript. Human ELK3 colocalizes with sap2, and we confirm that they are identical. These results firmly establish for the first time that Net, Elk1, and Sap1 are distinct gene products with different chromosomal localizations in both the mouse and the human genomes. Net, Elk1, and Sap1 are conserved and map to homologous regions of the mouse and human chromosomes. 19 refs., 1 fig., 1 tab.

  9. [Psychodynamik focal therapy of bulimia nervosa for female adolescents and young adults].


    Reich, Günter; Horn, Hildegard; Winkelmann, Klaus; Kronmüller, Klaus-Thomas; Stefini, Anette


    A manual for a disorder oriented psychodynamic treatment of bulimia nevosa and atypical bulimia nervosa of female adolescents and young adults is presented. This manual is applied in a therapy project, which started in 2007. The work on conflicts and structural dysfunctions is meant to lead to the removal or alleviation of the symptoms and an improvement of eating behavior and body image. The bulimic symptoms are contextualized and focussed according to the conflicts and ego-structural deficits of the patients. Typical patterns of interpersonal relationships, transference, conflict, defence and structural problems as well as therapeutic steps are described. The typical psychosocial situation of female adolescence and young adult age is taken into account. Special emphasis is laid on the limitedness of the therapy to 60 sessions and the active structuring of the final phase of he therapy by the therapist. PMID:24693801

  10. Pesticide Methoxychlor Promotes the Epigenetic Transgenerational Inheritance of Adult-Onset Disease through the Female Germline

    PubMed Central

    Manikkam, Mohan; Haque, M. Muksitul; Guerrero-Bosagna, Carlos; Nilsson, Eric E.; Skinner, Michael K.


    Environmental compounds including fungicides, plastics, pesticides, dioxin and hydrocarbons can promote the epigenetic transgenerational inheritance of adult-onset disease in future generation progeny following ancestral exposure during the critical period of fetal gonadal sex determination. This study examined the actions of the pesticide methoxychlor to promote the epigenetic transgenerational inheritance of adult-onset disease and associated differential DNA methylation regions (i.e. epimutations) in sperm. Gestating F0 generation female rats were transiently exposed to methoxychlor during fetal gonadal development (gestation days 8 to 14) and then adult-onset disease was evaluated in adult F1 and F3 (great-grand offspring) generation progeny for control (vehicle exposed) and methoxychlor lineage offspring. There were increases in the incidence of kidney disease, ovary disease, and obesity in the methoxychlor lineage animals. In females and males the incidence of disease increased in both the F1 and the F3 generations and the incidence of multiple disease increased in the F3 generation. There was increased disease incidence in F4 generation reverse outcross (female) offspring indicating disease transmission was primarily transmitted through the female germline. Analysis of the F3 generation sperm epigenome of the methoxychlor lineage males identified differentially DNA methylated regions (DMR) termed epimutations in a genome-wide gene promoters analysis. These epimutations were found to be methoxychlor exposure specific in comparison with other exposure specific sperm epimutation signatures. Observations indicate that the pesticide methoxychlor has the potential to promote the epigenetic transgenerational inheritance of disease and the sperm epimutations appear to provide exposure specific epigenetic biomarkers for transgenerational disease and ancestral environmental exposures. PMID:25057798

  11. A Case of Strangulated Urethral Prolapse in a Premenopausal Adult Female

    PubMed Central

    Jessop, Morris L.; Al-Omar, Osama


    Urethral prolapse in a premenopausal adult female is exceedingly rare. This paper describes a case of strangulated urethral prolapse presenting as a urethral mass in an unusual demographic and reviews the literature on etiology and management. Only a few cases have occurred in women of reproductive age. The etiology is likely multifactorial. Treatment with surgical excision provides good results in the majority of cases. PMID:27413572

  12. Patterns of coping preferences for male and female caregivers of frail older adults.


    DeVries, H M; Hamilton, D W; Lovett, S; Gallagher-Thompson, D


    The similarities and differences in male and female caregivers' preferred strategies for coping and the perceived helpfulness of these strategies in managing caregiving stressors were examined in this study. Respondents were 170 caregivers (139 women and 31 men) who were primary caregivers for an elderly adult relative who was either cognitively impaired or physically frail. Results provide preliminary evidence that gender is related to frequency of use but not to the perceived helpfulness of specific coping strategies. PMID:9189986

  13. Patterns of Dating Violence Perpetration and Victimization in U.S. Young Adult Males and Females.


    Spencer, Rachael A; Renner, Lynette M; Clark, Cari Jo


    Dating violence (DV) is frequently reported by young adults in intimate relationships in the United States, but little is known about patterns of DV perpetration and victimization. In this study, we examined sexual and physical violence perpetration and victimization reported by young adults to determine how the violence patterns differ by sex and race/ethnicity. Data from non-Hispanic White, non-Hispanic Black, and Hispanic participants in Wave 3 of the National Longitudinal Study of Adolescent to Adult Health were analyzed. DV was assessed using responses to four questions focused on perpetration and four questions focused on victimization. The information on DV was taken from the most violent relationship reported by participants prior to Wave 3. Latent class analysis was first conducted separately by sex, adjusting for age, race/ethnicity, and financial stress, then by race/ethnicity, adjusting for age and financial stress. Relative model fit was established by comparing Bayesian Information Criteria (BIC), adjusted BIC, entropy, interpretability of latent classes, and certainty of latent class assignment for covariate-adjusted models. The results indicate that patterns of violence differed by sex and for females, by race/ethnicity. A three-class model was the best fit for males. For females, separate four-class models were parsimonious for White, Black, and Hispanic females. Financial stress was a significant predictor of violence classification for males and females and age predicted membership in White and Black female models. Variations in DV patterns by sex and race/ethnicity suggest the need for a more nuanced understanding of differences in DV. PMID:25846756

  14. Female mice lack adult germ-line stem cells but sustain oogenesis using stable primordial follicles.


    Lei, Lei; Spradling, Allan C


    Whether or not mammalian females generate new oocytes during adulthood from germ-line stem cells to sustain the ovarian follicle pool has recently generated controversy. We used a sensitive lineage-labeling system to determine whether stem cells are needed in female adult mice to compensate for follicular losses and to directly identify active germ-line stem cells. Primordial follicles generated during fetal life are highly stable, with a half-life during adulthood of 10 mo, and thus are sufficient to sustain adult oogenesis without a source of renewal. Moreover, in normal mice or following germ-cell depletion with Busulfan, only stable, single oocytes are lineage-labeled, rather than cell clusters indicative of new oocyte formation. Even one germ-line stem cell division per 2 wk would have been detected by our method, based on the kinetics of fetal follicle formation. Thus, adult female mice neither require nor contain active germ-line stem cells or produce new oocytes in vivo. PMID:23630252

  15. Comparison of vertebral and femoral bone mineral density in adult females

    PubMed Central

    Choe, Han Seong; Lee, Jae Hong; Min, Dong Ki; Shin, So Hong


    [Purpose] This study assessed vertebral and femoral bone mineral density in adult females. [Subjects and Methods] A total of 314 females in their 40s to 70s were divided into normal, osteopenia, and osteoporosis groups and their vertebral and femoral bone mineral densities were compared. [Results] Comparisons of T scores revealed significant differences among measurements of the third lumbar vertebra, femoral neck, Ward’s triangle, and femoral trochanter. Pearson correlation coefficients were used to assess differences between the vertebral and femoral measurements, and significant differences and positive correlations were observed among third lumbar vertebra, femoral neck, Ward’s triangle, and femur trochanter in the normal group. [Conclusion] Females in the normal, osteopenia, and osteoporosis groups showed significant differences in their third lumbar vertebrae. The lack of significant differences among measurements in the osteoporosis group in this study suggests that patients with osteoporosis require careful and accurate diagnosis. PMID:27390449

  16. Comparison of vertebral and femoral bone mineral density in adult females.


    Choe, Han Seong; Lee, Jae Hong; Min, Dong Ki; Shin, So Hong


    [Purpose] This study assessed vertebral and femoral bone mineral density in adult females. [Subjects and Methods] A total of 314 females in their 40s to 70s were divided into normal, osteopenia, and osteoporosis groups and their vertebral and femoral bone mineral densities were compared. [Results] Comparisons of T scores revealed significant differences among measurements of the third lumbar vertebra, femoral neck, Ward's triangle, and femoral trochanter. Pearson correlation coefficients were used to assess differences between the vertebral and femoral measurements, and significant differences and positive correlations were observed among third lumbar vertebra, femoral neck, Ward's triangle, and femur trochanter in the normal group. [Conclusion] Females in the normal, osteopenia, and osteoporosis groups showed significant differences in their third lumbar vertebrae. The lack of significant differences among measurements in the osteoporosis group in this study suggests that patients with osteoporosis require careful and accurate diagnosis. PMID:27390449

  17. Are males and females sexually abused as children socially anxious adults?


    Rojas, Ariz; Kinder, Bill N


    It is well documented that childhood sexual abuse is associated with deleterious outcomes in the areas of anxiety, depression, and sexual functioning. However, very little research has been conducted to specifically investigate childhood sexual abuse's relationship to adult social anxiety in both males and females. Participants included 250 undergraduate students from a large metropolitan university. Results indicated that almost one-third of males and a little over a third of females reported being sexually abused as a child or adolescent. Although a large portion of the sample exhibited socially anxious symptomology, childhood sexual abuse did not place males and females at increased risk for social anxiety. The use of a nonclinical, college student sample may provide researchers the opportunity to investigate resiliency in individuals with a history of childhood sexual abuse. PMID:19842534

  18. Population viability analysis to identify management priorities for reintroduced elk in the Cumberland Mountains, Tennessee

    USGS Publications Warehouse

    Kindall, J.L.; Muller, L.I.; Clark, J.D.; Lupardus, J.L.; Murrow, J.L.


    We used an individual-based population model to perform a viability analysis to simulate population growth (λ) of 167 elk (Cervus elaphus manitobensis; 71 male and 96 female) released in the Cumberland Mountains, Tennessee, to estimate sustainability (i.e., λ > 1.0) and identify the most appropriate options for managing elk restoration. We transported elk from Elk Island National Park, Alberta, Canada, and from Land Between the Lakes, Kentucky, and reintroduced them beginning in December 2000 and ending in February 2003. We estimated annual survival rates for 156 radio-collared elk from December 2000 until November 2004. We used data from a nearby elk herd in Great Smoky Mountains National Park to simulate pessimistic and optimistic recruitment and performed population viability analyses to evaluate sustainability over a 25-year period. Annual survival averaged 0.799 (Total SE = 0.023). The primary identifiable sources of mortality were poaching, disease from meningeal worm (Parelaphostrongylus tenuis), and accidents (environmental causes and unintentional harvest). Population growth given pessimistic recruitment rates averaged 0.895 over 25 years (0.955 in year 1 to 0.880 in year 25); population growth was not sustainable in 100% of the runs. With the most optimistic estimates of recruitment, mean λ increased to 0.967 (1.038 in year 1 to 0.956 in year 25) with 99.6% of the runs failing to be sustainable. We suggest that further translocation efforts to increase herd size will be ineffective unless survival rates are increased in the Cumberland Mountains.

  19. Prepubertal exposure to bisphenol-A induces ERα upregulation and hyperplasia in adult gerbil female prostate

    PubMed Central

    Campos, Mônica S; Galvão, André L V; Rodríguez, Daniel A O; Biancardi, Manoel F; Marques, Mara R; Vilamaior, Patrícia S L; Santos, Fernanda C A; Taboga, Sebastião R


    Prostate physiology is highly dependent on oestrogenic and androgenic homeostasis. Interferences in this equilibrium, especially in early periods of life, may disrupt the prostate and increase the susceptibility to the development of diseases with ageing. Taking this into account, and considering the increase of environmental chemicals with endocrine-disrupting potential such as bisphenol-A (BPA), this study aimed to evaluate the prostates of adult female gerbils exposed to BPA and BPA plus testosterone from pubertal to adult periods. Morphological, stereological and chemical analyses revealed that long-term BPA exposure, even in environmental dosages, increases the proliferative status of the prostate, increases the number of ERα-positive stromal cells and elicits the development of prostatic hyperplasia in adult female gerbils. Moreover, we also observed that the association with testosterone did not increase the proliferative status of the gland, which shows that low levels of BPA are enough to cause an oestrogenic disruption of the prostate in young adults. This evidence suggests that this oestrogenic endocrine disruptor may increase the susceptibility to prostatic disorders with ageing. PMID:26098999

  20. Differential Effects of Sex Pheromone Compounds on Adult Female Sea Lamprey (Petromyzon marinus) Locomotor Patterns.


    Walaszczyk, Erin J; Goheen, Benjamin B; Steibel, Juan Pedro; Li, Weiming


    Synchronization of male and female locomotor activity plays a critical role in ensuring reproductive success, especially in semelparous species. The goal of this study was to elucidate the effects of individual chemical signals, or pheromones, on the locomotor activity in the sea lamprey (Petromyzon marinus). In their native habitat, adult preovulated females (POF) and ovulated females (OF) are exposed to sex pheromone compounds that are released from spermiated males and attract females to nests during their migration and spawning periods. In this study, locomotor activity of individual POF and OF was measured hourly in controlled laboratory conditions using an automated video-tracking system. Differences in the activity between a baseline day (no treatment exposure) and a treatment day (sex pheromone compound or control exposure) were examined for daytime and nighttime periods. Results showed that different pheromone compound treatments affected both POF and OF sea lamprey (p < 0.05) but in different ways. Spermiated male washings (SMW) and one of its main components, 7α,12α,24-trihydroxy-5α-cholan-3-one 24 sulfate (3kPZS), decreased activity of POF during the nighttime. SMW also reduced activity in POF during the daytime. In contrast, SMW increased activity of OF during the daytime, and an additional compound found in SMW, petromyzonol sulfate (PZS), decreased the activity during the nighttime. In addition, we examined factors that allowed us to infer the overall locomotor patterns. SMW increased the maximum hourly activity during the daytime, decreased the maximum hourly activity during the nighttime, and reduced the percentage of nocturnal activity in OF. Our findings suggest that adult females have evolved to respond to different male compounds in regards to their locomotor activity before and after final maturation. This is a rare example of how species-wide chemosensory stimuli can affect not only the amounts of activity but also the overall locomotor

  1. Effect of sericea lespedeza leaf meal pellets on adult female Haemonchus contortus in goats.


    Kommuru, D S; Whitley, N C; Miller, J E; Mosjidis, J A; Burke, J M; Gujja, S; Mechineni, A; Terrill, T H


    Sericea lespedeza (SL; Lespedeza cuneata) is a perennial warm-season forage rich in condensed tannins (CT) that has been reported to have anthelmintic activity against small ruminant gastrointestinal nematodes (GIN), particularly Haemonchus contortus, a highly pathogenic blood-feeder, but the mechanism of action of CT against H. contortus is not clearly understood. An experiment with young goats was designed to study the effect of SL leaf meal pellets on (1) a mature H. contortus infection, and (2) the surface appearance of adult H. contortus female worms. Thirty-six female and castrated male Boer crossbred goats artificially infected with H. contortus larvae were fed 75% SL leaf meal pellets or alfalfa pellets (18 goats/treatment group) in a 28-day confinement feeding trial. Fecal and blood samples were collected weekly for fecal egg count (FEC) and packed cell volume (PCV) determination, respectively, and all goats were slaughtered at the end of the trial for adult GIN recovery and counting. Five adult female H. contortus were recovered from the abomasum of two goats from each treatment group and from a prior study in which 75% and 95% SL leaf meal pellets or a commercial feed pellet were group-fed to grazing goats (270 days old, Spanish males, 10/treatment group) at 0.91 kg/head/d for 11 weeks. Adult GIN collected were fixed and examined for evidence of surface damage using scanning electron microscopy. Feeding 75% SL pellets to young goats in confinement reduced (P<0.05) FEC compared with control animals, while total worm numbers and PCV were not influenced by treatment. Three out of the 5 adult H. contortus recovered from SL treatment goats in the confinement feeding trial had cuticular surface damage, while no damage was observed on worms from the control group. All five worms observed from both SL treatments in the grazing study showed a shrunken, disheveled cuticular surface, whereas this was not observed on worms from control animals. Overall, this work

  2. Chimeric elk/mouse prion proteins in transgenic mice

    PubMed Central

    Tamgüney, Gültekin; Giles, Kurt; Oehler, Abby; Johnson, Natrina L.; DeArmond, Stephen J.


    Chronic wasting disease (CWD) of deer and elk is a highly communicable neurodegenerative disorder caused by prions. Investigations of CWD are hampered by slow bioassays in transgenic (Tg) mice. Towards the development of Tg mice that will be more susceptible to CWD prions, we created a series of chimeric elk/mouse transgenes that encode the N terminus of elk PrP (ElkPrP) up to residue Y168 and the C terminus of mouse PrP (MoPrP) beyond residue 169 (mouse numbering), designated Elk3M(SNIVVK). Between codons 169 and 219, six residues distinguish ElkPrP from MoPrP: N169S, T173N, V183I, I202V, I214V and R219K. Using chimeric elk/mouse PrP constructs, we generated 12 Tg mouse lines and determined incubation times after intracerebral inoculation with the mouse-passaged RML scrapie or Elk1P CWD prions. Unexpectedly, one Tg mouse line expressing Elk3M(SNIVVK) exhibited incubation times of <70 days when inoculated with RML prions; a second line had incubation times of <90 days. In contrast, mice expressing full-length ElkPrP had incubation periods of >250 days for RML prions. Tg(Elk3M,SNIVVK) mice were less susceptible to CWD prions than Tg(ElkPrP) mice. Changing three C-terminal mouse residues (202, 214 and 219) to those of elk doubled the incubation time for mouse RML prions and rendered the mice resistant to Elk1P CWD prions. Mutating an additional two residues from mouse to elk at codons 169 and 173 increased the incubation times for mouse prions to >300 days, but made the mice susceptible to CWD prions. Our findings highlight the role of C-terminal residues in PrP that control the susceptibility and replication of prions. PMID:23100369

  3. Rett syndrome in adolescent and adult females: clinical and molecular genetic findings.


    Smeets, E; Schollen, E; Moog, U; Matthijs, G; Herbergs, J; Smeets, H; Curfs, L; Schrander-Stumpel, C; Fryns, J P


    Rett syndrome (RTT) is a neurodevelopmental disorder which is diagnosed clinically. We report on 30 adolescent and adult females with classical or atypical RTT of whom 24 have a MECP2 mutation. In these 24 females, the clinical manifestations, degree of severity, and disorder profiles are discussed as well as the genotype phenotype correlation. After X-chromosome inactivation (XCI) study in these cases, we found no correlation between skewing and milder phenotype. Three large deletions were found after additional Southern blot analysis in three classical RTT cases. We confirm that early truncating mutations in MECP2 are responsible for a more severe course of the disorder. Three disorder profiles related to the missense mutations R133C and R306C, and to deletions in the C terminal segment are described and are of interest for further clinical study on larger numbers of cases. The R133C genotype has a predominantly autistic presentation while the R306C genotype is associated with a slower disease progression. The phenotype of the "hotspot" deletions in the C terminal segment is predominantly characterized by rapid progressive neurogenic scoliosis. Older women with RTT are underdiagnosed: seven adults were first diagnosed as having RTT between 29 and 60 years of age, and confirmed on finding a MECP2 mutation. Knowledge of the clinical phenotype of RTT at an adult age is important for all involved in the care of these individuals. The involvement of the parent support group is very important in this matter. PMID:12966523

  4. The effects of gait time and trunk acceleration ratio during stair climbing in old-old adult females

    PubMed Central

    Shin, Sun-Shil; Yoo, Won-Gyu


    [Purpose] This study investigated the effects of gait time and trunk acceleration ratio in old-old adult females during stair climbing. [Subjects and Methods] Twenty-five older adult females who were able to walk independently volunteered for this study and were categorized into two age groups (older adults or old-old adults). Gait time and trunk acceleration ratio were measured using an accelerometer during stair climbing. [Results] Gait time and trunk acceleration ratio when climbing stairs were significantly higher in the old-old age group than in the older adults group. [Conclusions] These findings suggest that old-old females have decreased upper trunk control. In addition, gait time and the trunk acceleration ratio during stair climbing are useful clinical markers for predicting function and balance control ability in old-old elderly populations. PMID:27512256

  5. Organ doses for reference adult male and female undergoing computed tomography estimated by Monte Carlo simulations

    SciTech Connect

    Lee, Choonsik; Kim, Kwang Pyo; Long, Daniel; Fisher, Ryan; Tien, Chris; Simon, Steven L.; Bouville, Andre; Bolch, Wesley E.


    Purpose: To develop a computed tomography (CT) organ dose estimation method designed to readily provide organ doses in a reference adult male and female for different scan ranges to investigate the degree to which existing commercial programs can reasonably match organ doses defined in these more anatomically realistic adult hybrid phantomsMethods: The x-ray fan beam in the SOMATOM Sensation 16 multidetector CT scanner was simulated within the Monte Carlo radiation transport code MCNPX2.6. The simulated CT scanner model was validated through comparison with experimentally measured lateral free-in-air dose profiles and computed tomography dose index (CTDI) values. The reference adult male and female hybrid phantoms were coupled with the established CT scanner model following arm removal to simulate clinical head and other body region scans. A set of organ dose matrices were calculated for a series of consecutive axial scans ranging from the top of the head to the bottom of the phantoms with a beam thickness of 10 mm and the tube potentials of 80, 100, and 120 kVp. The organ doses for head, chest, and abdomen/pelvis examinations were calculated based on the organ dose matrices and compared to those obtained from two commercial programs, CT-EXPO and CTDOSIMETRY. Organ dose calculations were repeated for an adult stylized phantom by using the same simulation method used for the adult hybrid phantom. Results: Comparisons of both lateral free-in-air dose profiles and CTDI values through experimental measurement with the Monte Carlo simulations showed good agreement to within 9%. Organ doses for head, chest, and abdomen/pelvis scans reported in the commercial programs exceeded those from the Monte Carlo calculations in both the hybrid and stylized phantoms in this study, sometimes by orders of magnitude. Conclusions: The organ dose estimation method and dose matrices established in this study readily provides organ doses for a reference adult male and female for different

  6. Organ doses for reference adult male and female undergoing computed tomography estimated by Monte Carlo simulations

    PubMed Central

    Lee, Choonsik; Kim, Kwang Pyo; Long, Daniel; Fisher, Ryan; Tien, Chris; Simon, Steven L.; Bouville, Andre; Bolch, Wesley E.


    Purpose: To develop a computed tomography (CT) organ dose estimation method designed to readily provide organ doses in a reference adult male and female for different scan ranges to investigate the degree to which existing commercial programs can reasonably match organ doses defined in these more anatomically realistic adult hybrid phantoms Methods: The x-ray fan beam in the SOMATOM Sensation 16 multidetector CT scanner was simulated within the Monte Carlo radiation transport code MCNPX2.6. The simulated CT scanner model was validated through comparison with experimentally measured lateral free-in-air dose profiles and computed tomography dose index (CTDI) values. The reference adult male and female hybrid phantoms were coupled with the established CT scanner model following arm removal to simulate clinical head and other body region scans. A set of organ dose matrices were calculated for a series of consecutive axial scans ranging from the top of the head to the bottom of the phantoms with a beam thickness of 10 mm and the tube potentials of 80, 100, and 120 kVp. The organ doses for head, chest, and abdomen∕pelvis examinations were calculated based on the organ dose matrices and compared to those obtained from two commercial programs, CT-EXPO and CTDOSIMETRY. Organ dose calculations were repeated for an adult stylized phantom by using the same simulation method used for the adult hybrid phantom. Results: Comparisons of both lateral free-in-air dose profiles and CTDI values through experimental measurement with the Monte Carlo simulations showed good agreement to within 9%. Organ doses for head, chest, and abdomen∕pelvis scans reported in the commercial programs exceeded those from the Monte Carlo calculations in both the hybrid and stylized phantoms in this study, sometimes by orders of magnitude. Conclusions: The organ dose estimation method and dose matrices established in this study readily provides organ doses for a reference adult male and female for

  7. Developmental Origins of Pregnancy Loss in the Adult Female Common Marmoset Monkey (Callithrix jacchus)

    PubMed Central

    Rutherford, Julienne N.; deMartelly, Victoria A.; Layne Colon, Donna G.; Ross, Corinna N.; Tardif, Suzette D.


    Background The impact of the intrauterine environment on the developmental programming of adult female reproductive success is still poorly understood and potentially underestimated. Litter size variation in a nonhuman primate, the common marmoset monkey (Callithrix jacchus), allows us to model the effects of varying intrauterine environments (e.g. nutrient restriction, exposure to male womb-mates) on the risk of losing fetuses in adulthood. Our previous work has characterized the fetuses of triplet pregnancies as experiencing intrauterine nutritional restriction. Methodology/Principal Findings We used over a decade of demographic data from the Southwest National Primate Research Center common marmoset colony. We evaluated differences between twin and triplet females in the number of pregnancies they produce and the proportion of those pregnancies that ended in fetal loss. We found that triplet females produced the same number of total offspring as twin females, but lost offspring during pregnancy at a significantly higher rate than did twins (38% vs. 13%, p = 0.02). Regardless of their own birth weight or the sex ratio of the litter the experienced as fetuses, triplet females lost more fetuses than did twins. Females with a male littermate experienced a significant increase in the proportion of stillbirths. Conclusions/Significance These striking findings anchor pregnancy loss in the mother’s own fetal environment and development, underscoring a "Womb to Womb" view of the lifecourse and the intergenerational consequences of development. This has important translational implications for understanding the large proportion of human stillbirths that are unexplained. Our findings provide strong evidence that a full understanding of mammalian life history and reproductive biology requires a developmental foundation. PMID:24871614

  8. A novel hormone is required for the development of reproductive phenotypes in adult female crabs.


    Zmora, Nilli; Chung, J Sook


    The crustacean male-specific androgenic hormone is widely accepted as a key factor in sexual differentiation and in the development of secondary sex characteristics. However, the mechanism by which the plethora of different reproductive strategies are controlled and executed in crustaceans is not known. We discovered in the blue crab, Callinectes sapidus, a hitherto unknown neurohormone, named crustacean female sex hormone (CFSH), in distinct neurosecretory cells in the eyestalk ganglia. CFSH is highly expressed in females but weakly in males, and its crucial role in developing adult female phenotypes has now been established. CFSH cDNA encodes a 225-amino acid (aa) novel protein composed of a 23-aa predicted signal peptide, 33-aa precursor-related peptide and 167-aa mature protein that did not match any other sequence in GenBank. CFSH RNA interference knockdown by multiple administrations of double-stranded RNA at the prepubertal stage causes abnormal development of brooding and mating systems upon puberty. These systems include a pair of gonopores and an egg attachment system for brooding, comprised of an enlarged semicircular abdomen and ovigerous setae. The ovigerous setae in CFSH knocked-down females were fewer and 50% shorter and the gonopores were either significantly smaller than those of controls, misplaced, or absent. We also identified CFSH in the green crab, Carcinus maenas, a species that shares a similar reproductive strategy with C. sapidus. Together, our data provide the first evidence for the presence of a female hormone in crustaceans and its importance in positively controlling anatomic features associated with brooding and mating systems. From an evolutionary standpoint, the endocrine control supporting a female-specific reproductive strategy, as previously described for many vertebrate species, has now been demonstrated for the first time in crustaceans. PMID:24280057

  9. Molecular cloning of Elk-3, a new member of the Ets family expressed during mouse embryogenesis and analysis of its transcriptional repression activity.


    Nozaki, M; Onishi, Y; Kanno, N; Ono, Y; Fujimura, Y


    We isolated a cDNA clone, Elk-3, that encodes a novel Ets transcription factor from 16-day mouse embryos. The deduced amino acid sequence of the protein was homologous to human ELK-1 and SAP-1. This protein, ELK-1, and SAP-1 shared some unique structural properties such as an Ets DNA-binding site in the amino-terminal region, a serum response factor interacting domain and phosphorylation sites of serine or threonine residues in the carboxy-terminal region. Northern blotting weakly revealed that two transcripts of 4 and 2.1 kb are expressed in the adult ovary and lung and a 2.1-kb transcript predominated in 8- to 14-day embryos. We assayed the transcriptional activities of Elk-3 protein on the cytokeratin EndoA enhancer containing Ets binding sites in endodermal cells. Elk-3 protein strongly repressed enhancer activity but did not affect the activity of the basal promoter in the absence of the enhancer. Furthermore, Elk-3 can suppress the activity of Ets-2 as the transcriptional activator on the EndoA enhancer. These data suggested that the Elk-3 gene product plays a role in transcriptional regulation during embryogenesis. PMID:8892757

  10. Male and Female Adult Population Health Status in China: A Cross-Sectional National Survey

    PubMed Central

    Shi, Jing; Liu, Meina; Zhang, Qiuju; Lu, Mingshan; Quan, Hude


    Background With rapid economic growth and globalization, lifestyle in China has been changing dramatically. This study aimed to describe the male and female adult Chinese population health status. Methods The Chinese Third National Health Services Survey was conducted in 2003 to collect information about health status and quality of life from randomly selected residents. Of the 193,689 respondents to the survey (response rate 77.8%), 139,831 (69,748 male and 70,083 female) respondents who were 18 years of age or older were analyzed. Results Among the respondents, fewer males than females rated their overall wellbeing as being poor or very poor (4.8% versus 6.2%), reported illness in the last 2 weeks (14.1% versus 17.4%), presence of physician diagnosed chronic disease (15.0% versus 17.7%) and at least one functional problem in seven items of the quality of life (26.9% versus 32.8%). More males than females were currently smoking (52.4% versus 3.4%) and drank alcohol more than three times per week (16.5% versus 1.1%). Physically inactive rate was similar between males and females (85.8% versus 87.0%). Fewer rural respondents reported chronic disease than urban respondents (13.0% versus 19.9% for males and 15.5% versus 22.8% for females). In all seven items of the quality of life measured, rural respondents reported less problems than urban respondents (26.2% versus 28.7% for males and 32.0% versus 34.7% for females). Conclusion Males had better health status than females in terms of self-perceived wellbeing, presence of illness, chronic disease, and quality of life. However, smoking and frequent alcohol drinking was more prevalent among males than that among females. In contrast with the social-economic gradient in health commonly found in the literature, the wealthier urban population in China was not found to be healthier than the rural population in terms of physician diagnosed chronic disease. PMID:18681978

  11. A Pilot Study of Alcohol and Cigarette Consumption among Adolescent and Young Adult Females Attending Health Clinics.

    ERIC Educational Resources Information Center

    Werch, Chudley E.; Dunn, Michael; Woods, Robert


    Examines the alcohol and cigarette use patterns of adolescent and young adult female patients (N=246). Results indicate that smoking differences between Whites and Blacks was inversely related to education: less-educated Whites and more-educated Blacks had a greater smoking risk. Conclusions show females' differential needs regarding alcohol and…

  12. Pathogenesis and epidemiology of Brucellosis in Yellowstone bison: serologic and culture results from adult females and their offspring

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this prospective study was to follow the natural course of Brucella abortus infection in cohorts of seropositive and seronegative female bison and their offspring in Yellowstone National Park over a 5 year period. Specimens were collected from 53 adult, female bison at least once a...

  13. Subadult experience influences adult mate choice in an arthropod: Exposed female wolf spiders prefer males of a familiar phenotype

    PubMed Central

    Hebets, Eileen A.


    Current sexual selection theory proposes several potential mechanisms driving the evolution of female mating preferences, few of which involve social interactions. Although vertebrate examples of socially influenced mating preferences do exist, the invertebrate examples are virtually nonexistent. Here I demonstrate that the mating preferences of female wolf spiders can be acquired through exposure as subadults to unrelated, sexually active adult males. I first conducted exposure trials during which subadult females of the wolf spider Schizocosa uetzi were allowed to interact with mature males of an experimentally manipulated phenotype (either black or brown forelegs). After maturation, these previously exposed females were paired with a male of either a familiar or unfamiliar manipulated phenotype for mate-choice trials. Subadult females that were exposed to directed courtship by mature males of a particular morphological phenotype were subsequently more likely to mate with a male of a familiar phenotype as adults. Furthermore, females that were exposed as subadults were more likely, as adults, to cannibalize a courting male with an unfamiliar phenotype. Unexposed females did not distinguish between phenotypes in either mate choice or cannibalism frequency. These results suggest a previously uncharacterized mechanism influencing the origin of female mating preferences and ultimately the evolution of male traits: subadult experience. This study also stresses the potential importance of learning and memory on adult mate choice in an arthropod. PMID:14597702

  14. Sexual Abuse Perpetrated by Adult and Juvenile Females: An Ultimate Attempt to Resolve a Conflict Associated with Maternal Identity

    ERIC Educational Resources Information Center

    Tardif, M.; Auclair, N.; Jacob, M.; Carpentier, J.


    Objective:: The purpose of this article is to report the descriptive and phenomenological aspects of adult females (AF) and juvenile females (JF) who sexually abuse children and adolescents. A major focus is to study the relational problems during childhood and adulthood of this specific population and how they echo the relational aspects of their…

  15. Mixed-Gender Group Co-Leadership on Group Counseling with Female Adult Survivors of Childhood Sexual Victimization.

    ERIC Educational Resources Information Center

    Threadcraft, Hal L.; Wilcoxon, S. Allen


    Conducted study to investigate whether group cofacilitated by male and female counselor could provide therapeutic benefit to women survivors of childhood sexual victimization. Findings seem to provide preliminary evidence contradicting assumption that male counselors should not be involved in counseling female adult survivors of sexual…

  16. Nutritional effects on reproductive performance of captive adult female coyotes (Canis latrans).


    Gese, Eric M; Roberts, Beth M; Knowlton, Frederick F


    Interactions between animals and their environment are fundamental to ecological research. Field studies of coyote (Canis latrans) reproductive performance suggest mean litter size changes in response to prey abundance. However, this relationship has been assessed primarily by using carcasses collected from trappers. The objective of this study was to assess whether nutritional manipulation prior to mating affected reproduction in adult female coyotes. We examined the effects of caloric restriction during the 7 months prior to estrus on the reproductive rates of 11 captive female coyotes and the subsequent initial survival of pups through two reproductive cycles. This was a 2-year study with a cross-over design so each female was monitored for reproductive performance on each of the two diet treatments. We assessed the number of implantation scars, number of pups born, sex ratios of pups, average pup weight at birth and 2- and 6-weeks of age, and the survival rates between implantation and 2-weeks of age for two diet treatments. We found the mean number of implantation sites and pups whelped during a reproductive cycle was influenced by food-intake prior to conception. Additionally, we found evidence suggesting the effects of nutritional stress may persist for additional breeding cycles. We also provided evidence suggesting well-fed females tended to have more male pups. Understanding how environmental factors influence reproductive output may improve model predictions of coyote population dynamics. PMID:26763531

  17. Older maternal age is associated with depression, anxiety, and stress symptoms in young adult female offspring.


    Tearne, Jessica E; Robinson, Monique; Jacoby, Peter; Allen, Karina L; Cunningham, Nadia K; Li, Jianghong; McLean, Neil J


    The evidence regarding older parental age and incidence of mood disorder symptoms in offspring is limited, and that which exists is mixed. We sought to clarify these relationships by using data from the Western Australian Pregnancy Cohort (Raine) Study. The Raine Study provided comprehensive data from 2,900 pregnancies, resulting in 2,868 live born children. A total of 1,220 participants completed the short form of the Depression Anxiety Stress Scale (DASS-21) at the 20-year cohort follow-up. We used negative binomial regression analyses with log link and with adjustment for known perinatal risk factors to examine the extent to which maternal and paternal age at childbirth predicted continuous DASS-21 index scores. In the final multivariate models, a maternal age of 30-34 years was associated with significant increases in stress DASS-21 scores in female offspring relative to female offspring of 25- to 29-year-old mothers. A maternal age of 35 years and over was associated with increased scores on all DASS-21 scales in female offspring. Our results indicate that older maternal age is associated with depression, anxiety, and stress symptoms in young adult females. Further research into the mechanisms underpinning this relationship is needed. PMID:26569038

  18. The effects of prenatal PCBs on adult female paced mating reproductive behaviors in rats

    PubMed Central

    Steinberg, Rebecca M.; Juenger, Thomas E.; Gore, Andrea C.


    Polychlorinated biphenyls (PCBs) are a family of toxicants that persist in measurable quantities in human and wildlife tissues, despite their ban in production in 1977. Some PCB mixtures can act as endocrine disrupting chemicals (EDCs) by mimicking or antagonizing the actions of hormones in the brain and periphery. When exposure to hormonally active substances such as PCBs occurs during vulnerable developmental periods, particularly prenatally or in early postnatal life, they can disrupt sex-specific patterning of the brain, inducing permanent changes that can later be manifested as improper sexual behaviors. Here, we investigated the effects of prenatal exposure to the PCB mixture Aroclor (A) 1221 on adult female reproductive behaviors in a dose-response model in the Sprague-Dawley rat. Using a paced mating paradigm that permits the female to set the timing of mating and control contact with the male during copulation, we were able to uncover significant differences in female-typical sexual activities in A1221-exposed females. Specifically, A1221 causes significant effects on mating trial pacing, vocalizations, ambulation and the female’s likelihood to mate. The results further demonstrate that the intermediate treatment group has the greatest number of disrupted endpoints, suggestive of non-linear dose responses to A1221. These data demonstrate that the behavioral phenotype in adulthood is disrupted by low, ecologically relevant exposures to PCBs, and the results have implications for reproductive success and health in wildlife and women. PMID:17274994

  19. Condition and mass impact oxygen stores and dive duration in adult female northern elephant seals.


    Hassrick, J L; Crocker, D E; Teutschel, N M; McDonald, B I; Robinson, P W; Simmons, S E; Costa, D P


    The range of foraging behaviors available to deep-diving, air-breathing marine vertebrates is constrained by their physiological capacity to breath-hold dive. We measured body oxygen stores (blood volume and muscle myoglobin) and diving behavior in adult female northern elephant seals, Mirounga angustirostris, to investigate age-related effects on diving performance. Blood volume averaged 74.4+/-17.0 liters in female elephant seals or 20.2+/-2.0% of body mass. Plasma volume averaged 32.2+/-7.8 liters or 8.7+/-0.7% of body mass. Absolute plasma volume and blood volume increased independently with mass and age. Hematocrit decreased weakly with mass but did not vary with age. Muscle myoglobin concentration, while higher than previously reported (7.4+/-0.7 g%), did not vary with mass or age. Pregnancy status did not influence blood volume. Mean dive duration, a proxy for physiological demand, increased as a function of how long seals had been at sea, followed by mass and hematocrit. Strong effects of female body mass (range, 218-600 kg) on dive duration, which were independent of oxygen stores, suggest that larger females had lower diving metabolic rates. A tendency for dives to exceed calculated aerobic limits occurred more frequently later in the at-sea migration. Our data suggest that individual physiological state variables and condition interact to determine breath-hold ability and that both should be considered in life-history studies of foraging behavior. PMID:20118309

  20. Estimating total population size for adult female sea turtles: Accounting for non-nesters

    USGS Publications Warehouse

    Kendall, W.L.; Richardson, J.I.


    Assessment of population size and changes therein is important to sea turtle management and population or life history research. Investigators might be interested in testing hypotheses about the effect of current population size or density (number of animals per unit resource) on future population processes. Decision makers might want to determine a level of allowable take of individual turtles of specified life stage. Nevertheless, monitoring most stages of sea turtle life histories is difficult, because obtaining access to individuals is difficult. Although in-water assessments are becoming more common, nesting females and their hatchlings remain the most accessible life stages. In some cases adult females of a given nesting population are sufficiently philopatric that the population itself can be well defined. If a well designed tagging study is conducted on this population, survival, breeding probability, and the size of the nesting population in a given year can be estimated. However, with published statistical methodology the size of the entire breeding population (including those females skipping nesting in that year) cannot be estimated without assuming that each adult female in this population has the same probability of nesting in a given year (even those that had just nested in the previous year). We present a method for estimating the total size of a breeding population (including nesters those skipping nesting) from a tagging study limited to the nesting population, allowing for the probability of nesting in a given year to depend on an individual's nesting status in the previous year (i.e., a Markov process). From this we further develop estimators for rate of growth from year to year in both nesting population and total breeding population, and the proportion of the breeding population that is breeding in a given year. We also discuss assumptions and apply these methods to a breeding population of hawksbill sea turtles (Eretmochelys imbricata) from

  1. Delayed Recognition of an Ureteropelvic Junction Obstruction in a Young Adult Female

    PubMed Central

    Schulman, Ariel; Wuilleumier, Jean Paul; Teper, Ervin


    A percentage of ureteropelvic junction obstruction cases are clinically silent in childhood and manifest symptoms in adults. Herein we present a 25-year-old female with several years of intermittent flank pain and abdominal symptoms with prior inconclusive diagnostic workup including abdominal imaging without hydronephrosis. Ultimately, a CT scan performed during an acute pain crisis clearly identified right-sided hydronephrosis. The keys to diagnosis are awareness of this entity, a detailed history, and obtaining imaging studies during a crisis. The patient subsequently underwent a right robotic-assisted laparoscopic pyeloplasty with preservation of a lower pole crossing vessel. We highlight noteworthy features of the clinical presentation and surgical repair. PMID:26221562

  2. The Experience of Resilience for Adult Female Survivors of Intimate Partner Violence: A Phenomenological Inquiry.


    Crann, Sara E; Barata, Paula C


    While resilience research in the context of intimate partner violence (IPV) is increasing, there remains little known about women's lived experience of resilience. Using a phenomenological approach, this study examined the experience of resilience for adult female survivors of IPV. Sixteen women who were currently experiencing or had previously experienced abuse by an intimate partner participated in semi-structured interviews. Resilience was experienced as multiple cognitive, emotional, and behavioral shifts across three theme areas: toward resistance, in the experience of control, and toward positivity. The results of this study suggest a number of applications for clinical practice and intervention. PMID:26567293

  3. Elevation of cadmium, lead, and zinc in the hair of adult black female hypertensives

    SciTech Connect

    Medeiros, D.M.; Pellum, L.K.


    The southern portion of the United States has the highest mortality due to cardiovascular disease of any region of the country. The prevalence of hypertension in the South is also higher. Dietary intake of sodium, an overweight condition, and genetic factors may contribute to the problem. The role of trace elements is also a factor in producing hypertension. The objective of the present study was to explore the relationship of selected trace elements with tensive status using hair as a biopsy material. The study examined the differences in hair elemental concentrations between adult black female hypertensives and normotensives from low socioeconomic backgrounds.

  4. Delayed Recognition of an Ureteropelvic Junction Obstruction in a Young Adult Female.


    Schulman, Ariel; Wuilleumier, Jean Paul; Teper, Ervin


    A percentage of ureteropelvic junction obstruction cases are clinically silent in childhood and manifest symptoms in adults. Herein we present a 25-year-old female with several years of intermittent flank pain and abdominal symptoms with prior inconclusive diagnostic workup including abdominal imaging without hydronephrosis. Ultimately, a CT scan performed during an acute pain crisis clearly identified right-sided hydronephrosis. The keys to diagnosis are awareness of this entity, a detailed history, and obtaining imaging studies during a crisis. The patient subsequently underwent a right robotic-assisted laparoscopic pyeloplasty with preservation of a lower pole crossing vessel. We highlight noteworthy features of the clinical presentation and surgical repair. PMID:26221562

  5. Self-characterizations of adult female informal caregivers: gender identity and the bearing of burden.


    Kramer, Maeona K


    Gender identity is a powerful aspect of self that shapes values, attitudes, and conduct. Family caregivers, particularly women, tend to forgo institutionalization of care recipients even when care demands are overwhelming. The reluctance of women to relinquish care raises questions about the relationship between gender identity and the bearing of burden. To illuminate the relationship between gender and burden, 36 adult women caring for highly dependent adults were asked to describe the nature of "self"; that is, how they characterized themselves as a person. Results were tabulated and critically examined in relation to stereotypical gender traits, as well as social and political processes that create gender dichotomies. Overall, self-characterizations indicated caregivers had internalized stereotypical female gender traits that support and facilitate the enduring of burden. PMID:16025695

  6. Racial Differences in Clinical Characteristics, Perceptions and Behaviors, and Psychosocial Impact of Adult Female Acne

    PubMed Central

    Alexis, Andrew F.; Daniels, Selena R.; Kawata, Ariane K.; Burk, Caroline T.; Wilcox, Teresa K.; Taylor, Susan C.


    Objective: Limited data are available on racial differences in clinical characteristics and burden in adult female acne. The objective was to describe racial differences in clinical characteristics, psychosocial impact, perceptions, behaviors, and treatment satisfaction in facial adult female acne. Design: Cross-sectional, web-based survey. Setting: Diverse sample of United States women. Participants: Women between the ages of 25 and 45 years with facial acne (≥25 visible lesions). Measurements: Outcomes included sociodemographic characteristics, psychosocial impacts, perceptions, behaviors, and treatment satisfaction. Racial differences were evaluated using descriptive statistics and t-test/chi-square analyses. Results: 208 females participated (mean age 35±6 years); 51.4 percent were White/Caucasian and 48.6 percent were non-White/Caucasian women [Black/African American (n=51); Hispanic/Latina (n=23); Asian (n=16); Other (n=ll)]. Age of acne onset (mean 14.8±5 vs. 17.0±8 years, p<0.05) and acne concern occurred earlier (16.6±7 vs. 19.3±9 years, p<0.05) in White/Caucasian than non-White/Caucasian subjects. Facial acne primarily presented on chin (28.0%) and cheeks (30.8%) for White/Caucasian women versus cheeks (58.4%) for non-White/Caucasian women. Non-White/Caucasian women experienced more postinflammatory hyperpigmentation than White/Caucasian women (p<0.0001). Facial acne negatively affected quality of life (QoL) in both groups, and most participants (>70%) reported some depression/anxiety symptoms. More White/Caucasian than non-White/Caucasian women were troubled by facial acne (88.8% vs. 76.2%, p<0.05). Lesion clearance was most important to White/Caucasian women (57.9 vs. non-White/Caucasian 31.7%, p<0.001); non-White/Caucasian females focused on postinflammatory hyperpigmentation clearance (41.6% vs. Caucasian 8.4%, p<0.0001). Conclusion: Results highlight racial differences in participant-reported clinical characteristics, attitudes, behaviors, and

  7. Maternal Undernutrition Induces Premature Reproductive Senescence in Adult Female Rat Offspring

    PubMed Central

    Khorram, Omid; Keen-Rinehart, Erin; Chuang, Tsai-Der; Ross, Michael G.; Desai, Mina


    Objective To determine the effects of maternal undernutrition (MUN) on the reproductive axis of aging offspring. Design Animal (rat) study. Setting Research Laboratory. Animals Female Sprague-Dawley rats. Intervention(s) Food restriction during the second half of pregnancy in rats. Main Outcome Measures Circulating gonadotropins, Anti-Mullerian Hormone (AMH), ovarian morphology, estrous cyclicity and gene expression studies in the hypothalamus and ovary in 1 day old (P1) and aging adult offspring. Results Offspring of MUN dams had low birth weight (LBW) and by adult age developed obesity. 80% of adult LBW offspring had disruption of estrous cycle by 8 months of age with the majority of animals in persistent estrous. Ovarian morphology was consistent with acyclicity with ovaries exhibiting large cystic structures and reduced corpora lutea. There was an elevation in circulating testosterone (T), increased ovarian expression of enzymes involved in androgen synthesis, an increase in plasma Leuteinizing (LH/)/Follicle Stimulating hormone (FSH) levels, reduced estradiol (E2) levels and no changes in AMH in adult LBW offspring compared to control offspring. Hypothalamic expression of leptin receptor (OBRb), estrogen receptor-α (ER-α) and Gonadotropin Releasing hormone (GnRH) protein were altered in an age-dependent manner with increased ObRb, ER-α expression in P1 LBW hypothalami and a reversal of this expression pattern in adult LBW hypothalami. Conclusion Our data indicates that the maternal nutritional environment programs reproductive potential of the offspring through alteration of the hypothalamic-pituitary-gonadal axis. The premature reproductive senescence in LBW offspring could be secondary to development of obesity and hyperleptinemia in these animals in adult life. PMID:25439841

  8. Septicemic pasteurellosis in elk (Cervus elaphus) on the United States National Elk Refuge, Wyoming

    USGS Publications Warehouse

    Franson, J.C.; Smith, B.L.


    Septicemic pasteurellosis caused by Pasteurella multocida is believed responsible for the deaths of 48 elk (Cervus elaphus) on the National Elk Refuge near Jackson, Wyoming (USA) during 1986 and 1987. Clinical signs included depression and salivation; necropsy findings included congestion and petechial and ecchymotic hemorrhages in lymph nodes, diaphragm, lungs and endocardium. Pasteurella multocida was isolated from femur marrow of eight carcasses and a variety of tissues from eight others.

  9. Mineral deficiencies in tule elk, Owens Valley, California.


    Johnson, Heather E; Bleich, Vernon C; Krausman, Paul R


    Male tule elk (Cervus elaphus nannodes) are susceptible to high rates of antler breakage in Owens Valley, California. We hypothesized that a mineral deficiency in the diet predisposed male elk to antler breakage. We analyzed elk antler, liver, and forage samples to identify mineral imbalances. We compared the mineral content of livers and antlers from elk in Owens Valley to samples taken from tule elk at Grizzly Island Wildlife Area, a population experiencing normal rates (<5%) of antler breakage. Antler and liver samples were collected from 1989 to 1993, and in 2002, and were tested for calcium (Ca), copper (Cu), iron (Fe), magnesium (Mg), manganese (Mn), molybdenum (Mo), phosphorus (P), sulfur (S), and zinc (Zn). Mineral levels from antler and liver samples were compared to reference values established for elk and deer. We also compared the mineral content of elk forage in Owens Valley, collected in 2002-03, to dietary reference values established for cattle. In antlers, Ca, Fe, and Mg levels were higher in Owens Valley elk than in Grizzly Island elk, although all mineral levels were lower than reference values established for deer antlers. In liver samples, Cu levels from elk in Owens Valley were lower than those from Grizzly Island and lower than minimum reference values; liver Ca and Mo levels were higher in elk from Owens Valley than in those from Grizzly Island. Compared to reference values, elk forage in Owens Valley had high levels of Ca and Mo, and low levels of Cu, P, and Zn. Mineral analyses from antlers, livers, and forage suggest that tule elk in the Owens Valley are Cu and/or P deficient. High levels of Mo and Ca may exacerbate Cu and P deficiencies, respectively. Bone fragility is a symptom of both deficiencies, and an imbalance in Cu, P, or a combination of both, may predispose male tule elk in the Owens Valley to antler breakage. PMID:17347394

  10. Early life stress induces renal dysfunction in adult male rats but not female rats

    PubMed Central

    Loria, Analia S.; Yamamoto, Tatsuo; Pollock, Jennifer S.


    Maternal separation (MatSep) is a model of behavioral stress during early life. We reported that MatSep exacerbates ANG II-induced hypertension in adult male rats. The aims of this study were to determine whether exposure to MatSep in female rats sensitizes blood pressure to ANG II infusion similar to male MatSep rats and to elucidate renal mechanisms involved in the response in MatSep rats. Wistar Kyoto (WKY) pups were exposed to MatSep 3 h/day from days 2 to 14, while control rats remained with their mothers. ANG II-induced mean arterial pressure (MAP; telemetry) was enhanced in female MatSep rats compared with control female rats but delayed compared with male MatSep rats. Creatinine clearance (Ccr) was reduced in male MatSep rats compared with control rats at baseline and after ANG II infusion. ANG II infusion significantly increased T cells in the renal cortex and greater histological damage in the interstitial arteries of male MatSep rats compared with control male rats. Plasma testosterone was greater and estradiol was lower in male MatSep rats compared with control rats with ANG II infusion. ANG II infusion failed to increase blood pressure in orchidectomized male MatSep and control rats. Female MatSep and control rats had similar Ccr, histological renal analysis, and sex hormones at baseline and after ANG II infusion. These data indicate that during ANG II-induced hypertension, MatSep sensitizes the renal phenotype in male but not female rats. PMID:23174859

  11. 27 CFR 9.172 - West Elks.

    Code of Federal Regulations, 2013 CFR


    ... Quadrangle (Colorado-Delta Co. 1955 (photorevised 1978)); (2) Hotchkiss Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979)); (3) Paonia Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979); and (4) Bowie Quadrangle (Colorado-Delta Co. 1965 (photorevised 1978). (c) Boundaries. The West Elks viticultural area...

  12. 27 CFR 9.172 - West Elks.

    Code of Federal Regulations, 2011 CFR


    ... Quadrangle (Colorado-Delta Co. 1955 (photorevised 1978)); (2) Hotchkiss Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979)); (3) Paonia Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979); and (4) Bowie Quadrangle (Colorado-Delta Co. 1965 (photorevised 1978). (c) Boundaries. The West Elks viticultural area...

  13. 27 CFR 9.172 - West Elks.

    Code of Federal Regulations, 2010 CFR


    ... Quadrangle (Colorado-Delta Co. 1955 (photorevised 1978)); (2) Hotchkiss Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979)); (3) Paonia Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979); and (4) Bowie Quadrangle (Colorado-Delta Co. 1965 (photorevised 1978). (c) Boundaries. The West Elks viticultural area...

  14. 27 CFR 9.172 - West Elks.

    Code of Federal Regulations, 2014 CFR


    ... Quadrangle (Colorado-Delta Co. 1955 (photorevised 1978)); (2) Hotchkiss Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979)); (3) Paonia Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979); and (4) Bowie Quadrangle (Colorado-Delta Co. 1965 (photorevised 1978). (c) Boundaries. The West Elks viticultural area...

  15. 27 CFR 9.172 - West Elks.

    Code of Federal Regulations, 2012 CFR


    ... Quadrangle (Colorado-Delta Co. 1955 (photorevised 1978)); (2) Hotchkiss Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979)); (3) Paonia Quadrangle (Colorado-Delta Co. 1965 (photorevised 1979); and (4) Bowie Quadrangle (Colorado-Delta Co. 1965 (photorevised 1978). (c) Boundaries. The West Elks viticultural area...

  16. Mate Choice in Adult Female Bengalese Finches: Females Express Consistent Preferences for Individual Males and Prefer Female-Directed Song Performances

    PubMed Central

    Dunning, Jeffery L.; Pant, Santosh; Bass, Aaron; Coburn, Zachary; Prather, Jonathan F.


    In the process of mate selection by female songbirds, male suitors advertise their quality through reproductive displays in which song plays an important role. Females evaluate the quality of each signal and the associated male, and the results of that evaluation guide expression of selective courtship displays. Some studies reveal broad agreement among females in their preferences for specific signal characteristics, indicating that those features are especially salient in female mate choice. Other studies reveal that females differ in their preference for specific characteristics, indicating that in those cases female evaluation of signal quality is influenced by factors other than simply the physical properties of the signal. Thus, both the physical properties of male signals and specific traits of female signal evaluation can impact female mate choice. Here, we characterized the mate preferences of female Bengalese finches. We found that calls and copulation solicitation displays are equally reliable indicators of female preference. In response to songs from an array of males, each female expressed an individual-specific song preference, and those preferences were consistent across tests spanning many months. Across a population of females, songs of some males were more commonly preferred than others, and females preferred female-directed songs more than undirected songs, suggesting that some song features are broadly attractive. Preferences were indistinguishable for females that did or did not have social experience with the singers, indicating that female preference is strongly directed by song features rather than experiences associated with the singer. Analysis of song properties revealed several candidate parameters that may influence female evaluation. In an initial investigation of those parameters, females could be very selective for one song feature yet not selective for another. Therefore, multiple song parameters are evaluated independently

  17. Mate choice in adult female Bengalese finches: females express consistent preferences for individual males and prefer female-directed song performances.


    Dunning, Jeffery L; Pant, Santosh; Bass, Aaron; Coburn, Zachary; Prather, Jonathan F


    In the process of mate selection by female songbirds, male suitors advertise their quality through reproductive displays in which song plays an important role. Females evaluate the quality of each signal and the associated male, and the results of that evaluation guide expression of selective courtship displays. Some studies reveal broad agreement among females in their preferences for specific signal characteristics, indicating that those features are especially salient in female mate choice. Other studies reveal that females differ in their preference for specific characteristics, indicating that in those cases female evaluation of signal quality is influenced by factors other than simply the physical properties of the signal. Thus, both the physical properties of male signals and specific traits of female signal evaluation can impact female mate choice. Here, we characterized the mate preferences of female Bengalese finches. We found that calls and copulation solicitation displays are equally reliable indicators of female preference. In response to songs from an array of males, each female expressed an individual-specific song preference, and those preferences were consistent across tests spanning many months. Across a population of females, songs of some males were more commonly preferred than others, and females preferred female-directed songs more than undirected songs, suggesting that some song features are broadly attractive. Preferences were indistinguishable for females that did or did not have social experience with the singers, indicating that female preference is strongly directed by song features rather than experiences associated with the singer. Analysis of song properties revealed several candidate parameters that may influence female evaluation. In an initial investigation of those parameters, females could be very selective for one song feature yet not selective for another. Therefore, multiple song parameters are evaluated independently

  18. No effect of different estrogen receptor ligands on cognition in adult female monkeys.


    Lacreuse, Agnès; Wilson, Mark E; Herndon, James G


    Many studies in women and animal models suggest that estrogens affect cognitive function. Yet, the mechanisms by which estrogens may impact cognition remain unclear. The goal of the present study was to assess the effects of different estrogen receptor (ER) ligands on cognitive function in adult ovariectomized female rhesus monkeys. The monkeys were tested for 6 weeks on a battery of memory and attentional tasks administered on a touchscreen: the object, face, and spatial versions of the Delayed Recognition Span Test (DRST) and a Visual Search task. Following a 2-week baseline period with oil vehicle treatment, monkeys were randomly assigned to one of 3 treatment groups: estradiol benzoate (EB), selective ERbeta agonist (diarylpropionitrile DPN) or selective ER modulator tamoxifen (TAM). In each treatment group, monkeys received oil vehicle for 2 weeks and the drug for 2 weeks, in a cross-over design. After a 4-week washout, a subset of monkeys was re-tested on the battery when treated with a selective ERalpha agonist (propyl-pyrazole-triol, PPT) or oil vehicle. Overall, drug treatments had no or negligible effects on cognitive performance. These results support the contention that exogenous estrogens and selective estrogen receptor modulators (SERMS) do not significantly affect cognition in young adult female macaques. Additional studies are needed to determine whether the cognitive effects of estrogens in monkeys of more advanced age are mediated by ERbeta, ERalpha or complex interactions between the two receptors. PMID:19101578

  19. Autonomic activation associated with ethanol self-administration in adult female P rats

    PubMed Central

    Bell, Richard L.; Rodd, Zachary A.; Toalston, Jamie E.; McKinzie, David L.; Lumeng, Lawrence; Li, Ting-Kai; McBride, William J.; Murphy, James M.


    The present study examined changes in heart rate (HR) prior to and during limited access ethanol drinking in adult female P rats. P rats were implanted with radiotelemetric transmitters to measure HR. Daily testing involved a 90-min pre-test period (water only available) and a subsequent 90-min test period [either water (W) or ethanol available]. After a week of habituation, one ethanol group had access to ethanol for 7 weeks (CE), and another ethanol group had access for 4 weeks, was deprived for 2 weeks and then had access for a final week (DEP). Analyses of HR revealed that CE and DEP rats had significantly higher HR than W rats during test periods that ethanol was present and that DEP rats displayed higher HR during the early test period of the ethanol deprivation interval, as well. These data indicate that ethanol drinking induces HR activation in adult female P rats, and that this activation can be conditioned to the test cage environment, paralleling reports on contextual conditioning and cue-reactivity in alcoholics exposed to alcohol-associated stimuli. Therefore, this behavioral test may prove advantageous in screening pharmacotherapies for reducing craving and relapse, which are associated with cue-reactivity in abstinent alcoholics. PMID:18713644

  20. Locomotor stability and adaptation during perturbed walking across the adult female lifespan.


    McCrum, Christopher; Epro, Gaspar; Meijer, Kenneth; Zijlstra, Wiebren; Brüggemann, Gert-Peter; Karamanidis, Kiros


    The aim of this work was to examine locomotor stability and adaptation across the adult female lifespan during perturbed walking on the treadmill. 11 young, 11 middle and 14 older-aged female adults (mean and SD: 25.5(2.1), 50.6(6.4) and 69.0(4.7) years old respectively) walked on a treadmill. We applied a sustained perturbation to the swing phase of the right leg for 18 consecutive gait cycles, followed by a step with the resistance unexpectedly removed, via an ankle strap connected to a break-and-release system. The margin of stability (MoS) at foot touchdown was calculated as the difference between the anterior boundary of the base of support (BoS) and extrapolated center of mass. Older participants showed lower MoS adaptation magnitude in the early adaptation phase (steps 1-3) compared to the young and middle-aged groups. However, in the late adaptation phase (steps 16-18) there were no significant differences in adaptation magnitude between the three age groups. After removing the resistance, all three age groups showed similar aftereffects (i.e. increased BoS). The current results suggest that in old age, the ability to recalibrate locomotion to control stability is preserved, but the rate of adaptive improvement in locomotor stability is diminished. PMID:26970886

  1. Acne treatment patterns, expectations, and satisfaction among adult females of different races/ethnicities

    PubMed Central

    Rendon, Marta I; Rodriguez, David A; Kawata, Ariane K; Degboe, Arnold N; Wilcox, Teresa K; Burk, Caroline T; Daniels, Selena R; Roberts, Wendy E


    Background Limited data are available on acne treatment patterns, expectations, and satisfaction in the adult female subpopulation, particularly among different racial and ethnic groups. Objective Describe acne treatment patterns and expectations in adult females of different racial/ethnic groups and analyze and explore their potential effects on medication compliance and treatment satisfaction. Methods A cross-sectional, Web-based survey was administered to US females (25–45 years) with facial acne (≥25 visible lesions). Data collected included sociodemographics, self-reported clinical characteristics, acne treatment use, and treatment expectations and satisfaction. Results Three hundred twelve subjects completed the survey (mean age, 35.3±5.9 years), comprising black (30.8%), Hispanic (17.6%), Asian/other (17.3%), and white (34.3%). More than half of the subjects in each racial group recently used an acne treatment or procedure (black, 63.5%; Hispanic, 54.5%; Asian/other, 66.7%; white, 66.4%). Treatment use was predominantly over-the-counter (OTC) (47.4%) versus prescription medications (16.6%). OTC use was highest in white subjects (black, 42.7%; Hispanic, 34.5%; Asian/other, 44.4%; white, 59.8%; P<0.05). The most frequently used OTC treatments in all racial/ethnic groups were salicylic acid (SA) (34.3%) and benzoyl peroxide (BP) (32.1%). Overall, compliance with acne medications was highest in white versus black (57.0±32.4 vs 42.7±33.5 days, P>0.05), Hispanic (57.0±32.4 vs 43.2±32.9 days, P>0.05), and Asian/other (57.0±32.4 vs 46.9±37.2 days, P>0.05) subjects. Most subjects expected OTC (73.7%) and prescription (74.7%) treatments to work quickly. Fewer than half of the subjects were satisfied with OTC treatment (BP, 47.0%; SA, 43.0%), often due to skin dryness (BP, 26.3%; SA, 44.3%) and flakiness (BP, 12.3%; SA, 31.1%). No statistically significant differences were observed among racial/ethnic groups in their level of satisfaction with OTC or

  2. Reproductive state modulates testosterone-induced singing in adult female European starlings (Sturnus vulgaris)

    PubMed Central

    Stevenson, Tyler J.; Fortune, Eric S.; Ball, Gregory F.


    European starlings (Sturnus vulgaris) exhibit seasonal changes in singing and in the volumes of the neural substrate. Increases in song nuclei volume are mediated at least in part by increases in day length, which is also associated with increases in plasma testosterone (T), reproductive activity, and singing behavior in males. The correlations between photoperiod (i.e. daylength), T, reproductive state and singing hamper our ability to disentangle causal relationships. We investigated how photoperiodic-induced variation in reproductive state modulates the effects of T on singing behavior and song nuclei volumes in adult female starlings. Female Starlings do not naturally produce measureable levels of circulating T but nevertheless respond to exogenous T, which induces male-like singing. We manipulated photoperiod by placing birds in a photosensitive or photorefractory state and then treated them with T-filled or empty silastic implants. We recorded morning singing behavior for three weeks, after which we assessed reproductive condition and measured song nuclei volumes. We found that T-treated photosensitive birds sang significantly more than all other groups including T-treated photorefractory birds. All T-treated birds had larger song nuclei volumes than with blank-treated birds (despite photorefractory T-treated birds not increasing song-rate). There was no effect of photoperiod on the song nuclei volumes of T-treated birds. These data show that the behavioral effects of exogenous T can be modulated by reproductive state in adult female songbirds. Furthermore, these data are consistent with other observations that increases in singing rate in response to T are not necessarily due to the direct effects of T on song nuclei volume. PMID:25989596

  3. Reproductive state modulates testosterone-induced singing in adult female European starlings (Sturnus vulgaris).


    Rouse, Melvin L; Stevenson, Tyler J; Fortune, Eric S; Ball, Gregory F


    European starlings (Sturnus vulgaris) exhibit seasonal changes in singing and in the volumes of the neural substrate. Increases in song nuclei volume are mediated at least in part by increases in day length, which is also associated with increases in plasma testosterone (T), reproductive activity, and singing behavior in males. The correlations between photoperiod (i.e. daylength), T, reproductive state and singing hamper our ability to disentangle causal relationships. We investigated how photoperiodic-induced variation in reproductive state modulates the effects of T on singing behavior and song nuclei volumes in adult female starlings. Female starlings do not naturally produce measureable levels of circulating T but nevertheless respond to exogenous T, which induces male-like singing. We manipulated photoperiod by placing birds in a photosensitive or photorefractory state and then treated them with T-filled or empty silastic implants. We recorded morning singing behavior for 3 weeks, after which we assessed reproductive condition and measured song nuclei volumes. We found that T-treated photosensitive birds sang significantly more than all other groups including T-treated photorefractory birds. All T-treated birds had larger song nuclei volumes than with blank-treated birds (despite photorefractory T-treated birds not increasing song-rate). There was no effect of photoperiod on the song nuclei volumes of T-treated birds. These data show that the behavioral effects of exogenous T can be modulated by reproductive state in adult female songbirds. Furthermore, these data are consistent with other observations that increases in singing rate in response to T are not necessarily due to the direct effects of T on song nuclei volume. PMID:25989596

  4. Long-term impacts of poaching on relatedness, stress physiology, and reproductive output of adult female african elephants.


    Gobush, K S; Mutayoba, B M; Wasser, S K


    Widespread poaching prior to the 1989 ivory ban greatly altered the demographic structure of matrilineal African elephant (Loxodonta africana) family groups in many populations by decreasing the number of old, adult females. We assessed the long-term impacts of poaching by investigating genetic, physiological, and reproductive correlates of a disturbed social structure resulting from heavy poaching of an African elephant population in Mikumi National Park, Tanzania, prior to 1989. We examined fecal glucocorticoid levels and reproductive output among 218 adult female elephants from 109 groups differing in size, age structure, and average genetic relatedness over 25 months from 2003 to 2005. The distribution in group size has changed little since 1989, but the number of families with tusked old matriarchs has increased by 14.2%. Females from groups that lacked an old matriarch, first-order adult relatives, and strong social bonds had significantly higher fecal glucocorticoid values than those from groups with these features (all females R(2)= 0.31; females in multiadult groups R(2)= 0.46). Females that frequented isolated areas with historically high poaching risk had higher fecal glucocorticoid values than those in low poaching risk areas. Females with weak bonds and low group relatedness had significantly lower reproductive output (R(2)[U]=0.21). Females from disrupted groups, defined as having observed average group relatedness 1 SD below the expected mean for a simulated unpoached family, had significantly lower reproductive output than females from intact groups, despite many being in their reproductive prime. These results suggest that long-term negative impacts from poaching of old, related matriarchs have persisted among adult female elephants 1.5 decades after the 1989 ivory ban was implemented. PMID:18759771

  5. Survey of selected pathogens and blood parameters of northern yellowstone elk: Wolf sanitation effect implications

    USGS Publications Warehouse

    Barber-Meyer, S. M.; White, P.J.; Mech, L.D.


    The restoration or conservation of predators could reduce seroprevalences of certain diseases in prey if predation selectively removes animals exhibiting clinical signs. We assessed disease seroprevalences and blood parameters of 115 adult female elk (Cervus elaphus) wintering on the northern range of Yellowstone National Park [YNP] during 2000-2005 and compared them to data collected prior to wolf (Canis lupus) restoration (WR) in 1995 and to two other herds in Montana to assess this prediction. Blood parameters were generally within two standard deviations of the means observed in other Montana herds (Gravelly-Snowcrest [GS] and Garnet Mountain [GM]), but Yellowstone elk had higher seroprevalences of parainfluenza-3 virus (95% CI YNP = 61.1-78.6, GS = 30.3-46.5) and bovine-virus-diarrhea virus type 1 (95% CI YNP = 15.9-31.9, GM = 0). In comparisons between pre-wolf restoration [pre-WR] (i.e., prior to 1995) seroprevalences with those post-wolf restoration [post-WR] in Yellowstone, we found lower seroprevalences for some disease-causing agents post-wolf restoration (e.g., bovine-virus-diarrhea virus type-1 [95% CI pre-WR = 73.1-86.3, post-WR = 15.9-31.9] and bovine-respiratory syncytial virus [95% CI pre-WR = 70.0-83.8, post-WR = 0]), but similar (e.g., Brucella abortus [95% CI pre-WR = 0-4.45, post-WR = 0-4.74] and epizootic hemorrhagic disease virus [95% CI pre-WR = 0, post-WR = 0]) or higher for others (e.g., Anaplasma marginale [95% CI pre-WR = 0, post-WR = 18.5-38.7] and Leptospira spp. [95% CI pre-WR = 0.5-6.5, post-WR = 9.5-23.5]). Though we did not detect an overall strong predation effect through reduced disease seroprevalence using retrospective comparisons with sparse data, our reference values will facilitate future assessments of this issue.

  6. Population Characteristics and Seasonal Movement Patterns of the Rattlesnake Hills Elk Herd - Status Report 2000

    SciTech Connect

    Tiller, Brett L; Cadwell, Larry L; Zufelt, Rhett K; Turner, Scott D; Turner, Gerald K


    Wildlife biologists documented an isolated elk population in 1972 on the U.S. Department of Energy's (DOE) Hanford Site. Since then the herd has grown, exceeding 800 animals in 1999. Limited harvests on adjacent private lands have occurred since 1986. The large herd size coupled with limited annual harvest have increased concerns about private land crop damages, vehicle collisions, degradation of the native environment, and the herd's use of radiologically controlled areas on the Hanford Site. As a result, in 1999, a decision was made by the Washington Department of Fish and Wildlife (WDFW) (animal management), the U.S. Fish and Wildlife Service (USFWS) (land management), and DOE (landowner) to conduct a large-scale animal roundup to remove elk from the DOE-owned lands and relocate them to distant areas within Washington State. The interagency roundup and relocation occurred in spring 2000. This report presents the current status of the herd size and composition, annual removal estimates, and some limited seasonal area-use patterns by several radio-collared elk subsequent to the large-scale elk roundup. The elk herd maintained an approximate 25% annual increase until 2000. A large harvest offsite in 1999 coupled with the large-scale roundup in spring 2000 reduced herd size to the current estimate of 660 animals. As of August 2000, the herd consisted of 287 (43%) males, 282 (42%) females, and 91 (13%) calves. There has been a notable cycling of calf recruitment rates throughout the 1990s and in 2000. Elk home-range estimates revealed a substantial decrease in summer home ranges in 2000, presumably, in part, as a result of the summer 2000 Hanford Site wildfire. Movement analysis also determined that, as population size increased, so has the frequency and extent of the animals' offsite movements, particularly on private lands adjacent to the Hanford Site in both spring and summer seasons. The frequency and duration of movements by male elk onto the central portions of

  7. Evaluation of the Western immunoblot as a detection method for Brucella abortus exposure in elk.


    Schumaker, Brant A; Mazet, Jonna A K; Gonzales, Ben J; Elzer, Philip H; Hietala, Sharon K; Ziccardi, Michael H


    Brucella abortus has been an important wildlife disease issue for most of the last century, especially because wildlife species are considered to be important disease reservoirs for cattle. Diagnostic uncertainty, caused in part by cross-reactions of antibodies to environmental pathogens such as Yersinia enterocolitica O:9 on standard Brucella serology, has exacerbated the challenges of managing the disease and has highlighted the need for test validation in wildlife species. The western immunoblot was evaluated for use in detecting B. abortus exposure in elk (Cervus elaphus) and for ruling out exposure to cross-reacting bacteria. Samples collected from 2003 to 2006, including 54 female and immature elk from four different elk herds, were tested using standard Brucella serologic methods (card, rapid automated presumptive [RAP], and rivanol tests), as well as the western immunoblot. Samples (n=28) from animals known to be naturally infected with B. abortus biovar 1 served as positive controls. For presumed negative samples, sera (n=26) were collected from two elk herds in which negative serologic tests, and the absence of clinical signs of disease such as abortions, supported Brucella-negative classification. In addition to these study samples, serologic data from 12 tule elk (Cervus elaphus nannodes) were provided from the California Department of Fish and Game in order to illustrate a field application of the western blot. The western immunoblot had the highest sensitivity (1.0; % 0.899-1.0) and specificity (1.0; 0.891-1.0) among all tests used in the study. The Kappa statistic for agreement between the western blot and the card, rivanol, and RAP tests were 0.701, 0.808, and 0.921, respectively, showing good to excellent agreement with the standard diagnostic tests currently in use. Although the western immunoblot is more expensive and time intensive than other tests, in this limited study, it was shown to be reliable for establishing and confirming B. abortus

  8. Neonatal mortality of elk driven by climate, predator phenology and predator community composition.


    Griffin, Kathleen A; Hebblewhite, Mark; Robinson, Hugh S; Zager, Peter; Barber-Meyer, Shannon M; Christianson, David; Creel, Scott; Harris, Nyeema C; Hurley, Mark A; Jackson, DeWaine H; Johnson, Bruce K; Myers, Woodrow L; Raithel, Jarod D; Schlegel, Mike; Smith, Bruce L; White, Craig; White, P J


    recovering wolves on neonatal elk survival, a contentious issue for management of elk populations, may be less important than the composition of the predator community. Future studies would benefit by synthesizing overwinter calf and adult-survival data sets, ideally from experimental studies, to test the roles of predation in annual compensatory and additive mortality of elk. PMID:21615401

  9. Individual variation in feeding habitat use by adult female green sea turtles (Chelonia mydas): are they obligately neritic herbivores?


    Hatase, Hideo; Sato, Katsufumi; Yamaguchi, Manami; Takahashi, Kotaro; Tsukamoto, Katsumi


    Satellite telemetry and stable isotope analysis were used to confirm that oceanic areas (where water depths are >200 m) are alternative feeding habitats for adult female green sea turtles (Chelonia mydas), which have been thought to be obligate herbivores in neritic areas (where depths are <200 m). Four females were tagged with satellite transmitters and tracked during post-nesting periods from Ogasawara Islands, Japan. Three females migrated to neritic habitats, while transmissions from another female ceased in an oceanic habitat. The overall mean nighttime dive depths during oceanic swimming periods in two females were <20 m, implying that the main function of their nighttime dives were resting with neutral buoyancy, whereas the means in two other females were >20 m, implying that they not only rested, but also foraged on macroplankton that exhibit diel vertical migration. Comparisons of stable carbon and nitrogen isotope ratios between 89 females and the prey items in a three-source mixing model estimated that 69% of the females nesting on Ogasawara Islands mainly used neritic habitats and 31% mainly used oceanic habitats. Out of four females tracked by satellite, two females were inferred from isotope ratios to be neritic herbivores and the two others oceanic planktivores. Although post-nesting movements for four females were not completely consistent with the inferences from isotope ratios, possibly due to short tracking periods (28-42 days), their diving behaviors were consistent with the inferences. There were no relationships between body size and the two isotope ratios, indicating a lack of size-related differences in feeding habitat use by adult female green turtles, which was in contrast with loggerhead sea turtles (Caretta caretta). These results and previous findings suggest that ontogenetic habitat shifts by sea turtles are facultative, and consequently, their life histories are polymorphic. PMID:16683139

  10. Spatial distribution of juvenile and adult female Tanner crabs (Chionoecetes bairdi) in a glacial fjord ecosystem: Implications for recruitment processes

    USGS Publications Warehouse

    Nielsen, J.K.; Taggart, S.J.; Shirley, T.C.; Mondragon, J.


    A systematic pot survey in Glacier Bay, Alaska, was conducted to characterize the spatial distribution of juvenile and adult female Tanner crabs, and their association with depth and temperature. The information was used to infer important recruitment processes for Tanner crabs in glaciated ecosystems. High-catch areas for juvenile and adult female Tanner crabs were identified using local autocorrelation statistics. Spatial segregation by size class corresponded to features in the glacial landscape: high-catch areas for juveniles were located at the distal ends of two narrow glacial fjords, and high-catch areas for adults were located in the open waters of the central Bay. Juvenile female Tanner crabs were found at nearly all sampled depths (15-439 m) and temperatures (4-8??C), but the biggest catches were at depths <150 m where adults were scarce. Because adults may prey on or compete with juveniles, the distribution of juveniles could be influenced by the distribution of adults. Areas where adults or predators are scarce, such as glacially influenced fjords, could serve as refuges for juvenile Tanner crabs. ?? 2007 International Council for the Exploration of the Sea. Published by Oxford Journals. All rights reserved.

  11. General Anxiety Disorder Symptoms, Tension Reduction, and Marijuana Use Among Young Adult Females

    PubMed Central

    Hagerty, Claire E.; Herman, Debra S.; Hayaki, Jumi; Anderson, Bradley J.; Budney, Alan J.; Stein, Michael


    Abstract Background The current study tested the hypothesis that tension reduction expectancies mediate the relationship between anxiety symptoms and marijuana use. Methods Interview data for 332 young adult females from Southern New England were collected from 2004 to 2009. Results In structural equation modeling, anxiety symptoms had a significant direct effect (byx = 0.227, 95% confidence interval [CI] 0.086-0.369, p < 0.05) on tension reduction expectancies and a significant indirect effect (byx = 0.026, 95% CI 0.010-0.046, p < 0.05) on marijuana use. Conclusions The effect of anxiety symptoms on marijuana use was fully mediated by tension reduction expectancies. Implications for tension reduction as a possible component of treatment interventions are discussed. PMID:20718677

  12. The experiences and needs of female adults with high-functioning autism spectrum disorder.


    Baldwin, Susanna; Costley, Debra


    There is limited large-scale research into the lived experiences of female adults who have an autism spectrum disorder with no co-occurring intellectual disability. Drawing on the findings of an Australia-wide survey, this report presents self-report data fromn = 82 women with high-functioning autism spectrum disorder in the areas of health, education, employment, social and community activities. Where relevant, comparisons are provided with the male subset of the same study population; however, in the majority of analyses, no discernible gender differences emerged. The findings highlight the diverse and complex challenges faced by women with high-functioning autism spectrum disorder, including high levels of mental health disorder, unmet support needs in education settings and the workplace, and social exclusion and isolation. PMID:26111537

  13. Prevalence and Correlates of Suicidal Behavior among Adult Female Victims of Intimate Partner Violence

    PubMed Central

    Cavanaugh, Courtenay E.; Messing, Jill Theresa; Del-Colle, Melissa; O’Sullivan, Chris; Campbell, Jacquelyn C.


    This study examined the prevalence and correlates of suicidal threats and attempts among 662 racially and ethnically diverse adult female victims of intimate partner violence (IPV). One in five women had threatened or attempted suicide during her lifetime. Multiple logistic regression results indicated that women at greater risk of severe or potentially lethal assaults as measured by the Danger Assessment and those who reported having a chronic or disabling illness were more likely to have threatened or attempted suicide. A linear association was found between age and suicide threats/attempts, with younger women having increased odds. Finally, African American IPV victims were less likely to have threatened or attempted suicide as compared to Latina victims. Study implications are discussed. PMID:21535096

  14. Ileo-Colic Burkitt Lymphoma in a Young Adult Female- A Case Report.


    Sangma, Mima Maychet B; Dasiah, Simon D; Ashok, Aju James


    Burkitt's lymphoma is an uncommon and aggressive type of Non-Hodgkin's lymphoma and is one of the fastest growing cancer tumour in humans; growth fraction close to 100%. We report a case of a young adult female presented with acute pain abdomen with ileo-caecal mass. On clinical presentation, initial diagnosis was acute appendicitis with lump formation. Ultrasound reported as diffuse inflammatory changes and later CECT was done which reported as Gastro-Intestinal Stromal Tumour (GIST). On laparotomy, a huge hard mass was found on ileo-caecal region and right hemicolectomy was done. Diagnosis was confirmed as Non-Hodgkins Burkitt's Lymphoma by HPE and immunohistochemistry testing. So, careful workup is the key to initiate early treatment. This patient had complete remission after the right hemicolectomy followed by multiagent chemotherapy. PMID:27190885

  15. Ileo-Colic Burkitt Lymphoma in a Young Adult Female- A Case Report

    PubMed Central

    Dasiah, Simon D; Ashok, Aju James


    Burkitt’s lymphoma is an uncommon and aggressive type of Non-Hodgkin’s lymphoma and is one of the fastest growing cancer tumour in humans; growth fraction close to 100%. We report a case of a young adult female presented with acute pain abdomen with ileo-caecal mass. On clinical presentation, initial diagnosis was acute appendicitis with lump formation. Ultrasound reported as diffuse inflammatory changes and later CECT was done which reported as Gastro-Intestinal Stromal Tumour (GIST). On laparotomy, a huge hard mass was found on ileo-caecal region and right hemicolectomy was done. Diagnosis was confirmed as Non-Hodgkins Burkitt’s Lymphoma by HPE and immunohistochemistry testing. So, careful workup is the key to initiate early treatment. This patient had complete remission after the right hemicolectomy followed by multiagent chemotherapy. PMID:27190885

  16. Urinary bladder hypersensitivity and dysfunction in female mice following early life and adult stress.


    Pierce, Angela N; Di Silvestro, Elizabeth R; Eller, Olivia C; Wang, Ruipeng; Ryals, Janelle M; Christianson, Julie A


    Early adverse events have been shown to increase the incidence of interstitial cystitis/painful bladder syndrome in adulthood. Despite high clinical relevance and reports of stress-related symptom exacerbation, animal models investigating the contribution of early life stress to female urological pain are lacking. We examined the impact of neonatal maternal separation (NMS) on bladder sensitivity and visceral neuroimmune status both prior-to, and following, water avoidance stress (WAS) in adult female mice. The visceromotor response to urinary bladder distension was increased at baseline and 8d post-WAS in NMS mice, while colorectal sensitivity was transiently increased 1d post-WAS only in naïve mice. Bladder micturition rate and output, but not fecal output, were also significantly increased following WAS in NMS mice. Changes in gene expression involved in regulating the stress response system were observed at baseline and following WAS in NMS mice, and WAS reduced serum corticosterone levels. Cytokine and growth factor mRNA levels in the bladder, and to a lesser extent in the colon, were significantly impacted by NMS and WAS. Peripheral mRNA levels of stress-responsive receptors were differentially influenced by early life and adult stress in bladder, but not colon, of naïve and NMS mice. Histological evidence of mast cell degranulation was increased in NMS bladder, while protein levels of protease activated receptor 2 (PAR2) and transient receptor potential ankyrin 1 (TRPA1) were increased by WAS. Together, this study provides new insight into mechanisms contributing to stress associated symptom onset or exacerbation in patients exposed to early life stress. PMID:26940840

  17. Association between hair mineral and age, BMI and nutrient intakes among Korean female adults

    PubMed Central

    Hong, Se Ra; Lee, Seung Min; Lim, Na Ri; Chung, Hwan Wook


    This study was performed to investigate the association between hair mineral levels and nutrient intakes, age, and BMI in female adults who visited a woman's clinic located in Seoul. Dietary intakes were assessed by food frequency questionnaire and mineral levels were measured in collected hairs, and the relationship between these was examined. The average daily nutrient intakes of subjects were compared to those of the KDRIs, and the energy intake status was fair. The average intake of calcium in women of 50 years and over was 91.35% of KDRIs and the potassium intake was greatly below the recommended levels in all age groups. In the average hair mineral contents in subjects, calcium and copper exceeded far more than the reference range while selenium was very low with 85.19% of subjects being lower than the reference value. In addition, the concentrations of sodium, potassium, iron, and manganese in the hair were below the reference ranges in over 15% of subjects. The concentrations of sodium, chromium, sulfur, and cadmium in the hair showed positive correlations (P < 0.05) with age, but the hair zinc level showed a negative correlation (P < 0.05) with age. The concentrations of sodium, potassium, chromium, and cadmium in the hair showed positive correlations (P < 0.05) with BMI. Some mineral levels in subjects of this study showed significant correlations with nutrient intakes, but it seems that the hair mineral content is not directly influenced by each mineral intake. As described above, some hair mineral levels in female adults deviated from the normal range, and it is considered that nutritional intervention to control the imbalance of mineral nutrition is required. Also, as some correlations were shown between hair mineral levels and age, BMI, and nutrient intakes, the possibility of utilizing hair mineral analysis for specific purposes in the future is suggested. PMID:20090887

  18. A Cross-Sectional Study of the Prevalence of Metabolic Syndrome among Young Female Emirati Adults

    PubMed Central

    Al Dhaheri, Ayesha S.; Mohamad, Maysm N.; Jarrar, Amjad H.; Ohuma, Eric O.; Ismail, Leila Cheikh; Al Meqbaali, Fatima T.; Souka, Usama; Shah, Syed M.


    Introduction Metabolic syndrome (MetS) is a growing problem in the United Arab Emirates (UAE). Moreover, the prevalence of overweight and obesity is rapidly increasing in the UAE especially among young females. However, few studies have evaluated the prevalence of MetS among young female adults in the UAE. This study determined the prevalence of MetS in Emirati females aged 17–25 years and its relation to overweight and obesity. Methods In total, 555 Emirati female college students were enrolled in a cross-sectional study, conducted during 2013–2014 at United Arab Emirates University in Al Ain, UAE. Anthropometric measurements, blood pressure and biochemical measurements were collected. MetS was defined according to the harmonised International Diabetes Federation criteria. Results Of the 555 participants enrolled, 23.1% were overweight and 10.4% were classified as obese. The overall prevalence of MetS was 6.8%. MetS prevalence was highest among obese participants (34.5%), as compared with normal-weight (1.7%) and overweight (10.1%) participants. MetS was significantly associated with overweight (adjusted odds ratio [aOR] = 3.8, 95% confidence interval [CI]; 1.15–12.52) and obesity (aOR = 11.2, 95% CI; 3.1–40.9), as compared with normal-weight. Waist-hip ratio ≥ 0.8 (aOR = 3.04, 95% CI; 1.10–8.44) was significantly associated with MetS, as compared with waist-hip ratio <0.8. The odds of MetS were 22 fold higher in participants with glycated haemoglobin (HbA1c) ≥ 6.5% (aOR = 22.5, 95% CI; 6.37–79.42) compared to HbA1c <6.5%. This difference was 9 fold higher when HbA1c between 5.6%–6.4% was compared to HbA1c <5.6% (aOR = 8.9, 95% CI; 3.4–23.5). Conclusion The prevalence of MetS among obese Emirati female students was significantly higher than overweight and normal weight students. The high prevalence of MetS highlights the importance of regular screening and intervention programmes targeting weight reduction. PMID:27414402

  19. HIV and STI risk behaviors, knowledge, and testing among female adult film performers as compared to other California women.


    Grudzen, Corita R; Meeker, Daniella; Torres, Jacqueline; Du, Qingling; Andersen, Ronald M; Gelberg, Lillian


    A cross-sectional structured online survey was self-administered to a convenience sample of current female adult film performers via the Internet; bivariate analyses compared HIV and other STI risk behaviors, knowledge, and testing in female adult performers to California Women's Health Survey respondents. 134 female adult film performers (mean age 27.8 years) were compared to the 1,773 female respondents (mean age 31.3 years) to the 2007 CWHS. Female performers initiated sex on average 3 years younger and had 6.8 more personal sexual partners in the prior year than other California women. The majority of performers reported HIV and Chlamydia testing (94 and 82%, respectively) in the prior 12 months. They more likely to use condoms consistently in their personal life than other California women (21 vs 17%), though this difference disappeared after controlling for other variables. Adult performers are routinely tested for HIV and Chlamydia, yet they have multiple sexual partners and use condoms inconsistently. PMID:22101890

  20. Stepwise evolution of Elk-1 in early deuterostomes.


    Saxton, Janice; Ferjentsik, Zoltan; Ducker, Charles; Johnson, Andrew D; Shaw, Peter E


    Metazoans have multiple ETS paralogues with overlapping or indiscriminate biological functions. Elk-1, one of three mammalian ternary complex factors (TCFs), is a well-conserved, ETS domain-containing transcriptional regulator of mitogen-responsive genes that operates in concert with serum response factor (SRF). Nonetheless, its genetic role remains unresolved because the elk-1 gene could be deleted from the mouse genome seemingly without adverse effect. Here we have explored the evolution of Elk-1 to gain insight into its conserved biological role. We identified antecedent Elk-1 proteins in extant early metazoans and used amino acid sequence alignments to chart the appearance of domains characteristic of human Elk-1. We then performed biochemical studies to determine whether putative domains apparent in the Elk-1 protein of a primitive hemichordate were functionally orthologous to those of human Elk-1. Our findings imply the existence of primordial Elk-1 proteins in primitive deuterostomes that could operate as mitogen-responsive ETS transcription factors but not as TCFs. The role of TCF was acquired later, but presumably prior to the whole genome duplications in the basal vertebrate lineage. Thus its evolutionary origins link Elk-1 to the appearance of mesoderm. PMID:26613204

  1. Research plan for elk in the eastern Jemez Mountains

    SciTech Connect

    White, G.C.; Lissoway, J.


    In June 1977, the holocaustic La Mesa Fire occurred in the eastern Jemez Mountains of New Mexico. The fire and the subsequent reseeding of the area have created a potential 15,000-acre winter range for elk. Winter range generally is considered the limiting factor in control of elk populations; this new abundance may allow a large increase in the eastern Jemez Mountains elk population. The Los Alamos Scientific Laboratory (LASL), located in the area, is interested in elk overpopulation because of the effect on the vegetation, because increased numbers of elk on the roads would increase traffic hazards, and because of the possibility of elk becoming contaminated with effluents released by the Laboratory. The elk population is difficult to control here because LASL and Bandelier National Monument do not allow hunting on their lands. A 1-day workshop, held June 12, 1979, to discuss problems that might occur with elk population changes, resulted in the research plan outlined here. Participants, including experts on elk and regional land and wildlife managers, are listed in the Appendix.

  2. Oral administration of leaf extracts of Momordica charantia affect reproductive hormones of adult female Wistar rats

    PubMed Central

    Adewale, Osonuga Odusoga; Oduyemi, Osonuga Ifabunmi; Ayokunle, Osonuga


    Objective To determine the effect of graded doses of aqueous leaf extracts of Momordica charantia on fertility hormones of female albino rats. Methods Twenty adult, healthy, female Wistar rats were divided into four groups: low dose (LD), moderate dose (MD) and high dose (HD) groups which received 12.5 g, 25.0 g, 50.0 g of the leaf extract respectively and control group that was given with water ad libatum. Result Estrogen levels reduced by 6.40 nmol/L, 10.80 nmol/L and 28.00 nmol/L in the LD, MD and HD groups respectively while plasma progesterone of rats in the LD, MD and HD groups reduced by 24.20 nmol/L, 40.8 nmol/L and 59.20 nmol/L respectively. Conclusion Our study has shown that the antifertility effect of Momordica charantia is achieved in a dose dependent manner. Hence, cautious use of such medication should be advocated especially when managing couples for infertility. PMID:25183143

  3. Prenatal dexamethasone selectively decreases calretinin expression in the adult female lateral amygdala

    PubMed Central

    Zuloaga, Damian G.; Carbone, David L.; Handa, Robert J.


    Exposure to high levels of glucocorticoids (GCs) during early development results in lasting disturbances in emotional behavior in rodents. Inhibitory GABAergic neurons, classified by their expression of calcium binding proteins (CBPs), also contribute to stress-related behaviors and may be GC sensitive during development. Therefore, in the present study we investigated the effects of prenatal treatment with the glucocorticoid receptor agonist dexamethasone (DEX) on expression of calbindin and calretinin in brain areas critical to emotional regulation (basolateral/lateral amygdala and hippocampal CA1 and CA3 regions). Late gestational treatment with DEX (gestational day 18–22) significantly decreased the density of calretinin immunoreactive cells in the lateral amygdala of adult female offspring with no differences in the basolateral amygdala, hippocampal CA1, or CA3 regions. Moreover, there were no effects of gestational DEX treatment on calretinin expression in males. Calbindin expression in adulthood was unaltered within either amygdala or hippocampal subregion of either sex following prenatal DEX treatment. Together these findings indicate that late gestational DEX treatment causes a targeted reduction of calretinin within the lateral amygdala of females and this may be one mechanism through which developmental glucocorticoid exposure contributes to lasting alterations in emotional behavior. PMID:22668856

  4. Using Pop-II models to predict effects of wolf predation and hunter harvests on elk, mule deer, and moose on the northern range

    USGS Publications Warehouse

    Mack, John A.; Singer, Francis J.


    The effects of establishing a gray wolf (Canis lupus) population in Yellowstone National Park were predicted for three ungulate species—elk (Cervus elaphus), mule deer (Odocoileus hemionus), and moose (Alces alces)—using previously developed POP-II population models. We developed models for 78 and 100 wolves. For each wolf population, we ran scenarios using wolf predation rates of 9, 12, and 15 ungulates/wolf/year. With 78 wolves and the antlerless elk harvest reduced 27%, our modeled elk population estimated were 5-18% smaller than the model estimate without wolves. With 100 wolves and the antlerless elk harvest reduced 27%, our elk population estimated were 11-30% smaller than the population estimates without wolves. Wolf predation effects were greater on the modeled mule deer population than on elk. With 78 wolves and no antlerless deer harvest, we predicted the mule deer population could be 13-44% larger than without wolves. With 100 wolves and no antlerless deer harvest, the mule deer population was 0-36% larger than without wolves. After wolf recovery, our POP-II models suggested moose harvests would have to be reduced at least 50% to maintain moose numbers at the levels predicted when wolves were not present. Mule deer and moose population data are limited, and these wolf predation effects may be overestimated if population sizes or male-female ratios were underestimated in our population models. We recommend additional mule deer and moose population data be obtained.

  5. Elk Valley coal implements smartcell flotation technology

    SciTech Connect

    Stirling, J.C.


    In anticipation of future raw coal containing higher fines content, Elk Valley Coal Corp.'s Greenhills Operations upgraded their fines circuit to include Wemco SmartCells in March 2007. Positive results were immediately achieved increasing the average flotation tailings ash by 16%. With this increase in yield the SmartCells project paid for itself in less than eight months. 2 figs., 1 tab., 1 photo.

  6. Differences in Brachypelma albopilosa (Theraphosidae) hemolymph proteome between subadult and adult females.


    Trabalon, Marie; Carapito, Christine; Voinot, Florian; Martrette, Jean-Marc; Van Dorsselaer, Alain; Gilbert, Caroline; Bertile, Fabrice


    The changes in the hemolymph proteome of mygalomorph Brachypelma albopilosa females were examined for the first time in relation to their developmental stage (subadult and adult period). Seven distinct subunits of hemocyanin (a, b, c, d, e, f, and g chains), as well as actin were clearly identified and their sequence partly characterized using a combination of one- and two-dimensional gel electrophoresis and mass spectrometry. The different structures determined along with possible post-translational modifications may reflect a role of hemocyanin in molting, immunity, and reproduction. In addition, despite no precise identification, additional peptide sequences from eight protein bands (four bands >200 kDa and four bands in the 95-200 kDa mass range) were determined. As reported in other spider species, the putative corresponding structures are the coagulogen protein and/or lipoproteins (HDL-1, HDL-2, VHDL) for which quantitative differences between adult and subadult individuals could be related to the molting process and/or cuticle lipid and protein composition according to the developmental stage. PMID:20717997

  7. An abattoir study of tuberculosis in a herd of farmed elk.

    PubMed Central

    Whiting, T L; Tessaro, S V


    The purpose of this study was to examine the prevalence and distribution of grossly visible lesions of tuberculosis in a herd of 344 North American elk (Cervus elaphus) depopulated during a three-month period in 1991. Abattoir inspection detected mycobacterial lesions in 134 (39.8%) of the 337 animals received for slaughter. The prevalence of lesions increased with the age of the animals. Lesions were predominantly suppurative rather than caseous, and mineralization was less evident than in tuberculous lesions in cattle. Lesions occurred predominantly in lymph nodes, and lungs were the only organs in which mycobacterial lesions were found. The distribution of lesions suggested that aerosol transmission was the most significant means of spread of the disease within the herd. Giant liver flukes (Fascioloides magna) were observed in approximately 80% of the adult elk. PMID:7954222

  8. Female Adult Learners in Rural Community Colleges: A Case Study of Role Perception and Navigation for Student Mothers

    ERIC Educational Resources Information Center

    Thompson, Tara Lynn


    Female adult learners, the fastest growing subpopulation in community colleges, face challenges navigating domestic, professional, and academic roles and take time off from school to reconcile issues with multiple role navigation; thus, their education is disjointed and staggered, creating barriers to persistence. This interpretive design…

  9. Analysis of Factors Causing Adult Female Learners to Drop out of E-Learning Courses in Korea

    ERIC Educational Resources Information Center

    Kim, Sung-Wan; Park, Soon-Shin


    The purpose of this study was to investigate the factors that influence adult female learners' dropout in e-learning courses, and to suggest possible solutions to problem of high dropout rates in Korea. To identify the factors, we analyzed the literature and developed a questionnaire consisting of 9 possible factors and 16 items. Data gathered…

  10. Care and feeding of Orius insidiosus (Hemiptera: Anthocoridae): Assessing the impact of diet on predation following adult female eclosion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Reproduction in female Orius insidiosus Say (Hemiptera, Anthocoridae) is a stringent process, and requires a source of nutrition high in quantity and quality of protein and lipid for optimal production of eggs. Adults can survive solely on a source of carbohydrates, but at the cost of suspending th...

  11. The Satellite Cell in Male and Female, Developing and Adult Mouse Muscle: Distinct Stem Cells for Growth and Regeneration

    PubMed Central

    Neal, Alice; Boldrin, Luisa; Morgan, Jennifer Elizabeth


    Satellite cells are myogenic cells found between the basal lamina and the sarcolemma of the muscle fibre. Satellite cells are the source of new myofibres; as such, satellite cell transplantation holds promise as a treatment for muscular dystrophies. We have investigated age and sex differences between mouse satellite cells in vitro and assessed the importance of these factors as mediators of donor cell engraftment in an in vivo model of satellite cell transplantation. We found that satellite cell numbers are increased in growing compared to adult and in male compared to female adult mice. We saw no difference in the expression of the myogenic regulatory factors between male and female mice, but distinct profiles were observed according to developmental stage. We show that, in contrast to adult mice, the majority of satellite cells from two week old mice are proliferating to facilitate myofibre growth; however a small proportion of these cells are quiescent and not contributing to this growth programme. Despite observed changes in satellite cell populations, there is no difference in engraftment efficiency either between satellite cells derived from adult or pre-weaned donor mice, male or female donor cells, or between male and female host muscle environments. We suggest there exist two distinct satellite cell populations: one for muscle growth and maintenance and one for muscle regeneration. PMID:22662253

  12. Connectivity differences between adult male and female patients with attention deficit hyperactivity disorder according to resting-state functional MRI

    PubMed Central

    Park, Bo-yong; Park, Hyunjin


    Attention deficit hyperactivity disorder (ADHD) is a pervasive psychiatric disorder that affects both children and adults. Adult male and female patients with ADHD are differentially affected, but few studies have explored the differences. The purpose of this study was to quantify differences between adult male and female patients with ADHD based on neuroimaging and connectivity analysis. Resting-state functional magnetic resonance imaging scans were obtained and preprocessed in 82 patients. Group-wise differences between male and female patients were quantified using degree centrality for different brain regions. The medial-, middle-, and inferior-frontal gyrus, superior parietal lobule, precuneus, supramarginal gyrus, superior- and middle-temporal gyrus, middle occipital gyrus, and cuneus were identified as regions with significant group-wise differences. The identified regions were correlated with clinical scores reflecting depression and anxiety and significant correlations were found. Adult ADHD patients exhibit different levels of depression and anxiety depending on sex, and our study provides insight into how changes in brain circuitry might differentially impact male and female ADHD patients. PMID:26981099

  13. Gut transcriptome of replete adult female cattle ticks, Rhipicephalus (Boophilus) microplus, feeding upon a Babesia bovis-infected bovine host

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Babesiosis develops in susceptible cattle when infected by the apicomplexan Babesia bovis, which is transmitted to cattle through the bite of the cattle tick Rhipicephalus (Boophilus) microplus. The R. microplus midgut transcriptome was studied for two cohorts: adult females feeding on cattle infect...

  14. Risk Factors and Protective Factors in Relation to Subjective Health among Adult Female Victims of Child Sexual Abuse

    ERIC Educational Resources Information Center

    Jonzon, Eva; Lindblad, Frank


    Objective: To investigate the relationships between risk and protective factors and health outcome in a sample of adult females who had been victims of child sexual abuse. Method: Both person- and variable-oriented analyses were applied to questionnaire data from a non-clinical group of women (n=152) reporting sexual abuse during childhood.…

  15. Prenatal cocaine exposure increases heart susceptibility to ischaemia–reperfusion injury in adult male but not female rats

    PubMed Central

    Bae, Soochan; Gilbert, Raymond D; Ducsay, Charles A; Zhang, Lubo


    The present study tested the hypothesis that prenatal cocaine exposure differentially regulates heart susceptibility to ischaemia–reperfusion (I/R) injury in adult offspring male and female rats. Pregnant rats were administered intraperitoneally either saline or cocaine (15 mg kg−1) twice daily from day 15 to day 21 of gestational age. There were no differences in maternal weight gain and birth weight between the two groups. Hearts were isolated from 2-month-old male and female offspring and were subjected to I/R (25 min/60 min) in a Langendorff preparation. Preischaemic values of left ventricular (LV) function were the same between the saline control and cocaine-treated hearts for both male and female rats. Prenatal cocaine exposure significantly increased I/R-induced myocardial apoptosis and infarct size, and significantly attenuated the postischaemic recovery of LV function in adult male offspring. In contrast, cocaine did not affect I/R-induced injury and postischaemic recovery of LV function in the female hearts. There was a significant decrease in PKCɛ and phospho-PKCɛ levels in LV in the male, but not female, offspring exposed to cocaine before birth. These results suggest that prenatal cocaine exposure causes a sex-specific increase in heart susceptibility to I/R injury in adult male offspring, and the decreased PKCɛ gene expression in the male heart may play an important role. PMID:15677681

  16. Ovariectomy Results in Variable Changes in Nociception, Mood and Depression in Adult Female Rats

    PubMed Central

    Li, Li-Hong; Wang, Zhe-Chen; Yu, Jin; Zhang, Yu-Qiu


    Decline in the ovarian hormones with menopause may influence somatosensory, cognitive, and affective processing. The present study investigated whether hormonal depletion alters the nociceptive, depressive-like and learning behaviors in experimental rats after ovariectomy (OVX), a common method to deplete animals of their gonadal hormones. OVX rats developed thermal hyperalgesia in proximal and distal tail that was established 2 weeks after OVX and lasted the 7 weeks of the experiment. A robust mechanical allodynia was also occurred at 5 weeks after OVX. In the 5th week after OVX, dilute formalin (5%)-induced nociceptive responses (such as elevating and licking or biting) during the second phase were significantly increased as compared to intact and sham-OVX females. However, chronic constriction injury (CCI) of the sciatic nerve-induced mechanical allodynia did not differ as hormonal status (e.g. OVX and ovarian intact). Using formalin-induced conditioned place avoidance (F-CPA), which is believed to reflect the pain-related negative emotion, we further found that OVX significantly attenuated F-CPA scores but did not alter electric foot-shock-induced CPA (S-CPA). In the open field and forced swimming test, there was an increase in depressive-like behaviors in OVX rats. There was no detectable impairment of spatial performance by Morris water maze task in OVX rats up to 5 weeks after surgery. Estrogen replacement retrieved OVX-induced nociceptive hypersensitivity and depressive-like behaviors. This is the first study to investigate the impacts of ovarian removal on nociceptive perception, negative emotion, depressive-like behaviors and spatial learning in adult female rats in a uniform and standard way. PMID:24710472

  17. Vegetation Responses to Supplemental Winter Feeding of Elk

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Some western states have resorted to supplemental winter feeding programs for elk to compensate for reductions in habitat. Our study quantified effects of winter elk feeding on native and nonnative vegetation occurring at a feedground in western Wyoming. A feedground was established in the upper ...

  18. Elk Habitat: A Case Study of Scientific Inquiry

    ERIC Educational Resources Information Center

    Graves, C. John


    A case study is an excellent way to help students think like scientists as they work to solve a dilemma. This article describes a case study of elk in Yellowstone National Park. Students read short narratives, based on scientific research data, about the puzzling question of why some elk live substantially longer than others in certain areas of…

  19. Pheromones from males of different familiarity exert divergent effects on adult neurogenesis in the female accessory olfactory bulb.


    Wu, Jyun-Han; Han, Yueh-Ting; Yu, Jenn-Yah; Wang, Tsu-Wei


    Pheromones from urine of unfamiliar conspecific male animals can reinitiate a female's estrus cycle to cause pregnancy block through the vomeronasal organ (VNO)-accessory olfactory bulb (AOB)-hypothalamic pathway. This phenomenon is called the Bruce effect. Pheromones from the mate of the female, however, do not trigger re-entrance of the estrus cycle because an olfactory memory toward its mate is formed. The activity of the VNO-AOB-hypothalamic pathway is negatively modulated by GABAergic granule cells in the AOB. Since these cells are constantly replenished by neural stem cells in the subventricular zone (SVZ) of the lateral ventricle throughout adulthood and adult neurogenesis is required for mate recognition and fertility, we tested the hypothesis that pheromones from familiar and unfamiliar males may have different effects on adult AOB neurogenesis in female mice. When female mice were exposed to bedding used by a male or lived with one, cell proliferation and neuroblast production in the SVZ were increased. Furthermore, survival of newly generated cells in the AOB was enhanced. This survival effect was transient and mediated by norepinephrine. Interestingly, male bedding-induced newborn cell survival in the AOB but not cell proliferation in the SVZ was attenuated when females were subjected to bedding from an unfamiliar male. Our results indicate that male pheromones from familiar and unfamiliar males exert different effects on neurogenesis in the adult female AOB. Given that adult neurogenesis is required for reproductive behaviors, these divergent pheromonal effects may provide a mechanism for the Bruce effect. © 2013 Wiley Periodicals, Inc. Develop Neurobiol 73: 632-645, 2013. PMID:23696538

  20. Effects of adult body size on fecundity and the pre-gravid rate of Anopheles gambiae females in Tanzania.


    Lyimo, E O; Takken, W


    The influence of adult body size on the pre-gravid state and fecundity was studied in Anopheles gambiae Giles females hand-caught inside houses and virgin females collected as pupae in Tanzania. Blood-fed mosquitoes were kept for 2-3 days before dissection and examination for insemination and ovarian condition. Those females which did not develop eggs were classified as pre-gravid. The number of mature eggs in those mosquitoes which became gravid was counted. Virgin females were fed and kept for egg maturation in the laboratory. Wing-length of females was measured as an index of mosquito size. The overall pre-gravid rate in the resting An.gambiae population was found to be 21% and, of these, 66% had been inseminated. In the virgin females the pre-gravid rate was 92.6%. The mean wing-length of wild females which became gravid was significantly larger than those which remained pre-gravid. There was a positive correlation between fecundity and wing-length. Smaller females tended to require two or three bloodmeals to facilitate completion of the first gonotrophic cycle. The critical size permitting oviposition from the first blood-meal was a wing-length of 3 mm. PMID:8268486

  1. Effects of Doxycycline on gene expression in Wolbachia and Brugia malayi adult female worms in vivo

    PubMed Central


    Background Most filarial nematodes contain Wolbachia symbionts. The purpose of this study was to examine the effects of doxycycline on gene expression in Wolbachia and adult female Brugia malayi. Methods Brugia malayi infected gerbils were treated with doxycycline for 6-weeks. This treatment largely cleared Wolbachia and arrested worm reproduction. RNA recovered from treated and control female worms was labeled by random priming and hybridized to the Version 2- filarial microarray to obtain expression profiles. Results and discussion Results showed significant changes in expression for 200 Wolbachia (29% of Wolbachia genes with expression signals in untreated worms) and 546 B. malayi array elements after treatment. These elements correspond to known genes and also to novel genes with unknown biological functions. Most differentially expressed Wolbachia genes were down-regulated after treatment (98.5%). In contrast, doxycycline had a mixed effect on B. malayi gene expression with many more genes being significantly up-regulated after treatment (85% of differentially expressed genes). Genes and processes involved in reproduction (gender-regulated genes, collagen, amino acid metabolism, ribosomal processes, and cytoskeleton) were down-regulated after doxycycline while up-regulated genes and pathways suggest adaptations for survival in response to stress (energy metabolism, electron transport, anti-oxidants, nutrient transport, bacterial signaling pathways, and immune evasion). Conclusions Doxycycline reduced Wolbachia and significantly decreased bacterial gene expression. Wolbachia ribosomes are believed to be the primary biological target for doxycycline in filarial worms. B. malayi genes essential for reproduction, growth and development were also down-regulated; these changes are consistent with doxycycline effects on embryo development and reproduction. On the other hand, many B. malayi genes involved in energy production, electron-transport, metabolism, anti

  2. Sexual segregation in North American elk: the role of density dependence

    PubMed Central

    Stewart, Kelley M; Walsh, Danielle R; Kie, John G; Dick, Brian L; Bowyer, R Terry


    We investigated how density-dependent processes and subsequent variation in nutritional condition of individuals influenced both timing and duration of sexual segregation and selection of resources. During 1999–2001, we experimentally created two population densities of North American elk (Cervus elaphus), a high-density population at 20 elk/km2, and a low-density population at 4 elk/km2 to test hypotheses relative to timing and duration of sexual segregation and variation in selection of resources. We used multi-response permutation procedures to investigate patterns of sexual segregation, and resource selection functions to document differences in selection of resources by individuals in high- and low-density populations during sexual segregation and aggregation. The duration of sexual segregation was 2 months longer in the high-density population and likely was influenced by individuals in poorer nutritional condition, which corresponded with later conception and parturition, than at low density. Males and females in the high-density population overlapped in selection of resources to a greater extent than in the low-density population, probably resulting from density-dependent effects of increased intraspecific competition and lower availability of resources. PMID:25691992

  3. Prenatal Testosterone Exposure Decreases Aldosterone Production but Maintains Normal Plasma Volume and Increases Blood Pressure in Adult Female Rats.


    More, Amar S; Mishra, Jay S; Hankins, Gary D; Kumar, Sathish


    Plasma testosterone levels are elevated in pregnant women with preeclampsia and polycystic ovaries; their offspring are at increased risk for hypertension during adult life. We tested the hypothesis that prenatal testosterone exposure induces dysregulation of the renin-angiotensin-aldosterone system, which is known to play an important role in water and electrolyte balance and blood pressure regulation. Female rats (6 mo old) prenatally exposed to testosterone were examined for adrenal expression of steroidogenic genes, telemetric blood pressure, blood volume and Na(+) and K(+) levels, plasma aldosterone, angiotensin II and vasopressin levels, and vascular responses to angiotensin II and arg(8)-vasopressin. The levels of Cyp11b2 (aldosterone synthase), but not the other adrenal steroidogenic genes, were decreased in testosterone females. Accordingly, plasma aldosterone levels were lower in testosterone females. Plasma volume and serum and urine Na(+) and K(+) levels were not significantly different between control and testosterone females; however, prenatal testosterone exposure significantly increased plasma vasopressin and angiotensin II levels and arterial pressure in adult females. In testosterone females, mesenteric artery contractile responses to angiotensin II were significantly greater, while contractile responses to vasopressin were unaffected. Angiotensin II type-1 receptor expression was increased, while angiotensin II type-2 receptor was decreased in testosterone arteries. These results suggest that prenatal testosterone exposure downregulates adrenal Cyp11b2 expression, leading to decreased plasma aldosterone levels. Elevated angiotensin II and vasopressin levels along with enhanced vascular responsiveness to angiotensin II may serve as an underlying mechanism to maintain plasma volume and Na(+) and K(+) levels and mediate hypertension in adult testosterone females. PMID:27385784

  4. Subglottal resonances of adult male and female native speakers of American English

    PubMed Central

    Lulich, Steven M.; Morton, John R.; Arsikere, Harish; Sommers, Mitchell S.; Leung, Gary K. F.; Alwan, Abeer


    This paper presents a large-scale study of subglottal resonances (SGRs) (the resonant frequencies of the tracheo-bronchial tree) and their relations to various acoustical and physiological characteristics of speakers. The paper presents data from a corpus of simultaneous microphone and accelerometer recordings of consonant-vowel-consonant (CVC) words embedded in a carrier phrase spoken by 25 male and 25 female native speakers of American English ranging in age from 18 to 24 yr. The corpus contains 17 500 utterances of 14 American English monophthongs, diphthongs, and the rhotic approximant [ɹ] in various CVC contexts. Only monophthongs are analyzed in this paper. Speaker height and age were also recorded. Findings include (1) normative data on the frequency distribution of SGRs for young adults, (2) the dependence of SGRs on height, (3) the lack of a correlation between SGRs and formants or the fundamental frequency, (4) a poor correlation of the first SGR with the second and third SGRs but a strong correlation between the second and third SGRs, and (5) a significant effect of vowel category on SGR frequencies, although this effect is smaller than the measurement standard deviations and therefore negligible for practical purposes. PMID:23039452

  5. Genetic and Environmental Influences on Female Sexual Orientation, Childhood Gender Typicality and Adult Gender Identity

    PubMed Central

    Burri, Andrea; Cherkas, Lynn; Spector, Timothy; Rahman, Qazi


    Background Human sexual orientation is influenced by genetic and non-shared environmental factors as are two important psychological correlates – childhood gender typicality (CGT) and adult gender identity (AGI). However, researchers have been unable to resolve the genetic and non-genetic components that contribute to the covariation between these traits, particularly in women. Methodology/Principal Findings Here we performed a multivariate genetic analysis in a large sample of British female twins (N = 4,426) who completed a questionnaire assessing sexual attraction, CGT and AGI. Univariate genetic models indicated modest genetic influences on sexual attraction (25%), AGI (11%) and CGT (31%). For the multivariate analyses, a common pathway model best fitted the data. Conclusions/Significance This indicated that a single latent variable influenced by a genetic component and common non-shared environmental component explained the association between the three traits but there was substantial measurement error. These findings highlight common developmental factors affecting differences in sexual orientation. PMID:21760939

  6. Correlation of the hand length and stature in adult Musahar females of Nepal; an anthropometric study.


    Basnet, K S; Dhungel, S; Panta, P P


    Stature of a person is one of the most important and useful anthropometric parameter for establishing identification of unknown living or a dead person. A descriptive cross sectional study was done on 165 Nepalese adult Musahar females of Aurahi Village of Mahottari district, Nepal to predict the stature from their hand length. Measurement of stature and the length of both right and left hands taken with a standard standing height measuring instrument and a slide caliper respectively showed significant (p<0.001) positive correlation between the stature and hand lengths. The multiplication factor which was obtained by dividing the height of the subject by the respective hand lengths was found appropriate parameter to calculate the stature of a questioned person. The importance of the hand length alone will be of a great value for anthropologists and forensic experts. As an alternative method, the coefficient of regression and intercept which were obtained from the measured height and hand length were also proved to be equally valuable to estimate the height of a questioned person. PMID:23441496

  7. Effect of an Eight-Week Ballroom Dancing Program on Muscle Architecture in Older Adults Females.


    Cepeda, Christina C P; Lodovico, Angélica; Fowler, Neil; Rodacki, André L F


    Aging is related to a progressive remodeling of the neuromuscular system, which includes muscle mass, strength, and power reductions. This study investigated the effect of an eight-week dance program on fascicle pennation angle, fascicle length, and thickness of the vastus lateralis (VL), tibialis anterior (TA), biceps femoris (BF), and gastrocnemius medialis (GM) muscles using ultrasound images. Thirty-four healthy older women were randomly assigned to either a dancing (DG: n = 19, 69.1 ± 6.5 years, 72.5 ± 11.7 kg) or control group (CG: n = 15, 71.5 ± 7.4 years, 70.9 ± 9.3 kg). After training, the DG showed greater (p < .05) thickness for VL (16%), TA (17%), BF (19%), and GM (15%); pennation angle for VL (21%), TA (23%), BF (21%), and GM (17%); and fascicle length for VL (11%), TA (12%), BF (10%), and GM (10%). These findings suggest that dance training was effective to change the lower limb muscle architecture in older female adults. PMID:25642640

  8. Comparative microarray analyses of adult female midgut tissues from feeding Rhipicephalus species.


    van Zyl, Willem A; Stutzer, Christian; Olivier, Nicholas A; Maritz-Olivier, Christine


    The cattle tick, Rhipicephalus microplus, has a debilitating effect on the livestock industry worldwide, owing to its being a vector of the causative agents of bovine babesiosis and anaplasmosis. In South Africa, co-infestation with R. microplus and R. decoloratus, a common vector species on local livestock, occurs widely in the northern and eastern parts of the country. An alternative to chemical control methods is sought in the form of a tick vaccine to control these tick species. However, sequence information and transcriptional data for R. decoloratus is currently lacking. Therefore, this study aimed at identifying genes that are shared between midgut tissues of feeding adult female R. microplus and R. decoloratus ticks. In this regard, a custom oligonucleotide microarray comprising of 13,477 R. microplus sequences was used for transcriptional profiling and 2476 genes were found to be shared between these Rhipicephalus species. In addition, 136 transcripts were found to be more abundantly expressed in R. decoloratus and 1084 in R. microplus. Chi-square analysis revealed that genes involved in lipid transport and metabolism are significantly overrepresented in R. microplus and R. decoloratus. This study is the first transcriptional profiling of R. decoloratus and is an additional resource that can be evaluated further in future studies for possible tick control. PMID:25448423

  9. Round and Round and Round We Go: Behavior of Adult Female Mice on the ISS

    NASA Technical Reports Server (NTRS)

    Ronca, April E.


    The NASA Decadal Survey (2011) emphasized the importance of long duration rodent experiments on the International Space Station (ISS). To accomplish this objective, flight hardware and science capabilities supporting mouse studies in space were developed at Ames Research Center. Here we present a video-based behavioral analysis of ten C57BL6 female adult mice exposed to a total of 37 days in space compared with identically housed Ground Controls. Flight and Control mice exhibited the same range of behaviors, including feeding, drinking, exploratory behavior, grooming, and social interactions. Mice propelled themselves freely and actively throughout the Habitat using their forelimbs to push off or by floating from one cage area to another. Overall activity was greater in Flt as compared to GC mice. Spontaneous, organized circling or race-tracking behavior emerged within the first few days of flight and encompassed the primary dark cycle activity for the remainder of the experiment. I will summarize qualitative observations and quantitative comparisons of mice in microgravity and 1g conditions. Behavioral phenotyping revealed important insights into the overall health and adaptation of mice to the space environment, and identified unique behaviors that can guide future habitat development and research on rodents in space.

  10. Biomarker investigations in adult female perch (Perca fluviatilis) from industrialised areas in northern Sweden in 2003.


    Hansson, Tomas; Hansen, Wenche; Tjärnlund, Ulla; Balk, Lennart; Bengtsson, Bengt-Erik


    Since the new millennium, a notion has developed in certain parts of society that environmental pollutants and their associated effects are under control. The primary objective of this investigation, performed in 2003, was to test whether this was actually the case in an industrialised region in the County of Västernorrland in northern Sweden with well-documented environmental pollution from past and present activities. This was performed by measuring a moderate battery of simple biomarkers in adult female perch at several stations. The point sources included sewage-treatment plants, pulp and paper mills, as well as other industries. The biomarkers included growth, somatic indices, gonad maturation status, gonad pigmentation, fin erosion, skin ulcers, and ethoxyresorufin-O-deethylase (EROD) activity in the liver. The results showed that the environmental pollutants and their associated effects were not under control. In fact, the health of the perch was impaired at all of the polluted stations. Many responses were unspecific with respect to underlying cause, whereas some effects on EROD activity and gonad maturation status were attributed to historical creosote pollution and current kraft pulp mill effluents, respectively. The data presented may also be used as reference values for future investigations of health effects in perch. PMID:24297393

  11. Sertraline inhibits increases in body fat and carbohydrate dysregulation in adult female cynomolgus monkeys.


    Silverstein-Metzler, Marnie G; Shively, Carol A; Clarkson, Thomas B; Appt, Susan E; Carr, J Jeffrey; Kritchevsky, Stephen B; Jones, Sara R; Register, Thomas C


    Selective serotonin reuptake inhibitor (SSRI) antidepressants are widely prescribed for depression and other disorders. SSRIs have become one of the most commonly used drugs in the United States, particularly by women. Acute effects on body composition and carbohydrate metabolism have been reported, but little is known regarding the effects of chronic SSRI use. We evaluated the effects of chronic administration of a commonly prescribed SSRI, sertraline HCl, on body weight and composition, fat distribution, carbohydrate metabolism, as well as activity, in adult female depressed and nondepressed cynomolgus monkeys (Macaca fascicularis; n=42) using a placebo-controlled, longitudinal, randomized study design. Phenotypes were evaluated prior to and after 18 months of oral sertraline (20mg/kg) or placebo. Over the 18 month treatment period, the placebo group experienced increases in body weight, body fat (visceral and subcutaneous) fasting insulin concentrations, and homeostasis model assessment of insulin resistance scores (HOMA-IR). Sertraline treatment prevented increases in body weight, fat, insulin, and HOMA-IR (all p<0.05), without significantly altering activity levels. Sertraline treatment altered adiponectin in an unusual way - reducing circulating adiponectin in depressed monkeys without affecting fat mass or body weight. Deleterious effects on adiponectin, a potentially insulin-sensitizing and atheroprotective protein, may result in adverse effects on cardiovascular health despite otherwise beneficial effects on body composition and carbohydrate metabolism. PMID:26939086

  12. Concordance between measured and estimated appendicular muscle mass in adult females.


    Lekamwasam, S; Nanayakkara, J


    This study assessed the accuracy of a selected formula used to estimate the appendicular muscle mass (AMM) which is linked with many clinical outcomes. A group of community-dwelling adult women (n=80) had their AMM measured using dual energy x-ray absorptiometry (DXA). The same was estimated using a formula already published {Skeletal muscle mass = (0.244 × BW in kg) + (7.80 × Ht in meters) + (6.6 × Sex) - (0.098 × Age) + race - 3.3} (sex=0 for female and 1 for male, race =-1.2 for Asian, 1.4 for African American and 0 for White and Hispanic).The two datasets were compared for accuracy and precision. Mean AMM measured by DXA and estimated by the formula were very close (14.8 and 14.5 kg) and the difference ranged from -1.2 to 3.6 kg. Correlation between the two datasets was high (r=0.92) and the Bland-Altman plot showed an acceptable measurement agreement between the two methods. Results were independent of age and BMI. The formula used in this analysis gave an accurate estimation of the absolute AMM in women included in this study. PMID:26520864

  13. Predictors of delayed disclosure of rape in female adolescents and young adults

    PubMed Central

    Bicanic, Iva A. E.; Hehenkamp, Lieve M.; van de Putte, Elise M.; van Wijk, Arjen J.; de Jongh, Ad


    Background Delayed disclosure of rape has been associated with impaired mental health; it is, therefore, important to understand which factors are associated with disclosure latency. The purpose of this study was to compare various demographics, post-rape characteristics, and psychological functioning of early and delayed disclosers (i.e., more than 1-week post-rape) among rape victims, and to determine predictors for delayed disclosure. Methods Data were collected using a structured interview and validated questionnaires in a sample of 323 help-seeking female adolescents and young adults (12–25 years), who were victimized by rape, but had no reported prior chronic child sexual abuse. Results In 59% of the cases, disclosure occurred within 1 week. Delayed disclosers were less likely to use medical services and to report to the police than early disclosers. No significant differences were found between delayed and early disclosers in psychological functioning and time to seek professional help. The combination of age category 12–17 years [odds ratio (OR) 2.05, confidence intervals (CI) 1.13–3.73], penetration (OR 2.36, CI 1.25–4.46), and closeness to assailant (OR 2.64, CI 1.52–4.60) contributed significantly to the prediction of delayed disclosure. Conclusion The results point to the need of targeted interventions that specifically encourage rape victims to disclose early, thereby increasing options for access to health and police services. PMID:25967381

  14. Ursa Major: ot losya do medvedya %t Ursa Major: from elk to bear

    NASA Astrophysics Data System (ADS)

    Lushnikova, A. V.

    In the article material from various cultural and linguistic sources (Indo-European - Slavic, Indo-Iranian; Uralo-Altaic, Tungus, Ancient Egyptian, Babylonian) is used in order to trace up the chronology of the designation of Ursa Majopr, a constellation which has been playing an important role for people different regions since ancient times. It was used for observing of the visible yearly motion of the Sun, for working out seasonal changes; being a circumpolar and non-hiding behind the horizon it has been perceived as a symbol of immortality, its peculiar positional change during a year lay down in plot of the Uralo-Siberian myths about a cosmic hunt for the Elk, myths about deluge. Data from Uralo-Siberian mythology are analyzed. Designations of Ursa Major in the form of a horned hoofed animal such as elk, deer, cow (Uralo-Altaic, Tungus, Slavic, Indo-Iranian languages; Ancient Greece, Crete, Ancient Egypt) and connected with it (or derived from it) denominations and images of "enclosed space" - "vehicle for travelling and carrying goods" (a wagon, a boat) - "instrument for hunting-fishing, a ritual thing" - "household construction" are taken in consideration. The conclusion is made that the transition of the Ursa Major designation from elk to bear could follow the general tendency to shift from so-called matriarchy to patriarchy, to substitute female deities with male ones, which was reflected "in the rise" of the predatory animal cults (not earlier than II mil. B.C.). To prove this, lexical examples of resemblance and coincidences in designation of homed hoofed (elk, deer) and predatory (bear, wolf) animals should be analyzed. Such a goal-directed investigation of the chronology of Ursa Major designations has never been carried out.

  15. Demographics of an experimentally released population of elk in Great Smoky Mountains National Park

    USGS Publications Warehouse

    Murrow, Jennifer L.; Clark, Joseph D.; Delozier, E. Kim


    We assessed the potential for reestablishing elk (Cervus elaphus) in Great Smoky Mountains National Park (GSMNP), USA, by estimating vital rates of experimentally released animals from 2001 to 2006. Annual survival rates for calves ranged from 0.333 to 1.0 and averaged 0.592. Annual survival for subadult and adult elk (i.e., ≥1 yr of age) ranged from 0.690 to 0.933, depending on age and sex. We used those and other vital rates to model projected population growth and viability using a stochastic individual-based model. The annual growth rate (λ) of the modeled population over a 25-year period averaged 0.996 and declined from 1.059 the first year to 0.990 at year 25. The modeled population failed to attain a positive 25-year mean growth rate in 46.0% of the projections. Poor calf recruitment was an important determinant of low population growth. Predation by black bears (Ursus americanus) was the dominant calf mortality factor. Most of the variance of growth projections was due to demographic variation resulting from the small population size (n  =  61). Management actions such as predator control may help increase calf recruitment, but our projections suggest that the GSMNP elk population may be at risk for some time because of high demographic variation.

  16. Perinatal Exposure of Mice to the Pesticide DDT Impairs Energy Expenditure and Metabolism in Adult Female Offspring

    PubMed Central

    La Merrill, Michele; Karey, Emma; Moshier, Erin; Lindtner, Claudia; La Frano, Michael R.; Newman, John W.; Buettner, Christoph


    Dichlorodiphenyltrichloroethane (DDT) has been used extensively to control malaria, typhus, body lice and bubonic plague worldwide, until countries began restricting its use in the 1970s. Its use in malaria control continues in some countries according to recommendation by the World Health Organization. Individuals exposed to elevated levels of DDT and its metabolite dichlorodiphenyldichloroethylene (DDE) have an increased prevalence of diabetes and insulin resistance. Here we hypothesize that perinatal exposure to DDT disrupts metabolic programming leading to impaired metabolism in adult offspring. To test this, we administered DDT to C57BL/6J mice from gestational day 11.5 to postnatal day 5 and studied their metabolic phenotype at several ages up to nine months. Perinatal DDT exposure reduced core body temperature, impaired cold tolerance, decreased energy expenditure, and produced a transient early-life increase in body fat in female offspring. When challenged with a high fat diet for 12 weeks in adulthood, female offspring perinatally exposed to DDT developed glucose intolerance, hyperinsulinemia, dyslipidemia, and altered bile acid metabolism. Perinatal DDT exposure combined with high fat feeding in adulthood further impaired thermogenesis as evidenced by reductions in core temperature and in the expression of numerous RNA that promote thermogenesis and substrate utilization in the brown adipose tissue of adult female mice. These observations suggest that perinatal DDT exposure impairs thermogenesis and the metabolism of carbohydrates and lipids which may increase susceptibility to the metabolic syndrome in adult female offspring. PMID:25076055

  17. Sex-biased gene flow among elk in the greater Yellowstone ecosystem

    USGS Publications Warehouse

    , Brian K. Hand; , Shanyuan Chen; , N. Anderson; , A. Beja-Pereira; Cross, Paul C.; , M. Ebinger; , H. Edwards; , R.A. Garrott; , M.D. Kardos; Kauffman, Matthew J.; , E.L. Landguth; , A. Middleton; , B. Scurlock; , P.J. White; , P. Zager; , M.K. Schwartz; , G. Luikart


    We quantified patterns of population genetic structure to help understand gene flow among elk populations across the Greater Yellowstone Ecosystem. We sequenced 596 base pairs of the mitochondrial control region of 380 elk from eight populations. Analysis revealed high mitochondrial DNA variation within populations, averaging 13.0 haplotypes with high mean gene diversity (0.85). The genetic differentiation among populations for mitochondrial DNA was relatively high (FST = 0.161; P = 0.001) compared to genetic differentiation for nuclear microsatellite data (FST = 0.002; P = 0.332), which suggested relatively low female gene flow among populations. The estimated ratio of male to female gene flow (mm/mf = 46) was among the highest we have seen reported for large mammals. Genetic distance (for mitochondrial DNA pairwise FST) was not significantly correlated with geographic (Euclidean) distance between populations (Mantel’s r = 0.274, P = 0.168). Large mitochondrial DNA genetic distances (e.g., FST > 0.2) between some of the geographically closest populations (<65 km) suggested behavioral factors and/or landscape features might shape female gene flow patterns. Given the strong sex-biased gene flow, future research and conservation efforts should consider the sexes separately when modeling corridors of gene flow or predicting spread of maternally transmitted diseases. The growing availability of genetic data to compare male vs. female gene flow provides many exciting opportunities to explore the magnitude, causes, and implications of sex-biased gene flow likely to occur in many species

  18. Late summer survival of adult female and juvenile spectacled eiders on the Yukon-Kuskokwim Delta, Alska

    USGS Publications Warehouse

    Flint, P.L.; Barry, Grand J.; Morse, J.A.; Fondell, T.F.


    We used radio-telemetry to examine survival of adult female and juvenile Spectacled Eiders (Somateria fischeri) from 30 days after hatch until departure from the Yukon-Kuskokwim Delta (YKD) during 1997-1999. Juvenile survival was 71.4%; adult female survival was 88.5%. Mink (Mustella vison) were the most common predator identified for both adults and juveniles. Detectable levels of lead were found in bones of 74% of juvenile carcasses recovered and 21% had levels indicative of acute exposure. Average age at departure was 59 ?? 1 days old for juveniles and 56 ?? 1 days after hatch for adults. Most broods (60.5%) departed the YKD synchronously. Overall our data indicate that mortality during the latter half of brood-rearing is higher than previously thought. We conclude that brood rearing is a period of high mortality for brood-rearing females and that lead poisoning is responsible for reductions in juvenile survival to fledging. Received 15 February 2000, accepted 1 April 2000.

  19. Breeding Sex Ratios in Adult Leatherback Turtles (Dermochelys coriacea) May Compensate for Female-Biased Hatchling Sex Ratios

    PubMed Central

    Stewart, Kelly R.; Dutton, Peter H.


    For vertebrates with temperature-dependent sex determination, primary (or hatchling) sex ratios are often skewed, an issue of particular relevance to concerns over effects of climate change on populations. However, the ratio of breeding males to females, or the operational sex ratio (OSR), is important to understand because it has consequences for population demographics and determines the capacity of a species to persist. The OSR also affects mating behaviors and mate choice, depending on the more abundant sex. For sea turtles, hatchling and juvenile sex ratios are generally female-biased, and with warming nesting beach temperatures, there is concern that populations may become feminized. Our purpose was to evaluate the breeding sex ratio for leatherback turtles at a nesting beach in St. Croix, USVI. In 2010, we sampled nesting females and later sampled their hatchlings as they emerged from nests. Total genomic DNA was extracted and all individuals were genotyped using 6 polymorphic microsatellite markers. We genotyped 662 hatchlings from 58 females, matching 55 females conclusively to their nests. Of the 55, 42 females mated with one male each, 9 mated with 2 males each and 4 mated with at least 3 males each, for a multiple paternity rate of 23.6%. Using GERUD1.0, we reconstructed parental genotypes, identifying 47 different males and 46 females for an estimated breeding sex ratio of 1.02 males for every female. Thus we demonstrate that there are as many actively breeding males as females in this population. Concerns about female-biased adult sex ratios may be premature, and mate choice or competition may play more of a role in sea turtle reproduction than previously thought. We recommend monitoring breeding sex ratios in the future to allow the integration of this demographic parameter in population models. PMID:24505403

  20. Effect of Perceived Stigmatisation on the Quality of Life among Ageing Female Family Carers: A Comparison of Carers of Adults with Intellectual Disability and Carers of Adults with Mental Illness

    ERIC Educational Resources Information Center

    Chou, Y. C.; Pu, C. Y.; Lee, Y. C.; Lin, L. C.; Kroger, T.


    Background: Little account has been taken of quality of life (QoL) among family carers of adults with an intellectual disability (ID) and family carers of adults with a mental illness (MI), particularly the female ageing carers' perceived stigma. We explore whether there are differences in the significant predictors of female ageing family carers'…

  1. Effects of dietary fibers with different fermentation characteristics on feeding motivation in adult female pigs.


    Souza da Silva, Carol; Bolhuis, J Elizabeth; Gerrits, Walter J J; Kemp, Bas; van den Borne, Joost J G C


    Dietary fibers can be fermented in the colon, resulting in production of short-chain fatty acids (SCFA) and secretion of satiety-related peptides. Fermentation characteristics (fermentation kinetics and SCFA-profile) differ between fibers and could impact their satiating potential. We investigated the effects of fibers with varying fermentation characteristics on feeding motivation in adult female pigs. Sixteen pair-housed pigs received four diets in four periods in a Latin square design. Starch from a control (C) diet was exchanged, based on gross energy, for inulin (INU), guar gum (GG), or retrograded tapioca starch (RS), each at a low (L) and a high (H) inclusion level. This resulted in a decreased metabolizable energy intake when feeding fiber diets as compared with the C diet. According to in vitro fermentation measurements, INU is rapidly fermentable and yields relatively high amounts of propionate, GG is moderately rapidly fermentable and yields relatively high amounts of acetate, and RS is slowly fermentable and yields relatively high amounts of butyrate. Feeding motivation was assessed using behavioral tests at 1h, 3h and 7h after the morning meal, and home pen behavioral observations throughout the day. The number of wheel turns paid for a food reward in an operant test was unaffected by diet. Pigs on H-diets ran 25% slower for a food reward in a runway test than pigs on L-diets, and showed less spontaneous physical activity and less stereotypic behavior in the hours before the afternoon meal, reflecting increased interprandial satiety. Reduced feeding motivation with increasing inclusion level was most pronounced for RS, as pigs decreased speed in the runway test and tended to have a lower voluntary food intake in an ad libitum food intake test when fed RS-H. In conclusion, increasing levels of fermentable fibers in the diet seemed to enhance satiety in adult pigs, despite a reduction in metabolizable energy supply. RS was the most satiating fiber

  2. Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.


    Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A


    A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. PMID:26844865

  3. Response of Elk to Habitat Modification Near Natural Gas Development

    NASA Astrophysics Data System (ADS)

    Van Dyke, Fred; Fox, Autumn; Harju, Seth M.; Dzialak, Matthew R.; Hayden-Wing, Larry D.; Winstead, Jeffrey B.


    Elk (Cervus elaphus) are known to shift habitat use in response to environmental modifications, including those associated with various forms of energy development. The specific behavioral responses underlying these trends, however, have not been effectively studied. To investigate such effects, we examined elk response to habitat alteration near natural gas wells in Las Animas County, Colorado, USA in 2008-2010. We created 10 1-ha openings in forests adjacent to 10 operating natural gas wells by removing standing timber in 2008, with concomitant establishment of 10 1-ha control sites adjacent to the same wells. On each site, we estimated elk use, indexed by pellet density, before and after timber removal. Concurrently, we measured plant production and cover, nutritional quality, species composition and biomass removed by elk and other large herbivores. Species richness and diversity, graminoid and forb cover, and graminoid and forb biomass increased on cut sites following tree removal. Differences were greater in 2010 than in 2009, and elk and deer removed more plant biomass in 2010 than 2009. Elk use of cut sites was 37 % lower than control sites in 2009, but 46 % higher in 2010. The initially lower use of cut sites may be attributable to lack of winter forage on these sites caused by timber removal and associated surface modification. The increased use of cut sites in 2010 suggested that elk possessed the behavioral capacity, over time, to exploit enhanced forage resources in the proximity of habitat modifications and human activity associated with maintenance of operating natural gas wells.

  4. Fluid absorption in the isolated midgut of adult female yellow fever mosquitoes (Aedes aegypti)

    PubMed Central

    Onken, Horst; Moffett, David F.


    ABSTRACT The transepithelial voltage (Vte) and the volume of isolated posterior midguts of adult female yellow fever mosquitoes (Aedes aegypti) were monitored. In all experiments, the initial Vte after filling the midgut was lumen negative, but subsequently became lumen positive at a rate of approximately 1 mV min−1. Simultaneously, the midgut volume decreased, indicating spontaneous fluid absorption. When the midguts were filled and bathed with mosquito saline, the average rate of fluid absorption was 36.5±3.0 nl min−1 (N=4, ±s.e.m.). In the presence of theophylline (10 mmol l−1), Vte reached significantly higher lumen-positive values, but the rate of fluid absorption was not affected (N=6). In the presence of NaCN (5 mmol l−1), Vte remained close to 0 mV (N=4) and fluid absorption was reduced (14.4±1.3 nl min−1, N=3, ±s.e.m.). When midguts were filled with buffered NaCl (154 mmol l−1 plus 1 mmol l−1 HEPES) and bathed in mosquito saline with theophylline, fluid absorption was augmented (50.0±5.8 nl min−1, N=12, ±s.e.m.). Concanamycin A (10 µmol l−1), ouabain (1 mmol l−1), and acetazolamide (1 mmol l−1) affected Vte in different ways, but all reduced fluid absorption by 60–70% of the value before addition of the drugs. PMID:25944920

  5. Effects of dietary fibers with different physicochemical properties on feeding motivation in adult female pigs.


    da Silva, Carol Souza; van den Borne, Joost J G C; Gerrits, Walter J J; Kemp, Bas; Bolhuis, J Elizabeth


    The satiating effects of dietary fiber may depend more on physicochemical properties of the fiber than on total fiber intake. These properties are expected to affect satiety feelings and feeding motivation due to different effects in the gastrointestinal tract. The aim of the current study was to assess the effects of fibers with varying physicochemical properties (bulkiness, viscosity and fermentability) on feeding motivation in adult female pigs. Sixteen pair-housed pigs received four diets: lignocellulose (LC), pectin (PEC), resistant starch (RS), and control (C) without fiber, in four periods in a Latin square design. Each fiber was fed at a low (L) followed by a high (H) inclusion level (7 days each). At 1h, 3h, and 7h after the morning meal, feeding motivation was assessed in an operant test, where turning a wheel yielded multiple food rewards, and in a runway test, where walking a fixed U-shaped track yielded one food reward. Pigs were observed in their home pen for 6h, using 90-s instantaneous scan sampling. In the operant test, throughout the day feeding motivation was higher for pigs on PEC compared with pigs on LC. In the runway, feeding motivation increased particularly at 1h after the meal for pigs on PEC compared with pigs on RS. Also at 7h, feeding motivation tended to decrease for pigs on RS compared with pigs fed other diets. In their home pen, pigs on PEC showed more feeder-directed behavior compared with pigs on RS. In conclusion, PEC was the least satiating fiber. LC and RS, despite a lower supply of available energy, were the most satiating fibers, possibly due to their bulky and fermentation properties, respectively. PMID:22796465

  6. Migratory corridors of adult female Kemp’s ridley turtles in the Gulf of Mexico

    USGS Publications Warehouse

    Shaver, Donna J.; Hart, Kristen M.; Fujisaki, Ikuko; Rubio, Cynthia; Sartain-Iverson, Autumn R.; Pena, Jaime; Gamez, Daniel Gomez; Gonzales Diaz Miron, Raul de Jesus; Burchfield, Patrick M.; Martinez, Hector J.; Ortiz, Jaime


    For many marine species, locations of migratory pathways are not well defined. We used satellite telemetry and switching state-space modeling (SSM) to define the migratory corridor used by Kemp's ridley turtles (Lepidochelys kempii) in the Gulf of Mexico. The turtles were tagged after nesting at Padre Island National Seashore, Texas, USA from 1997 to 2014 (PAIS; n = 80); Rancho Nuevo, Tamaulipas, Mexico from 2010 to 2011 (RN; n = 14); Tecolutla, Veracruz, Mexico from 2012 to 2013 (VC; n = 13); and Gulf Shores, Alabama, USA during 2012 (GS; n = 1). The migratory corridor lies in nearshore Gulf of Mexico waters in the USA and Mexico with mean water depth of 26 m and a mean distance of 20 km from the nearest mainland coast. Migration from the nesting beach is a short phenomenon that occurs from late-May through August, with a peak in June. There was spatial similarity of post-nesting migratory pathways for different turtles over a 16 year period. Thus, our results indicate that these nearshore Gulf waters represent a critical migratory habitat for this species. However, there is a gap in our understanding of the migratory pathways used by this and other species to return from foraging grounds to nesting beaches. Therefore, our results highlight the need for tracking reproductive individuals from foraging grounds to nesting beaches. Continued tracking of adult females from PAIS, RN, and VC nesting beaches will allow further study of environmental and bathymetric components of migratory habitat and threats occurring within our defined corridor. Furthermore, the existence of this migratory corridor in nearshore waters of both the USA and Mexico demonstrates that international cooperation is necessary to protect essential migratory habitat for this imperiled species.

  7. Prevalence and associated factors of female genital cutting among young adult females in Jigjiga district, eastern Ethiopia: a cross-sectional mixed study

    PubMed Central

    Gebremariam, Kidanu; Assefa, Demeke; Weldegebreal, Fitsum


    Purpose The aim of this study was to assess the prevalence and associated factors of female genital cutting (FGC) among young adult (10–24 years of age) females in Jigjiga district, eastern Ethiopia. Methods A school-based cross-sectional mixed method combining both quantitative and qualitative research methods was employed among 679 randomly selected young adult female students from Jigjiga district, Somali regional state, eastern Ethiopia, from February to March 2014 to assess the prevalence and associated factors with FGC. A pretested structured questionnaire was used to collect data. The qualitative data were collected using focus group discussion. Results This study depicted that the prevalence of FGC among the respondents was found to be 82.6%. The dominant form of FGC in this study was type I FGC, 265 (49.3%). The majority of the respondents, 575 (88.3%), had good knowledge toward the bad effects of FGC. Four hundred and seven (62.7%) study participants had positive attitude toward FGC discontinuation. Religion, residence, respondents’ educational level, maternal education, attitude, and belief in religious requirement were the most significant predictors of FGC. The possible reasons for FGC practice were to keep virginity, improve social acceptance, have better marriage prospects, religious approval, and have hygiene. Conclusion Despite girls’ knowledge and attitude toward the bad effects of FGC, the prevalence of FGC was still high. There should be a concerted effort among women, men, religious leaders, and other concerned bodies in understanding and clarifying the wrong attachment between the practice and religion through behavioral change communication and advocacy at all levels. PMID:27563257

  8. Phthalate concentrations in personal care products and the cumulative exposure to female adults and infants in Shanghai.


    Bao, Jiaqin; Wang, Min; Ning, Xiaojun; Zhou, Yaobin; He, Yuping; Yang, Jielin; Gao, Xi; Li, Shuguang; Ding, Zhuoping; Chen, Bo


    Phthalate esters (PE) are synthetic chemicals widely used in industry, and have been detected in personal care products (PCP). Recent findings of human reports demonstrated endocrine-disrupting action associated with phthalate exposures. The aims of this study were to (1) measure levels of 11 PE in 198 PCP collected from retail markets in Shanghai and (2) assess daily dermal exposure in adult females and infants. The health risk of cumulative exposure to eight PE on reproductive system function derived from dermal PCP use was further assessed by utilizing the hazard index (HI) approach. Diethyl phthalate (DEP) was the most frequently detected compound (29.8%), followed by diisobutyl phthalate (DiBP) (6.6%). The geometric mean (GM) concentrations of daily exposure to DEP, bis(2-methoxyethyl) phthalate (DMEP), DiBP, dibutyl phthalate (DBP), diphenyl phthalate (DPP), and bis(2-ethylhexyl) phthalate (DEHP) in female adults were 0.018, 0.012, 0.002, 0.001, 0.003, and 0.002 μg/kg body weight (bw)/d, respectively. The GM daily exposure levels to PE in infants and adult females were similar except for DEHP, which was higher in infants. DEP exposure was highest in both subpopulations at either GM or maximal level. All HI of 8 PE were far less than 1, ranging from 0.0002 to 0.005, indicating no cumulative reproductive risks to these populations. DBP, DMEP, and DEHP were three major contributors to the cumulative HI. In summary, the level of phthalate in PCP from Shanghai retail markets posed no apparent cumulative risk to adult females and infants in China. PMID:25734628

  9. Reproductive development of male goat kids reared with or without permanent contact with adult females until 10 months of age.


    Lacuesta, L; Orihuela, A; Ungerfeld, R


    Adult male ruminants that were reared in contact with females display greater sexual behavior than those reared in single male groups. The aim of the experiment was to compare the reproductive development of prepubertal male kids reared with or without direct permanent contact with adult females until they were 10 months old. Seventeen Saanen male kids were maintained in two groups until 44 weeks of age: kids reared in permanent direct contact with four adult goats (group FEM, N = 8) and kids that remained isolated from females (group ISO, N = 9). All goats in the FEM group became pregnant approximately when bucks attained 28 weeks of age. Scrotal circumference and testosterone concentration were measured, and semen was obtained by electroejaculation to avoid female contact in the ISO group. Scrotal circumference was greater in FEM kids at 12 and 14 weeks of age (P < 0.0001) and testosterone when they were 20 and 22 weeks old (P < 0.0001). Testosterone concentration was greater in ISO kids from 28 to 44 weeks of age. All semen characteristics increased with age (P < 0.0001). Individual motility was greater in FEM kids than that in ISO kids at 15 and 17 weeks (P < 0.005); mass motility was greater in ISO than that in FEM kids at 32 weeks (P < 0.05); total number of spermatozoa/ejaculate was greater in ISO kids at 30, 32, and 40 weeks and in FEM kids at 43 weeks (P < 0.005); total number of motile spermatozoa was greater in ISO kids at 32 and 40 weeks, whereas at 43 weeks, it was greater in FEM kids (P < 0.005). It was concluded that permanent contact with adult goats had transient and short-time positive effects in male kids' reproductive traits during prepubertal development. However, positive effects stopped after goats used as stimulus became pregnant. PMID:25277528

  10. Stress-induced oxytocin release and oxytocin cell number and size in prepubertal and adult male and female rats.


    Minhas, Sumeet; Liu, Clarissa; Galdamez, Josselyn; So, Veronica M; Romeo, Russell D


    Studies indicate that adolescent exposure to stress is a potent environmental factor that contributes to psychological and physiological disorders, though the mechanisms that mediate these dysfunctions are not well understood. Periadolescent animals display greater stress-induced hypothalamic-pituitary-adrenal (HPA) axis responses than adults, which may contribute to these vulnerabilities. In addition to the HPA axis, the hypothalamo-neurohypophyseal tract (HNT) is also activated in response to stress. In adults, stress activates this system resulting in secretion of oxytocin from neurons in the supraoptic (SON) and paraventricular (PVN) nuclei. However, it is currently unknown whether a similar or different response occurs in prepubertal animals. Given the influence of these hormones on a variety of emotional behaviors and physiological systems known to change as an animal transitions into adulthood, we investigated stress-induced HPA and HNT hormonal responses before and after stress, as well as the number and size of oxytocin-containing cells in the SON and PVN of prepubertal (30d) and adult (70d) male and female rats. Though we found the well-established protracted adrenocorticotropic hormone and corticosterone response in prepubertal males and females, only adult males and prepubertal females showed a significant stress-induced increase in plasma oxytocin levels. Moreover, though we found no pubertal changes in the number of oxytocin cells, we did find a pubertal-related increase in oxytocin somal size in both the SON and PVN of males and females. Taken together, these data indicate that neuroendocrine systems can show different patterns of stress reactivity before and after adolescent development and that these responses can be further modified by sex. Given the impact of these hormones on a variety of systems, it will be imperative to further explore these changes in hormonal stress reactivity and their role in adolescent health. PMID:26972154

  11. Pubertal exposure to di-(2-ethylhexyl) phthalate influences social behavior and dopamine receptor D2 of adult female mice.


    Wang, Ran; Xu, Xiaohong; Zhu, Qingjie


    DEHP, one of the most commonly phthalates used in plastics and many other products, is an environmental endocrine disruptor (EED). Puberty is another critical period for the brain development besides the neonatal period and is sensitive to EEDs. Social behavior is organized during puberty, so the present study is to investigate whether pubertal exposure to DEHP influenced social behavior of adult female mice. The results showed that pubertal exposure to DEHP for 2 weeks did not change the serum level of 17β-estradiol and the weight of uterus of adult females, but decreased the number of grid crossings and the frequency of rearing, and increased grooming in open field. DEHP reduced the open arm entries and the time spent in open arms in the elevated plus maze. DEHP reduced mutual sniffing and grooming between unfamiliar conspecifics in social play task and reduced the right chamber (containing unfamiliar female mouse) entries and the frequency of sniffing unfamiliar female mouse. DEHP at 1 mg kg(-1) d(-1) reduced the time spent in right chamber. Furthermore, Western blot analyses showed that DEHP decreased the levels of estrogen receptor β (ERβ), dopamine receptor D2, and the phosphorylation of ERKs in striatum. These results suggest that pubertal exposure to DEHP impaired social investigation and sociability and influenced anxiety-like state of adult female mice. The decreased activity of ERK1/2, and the down-regulated D2 and ERβ in striatum may be associated with the DEHP-induced changes of emotional and social behavior in mice. PMID:26524146

  12. Selected Dietary Nutrients and the Prevalence of Metabolic Syndrome in Adult Males and Females in Saudi Arabia: A Pilot Study

    PubMed Central

    Al-Daghri, Nasser M.; Khan, Nasiruddin; Alkharfy, Khalid M.; Al-Attas, Omar S.; Alokail, Majed S.; Alfawaz, Hanan A.; Alothman, Abdulaziz; Vanhoutte, Paul M.


    During the last decade, the rapid economic development in Saudi Arabia resulted in an unbalanced dietary intake pattern within the general population. Consequently, metabolic syndrome was also documented to be highly prevalent in the Middle-East region. We aimed to examine the relationship between selected dietary nutrient intakes and the prevalence of metabolic syndrome in the general adult population of Riyadh, Saudi Arabia. In this cross-sectional study, 185 adult Saudis aged 19 to 60 years (87 males and 98 females (mean age 35.6 ± 13.2 and 37.6 ± 11.7 years, respectively)) were included. The criteria for metabolic syndrome were based on the International Diabetes Foundation (IDF) criteria, and the dietary food intake was assessed by two 24-h dietary recall methods. The odd ratios (ORs) of metabolic syndrome risk across quartiles of selected dietary nutrients were significantly lower for carbohydrates and proteins, as well as for vitamins A, C, E and K, calcium, zinc and magnesium (p < 0.05 for all) in the female group with metabolic syndrome than those without. The pattern of daily dietary intake of selected nutrients among the general population of Saudi Arabia raises concern, and this dietary imbalance could increase the risk of metabolic syndrome, particularly in adult Saudi females. PMID:24284611

  13. Blood vitamin D(3) metabolite concentrations of adult female bearded dragons (Pogona vitticeps) remain stable after ceasing UVb exposure.


    Oonincx, D G A B; van de Wal, M D; Bosch, G; Stumpel, J B G; Heijboer, A C; van Leeuwen, J P T M; Hendriks, W H; Kik, M


    Vitamin D deficiency can lead to several health problems collectively called metabolic bone disease (MBD). One commonly kept reptile species prone to develop MBD if managed incorrectly is the bearded dragon (Pogona vitticeps). This study aimed to determine the extent to which adult female bearded dragons fed a diet low in vitamin D can use stored vitamin D and its metabolites to maintain plasma 25(OH)D(3) and 1,25(OH)(2)D(3) concentrations after discontinuing UVb exposure. Blood samples of healthy adult female bearded dragons, exposed to UVb radiation for over 6 months were collected (day 0) after which UVb exposure was discontinued for 83 days and blood was collected. Blood plasma was analysed for concentrations of total Ca, total P, ionized Ca, uric acid, 25(OH)D(3) and 1,25(OH)(2)D(3). There was no significant change in plasma 25(OH)D(3) and 1,25(OH)(2)D(3) concentrations during the study. While total Ca and P in whole blood was found to significantly decrease over time (P < 0.0088 and 0.0016, respectively), values were within the reference range. Plasma ionized Ca tended (P = 0.0525) to decrease during the study. Adult female bearded dragons, previously exposed to UVb, are able to maintain blood vitamin D metabolite concentrations when UVb exposure is discontinued for a period of up to 83 days. PMID:23648288

  14. Female-biased expression of odourant receptor genes in the adult antennae of the silkworm, Bombyx mori.


    Wanner, K W; Anderson, A R; Trowell, S C; Theilmann, D A; Robertson, H M; Newcomb, R D


    Olfaction plays an important role in the life history of insects, including key behaviours such as host selection, oviposition and mate recognition. Odour perception by insects is primarily mediated by the large diverse family of odourant receptors (Ors) that are expressed on the dendrites of olfactory neurones housed within chemosensilla. However, few Or sequences have been identified from the Lepidoptera, an insect order that includes some of the most important pest species worldwide. We have identified 41 Or gene sequences from the silkworm (Bombyx mori) genome, more than double the number of published Or sequences from the Lepidoptera. Many silkworm Ors appear to be orthologs of the 17 published tobacco budworm (Heliothis virescens) Ors indicating that many Or lineages may be conserved within the Lepidoptera. The majority of the Or genes are expressed in adult female and male antennae (determined by quantitative real-time PCR analysis), supporting their probable roles in adult olfaction. Several Or genes are expressed at high levels in both male and female antennae, suggesting they mediate the perception of common host or conspecific volatiles important to both sexes. BmOrs 45-47 group together in the same phylogenetic branch and all three are expressed at moderate female-biased ratios, six to eight times higher in female compared to male moth antennae. Interestingly, BmOrs19 and 30 appear to be expressed predominantly in female antennae, opposite to that of the published silkworm pheromone receptors BmOrs 1 and 3 that are specific to male antennae. These results suggest that BmOr19 and 30 may detect odours critical to female behaviour, such as oviposition cues or male-produced courtship pheromones. PMID:17257213

  15. Assessing uncertainty in ecological systems using global sensitivity analyses: a case example of simulated wolf reintroduction effects on elk

    USGS Publications Warehouse

    Fieberg, J.; Jenkins, Kurt J.


    Often landmark conservation decisions are made despite an incomplete knowledge of system behavior and inexact predictions of how complex ecosystems will respond to management actions. For example, predicting the feasibility and likely effects of restoring top-level carnivores such as the gray wolf (Canis lupus) to North American wilderness areas is hampered by incomplete knowledge of the predator-prey system processes and properties. In such cases, global sensitivity measures, such as Sobola?? indices, allow one to quantify the effect of these uncertainties on model predictions. Sobola?? indices are calculated by decomposing the variance in model predictions (due to parameter uncertainty) into main effects of model parameters and their higher order interactions. Model parameters with large sensitivity indices can then be identified for further study in order to improve predictive capabilities. Here, we illustrate the use of Sobola?? sensitivity indices to examine the effect of parameter uncertainty on the predicted decline of elk (Cervus elaphus) population sizes following a hypothetical reintroduction of wolves to Olympic National Park, Washington, USA. The strength of density dependence acting on survival of adult elk and magnitude of predation were the most influential factors controlling elk population size following a simulated wolf reintroduction. In particular, the form of density dependence in natural survival rates and the per-capita predation rate together accounted for over 90% of variation in simulated elk population trends. Additional research on wolf predation rates on elk and natural compensations in prey populations is needed to reliably predict the outcome of predatora??prey system behavior following wolf reintroductions.


    EPA Science Inventory

    A study was conducted within the Elk Creek Watershed, West Virginia to determine the technical and economic feasibility of three acid mine drainage abatement techniques. Alkaline regarding and slurry trench construction were established as technically and economically viable abat...

  17. Urinary excretion of dietary Maillard reaction products in healthy adult female cats.


    van Rooijen, C; Bosch, G; Butré, C I; van der Poel, A F B; Wierenga, P A; Alexander, L; Hendriks, W H


    During processing of foods, the Maillard reaction occurs, resulting in the formation of advanced Maillard reaction products (MRP). Varying amounts of MRP have been found in commercially processed pet foods. Dietary MRP can be absorbed and contribute to the endogenous pool of MRP and possibly the etiology of age-related diseases. The aim of the present study was to determine urinary excretion of dietary MRP in cats fed commercial moist and dry foods. A pilot study with 10 cats, conducted to determine the adaptation time required for stable urinary excretion of MRP when changing to a diet with contrasting MRP content, showed an adaptation time of 1 d for all components. In the main study, 6 commercially processed dry and 6 moist diets were fed to 12 adult female cats in 2 parallel randomized, 36-d Latin square designs. The 24-h urine was collected quantitatively using modified litter boxes, and fructoselysine (FL), carboxymethyllysine (CML), and lysinoalanine (LAL) were analyzed using ultra high performance liquid chromatography (UHPLC) - mass spectrometer. Daily urinary excretion of FL and CML showed a positive relationship with daily intake in the dry ( = 0.03 and < 0.01, respectively) and moist ( < 0.01) foods. For LAL, no significant relationship was observed. Urinary recovery (% ingested) showed a negative relationship with daily intake for FL, CML, and LAL in the dry foods ( < 0.01, < 0.01, and = 0.08, respectively) and for CML and LAL in the moist foods ( < 0.01). The observed increase in urinary excretion with increasing dietary intake indicates that dietary MRP were absorbed from the gastrointestinal tract of cats and excreted in the urine. The adaptation time with change in diet indicates a likely effective excretion of MRP. Minimum apparent absorption of FL, CML, and LAL was found to range between 8% and 23%, 25% and 73%, and 6% and 19%, respectively. The observed decrease in urinary recovery suggests a limiting factor in digestion, absorption, metabolism

  18. Learning Curves: Body Image and Female Sexuality in Young Adult Literature. Scarecrow Studies in Young Adult Literature #35

    ERIC Educational Resources Information Center

    Younger, Beth


    Adolescence is a time of growth, change, and confusion for young women. During this transition from childhood to adulthood, sex and gender roles become more important. Meanwhile, depictions of females--from the hyper-sexualized girls of music videos to the chaste repression of Purity Balls--send mixed messages to young women about their bodies…

  19. Effects of Extended Exposure to the Antibacterial Triclosan in the the Adult Female Rat

    EPA Science Inventory

    Triclosan (TCS), an antibacterial, has been shown to have endocrine disrupting activity in the rat. We reported previously that TCS advanced puberty in the female rat in the female pubertal assay and potentiated the estrogenic effect of ethinyl estradiol (EE) on uterine growth i...

  20. Understanding of Parents and Adults on the Down Syndrome Female Sexual Reproductive Health

    ERIC Educational Resources Information Center

    Zhagan, Madhya


    The purpose of this study is to determine the understanding of reproductive health among parents and female adolescents with Down syndrome. This cross-sectional study involved 22 parents and 22 female adolescents with Down syndrome in Kuala Lumpur, Malaysia. The parents were required to fill up the socio-demographic information in questionnaire…

  1. Septicemic pasteurellosis in farmed elk (Cervus canadensis) in Alberta.


    Malhi, Pritpal S; Ngeleka, Musangu; Woodbury, Murray R


    Septicemic pasteurellosis is a bacterial disease of domestic and wild animals including bison, elk, and pronghorn antelope caused by Pasteurella multocida. Here we report 2 cases of septicemic pasteurellosis in farmed elk. Pasteurella multocida serogroup B was isolated from multiple tissues in both animals. Gene sequencing (16S ribosomal RNA) and BLAST query confirmed that the sequence is 99% to 100% homologous to the P. multocida sequences in the database. PMID:27587888

  2. Chemical immobilization of adult female Weddell seals with tiletamine and zolazepam: effects of age, condition and stage of lactation

    PubMed Central

    Wheatley, Kathryn E; Bradshaw, Corey JA; Harcourt, Robert G; Davis, Lloyd S; Hindell, Mark A


    Background Chemical immobilization of Weddell seals (Leptonychotes weddellii) has previously been, for the most part, problematic and this has been mainly attributed to the type of immobilizing agent used. In addition to individual sensitivity, physiological status may play an important role. We investigated the use of the intravenous administration of a 1:1 mixture of tiletamine and zolazepam (Telazol®) to immobilize adult females at different points during a physiologically demanding 5–6 week lactation period. We also compared performance between IV and IM injection of the same mixture. Results The tiletamine:zolazepam mixture administered intravenously was an effective method for immobilization with no fatalities or pronounced apnoeas in 106 procedures; however, there was a 25 % (one animal in four) mortality rate with intramuscular administration. Induction time was slightly longer for females at the end of lactation (54.9 ± 2.3 seconds) than at post-parturition (48.2 ± 2.9 seconds). In addition, the number of previous captures had a positive effect on induction time. There was no evidence for effects due to age, condition (total body lipid), stage of lactation or number of captures on recovery time. Conclusion We suggest that intravenous administration of tiletamine and zolazepam is an effective and safe immobilizing agent for female Weddell seals. Although individual traits could not explain variation in recovery time, we suggest careful monitoring of recovery times during longitudinal studies (> 2 captures). We show that physiological pressures do not substantially affect response to chemical immobilization with this mixture; however, consideration must be taken for differences that may exist for immobilization of adult males and juveniles. Nevertheless, we recommend a mass-specific dose of 0.50 – 0.65 mg/kg for future procedures with adult female Weddell seals and a starting dose of 0.50 mg/kg for other age classes and other phocid seals. PMID

  3. Spectrographic analysis of the ultrasonic vocalisations of adult male and female BALB/c mice

    NASA Astrophysics Data System (ADS)

    Gourbal, Benjamin E. F.; Barthelemy, Mathieu; Petit, Gilles; Gabrion, Claude

    In this study, a spectrographic analysis was designed to improve the description of the shape, the modulations, the rate, length and frequencies of BALB/c mouse calls in different behavioural situations. Male and female calls emitted during investigation of cages with clean bedding, soiled with male or female bedding, and during same-sex encounters, were recorded and described. BALB/c male mice uttered different types of vocalisations both when investigating counterpart odour cues and when interacting with same-sex counterparts. BALB/c female mice vocalised solely during same-sex counterpart encounters and it appeared that calls were uttered mainly by the resident females. Male and female mice present a complex array of calls, which seem to be linked to particular behavioural situations. Further studies using this technology may help to improve our understanding of the role of vocal communication in natural rodent populations.

  4. Competition favors elk over beaver in a riparian willow ecosystem

    USGS Publications Warehouse

    Baker, B.W.; Peinetti, H.R.; Coughenour, M.C.; Johnson, T.L.


    Beaver (Castor spp.) conservation requires an understanding of their complex interactions with competing herbivores. Simulation modeling offers a controlled environment to examine long-term dynamics in ecosystems driven by uncontrollable variables. We used a new version of the SAVANNA ecosystem model to investigate beaver (C. Canadensis) and elk (Cervus elapses) competition for willow (Salix spp.). We initialized the model with field data from Rocky Mountain National Park, Colorado, USA, to simulate a 4-ha riparian ecosystem containing beaver, elk, and willow. We found beaver persisted indefinitely when elk density was or = 30 elk km_2. The loss of tall willow preceded rapid beaver declines, thus willow condition may predict beaver population trajectory in natural environments. Beaver were able to persist with slightly higher elk densities if beaver alternated their use of foraging sites in a rest-rotation pattern rather than maintained continuous use. Thus, we found asymmetrical competition for willow strongly favored elk over beaver in a simulated montane ecosystem. Finally, we discuss application of the SAVANNA model and mechanisms of competition relative to beaver persistence as metapopulations, ecological resistance and alternative state models, and ecosystem regulation.

  5. Vegetation changes associated with a population irruption by Roosevelt elk.


    Starns, Heath D; Weckerly, Floyd W; Ricca, Mark A; Duarte, Adam


    Interactions between large herbivores and their food supply are central to the study of population dynamics. We assessed temporal and spatial patterns in meadow plant biomass over a 23-year period for meadow complexes that were spatially linked to three distinct populations of Roosevelt elk (Cervus elaphus roosevelti) in northwestern California. Our objectives were to determine whether the plant community exhibited a tolerant or resistant response when elk population growth became irruptive. Plant biomass for the three meadow complexes inhabited by the elk populations was measured using Normalized Difference Vegetation Index (NDVI), which was derived from Landsat 5 Thematic Mapper imagery. Elk populations exhibited different patterns of growth through the time series, whereby one population underwent a complete four-stage irruptive growth pattern while the other two did not. Temporal changes in NDVI for the meadow complex used by the irruptive population suggested a decline in forage biomass during the end of the dry season and a temporal decline in spatial variation of NDVI at the peak of plant biomass in May. Conversely, no such patterns were detected in the meadow complexes inhabited by the nonirruptive populations. Our findings suggest that the meadow complex used by the irruptive elk population may have undergone changes in plant community composition favoring plants that were resistant to elk grazing. PMID:25628868

  6. Vegetation changes associated with a population irruption by Roosevelt elk

    PubMed Central

    Starns, Heath D; Weckerly, Floyd W; Ricca, Mark A; Duarte, Adam


    Interactions between large herbivores and their food supply are central to the study of population dynamics. We assessed temporal and spatial patterns in meadow plant biomass over a 23-year period for meadow complexes that were spatially linked to three distinct populations of Roosevelt elk (Cervus elaphus roosevelti) in northwestern California. Our objectives were to determine whether the plant community exhibited a tolerant or resistant response when elk population growth became irruptive. Plant biomass for the three meadow complexes inhabited by the elk populations was measured using Normalized Difference Vegetation Index (NDVI), which was derived from Landsat 5 Thematic Mapper imagery. Elk populations exhibited different patterns of growth through the time series, whereby one population underwent a complete four-stage irruptive growth pattern while the other two did not. Temporal changes in NDVI for the meadow complex used by the irruptive population suggested a decline in forage biomass during the end of the dry season and a temporal decline in spatial variation of NDVI at the peak of plant biomass in May. Conversely, no such patterns were detected in the meadow complexes inhabited by the nonirruptive populations. Our findings suggest that the meadow complex used by the irruptive elk population may have undergone changes in plant community composition favoring plants that were resistant to elk grazing. PMID:25628868

  7. Vegetation changes associated with a population irruption by Roosevelt elk

    USGS Publications Warehouse

    Starns, H D; Weckerly, Floyd W.; Ricca, Mark; Duarte, Adam


    Interactions between large herbivores and their food supply are central to the study of population dynamics. We assessed temporal and spatial patterns in meadow plant biomass over a 23-year period for meadow complexes that were spatially linked to three distinct populations of Roosevelt elk (Cervus elaphus roosevelti) in northwestern California. Our objectives were to determine whether the plant community exhibited a tolerant or resistant response when elk population growth became irruptive. Plant biomass for the three meadow complexes inhabited by the elk populations was measured using Normalized Difference Vegetation Index (NDVI), which was derived from Landsat 5 Thematic Mapper imagery. Elk populations exhibited different patterns of growth through the time series, whereby one population underwent a complete four-stage irruptive growth pattern while the other two did not. Temporal changes in NDVI for the meadow complex used by the irruptive population suggested a decline in forage biomass during the end of the dry season and a temporal decline in spatial variation of NDVI at the peak of plant biomass in May. Conversely, no such patterns were detected in the meadow complexes inhabited by the nonirruptive populations. Our findings suggest that the meadow complex used by the irruptive elk population may have undergone changes in plant community composition favoring plants that were resistant to elk grazing.

  8. Mathematical models and specific absorbed fractions of photon energy in the nonpregnant adult female and at the end of each trimester of pregnancy

    SciTech Connect

    Stabin, M.G.; Watson, E.E.; Cristy, M.; Ryman, J.C.; Eckerman, K.F.; Davis, J.L.; Marshall, D.; Gehlen, M.K.


    Mathematical phantoms representing the adult female at three, six, and nine months of gestation are described. They are modifications of the 15-year-old male/adult female phantom (15-AF phantom) of Cristy and Eckerman (1987). The model of uterine contents includes the fetus, fetal skeleton, and placenta. The model is suitable for dose calculations for the fetus as a whole; individual organs within the fetus (other than the skeleton) are not modeled. A new model for the nonpregnant adult female is also described, comprising (1) the 15-AF phantom; (2) an adjustment to specific absorbed fractions for organ self-dose from photons to better match Reference Woman masses; and (3) computation of specific absorbed fractions with Reference Woman masses from ICRP Publication 23 for both penetrating and nonpenetrating radiations. Specific absorbed fractions for photons emitted from various source regions are tabulated for the new non;pregnant adult female model and the three pregnancy models.

  9. Morphology of the first-instar nymph and adult female of Kermes echinatus Balachowsky, with a comparison to K. vermilio Planchon (Hemiptera, Coccoidea, Kermesidae)

    PubMed Central

    Spodek, Malkie; Ben-Dov, Yair


    Abstract Thefirst-instar nymph and the adult female of Kermes echinatus Balachowsky (Hemiptera, Coccoidea, Kermesidae) are described and illustrated. This species is compared with Kermes vermilio Planchon, a morphologically similar species known in the Palaeractic region. PMID:23275748

  10. Estimation of stature from the foot and its segments in a sub-adult female population of North India

    PubMed Central


    Background Establishing personal identity is one of the main concerns in forensic investigations. Estimation of stature forms a basic domain of the investigation process in unknown and co-mingled human remains in forensic anthropology case work. The objective of the present study was to set up standards for estimation of stature from the foot and its segments in a sub-adult female population. Methods The sample for the study constituted 149 young females from the Northern part of India. The participants were aged between 13 and 18 years. Besides stature, seven anthropometric measurements that included length of the foot from each toe (T1, T2, T3, T4, and T5 respectively), foot breadth at ball (BBAL) and foot breadth at heel (BHEL) were measured on both feet in each participant using standard methods and techniques. Results The results indicated that statistically significant differences (p < 0.05) between left and right feet occur in both the foot breadth measurements (BBAL and BHEL). Foot length measurements (T1 to T5 lengths) did not show any statistically significant bilateral asymmetry. The correlation between stature and all the foot measurements was found to be positive and statistically significant (p-value < 0.001). Linear regression models and multiple regression models were derived for estimation of stature from the measurements of the foot. The present study indicates that anthropometric measurements of foot and its segments are valuable in the estimation of stature. Foot length measurements estimate stature with greater accuracy when compared to foot breadth measurements. Conclusions The present study concluded that foot measurements have a strong relationship with stature in the sub-adult female population of North India. Hence, the stature of an individual can be successfully estimated from the foot and its segments using different regression models derived in the study. The regression models derived in the study may be applied successfully for the

  11. Den site activity patterns of adult male and female swift foxes, Vulpes velox, in Northwestern Texas

    USGS Publications Warehouse

    Lemons, P.R.; Ballard, W.B.; Sullivan, R.M.; Sovada, M.A.


    Activity of Swift Foxes (Vulpes velox) at den sites was studied in northwestern Texas during pup rearing seasons in 2000 and 2001 to determine role of males in parental care. Twenty-four percent of radio-collared females with a potential to breed successfully raised pups to eight weeks of age. We intensively monitored presence and absence of male and female Swift Foxes at two den sites each year. Females were present >2.6 times more at den sites than males during the pup rearing season. Female and male Swift Foxes largely stayed at dens during diurnal hours and were active away from dens during nocturnal and crepuscular hours. Females and males spent 12.4% and 3.0% more time at dens before pups emerged, than after pups emerged, respectively. Following depredation of one male parent, the female spent 29% less time at the den site. Decrease in time spent at the den by the female following loss of her mate suggested that loss of one parent might severely impact recruitment of Swift Foxes. Our observations indicated that intense Coyote (Canis latrans) depredation may severely impact pup-rearing success as well as the parental care within Swift Fox family groups.

  12. Adult Female Victims of Child Sexual Abuse: Multitype Maltreatment and Disclosure Characteristics Related to Subjective Health

    ERIC Educational Resources Information Center

    Jonzon, Eva; Lindblad, Frank


    This study examined the impact of child sexual abuse and disclosure characteristics on adult psychological and psychosomatic symptoms. Data on abuse characteristics, disclosure-related events, and subjective health were collected through semistructured interviews and questionnaires from 123 adult women reporting having been sexually abused in…

  13. Recruitment and Retention of Older Adolescent and Young Adult Female Survivors of Childhood Cancer in Longitudinal Research

    PubMed Central

    Cantrell, Mary Ann; Conte, Teresa; Hudson, Melissa; Shad, Aziza; Ruble, Kathy; Herth, Kaye; Canino, Alyssa; Kemmy, Sinead


    Purpose/Objectives To describe the challenges encountered in the recruitment and retention of a sample of older adolescent and young adult female survivors of childhood cancer for a longitudinal study testing a targeted psychosocial intervention aimed at enhancing hope. Data Sources Published literature on constructing longitudinal intervention studies and strategies in the recruitment and retention of childhood cancer survivors in research was used to develop the protocol of this study. Data Synthesis Using empirical literature to construct the study’s design resulted in achieving certain goals for the design, but not in the recruitment and retention of study participants. Using online technology to deliver the intervention and collect data was efficient and effective. Traditional approaches to recruitment and retention of those survivors, however, were not effective. Use of more novel approaches to enroll study participants demonstrated only modest success. Conclusions Additional research is needed on strategies to successfully recruit and retain older adolescents and young adult female survivors of childhood cancer in longitudinal intervention studies. Implications for Nursing The improvement in the psychological well-being of female survivors of childhood cancer remains an important outcome in ongoing care. The need to continue to identify creative and effective ways to recruit and retain those survivors is warranted. PMID:22940512

  14. Larval host plant origin modifies the adult oviposition preference of the female European grapevine moth Lobesia botrana

    NASA Astrophysics Data System (ADS)

    Moreau, J.; Rahme, J.; Benrey, B.; Thiery, D.


    According to the ‘natal habitat preference induction’ (NHPI) hypothesis, phytophagous insect females should prefer to lay their eggs on the host species on which they developed as larvae. We tested whether this hypothesis applies to the breeding behaviour of polyphagous European grapevine moth, Lobesia botrana, an important pest in European vineyards. We previously found that different grape cultivars affect several life history traits of the moth. Because the different cultivars of grapes are suspected to provide different plant quality, we tested the NHPI hypothesis by examining oviposition choice of L. botrana among three Vitis vinifera cultivars (Pinot, Chasselas and Chardonnay). In a choice situation, females of L. botrana that had never experienced grapes were able to discriminate between different grape cultivars and preferentially selected Pinot as an oviposition substrate. This ‘naive’ preference of oviposition could be modified by larval environment: Females raised on grapes as larvae preferred to lay eggs on the cultivar that they had experienced. Furthermore, experience of the host plant during adult emergence could be excluded because when pupae originating from our synthetic diet were exposed to grapes, the emerging adults did not show preference for the cultivar from which they emerged. The NHPI hypothesis that includes the two sub-hypothesis “Hopkins host selection principle” and “chemical legacy” may thus be relevant in this system.

  15. A Diversified Recruitment Approach Incorporating Social Media Leads to Research Participation Among Young Adult-Aged Female Cancer Survivors.


    Gorman, Jessica R; Roberts, Samantha C; Dominick, Sally A; Malcarne, Vanessa L; Dietz, Andrew C; Su, H Irene


    Purpose: Cancer survivors in their adolescent and young adult (AYA) years are an understudied population, possibly in part because of the high effort required to recruit them into research studies. The aim of this paper is to describe the specific recruitment strategies used in four studies recruiting AYA-aged female cancer survivors and to identify the highest yielding approaches. We also discuss challenges and recommendations. Methods: We recruited AYA-aged female cancer survivors for two studies conducted locally and two conducted nationally. Recruitment strategies included outreach and referral via: healthcare providers and clinics; social media and the internet; community and word of mouth; and a national fertility information hotline. We calculated the yield of each recruitment approach for the local and national studies by comparing the number that participated to the number of potential participants. Results: We recruited a total of 534 participants into four research studies. Seventy-one percent were diagnosed as young adults and 61% were within 3 years of their cancer diagnosis. The highest-yielding local recruitment strategy was healthcare provider and clinic referral. Nationally, social media and internet outreach yielded the highest rate of participation. Overall, internet-based recruitment resulted in the highest number and yield of participants. Conclusion: Our results suggest that outreach through social media and the internet are effective approaches to recruiting AYA-aged female cancer survivors. Forging collaborative relationships with survivor advocacy groups' members and healthcare providers also proved beneficial. PMID:24940529

  16. An Action Research Project to Assist Incarcerated Females to Become More Effective Adult Learners.

    ERIC Educational Resources Information Center

    Askins, Billy E.; Young, Teresa


    Learning style preferences and brain hemispheric dominance were determined for 82 low achieving female inmates. They were counseled to use their modality strengths and take responsibility for learning. Higher test scores, reduced absenteeism, and greater achievement motivation resulted. (SK)

  17. Investigating Potential Effects of the Contraceptive Implanon on the Behavior of Free-Ranging Adult Female Barbary Macaques.


    Maijer, Amanda M; Semple, Stuart


    In recent years, the use of hormonal contraception in captive, free-ranging, and wild mammal populations has increased, but the effects on these nonhuman animals' behavior and the associated welfare impacts remain poorly understood. This study of free-ranging adult female Barbary macaques (Macaca sylvanus) at Trentham Monkey Forest compared females implanted with the progestin-only contraceptive Implanon to those not receiving contraception. Females with contraceptive implants had higher rates of self-scratching and spent more time self-grooming (2 behavioral indexes of anxiety) than those without implants. They also directed more aggression at others, spent more time receiving grooming and traveling, and spent less time giving grooming and resting. No significant differences between the 2 groups of females were seen for time spent foraging. These results suggest that Implanon had a number of effects on Barbary macaques, although these need to be considered in light of the significant benefits afforded by the use of this contraceptive. The findings of this study provide important information to those evaluating the relative welfare costs and benefits of alternative methods of population control in this and other species. PMID:26466916

  18. Adolescent chronic stress causes hypothalamo-pituitary-adrenocortical hypo-responsiveness and depression-like behavior in adult female rats.


    Wulsin, Aynara C; Wick-Carlson, Dayna; Packard, Benjamin A; Morano, Rachel; Herman, James P


    Adolescence is a period of substantial neuroplasticity in stress regulatory neurocircuits. Chronic stress exposure during this period leads to long-lasting changes in neuroendocrine function and emotional behaviors, suggesting adolescence may be a critical period for development of stress vulnerability. This study investigated the effects of exposure to 14 days of chronic variable stress (CVS) in late-adolescent (pnd 45-58) female rats on neuroendocrine function, neuropeptide mRNA expression and depressive-like behavior in adolescence (pnd 59) and in adulthood (pnd 101). Adult females exposed to CVS in adolescence have a blunted hypothalamo-pituitary-adrenocortical (HPA) axis in response to a novel stressor and increased immobility in the forced swim test. Blunted HPA axis responses were accompanied by reduced vasopressin mRNA expression in the paraventricular nucleus of the hypothalamus (PVN), suggesting decreased central drive. Adolescent females tested immediately after CVS did not exhibit differences in stress reactivity or immobility in the forced swim test, despite evidence for enhanced central HPA axis drive (increased CRH mRNA expression in PVN). Overall, our study demonstrates that exposure to chronic stress in adolescence is sufficient to induce lasting changes in neuroendocrine drive and behavior, potentially altering the developmental trajectory of stress circuits as female rats age into adulthood. PMID:26751968

  19. Adolescent chronic stress causes hypothalamo-pituitary-adrenocortical hypo-responsiveness and depression-like behavior in adult female rats

    PubMed Central

    Wulsin, Aynara C.; Wick-Carlson, Dayna; Packard, Benjamin A.; Morano, Rachel; Herman, James P.


    Adolescence is a period of substantial neuroplasticity in stress regulatory neurocircuits. Chronic stress exposure during this period leads to long-lasting changes in neuroendocrine function and emotional behaviors, suggesting adolescence may be a critical period for development of stress vulnerability. This study investigated the effects of exposure to 14 days of chronic variable stress (CVS) in late-adolescent (pnd 45–58) female rats on neuroendocrine function, neuropeptide mRNA expression and depressive-like behavior in adolescence (pnd 59) and in adulthood (pnd 101). Adult females exposed to CVS in adolescence have a blunted hypothalamo-pituitary-adrenocortical (HPA) axis in response to a novel stressor and increased immobility in the forced swim test. Blunted HPA axis responses were accompanied by reduced vasopressin mRNA expression in the paraventricular nucleus of the hypothalamus (PVN), suggesting decreased central drive. Adolescent females tested immediately after CVS did not exhibit differences in stress reactivity or immobility in the forced swim test, despite evidence for enhanced central HPA axis drive (increased CRH mRNA expression in PVN). Overall, our study demonstrates that exposure to chronic stress in adolescence is sufficient to induce lasting changes in neuroendocrine drive and behavior, potentially altering the developmental trajectory of stress circuits as female rats age into adulthood. PMID:26751968

  20. The effects of adult sex ratio on mating competition in male and female guppies (Poecilia reticulata) in two wild populations.


    Chuard, Pierre J C; Brown, Grant E; Grant, James W A


    When competing for mates, males typically exhibit higher rates of intrasexual aggression and courtship than females. Operational sex ratio, represented here by adult sex ratio (ASR) as a proxy, is likely the best predictor of this competition, which typically increases between members of one sex as members of the opposite sex become rarer. Moreover, in populations subject to high predation, males often decrease mating competitive behaviour due to predation risk. We explored the combined effects of ASR and population of origin (low vs. high ambient predation risk) on mating competition in male and female wild-caught Trinidadian guppies. Both male and female aggression rates increased with ASR, but the increase for males was only significant in the low-predation population. In regard to male mating tactics, courtship propensity was unaffected by ASR, while the propensity to sneak increased at male-biased ASRs. Guppies from a high predation population had lower aggression rates than their low predation counterpart, but male courtship and sneaking attempts did not differ between populations. Surprisingly, females were just as aggressive as males when competing for mates. These results highlight the trade-offs between antipredator and agonistic behaviour, which may affect sexual selection pressures in wild populations. PMID:27208810

  1. Tradition over trend: Neighboring chimpanzee communities maintain differences in cultural behavior despite frequent immigration of adult females.


    Luncz, Lydia V; Boesch, Christophe


    The notion of animal culture has been well established mainly through research aiming at uncovering differences between populations. In chimpanzees (Pan troglodytes verus), cultural diversity has even been found in neighboring communities, where differences were observed despite frequent immigration of individuals. Female chimpanzees transfer at the onset of sexual maturity at an age, when the behavioral repertoire is fully formed. With immigrating females, behavioral variety enters the group. Little is known about the diversity and the longevity of cultural traits within a community. This study is building on previous findings of differences in hammer selection when nut cracking between neighboring communities despite similar ecological conditions. We now further investigated the diversity and maintenance of cultural traits within one chimpanzee community and were able to show high levels of uniformity in group-specific behavior. Fidelity to the behavior pattern did not vary between dispersing females and philopatric males. Furthermore, group-specific tool selection remained similar over a period of 25 years. Additionally, we present a study case on how one newly immigrant female progressively behaved more similar to her new group, suggesting that the high level of similarity in behavior is actively adopted by group members possibly even when originally expressing the behavior in another form. Taken together, our data support a cultural transmission process in adult chimpanzees, which leads to persisting cultural behavior of one community over time. PMID:24482055

  2. Sex and age differences in hibernation patterns of common hamsters: adult females hibernate for shorter periods than males.


    Siutz, Carina; Franceschini, Claudia; Millesi, Eva


    In this study, we investigated the timing and duration of hibernation as well as body temperature patterns in free-ranging common hamsters (Cricetus cricetus) with regard to sex and age differences. Body temperature was recorded using subcutaneously implanted data loggers. The results demonstrate that although immergence and vernal emergence sequences of sex and age groups resembled those of most hibernators, particularly adult females delayed hibernation onset until up to early January. Thus, in contrast to other hibernators, female common hamsters hibernated for shorter periods than males and correspondingly spent less time in torpor. These sex differences were absent in juvenile hamsters. The period between the termination of hibernation and vernal emergence varied among individuals but did not differ between the sex and age groups. This period of preemergence euthermy was related to emergence body mass: individuals that terminated hibernation earlier in spring and had longer euthermic phases prior to emergence started the active season in a better condition. In addition, males with longer periods of preemergence euthermy had larger testes at emergence. In conclusion, females have to rely on sufficient food stores but may adjust the use of torpor in relation to the available external energy reserves, whereas males show a more pronounced energy-saving strategy by hibernating for longer periods. Nonetheless, food caches seem to be important for both males and females as indicated by the euthermic preemergence phase and the fact that some individuals, mainly yearlings, emerged with a higher body mass than shortly before immergence in autumn. PMID:27138337

  3. Species differences in behavior and cell proliferation/survival in the adult brains of female meadow and prairie voles.


    Pan, Y; Liu, Y; Lieberwirth, C; Zhang, Z; Wang, Z


    Microtine rodents display diverse patterns of social organization and behaviors, and thus provide a useful model for studying the effects of the social environment on physiology and behavior. The current study compared the species differences and the effects of oxytocin (OT) on anxiety-like, social affiliation, and social recognition behaviors in female meadow voles (Microtus pennsylvanicus) and prairie voles (Microtus ochrogaster). Furthermore, cell proliferation and survival in the brains of adult female meadow and prairie voles were compared. We found that female meadow voles displayed a higher level of anxiety-like behavior but lower levels of social affiliation and social recognition compared to female prairie voles. In addition, meadow voles showed lower levels of cell proliferation (measured by Ki67 staining) and cell survival (measured by BrdU staining) in the ventromedial hypothalamus (VMH) and amygdala (AMY), but not the dentate gyrus of the hippocampus (DG), than prairie voles. Interestingly, the numbers of new cells in the VMH and AMY, but not DG, also correlated with anxiety-like, social affiliation, and social recognition behaviors in a brain region-specific manner. Finally, central OT treatment (200 ng/kg, icv) did not lead to changes in behavior or cell proliferation/survival in the brain. Together, these data indicate a potential role of cell proliferation/survival in selected brain areas on different behaviors between vole species with distinct life strategies. PMID:26708743

  4. Locomotor activity changes in female adolescent and adult rats during repeated treatment with a cannabinoid or club drug.


    Wiley, Jenny L; Evans, Rhys L; Grainger, Darren B; Nicholson, Katherine L


    Adolescents and young adults of both sexes are the primary consumers of "club" drugs; yet, most of the mechanistic preclinical research in this area has been performed in adult male rodents. The purpose of this study was to evaluate the acute and repeated effects of drugs that are commonly abused by adolescents in female adolescent and adult rats in a rodent model of behavioral sensitization. During two five-day periods separated by a two-day break, rats were injected daily with saline or with one of the following drugs: cocaine (7 or 15 mg/kg), ketamine (3 or 10 mg/kg), 3,4-methylenedioxymethamphetamine (MDMA) (3, 10, or 30 mg/kg), or Δ(9)-tetrahydrocannabinol (THC) (0.03, 0.1, 0.3 or 1 mg/kg) and their locomotor activity was measured. Cocaine increased activity across days in both age groups. Whereas ketamine produced progressive increases in activity with repeated administration in rats of both ages, MDMA increased, and then decreased, activity in the chronic dosing regimen in female adolescents only. Tolerance to the initial stimulatory effects of low doses of THC was observed at both ages. The results with THC are similar to those obtained for male rats tested under identical conditions in a previous study; however, in contrast with the present results in females, male adolescent rats in the previous study failed to develop behavioral sensitization to ketamine. Together, these results suggest that age and sex strongly influence the progressive adaptive changes that occur with repeated administration of some, but not all, of these commonly abused substances. PMID:22180350

  5. Pup Vibrissae Stable Isotopes Reveal Geographic Differences in Adult Female Southern Sea Lion Habitat Use during Gestation

    PubMed Central

    Baylis, Alastair M. M.; Kowalski, Gabriele J.; Voigt, Christian C.; Orben, Rachael A.; Trillmich, Fritz; Staniland, Iain J.; Hoffman, Joseph I.


    Individuals within populations often differ substantially in habitat use, the ecological consequences of which can be far reaching. Stable isotope analysis provides a convenient and often cost effective means of indirectly assessing the habitat use of individuals that can yield valuable insights into the spatiotemporal distribution of foraging specialisations within a population. Here we use the stable isotope ratios of southern sea lion (Otaria flavescens) pup vibrissae at the Falkland Islands, in the South Atlantic, as a proxy for adult female habitat use during gestation. A previous study found that adult females from one breeding colony (Big Shag Island) foraged in two discrete habitats, inshore (coastal) or offshore (outer Patagonian Shelf). However, as this species breeds at over 70 sites around the Falkland Islands, it is unclear if this pattern is representative of the Falkland Islands as a whole. In order to characterize habitat use, we therefore assayed carbon (δ13C) and nitrogen (δ15N) ratios from 65 southern sea lion pup vibrissae, sampled across 19 breeding colonies at the Falkland Islands. Model-based clustering of pup isotope ratios identified three distinct clusters, representing adult females that foraged inshore, offshore, and a cluster best described as intermediate. A significant difference was found in the use of inshore and offshore habitats between West and East Falkland and between the two colonies with the largest sample sizes, both of which are located in East Falkland. However, habitat use was unrelated to the proximity of breeding colonies to the Patagonian Shelf, a region associated with enhanced biological productivity. Our study thus points towards other factors, such as local oceanography and its influence on resource distribution, playing a prominent role in inshore and offshore habitat use. PMID:27304855

  6. Pup Vibrissae Stable Isotopes Reveal Geographic Differences in Adult Female Southern Sea Lion Habitat Use during Gestation.


    Baylis, Alastair M M; Kowalski, Gabriele J; Voigt, Christian C; Orben, Rachael A; Trillmich, Fritz; Staniland, Iain J; Hoffman, Joseph I


    Individuals within populations often differ substantially in habitat use, the ecological consequences of which can be far reaching. Stable isotope analysis provides a convenient and often cost effective means of indirectly assessing the habitat use of individuals that can yield valuable insights into the spatiotemporal distribution of foraging specialisations within a population. Here we use the stable isotope ratios of southern sea lion (Otaria flavescens) pup vibrissae at the Falkland Islands, in the South Atlantic, as a proxy for adult female habitat use during gestation. A previous study found that adult females from one breeding colony (Big Shag Island) foraged in two discrete habitats, inshore (coastal) or offshore (outer Patagonian Shelf). However, as this species breeds at over 70 sites around the Falkland Islands, it is unclear if this pattern is representative of the Falkland Islands as a whole. In order to characterize habitat use, we therefore assayed carbon (δ13C) and nitrogen (δ15N) ratios from 65 southern sea lion pup vibrissae, sampled across 19 breeding colonies at the Falkland Islands. Model-based clustering of pup isotope ratios identified three distinct clusters, representing adult females that foraged inshore, offshore, and a cluster best described as intermediate. A significant difference was found in the use of inshore and offshore habitats between West and East Falkland and between the two colonies with the largest sample sizes, both of which are located in East Falkland. However, habitat use was unrelated to the proximity of breeding colonies to the Patagonian Shelf, a region associated with enhanced biological productivity. Our study thus points towards other factors, such as local oceanography and its influence on resource distribution, playing a prominent role in inshore and offshore habitat use. PMID:27304855

  7. Effect of hormonal manipulation on sociosexual behavior in adult female leopard geckos (Eublepharis macularius), a species with temperature-dependent sex determination.


    Flores, D L; Crews, D


    Aggressive and sexual behavior in the adult leopard gecko (Eublepharis macularius), a species with temperature-dependent sex determination (TSD), is influenced by the temperature experienced as an egg, as well as by prenatal and perinatal hormones. This study focused on the effects of hormonal manipulation of adult female leopard geckos from different incubation temperatures. Following ovariectomy, females from both all-female (26 degrees C) and male-biased (32.5 degrees C) incubation temperatures exhibited a significant decrease in high-posture (HP) aggression toward male and female stimulus animals. Testosterone treatment attenuated this decrease in HP aggression toward female but not toward male stimulus animals. Ovariectomy also resulted in a loss in attractiveness in both groups of females. Following treatment with testosterone, over 50% of the females were attacked by male stimulus animals, suggesting a change in the pheromonal cues normally secreted by females. Unmanipulated females never exhibit tail vibrations, a male-typical courtship behavior. However, following ovariectomy with testosterone treatment, half of the females from both incubation temperatures exhibited this behavior, indicating an activational effect of testosterone. An effect of incubation temperature on aggression was evident with females from the male-biased incubation temperature exhibiting a greater likelihood of aggression compared to females from the all-female incubation temperature. This effect continued to be detected after hormone manipulation. Ovariectomized females from the all-female incubation temperature were less aggressive even with testosterone treatment toward males, whereas females from the male-biased incubation temperature showed no significant decline in aggression following testosterone treatment, suggesting that individuals from different incubation temperatures may have different sensitivities to hormones. PMID:8748508

  8. All about FAX: a Female Adult voXel phantom for Monte Carlo calculation in radiation protection dosimetry

    NASA Astrophysics Data System (ADS)

    Kramer, R.; Khoury, H. J.; Vieira, J. W.; Loureiro, E. C. M.; Lima, V. J. M.; Lima, F. R. A.; Hoff, G.


    The International Commission on Radiological Protection (ICRP) has created a task group on dose calculations, which, among other objectives, should replace the currently used mathematical MIRD phantoms by voxel phantoms. Voxel phantoms are based on digital images recorded from scanning of real persons by computed tomography or magnetic resonance imaging (MRI). Compared to the mathematical MIRD phantoms, voxel phantoms are true to the natural representations of a human body. Connected to a radiation transport code, voxel phantoms serve as virtual humans for which equivalent dose to organs and tissues from exposure to ionizing radiation can be calculated. The principal database for the construction of the FAX (Female Adult voXel) phantom consisted of 151 CT images recorded from scanning of trunk and head of a female patient, whose body weight and height were close to the corresponding data recommended by the ICRP in Publication 89. All 22 organs and tissues at risk, except for the red bone marrow and the osteogenic cells on the endosteal surface of bone ('bone surface'), have been segmented manually with a technique recently developed at the Departamento de Energia Nuclear of the UFPE in Recife, Brazil. After segmentation the volumes of the organs and tissues have been adjusted to agree with the organ and tissue masses recommended by ICRP for the Reference Adult Female in Publication 89. Comparisons have been made with the organ and tissue masses of the mathematical EVA phantom, as well as with the corresponding data for other female voxel phantoms. The three-dimensional matrix of the segmented images has eventually been connected to the EGS4 Monte Carlo code. Effective dose conversion coefficients have been calculated for exposures to photons, and compared to data determined for the mathematical MIRD-type phantoms, as well as for other voxel phantoms.

  9. Prenatal ethanol exposure programs an increased susceptibility of non-alcoholic fatty liver disease in female adult offspring rats

    SciTech Connect

    Shen, Lang; Liu, Zhongfen; Gong, Jun; Zhang, Li; Wang, Linlong; Magdalou, Jacques; Chen, Liaobin; Wang, Hui


    Prenatal ethanol exposure (PEE) induces dyslipidemia and hyperglycemia in fetus and adult offspring. However, whether PEE increases the susceptibility to non-alcoholic fatty liver disease (NAFLD) in offspring and its underlying mechanism remain unknown. This study aimed to demonstrate an increased susceptibility to high-fat diet (HFD)-induced NAFLD and its intrauterine programming mechanisms in female rat offspring with PEE. Rat model of intrauterine growth retardation (IUGR) was established by PEE, the female fetus and adult offspring that fed normal diet (ND) or HFD were sacrificed. The results showed that, in PEE + ND group, serum corticosterone (CORT) slightly decreased and insulin-like growth factor-1 (IGF-1) and glucose increased with partial catch-up growth; In PEE + HFD group, serum CORT decreased, while serum IGF-1, glucose and triglyceride (TG) increased, with notable catch-up growth, higher metabolic status and NAFLD formation. Enhanced liver expression of the IGF-1 pathway, gluconeogenesis, and lipid synthesis as well as reduced expression of lipid output were accompanied in PEE + HFD group. In PEE fetus, serum CORT increased while IGF-1 decreased, with low body weight, hyperglycemia, and hepatocyte ultrastructural changes. Hepatic IGF-1 expression as well as lipid output was down-regulated, while lipid synthesis significantly increased. Based on these findings, we propose a “two-programming” hypothesis for an increased susceptibility to HFD-induced NAFLD in female offspring of PEE. That is, the intrauterine programming of liver glucose and lipid metabolic function is “the first programming”, and postnatal adaptive catch-up growth triggered by intrauterine programming of GC-IGF1 axis acts as “the second programming”. - Highlights: • Prenatal ethanol exposure increase the susceptibility of NAFLD in female offspring. • Prenatal ethanol exposure reprograms fetal liver’s glucose and lipid metabolism . • Prenatal ethanol exposure cause

  10. The oxytocin system promotes resilience to the effects of neonatal isolation on adult social attachment in female prairie voles.


    Barrett, C E; Arambula, S E; Young, L J


    Genes and social experiences interact to create variation in social behavior and vulnerability to develop disorders of the social domain. Socially monogamous prairie voles display remarkable diversity in neuropeptide receptor systems and social behavior. Here, we examine the interaction of early-life adversity and brain oxytocin receptor (OTR) density on adult social attachment in female prairie voles. First, pups were isolated for 3 h per day, or unmanipulated, from postnatal day 1-14. Adult subjects were tested on the partner preference (PP) test to assess social attachment and OTR density in the brain was quantified. Neonatal social isolation impaired female PP formation, without affecting OTR density. Accumbal OTR density was, however, positively correlated with the percent of time spent huddling with the partner in neonatally isolated females. Females with high accumbal OTR binding were resilient to neonatal isolation. These results are consistent with the hypothesis that parental nurturing shapes neural systems underlying social relationships by enhancing striatal OTR signaling. Thus, we next determined whether early touch, mimicking parental licking and grooming, stimulates hypothalamic OT neuron activity. Tactile stimulation induced immediate-early gene activity in OT neurons in neonates. Finally, we investigated whether pharmacologically potentiating OT release using a melanocortin 3/4 agonist, melanotan-II (10 mg kg(-1) subcutaneously), would mitigate the social isolation-induced impairments in attachment behavior. Neonatal melanotan-II administration buffered against the effects of early isolation on partner preference formation. Thus, variation in accumbal OTR density and early OT release induced by parental nurturing may moderate susceptibility to early adverse experiences, including neglect. PMID:26196439

  11. D2 antagonist during development decreases anxiety and infanticidal behavior in adult female prairie voles (Microtus ochrogaster).


    Hostetler, Caroline M; Harkey, Shanna L; Bales, Karen L


    On postnatal day 8, prairie vole pups were randomly assigned a treatment of 1mg/kg SKF38393 (D1 agonist), quinpirole (D2 agonist), SCH23390 (D1 antagonist), eticlopride (D2 antagonist), or saline vehicle. As adults, females treated with eticlopride exhibited reduced anxiety-like behavior in an elevated plus maze and a reduction in infanticidal behavior. These behavioral effects were not seen in males. These data demonstrate that a single exposure to a D2 antagonist during development can have persistent, sex-specific effects on behavior into adulthood. PMID:20152865

  12. The Long-Term Effects of Childhood Bullying Experiences on Female Adults as It Relates to Their Perception of Themselves and Their Relationships with Women

    ERIC Educational Resources Information Center

    Barcalow, Julia M.


    Childhood bullying is a phenomenon that affects many individuals well beyond their childhood. This study looked specifically at female adults, and how the bullying they experienced in their childhood continues to have long-term effects on them in their adult lives. The purpose of this study was to explore the long-term effects that bullying has on…

  13. A Case Study on the Impacts of Connective Technology on Self-Efficacy and Self-Regulated Learning of Female Adult Students Managing Work-Life Balance

    ERIC Educational Resources Information Center

    Sheetz, Tracey L.


    Adults frequently define their lives as "hectic" and "overextended;" yet, many make the decision to return to school and add the role of student into their busy lives. This research study explored and explained the impact of connective technology on self-efficacy and self-regulated learning of female adult students balancing…

  14. Social experience affects neuronal responses to male calls in adult female zebra finches.


    Menardy, F; Touiki, K; Dutrieux, G; Bozon, B; Vignal, C; Mathevon, N; Del Negro, C


    Plasticity studies have consistently shown that behavioural relevance can change the neural representation of sounds in the auditory system, but what occurs in the context of natural acoustic communication where significance could be acquired through social interaction remains to be explored. The zebra finch, a highly social songbird species that forms lifelong pair bonds and uses a vocalization, the distance call, to identify its mate, offers an opportunity to address this issue. Here, we recorded spiking activity in females while presenting distance calls that differed in their degree of familiarity: calls produced by the mate, by a familiar male, or by an unfamiliar male. We focused on the caudomedial nidopallium (NCM), a secondary auditory forebrain region. Both the mate's call and the familiar call evoked responses that differed in magnitude from responses to the unfamiliar call. This distinction between responses was seen both in single unit recordings from anesthetized females and in multiunit recordings from awake freely moving females. In contrast, control females that had not heard them previously displayed responses of similar magnitudes to all three calls. In addition, more cells showed highly selective responses in mated than in control females, suggesting that experience-dependent plasticity in call-evoked responses resulted in enhanced discrimination of auditory stimuli. Our results as a whole demonstrate major changes in the representation of natural vocalizations in the NCM within the context of individual recognition. The functional properties of NCM neurons may thus change continuously to adapt to the social environment. PMID:22512260

  15. A Sex-Linked Gene Controlling the Onset of Sexual Maturity in Female and Male Platyfish (XIPHOPHORUS MACULATUS), Fecundity in Females and Adult Size in Males

    PubMed Central

    Kallman, Klaus D.; Borkoski, Valerie


    A sex-linked gene, P, controls the onset of sexual maturity in the platyfish, Xiphophorus maculatus. The activity of this gene is correlated with the age and size at which the gonadotropic zone of the adenohypophysis differentiates and becomes physiologically active. Immature fish of all genotypes grow at the same rate; however, as adults, males with "early" genotypes are significantly smaller than males of "late" genotypes, since growth rate declines strongly under the influence of androgenic hormone. Five alleles, P1... P5, have been identified from natural populations that under controlled conditions cause gonad maturation between eight and 73 weeks. P1P1 males become mature at eight weeks and 21 mm, P2P2 and P3P3 males between eleven and 13.5 weeks and 25 to 29 mm, and P4P4 males at 25 weeks and 37 mm. Since P5 is X-linked, no males homozygous for P5 could be produced. The difference between P2 and P3 is largely based upon their interaction with P5. P3P5 males mature at 17.5 weeks and 33.5 mm and P2P5 males at 28 weeks and 38 mm. The rate of transformation of the unmodified anal fin into a gonopodium, which is under androgenic control, is directly related to the age at initiation of sexual maturity, ranging from 3.2 weeks in P1P1 males to seven weeks in P2P 5 males. These differences may reflect different levels of circulating gonadotropic and androgenic hormones.—In two genotypes of females, initiation of vitellogenesis was closely correlated with size and this critical size was independent of age (e.g., 21 mm for P1P1 ). In a third genotype (P1P5) the minimum size for vitellogenesis decreased with increasing age, so that females would mature as early as eleven weeks, provided they had attained at least 29 mm, but at 25 weeks even females as small as 23 mm possessed ripe gonads. For P5P5 females, which become mature between 34 and 73 weeks of age, there is no correlation between size and initiation of vitellogenesis. In all four genotypes of females examined

  16. Differences in sperm storage and remating propensity between adult females of two morphotypes of the Anastrepha fraterculus (Diptera: Tephritidae) cryptic species complex.


    Abraham, S; Rull, J; Mendoza, M; Liendo, M C; Devescovi, F; Roriz, A K; Kovaleski, A; Segura, D F; Vera, M T


    The South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species composed of at least seven morphotypes. Some of them, such as the Peruvian and Brazilian 1 morphotypes (which include Argentinean populations), exhibit strong pre-copulatory isolation, yet it is possible to obtain heterotypic crosses when forcing copulation of adults under laboratory conditions. The cross involving Peruvian males and Argentinean females produces F1 offspring with reduced viability in terms of egg hatch. This low hatchability could be caused by a reduced amount of sperm transferred to and stored by females mated with heterotypic males, which in turn could affect their post-copulatory behaviour. To test these hypotheses, we investigated sperm transfer and female mating and remating behaviour for homotypic and heterotypic crosses between adults of two morphotypes (Brazilian 1 [Argentina] and Peruvian [Peru]) of the A. fraterculus cryptic species complex. As reported before, Argentinean males and females mated earlier in the day than the other three mating combinations. Peruvian females engaged in shorter copulation times than Argentinean females. Peruvian females tended to store smaller quantities of sperm than Argentinean females, and almost a half of the crosses involving Argentinean males and Peruvian females were unsuccessful (no sperm transfer). However, there was no evidence that the cross between Peruvian males and Argentinean females resulted in storage of a critically small amount of sperm (posing risk of sperm shortage). Argentinean females were more willing to remate than Peruvian females, irrespective of male morphotype, but latency to remating was not affected by male or female morphotype. This study shows that mating behaviour differs between some of the A. fraterculus complex morphotypes, with female but not male morphotype determining female likelihood to remate. PMID:24702958

  17. HDRK-Woman: whole-body voxel model based on high-resolution color slice images of Korean adult female cadaver

    NASA Astrophysics Data System (ADS)

    Yeom, Yeon Soo; Jeong, Jong Hwi; Kim, Chan Hyeong; Han, Min Cheol; Ham, Bo Kyoung; Cho, Kun Woo; Hwang, Sung Bae


    In a previous study, we constructed a male reference Korean phantom; HDRK-Man (High-Definition Reference Korean-Man), to represent Korean adult males for radiation protection purposes. In the present study, a female phantom; HDRK-Woman (High-Definition Reference Korean-Woman), was constructed to represent Korean adult females. High-resolution color photographic images obtained by serial sectioning of a 26 year-old Korean adult female cadaver were utilized. The body height and weight, the skeletal mass, and the dimensions of the individual organs and tissues were adjusted to the reference Korean data. The phantom was then compared with the International Commission on Radiological Protection (ICRP) female reference phantom in terms of calculated organ doses and organ-depth distributions. Additionally, the effective doses were calculated using both the HDRK-Man and HDRK-Woman phantoms, and the values were compared with those of the ICRP reference phantoms.

  18. An Exploration of Female Travellers' Experiences of Guidance Counselling in Adult Education

    ERIC Educational Resources Information Center

    Doyle, Anne; Hearne, Lucy


    The proposed changes in the further education sector, including the rationalisation of the VEC into Local Education and Training Boards (LETBs) and the closures of the Senior Traveller Training Centres (STTCs), have implications for guidance counselling provision to the Traveller community. This article discusses female Travellers' experiences of…

  19. Seroprevalence of tuberculosis in domesticated elk (Cervus canadensis) in Korea.


    Kang, Shin-Seok; Byeon, Hyeon-Seop; Ku, Bok Kyung; Kim, Sang Woo; Kim, Jiro; Woo, Jeongim; Ahn, Byeongwoo; Kim, Soojin; Monoldorova, Sezim; Park, Chan-Ho; Cho, Sang-Nae; Jeon, Bo-Young


    Tuberculosis is a contagious disease in animals, primarily cattle, although it also affects wild animals and humans. There are few data on the state of tuberculosis in domesticated elk (Cervus canadensis) in Korea. In order to investigate tuberculosis in elk, the effectiveness of an enzyme linked immunosorbent assay (ELISA) using MPB70 and MPB83 antigens was compared with the tuberculin skin test (TST), and seroprevalence was measured with this assay using serum samples collected from domesticated elk herds in Korea. The respective sensitivities of the MPB70 and MPB83 ELISAs were 51.9% (95% CI 42.0-61.6) and 49.1% (95% CI 39.3-58.9), and their specificities were 100.0% (95% CI 92.6-100.0) and 97.9% (95% CI 88.9-100.0), respectively, in comparison with the TST. The herd prevalence ranged from 50 to 80% and the mean herd seropositive rate was 67.7% (21 of 31). Of 819 serum samples, 163 (19.9%) were seropositive, and the within-region prevalence ranged from 18.5-58.0%. In conclusion, the ELISA using the MPB70 and MPB83 antigens showed moderate sensitivity and high specificity compared to TST in elk, and tuberculosis was assumed to be fairly prevalent in domesticated elk in Korea. PMID:27474000

  20. The Stimulation Effect of Auricular Magnetic Press Pellets on Older Female Adults with Sleep Disturbance Undergoing Polysomnographic Evaluation

    PubMed Central

    Lo, Chyi; Liao, Wen-Chun; Liaw, Jen-Jiuan; Hang, Liang-Wen; Lin, Jaung-Geng


    Study Objectives. To examine the stimulation effect of auricular magnetic press pellet therapy on older female adults with sleep disturbance as determined by polysomnography (PSG). Design. Randomized, single-blind, experimental-controlled, parallel-group. Setting. Community. Participants. Twenty-seven older female adults with sleep disturbance according to the Pittsburgh Sleep Quality Index (PSQI) >5 for at least 3 months were recruited. Participants were screened by both the Hospital Anxiety and Depression Scale (HADS) and the Mini-Mental State Examination (MMSE), as well as polysomnography prior to randomization. Interventions. All eligible participants were randomly allocated into the experimental or control group. Both groups were taped with magnetic press pellet on auricular points for 3 weeks. The experimental group was treated by applying pressure on the magnetic press pellets 3 times per day while no stimulation was applied on the control group. Measurements and Results. Both groups were measured by PSG and PSQI at the beginning of the study and 3 weeks after the study. Both groups showed improvements on PSQI scores compared to the baseline. One-way analysis of covariance adjusted for baseline scores showed that significant improvements of PSG-derived sleep parameters, such as sleep efficiency, were found in the experimental group. However, no significant differences between groups were observed in the proportion of sleep stages with the exception of Stage 2. Conclusions. Auricular therapy using magnetic pellets and stimulation by pressing was more effective in improving the sleep quality compared to auricular therapy without any stimulation. PMID:23573133

  1. Flight capacity of Bactrocera dorsalis (Diptera: Tephritidae) adult females based on flight mill studies and flight muscle ultrastructure.


    Chen, Min; Chen, Peng; Ye, Hui; Yuan, Ruiling; Wang, Xiaowei; Xu, Jin


    The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is considered a major economic threat in many regions worldwide. To better comprehend flight capacity of B. dorsalis and its physiological basis, a computer-monitored flight mill was used to study flight capacity of B. dorsalis adult females of various ages, and the changes of its flight muscle ultrastructures were studied by transmission electron microscopy. The flight capacity (both speed and distance) changed significantly with age of B. dorsalis female adults, peaking at about 15 d; the myofibril diameter of the flight muscle of test insects at 15-d old was the longest, up to 1.56 µm, the sarcomere length at 15-d old was the shortest, averaging at 1.37 µm, volume content of mitochondria of flight muscle at 15-d old reached the peak, it was 32.64%. This study provides the important scientific data for better revealing long-distance movement mechanism of B. dorsalis. PMID:26450591

  2. Flight Capacity of Bactrocera dorsalis (Diptera: Tephritidae) Adult Females Based on Flight Mill Studies and Flight Muscle Ultrastructure

    PubMed Central

    Chen, Peng; Yuan, Ruiling; Wang, Xiaowei; Xu, Jin


    The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is considered a major economic threat in many regions worldwide. To better comprehend flight capacity of B. dorsalis and its physiological basis, a computer-monitored flight mill was used to study flight capacity of B. dorsalis adult females of various ages, and the changes of its flight muscle ultrastructures were studied by transmission electron microscopy. The flight capacity (both speed and distance) changed significantly with age of B. dorsalis female adults, peaking at about 15 d; the myofibril diameter of the flight muscle of test insects at 15-d old was the longest, up to 1.56 µm, the sarcomere length at 15-d old was the shortest, averaging at 1.37 µm, volume content of mitochondria of flight muscle at 15-d old reached the peak, it was 32.64%. This study provides the important scientific data for better revealing long-distance movement mechanism of B. dorsalis. PMID:26450591

  3. 9 CFR 81.2 - Identification of deer, elk, and moose in interstate commerce.

    Code of Federal Regulations, 2010 CFR


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Identification of deer, elk, and moose in interstate commerce. 81.2 Section 81.2 Animals and Animal Products ANIMAL AND PLANT HEALTH... ANIMAL PRODUCTS CHRONIC WASTING DISEASE IN DEER, ELK, AND MOOSE § 81.2 Identification of deer, elk,...

  4. ELK3 Suppresses Angiogenesis by Inhibiting the Transcriptional Activity of ETS-1 on MT1-MMP

    PubMed Central

    Heo, Sun-Hee; Cho, Je-Yoel


    Ets transcription factors play important roles in vasculogenesis and angiogenesis. Knockout of the Ets gene family members in mice resulted in disrupted angiogenesis and malformed vascular systems. In this study, the role and mechanism of ELK3, an Ets factor, in angiogenesis was investigated using ELK3-specific siRNA in human vascular endothelial cells (HUVECs) and in vivo implantation assay. The suppression of ELK3 expression resulted in the reinforcement of VEGF-induced tube formation in HUVECs. The in vivo Matrigel plug assay also showed that ELK3 knockdown resulted in increased angiogenesis. Luciferase activity of the MT1-MMP promoter induced by ETS-1 factor was attenuated ELK3 co-transfection. CHIP assay showed the binding of ELK3 on the MT1-MMP promoter. MT1-MMP knockdown in the ELK3 knockdowned cells resulted in the decrease of tube formation suggesting that MT1-MMP transcriptional repression is required for ELK3-mediated anti-angiogenesis effect. Our data also showed that the suppressive effect of ELK3 on the angiogenesis was partly due to the inhibitory effect of ELK3 to the ETS-1 transcriptional activity on the MT1-MMP promoter rather than direct suppression of ELK3 on the target gene, since the expression level of co-repressor Sin3A is low in endothelial cells. Our results suggest that ELK3 plays a negative role of VEGF-induced angiogenesis through indirectly inhibiting ETS-1 function. PMID:24719561

  5. ELK3 suppresses angiogenesis by inhibiting the transcriptional activity of ETS-1 on MT1-MMP.


    Heo, Sun-Hee; Cho, Je-Yoel


    Ets transcription factors play important roles in vasculogenesis and angiogenesis. Knockout of the Ets gene family members in mice resulted in disrupted angiogenesis and malformed vascular systems. In this study, the role and mechanism of ELK3, an Ets factor, in angiogenesis was investigated using ELK3-specific siRNA in human vascular endothelial cells (HUVECs) and in vivo implantation assay. The suppression of ELK3 expression resulted in the reinforcement of VEGF-induced tube formation in HUVECs. The in vivo Matrigel plug assay also showed that ELK3 knockdown resulted in increased angiogenesis. Luciferase activity of the MT1-MMP promoter induced by ETS-1 factor was attenuated ELK3 co-transfection. CHIP assay showed the binding of ELK3 on the MT1-MMP promoter. MT1-MMP knockdown in the ELK3 knockdowned cells resulted in the decrease of tube formation suggesting that MT1-MMP transcriptional repression is required for ELK3-mediated anti-angiogenesis effect. Our data also showed that the suppressive effect of ELK3 on the angiogenesis was partly due to the inhibitory effect of ELK3 to the ETS-1 transcriptional activity on the MT1-MMP promoter rather than direct suppression of ELK3 on the target gene, since the expression level of co-repressor Sin3A is low in endothelial cells. Our results suggest that ELK3 plays a negative role of VEGF-induced angiogenesis through indirectly inhibiting ETS-1 function. PMID:24719561

  6. 33 CFR 110.71 - Jacobs Nose Cove, Elk River, Md.

    Code of Federal Regulations, 2010 CFR


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Jacobs Nose Cove, Elk River, Md... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.71 Jacobs Nose Cove, Elk River, Md. The water area of Jacobs Nose Cove, on the west side of the mouth of Elk River, Maryland, comprising the...

  7. 33 CFR 110.71 - Jacobs Nose Cove, Elk River, Md.

    Code of Federal Regulations, 2013 CFR


    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Jacobs Nose Cove, Elk River, Md... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.71 Jacobs Nose Cove, Elk River, Md. The water area of Jacobs Nose Cove, on the west side of the mouth of Elk River, Maryland, comprising the...

  8. 33 CFR 110.71 - Jacobs Nose Cove, Elk River, Md.

    Code of Federal Regulations, 2012 CFR


    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Jacobs Nose Cove, Elk River, Md... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.71 Jacobs Nose Cove, Elk River, Md. The water area of Jacobs Nose Cove, on the west side of the mouth of Elk River, Maryland, comprising the...

  9. 33 CFR 110.71 - Jacobs Nose Cove, Elk River, Md.

    Code of Federal Regulations, 2011 CFR


    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Jacobs Nose Cove, Elk River, Md... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.71 Jacobs Nose Cove, Elk River, Md. The water area of Jacobs Nose Cove, on the west side of the mouth of Elk River, Maryland, comprising the...

  10. 33 CFR 110.71 - Jacobs Nose Cove, Elk River, Md.

    Code of Federal Regulations, 2014 CFR


    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Jacobs Nose Cove, Elk River, Md... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.71 Jacobs Nose Cove, Elk River, Md. The water area of Jacobs Nose Cove, on the west side of the mouth of Elk River, Maryland, comprising the...

  11. 9 CFR 81.2 - Identification of deer, elk, and moose in interstate commerce.

    Code of Federal Regulations, 2011 CFR


    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Identification of deer, elk, and moose in interstate commerce. 81.2 Section 81.2 Animals and Animal Products ANIMAL AND PLANT HEALTH... ANIMAL PRODUCTS CHRONIC WASTING DISEASE IN DEER, ELK, AND MOOSE § 81.2 Identification of deer, elk,...

  12. Schistosoma mansoni Egg, Adult Male and Female Comparative Gene Expression Analysis and Identification of Novel Genes by RNA-Seq

    PubMed Central

    Anderson, Letícia; Amaral, Murilo S.; Beckedorff, Felipe; Silva, Lucas F.; Dazzani, Bianca; Oliveira, Katia C.; Almeida, Giulliana T.; Gomes, Monete R.; Pires, David S.; Setubal, João C.; DeMarco, Ricardo; Verjovski-Almeida, Sergio


    Background Schistosomiasis is one of the most prevalent parasitic diseases worldwide and is a public health problem. Schistosoma mansoni is the most widespread species responsible for schistosomiasis in the Americas, Middle East and Africa. Adult female worms (mated to males) release eggs in the hepatic portal vasculature and are the principal cause of morbidity. Comparative separate transcriptomes of female and male adult worms were previously assessed with using microarrays and Serial Analysis of Gene Expression (SAGE), thus limiting the possibility of finding novel genes. Moreover, the egg transcriptome was analyzed only once with limited bacterially cloned cDNA libraries. Methodology/Principal findings To compare the gene expression of S. mansoni eggs, females, and males, we performed RNA-Seq on these three parasite forms using 454/Roche technology and reconstructed the transcriptome using Trinity de novo assembly. The resulting contigs were mapped to the genome and were cross-referenced with predicted Smp genes and H3K4me3 ChIP-Seq public data. For the first time, we obtained separate, unbiased gene expression profiles for S. mansoni eggs and female and male adult worms, identifying enriched biological processes and specific enriched functions for each of the three parasite forms. Transcripts with no match to predicted genes were analyzed for their protein-coding potential and the presence of an encoded conserved protein domain. A set of 232 novel protein-coding genes with putative functions related to reproduction, metabolism, and cell biogenesis was detected, which contributes to the understanding of parasite biology. Conclusions/Significance Large-scale RNA-Seq analysis using de novo assembly associated with genome-wide information for histone marks in the vicinity of gene models constitutes a new approach to transcriptome analysis that has not yet been explored in schistosomes. Importantly, all data have been consolidated into a UCSC Genome Browser search

  13. Early Fasting Is Long Lasting: Differences in Early Nutritional Conditions Reappear under Stressful Conditions in Adult Female Zebra Finches

    PubMed Central

    Krause, E. Tobias; Honarmand, Mariam; Wetzel, Jennifer; Naguib, Marc


    Conditions experienced during early life can have profound effects on individual development and condition in adulthood. Differences in nutritional provisioning in birds during the first month of life can lead to differences in growth, reproductive success and survival. Yet, under natural conditions shorter periods of nutritional stress will be more prevalent. Individuals may respond differently, depending on the period of development during which nutritional stress was experienced. Such differences may surface specifically when poor environmental conditions challenge individuals again as adults. Here, we investigated long term consequences of differences in nutritional conditions experienced during different periods of early development by female zebra finches (Taeniopygia guttata) on measures of management and acquisition of body reserves. As nestlings or fledglings, subjects were raised under different nutritional conditions, a low or high quality diet. After subjects reached sexual maturity, we measured their sensitivity to periods of food restriction, their exploration and foraging behaviour as well as adult resting metabolic rate (RMR). During a short period of food restriction, subjects from the poor nutritional conditions had a higher body mass loss than those raised under qualitatively superior nutritional conditions. Moreover, subjects that were raised under poor nutritional conditions were faster to engage in exploratory and foraging behaviour. But RMR did not differ among treatments. These results reveal that early nutritional conditions affect adult exploratory behaviour, a representative personality trait, foraging and adult's physiological condition. As early nutritional conditions are reflected in adult phenotypic plasticity specifically when stressful situations reappear, the results suggest that costs for poor developmental conditions are paid when environmental conditions deteriorate. PMID:19325706

  14. Acute exposure to gas-supersaturated water does not affect reproductive success of female adult chinook salmon late in maturation

    USGS Publications Warehouse

    Gale, William L.; Maule, A.G.; Postera, A.; Peters, M.H.


    At times, total dissolved gas concentrations in the Columbia and Snake rivers have been elevated due to involuntary spill from high spring runoff and voluntary spill used as a method to pass juvenile salmonids over dams. The goal of this project was to determine if acute exposure to total dissolved gas supersaturation (TDGS) affects the reproductive performance of female chinook salmon late in their maturation. During this study, adult female spring chinook salmon were exposed to mean TDGS levels of 114.1 % to 125.5%. We ended exposures at first mortality, or at the appearance of impending death. Based on this criterion, exposures lasted from 10 to 68 h and were inversely related to TDGS. There was no effect of TDGS on pre-spawning mortality or fecundity when comparing treatment fish to experimental controls or the general hatchery population four to six weeks after exposures. Egg quality, based on egg weight and egg diameter, did not differ between treatment and control fish. Fertilization rate and survival to eyed-stage was high (>94%) for all groups. With the exception of Renibacterium salmoninarum (the causative agent of bacterial kidney disease; BKD), no viral or bacterial fish pathogens were isolated from experimental fish. The prevalence (about 45%) and severity of R. salmoninarum did not differ among the groups or the general hatchery population. We conclude that these acute exposures to moderate levels of gas-supersaturated water-perhaps similar to that experienced by immigrating adult salmon as they approach and pass a hydropower dam on the Columbia River-did not affect reproductive success of female chinook salmon late in their maturation. These results are most applicable to summer and fall chinook salmon, which migrate in the summer/fall and spawn shortly after reaching their natal streams. Published in 2004 by John Wiley and Sons, Ltd.

  15. Prenatal ethanol exposure programs an increased susceptibility of non-alcoholic fatty liver disease in female adult offspring rats.


    Shen, Lang; Liu, Zhongfen; Gong, Jun; Zhang, Li; Wang, Linlong; Magdalou, Jacques; Chen, Liaobin; Wang, Hui


    Prenatal ethanol exposure (PEE) induces dyslipidemia and hyperglycemia in fetus and adult offspring. However, whether PEE increases the susceptibility to non-alcoholic fatty liver disease (NAFLD) in offspring and its underlying mechanism remain unknown. This study aimed to demonstrate an increased susceptibility to high-fat diet (HFD)-induced NAFLD and its intrauterine programming mechanisms in female rat offspring with PEE. Rat model of intrauterine growth retardation (IUGR) was established by PEE, the female fetus and adult offspring that fed normal diet (ND) or HFD were sacrificed. The results showed that, in PEE+ND group, serum corticosterone (CORT) slightly decreased and insulin-like growth factor-1 (IGF-1) and glucose increased with partial catch-up growth; In PEE+HFD group, serum CORT decreased, while serum IGF-1, glucose and triglyceride (TG) increased, with notable catch-up growth, higher metabolic status and NAFLD formation. Enhanced liver expression of the IGF-1 pathway, gluconeogenesis, and lipid synthesis as well as reduced expression of lipid output were accompanied in PEE+HFD group. In PEE fetus, serum CORT increased while IGF-1 decreased, with low body weight, hyperglycemia, and hepatocyte ultrastructural changes. Hepatic IGF-1 expression as well as lipid output was down-regulated, while lipid synthesis significantly increased. Based on these findings, we propose a "two-programming" hypothesis for an increased susceptibility to HFD-induced NAFLD in female offspring of PEE. That is, the intrauterine programming of liver glucose and lipid metabolic function is "the first programming", and postnatal adaptive catch-up growth triggered by intrauterine programming of GC-IGF1 axis acts as "the second programming". PMID:24275070

  16. Estradiol and GPER Activation Differentially Affect Cell Proliferation but Not GPER Expression in the Hippocampus of Adult Female Rats

    PubMed Central

    Duarte-Guterman, Paula; Lieblich, Stephanie E.; Chow, Carmen; Galea, Liisa A. M.


    Estradiol increases cell proliferation in the dentate gyrus of the female rodent but it is not known whether the G protein-coupled estrogen receptor (GPER), a membrane receptor, is involved in this process, nor whether there are regional differences in estradiol’s effects on cell proliferation. Thus, we investigated whether estradiol exerts its effects on cell proliferation in the dorsal and ventral dentate gyrus through GPER, using the GPER agonist, G1, and antagonist, G15. Ovariectomized adult female rats received a single injection of either: 17β-estradiol (10 μg), G1 (0.1, 5, 10 μg), G15 (40 μg), G15 and estradiol, or vehicle (oil, DMSO, or oil+DMSO). After 30 min, animals received an injection of bromodeoxyuridine (BrdU) and were perfused 24 h later. Acute treatment with estradiol increased, while the GPER agonist G1 (5 μg) decreased, the number of BrdU+ cells in the dentate gyrus relative to controls. The GPER antagonist, G15 increased the number of BrdU+ cells relative to control in the dorsal region and decreased the number of BrdU+ cells in the ventral region. However, G15 treatment in conjunction with estradiol partially eliminated the estradiol-induced increase in cell proliferation in the dorsal dentate gyrus. Furthermore, G1 decreased the expression of GPER in the dentate gyrus but not the CA1 and CA3 regions of the hippocampus. In summary, we found that activation of GPER decreased cell proliferation and GPER expression in the dentate gyrus of young female rats, presenting a potential and novel estrogen-independent role for this receptor in the adult hippocampus. PMID:26075609

  17. Item Parameter Invariance of the Kaufman Adolescent and Adult Intelligence Test across Male and Female Samples

    ERIC Educational Resources Information Center

    Immekus, Jason C.; Maller, Susan J.


    The Kaufman Adolescent and Adult Intelligence Test (KAIT[TM]) is an individually administered test of intelligence for individuals ranging in age from 11 to 85+ years. The item response theory-likelihood ratio procedure, based on the two-parameter logistic model, was used to detect differential item functioning (DIF) in the KAIT across males and…

  18. Bladder augmentation in a young adult female exstrophy patient with associated omphalocele: an extremely unusual case.


    Quiroz-Guerrero, Javier; Badillo, Marco; Muñoz, Norberto; Anaya, Jorge; Rico, Gazpar; Maldonado-Valadez, Rafael


    We present the case of a 20-year-old woman with uncorrected bladder exstrophy and omphalocele treated with ileocystoplasty and continent urinary stoma. To our knowledge this is the first reported case of a young adult patient presenting with both congenital anomalies. The treatment result suggests that bladder preservation is a safe and feasible therapeutic option in bladder exstrophy. PMID:19375388

  19. Attitudes toward Maternal Employment in Male and Female Young Adults: 1990 versus 2000.

    ERIC Educational Resources Information Center

    Gorton, Laura; Nicodemus, Teresa; Pomante, Michael; Binasiewicz, Megan; Dheer, Rahul; Dugan, Amy; Madaras, Janice; Chambliss, Catherine

    The increase in maternal employment has affected society and children. Indications are that the increased numbers of working mothers had impacted the size of families and the birth intervals within them. In addition, as children experience life with a working mother, personal constructs of adult roles and attitudes towards maternal employment can…


    EPA Science Inventory

    The relationships of lung function to physical characteristics in young adults have not been adequately described for different gender-race groups in the United States. s part of a study of the effects of ozone exposure upon Black and White men and women, we measured lung volumes...

  1. Resiliency Determinants and Resiliency Processes among Female Adult Survivors of Childhood Sexual Abuse

    ERIC Educational Resources Information Center

    Bogar, Christine B.; Hulse-Killacky, Diana


    This phenomenological, qualitative study examined resiliency determinants and resiliency formation among 10 women who had been sexually abused as children. An examination of the determinants and processes that facilitated resiliency in participants' adult lives revealed 5 determinant clusters (interpersonally skilled, competent, high self-regard,…

  2. Exploring the Experiences of Female Emerging Adult Mentors: Building a Conceptual Model

    ERIC Educational Resources Information Center

    McGill, Julianne; Adler-Baeder, Francesca; Sollie, Donna L.; Kerpelman, Jennifer L.


    While mentoring programs are prevalent, limited research focused on the mentors' experiences exist, particularly during critical periods of development. Using a qualitative, grounded theory approach, this study explores the elements of the mentoring experience for a cohort of late adolescent/emerging adult women in a long-term program. Outcomes…

  3. Effects of perinatal bisphenol A exposure during early development on radial arm maze behavior in adult male and female rats

    PubMed Central

    Sadowski, Renee N.; Park, Pul; Neese, Steven L.; Ferguson, Duncan C.; Schantz, Susan L.; Juraska, Janice M.


    Previous work has shown that exposure to bisphenol A (BPA) can affect anxiety behavior. However, no studies have examined whether administration of this endocrine disruptor during the perinatal period has the potential to induce alterations in cognitive behavior in both adult males and females as assessed in an appetitive task. The goal of the current study was to determine whether exposure to different doses of BPA during early development alters performance on the 17-arm radial maze in adulthood in Long-Evans rats. Oral administration of corn oil (vehicle), 4 μg/kg, 40 μg/kg, or 400 μg/kg BPA to the dams occurred daily throughout pregnancy, and the pups received direct oral administration of BPA between postnatal days 1-9. Blood was collected from offspring at weaning age to determine levels of several hormones (thyroxine, thyroid stimulating hormone, follicle stimulating hormone, luteinizing hormone). One male and one female from each litter were evaluated on the 17-arm radial maze, a working/reference memory task, in adulthood. Results indicated that after exposure to BPA at both 4 and 400 μg/kg/day, rats of both sexes had decreased levels of FSH at weaning. There were no significant effects of BPA on performance on the radial arm maze in males or females. In conclusion, exposure to BPA during early development had modest effects on circulating hormones but did not affect a spatial learning and memory task. PMID:24440629

  4. Prenatal choline availability modulates hippocampal neurogenesis and neurogenic responses to enriching experiences in adult female rats

    PubMed Central

    Glenn, Melissa J.; Gibson, Erin M.; Kirby, Elizabeth D.; Mellott, Tiffany J.; Blusztajn, Jan K.; Williams, Christina L.


    Increased dietary intake of choline early in life improves performance of adult rats on memory tasks and prevents their age-related memory decline. Because neurogenesis in the adult hippocampus also declines with age, we investigated whether prenatal choline availability affects hippocampal neurogenesis in adult Sprague–Dawley rats and modifies their neurogenic response to environmental stimulation. On embryonic days (ED) 12−17, pregnant rats ate a choline-supplemented (SUP-5 g/kg), choline sufficient (SFF-1.1 g/kg), or choline-free (DEF) semisynthetic diet. Adult offspring either remained in standard housing or were given 21 daily visits to explore a maze. On the last ten exploration days, all rats received daily injections of 5-bromo-2-deoxyuridine (BrdU, 100 mg/kg). The number of BrdU+ cells was significantly greater in the dentate gyrus in SUP rats compared to SFF or DEF rats. While maze experience increased the number of BrdU+ cells in SFF rats to the level seen in the SUP rats, this enriching experience did not alter cell proliferation in DEF rats. Similar patterns of cell proliferation were obtained with immunohistochemical staining for neuronal marker doublecortin, confirming that diet and exploration affected hippocampal neurogenesis. Moreover, hippocampal levels of the brain-derived neurotrophic factor (BDNF) were increased in SUP rats as compared to SFF and DEF animals. We conclude that prenatal choline intake has enduring effects on adult hippocampal neurogenesis, possibly via up-regulation of BDNF levels, and suggest that these alterations of neurogenesis may contribute to the mechanism of life-long changes in cognitive function governed by the availability of choline during gestation. PMID:17445242

  5. Induction of Female-to-Male Sex Change in Adult Zebrafish by Aromatase Inhibitor Treatment

    NASA Astrophysics Data System (ADS)

    Takatsu, Kanae; Miyaoku, Kaori; Roy, Shimi Rani; Murono, Yuki; Sago, Tomohiro; Itagaki, Hideyuki; Nakamura, Masaru; Tokumoto, Toshinobu


    This study investigated whether undifferentiated germ and/or somatic stem cells remain in the differentiated ovary of a species that does not undergo sex changes under natural conditions and retain their sexual plasticity. The effect of aromatase inhibitor (AI)-treatment on sexually mature female zebrafish was examined. A 5-month AI treatment caused retraction of the ovaries after which testes-like organs appeared, and cyst structures filled with spermatozoa-like cells were observed in sections of these tissues. Electron microscopic observations revealed that these cells appeared as large sperm heads without tails. Sperm formation was re-examined after changing the diet to an AI-free food. A large number of normal sperm were obtained after eight weeks, and no formation of ovarian tissue was observed. Artificial fertilization using sperm from the sex-changed females was successful. These results demonstrated that sex plasticity remains in the mature ovaries of this species.

  6. Permanent bilateral acoustic trauma due to air bag deployment in a young female adult.


    Kastanioudakis, Ioannis; Exarchakos, Georgios; Ziavra, Nausica; Skevas, Antonios


    Air bag safety systems have significantly reduced the number of occupant injuries from road traffic accidents (RTA). However air bag deployment is also associated with unavoidable risks. We report the acoustic trauma incurred by a young female driver who was a heavy smoker as a consequence of air-bag deployment in a low speed RTA and the sparing of her child seated in the rear. PMID:12625890

  7. Personalised Prescription of Scalable High Intensity Interval Training to Inactive Female Adults of Different Ages

    PubMed Central

    Mair, Jacqueline L.


    Stepping is a convenient form of scalable high-intensity interval training (HIIT) that may lead to health benefits. However, the accurate personalised prescription of stepping is hampered by a lack of evidence on optimal stepping cadences and step heights for various populations. This study examined the acute physiological responses to stepping exercise at various heights and cadences in young (n = 14) and middle-aged (n = 14) females in order to develop an equation that facilitates prescription of stepping at targeted intensities. Participants completed a step test protocol consisting of randomised three-minute bouts at different step cadences (80, 90, 100, 110 steps·min-1) and step heights (17, 25, 30, 34 cm). Aerobic demand and heart rate values were measured throughout. Resting metabolic rate was measured in order to develop female specific metabolic equivalents (METs) for stepping. Results revealed significant differences between age groups for METs and heart rate reserve, and within-group differences for METs, heart rate, and metabolic cost, at different step heights and cadences. At a given step height and cadence, middle-aged females were required to work at an intensity on average 1.9 ± 0.26 METs greater than the younger females. A prescriptive equation was developed to assess energy cost in METs using multilevel regression analysis with factors of step height, step cadence and age. Considering recent evidence supporting accumulated bouts of HIIT exercise for health benefits, this equation, which allows HIIT to be personally prescribed to inactive and sedentary women, has potential impact as a public health exercise prescription tool. PMID:26848956

  8. Personalised Prescription of Scalable High Intensity Interval Training to Inactive Female Adults of Different Ages.


    Mair, Jacqueline L; Nevill, Alan M; De Vito, Giuseppe; Boreham, Colin A


    Stepping is a convenient form of scalable high-intensity interval training (HIIT) that may lead to health benefits. However, the accurate personalised prescription of stepping is hampered by a lack of evidence on optimal stepping cadences and step heights for various populations. This study examined the acute physiological responses to stepping exercise at various heights and cadences in young (n = 14) and middle-aged (n = 14) females in order to develop an equation that facilitates prescription of stepping at targeted intensities. Participants completed a step test protocol consisting of randomised three-minute bouts at different step cadences (80, 90, 100, 110 steps·min-1) and step heights (17, 25, 30, 34 cm). Aerobic demand and heart rate values were measured throughout. Resting metabolic rate was measured in order to develop female specific metabolic equivalents (METs) for stepping. Results revealed significant differences between age groups for METs and heart rate reserve, and within-group differences for METs, heart rate, and metabolic cost, at different step heights and cadences. At a given step height and cadence, middle-aged females were required to work at an intensity on average 1.9 ± 0.26 METs greater than the younger females. A prescriptive equation was developed to assess energy cost in METs using multilevel regression analysis with factors of step height, step cadence and age. Considering recent evidence supporting accumulated bouts of HIIT exercise for health benefits, this equation, which allows HIIT to be personally prescribed to inactive and sedentary women, has potential impact as a public health exercise prescription tool. PMID:26848956

  9. Influence of acute tryptophan depletion on verbal declarative episodic memory in young adult females.


    Helmbold, K; Bubenzer, S; Dahmen, B; Eisert, A; Gaber, T J; Habel, U; Konrad, K; Herpertz-Dahlmann, B; Zepf, F D


    Diminished synthesis of the neurotransmitter serotonin (5-HT) in the brain has been linked to disturbed memory processes. The present study investigated the effects of diminished central nervous 5-HT synthesis as achieved by an acute dietary tryptophan depletion (ATD) on verbal declarative episodic memory in young women while controlling for the effects of female sex hormones. Eighteen healthy females (aged 20-31 years) participated in a within-subject repeated measures study, with two separate days of assessment spaced at least one individual menstrual cycle apart. On one day, participants were subjected to ATD, thus lowering central nervous 5-HT synthesis. The other day participants received a tryptophan-balanced amino acid load (BAL = control condition). The study was randomized, counterbalanced and double blind in terms of ATD/BAL administration. Measurements took place in the early follicular phase of the participants' menstrual cycle. Estrogen, FSH and LH levels were assessed at baseline. Verbal declarative episodic memory was assessed using a structured word-learning task. Short-term memory, as indexed by immediate recall, was reduced after ATD intake, whereas delayed recall and recognition after a 25-min delay did not show any differences after intake of ATD or BAL. In young women, verbal short-term memory function was more vulnerable to ATD than consolidation processes. In light of the possible interplay between female sex hormones and 5-HT, further studies comparing different menstrual cycle phases are needed. PMID:24072504

  10. Ah receptor expression in cardiomyocytes protects adult female mice from heart dysfunction induced by TCDD exposure.


    Kurita, Hisaka; Carreira, Vinicius S; Fan, Yunxia; Jiang, Min; Naticchioni, Mindi; Koch, Sheryl; Rubinstein, Jack; Puga, Alvaro


    Epidemiological studies in humans and experimental work in rodents suggest that exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a persistent environmental toxicant, is associated with incidence of heart disease. Although TCDD toxicity depends by and large on the aryl hydrocarbon receptor (AHR), the role of the cardiac AHR in TCDD induced cardiovascular disease is not well defined. To determine whether the Ahr gene mediates disruption of heart function by TCDD, we generated a cardiomyocyte-specific Ahr knockout mouse by crossing Ahr(fx/fx) mice with βMhc:cre/+ mice, in which expression of Cre recombinase is driven by the promoter of the βMhc (myosin heavy chain-beta) gene. Starting at three months of age, mice with cardiomyocyte-specific Ahr ablation were exposed to 1μg/kg/week of TCDD or control vehicle by oral gavage for an additional three months. Relative to unexposed controls, TCDD-exposure induced cardiomyocyte Ahr-independent changes in males but not females, including a significant increase in body weight, blood pressure, and cardiac hypertrophy and a decrease in cardiac ejection fraction. TCDD exposure also induced cardiomyocyte Ahr-dependent changes in fibrosis and calcium signaling gene expression in both males and females. TCDD exposure appears to cause sexually dimorphic effects on heart function and induce fibrosis and changes in calcium signaling in both males and females through activation of the cardiomyocyte-specific Ahr. PMID:27163630

  11. Charcoal deposition and redeposition in Elk Lake, Minnesota, USA

    USGS Publications Warehouse

    Platt, Bradbury J.


    Sedimentary charcoal, diatom and phytolith records of the past 1500 years at Elk Lake, Minnesota, in combination with sediment trap studies and a transect of surface sediment samples, document the mechanisms by which previously deposited charcoal is redeposited and finally buried in this lake. The frequent correspondence of high diatom concentrations and peaks of phytolith and charcoal fragments suggest that currents and turbulence related to lake circulation are responsible for winnowing charcoal and phytoliths from shallow water depositional sites to deeper areas of the lake. High diatom concentrations in the record relate to increased nutrient fluxes also supplied by circulation. Despite the fact that the watershed and area around Elk Lake has not been burned since AD 1922, charcoal continues to reach the profundal zone from littoral source areas in Elk Lake. The variable redeposition of within-lake charcoal requires evaluation before fire-history records can be related to global, regional or even local fire events.

  12. Conservation and expression of PIWI-interacting RNA pathway genes in male and female adult gonad of amniotes.


    Lim, Shu Ly; Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Jacob, Reuben; Ricciardelli, Carmela; Oehler, Martin K; Grützner, Frank


    The PIWI-interacting RNA (piRNA) pathway is essential for germline development and transposable element repression. Key elements of this pathway are members of the piRNA-binding PIWI/Argonaute protein family and associated factors (e.g., VASA, MAELSTROM, and TUDOR domain proteins). PIWI-interacting RNAs have been identified in mouse testis and oocytes, but information about the expression of the different piRNA pathway genes, in particular in the mammalian ovary, remains incomplete. We investigated the evolution and expression of piRNA pathway genes in gonads of amniote species (chicken, platypus, and mouse). Database searches confirm a high level of conservation and revealed lineage-specific gain and loss of Piwi genes in vertebrates. Expression analysis in mammals shows that orthologs of Piwi-like (Piwil) genes, Mael (Maelstrom), Mvh (mouse vasa homolog), and Tdrd1 (Tudor domain-containing protein 1) are expressed in platypus adult testis. In contrast to mouse, Piwil4 is expressed in platypus and human adult testis. We found evidence for Mael and Piwil2 expression in mouse Sertoli cells. Importantly, we show mRNA expression of Piwil2, Piwil4, and Mael in oocytes and supporting cells of human, mouse, and platypus ovary. We found no Piwil1 expression in mouse and chicken ovary. The conservation of gene expression in somatic parts of the gonad and germ cells of species that diverged over 800 million yr ago indicates an important role in adult male and female gonad. PMID:24108303

  13. 9 CFR 81.5 - Movement of deer, elk, or moose through a State to another State.

    Code of Federal Regulations, 2014 CFR


    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Movement of deer, elk, or moose... ANIMAL PRODUCTS CHRONIC WASTING DISEASE IN DEER, ELK, AND MOOSE § 81.5 Movement of deer, elk, or moose through a State to another State. Farmed or captive deer, elk, or moose may be moved through a State...

  14. 9 CFR 81.5 - Movement of deer, elk, or moose through a State to another State.

    Code of Federal Regulations, 2013 CFR


    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Movement of deer, elk, or moose... ANIMAL PRODUCTS CHRONIC WASTING DISEASE IN DEER, ELK, AND MOOSE § 81.5 Movement of deer, elk, or moose through a State to another State. Farmed or captive deer, elk, or moose may be moved through a State...

  15. Changing migratory patterns in the Jackson elk herd

    USGS Publications Warehouse

    Cole, Eric K.; Foley, Aaron M.; Warren, Jeffrey M.; Smith, Bruce L.; Dewey, Sarah R.; Brimeyer, Douglas G.; Fairbanks, W. Sue; Sawyer, Hall; Cross, Paul C.


    Migratory behavior in ungulates has declined globally and understanding the causative factors (environmental change vs. human mediated) is needed to formulate effective management strategies. In the Jackson elk herd of northwest Wyoming, demographic differences between summer elk (Cervus elaphus) population segments have led to changes in migratory patterns over a 35-year time period. The proportion of short-distance migrants (SDM) has increased and the proportion of long-distance migrants (LDM) has concurrently declined. The probability of winter-captured elk on the National Elk Refuge being LDM decreased from 0.99 (95% CI = 0.97–1.00) to 0.59 (95% CI = 0.47–0.70) from 1978 to 2012. We tested 4 hypotheses that could contribute toward the decline in the LDM segment: behavioral switching from LDM to SDM, differential survival, harvest availability, and calf recruitment. Switching rates from LDM to SDM were very low (0.2% each elk-year). Survival rates were similar between LDM and SDM, although harvest availability was relatively low for SDM that tended to use areas close to human development during the hunting season. Average summer calf/cow ratios of LDM declined from 42 to 23 calves per 100 cows from 1978–1984 to 2006–2012. Further, during 2006–2012, LDM summer calf/cow ratios were less than half of SDM (23 vs. 47 calves per 100 cows). Our data suggest recruitment is the driving factor behind the declining proportion of LDM in this region. Effectiveness of altering harvest management strategies to conserve the LDM portion of the Jackson elk herd may be limited.

  16. An annotated catalogue of salivary gland transcripts in the adult female mosquito, Ædes ægypti*

    PubMed Central

    Ribeiro, José MC; Arcà, Bruno; Lombardo, Fabrizio; Calvo, Eric; Chandra, Prafulla K; Wikel, Stephen K


    Background Saliva of blood-sucking arthropods contains a cocktail of antihemostatic agents and immunomodulators that help blood feeding. Mosquitoes additionally feed on sugar meals and have specialized regions of their glands containing glycosidases and antimicrobials that might help control bacterial growth in the ingested meals. To expand our knowledge on the salivary cocktail of Ædes ægypti, a vector of dengue and yellow fevers, we analyzed a set of 4,232 expressed sequence tags from cDNA libraries of adult female mosquitoes. Results A nonredundant catalogue of 614 transcripts (573 of which are novel) is described, including 136 coding for proteins of a putative secretory nature. Additionally, a two-dimensional gel electrophoresis of salivary gland (SG) homogenates followed by tryptic digestion of selected protein bands and MS/MS analysis revealed the expression of 24 proteins. Analysis of tissue-specific transcription of a subset of these genes revealed at least 31 genes whose expression is specific or enriched in female SG, whereas 24 additional genes were expressed in female SG and in males but not in other female tissues. Most of the 55 proteins coded by these SG transcripts have no known function and represent high-priority candidates for expression and functional analysis as antihemostatic or antimicrobial agents. An unexpected finding is the occurrence of four protein families specific to SG that were probably a product of horizontal transfer from prokaryotic organisms to mosquitoes. Conclusion Overall, this paper contributes to the novel identification of 573 new transcripts, or near 3% of the Æ. ægypti proteome assuming a 20,000-protein set, and to the best-described sialome of any blood-feeding insect. PMID:17204158

  17. Title IX, girls' sports participation, and adult female physical activity and weight.


    Kaestner, Robert; Xin Xu


    Arguably, the most important school-based intervention to increase physical activity was Title IX of the Education Amendments of 1972, which led to a 600% increase in girls' sports participation between 1972 and 1978. We studied the effect of this increase in sports participation and athletic opportunities while young on the physical activity and weight of adult women some 20-25 years later. Our results indicate that adult women who were affected by Title IX and had greater opportunity to participate in athletics while young had lower body mass index (BMI) and lower rates of obesity and reported being more physically active than women who were not afforded these opportunities. However, effect sizes were quite modest. PMID:20130236

  18. Management of acne vulgaris with hormonal therapies in adult female patients.


    Husein-ElAhmed, Husein


    Acne vulgaris is a very common condition affecting up of 93% of adolescents. Although rare, this disease may persist in adulthood. In adult women with acne (those older than 25 years old), this condition is particularly relevant because of the refractory to conventional therapies, which makes acne a challenge for dermatologists in this group of patients. In order to its potential risk for chronicity and the involvement of visible anatomical sites such as face and upper torso, acne has been associated with a wide spectrum of psychological and social dysfunction such as depression, anxiety, suicidal ideation, somatization, and social inhibition. In particular, adult women with acne have been shown to be adversely impacted by the effect of acne on their quality of life. For the last four decades, dermatologists have used hormonal therapies for the management of acne vulgaris in adult women, which are considered a rational choice given the severity and chronicity of this condition in this group of patients. The aim of this work is to review the hormonal drugs for management of acne. PMID:25845307

  19. Age related changes in pelvis size among adolescent and adult females with reference to parturition from Naraingarh, Haryana (India).


    Sharma, Krishan; Gupta, Puneet; Shandilya, Shailza


    This research examines the ontogenic patterns of changes in growth during adolescence, pelvis variations and growth during twenties and thirties of age, structural remodeling of pelvis related to childbirth and relationship of pelvis area with physique based on the cross-sectional data on 391 females from the state of Haryana. Peak growth velocity for body height and breadths of skeletal traits occurred between 11 and 12 years, much before mean age of menarche at 13.5 years; while for body weight and body mass index (BMI) occurred between 14 and 15 years, after the mean age of menarche. Untill the age 11 years, 11.87% of growth in stature was remaining, 19.37% for bi-cristal breadth, 25.96% for bi-ischial breadth and 35.82% for pelvic area. The hypothesis of critical value of pelvic width of 240mm at iliocristale for menarche to occur has been only a statistical association. Higher prevalence of malnutrition during pubertal phase than pre- and post-pubertal phases was due to greater nutritional needs during puberty. Among adult females, BMI was very poorly correlated with stature but very strongly correlated with body breadths, body breadth-stature indices and body weight. The body mass and pelvis size continued to change during 20s and first half of 30s. The continued increase of BMI was due to increase in body fat and muscle mass in females 18 years and older. To tease apart age and parturition effects on pelvis variations, the analysis showed that pelvic bones remodeling took place after the first child was born and not after the subsequent births, and it was a sign of childbirth phenotypic plasticity rather than age. Pelvis area was strongly associated with stature, BMI and age. Mean pelvic area of tall females was greater than those of medium and short stature. Females with broad shoulders had significantly greater mean pelvis area than those with narrow shoulders and medium shoulders. Females having thin/lean physique had the smallest mean pelvis area

  20. Subglottal resonances of adult male and female native speakers of American English.


    Lulich, Steven M; Morton, John R; Arsikere, Harish; Sommers, Mitchell S; Leung, Gary K F; Alwan, Abeer


    This paper presents a large-scale study of subglottal resonances (SGRs) (the resonant frequencies of the tracheo-bronchial tree) and their relations to various acoustical and physiological characteristics of speakers. The paper presents data from a corpus of simultaneous microphone and accelerometer recordings of consonant-vowel-consonant (CVC) words embedded in a carrier phrase spoken by 25 male and 25 female native speakers of American English ranging in age from 18 to 24 yr. The corpus contains 17,500 utterances of 14 American English monophthongs, diphthongs, and the rhotic approximant [[inverted r

  1. Predicting eating disturbances in Turkish adult females: Examining the role of intimate partner violence and perfectionism.


    Muyan, Mine; Chang, Edward C; Jilani, Zunaira; Yu, Tina


    We examined the relationships between intimate partner violence (IPV), perfectionism, and eating disturbances, namely, excessive dieting and bulimia, in a sample of 149 Turkish female college students. Results of conducting hierarchical regression analyses indicated that IPV accounted for significant variance in both excessive dieting and bulimic symptoms. The inclusion of perfectionism was found to predict additional variance in eating disturbances, beyond IPV. Specifically, we found parental expectations to be a significant predictor of dieting, and personal standards, doubts about actions, and parental criticism to be significant predictors of bulimia. Some implications for understanding eating disturbances in Turkish women are discussed. PMID:26276707

  2. Reduction of feral cat (Felis catus Linnaeus 1758) colony size following hysterectomy of adult female cats.


    Mendes-de-Almeida, Flavya; Remy, Gabriella L; Gershony, Liza C; Rodrigues, Daniela P; Chame, Marcia; Labarthe, Norma V


    The size of urban cat colonies is limited only by the availability of food and shelter; therefore, their population growth challenges all known population control programs. To test a new population control method, a free-roaming feral cat colony at the Zoological Park in the city of Rio de Janeiro was studied, beginning in 2001. The novel method consisted of performing a hysterectomy on all captured female cats over 6 months of age. To estimate the size of the colony and compare population from year to year, a method of capture-mark-release-recapture was used. The aim was to capture as many individuals as possible, including cats of all ages and gender to estimate numbers of cats in all population categories. Results indicated that the feral cat population remained constant from 2001 to 2004. From 2004 to 2008, the hysterectomy program and population estimates were performed every other year (2006 and 2008). The population was estimated to be 40 cats in 2004, 26 in 2006, and 17 cats in 2008. Although pathogens tend to infect more individuals as the population grows older and maintains natural behavior, these results show that free-roaming feral cat colonies could have their population controlled by a biannual program that focuses on hysterectomy of sexually active female cats. PMID:21440475

  3. Prior swimming exercise favors muscle recovery in adult female rats after joint immobilization

    PubMed Central

    Petrini, Ana Claudia; Ramos, Douglas Massoni; Gomes de Oliveira, Luana; Alberto da Silva, Carlos; Pertille, Adriana


    [Purpose] To evaluate the efficacy of pre-exercise on immobilization and subsequent recovery of white gastrocnemius (WG) and soleus (SOL) muscles of female rats. [Subjects and Methods] Thirty, 8-month-old, female Wistar rats were randomly and evenly allocated to six groups: sedentary (S); immobilized sedentary (IS); immobilized/rehabilitated sedentary (IRS); trained (T); immobilized trained (IT); and immobilized/rehabilitated trained (IRT). For four months, T, IT and IRT group animals performed swimming exercise (three sessions per week, 60 minutes per session), while S, IS and IRS groups animals remained housed in cages. After this period, the left hindlimb of the animals from the IS, IRS, IT and IRT groups was immobilized for five days, with the ankle at 90°. After removal of the orthosis, animals from the IRS and IRT groups followed a rehabilitation program based on swimming (five sessions per week, 60 minutes per session) for two weeks. [Results] Immobilization significantly reduced the cross-sectional area of the white gastrocnemius muscle; no changes were observed in the soleus muscles of the trained animals. Transforming growth factor-β1 protein levels were similar among the trained groups. [Conclusion] Prior swimming prevents hypotrophy of the soleus muscle after immobilization, and protein levels reflected the adaptive capacity of the skeletal muscle. PMID:27512267

  4. Positive Body Image and Sexual Functioning in Dutch Female University Students: The Role of Adult Romantic Attachment.


    van den Brink, Femke; Smeets, Monique A M; Hessen, David J; Woertman, Liesbeth


    This study focused on links between romantic attachment, positive body image, and sexual functioning. Dutch female university students (N = 399) completed an online survey that included self-report items about body appreciation, sexual functioning, and romantic attachment. A proposed conceptual model was tested using structural equation modeling and a good fit to the data was found. Results revealed that attachment avoidance in a romantic context was negatively related to sexual arousal, vaginal lubrication, the ability to reach orgasm, and sexual satisfaction. Attachment anxiety was negatively related to body appreciation which, in turn, was positively related to sexual desire and arousal. Findings indicated that romantic attachment is meaningfully linked to body appreciation and sexual functioning. Therefore, the concept of adult attachment may be a useful tool for the treatment of sexual problems of young women. PMID:25778405

  5. Observations of a free-ranging adult female dingo (Canis dingo) and littermates' responses to the death of a pup.


    Appleby, Rob; Smith, Bradley; Jones, Darryl


    In contrast to several species of cetaceans and primates, behavioural responses to dead conspecifics have rarely been reported in wild canids. Here we provide details of the responses of an adult female and littermates to a dying and subsequently dead pup, including what appeared to be four instances of transport of the deceased pup by the mother over a two-day period, one of which was directly observed and filmed. We tentatively propose that, in the absence of any evidence of consumption of the pup, its transport by the mother could be interpreted as care-giving behaviour emanating from an enduring mother-infant bond, in a similar vein to what has been suggested for several other species exhibiting such behaviour. PMID:23500482

  6. Morphological comparison of cervical vertebrae in adult females with different sagittal craniofacial patterns: A cross-sectional study

    PubMed Central

    Alkan, Özer; Aydoğan, Cihan; Akkaya, Sevil


    Introduction: Cervical vertebral maturation (CVM) methods have gained popularity to assess growth and development status for orthodontic patients. Although craniofacial and craniocervical structures are known to be associated, there is no evidence in the literature if this relation might negatively affect the accuracy of CVM assessments. Therefore, this study aimed to comparatively investigate the sizes of the 2nd, 3rd, and 4th cervical vertebrae in adult females (radius union stage of skeletal maturity) who have different sagittal skeletal patterns. Materials and Methods: A cross-sectional study was conducted, and 151 lateral cephalometric radiographs of adult female patients were assessed in the study. Patients were assigned to three groups according to ANB angle. Parameters including concavity depth at the lower border of the 2nd, 3rd, and 4th cervical vertebrae and base length, upper border length, body length, posterior height, anterior height, and body height of the 3rd and 4th cervical vertebrae bodies were measured. One-way analysis of variance was used for between-group comparisons. Results: No statistically significant differences were found between groups in terms of concavity depth at the lower borders of the 2nd, 3rd, and 4th cervical vertebrae (P > 0.05). Base length, upper border length, body length, posterior height, anterior height, and body height of the 3rd and 4th cervical vertebrae were also similar between groups (P > 0.05). Conclusions: The results of this study supports that sagittal craniofacial pattern has no effect on the accuracy of using the methods assessing CVM and calculating cervical vertebral age.

  7. Feeding frequency, but not dietary water content, affects voluntary physical activity in young lean adult female cats.


    de Godoy, M R C; Ochi, K; de Oliveira Mateus, L F; de Justino, A C C; Swanson, K S


    The objective of this study was to investigate whether increased dietary water content and feeding frequency increased voluntary physical activity of young, lean adult female cats. A replicated 4 × 4 Latin square design with a 2 × 2 factorial treatment arrangement (feeding frequency and water content) was used. The 4 treatments consisted of 1 meal daily dry pet food without added water (1D; 12% moisture as is), 1 meal daily dry pet food with added water (1W; 70% total water content), 4 meals daily dry pet food without added water (4D; 12% moisture as is), and 4 meals daily dry pet food with added water (4W; 70% total water content). Eight healthy adult, lean, intact, young, female domestic shorthair cats were used in this experiment. Voluntary physical activity was evaluated using Actical activity monitors placed on collars and worn around the cats' necks for the last 7 d of each experimental period of 14 d. Food anticipatory activity (FAA) was calculated based on 2 h prior to feeding periods and expressed as a percentage of total daily voluntary physical activity. Increased feeding frequency (4 vs. 1 meal daily) resulted in greater average daily activity (P = 0.0147), activity during the light period (P = 0.0023), and light:dark activity ratio (P = 0.0002). In contrast, physical activity during the dark period was not altered by feeding frequency (P > 0.05). Cats fed 4 meals daily had increased afternoon FAA (P= 0.0029) compared with cats fed once daily. Dietary water content did not affect any measure of voluntary physical activity. Increased feeding frequency is an effective strategy to increase the voluntary physical activity of cats. Thus, it may assist in the prevention and management of obesity. PMID:26020354

  8. One-year assessment of physical activity level in adult Qatari females: a pedometer-based longitudinal study

    PubMed Central

    Sayegh, Suzan; Van Der Walt, Mercia; Al-Kuwari, Mohamed Ghaith


    Background Physical inactivity is a growing health concern and has been identified as the fourth leading risk factor for global mortality. The Arab region includes countries with some of the world’s highest physical inactivity levels, such as Qatar, more specifically the Qatari female population. Objective The objective of this study is to assess the physical activity levels of Qatari national female adults during a 1-year pedometer-based program. Materials and methods A total of 549 Qatari national females aged between 18 years and 64 years were included. Data extracted from “Step into Health” program web database in Qatar were used for analyses. Daily habitual physical activity (daily total step count and aerobic steps) was assessed through the Omron HJ-324U pedometer. Step counts were classified as follows: <5,000 steps/d, sedentary; 5,000–7,499 steps/d, low active; and ≥7,500 steps/d, physically active. Statistical significance was set at P-value ≤0.05. Descriptive statistics were used, and habitual physical activity was calculated through repeated measures analysis of variance to determine the difference across the monitored days. Results Mean age was 37.4±11.7 years, and median body mass index of 28.8 kg/m2 (interquartile range 24.8–33.5). Daily steps for the overall population ranged from 3,505 steps/d to 10,010 steps/d, with a median of 6,008 steps/d. A total of 242 (44.1%) females were sedentary, 178 (32.4%) were low active, and 129 (23.5%) were physically active. The physically active group showed a median of 927 aerobic steps/d (interquartile range 0–4,248). Conclusion Based on the results of this study, Qatari females are not meeting the global recommendations of physical activity. Future research might need to consider barriers to physical activity as well as social, cultural, and environmental factors. PMID:27486343

  9. Mount Rainier National Park and Olympic National Park Elk Monitoring Program Annual Report 2010

    USGS Publications Warehouse

    Griffin, Paul; Happe, Patricia J.; Jenkins, Kurt J.; Reid, Mason; Vales, David J.; Moeller, Barbara J.; Tirhi, Michelle; McCorquodale, Scott; Miller, Pat


    Fiscal year 2010 was the third year of gathering data needed for protocol development while simultaneously implementing what is expected to be the elk monitoring protocol at Mount Rainier (MORA) and Olympic (OLYM) national parks in the North Coast and Cascades Network (NCCN). Elk monitoring in these large wilderness parks relies on aerial surveys from a helicopter. Summer surveys are planned for both parks and are intended to provide quantitative estimates of abundance, sex and age composition, and distribution of migratory elk in high elevation trend count areas. Spring surveys are planned at Olympic National Park and are intended to provide quantitative estimates of abundance of resident and migratory elk on low-elevation winter ranges within surveyed trend count areas. An unknown number of elk is not detected during surveys. The protocol under development aims to estimate the number of missed elk by applying a model that accounts for detection bias. Detection bias in elk surveys in MORA will be estimated using a double-observer sightability model that was developed based on data from surveys conducted in 2008-2010. The model was developed using elk that were previously equipped with radio collars by cooperating tribes. That model is currently in peer review. At the onset of protocol development in OLYM there were no existing radio- collars on elk. Consequently double-observer sightability models have not yet been developed for elk surveys in OLYM; the majority of the effort in OLYM has been focused on capturing and radio collaring elk to permit the development of sightability models for application in OLYM. As a result, no estimates of abundance or composition are included in this annual report, only raw counts of the numbers of elk seen in surveys. At MORA each of the two trend count areas (North Rainier herd, and South Rainier herd) were surveyed twice. 290 and 380 elk were counted on the two replicates in the North Rainier herd, and 621 and 327 elk counted on

  10. Evaluation of Acne Quality of Life and Clinical Severity in Acne Female Adults

    PubMed Central

    Kokandi, Amal


    Acne is a common disease especially among teenagers. It has a considerable psychological impact on affected individuals. The aim of this paper was to assess if the effect of acne on acne-related quality of life is correlated to acne clinical severity. 112 university female students attending the university medical clinics with acne complaints were examined. Cardiff Acne Disability Index (CADI) was used to assess acne-related quality of life, and global acne grading system (GAGS) was used to assess clinical severity of acne. There was no correlation between acne severity (GAGS scoring system) and quality of life impairment as assessed by CADI score (r = 0.145, P = .127). Additionally, CADI score did not correlate with disease duration or age of patients. We therefore conclude that acne clinical severity alone does not affect acne-related quality of life changes. Many other factors might play a role. PMID:20706683

  11. Female sexual dysfunction in young adult women - Impact of age and lifestyle

    NASA Astrophysics Data System (ADS)

    Stoian, Dana; PAter, Liana; Pater, Flavius; Craciunescu, Mihaela


    Female sexual function is a difficult entity to be assessed. Subjective factors and interview biases can change the perception of it. Using validated questionnaires can improve the scientific approach to this matter. There is a huge difference of severity and incidence among young, apparent healthy women, which are in a harmonious relationship. We evaluated 320 healthy women, with stable sexual active relationship, with no know depressive disease, endocrinological and metabolic pathology, no premature menopause, no malignancy. We compose a mathematic model to study the impact of age, and body weight on the sexual function, with FSFI total score as surrogate marker. We observed that even in healthy women, increase in age and/or weight/body mass significantly impair general sexual function.

  12. Factors Associated with Pregnancy Attempts among Female Young Adult Cancer Survivors

    PubMed Central

    Dominick, Sally A.; Whitcomb, Brian W.; Gorman, Jessica R.; Mersereau, Jennifer E.; Chung, Karine; Su, H. Irene


    Structured Abstract Purpose Little is known about pregnancy attempts among female young cancer survivors (YCS). We sought to determine fertility preservation (FP), demographic, cancer and reproductive characteristics associated with pregnancy attempts after cancer. Methods We recruited 251 female YCS (ages 18-44) to complete a survey on reproductive health outcomes. We used log-binomial regression models to estimate relative risks (RR) for characteristics associated with pregnancy attempts. Results For the entire cohort, median time since cancer diagnosis was 2.4 years (interquartile range 4.0). Fifty-two YCS (21%) attempted pregnancy after cancer diagnosis. In unadjusted analyses, lack of FP therapy prior to cancer treatment, older age, partnered relationship, higher income, history of stem cell or bone marrow transplant, and longer duration of survivorship were significantly associated with pregnancy attempts. In multivariable analyses, YCS who did not undergo FP therapy were more than twice as likely to attempt pregnancy as those who did undergo FP therapy (RR 2.4, 95%CI 1.3, 4.3). Partnered status (RR 7.1, 95%CI 2.5, 20.2) and >2 years since cancer diagnosis (RR 2.3, 95%CI 1.3, 4.1) were also significantly associated with attempts. Conclusions In YCS, milestones including partnered relationships and longer duration of cancer survivorship are important to attempting pregnancy. A novel, inverse association between FP therapy and pregnancy attempts warrants further study. Implications for Cancer Survivors Pregnancy attempts after cancer were more likely after attaining both social and cancer-related milestones. As these milestones require time, YCS should be made aware of their potential for concomitant, premature loss of fertility in order to preserve their range of fertility options. PMID:24859010

  13. Prenatal nicotine exposure induces poor articular cartilage quality in female adult offspring fed a high-fat diet and the intrauterine programming mechanisms.


    Tie, Kai; Tan, Yang; Deng, Yu; Li, Jing; Ni, Qubo; Magdalou, Jacques; Chen, Liaobin; Wang, Hui


    Prenatal nicotine exposure (PNE) induces skeletal growth retardation and dyslipidemia in offspring displaying intrauterine growth retardation (IUGR). Cholesterol accumulation resulting from cholesterol efflux dysfunction may reduce the quality of articular cartilage through fetal programming. This study evaluated the quality of articular cartilage of female adult offspring fed a high-fat diet and explored the mechanisms using a rat IUGR model established by the administration of 2.0mg/kg/d of subcutaneous nicotine from gestational days 11-20. The results demonstrated an increased OARSI (Osteoarthritis Research Society International) score and total cholesterol content, decreased serum corticosterone, and increased IGF1 and dyslipidemia with catch-up growth in PNE adult offspring. Cartilage matrix, IGF1 and cholesterol efflux pathway expression were reduced in PNE fetuses and adult offspring. Therefore, PNE induced poor articular cartilage quality in female adult offspring fed a high-fat diet via a dual programming mechanism. PMID:26769161

  14. A global research synthesis of HIV and STI biobehavioural risks in female-to-male transgender adults.


    Reisner, Sari L; Murchison, Gabriel R


    There is a growing interest in HIV infection and sexually transmitted infection (STI) disease burden and risk among transgender people globally; however, the majority of work has been conducted with male-to-female transgender populations. This research synthesis comprehensively reviews HIV and STI research in female-to-male (FTM) transgender adults. A paucity of research exists about HIV and STIs in FTMs. Only 25 peer-reviewed papers (18 quantitative, 7 qualitative) and 11 'grey literature' reports were identified, most in the US or Canada, that include data identifying HIV and STI risks in FTMs (five with fully laboratory-confirmed HIV and/or STIs, and five with partial laboratory confirmation). Little is known about the sexual and drug use risk behaviours contributing to HIV and STIs in FTMs. Future directions are suggested, including the need for routine surveillance and monitoring of HIV and STIs globally by transgender identity, more standardised sexual risk assessment measures, targeted data collection in lower- and middle-income countries, and explicit consideration of the rationale for inclusion/exclusion of FTMs in category-based prevention approaches with MSM and transgender people. Implications for research, policy, programming, and interventions are discussed, including the need to address diverse sexual identities, attractions, and behaviours and engage local FTM communities. PMID:26785800

  15. Mediators involved in the relation between depressive symptoms and weight status in female adolescents and young adults

    PubMed Central

    Goldschmidt, Andrea B.; Wall, Melanie M.; Choo, Tse-Hwei J.; Larson, Nicole I.; Neumark-Sztainer, Dianne


    Depression may be a risk factor for overweight status, but mechanisms involved in this relationship are unclear. This study explored behavioral factors involved in the relationship between adolescent depression symptoms and adult overweight status. A population-based cohort of female participants in Project EAT (n=1,035) was followed over 10 years and reported on psychological functioning, weight status, and eating and activity patterns in early/middle adolescence (1999=Time 1; T1), middle adolescence/early young adulthood (2004=Time 2; T2), and early/middle young adulthood (2009=Time 3; T3). Structural equation models were fit which included T1 depression scores predicting overweight status at T3, with T2 fruit and vegetable consumption, moderate-to-vigorous physical activity, and binge eating examined as mediators. There were small but significant effects of T1 depression scores predicting an increased likelihood of T3 overweight status (standardized estimate=0.038; p=.007), and of T2 binge eating mediating the relation between T1 depression and T3 overweight status (standardized indirect effect estimate=.036; p=.009). Binge eating may be one pathway to overweight among depressed females, suggesting that recognition and treatment of eating pathology in individuals with depression may help prevent overweight. Examination of other behavioral (and non-behavioral) factors explaining the relationship between depression and overweight is warranted. PMID:25640769

  16. Chronic Wasting Disease Prions in Elk Antler Velvet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic wasting disease (CWD) is a transmissible spongiform encephalopathy or prion disease of captive and free ranging white tailed deer, mule deer, Rocky Mountain elk and moose in the some parts of the United States and Canada. The presence of the disease has sharply curtailed movement of captive...

  17. Potential geothermal energy applications for Idaho Elks Rehabilitation Hospital

    SciTech Connect

    Austin, J.C.


    Several potential applications of geothermal energy for the Idaho Elks Rehabilitation Hospital are outlined. A brief background on the resource and distribution system, is provided; which hospital heating systems should be considered for potential geothermal retrofit is discussed; and technical and economic feasibility are addressed.

  18. A model for autumn pelagic distribution of adult female polar bears in the Chukchi Seas, 1987-1994

    USGS Publications Warehouse

    Durner, G.M.; Douglas, D.C.; Nielson, R.M.; Amstrup, Steven C.


    We made predictions of polar bear (Ursus maritimus) autumn distribution in the Chukchi Sea with a Resource Selection Function (RSF) developed from 1198 satellite radio-collar locations on 124 adult female polar bears, 1987 – 1994. The RSF was created to assist in an aerial survey design for polar bears proposed by the U.S. Fish and Wildlife Service. The RSF was based on bathymetry and daily sea ice covariates extracted from passive microwave satellite imagery within the pelagic region > 25 km from shore. The RSF indicated that polar bears selected habitats with intermediate amounts (~50%) of ice cover in close proximity to higher ice concentrations, and over relatively shallow waters. The RSF showed good predictive abilities for the years of its construct, worked best in October, and was robust to inter-annual variability. When evaluated with recent (1997 – 2005) data, the RSF performed well for October and November but poorly in September. This loss of predictive abilities appeared to be related to recent changes in habitat due to longer melt seasons and younger sea ice, and testing the retrospective model with a small sample of recent polar bears locations from a limited region of the Chukchi Sea. Contemporary applications of this RSF must consider three factors that could limit its utility: 1) 2 different sea ice phenology; 2) distributions of males and sub-adults; and 3) occupancy in nearshore habitats.

  19. ICRP Publication 116--the first ICRP/ICRU application of the male and female adult reference computational phantoms.


    Petoussi-Henss, Nina; Bolch, Wesley E; Eckerman, Keith F; Endo, Akira; Hertel, Nolan; Hunt, John; Menzel, Hans G; Pelliccioni, Maurizio; Schlattl, Helmut; Zankl, Maria


    ICRP Publication 116 on 'Conversion coefficients for radiological protection quantities for external radiation exposures', provides fluence-to-dose conversion coefficients for organ-absorbed doses and effective dose for various types of external exposures (ICRP 2010 ICRP Publication 116). The publication supersedes the ICRP Publication 74 (ICRP 1996 ICRP Publication 74, ICRU 1998 ICRU Report 57), including new particle types and expanding the energy ranges considered. The coefficients were calculated using the ICRP/ICRU computational phantoms (ICRP 2009 ICRP Publication 110) representing the reference adult male and reference adult female (ICRP 2002 ICRP Publication 89), together with a variety of Monte Carlo codes simulating the radiation transport in the body. Idealized whole-body irradiation from unidirectional and rotational parallel beams as well as isotropic irradiation was considered for a large variety of incident radiations and energy ranges. Comparison of the effective doses with operational quantities revealed that the latter quantities continue to provide a good approximation of effective dose for photons, neutrons and electrons for the 'conventional' energy ranges considered previously (ICRP 1996, ICRU 1998), but not at the higher energies of ICRP Publication 116. PMID:25144220

  20. ICRP Publication 116—the first ICRP/ICRU application of the male and female adult reference computational phantoms

    NASA Astrophysics Data System (ADS)

    Petoussi-Henss, Nina; Bolch, Wesley E.; Eckerman, Keith F.; Endo, Akira; Hertel, Nolan; Hunt, John; Menzel, Hans G.; Pelliccioni, Maurizio; Schlattl, Helmut; Zankl, Maria


    ICRP Publication 116 on ‘Conversion coefficients for radiological protection quantities for external radiation exposures’, provides fluence-to-dose conversion coefficients for organ-absorbed doses and effective dose for various types of external exposures (ICRP 2010 ICRP Publication 116). The publication supersedes the ICRP Publication 74 (ICRP 1996 ICRP Publication 74, ICRU 1998 ICRU Report 57), including new particle types and expanding the energy ranges considered. The coefficients were calculated using the ICRP/ICRU computational phantoms (ICRP 2009 ICRP Publication 110) representing the reference adult male and reference adult female (ICRP 2002 ICRP Publication 89), together with a variety of Monte Carlo codes simulating the radiation transport in the body. Idealized whole-body irradiation from unidirectional and rotational parallel beams as well as isotropic irradiation was considered for a large variety of incident radiations and energy ranges. Comparison of the effective doses with operational quantities revealed that the latter quantities continue to provide a good approximation of effective dose for photons, neutrons and electrons for the ‘conventional’ energy ranges considered previously (ICRP 1996, ICRU 1998), but not at the higher energies of ICRP Publication 116.

  1. The Elk Creek Carbonatite Complex, Nebraska (USA)

    NASA Astrophysics Data System (ADS)

    Kettler, R. M.; Blessington, M.


    The Elk Creek carbonatite complex (ECCC) is a large Early Cambrian carbonatite-alkaline syenite complex located in SE Nebraska (USA). The carbonatite and related rocks are buried by more than 200 m of Pennsylvanian marine sedimentary rocks and Quaternary till. The pre-Pennsylvanian sub-crop is crudely circular in plan-view and exceeds 30 km2, making it one of the larger carbonatite complexes in North America. The rocks of the complex were intruded in Precambrian granite and gneiss on the eastern margin of the Mid-Continent rift where it has been offset by one of a series of southeasterly trending structures. The primary rock type in the ECCC is dolomite carbonatite. The dolomite carbonatite ranges from fine-grained flow-banded dolomite to a coarse-grained rock comprising large prismatic dolomite crystals. The central portion of the complex comprises a pipe-like intrusion of magnetite dolomite carbonatite and magnetite dolomite carbonatite breccia. Magnetite dolomite carbonatite is typically fine-grained and contains angular or rounded elongate fragments of dolomite carbonatite. Fragments of magnetite dolomite carbonatite are also included in dolomite carbonatite and other carbonatite rocks in the complex. Emplacement of a discreet pulse of reduced, iron-rich carbonatite magma was, therefore, a likely early event in the evolution of the ECCC. The magnetite is altered locally to hematite and other iron oxides. The oxidation ranges from a dusting of hematite to pervasive alteration to hematite and ferric oxyhydroxides and occurs to depths as much as 630 m below the modern land surface. Other volumetrically important rock types include apatite dolomite carbonatite and barite dolomite carbonatite. Both of these rock types are localized largely along fractures, occur later in the intrusive sequence, and may reflect exsolution of phosphates and sulfates with decreasing temperatures. The magnetite dolomite carbonatite hosts significant pyrochlore mineralization. Microprobe

  2. Energy Availability and Dietary Patterns of Adult Male and Female Competitive Cyclists With Lower Than Expected Bone Mineral Density.


    Viner, Rebecca T; Harris, Margaret; Berning, Jackie R; Meyer, Nanna L


    The purpose of this study was to assess energy availability (EA) and dietary patterns of 10 adult (29-49 years) male (n = 6) and female (n = 4) competitive (USA Cycling Category: Pro, n = 2; 1-4, n = 8) endurance cyclists (5 road, 5 off-road), with lower than expected bone mineral density (BMD; Z score < 0) across a season. Energy intake (EI) and exercise energy expenditure during preseason (PS), competition (C), and off-season (OS) were estimated from 3-day dietary records, completed once per month, across a cycling season. BMD was measured by DXA at 0 months/5 months/10 months. The Three-Factor Eating Questionnaire (TFEQ) was used to assess cognitive dietary restraint. Seventy percent of participants had low EA [(LEA); < 30 kcal · kg fat-free mass (FFM) (-1) · day(-1)] during PS, 90% during C, and 80% during OS (range: 3-37 kcal · kg FFM(-1) · day(-1)). Ninety percent of cyclists had LEA during ≥ 1 training period, and 70% had LEA across the season. Seventy percent of cyclists were identified as restrained eaters who consciously restrict EI as a means of weight control. Mean daily carbohydrate intake was below sport nutrition recommendations during each training period (PS: 3.9 ± 1.1 g · kg(-1) · day(-1), p < .001; C: 4.3 ± 1.4 g · kg(-1) · day(-1), p = .005; OS: 3.7 ± 1.4 g · kg(-1) · day(-1), p = .01). There were no differences in EA and EI · kg(-1) between male and female cyclists and road and off-road cyclists. Low EI, and specifically low carbohydrate intake, appears to be the main contributor to chronic LEA in these cyclists. Adult male and female competitive road and off-road cyclists in the United States may be at risk for long-term LEA. Further studies are needed to explore strategies to prevent and monitor long-term LEA in these athletes. PMID:26131616

  3. Effects of hypothyroidism upon the granular layer of the dentate gyrus in male and female adult rats: a morphometric study.


    Madeira, M D; Cadete-Leite, A; Andrade, J P; Paula-Barbosa, M M


    The effects of hypothyroidism upon the structure of the central nervous system of adult rats are poorly understood in spite of evidence that the mature brain is vulnerable to this condition. Existing developmental studies show that the morphological changes induced by thyroid hormone deficiency are related to alterations in neurogenesis. We studied the granular layer of the dentate gyrus under different experimental conditions of hypothyroidism, because in rodents the neurogenesis of the granule cells continues during adulthood. The following groups of rats were analysed: 1) control; 2) hypothyroid from day 0 until day 180 (hypothyroid group); 3) hypothyroid until day 30 and henceforth maintained euthyroid (recovery group); and 4) hypothyroid since day 30 (adult hypothyroid group). Groups of 6 male rats and 6 female rats were analysed separately. The volume of the dentate gyrus granular layer and the numerical density of its neurons were evaluated, so we were able to estimate the total number of granule cells. Because in the experimental groups the volume of the granular layer and the numerical density of its neurons were reduced, the total number of granule cells was decreased. In the hypothyroid and recovery groups the alterations were identical and more striking than in the adult hypothyroid groups. The total number of granule cells displayed sexual differences in all groups studied except in the hypothyroid groups. The present results support the view that thyroid hormone deficiency interferes with the process of cell acquisition by reducing neuronal proliferation and that it also leads to increased cell death. These events underlie the irreversible morphological changes observed in the brain of hypothyroid rats, either during development or at maturity. The referred structural alterations are probably related to the functional deficits observed in this condition. PMID:1797872

  4. FASH and MASH: female and male adult human phantoms based on polygon mesh surfaces: II. Dosimetric calculations.


    Kramer, R; Cassola, V F; Khoury, H J; Vieira, J W; Lima, V J de Melo; Brown, K Robson


    Female and male adult human phantoms, called FASH (Female Adult meSH) and MASH (Male Adult meSH), have been developed in the first part of this study using 3D animation software and anatomical atlases to replace the image-based FAX06 and the MAX06 voxel phantoms. 3D modelling methods allow for phantom development independent from medical images of patients, volunteers or cadavers. The second part of this study investigates the dosimetric implications for organ and tissue equivalent doses due to the anatomical differences between the new and the old phantoms. These differences are mainly caused by the supine position of human bodies during scanning in order to acquire digital images for voxel phantom development. Compared to an upright standing person, in image-based voxel phantoms organs are often coronally shifted towards the head and sometimes the sagittal diameter of the trunk is reduced by a gravitational change of the fat distribution. In addition, volumes of adipose and muscle tissue shielding internal organs are sometimes too small, because adaptation of organ volumes to ICRP-based organ masses often occurs at the expense of general soft tissues, such as adipose, muscle or unspecified soft tissue. These effects have dosimetric consequences, especially for partial body exposure, such as in x-ray diagnosis, but also for whole body external exposure and for internal exposure. Using the EGSnrc Monte Carlo code, internal and external exposure to photons and electrons has been simulated with both pairs of phantoms. The results show differences between organ and tissue equivalent doses for the upright standing FASH/MASH and the image-based supine FAX06/MAX06 phantoms of up to 80% for external exposure and up to 100% for internal exposure. Similar differences were found for external exposure between FASH/MASH and REGINA/REX, the reference voxel phantoms of the International Commission on Radiological Protection. Comparison of effective doses for external photon

  5. Comparison of body fat in Brazilian adult females by bioelectrical impedance analysis

    NASA Astrophysics Data System (ADS)

    Altamir, Vaz; Frère, Slaets Annie France; Ramírez Leonardo, López


    Body-fat is essential for human body, provided that its amount is at healthy levels. If in-excess body-fat is deleterious, its lack is otherwise also harmful. Estimated percent body-fat performed with commercially available devices measuring bioimpedance have many advantages, such as easy measurement and low cost. However, these measurements are based on standard models and equations that are not disclosed by manufacturers, and this leads to questioning the validity of these estimates for Brazilian females. The aim of this study was to compare electrical tetrapolar and octapolar impedance results obtained with commercially available equipment: Maltron BF-906 and OMRON 510-W. Data analysis involved descriptive and inferential statistics. Devices used in this study to estimate body fat quantity have not shown any significant differences in results; this is a major issue when selecting equipment based on three factors: study focus, available financial resources, and target population. Results obtained from the two devices have not shown any significant differences, which lead to the conclusion that either device may be reliably used.

  6. Salvia officinalis L. induces alveolar bud growing in adult female rat mammary glands

    PubMed Central

    Monsefi, Malihezaman; Abedian, Mehrnaz; Azarbahram, Zahra; Ashraf, Mohammad Javad


    Objectives: In traditional medicine Salvia officinalis (sage) has been used as menstrual cycle regulator. In the present study the effects of sage extract on breast tissue were examined. Materials and Methods: Fourteen female rats were divided into two groups: 1) Distilled water-treated rats (Con) that were gavaged with 1ml distilled water and 2) Saliva officinalis hydroalcoholic extract (SHE)-treated rats that were gavaged with 30mg/kg/body weight of sage extract for 30 days. The estrus cycle changes were monitored by daily examination of vaginal smear. Whole mounts of right pelvic breast were spread on the slide and stained by carmine. The number of alveolar buds (ABs) type 1 and 2 and lobules of mammary gland were scored. Tissue sections of left pelvic mammary gland were prepared and its histomorphometrical changes were measured. Blood samples were taken from dorsal aorta and estradiol and progesterone concentrations were measured using radioimmunoassay. Results: Estrous cycles decreased significantly in SHE-treated animals. The number of alveolar buds and lobules in mammary gland whole mount of SHE-treated group were higher than the Con group. The number and diameter of ducts in histological section of mammary gland in SHE-treated group increased as compared to the Con group. Conclusion: Sage promotes alveologenesis of mammary glands and it can be used as a lactiferous herb. PMID:26693413

  7. Correlates of human papillomavirus vaccine series completion among young adult female initiators

    PubMed Central

    Rahman, Mahbubur; Laz, Tabassum H; McGrath, Christine; Berenson, Abbey B


    Incomplete human papillomavirus (HPV) vaccination is a public health concern. The objective of this study was to examine the correlates of vaccine series completion among 18–26 year old US women using the Behavioral Risk Factor Surveillance System (BRFSS) data. Using BRFSS data collected during 2008–2010, we conducted multivariable logistic regression analysis to examine the correlates of HPV vaccine completion among HPV vaccine initiators. Among 656 women (18–26 years old) who initiated the HPV vaccine, the overall weighted vaccine series completion rate was 60.7%. It was 32.9%, 65.3%, and 69.9% in 2008, 2009, and 2010, respectively. Black and Hispanic women were less likely to complete the series compared with white women. Higher income, having a college degree and completion of the study in a more recent year were associated with higher completion rates. Thus, the reasons for HPV series non-completion may be multifactorial. Interventions targeting 18–26 year old female vaccine initiators with low income and education, and minority backgrounds may improve HPV vaccine series completion. PMID:25424919

  8. Cultural predictors of self-esteem: a study of Chinese American female and male young adults.


    Tsai, J L; Ying, Y W; Lee, P A


    This study examined how specific domains of cultural orientation (language, social affiliation, and cultural pride) related to self-esteem for a sample of 174 Chinese American male and 179 Chinese American female college students. Participants completed measures of cultural orientation (General Ethnicity Questionnaire; J.L. Tsai, Y.W. Ying, & P.A. Lee, 2000) and self-esteem (M. Rosenberg, 1965). Cultural orientation significantly predicted self-esteem, above and beyond the contribution of age, gender, grade point average, and socioeconomic status. Specifically, proficiency in English and Chinese languages and pride in Chinese culture were positively correlated with self-esteem, whereas affiliation with Chinese people was negatively correlated with selfesteem. The cultural predictors of self-esteem differed for Chinese American men and women. Whereas self-esteem was mainly related to pride in Chinese culture for Chinese American women, self-esteem was mainly related to English and Chinese language proficiency for Chinese American men. Implications of these findings for understanding Asian Americans are discussed. PMID:11506074

  9. Lesions targeted to the anterior forebrain disrupt vocal variability associated with testosterone-induced sensorimotor song development in adult female canaries, Serinus canaria.


    Rouse, Melvin L; Ball, Gregory F


    Learned communication was a trait observed in a limited number of vertebrates such as humans but also songbirds (i.e., species in the suborder passeri sometimes called oscines). Robust male-biased sex-differences in song development and production have been observed in several songbird species. However, in some of these species treating adult females with testosterone (T) induced neuro-behavioral changes such that females become more male-like in brain and behavior. T-treatment in these adult females seemed to stimulate sensorimotor song development to facilitate song masculinization. In male songbirds it was known that the lateral magnocellular nucleus of the anterior nidopallium (LMAN) played a modulatory role during song development. LMAN was androgen sensitive and may be a key target of a T-induced recapitulation of a developmental process in adult females. This hypothesis was tested. Adult female canaries were given either a chemical lesion of LMAN or a control sham-surgery. Prior to surgery birds were individually housed for 2-weeks in sound-attenuated chambers to record baseline vocal behavior. Post-surgery birds were given 1-week to recover before subcutaneous implantation with silastic capsules filled with crystalline-T. Birds remained on treatment for 3-weeks (behavioral recordings continued throughout). Birds with a lesion to LMAN had less variability in their song compared with controls. The diversity of syllable and phrase type(s) was greater in sham controls as compared with birds with LMAN lesions. Birds did not differ in song rate. These data suggested that the sustention and conclusion of T-induced sensorimotor song development in adult female canaries required an intact LMAN. PMID:25864444

  10. Sella Turcica Atypical Teratoid/Rhabdoid Tumor Complicated with Lung Metastasis in an Adult Female

    PubMed Central

    Moretti, Costanzo; Lupoi, Domenico; Spasaro, Francesca; Chioma, Laura; Di Giacinto, Paola; Colicchia, Martina; Frajoli, Mario; Mocini, Renzo; Ulisse, Salvatore; Antonelli, Manila; Giangaspero, Felice; Gnessi, Lucio


    Here we present the case of a 60-year-old woman with a rare sellar region atypical teratoid/rhabdoid tumor (AT/RT), complicated by lung metastasis and treated with neurosurgery, radiotherapy, and chemotherapy. The patient had recurrent headache associated with left cavernous sinus syndrome after a previous endonasal transsphenoidal resection for a presumptive pituitary macroadenoma. Pituitary magnetic resonance imaging showed a tumor regrowth in the original location with a haemorrhagic component involving the left cavernous sinus. A near complete transsphenoidal resection of the sellar mass was performed followed by 3 months of stereotactic radiotherapy. Because of a worsening of the general clinical conditions, respiratory failure, and asthenia, the patient underwent a contrast enhanced computer tomography of the whole body which showed the presence of lung metastasis. The histopathological diagnosis on samples from pituitary and lung tissues was AT/RT. The patient survived 30 months after diagnosis regardless chemotherapy. In the adult, the AT/RT should be considered as a possible rare, aggressive, and malignant neoplasm localized in the sella turcica. PMID:24324353

  11. Prenatal nicotine exposure increases anxiety and modifies sensorimotor integration behaviors in adult female mice.


    Santiago, Sarah E; Huffman, Kelly J


    Prenatal exposure to nicotine (PNE) has been associated with a myriad of physiological, cognitive, and behavioral effects in the developing offspring. In this study, CD-1 dams were given injections of nicotine or control vehicle throughout gestation and their offspring were raised to 6 months of age. Adult mice were administered a battery of behavioral tests (the Suok test, the elevated platform test, and the elevated plus maze test) to assess anxiety and sensorimotor integration. PNE resulted in a decreased likelihood of jumping during the elevated platform test and decreased directed exploration in the Suok test, both indicative of increased anxiety. Also, PNE mice showed increased numbers of missteps while traversing an elevated rod in the Suok test, demonstrating altered sensorimotor integration. No significant differences were found in falls, segments traveled, latency to leave the central zone, vegetative responses, risk assessment behaviors, or autogroom behaviors. The elevated plus maze test revealed no significant differences between groups. No significant differences in body and brain weights, or cortical thickness within motor, somatosensory, and visual cortices were observed between PNE and control mice. Although neuroanatomical effects of PNE may be rescued as development progresses, defects in sensorimotor integration and increased anxiety persist into adulthood. PMID:24157430

  12. Sex hormones affect neurotransmitters and shape the adult female brain during hormonal transition periods

    PubMed Central

    Barth, Claudia; Villringer, Arno; Sacher, Julia


    Sex hormones have been implicated in neurite outgrowth, synaptogenesis, dendritic branching, myelination and other important mechanisms of neural plasticity. Here we review the evidence from animal experiments and human studies reporting interactions between sex hormones and the dominant neurotransmitters, such as serotonin, dopamine, GABA and glutamate. We provide an overview of accumulating data during physiological and pathological conditions and discuss currently conceptualized theories on how sex hormones potentially trigger neuroplasticity changes through these four neurochemical systems. Many brain regions have been demonstrated to express high densities for estrogen- and progesterone receptors, such as the amygdala, the hypothalamus, and the hippocampus. As the hippocampus is of particular relevance in the context of mediating structural plasticity in the adult brain, we put particular emphasis on what evidence could be gathered thus far that links differences in behavior, neurochemical patterns and hippocampal structure to a changing hormonal environment. Finally, we discuss how physiologically occurring hormonal transition periods in humans can be used to model how changes in sex hormones influence functional connectivity, neurotransmission and brain structure in vivo. PMID:25750611

  13. Evaluating use of cattle winter feeding areas by elk and white-tailed deer: implications for managing bovine tuberculosis transmission risk from the ground up.


    Brook, Ryan K; Wal, Eric Vander; van Beest, Floris M; McLachlan, Stéphane M


    Transmission of bovine tuberculosis (Mycobacterium bovis) among wildlife and livestock has created important risks for conservation and agriculture. Management strategies aimed at controlling TB have typically been top-down, regionally focused, and government-led programs that were at best only partially successful. The purpose of this study was to quantify co-mingling of elk and white-tailed deer (WTD) with cattle at multiple spatial scales (i.e., the regional farm scale and winter cattle feeding area patch) in southwestern Manitoba, Canada, to assess the potential for bovine tuberculosis transmission and identify alternative management strategies. For each spatial scale we quantified use of cattle farms by elk and white-tailed deer. We mailed questionnaires to rural households and then conducted personal interviews with 86 cattle farmers to map the spatial distribution of their cattle winter feeding areas at a fine scale. We deployed Global Positioning System (GPS) collars on 48 wild elk and 16 wild white-tailed deer from 2003 to 2011. Elk were observed on farms by 66% of cattle producers, including 5% and 20% who observed direct and indirect contact, respectively, between elk and cattle. Cattle producers consistently (≈100%) observed white-tailed deer on their farms, including 11% and 47% whom observed direct and indirect contact, respectively, between white-tailed deer and cattle. A higher probability of white-tailed deer-cattle contact at the regional scale occurs on farms that (1) left crop residues specifically for wildlife, (2) had larger cattle herds, (3) used round bale feeders, and (4) were farther away from protected areas. None of the GPS-collared elk locations overlapped with cattle winter feeding areas. In contrast, 21% of GPS-collared white-tailed deer locations overlapped with winter cattle winter feeding areas (22% of these were from male WTD and 78% were from female WTD). White-tailed deer selected cattle winter feeding areas with higher (1

  14. Does long-term swimming participation have a deleterious effect on the adult female skeleton?


    Greenway, Kate Gwendoline; Walkley, Jeff Whenan; Rich, Peter Adrian


    Swimming is a popular activity for Australian women with proven cardiovascular benefits yet lacks the features thought necessary to stimulate positive adaptive changes in bone. Given that peak bone mass is attained close to the end of the second decade, we asked whether swimming was negatively associated with bone mineral density in premenopausal women beyond this age. Bone mass and retrospective physical activity data were gathered from 43 female swimmers and 44 controls (mean ages 40.4 and 43.8 years, respectively). Swimmers were recruited from the Australian Union of Senior Swimmers International while controls were healthy community dwellers with similar lean mass, fat mass, height, weight and body mass index. None of the participants had a history of medical complaints nor use of medications known to affect bone. Dual energy X-ray absorptiometry was used to determine areal bone mineral density at total body, lumbar spine, proximal femur, distal radius and tibia while self-administered questionnaires were used to approximate historical and recent physical activity and calcium intake. Swimmers had averaged over 2 hours of swimming per week for the past 5 years and 1.45 h/week over lifetime with no systematic swimming exposure for controls. Lifetime exposure to weight bearing and impact exercise were similar. There were no intergroup differences for bone mass at any site though controls had higher incidence of low bone mass/osteoporosis. No differences in bone mass were detected between swimmers in the upper and lower quartiles for swim participation for any period. Long-term swim participation did not compromise areal bone mineral density. PMID:22230920

  15. First Comparative Transcriptomic Analysis of Wild Adult Male and Female Lutzomyia longipalpis, Vector of Visceral Leishmaniasis

    PubMed Central

    McCarthy, Christina B.; Santini, María Soledad; Pimenta, Paulo F. P.; Diambra, Luis A.


    Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative

  16. Effects of hyperandrogenemia and increased adiposity on reproductive and metabolic parameters in young adult female monkeys

    PubMed Central

    Bishop, C. V.; Pohl, C. R.; Chang, R. J.; Marshall, J. C.; Pau, F. K.; Stouffer, R. L.; Cameron, J. L.


    Many patients with hyperandrogenemia are overweight or obese, which exacerbates morbidities associated with polycystic ovary syndrome (PCOS). To examine the ability of testosterone (T) to generate PCOS-like symptoms, monkeys received T or cholesterol (control) implants (n = 6/group) beginning prepubertally. As previously reported, T-treated animals had increased neuroendocrine drive to the reproductive axis [increased luteinizing hormone (LH) pulse frequency] at 5 yr, without remarkable changes in ovarian or metabolic features. To examine the combined effects of T and obesity, at 5.5 yr (human equivalent age: 17 yr), monkeys were placed on a high-calorie, high-fat diet typical of Western cultures [Western style diet (WSD)], which increased body fat from <2% (pre-WSD) to 15–19% (14 mo WSD). By 6 mo on WSD, LH pulse frequency in the controls increased to that of T-treated animals, whereas LH pulse amplitude decreased in both groups and remained low. The numbers of antral follicles present during the early follicular phase increased in both groups on the WSD, but maximal follicular size decreased by 50%. During the late follicular phase, T-treated females had greater numbers of small antral follicles than controls. T-treated monkeys also had lower progesterone during the luteal phase of the menstrual cycle. Although fasting insulin did not vary between groups, T-treated animals had decreased insulin sensitivity after 1 yr on WSD. Thus, while WSD consumption alone led to some features characteristic of PCOS, T + WSD caused a more severe phenotype with regard to insulin insensitivity, increased numbers of antral follicles at midcycle, and decreased circulating luteal phase progesterone levels. PMID:24735887

  17. Adolescent pre-treatment with oxytocin protects against adult methamphetamine-seeking behavior in female rats.


    Hicks, Callum; Cornish, Jennifer L; Baracz, Sarah J; Suraev, Anastasia; McGregor, Iain S


    The neuropeptide oxytocin (OT), given acutely, reduces self-administration of the psychostimulant drug methamphetamine (METH). Additionally, chronic OT administration to adolescent rats reduces levels of alcohol consumption in adulthood, suggesting developmental neuroplasticity in the OT system relevant to addiction-related behaviors. Here, we examined whether OT exposure during adolescence might subsequently inhibit METH self-administration in adulthood. Female Sprague-Dawley rats were administered vehicle or OT (1 mg/kg, i.p.) once daily from postnatal days (PND) 28 to 37 (adolescence). At PND 62 (adulthood), rats were trained to self-administer METH (intravenous, i.v.) in daily 2-hour sessions for 10 days under a fixed ratio 1 (FR1) reinforcement schedule, followed by determination of dose-response functions (0.01-0.3 mg/kg/infusion, i.v.) under both FR1 and progressive ratio (PR) schedules of reinforcement. Responding was then extinguished, and relapse to METH-seeking behavior assessed following priming doses of non-contingent METH (0.1-1 mg/kg, i.p.). Finally, plasma was collected to determine pre-treatment effects on OT and corticosterone levels. Results showed that OT pre-treatment did not significantly inhibit the acquisition of METH self-administration or FR1 responding. However, rats pre-treated with OT responded significantly less for METH under a PR reinforcement schedule, and showed reduced METH-primed reinstatement with the 1 mg/kg prime. Plasma OT levels were also significantly higher in OT pre-treated rats. These results confirm earlier observations that adolescent OT exposure can subtly, yet significantly, inhibit addiction-relevant behaviors in adulthood. PMID:25402719

  18. ELK1 is up-regulated by androgen in bladder cancer cells and promotes tumor progression

    PubMed Central

    Aljarah, Ali Kadhim; Ide, Hiroki; Li, Yi; Kashiwagi, Eiji; Netto, George J.; Zheng, Yichun; Miyamoto, Hiroshi


    Little is known about biological significance of ELK1, a transcriptional factor that activates downstream targets including c-fos proto-oncogene, in bladder cancer. Recent preclinical evidence also suggests the involvement of androgen receptor (AR) signaling in bladder cancer progression. In this study, we aim to investigate the functions of ELK1 in bladder cancer growth and their regulation by AR signals. Immunohistochemistry in bladder tumor specimens showed that the levels of phospho-ELK1 (p-ELK1) expression were significantly elevated in urothelial neoplasms, compared with non-neoplastic urothelium tissues, and were also correlated with AR positivity. Patients with p-ELK1-positive non-muscle-invasive and muscle-invasive tumors had significantly higher risks for tumor recurrence and progression, respectively. In AR-positive bladder cancer cell lines, dihydrotestosterone treatment increased ELK1 expression (mRNA, protein) and its nuclear translocation, ELK1 transcriptional activity, and c-fos expression, which was restored by an anti-androgen hydroxyflutamide. ELK1 silencing via short hairpin RNA (shRNA) resulted in decreases in cell viability/colony formation, and cell migration/invasion as well as an increase in apoptosis. Importantly, ELK1 appears to require activated AR to regulate bladder cancer cell proliferation, but not cell migration. Androgen also failed to significantly induce AR transactivation in ELK1-knockdown cells. In accordance with our in vitro findings, ELK1-shRNA expression considerably retarded tumor formation as well as its growth in xenograft-bearing male mice. Our results suggest that ELK1 plays an important role in bladder tumorigenesis and cancer progression, which is further induced by AR activation. Accordingly, ELK1 inhibition, together with AR inactivation, has the potential of being a therapeutic approach for bladder cancer. PMID:26342199

  19. Interactions between a group of Golden Eagles and a herd of North American elk

    USGS Publications Warehouse

    O'Connell, Matt P.; Kochert, Michael N.


    Raptors are generally considered solitary predators (Schoener 1969), but occasionally they interact socially (Brown and Amadon 1968). Certain raptor species (e.g., Swallow-tailed Kites [Elanoides forficatus] and Swainson's Hawks [Buteo swainsoni]) concentrate in aggregations in response to localized, abundant food sources (Ellis et al. 1993). Many raptor species engage in group hunting (Ellis et al. 1993), and social foraging is a routine strategy for some species (e.g., Harris's Hawks [Parabuteo unicinctus]; Bednarz 1988, Ellis et al. 1993]. Raptors generally engage in group hunting to pursue elusive or large prey (Ellis et al. 1993). Occasionally individuals of conspecific raptors engage in play as a group sometimes involving chases of prey species (Palmer 1988). In this letter, we report interactions between a large group of Golden Eagles and a herd of adult and juvenile Rocky Mountain elk (Cervus canadensis nelsoni) in late autumn.

  20. The Principal Components of Adult Female Insole Shape Align Closely with Two of Its Classic Indicators

    PubMed Central

    Bookstein, Fred L.; Domjanic, Jacqueline


    The plantar surface of the human foot transmits the weight and dynamic force of the owner’s lower limbs to the ground and the reaction forces back to the musculoskeletal system. Its anatomical variation is intensely studied in such fields as sports medicine and orthopedic dysmorphology. Yet, strangely, the shape of the insole that accommodates this surface and elastically buffers these forces is neither an aspect of the conventional anthropometrics of feet nor an informative label on the packet that markets supplementary insoles. In this paper we pursue an earlier suggestion that insole form in vertical view be quantified in terms of the shape of the foot not at the plane of support (the “footprint”) but some two millimeters above that level. Using such sections extracted from laser scans of 158 feet of adult women from the University of Zagreb, in conjunction with an appropriate modification of today’s standard geometric morphometrics (GMM), we find that the sectioned form can be described by its size together with two meaningful relative warps of shape. The pattern of this shape variation is not novel. It is closely aligned with two of the standard footprint measurements, the Chippaux-Šmiřák arch index and the Clarke arch angle, whose geometrical foci (the former in the ball of the foot, the latter in the arch) it apparently combines. Thus a strong contemporary analysis complements but does not supplant the simpler anthropometric analyses of half a century ago, with implications for applied anthropology. PMID:26308442

  1. Fluence-to-dose conversion coefficients based on the posture modification of Adult Male (AM) and Adult Female (AF) reference phantoms of ICRP 110

    NASA Astrophysics Data System (ADS)

    Galeano, D. C.; Santos, W. S.; Alves, M. C.; Souza, D. N.; Carvalho, A. B.


    The aim of this work was to modify the standing posture of the anthropomorphic reference phantoms of ICRP publication 110, AM (Adult Male) and AF (Adult Female), to the sitting posture. The change of posture was performed using the Visual Monte Carlo software (VMC) to rotate the thigh region of the phantoms and position it between the region of the leg and trunk. Scion Image software was used to reconstruct and smooth the knee and hip contours of the phantoms in a sitting posture. For 3D visualization of phantoms, the VolView software was used. In the change of postures, the organ and tissue masses were preserved. The MCNPX was used to calculate the equivalent and effective dose conversion coefficients (CCs) per fluence for photons for six irradiation geometries suggested by ICRP publication 110 (AP, PA, RLAT, LLAT, ROT and ISO) and energy range 0.010-10 MeV. The results were compared between the standing and sitting postures, for both sexes, in order to evaluate the differences of scattering and absorption of radiation for different postures. Significant differences in the CCs for equivalent dose were observed in the gonads, colon, prostate, urinary bladder and uterus, which are present in the pelvic region, and in organs distributed throughout the body, such as the lymphatic nodes, muscle, skeleton and skin, for the phantoms of both sexes. CCs for effective dose showed significant differences of up to 16% in the AP irradiation geometry, 27% in the PA irradiation geometry and 13% in the ROT irradiation geometry. These results demonstrate the importance of using phantoms in different postures in order to obtain more precise conversion coefficients for a given exposure scenario.

  2. Hepatic reference gene selection in adult and juvenile female Atlantic salmon at normal and elevated temperatures

    PubMed Central


    Background The use of quantitative real-time polymerase chain reaction (qPCR) has become widespread due to its specificity, sensitivity and apparent ease of use. However, experimental error can be introduced at many stages during sample processing and analysis, and for this reason qPCR data are often normalised to an internal reference gene. The present study used three freely available algorithms (GeNorm, NormFinder and BestKeeper) to assess the stability of hepatically expressed candidate reference genes (Hprt1, Tbp, Ef1α and β-tubulin) in two experiments. In the first, female Atlantic salmon (Salmo salar) broodstock of different ages were reared at either 14 or 22°C for an entire reproductive season, therefore a reference gene that does not respond to thermal challenge or reproductive condition was sought. In the second, estrogen treated juvenile salmon were maintained at the same temperatures for 14 days and a reference gene that does not respond to temperature or estrogen was required. Additionally, we performed independent statistic analysis to validate the outputs obtained from the program based analysis. Results Based on the independent statistical analysis performed the stability of the genes tested was Tbp > Ef1α > Hprt1 > β-tubulin for the temperature/reproductive development experiment and Ef1α > Hprt1 > Tbp for the estrogen administration experiment (β-tubulin was not analysed). Results from the algorithms tested were quite ambiguous for both experiments; however all programs consistently identified the least stable candidate gene. BestKeeper provided rankings that were consistent with the independent analysis for both experiments. When an inappropriate candidate reference gene was used to normalise the expression of a hepatically expressed target gene, the ability to detect treatment-dependent changes in target gene expression was lost for multiple groups in both experiments. Conclusions We have highlighted the need to independently validate

  3. Temporal Gene Expression Profiles of Pre Blood-Fed Adult Females Immediately Following Eclosion in the Southern House Mosquito Culex quinquefasciatus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Prior to acquisition of the first host blood meal, the anautogenous mosquito Culex quinquefasciatus requires a period of time in order to prepare for the blood feeding and, later, vitellogenesis. In the current study, we conducted whole transcriptome analyses of adult female Culex mosquitoes to iden...

  4. Modulatory Effect of Eui-E-In-Tang on Serum Leptin Concentration in Obese Korean Female Adults: A Randomized Controlled Trial

    PubMed Central

    Song, Yun-Kyung


    Background. Obesity is associated with chronic inflammation and cytokines. However, to date, the relationship between the serum levels of cytokines in obese individuals and taking herbal drugs remains largely unexplored. Methods. Serum cytokines were assessed by multiplex cytokine profiling assay. Serum samples of obese female Korean adults (obese group; n = 20) as well as normal female Korean adults (normal group; n = 21) were collected at the start and end of study period. Twenty obese female Korean adults were randomized to receive Eui-E-In-Tang (Eui-E-In-Tang group; n = 9) at a daily dose of 9 g or a matched placebo (placebo group; n = 11) for 12 weeks. Results. According to investigating serum cytokine levels at the start point of this study, the serum C-peptide, insulin, leptin, lipocalin-2, and adipsin levels in the obese group were found to be significantly higher than in the normal group. And the investigation of serum cytokine levels at the end point of this study demonstrated that mean serum leptin of Eui-E-In-Tang group was found to be significantly reduced (P = 0.037). Conclusions. This study provides preliminary evidence that Eui-E-In-Tang may exert immunomodulatory effect via altering the circulating concentration of leptin in Korean female adults.

  5. Volatiles induced by larvae of asian corn borer (Ostrinia furnacalis) in maize plants affect behavior of conspecific larvae and female adults

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Larvae of the Asian corn borer (ACB), Ostrinia furnacalis, (Guenée), feeding on maize (Zea mays L.) induced volatiles from the plants that affected orientation behaviors of ACB larvae and oviposition of ACB adult females. Nineteen volatile chemicals were identified from maize plants attacked by thir...

  6. Women Reading for Education, Affinity & Development (WREAD): An Evaluation of a Semistructured Reading Discussion Group for African American Female Adult-Literacy Students with Histories of Trauma

    ERIC Educational Resources Information Center

    Jones, Jayatta D.


    Women Reading for Education, Affinity & Development (WREAD), a reading discussion group geared toward African American female adult-literacy students with self-defined histories of trauma, was an outgrowth of research identifying links between trauma, women's struggles with literacy, and the need to be conscious of emotional health…

  7. Assessing the Long-Term Effects of EMDR: Results from an 18-Month Follow-Up Study with Adult Female Survivors of CSA

    ERIC Educational Resources Information Center

    Edmond, Tonya; Rubin, Allen


    This 18-month follow-up study builds on the findings of a randomized experimental evaluation that found qualified support for the short-term effectiveness of Eye Movement Desensitization and Reprocessing (EMDR) in reducing trauma symptoms among adult female survivors of childhood sexual abuse (CSA). The current study provides preliminary evidence…

  8. Overwintering of Uranotaenia Unguiculata Adult Females in Central Europe: A Possible Way of Persistence of the Putative New Lineage of West Nile Virus?


    Rudolf, Ivo; Šebesta, Oldřich; Straková, Petra; Betášová, Lenka; Blažejová, Hana; VEnclíková, Kristýna; Seidel, Bernhard; Tóth, Sandor; Hubálek, Zdeněk; Schaffner, Francis


    We report the overwintering of Uranotaenia unguiculata adult females in Central Europe (Czech Republic, Hungary, Austria). This finding suggests a potential mode of winter persistence of putative novel lineage of West Nile virus in the temperate regions of Europe. PMID:26675459

  9. Extensive juvenile "babysitting" facilitates later adult maternal responsiveness, decreases anxiety, and increases dorsal raphe tryptophan hydroxylase-2 expression in female laboratory rats.


    Harding, Kaitlyn M; Lonstein, Joseph S


    Pregnancy and parturition can dramatically affect female neurobiology and behavior. This is especially true for laboratory-reared rodents, in part, because such rearing prevents a host of developmental experiences that females might undergo in nature, including juvenile alloparenting. We examined the effect of chronic exposure to pups during post-weaning juvenile life (days 22-36) on adult maternal responsiveness, anxiety-related behaviors, and dorsal raphe tryptophan hydroxylase-2 (TPH2) and serotonin transporter (SERT) levels in nulliparous rats. Adult females with juvenile alloparental experience showed significantly faster sensitized maternal responsiveness, less anxiety, and more dorsal raphe TPH2. Juvenile alloparenting did not affect females' later social novelty and preference behaviors toward adults, suggesting their increased interest in pups did not extend to all social partners. In a second experiment, suckling a pregnant dam (achieved by postpartum estrus reinsemination), interacting with her after standard laboratory weaning age, and a 3-day exposure to younger siblings also reduced juvenile females' later anxiety but did not affect maternal responsiveness or TPH2. Thus, extensive juvenile "babysitting" can have long-term effects reminiscent of pregnancy and parturition on maternal responsiveness and anxiety, and these effects may be driven by upregulated serotonin. © 2016 Wiley Periodicals, Inc. Dev Psychobiol 58: 492-508, 2016. PMID:26806471

  10. Mount Rainier National Park and Olympic National Park elk monitoring program annual report 2011

    USGS Publications Warehouse

    Happe, Patricia J.; Reid, Mason; Griffin, Paul C.; Jenkins, Kurt J.; Vales, David J.; Moeller, Barbara J.; Tirhi, Michelle; McCorquodale, Scott


    Fiscal year 2011 was the first year of implementing an approved elk monitoring protocol in Mount Rainier (MORA) and Olympic (OLYM) National Parks in the North Coast and Cascades Network (NCCN) (Griffin et al. 2012). However, it was the fourth and second year of gathering data according to protocol in MORA and OLYM respectively; data gathered during the protocol development phase followed procedures that are laid out in the protocol. Elk monitoring in these large wilderness parks relies on aerial surveys from a helicopter. Summer surveys are intended to provide quantitative estimates of abundance, sex and age composition, and distribution of migratory elk in high elevation trend count areas. An unknown number of elk is not detected during surveys; however the protocol estimates the number of missed elk by applying a model that accounts for detection bias. Detection bias in elk surveys in MORA is estimated using a double-observer sightability model that was developed using survey data from 2008-2010 (Griffin et al. 2012). That model was developed using elk that were previously equipped with radio collars by cooperating tribes. At the onset of protocol development in OLYM there were no existing radio-collars on elk. Consequently the majority of the effort in OLYM in the past 4 years has been focused on capturing and radio-collaring elk and conducting sightability trials needed to develop a double-observer sightability model in OLYM. In this annual report we provide estimates of abundance and composition for MORA elk, raw counts of elk made in OLYM, and describe sightability trials conducted in OLYM. At MORA the North trend count area was surveyed twice and the South once (North Rainier herd, and South Rainier herd). We counted 373 and 267 elk during two replicate surveys of the North Rainier herd, and 535 elk in the South Rainier herd. Using the model, we estimated that 413 and 320 elk were in the North and 652 elk were in the South trend count areas during the time

  11. Elk migration patterns and human activity influence wolf habitat use in the Greater Yellowstone Ecosystem

    USGS Publications Warehouse

    Nelson, Abigail; Kauffman, Matthew J.; Middleton, Arthur D.; Jimenez, Mike; McWhirter, Douglas; Barber, Jarrett; Gerow, Ken


    Identifying the ecological dynamics underlying human–wildlife conflicts is important for the management and conservation of wildlife populations. In landscapes still occupied by large carnivores, many ungulate prey species migrate seasonally, yet little empirical research has explored the relationship between carnivore distribution and ungulate migration strategy. In this study, we evaluate the influence of elk (Cervus elaphus) distribution and other landscape features on wolf (Canis lupus) habitat use in an area of chronic wolf–livestock conflict in the Greater Yellowstone Ecosystem, USA. Using three years of fine-scale wolf (n = 14) and elk (n = 81) movement data, we compared the seasonal habitat use of wolves in an area dominated by migratory elk with that of wolves in an adjacent area dominated by resident elk. Most migratory elk vacate the associated winter wolf territories each summer via a 40–60 km migration, whereas resident elk remain accessible to wolves year-round. We used a generalized linear model to compare the relative probability of wolf use as a function of GIS-based habitat covariates in the migratory and resident elk areas. Although wolves in both areas used elk-rich habitat all year, elk density in summer had a weaker influence on the habitat use of wolves in the migratory elk area than the resident elk area. Wolves employed a number of alternative strategies to cope with the departure of migratory elk. Wolves in the two areas also differed in their disposition toward roads. In winter, wolves in the migratory elk area used habitat close to roads, while wolves in the resident elk area avoided roads. In summer, wolves in the migratory elk area were indifferent to roads, while wolves in resident elk areas strongly avoided roads, presumably due to the location of dens and summering elk combined with different traffic levels. Study results can help wildlife managers to anticipate the movements and establishment of wolf packs as they expand into

  12. Elk migration patterns and human activity influence wolf habitat use in the Greater Yellowstone Ecosystem.


    Nelson, Abigail A; Kauffman, Matthew J; Middleton, Arthur D; Jimenez, Michael D; McWhirter, Douglas E; Barber, Jarrett; Gerow, Kenneth


    Identifying the ecological dynamics underlying human-wildlife conflicts is important for the management and conservation of wildlife populations. In landscapes still occupied by large carnivores, many ungulate prey species migrate seasonally, yet little empirical research has explored the relationship between carnivore distribution and ungulate migration strategy. In this study, we evaluate the influence of elk (Cervus elaphus) distribution and other landscape features on wolf (Canis lupus) habitat use in an area of chronic wolf-livestock conflict in the Greater Yellowstone Ecosystem, USA. Using three years of fine-scale wolf (n = 14) and elk (n = 81) movement data, we compared the seasonal habitat use of wolves in an area dominated by migratory elk with that of wolves in an adjacent area dominated by resident elk. Most migratory elk vacate the associated winter wolf territories each summer via a 40-60 km migration, whereas resident elk remain accessible to wolves year-round. We used a generalized linear model to compare the relative probability of wolf use as a function of GIS-based habitat covariates in the migratory and resident elk areas. Although wolves in both areas used elk-rich habitat all year, elk density in summer had a weaker influence on the habitat use of wolves in the migratory elk area than the resident elk area. Wolves employed a number of alternative strategies to cope with the departure of migratory elk. Wolves in the two areas also differed in their disposition toward roads. In winter, wolves in the migratory elk area used habitat close to roads, while wolves in the resident elk area avoided roads. In summer, wolves in the migratory elk area were indifferent to roads, while wolves in resident elk areas strongly avoided roads, presumably due to the location of dens and summering elk combined with different traffic levels. Study results can help wildlife managers to anticipate the movements and establishment of wolf packs as they expand into areas

  13. Positive, But Not Negative Feedback Actions of Estradiol in Adult Female Mice Require Estrogen Receptor α in Kisspeptin Neurons

    PubMed Central

    Dubois, Sharon L.; Acosta-Martínez, Maricedes; DeJoseph, Mary R.; Wolfe, Andrew; Radovick, Sally; Boehm, Ulrich; Urban, Janice H.


    Hypothalamic kisspeptin (Kiss1) neurons express estrogen receptor α (ERα) and exert control over GnRH/LH secretion in female rodents. It has been proposed that estradiol (E2) activation of ERα in kisspeptin neurons in the arcuate nucleus (ARC) suppresses GnRH/LH secretion (negative feedback), whereas E2 activation of ERα in kisspeptin neurons in the anteroventral periventricular nucleus (AVPV) mediates the release of preovulatory GnRH/LH surges (positive feedback). To test these hypotheses, we generated mice bearing kisspeptin cell–specific deletion of ERα (KERαKO) and treated them with E2 regimens that evoke either negative or positive feedback actions on GnRH/LH secretion. Using negative feedback regimens, as expected, E2 effectively suppressed LH levels in ovariectomized (OVX) wild-type (WT) mice to the levels seen in ovary-intact mice. Surprisingly, however, despite the fact that E2 regulation of Kiss1 mRNA expression was abrogated in both the ARC and AVPV of KERαKO mice, E2 also effectively decreased LH levels in OVX KERαKO mice to the levels seen in ovary-intact mice. Conversely, using a positive feedback regimen, E2 stimulated LH surges in WT mice, but had no effect in KERαKO mice. These experiments clearly demonstrate that ERα in kisspeptin neurons is required for the positive, but not negative feedback actions of E2 on GnRH/LH secretion in adult female mice. It remains to be determined whether the failure of KERαKO mice to exhibit GnRH/LH surges reflects the role of ERα in the development of kisspeptin neurons, in the active signaling processes leading to the release of GnRH/LH surges, or both. PMID:25545386

  14. Adult house fly (Diptera: Muscidae) activity and age of females near varying levels of (Z)-9-tricosene on a southern California dairy.


    Butler, Sarah M; Mullens, Bradley A


    The number of adult male and female house flies, Musca domestica L. (Diptera: Muscidae), near varying levels of (Z)-9-tricosene alone (5, 50, or 100 micdrol) or combined (50 microl) with sugar was determined using conical screened traps on a dairy in southern California. Overall, significantly more males than females were collected in the traps. Significantly more flies (male and female) were collected in traps with (Z)-9-tricosene. There were no significant differences among doses of (Z)-9-tricosene alone, but numbers of both sexes were significantly higher in traps baited with (Z)-9-tricosene and sugar compared with the 5- and 50-microl doses without sugar. The age of female flies collected in traps was determined by pterin analysis. Mean female ages ranged from 94.7 to 99.6 degree-days (6.3-6.8 d of age) and did not differ significantly among treatments. Dissections of a subset of females from each treatment determined that collected females were primarily nongravid (86.3%). Proportions of gravid females that were collected did not differ among treatments. PMID:21061998

  15. The sun, moon, wind, and biological imperative-shaping contrasting wintertime migration and foraging strategies of adult male and female northern fur seals (Callorhinus ursinus).


    Sterling, Jeremy T; Springer, Alan M; Iverson, Sara J; Johnson, Shawn P; Pelland, Noel A; Johnson, Devin S; Lea, Mary-Anne; Bond, Nicholas A


    Adult male and female northern fur seals (Callorhinus ursinus) are sexually segregated in different regions of the North Pacific Ocean and Bering Sea during their winter migration. Explanations for this involve interplay between physiology, predator-prey dynamics, and ecosystem characteristics, however possible mechanisms lack empirical support. To investigate factors influencing the winter ecology of both sexes, we deployed five satellite-linked conductivity, temperature, and depth data loggers on adult males, and six satellite-linked depth data loggers and four satellite transmitters on adult females from St. Paul Island (Bering Sea, Alaska, USA) in October 2009. Males and females migrated to different regions of the North Pacific Ocean: males wintered in the Bering Sea and northern North Pacific Ocean, while females migrated to the Gulf of Alaska and California Current. Horizontal and vertical movement behaviors of both sexes were influenced by wind speed, season, light (sun and moon), and the ecosystem they occupied, although the expression of the behaviors differed between sexes. Male dive depths were aligned with the depth of the mixed layer during daylight periods and we suspect this was the case for females upon their arrival to the California Current. We suggest that females, because of their smaller size and physiological limitations, must avoid severe winters typical of the northern North Pacific Ocean and Bering Sea and migrate long distances to areas of more benign environmental conditions and where prey is shallower and more accessible. In contrast, males can better tolerate often extreme winter ocean conditions and exploit prey at depth because of their greater size and physiological capabilities. We believe these contrasting winter behaviors 1) are a consequence of evolutionary selection for large size in males, important to the acquisition and defense of territories against rivals during the breeding season, and 2) ease environmental

  16. The Sun, Moon, Wind, and Biological Imperative–Shaping Contrasting Wintertime Migration and Foraging Strategies of Adult Male and Female Northern Fur Seals (Callorhinus ursinus)

    PubMed Central

    Sterling, Jeremy T; Springer, Alan M.; Iverson, Sara J.; Johnson, Shawn P.; Pelland, Noel A.; Johnson, Devin S.; Lea, Mary-Anne; Bond, Nicholas A.


    Adult male and female northern fur seals (Callorhinus ursinus) are sexually segregated in different regions of the North Pacific Ocean and Bering Sea during their winter migration. Explanations for this involve interplay between physiology, predator-prey dynamics, and ecosystem characteristics, however possible mechanisms lack empirical support. To investigate factors influencing the winter ecology of both sexes, we deployed five satellite-linked conductivity, temperature, and depth data loggers on adult males, and six satellite-linked depth data loggers and four satellite transmitters on adult females from St. Paul Island (Bering Sea, Alaska, USA) in October 2009. Males and females migrated to different regions of the North Pacific Ocean: males wintered in the Bering Sea and northern North Pacific Ocean, while females migrated to the Gulf of Alaska and California Current. Horizontal and vertical movement behaviors of both sexes were influenced by wind speed, season, light (sun and moon), and the ecosystem they occupied, although the expression of the behaviors differed between sexes. Male dive depths were aligned with the depth of the mixed layer during daylight periods and we suspect this was the case for females upon their arrival to the California Current. We suggest that females, because of their smaller size and physiological limitations, must avoid severe winters typical of the northern North Pacific Ocean and Bering Sea and migrate long distances to areas of more benign environmental conditions and where prey is shallower and more accessible. In contrast, males can better tolerate often extreme winter ocean conditions and exploit prey at depth because of their greater size and physiological capabilities. We believe these contrasting winter behaviors 1) are a consequence of evolutionary selection for large size in males, important to the acquisition and defense of territories against rivals during the breeding season, and 2) ease environmental

  17. Exposure to social defeat stress in adolescence improves the working memory and anxiety-like behavior of adult female rats with intrauterine growth restriction, independently of hippocampal neurogenesis.


    Furuta, Miyako; Ninomiya-Baba, Midori; Chiba, Shuichi; Funabashi, Toshiya; Akema, Tatsuo; Kunugi, Hiroshi


    Intrauterine growth restriction (IUGR) is a risk factor for memory impairment and emotional disturbance during growth and adulthood. However, this risk might be modulated by environmental factors during development. Here we examined whether exposing adolescent male and female rats with thromboxane A2-induced IUGR to social defeat stress (SDS) affected their working memory and anxiety-like behavior in adulthood. We also used BrdU staining to investigate hippocampal cellular proliferation and BrdU and NeuN double staining to investigate neural differentiation in female IUGR rats. In the absence of adolescent stress, IUGR female rats, but not male rats, scored significantly lower in the T-maze test of working memory and exhibited higher anxiety-like behavior in the elevated-plus maze test compared with controls. Adolescent exposure to SDS abolished these behavioral impairments in IUGR females. In the absence of adolescent stress, hippocampal cellular proliferation was significantly higher in IUGR females than in non-IUGR female controls and was not influenced by adolescent exposure to SDS. Hippocampal neural differentiation was equivalent in non-stressed control and IUGR females. Neural differentiation was significantly increased by adolescent exposure to SDS in controls but not in IUGR females. There was no significant difference in the serum corticosterone concentrations between non-stressed control and IUGR females; however, adolescent exposure to SDS significantly increased serum corticosterone concentration in control females but not in IUGR females. These results demonstrate that adolescent exposure to SDS improves behavioral impairment independent of hippocampal neurogenesis in adult rats with IUGR. PMID:25725425

  18. Female circumcision.


    Abu Daia, J M


    It is uncertain when female circumcision was first practiced, but it certainly preceded the founding of both Christianity and Islam. A review of past and current historical, popular and professional literature was undertaken, and 4 types of female circumcision were identified. Typically female circumcision is performed by a local village practitioner, lay person or by untrained midwives. Female genital mutilation is not accepted by any religious or medical opinion, and is a violation of human rights against helpless individuals who are unable to provide informed consent and who must therefore be protected through education and legislation. Complications of female circumcision can present after many years. Any medical practitioner (either for adult or pediatric) can be confronted with this issue of female circumcision, even in countries where this custom is not present, thus mandating the understanding of this complex issue. PMID:11369952

  19. Mortality of rocky mountain elk in Michigan due to meningeal worm

    USGS Publications Warehouse

    Bender, L.C.; Schmitt, S.M.; Carlson, E.; Haufler, J.B.; Beyer, D.E., Jr.


    Mortality from cerebrospinal parelaphostrongylosis caused by the meningeal worm (Parelaphostrongylus tenuis) has been hypothesized to limit elk (Cervus elaphus nelsoni) populations in areas where elk are conspecific with white-tailed deer (Odocoileus virginianus). Elk were reintroduced into Michigan (USA) in the early 1900s and subsequently greatly increased population size and distribution despite sympatric high-density (???12/km2) white-tailed deer populations. We monitored 100 radio-collared elk of all age and sex classes from 1981-94, during which time we documented 76 mortalities. Meningeal worm was a minor mortality factor for elk in Michigan and accounted for only 3% of mortalities, fewer than legal harvest (58%), illegal kills (22%), other diseases (7%), and malnutrition (4%). Across years, annual cause-specific mortality rates due to cerebrospinal parelaphostrongylosis were 0.033 (SE=0.006), 0.029 (SE=0.005), 0.000 (SE=0.001), and 0.000 (SE=0.000) for calves, 1-yr-old, 2-yr-old, and ???3-yr-old, respectively. The overall population-level mortality rate due to cerebrospinal parelaphostrongylosis was 0.009 (SE=0.001). Thus, meningeal worm had little impact on elk in Michigan during our study despite greater than normal precipitation (favoring gastropods) and record (???14 km2) deer densities. Further, elk in Michigan have shown sustained population rates-of-increase of ???18%/yr and among the highest levels of juvenile production and survival recorded for elk in North America, indicating that elk can persist in areas with meningeal worm at high levels of population productivity. it is likely that local ecologic characteristics among elk, white-tailed deer, and gastropods, and degree of exposure, age of elk, individual and population experience with meningeal worm, overall population vigor, and moisture determine the effects of meningeal worm on elk populations. ?? Wildlife Disease Association 2005.

  20. Elk-1 a Transcription Factor with Multiple Facets in the Brain

    PubMed Central

    Besnard, Antoine; Galan-Rodriguez, Beatriz; Vanhoutte, Peter; Caboche, Jocelyne


    The ternary complex factor (TCF) Elk-1 is a transcription factor that regulates immediate early gene (IEG) expression via the serum response element (SRE) DNA consensus site. Elk-1 is associated with a dimer of serum response factor (SRF) at the SRE site, and its phosphorylation occurs at specific residues in response to mitogen-activated protein kinases (MAPKs), including c-Jun-N terminal kinase (JNK), p38/MAPK, and extracellular-signal regulated kinase (ERK). This phosphorylation event is critical for triggering SRE-dependent transcription. Although MAPKs are fundamental actors for the instatement and maintenance of memory, and much investigation of their downstream signaling partners have been conducted, no data yet clearly implicate Elk-1 in these processes. This is partly due to the complexity of Elk-1 sub-cellular localization, and hence functions, within neurons. Elk-1 is present in its resting state in the cytoplasm, where it colocalizes with mitochondrial proteins or microtubules. In this particular sub-cellular compartment, overexpression of Elk-1 is toxic for neuronal cells. When phosphorylated by the MAPK/ERK, Elk-1 translocates to the nucleus where it is implicated in regulating chromatin remodeling, SRE-dependent transcription, and neuronal differentiation. Another post-translational modification is the conjugation to SUMO (Small Ubiquitin-like MOdifier), which relocalizes Elk-1 in the cytoplasm. Thus, Elk-1 plays a dual role in neuronal functions: pro-apoptotic within the cytoplasm, and pro-differentiation within the nucleus. To address the role of Elk-1 in the brain, one must be aware of its multiple facets, and design molecular tools that will shut down Elk-1 expression, trafficking, or activation, in specific neuronal compartments. We summarize in this review the known molecular functions of Elk-1, its regulation in neuronal cells, and present evidence of its possible implication in model systems of synaptic plasticity, learning, but also in

  1. Posture-specific phantoms representing female and male adults in Monte Carlo-based simulations for radiological protection

    NASA Astrophysics Data System (ADS)

    Cassola, V. F.; Kramer, R.; Brayner, C.; Khoury, H. J.


    Does the posture of a patient have an effect on the organ and tissue absorbed doses caused by x-ray examinations? This study aims to find the answer to this question, based on Monte Carlo (MC) simulations of commonly performed x-ray examinations using adult phantoms modelled to represent humans in standing as well as in the supine posture. The recently published FASH (female adult mesh) and MASH (male adult mesh) phantoms have the standing posture. In a first step, both phantoms were updated with respect to their anatomy: glandular tissue was separated from adipose tissue in the breasts, visceral fat was separated from subcutaneous fat, cartilage was segmented in ears, nose and around the thyroid, and the mass of the right lung is now 15% greater than the left lung. The updated versions are called FASH2_sta and MASH2_sta (sta = standing). Taking into account the gravitational effects on organ position and fat distribution, supine versions of the FASH2 and the MASH2 phantoms have been developed in this study and called FASH2_sup and MASH2_sup. MC simulations of external whole-body exposure to monoenergetic photons and partial-body exposure to x-rays have been made with the standing and supine FASH2 and MASH2 phantoms. For external whole-body exposure for AP and PA projection with photon energies above 30 keV, the effective dose did not change by more than 5% when the posture changed from standing to supine or vice versa. Apart from that, the supine posture is quite rare in occupational radiation protection from whole-body exposure. However, in the x-ray diagnosis supine posture is frequently used for patients submitted to examinations. Changes of organ absorbed doses up to 60% were found for simulations of chest and abdomen radiographs if the posture changed from standing to supine or vice versa. A further increase of differences between posture-specific organ and tissue absorbed doses with increasing whole-body mass is to be expected.

  2. In vitro flubendazole-induced damage to vital tissues in adult females of the filarial nematode Brugia malayi.


    O'Neill, Maeghan; Geary, James F; Agnew, Dalen W; Mackenzie, Charles D; Geary, Timothy G


    The use of a microfilaricidal drug for the control of onchocerciasis and lymphatic filariasis necessitates prolonged yearly dosing. Prospects for elimination or eradication of these diseases would be enhanced by availability of a macrofilaricidal drug. Flubendazole (FLBZ), a benzimidazole anthelmintic, is an appealing candidate macrofilaricide. FLBZ has demonstrated profound and potent macrofilaricidal effects in a number of experimental filarial rodent models and one human trial. Unfortunately, FLBZ was deemed unsatisfactory for use in mass drug administration (MDA) campaigns due to its markedly limited oral bioavailability. However, a new formulation that provided sufficient bioavailability following oral administration could render FLBZ an effective treatment for onchocerciasis and LF. This study characterized the effects of FLBZ and its reduced metabolite (FLBZ-R) on filarial nematodes in vitro to determine the exposure profile which results in demonstrable damage. Adult female Brugia malayi were exposed to varying concentrations of FLBZ or FLBZ-R (100 nM-10 μM) for up to five days, after which worms were fixed for histology. Morphological damage following exposure to FLBZ was observed prominently in the hypodermis and developing embryos at concentrations as low as 100 nM following 24 h exposure. The results indicate that damage to tissues required for reproduction and survival can be achieved at pharmacologically relevant concentrations. PMID:26288741

  3. Ovarian dysfunctions in adult female rat offspring born to mothers perinatally exposed to low doses of bisphenol A.


    Santamaría, Clarisa; Durando, Milena; Muñoz de Toro, Mónica; Luque, Enrique H; Rodriguez, Horacio A


    The study of oral exposure to the environmental estrogen bisphenol A (BPA) during the perinatal period and its effects on ovarian functionality in adulthood has generated special interest. Thus, our objective was to investigate ovarian folliculogenesis and steroidogenesis in adult female rat offspring born to mothers exposed to low doses of BPA (BPA50: 50μg/kgday; BPA0.5: 0.5μg/kgday) by the oral route during gestation and breastfeeding. Ovaries from both BPA-treated groups showed reduced primordial follicle recruitment and a greater number of corpora lutea, indicating an increased number of ovulated oocytes, coupled with higher levels of mRNA expression of 3β-hydroxysteroid dehydrogenase and serum progesterone. BPA50-treated animals had lower expression of androgen receptor (AR) at different stages of the growing follicle population. BPA0.5-treated rats evidenced an imbalance of AR expression between primordial/primary follicles, with higher mRNA-follicle-stimulating hormone receptor expression. These results add to the growing evidence that folliculogenesis and steroidogenesis are targets of BPA within the ovary. PMID:26658420

  4. Male and female experiences of having fertility matters raised alongside a cancer diagnosis during the teenage and young adult years.


    Crawshaw, M A; Glaser, A W; Hale, J P; Sloper, P


    Discussion and management of potential reproductive health sequelae of adolescent cancer are essential and challenging components of care for the multidisciplinary team. Despite this, research has been limited to specific experiences (e.g. sperm banking) or fertility-related concerns of adult survivors. This grounded theory study of 38 male and female survivors of adolescent cancer aged 16-30 years drew on in-depth single interviews to map the range of experiences of being advised that treatment might affect fertility. Strong support for being told at around diagnosis was found regardless of gender, age, incapacity or availability of fertility preservation services. Age and life stage appeared less significant for impact than the perceived level of threat to personal and social well-being. Women were more likely to achieve lower levels of comprehension about the physiological impact, to report later distress from lack of fertility preservation services and to revisit more frequently those decisions made by the few offered fertility preservation. Men found decision making about sperm banking straightforward on the whole and reported satisfaction with having the choice regardless of outcome. Findings suggest that young people can cope with this information alongside diagnosis especially when professional and parental support is proportionate to the particular impact on them. PMID:19594609

  5. In vitro flubendazole-induced damage to vital tissues in adult females of the filarial nematode Brugia malayi

    PubMed Central

    O'Neill, Maeghan; Geary, James F.; Agnew, Dalen W.; Mackenzie, Charles D.; Geary, Timothy G.


    The use of a microfilaricidal drug for the control of onchocerciasis and lymphatic filariasis necessitates prolonged yearly dosing. Prospects for elimination or eradication of these diseases would be enhanced by availability of a macrofilaricidal drug. Flubendazole (FLBZ), a benzimidazole anthelmintic, is an appealing candidate macrofilaricide. FLBZ has demonstrated profound and potent macrofilaricidal effects in a number of experimental filarial rodent models and one human trial. Unfortunately, FLBZ was deemed unsatisfactory for use in mass drug administration (MDA) campaigns due to its markedly limited oral bioavailability. However, a new formulation that provided sufficient bioavailability following oral administration could render FLBZ an effective treatment for onchocerciasis and LF. This study characterized the effects of FLBZ and its reduced metabolite (FLBZ-R) on filarial nematodes in vitro to determine the exposure profile which results in demonstrable damage. Adult female Brugia malayi were exposed to varying concentrations of FLBZ or FLBZ-R (100 nM–10 μM) for up to five days, after which worms were fixed for histology. Morphological damage following exposure to FLBZ was observed prominently in the hypodermis and developing embryos at concentrations as low as 100 nM following 24 h exposure. The results indicate that damage to tissues required for reproduction and survival can be achieved at pharmacologically relevant concentrations. PMID:26288741

  6. Effects of supplemental feeding on gastrointestinal parasite infection in Rocky Mountain Elk (Cervus elaphus)

    USGS Publications Warehouse

    Hines, Alicia M.; Ezenwa, Vanessa O.; Cross, Paul C.; Rogerson, Jared D.


    The effects of management practices on the spread and impact of parasites and infectious diseases in wildlife and domestic animals are of increasing concern worldwide, particularly in cases where management of wild species can influence disease spill-over into domestic animals. In the Greater Yellowstone Ecosystem, USA, winter supplemental feeding of Rocky Mountain elk (Cervus elaphus) may enhance parasite and disease transmission by aggregating elk on feedgrounds. In this study, we tested the effect of supplemental feeding on gastrointestinal parasite infection in elk by comparing fecal egg/oocyst counts of fed and unfed elk. We collected fecal samples from fed and unfed elk at feedground and control sites from January to April 2006, and screened all samples for parasites. Six different parasite types were identified, and 48.7% of samples were infected with at least one parasite. Gastrointenstinal (GI) nematodes (Nematoda: Strongylida), Trichuris spp., and coccidia were the most common parasites observed. For all three of these parasites, fecal egg/oocyst counts increased from January to April. Supplementally fed elk had significantly higher GI nematode egg counts than unfed elk in January and February, but significantly lower counts in April. These patterns suggest that supplemental feeding may both increase exposure and decrease susceptibility of elk to GI nematodes, resulting in differences in temporal patterns of egg shedding between fed and unfed elk.

  7. A Single Neonatal Injection of Ethinyl Estradiol Impairs Passive Avoidance Learning and Reduces Expression of Estrogen Receptor α in the Hippocampus and Cortex of Adult Female Rats

    PubMed Central

    Shiga, Tatsuomi; Nakamura, Takahiro J.; Komine, Chiaki; Goto, Yoshikuni; Mizoguchi, Yasushi; Yoshida, Midori; Kondo, Yasuhiko; Kawaguchi, Maiko


    Although perinatal exposure of female rats to estrogenic compounds produces irreversible changes in brain function, it is still unclear how the amount and timing of exposure to those substances affect learning function, or if exposure alters estrogen receptor α (ERα) expression in the hippocampus and cortex. In adult female rats, we investigated the effects of neonatal exposure to a model estrogenic compound, ethinyl estradiol (EE), on passive avoidance learning and ERα expression. Female Wistar-Imamichi rats were subcutaneously injected with oil, 0.02 mg/kg EE, 2 mg/kg EE, or 20 mg/kg 17β-estradiol within 24 h after birth. All females were tested for passive avoidance learning at the age of 6 weeks. Neonatal 0.02 mg/kg EE administration significantly disrupted passive avoidance compared with oil treatment in gonadally intact females. In a second experiment, another set of experimental females, treated as described above, was ovariectomized under pentobarbital anesthesia at 10 weeks of age. At 15–17 weeks of age, half of each group received a subcutaneous injection of 5 μg estradiol benzoate a day before the passive avoidance learning test. Passive avoidance learning behavior was impaired by the 0.02 mg/kg EE dose, but notably only in the estradiol benzoate-injected group. At 17–19 weeks of age, hippocampal and cortical samples were collected from rats with or without the 5 μg estradiol benzoate injection, and western blots used to determine ERα expression. A significant decrease in ERα expression was observed in the hippocampus of the estradiol-injected, neonatal EE-treated females. The results demonstrated that exposure to EE immediately after birth decreased learning ability in adult female rats, and that this may be at least partly mediated by the decreased expression of ERα in the hippocampus. PMID:26741502

  8. A Single Neonatal Injection of Ethinyl Estradiol Impairs Passive Avoidance Learning and Reduces Expression of Estrogen Receptor α in the Hippocampus and Cortex of Adult Female Rats.


    Shiga, Tatsuomi; Nakamura, Takahiro J; Komine, Chiaki; Goto, Yoshikuni; Mizoguchi, Yasushi; Yoshida, Midori; Kondo, Yasuhiko; Kawaguchi, Maiko


    Although perinatal exposure of female rats to estrogenic compounds produces irreversible changes in brain function, it is still unclear how the amount and timing of exposure to those substances affect learning function, or if exposure alters estrogen receptor α (ERα) expression in the hippocampus and cortex. In adult female rats, we investigated the effects of neonatal exposure to a model estrogenic compound, ethinyl estradiol (EE), on passive avoidance learning and ERα expression. Female Wistar-Imamichi rats were subcutaneously injected with oil, 0.02 mg/kg EE, 2 mg/kg EE, or 20 mg/kg 17β-estradiol within 24 h after birth. All females were tested for passive avoidance learning at the age of 6 weeks. Neonatal 0.02 mg/kg EE administration significantly disrupted passive avoidance compared with oil treatment in gonadally intact females. In a second experiment, another set of experimental females, treated as described above, was ovariectomized under pentobarbital anesthesia at 10 weeks of age. At 15-17 weeks of age, half of each group received a subcutaneous injection of 5 μg estradiol benzoate a day before the passive avoidance learning test. Passive avoidance learning behavior was impaired by the 0.02 mg/kg EE dose, but notably only in the estradiol benzoate-injected group. At 17-19 weeks of age, hippocampal and cortical samples were collected from rats with or without the 5 μg estradiol benzoate injection, and western blots used to determine ERα expression. A significant decrease in ERα expression was observed in the hippocampus of the estradiol-injected, neonatal EE-treated females. The results demonstrated that exposure to EE immediately after birth decreased learning ability in adult female rats, and that this may be at least partly mediated by the decreased expression of ERα in the hippocampus. PMID:26741502

  9. Reversing song behavior phenotype: testosterone driven induction of singing and measures of song quality in adult male and female canaries (Serinus canaria)

    PubMed Central

    Madison, Farrah N.; Rouse, Melvin L.; Balthazart, Jacques; Ball, Gregory F


    In songbirds, such as canaries (Serinus canaria), the song control circuit has been shown to undergo a remarkable change in morphology in response to exogenous testosterone (T). It is also well established that HVC, a telencephalic nucleus involved in song production, is significantly larger in males than in females. T regulates seasonal changes in HVC volume in males and exposure to exogenous T in adult females increases HVC volume and singing activity such that their song becomes more male-like in frequency and structure. However, whether there are sex differences in the ability of T to modulate changes in the song system and song behavior has not been investigated in canaries. In this study, we compared the effects of increasing doses of T on singing and song control nuclei volumes in adult male and female American Singer canaries exposed to identical environmental conditions. Males were castrated and all birds were placed on short days (8L:16D) for 8 weeks. Males and females were implanted either with a 2, 6 or 12 mm long Silastic™ implant filled with crystalline T or an empty 12 mm implant as control. Birds were then housed individually in sound attenuated chambers. Brains were collected from six birds from each group after 1 week or 3 weeks of treatment. Testosterone was not equally effective in increasing singing activity in both males and females. Changes in song quality and occurrence rate took place after a shorter latency in males than in females however, females did undergo marked changes in a number of measures of song behavior if given sufficient time. Males responded with an increase in HVC volume at all three doses. In females, T-induced changes in HVC volume only had limited amplitude and these volumes never reached male-typical levels a suggesting that there are sex differences in the neural substrate that responds to T. PMID:25260250


    USGS Publications Warehouse

    Ohlin, Henry N.; Spear, R.J.


    A mineral investigation in the nearly contiguous Black Butte and Elk Creek Roadless Areas of northern California, indicates that small parts of both roadless areas have a probable mineral-resource potential for small manganese-copper- or chromite-type deposits. There is little promise for the occurrence of energy resources in the areas. Investigation of geothermal resource potential and of the potential for other hydrothermal base- and precious-metal mineralization should be initiated.

  11. In-vivo delivery of FTY720 prevents radiation-induced ovarian failure and infertility in adult female non-human primates

    PubMed Central

    Zelinski, Mary B.; Murphy, Mark K.; Lawson, Maralee S.; Jurisicova, Andrea; Pau, K. Y. Francis; Toscano, Natalia P.; Jacob, Darla S.; Fanton, John K.; Casper, Robert F.; Dertinger, Stephen D.; Tilly, Jonathan L.


    Objective To determine if sphingosine-1-phosphate (S1P), or the S1P mimetic FTY720 shields ovaries of adult female rhesus monkeys from damage caused by 15 Gy of targeted radiotherapy, allowing for retention of long-term fertility; and, to evaluate if S1P protects human ovarian tissue xenografted into mice from radiation-induced damage. Design Research animal study. Setting Research laboratory and teaching hospital. Animal(s) Adult female rhesus macaques (8–14 years of age). Patient(s) Two women (24 and 27 years of age) undergoing gynecologic surgery for benign reasons, after informed consent and approval. Intervention(s) None. Main Outcome Measure(s) Ovarian histology, ovarian reserve measurements and fertility in mating trials. Result(s) Rapid ovarian failure was induced in female macaques by ovarian application of 15 Gy of radiation. Females given S1P or FTY720 by direct intraovarian cannulation for 1 week prior to ovarian irradiation rapidly resumed menstrual cycles due to maintenance of follicles, with greater beneficial effects achieved using FTY720. Monkeys given the S1P mimetic prior to ovarian irradiation also became pregnant in mating trials. Offspring conceived and delivered by radioprotected females developed normally, and showed no evidence of genomic instability as measured by micronucleus frequency in reticulocytes. Adult human ovarian cortical tissue xenografted into mice also exhibited a reduction in radiation-induced primordial oocyte depletion when pre-exposed to S1P. Conclusion(s) S1P and its analogs hold clinical promise as therapeutic agents to preserve both ovarian function and fertility in female cancer patients exposed to cytotoxic treatments. PMID:21316047

  12. Elk Monitoring Protocol for Lewis and Clark National Historical Park, Version 1.0

    USGS Publications Warehouse

    Jenkins, Kurt J.; Griffin, Paul C.; Boetsch, John R.; Cole, Carla


    Maintaining elk (Cervus elaphus roosevelti) herds that frequent Lewis and Clark National Historical Park (NHP) is central to the park’s purpose of preserving the historic, cultural, scenic, and natural resources. Elk were critical to sustaining the members of the Lewis and Clark expedition by providing food and clothing over the winter of 1805-1806. Today, elk viewing opportunities in the park and surrounding region generate broad appeal with the visiting public, which number over 250,000 per year at the Fort Clatsop visitor center. This protocol describes procedures for monitoring trends in the use of the Fort Clatsop area by Roosevelt elk. Specific objectives of elk monitoring in Lewis and Clark NHP are to measure the relative use and proportion of area used by elk during winter in the Fort Clatsop Unit of the park, and the rate at which elk are sighted from roads in and around the park. Relative use and the proportion of area used by elk are determined from elk fecal pellet surveys conducted every other year in the Fort Clatsop park unit. Pairs of observers visit a systematic array of permanent plots in the fall to clear them of elk fecal pellets, and return to the plots in late winter to count elk fecal pellets that have accumulated during winter. Half of the subplots are counted by two independent observers, which allows for the estimation of relative use and proportion of area occupied by elk with analyses of detection biases that account for unseen elk pellet groups. Standardized road surveys are conducted in and near the Fort Clatsop park unit three or four times monthly during alternate months. Data from road surveys are used to quantify the rate that park visitors would be expected to see elk, when driving the selected set of routes. The monitoring protocol is based on three field seasons of development and testing. The protocol narrative describes the background, rationale, sampling design, field methods, analytical methods, data management, reporting

  13. Investment in constitutive immune function by North American elk experimentally maintained at two different population densities.


    Downs, Cynthia J; Stewart, Kelley M; Dick, Brian L


    Natural selection favors individuals that respond with effective and appropriate immune responses to macro or microparasites. Animals living in populations close to ecological carrying capacity experience increased intraspecific competition, and as a result are often in poor nutritional condition. Nutritional condition, in turn, affects the amount of endogenous resources that are available for investment in immune function. Our objective was to understand the relationship between immune function and density dependence mediated by trade-offs between immune function, nutritional condition, and reproduction. To determine how immune function relates to density-dependent processes, we quantified bacteria killing ability, hemolytic-complement activity, and nutritional condition of North American elk (Cervus elaphus) from populations maintained at experimentally high- and low-population densities. When compared with elk from the low-density population, those from the high-density population had higher bacteria killing ability and hemolytic-complement activity despite their lower nutritional condition. Similarly, when compared with adults, yearlings had higher bacteria killing ability, higher hemolytic-complement activity, and lower nutritional condition. Pregnancy status and lactational status did not change either measure of constitutive immunity. Density-dependent processes affected both nutritional condition and investment in constitutive immune function. Although the mechanism for how density affects immunity is ambiguous, we hypothesize two possibilities: (i) individuals in higher population densities and in poorer nutritional condition invested more into constitutive immune defenses, or (ii) had higher parasite loads causing higher induced immune responses. Those explanations are not mutually exclusive, and might be synergistic, but overall our results provide stronger support for the hypothesis that animals in poorer nutritional condition invest more in

  14. Investment in Constitutive Immune Function by North American Elk Experimentally Maintained at Two Different Population Densities

    PubMed Central

    Downs, Cynthia J.; Stewart, Kelley M.; Dick, Brian L.


    Natural selection favors individuals that respond with effective and appropriate immune responses to macro or microparasites. Animals living in populations close to ecological carrying capacity experience increased intraspecific competition, and as a result are often in poor nutritional condition. Nutritional condition, in turn, affects the amount of endogenous resources that are available for investment in immune function. Our objective was to understand the relationship between immune function and density dependence mediated by trade-offs between immune function, nutritional condition, and reproduction. To determine how immune function relates to density-dependent processes, we quantified bacteria killing ability, hemolytic-complement activity, and nutritional condition of North American elk (Cervus elaphus) from populations maintained at experimentally high- and low-population densities. When compared with elk from the low-density population, those from the high-density population had higher bacteria killing ability and hemolytic-complement activity despite their lower nutritional condition. Similarly, when compared with adults, yearlings had higher bacteria killing ability, higher hemolytic-complement activity, and lower nutritional condition. Pregnancy status and lactational status did not change either measure of constitutive immunity. Density-dependent processes affected both nutritional condition and investment in constitutive immune function. Although the mechanism for how density affects immunity is ambiguous, we hypothesize two possibilities: (i) individuals in higher population densities and in poorer nutritional condition invested more into constitutive immune defenses, or (ii) had higher parasite loads causing higher induced immune responses. Those explanations are not mutually exclusive, and might be synergistic, but overall our results provide stronger support for the hypothesis that animals in poorer nutritional condition invest more in

  15. Immune function is related to adult carotenoid and bile pigment levels, but not to dietary carotenoid access during development, in female mallard ducks.


    Butler, Michael W; McGraw, Kevin J


    Immune function can be modulated by multiple physiological factors, including nutrition and reproductive state. Because these factors can vary throughout an individual's lifetime as a result of environmental conditions (affecting nutrition) or life-history stage (e.g. entering the adult reproduction stage), we must carefully examine the degree to which developmental versus adult conditions shape performance of the immune system. We investigated how variation in dietary access to carotenoid pigments - a class of molecules with immunostimulatory properties that females deposit into egg yolks - during three different developmental time points affected adult immunological and reproductive traits in female mallard ducks (Anas platyrhynchos). In males and females of other avian species, carotenoid access during development affects carotenoid assimilation ability, adult sexual ornamentation and immune function, while carotenoid access during adulthood can increase immune response and reproductive investment (e.g. egg-laying capacity, biliverdin deposition in eggshells). We failed to detect effects of developmental carotenoid supplementation on adult immune function [phytohemagglutinin-induced cutaneous immune response, antibody production in response to the novel antigen keyhole limpet hemocyanin (KLH), or oxidative burst, assessed by changes in circulating nitric oxide levels], carotenoid-pigmented beak coloration, ovarian development, circulating carotenoid levels or concentration of bile pigments in the gall bladder. However, we did uncover positive relationships between circulating carotenoid levels during adulthood and KLH-specific antibody production, and a negative relationship between biliverdin concentration in bile and KLH-specific antibody production. These results are consistent with the view that adult physiological parameters better predict current immune function than do developmental conditions, and highlight a possible, previously unstudied relationship

  16. Adult Female Human Being.

    ERIC Educational Resources Information Center

    Murray, Fran; Erickson, Mildred

    This handbook is intended as an informal guide for mature women returning to college or starting late. Chapter 1 describes the life patterns of women. Chapter 2 provides statistical information on working mothers, ages of women workers, educational achievement, jobs by sex, and women in labor unions and the labor force. Costs and benefits of jobs…

  17. Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages.


    Tsoyi, Konstantin; Geldart, Adriana M; Christou, Helen; Liu, Xiaoli; Chung, Su Wol; Perrella, Mark A


    ETS family proteins play a role in immune responses. A unique member of this family, Elk-3, is a transcriptional repressor that regulates the expression of HO-1. Elk-3 is very sensitive to the effects of inflammatory mediators and is down-regulated by bacterial endotoxin (LPS). In the present study, exposure of mouse macrophages to Escherichia coli LPS resulted in decreased, full-length, and splice-variant isoforms of Elk-3. We isolated the Elk-3 promoter and demonstrated that LPS also decreased promoter activity. The Elk-3 promoter contains GC-rich regions that are putative binding sites for zinc-finger transcription factors, such as Sp1 and KLFs. Mutation of the GC-rich region from bp -613 to -603 blunted LPS-induced down-regulation of the Elk-3 promoter. Similar to the LPS response, coexpression of KLF4 led to repression of Elk-3 promoter activity, whereas coexpression of Sp1 increased activity. ChIP assays revealed that KLF4 binding to the Elk-3 promoter was increased by LPS exposure, and Sp1 binding was decreased. Thus, down-regulation of Elk-3 by bacterial LPS is regulated, in part, by the transcriptional repressor KLF4. Overexpression of Elk-3, in the presence of E. coli bacteria, resulted in decreased macrophage phagocytosis. To determine whether limited expression of HO-1 may contribute to this response, we exposed HO-1-deficient bone marrow-derived macrophages to E. coli and found a comparable reduction in bacterial phagocytosis. These data suggest that down-regulation of Elk-3 and the subsequent induction of HO-1 are important for macrophage function during the inflammatory response to infection. PMID:25351511

  18. Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages

    PubMed Central

    Tsoyi, Konstantin; Geldart, Adriana M.; Christou, Helen; Liu, Xiaoli; Chung, Su Wol; Perrella, Mark A.


    ETS family proteins play a role in immune responses. A unique member of this family, Elk-3, is a transcriptional repressor that regulates the expression of HO-1. Elk-3 is very sensitive to the effects of inflammatory mediators and is down-regulated by bacterial endotoxin (LPS). In the present study, exposure of mouse macrophages to Escherichia coli LPS resulted in decreased, full-length, and splice-variant isoforms of Elk-3. We isolated the Elk-3 promoter and demonstrated that LPS also decreased promoter activity. The Elk-3 promoter contains GC-rich regions that are putative binding sites for zinc-finger transcription factors, such as Sp1 and KLFs. Mutation of the GC-rich region from bp –613 to –603 blunted LPS-induced down-regulation of the Elk-3 promoter. Similar to the LPS response, coexpression of KLF4 led to repression of Elk-3 promoter activity, whereas coexpression of Sp1 increased activity. ChIP assays revealed that KLF4 binding to the Elk-3 promoter was increased by LPS exposure, and Sp1 binding was decreased. Thus, down-regulation of Elk-3 by bacterial LPS is regulated, in part, by the transcriptional repressor KLF4. Overexpression of Elk-3, in the presence of E. coli bacteria, resulted in decreased macrophage phagocytosis. To determine whether limited expression of HO-1 may contribute to this response, we exposed HO-1-deficient bone marrow-derived macrophages to E. coli and found a comparable reduction in bacterial phagocytosis. These data suggest that down-regulation of Elk-3 and the subsequent induction of HO-1 are important for macrophage function during the inflammatory response to infection. PMID:25351511

  19. Substance Use to Cope with Stigma in Healthcare Among U.S. Female-to-Male Trans Masculine Adults

    PubMed Central

    Pardo, Seth T.; Gamarel, Kristi E.; Hughto, Jaclyn M. White; Pardee, Dana J.; Keo-Meier, Colton L.


    Abstract Purpose: Enacted and anticipated stigma exist within healthcare settings for transgender people, but research has yet to examine the effects of these forms of stigma on the substance use behaviors of female-to-male (FTM) trans masculine people. Methods: Data were analyzed from the cross-sectional U.S. National Transgender Discrimination Survey, a convenience sample of transgender adults purposively sampled in 2008. Trans masculine respondents (n=2,578) were identified using a two-step method: Step 1, Assigned birth sex; Step 2, Current gender identity. A gender minority stress model of substance use was tested to examine the relation of enacted and anticipated stigma with substance use to cope with mistreatment. Results: Overall, 14.1% of the sample reported having been refused care by a provider (enacted stigma), 32.8% reported delaying needed medical care when sick/injured, and 39.1% delayed routine preventive care (anticipated stigma). Having been refused care was significantly associated with avoidance of healthcare, including delaying needed medical care when sick/injured and delaying routine preventive medical care. Substance use to cope with mistreatment was self-reported by 27.6% of the sample. Enacted stigma by providers was associated with self-reported substance use to cope. Delays in both needed and preventive care (anticipated stigma) were highly associated with substance use, and attenuated the effect of enacted stigma. Conclusion: Gender minority-related stressors, particularly enacted and anticipated stigma in healthcare, should be integrated into substance use and abuse prevention and intervention efforts with this underserved population. PMID:26788773

  20. Vitamin D Receptor and Enzyme Expression in Dorsal Root Ganglia of Adult Female Rats: Modulation by Ovarian Hormones

    PubMed Central

    Tague, Sarah E.; Smith, Peter G.


    Vitamin D insufficiency impacts sensory processes including pain and proprioception, but little is known regarding vitamin D signaling in adult sensory neurons. We analyzed female rat dorsal root ganglia (DRG) for vitamin receptor (VDR) and the vitamin D metabolizing enzymes CYP27B1 and CYP24. Western blots and immunofluorescence revealed the presence of these proteins in sensory neurons. Nuclear VDR immunoreactivity was present within nearly all neurons, while cytoplasmic VDR was found preferentially in unmyelinated calcitonin gene-related peptide (CGRP)-positive neurons, colocalizing with CYP27B1 and CYP24. These data suggest that 1,25(OH)2D3 may affect sensory neurons through nuclear or extranuclear signaling pathways. In addition, local vitamin D metabolite concentrations in unmyelinated sensory neurons may be controlled through expression of CYP27B1 and CYP24. Because vitamin D deficiency appears to exacerbate some peri-menopausal pain syndromes, we assessed the effect of ovariectomy on vitamin D-related proteins. Two weeks following ovariectomy, total VDR expression in DRG dropped significantly, owing to a slight decrease in the percentage of total neurons expressing nuclear VDR and a large drop in unmyelinated CGRP-positive neurons expressing cytoplasmic VDR. Total CYP27B1 expression dropped significantly, predominantly due to decreased expression within unmyelinated CGRP-positive neurons. CYP24 expression remained unchanged. Therefore, unmyelinated CGRP-positive neurons appear to have a distinct vitamin D phenotype with hormonally-regulated ligand and receptor levels. These findings imply that vitamin D signaling may play a specialized role in a neural cell population that is primarily nociceptive. PMID:20969950

  1. Individual and molecular level effects of produced water contaminants on nauplii and adult females of Calanus finmarchicus.


    Jensen, Louise Kiel; Halvorsen, Elisabeth; Song, You; Hallanger, Ingeborg G; Hansen, Elisabeth Lindbo; Brooks, Steven J; Hansen, Bjørn Henrik; Tollefsen, Knut Erik


    In the Barents Sea region new petroleum fields are discovered yearly and extraction of petroleum products is expected to increase in the upcoming years. Despite enhanced technology and stricter governmental legislation, establishment of the petroleum industry in the Barents Sea may potentially introduce a new source of contamination to the area, as some discharges of produced water will be allowed. Whether the presence of produced water poses a risk to the Arctic marine life remains to be investigated. The aim of this study was to examine effects of exposure to several compounds found in produced water-a mixture of selected organic compounds (APW), radium-226 ((226)Ra), barium (Ba), and a scale inhibitor-on the copepod species Calanus finmarchicus. Experiments were performed using exposure concentrations at realistic levels based on those detected in the vicinity of known discharge points. The influence of lethal and sublethal effects on early life stages was determined and significantly lower survival in the APW exposure groups was found. In the Ba treatment the life stage development did not proceed to the same advanced stages as observed in the control (filtered sea water). The scale inhibitor and (226)Ra treatments showed no significant difference from control. In addition, adult females were exposed to APW, (226)Ra, and a mixture of the two. Both individual-level effects (egg production and feeding) and molecular-level effects (gene expression) were assessed. On the individual level endpoints, only treatments including APW produced an effect compared to control. However, on the molecular level the possibility that also (226)Ra induced toxicologically relevant effects cannot be ruled out. PMID:27484140

  2. [Comparative study of the long-term behavioral effects of noopept and piracetam in adult male rats and female rats in postnatal period].


    Voronina, T A; Guzevatykh, L S; Trofimov, S S


    Adult male and female rats were treated with the peptide nootrope drug noopept (daily dose, 0.1 mg/kg) and piracetam (200 mg/kg). In the period from 8th to 20th day, both drugs (cognitive enhancers) suppressed the horizontal and vertical activity and the anxiety in test animals as compared to the control group treated with 0.9 % aqueous NaCl solution. Early postnatal injections of the nootropes influenced neither the morphology development nor the behavior of adult female rats in the plus maze, extrapolational escape, passive avoidance, and pain sensitivity threshold tests. Animals in the "intact" group (having received neither drugs not physiological solution, that is, developing in a poor sensor environment), showed less pronounced habituation in the open field test as compared to the control and drug treated groups. PMID:15934357

  3. Temporal Gene Expression Profiles of Pre Blood-Fed Adult Females Immediately Following Eclosion in the Southern House Mosquito Culex Quinquefasciatus

    PubMed Central

    Reid, William R.; Zhang, Lee; Liu, Nannan


    Prior to acquisition of the first host blood meal, the anautogenous mosquito Culex quinquefasciatus requires a period of time in order to prepare for the blood feeding and, later, vitellogenesis. In the current study, we conducted whole transcriptome analyses of adult female Culex mosquitoes to identify genes that may be necessary for both taking of the blood meal, and processing of the blood meal in adult female mosquitoes Cx. quinquefasciatus. We examined temporal expression of genes for the periods of post eclosion and prior to the female freely taking a blood meal. We further evaluated the temporal expression of certain genes for the periods after the taking of a blood meal to identify genes that may be necessary for both the taking of the blood meal, and the processing of the blood meal. We found that adult females required a minimum of 48 h post-eclosion before they freely took their first blood meal. We hypothesized that gene expression signatures were altered in the mosquitoes before blood feeding in preparation for the acquisition of the blood meal through changes in multiple gene expression. To identify the genes involved in the acquisition of blood feeding, we quantified the gene expression levels of adult female Cx. quinquefasciatus using RNA Seq throughout a pre-blooding period from 2 to 72 h post eclosion at 12 h intervals. A total of 325 genes were determined to be differentially-expressed throughout the pre-blooding period, with the majority of differentially-expressed genes occurring between the 2 h and 12 h post-eclosion time points. Among the up-regulated genes were salivary proteins, cytochrome P450s, odorant-binding proteins, and proteases, while the majority of the down-regulated genes were hypothetical or cuticular genes. In addition, Trypsin was found to be up-regulated immediately following blood feeding, while trypsin and chymotrypsin were up-regulated at 48h and 60h post blood-feeding, respectively, suggesting that these proteases are

  4. The influence of herd size, conspecific risk, and predation risk on the vigilance of elk (Cervus elaphus) in Yellowstone National Park, and, Interest, learning, and a thematic biology course

    NASA Astrophysics Data System (ADS)

    Lung, Mark A.

    This dissertation is a composite of biological and educational research. The biological research concerns Rocky Mountain elk (Cervus elaphus ) behavior. The educational research presents ideas and findings on the influence of a thematic general biology course on student interest and perception of learning. The dissertation begins with a Preface that attempts to bring the ideas presented in later chapters together. Chapter One is a review of the literature concerning sociality, social behaviors, and elk biology. It summarizes current research literature as a means of introduction to Chapter Two. Chapter Two presents findings concerning the effects of herd size, predation risk, and the risk of being near conspecifics on two behaviors commonly associated with social animals---vigilance and aggression. Vigilance and aggression were measured in elk in Yellowstone National Park in two regions that varied in their presence of elk predators (wolves---Canis lupus, and grizzly bears---Ursus arctos) and in two seasons (spring and fall) that varied in the risks of being near conspecifics. Overall, male and female elk responded very differently. Male elk adjust their vigilance and aggression in response to changes in conspecific risk, but not to changes in predation risk. Female elk adjust their vigilance in response to changes in predation risk, but not to changes in conspecific risk. Males show no response in vigilance to changes in herd size. Non-reproductive females, however, adjust their levels of vigilance with changes in herd size in high risk regions. Interestingly, in the spring, vigilance decreases with increasing herd size, but in the fall, vigilance increases with increasing herd size. Chapter Three presents findings concerning the influence of a thematic course design on student perceptions of interest and teaming in a non-major's biology course (Bins 100: Concepts of Biology). I compared responses on student evaluations from two sections of Bios 100 taught in a

  5. Diurnal activity of Rocky Mountain elk (Cervus elaphus) and beef cattle (Bos taurus) grazing a northeastern Oregon summer range

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rocky Mountain elk (Cervus elaphus) and beef cattle (Bos taurus) exist in a complex social environment that is marked by diurnal activities such as periods of foraging, ruminating, resting, and sheltering. Elk unlike cattle, must be continually alert to potential predators. We hypothesize that elk...

  6. Some important elk-forest habitat relationships for Western Oregon and Washington. [Cervus canadensis

    SciTech Connect

    Witmer, G.; Wisdom, M.


    The report identifies some basic Roosevelt elk - habitat relationships so that the needs of elk could be better integrated with forestry practices and other human activities occurring in the forestlands of western Oregon and Washington. The relationships discussed are: space and water, large areas, cover areas, and interspersion component, and the roading/disturbance component. (ACR)

  7. Application of LANDSAT MSS to elk habitat management. [Blue Mountains, Oregon

    NASA Technical Reports Server (NTRS)

    Schrumpf, B. J.


    The utilization of information derived from LANDSAT multispectral scanner data to estimate the impact of proposed timber harvests on potential elk use is briefly discussed. The evaluations were conducted in Northeastern Oregon where several herds of Rocky Mountain elk range in the Blue Mountains. The inventory product is a geographically referenced data base containing land cover types and habitat components (cover/forage).

  8. Evidence of Parelaphostrongylus tenuis infections in free-ranging elk (Cervus elaphus) in southern Ontario

    PubMed Central

    McIntosh, Terese; Rosatte, Rick; Campbell, Doug; Welch, Kate; Fournier, Dominique; Spinato, Maria; Ogunremi, Oladele


    The antemortem detection of a Parelaphostrongylus tenuis infection in a free-ranging wild elk (Cervus elaphus) in southern Ontario is documented. Postmortems on other free-ranging elk that died during 2000–2005 indicated that 59% (17/29) were infected with P. tenuis, based on presence of lesions in the brain. PMID:18050795

  9. Effect of lunar phase on summer activity budgets of Rocky Mountain elk (Cervus elaphus nelsonii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rocky Mountain elk (Cervus elaphus) exist in a complex biological and social environment that is marked by necessary diurnal activities such as foraging, ruminating, and resting. It has long been understood that elk demonstrate circadian rhythms. One of the most predictable variables that could af...

  10. Spent Mushroom Substrate Influences Elk (Cervus Elaphus Canadensis) Hematological and Serum Biochemical Parameters

    PubMed Central

    Park, Jae Hong; Kim, Sang Woo; Do, Yoon Jung; Kim, Hyun; Ko, Yeoung Gyu; Yang, Boh Suk; Shin, Daekeun; Cho, Young Moo


    The objective of this study was to evaluate the effect of spent mushroom substrate (SMS) derived from Pleurotus eryngii on the hematological and biochemical blood properties of elk. A total of 18, two and three-year-old elk were fed three different levels of SMS (0, 15 and 20%) in a corn-wheat bran diet for 80 days. The results indicated significantly high levels of blood monocytes, hemoglobin (Hb), and hematocrit (HCT) in elk fed 15% or 20% SMS (p<0.05) compared to control animals. Serum blood urea nitrogen (BUN) and glucose concentrations were also significantly elevated in elk fed both 15% and 20% SMS. The inclusion of SMS in the elk diet did not affect serum total cholesterol, triglyceride, or low density lipoprotein (LDL)-cholesterol concentrations; however, high density lipoprotein (HDL)-cholesterol concentration was significantly increased in SMS-fed groups. In addition, 20% SMS in the diet increased serum iron and testosterone concentrations in elk. These results indicate that adding SMS to the diet of elk can increase their Hgb, serum BUN, glucose, and HDL-cholesterol concentration; therefore, diets containing SMS may enhance the physiologic condition of elk during growth. PMID:25049569

  11. Elk (Cervus elaphus canadensis) preference for feeds varying in selenium concentration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Selenium-accumulator plants are reputed to be unpalatable to large ungulates. Elk (Cervus elaphus canadensis) populations in south-eastern Idaho overlap with populations of Se-rich plants, but there is no information on the influence of plant Se concentration on elk dietary preferences. The objecti...

  12. Estradiol target neurons in the hypothalamic arcuate nucleus and lateral ventromedial nucleus of young adult, reproductively senescent, and monosodium glutamate-lesioned female golden hamsters

    SciTech Connect

    Blaha, G.C.; Lamperti, A.A.


    Histoautoradiographic methods were used to assess estrogen target neurons in the hypothalamic arcuate nucleus (ARC) and ventromedial nucleus, lateral portion (LVM), comparing young adult and aged female golden hamsters. A subgroup of young adult females had ARC lesions induced by monosodium glutamate at neonatal day 8. All were ovariectomized to remove endogenous estrogens. Controls were given nonradioactive estradiol. After /sup 3/H-estradiol (/sup 3/H-E2) was injected intravenously, hypothalami were removed, frozen, and processed for histoautoradiography. In the ARC and LVM the ratio of /sup 3/H-E2 labelled neurons to total neurons counted was significantly lower in the older animals. Young females with ARC lesions had very few /sup 3/H-E2 labelled neurons remaining in the ARC but had a normal complement in the LVM. Although /sup 3/H-E2 labelled ARC neurons were notably decreased in old females, those ARC neurons that were labelled in the old had virtually the same frequency distribution of the labelling index as in the young, suggesting no change in the average estrogen uptake per target cell.

  13. Radionuclide Concentrations in Deer and Elk from Los Alamos National Laboratory: 1991-1998

    SciTech Connect

    D. H. Kraig; J. K. Ferenbaugh; J. R. Biggs; K. D. Bennett; M. A. Mullen; P. R. Fresquez


    Mule deer (Odocoileus hemionus) and Rocky Mountain elk (Cervus elaphus) forage in many areas at Los Alamos National Laboratory (LANL) that may contain radioactivity above natural and/or worldwide fallout levels. This paper summarizes radionuclide concentrations 3H, 90Sr, 137Cs, 238Pu, 239,240Pu, 241Am, and total uranium in muscle and bone tissue of deer and elk collected from LANL lands from 1991 through 1998. Also, the committed effective dose equivalent (CEDE) and the risk of excess cancer fatalities (RECF) to people who ingest muscle and bone from deer and elk collected from LANL lands were estimated. Most radionuclide concentrations in muscle and bone from individual deer and elk collected from LANL lands were either at less than detectable quantities (where the analytical result was smaller than two counting uncertainties) and/or within upper (95%) level background (BG) concentrations. As a group, most radionuclides in muscle and bone of deer and elk from LANL lands were not significantly higher (p<0.10) than in similar tissues from deer and elk collected from BG locations. Also, elk that had been radio collared and tracked for two years and spent an average time of 50% on LANL lands were not significantly different in most radionuclides from road kill elk that have been collected as part of the environmental surveillance program. Overall, the upper (95%) level net CEDES (the CEDE plus two sigma for each radioisotope minus background) at the most conservative ingestion rate (51 lbs of muscle and 13 lbs of bone) were as follows: deer muscle = 0.220, deer bone = 3.762, elk muscle = 0.117, and elk bone = 1.67 mrendy. AU CEDES were far below the International Commission on Radiological Protection guideline of 100 mrem/y, and the highest muscle plus bone CEDE (4.0 mrendy) corresponded to a RECF of 2E-06 which is far below the Environmental Protection Agency upper level guideline of 1E04.

  14. Winter survival of adult female harlequin ducks in relation to history of contamination by the Exxon Valdez oil spill

    USGS Publications Warehouse

    Esler, Daniel; Schmutz, J.A.; Jarvis, R.L.; Mulcahy, D.M.


    Harlequin duck (Histrionicus histrionicus) life-history characteristics make their populations particularly vulnerable to perturbations during nonbreeding periods. The 1989 Exxon Valdez oil spill was a major perturbation to nonbreeding habitats of harlequin ducks in Prince William Sound, Alaska, which resulted in population injury. To assess the status of population recovery from the oil spill and to evaluate factors potentially constraining full recovery, we used radiotelemetry to examine survival of adult female harlequin ducks during winters of 1995-96, 1996-97, and 1997-98. We implanted 294 harlequin ducks (154 and 140 in oiled and unoiled areas, respectively) with transmitters and tracked their signals from aircraft during October through March. We examined variation in survival rates relative to area and season (early, mid, and late winter) through comparisons of models using Akaike's information criterion (AIC(c)) values. The 3 models best supported by the data indicated that survival of birds in oiled areas was lower than in unoiled areas. Inclusion of standardized body mass during wing molt in the 3 best models did not improve their fit, indicating that body mass during wing molt did not affect subsequent winter survival. In the model that best fit our data, survival was high in early winter for both areas, lower during mid and late winter seasons, and lowest in oiled areas during mid winter. Cumulative winter survival estimated from this model was 78.0% (SE = 3.3%) in oiled areas and 83.7% (SE = 2.9%) in unoiled areas. We determined that area differences in survival were more likely related to oiling history than intrinsic geographic differences. Based on a demographic model, area differences in survival offer a likely mechanism for observed declines in populations on oiled areas. Concurrent studies indicated that harlequin ducks continued to be exposed to residual Exxon Valdez oil as much as 9 years after the spill. We suggest that oil exposure

  15. Oviposition-altering and ovicidal potentials of five essential oils against female adults of the dengue vector, Aedes aegypti L.


    Warikoo, Radhika; Wahab, Naim; Kumar, Sarita


    The oviposition deterrence and ovicidal potential of five different essential oils, peppermint oil (Mentha piperita), basil oil (Ocimum basilicum), rosemary oil (Rosemarinus officinalis), citronella oil (Cymbopogon nardus), and celery seed oil (Apium graveolens), were assessed against female adults of the dengue vector, Aedes aegypti L. Multiple concentration tests were carried out where cups containing 1 mL of different concentrations (100%, 10%, 1%, 0.1%) of the oils and 199 mL of water were used for oviposition. The number of eggs laid and the larvae hatched in each cup were scored to evaluate the oviposition deterrent and ovicidal potentials of the oils. Our investigations revealed that the addition of 100% oil (pure oil) caused complete oviposition deterrence except in A. graveolens which resulted in 75% effective repellency. The use of 10% oil resulted in the maximum deterrence of 97.5% as shown by the M. piperita oil while other oils caused 36-97% oviposition deterrence as against the control. The oviposition medium with 1% oil showed decreased deterrent potential with 30-64% effective repellency, the M. piperita oil being exceptional. However, as the concentrations of the oil were reduced further to 0.1%, the least effective oil observed was A. graveolens (25% ER). Also, the M. piperita oil showed much reduced activity (40%) as compared to the control, while the other oils exhibited 51-58% repellency to oviposition. The studies on the ovicidal effects of these oils revealed that the eggs laid in the water with 100% essential oils did not hatch at all, whereas when 10% oils were used, only the R. officinalis oil resulted in 28% egg hatch. At lower concentrations (1%), the oils of M. piperita, O. basilicum, and C. nardus showed complete egg mortality while those of A. graveolens and R. officinalis resulted in 71% and 34% egg hatches, respectively. When used at 0.1%, the O. basilicum oil was found to be the only effective oil with 100% egg mortality, whereas

  16. Early consumption of blueberry diet protects against sex steroid deficiency-induced bone loss in adult female rats

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We studied the effects of blueberry consumption in early development on bone loss in ovariectomized (OVX) female rats later in life. Weanling female rats were fed AIN-93G semi-purified diets supplemented with 10% whole blueberry powder from PND 21 to PND34 (short-term group), or PND21 to PND81 (chro...

  17. A Child's Mind in the Adult Body: An Investigation of Perceptual Differences between Males and Females towards Emotional Maturity.

    ERIC Educational Resources Information Center

    Sandhu, Daya Singh


    Examined potential gender differences in emotional immaturity. Forty graduate students completed personal data sheets and Peter Pan Syndrome Test. Findings suggest widespread perceptions between females and males about prevalence of emotional immaturity among their significant others. Females seem to consider emotional immaturity special problem…

  18. The Female Sexual Subjectivity Inventory: Development and Validation of a Multidimensional Inventory for Late Adolescents and Emerging Adults

    ERIC Educational Resources Information Center

    Horne, Sharon; Zimmer-Gembeck, Melanie J.


    Three studies were conducted to develop and validate a theoretically derived multidimensional inventory of females' sexual self-conceptions ("sexual subjectivity"). Study 1 revealed five factors on the Female Sexual Subjectivity Inventory (FSSI): sexual body-esteem, three factors of conceptions and expectations of sexual desire and pleasure (self,…

  19. Shaking Youngsters and Shaken Adults: Female Beetles Eavesdrop on Larval Seed Vibrations to Make Egg-Laying Decisions.


    Guedes, Raul Narciso C; Yack, Jayne E


    Egg-laying decisions are critical for insects, and particularly those competing for limited resources. Sensory information used by females to mediate egg-laying decisions has been reported to be primarily chemical, but the role of vibration has received little attention. We tested the hypothesis that vibrational cues produced by feeding larvae occupying a seed influences egg-laying decisions amongst female cowpea beetles. This hypothesis is supported by three lines of evidence using two strains of the cowpea beetle (Callosobruchus maculatus), an Indian strain with choosy females and aggressively competing larvae and a Brazilian strain with less choosy females and larvae exhibiting an "accommodating" type of competition. First, in free-choice bioassays of seed selection, choosy Indian females selected control seeds (free of eggs, larvae, or egg-laying marker) over seeds with live larvae (free of eggs and egg-laying marker), but did not discriminate between control seeds and those with dead larvae. In contrast, less choosy Brazilian females showed no preference for seeds containing live or dead larvae over controls. Second, laser-doppler vibrometer recordings confirmed that larvae feeding inside seeds generate vibrations that are available to the female during egg-laying decisions. Third, during dichotomous choice experiments where artificial vibrations approximating those produced by feeding larvae were played back during seed selection, Indian females preferred immobile control seeds over vibrating seeds, but Brazilian females showed no preference. These results support the hypothesis that females use larval vibrations in their egg-laying decisions; whether these vibrations are passive cues exploited by the female, or active signals that 'steer' the behaviour of the female is unknown. We propose that vibration cues and signals could be important for host selection in insects, particularly those laying on substrates where visual or chemical cues may be unreliable

  20. Shaking Youngsters and Shaken Adults: Female Beetles Eavesdrop on Larval Seed Vibrations to Make Egg-Laying Decisions

    PubMed Central

    Guedes, Raul Narciso C.; Yack, Jayne E.


    Egg-laying decisions are critical for insects, and particularly those competing for limited resources. Sensory information used by females to mediate egg-laying decisions has been reported to be primarily chemical, but the role of vibration has received little attention. We tested the hypothesis that vibrational cues produced by feeding larvae occupying a seed influences egg-laying decisions amongst female cowpea beetles. This hypothesis is supported by three lines of evidence using two strains of the cowpea beetle (Callosobruchus maculatus), an Indian strain with choosy females and aggressively competing larvae and a Brazilian strain with less choosy females and larvae exhibiting an “accommodating” type of competition. First, in free-choice bioassays of seed selection, choosy Indian females selected control seeds (free of eggs, larvae, or egg-laying marker) over seeds with live larvae (free of eggs and egg-laying marker), but did not discriminate between control seeds and those with dead larvae. In contrast, less choosy Brazilian females showed no preference for seeds containing live or dead larvae over controls. Second, laser-doppler vibrometer recordings confirmed that larvae feeding inside seeds generate vibrations that are available to the female during egg-laying decisions. Third, during dichotomous choice experiments where artificial vibrations approximating those produced by feeding larvae were played back during seed selection, Indian females preferred immobile control seeds over vibrating seeds, but Brazilian females showed no preference. These results support the hypothesis that females use larval vibrations in their egg-laying decisions; whether these vibrations are passive cues exploited by the female, or active signals that ‘steer’ the behaviour of the female is unknown. We propose that vibration cues and signals could be important for host selection in insects, particularly those laying on substrates where visual or chemical cues may be

  1. The effects of prepubertal gonadectomy and binge-like ethanol exposure during adolescence on ethanol drinking in adult male and female rats

    PubMed Central

    Sherrill, Luke K.; Koss, Wendy A.; Foreman, Emily S.; Gulley, Joshua M.


    The pubertal surge in gonadal hormones that occurs during adolescence may impact the long-term effects of early alcohol exposure and sex differences in drinking behavior in adulthood. We investigated this hypothesis by performing sham or gonadectomy surgeries in Long Evans rats around postnatal day (P) 20. From P35–45, males and females were given saline or 3.0 g/kg ethanol using a binge-like model of exposure (8 injections total). As adults (P100), they were trained to self-administer ethanol via a sucrose-fading procedure and then given access to different unsweetened concentrations (5–20% w/v) for 5 days/concentration. We found that during adolescence, ethanol-induced intoxication was similar in males and females that underwent sham surgery. In gonadectomized males and females, however, the level of intoxication was greater following the last injection compared to the first. During adulthood, females drank more sucrose per body weight than males and binge-like exposure to ethanol reduced sucrose consumption in both sexes. These effects were not seen in gonadectomized rats. Ethanol consumption was higher in saline-exposed females compared to males, with gonadectomy reversing this sex difference by increasing consumption in males and decreasing it in females. Exposure to ethanol during adolescence augmented ethanol consumption in both sexes, but this effect was statistically significant only in gonadectomized females. Together, these results support a role for gonadal hormones during puberty in the short- and long-term effects of ethanol on behavior and in the development of sex differences in consummatory behavior during adulthood. PMID:20816899

  2. The effects of pre-pubertal gonadectomy and binge-like ethanol exposure during adolescence on ethanol drinking in adult male and female rats.


    Sherrill, Luke K; Koss, Wendy A; Foreman, Emily S; Gulley, Joshua M


    The pubertal surge in gonadal hormones that occurs during adolescence may impact the long-term effects of early alcohol exposure and sex differences in drinking behavior in adulthood. We investigated this hypothesis by performing sham or gonadectomy surgeries in Long-Evans rats around post-natal day (P) 20. From P35-45, males and females were given saline or 3.0 g/kg ethanol using a binge-like model of exposure (8 injections total). As adults (P100), they were trained to self-administer ethanol via a sucrose-fading procedure and then given access to different unsweetened concentrations (5-20%, w/v) for 5 days/concentration. We found that during adolescence, ethanol-induced intoxication was similar in males and females that underwent sham surgery. In gonadectomized males and females, however, the level of intoxication was greater following the last injection compared to the first. During adulthood, females drank more sucrose per body weight than males and binge-like exposure to ethanol reduced sucrose consumption in both sexes. These effects were not seen in gonadectomized rats. Ethanol consumption was higher in saline-exposed females compared to males, with gonadectomy reversing this sex difference by increasing consumption in males and decreasing it in females. Exposure to ethanol during adolescence augmented ethanol consumption in both sexes, but this effect was statistically significant only in gonadectomized females. Together, these results support a role for gonadal hormones during puberty in the short- and long-term effects of ethanol on behavior and in the development of sex differences in consummatory behavior during adulthood. PMID:20816899

  3. Recovering aspen follow changing elk dynamics in Yellowstone: evidence of a trophic cascade?


    Painter, Luke E; Beschta, Robert L; Larsen, Eric J; Ripple, William J


    To investigate the extent and causes of recent quaking aspen (Populus tremuloides) recruitment in northern Yellowstone National Park, we measured browsing intensity and height of young aspen in 87 randomly selected aspen stands in 2012, and compared our results to similar data collected in 1997-1998. We also examined the relationship between aspen recovery and the distribution of Rocky Mountain elk (Cervus elaphus) and bison (Bison bison) on the Yellowstone northern ungulate winter range, using ungulate fecal pile densities and annual elk count data. In 1998, 90% of young aspen were browsed and none were taller-than 200 cm, the height at which aspen begin to escape from elk browsing. In 2012, only 37% in the east and 63% in the west portions of the winter range were browsed, and 65% of stands in the east had young aspen taller than 200 cm. Heights of young aspen were inversely related to browsing intensity, with the least browsing and greatest heights in the eastern portion of the range, corresponding with recent changes in elk density and distribution. In contrast with historical elk distribution (1930s-1990s), the greatest densities of elk recently (2006-2012) have been north of the park boundary (approximately 5 elk/km2), and in the western part of the range (2-4 elk/km2), with relatively few elk in the eastern portion of the range (<2 elk/km2), even in mild winters. This redistribution of elk and decrease in density inside the park, and overall reduction in elk numbers, explain why many aspen stands have begun to recover. Increased predation pressure following the reintroduction of gray wolves (Canis lupius) in 1995-1996 played a role in these changing elk population dynamics, interacting with other influences including increased predation by bears (Ursus spp.), competition with an expanding bison population, and shifting patterns of human land use and hunting outside the park. The resulting new aspen recruitment is evidence of a landscape-scale trophic cascade

  4. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian


    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  5. Differential motor and sensory functional recovery in male but not female adult rats is associated with remyelination rather than axon regeneration after sciatic nerve crush.


    Tong, Ling-Ling; Ding, You-Quan; Jing, Hong-Bo; Li, Xuan-Yang; Qi, Jian-Guo


    Peripheral nerve functional recovery after injuries relies on both axon regeneration and remyelination. Both axon regeneration and remyelination require intimate interactions between regenerating neurons and their accompanying Schwann cells. Previous studies have shown that motor and sensory neurons are intrinsically different in their regeneration potentials. Moreover, denervated Schwann cells accompanying myelinated motor and sensory axons have distinct gene expression profiles for regeneration-associated growth factors. However, it is unknown whether differential motor and sensory functional recovery exists. If so, the particular one among axon regeneration and remyelination responsible for this difference remains unclear. Here, we aimed to establish an adult rat sciatic nerve crush model with the nonserrated microneedle holders and measured rat motor and sensory functions during regeneration. Furthermore, axon regeneration and remyelination was evaluated by morphometric analysis of electron microscopic images on the basis of nerve fiber classification. Our results showed that Aα fiber-mediated motor function was successfully recovered in both male and female rats. Aδ fiber-mediated sensory function was partially restored in male rats, but completely recovered in female littermates. For both male and female rats, the numbers of regenerated motor and sensory axons were quite comparable. However, remyelination was diverse among myelinated motor and sensory nerve fibers. In detail, Aβ and Aδ fibers incompletely remyelinated in male, but not female rats, whereas Aα fibers fully remyelinated in both sexes. Our result indicated that differential motor and sensory functional recovery in male but not female adult rats is associated with remyelination rather than axon regeneration after sciatic nerve crush. PMID:25830493

  6. Assignment of the gene (EPLG2) encoding a high-affinity binding protein for the receptor tyrosine kinase elk to a 200-kilobasepair region in human chromosome Xq12

    SciTech Connect

    Fletcher, F.A.; Beckmann, M.P.; Lyman, S.D.


    Elk is a member of the eph family of receptor tyrosine kinases. Elk is expressed only in the brain and testes of the developing and adult rat, and the interaction of elk with its ligand(s) has been suggested to play a role in the development or maintenance of the nervous system. The mouse gene Eplg2 encodes a potential elk ligand that is highly conserved among rat, mouse, and human. Eplg2 has been mapped to the central portion of the mouse X chromosome, tightly linked to the androgen receptor (Ar) locus. Linkage conservation between the mouse and the human X chromosomes suggested that the human homologue (EPLG2) would map near human AR, in the interval Xq11-q12. In the present study, we have confirmed this prediction and have localized EPLG2 to a 200-kb interval in Xq12 by somatic cell hybrid analysis, two-color fluorescence in situ hybridization (FISH), and yeast artificial chromosome (YAC) hybridization. 12 refs., 1 fig.

  7. Self-Control and Impulsiveness in Nondieting Adult Human Females: Effects of Visual Food Cues and Food Deprivation

    ERIC Educational Resources Information Center

    Forzano, Lori-Ann B.; Chelonis, John J.; Casey, Caitlin; Forward, Marion; Stachowiak, Jacqueline A.; Wood, Jennifer


    Self-control can be defined as the choice of a larger, more delayed reinforcer over a smaller, less delayed reinforcer, and impulsiveness as the opposite. Previous research suggests that exposure to visual food cues affects adult humans' self-control. Previous research also suggests that food deprivation decreases adult humans' self-control. The…

  8. The Lived Experience of the Adult African American Female Who Has Lived in Multiple Foster Care Placements

    ERIC Educational Resources Information Center

    Johnson, Avonda C.


    The purpose of the study was to examine and describe the lived experiences of the adult African American woman who had lived in multiple foster care placements. Eleven adult African American women ages 22-25 participated in semi-structured, face-to-face interviews to tell their stories and provide data of the memories of the experience. The…

  9. Effects of Dicto-Comp and Dictation on the Writing Skill of Female Adult Iranian EFL Learners

    ERIC Educational Resources Information Center

    Adel, Rahil; Hashemian, Mahmood


    This study was an attempt to clarify and remind L2 learners/teachers of 2 kinds of writing: dicto-comp and dictation. We explored the effect of controlled writing on the accuracy of the writing of adult Iranian EFL learners. Prior to the study, the homogeneity of 30 adult EFL learners was checked through an OPT test. Thirty participants were…

  10. Testing the ‘Extreme Female Brain’ Theory of Psychosis in Adults with Autism Spectrum Disorder with or without Co-Morbid Psychosis

    PubMed Central

    Larson, Felicity V.; Lai, Meng-Chuan; Wagner, Adam P.; Baron-Cohen, Simon; Holland, Anthony J.


    Introduction Males and females in the general population differ, on average, in their drive for empathizing (higher in females) and systemizing (higher in males). People with autism spectrum disorder (ASD) show a drive for systemizing over empathizing, irrespective of sex, which led to the conceptualisation of ASD as an ‘extreme of the typical male brain’. The opposite cognitive profile, an ‘extreme of the typical female brain’, has been proposed to be linked to conditions such as psychosis and mania/hypomania. Methods We compared an empathizing-over-systemizing bias (for short ‘empathizing bias’) in individuals with ASD, who had experienced psychotic illness (N = 64) and who had not (N = 71). Results There were overall differences in the distribution of cognitive style. Adults with ASD who had experienced psychosis were more likely to show an empathizing bias than adults with ASD who had no history of psychosis. This was modulated by IQ, and the group-difference was driven mainly by individuals with above-average IQ. In women with ASD and psychosis, the link between mania/hypomania and an empathizing bias was greater than in men with ASD. Conclusions The bias for empathizing over systemizing may be linked to the presence of psychosis in people with ASD. Further research is needed in a variety of clinical populations, to understand the role an empathizing bias may play in the development and manifestation of mental illness. PMID:26069955

  11. Life Table Analysis for Immatures and Female Adults of the Predatory Beetle, Delphastus catalinae, Feeding on Whiteflies Under Three Constant Temperatures

    PubMed Central

    Crisostomo Legaspi, Jesusa; Legaspi, Benjamin C.; Simmons, Alvin M.; Soumare, Mohamed


    Immature development and reproductive life history of Delphastus catalinae (Horn) (Coleoptera: Coccinellidae) feeding on Bemisia tabaci biotype B (Gennadius) (Homoptera: Aleyrodidae) (= B. argentifolii Bellows and Perring) immatures was studied at three constant temperatures: 22, 26 and 30 °C. Lower developmental threshold temperatures (T0) were estimated at 9 and 9.9 °C, for males and females, respectively. Female adults weighed slightly more than males (0.587 and 0.505 mg, respectively). As temperature increased from 22 to 30 °C, developmental time from eggs to eclosion of the adult declined from 24 to 15 days. Thermal units required for immature development was ∼300 degree-days. Percentage egg hatch declined at increasing temperatures, but no significant effect of time was found. The intrinsic rate of increase, r, increased from 0.048 to 0.082 and doubling time decreased from 14.44 to 8.45 days as temperature increased from 22 to 26 °C. Mean daily fecundity was modeled as a function of time and temperature to create a 3-dimensional surface. Overall, Delphastus catalinae was found to perform better at 22 and 26 °C while 30 °C was detrimental to immature development and adult reproduction. PMID:20345295

  12. Distinct morphological and electrophysiological properties of an elk prion peptide.


    Glaves, John Paul; Gorski, Przemek A; Alier, Kwai; Ma, Li; Renault, Ludovic; Primeau, Joseph O; Jhamandas, Jack H; Young, Howard S


    A key event in prion diseases is the conversion of the prion protein (PrP) from its native α-helical conformation to a misfolded, β-sheet rich conformation. Thus, preventing or reversing PrP misfolding could provide a means to disrupt prion disease progression and transmission. However, determining the structure of misfolded PrP has been notoriously difficult due to its inherent heterogeneity and aggregation behavior. For these reasons, simplified peptide fragments have been used as models that recapitulate characteristics of full-length PrP, such as amyloid-like aggregation and fibril formation, and in vitro toxicity. We provide a biochemical and structural comparison of PrP(127-147) peptides from elk, bovine and hamster using electrophysiology, electron microscopy and fluorescence. Our results demonstrate that the PrP(127-147) peptides adopt distinct populations of fibril structures. In addition, the elk PrP(127-147) peptide is unique in its ability to enhance Thioflavin T fluorescence and its ability to modulate neuronal ion channel conductances. PMID:23262353

  13. What is "natural"?: Yellowstone elk population? A case study

    USGS Publications Warehouse

    Keigley, R.B.; Wagner, F.H.


    Ecology analyzes the structure and function of ecosystems at all points along the continuum of human disturbance, from so-called pristine forests to urban backyards. Undisturbed systems provide reference points at one end of the spectrum, and nature reserves and parks are highly valued because they can provide unique examples of such ecosystems. Unfortunately the concept of “natural” or pristine is not that easy to define. Indeed, although ecologists have considered pre-Columbian, western-hemisphere ecosystems to have been largely unaltered by human action, and have termed their state “natural” or “pristine,” evidence from archaeology challenges this view. U.S. and Canadian national parks are charged with preserving the “natural,” and thus need to be able to understand and manage for the “natural.” A pivotal “natural” question in Yellowstone National Park management is the size of the northern-range, wintering elk population at Park establishment in 1872, argued both to have been small and large. Integrating and quantifying several sources of evidence provides a consistent picture of a low population (ca. 5,000–6,000), largely migrating out of the northern range in winter, with little vegetation impact. If we accept this conclusion about what is natural for the Yellowstone ecosystem, then it dramatically alters how we view management alternatives for the Park, which currently supports a northern wintering herd of up to ˜ 25,000 elk.

  14. Elk Hills Endangered Species Program: environmental assessment of the blunt-nosed leopard lizard, Crotaphytus silus. Phase 2, 1980

    SciTech Connect

    Mullen, R.K.


    This report represents an extension of previous findings concerning the status of the endangered species, Crotaphytus silus (blunt-nosed leopard lizard) on the Naval Petroleum Reserve Number 1 (NPR-1), Elk Hills, California. Previous findings in 1979 were limited to superficial observations of the occurrence and distribution of C. silus on NPR-1. The present report details findings from more extensive field work conducted from late May to early August 1980, and complements the 1979 work. The ultimate purpose of the investigations reported here is to provide sufficient bases for making informed decisions concerning the relationships of present and possible future oil-related activities at Elk Hills to the status of C. silus. There have been no particularly unique life history indicators of environmental impact on C. silus mediated through activities on NPR-1. Observations may be made, however, on the seasonal correlates of such activities: (1) individual C. silus may be buried or fatally exposed to the environment by construction activities occurring during the species' hibernation; (2) during periods when adult C. silus is active on the surface, construction activities may displace individuals that may not then be able to successfully occupy a new range, although it is to be noted in this regard that the home range of the species can be rather plastic; (3) construction activities bury or expose nest chambers of C. silus. This would unfavorably affect an average of three potential hatchlings with each burial or exposure; and (4) construction occurring when only (or predominantly) hatchlings are active on the surface may affect animals less able to avoid these activities than adults. In addition, hibernating adults will be affected, as previously noted.

  15. Elk3 from hamster--a ternary complex factor with strong transcriptional repressor activity.


    Hjortoe, Gertrud Malene; Weilguny, Dietmar; Willumsen, Berthe Marie


    Elk3 belongs to the Ets family of transcription factors, which are regulated by the Ras/mitogen-activated protein kinase-signaling pathway. In the absence of Ras, this protein is a strong inhibitor of transcription and may be directly involved in regulation of growth by downregulating the transcription of genes that are activated during entry into G1. We have isolated the Cricetulus griseus Elk3 gene from the Chinese hamster ovary (CHO) cell line and investigated the transcriptional potential of this factor. Transient transfections revealed that, in addition to its regulation of the c-fos promoter, Elk3 from CHO cells seems to inhibit other promoters controlling expression of proteins involved in G1/S phase progression; Cyclin D1 and DHFR. As has been described for the Elk3 homologs Net (Mouse) and Sap-2 (Human), the results of the present study further indicate that hamster Elk3 is a target of the Ras-Raf-MAPK pathway, and cotransfections with constitutively active H-ras relieves its negative transcriptional activity. No cells stably expressing exogenous Elk3 could be obtained, possibly due to an unspecified toxic or growth retarding effect. These findings support a possible role for Elk3 in growth regulation and reveal a high degree of homology for this protein across species. PMID:15684718

  16. Elk3 is essential for the progression from progenitor to definitive neural crest cell.


    Rogers, Crystal D; Phillips, Jacquelyn L; Bronner, Marianne E


    Elk3/Net/Sap2 (here referred to as Elk3) is an Ets ternary complex transcriptional repressor known for its involvement in angiogenesis during embryonic development. Although Elk3 is expressed in various tissues, additional roles for the protein outside of vasculature development have yet to be reported. Here, we characterize the early spatiotemporal expression pattern of Elk3 in the avian embryo using whole mount in situ hybridization and quantitative RT-PCR and examine the effects of its loss of function on neural crest development. At early stages, Elk3 is expressed in the head folds, head mesenchyme, intersomitic vessels, and migratory cranial neural crest (NC) cells. Loss of the Elk3 protein results in the retention of Pax7+ precursors in the dorsal neural tube that fail to upregulate neural crest specifier genes, FoxD3, Sox10 and Snail2, resulting in embryos with severe migration defects. The results putatively place Elk3 downstream of neural plate border genes, but upstream of neural crest specifier genes in the neural crest gene regulatory network (NC-GRN), suggesting that it is critical for the progression from progenitor to definitive neural crest cell. PMID:23266330

  17. Response of Rocky Mountain elk (Cervus elaphus) to wind-power development

    USGS Publications Warehouse

    Walter, W. David; Leslie, David M., Jr.; Jenks, J.A.


    Wind-power development is occurring throughout North America, but its effects on mammals are largely unexplored. Our objective was to determine response (i.e., home-range, diet quality) of Rocky Mountain elk (Cervus elaphus) to wind-power development in southwestern Oklahoma. Ten elk were radiocollared in an area of wind-power development on 31 March 2003 and were relocated bi-weekly through March 2005. Wind-power construction was initiated on 1 June 2003 and was completed by December 2003 with 45 active turbines. The largest composite home range sizes (>80 km2) occurred April-June and September, regardless of the status of wind-power facility development. The smallest home range sizes (<50 km2) typically occurred in October-February when elk aggregated to forage on winter wheat. No elk left the study site during the study and elk freely crossed the gravel roads used to access the wind-power facility. Carbon and nitrogen isotopes and percent nitrogen in feces suggested that wind-power development did not affect nutrition of elk during construction. Although disturbance and loss of some grassland habitat was apparent, elk were not adversely affected by wind-power development as determined by home range and dietary quality.

  18. Unusual behavior by bison, Bison bison, toward elk, Cervus elaphus, and wolves, Canis lupus

    USGS Publications Warehouse

    Mech, L.D.; McIntyre, R.T.; Smith, D.W.


    Incidents are described of bison (Bison bison) in Yellowstone National Park mauling and possibly killing a young elk (Cervus elaphus) calf, chasing wolves (Canis lupus) off elk they had just killed or were killing, and keeping the wolves away for extended periods. During one of the latter cases, the bison knocked a wolf-wounded elk down. Bison were also seen approaching wolves that were resting and sleeping, rousting them, following them to new resting places and repeating this behavior. These behaviors might represent some type of generalized hyper-defensiveness that functions as an anti-predator strategy.

  19. Unusual behavior by Bison, Bison bison, toward Elk, Cervus elaphus, and wolves, Canis lupus

    USGS Publications Warehouse

    Mech, L.D.; McIntyre, R.T.; Smith, D.W.


    Incidents are described of Bison (Bison bison) in Yellowstone National Park mauling and possibly killing a young Elk (Cervus elaphus) calf, chasing wolves (Canis lupus) off Elk they had just killed or were killing, and keeping the wolves away for extended periods. During one of the latter cases, the Bison knocked a wolf-wounded Elk down. Bison were also seen approaching wolves that were resting and sleeping, rousting them, following them to new resting places and repeating this behavior. These behaviors might represent some type of generalized hyper-defensiveness that functions as an anti-predator strategy.

  20. Elk-3 is a transcriptional repressor of nitric-oxide synthase 2.


    Chen, Yen-Hsu; Layne, Matthew D; Chung, Su Wol; Ejima, Kuniaki; Baron, Rebecca M; Yet, Shaw-Fang; Perrella, Mark A


    The inducible isoform of nitric-oxide synthase (NOS2), a key enzyme catalyzing the dramatic increase in nitric oxide by lipopolysaccharide (LPS), plays an important role in the pathophysiology of endotoxemia and sepsis. Recent evidence suggests that Ets transcription factors may contribute to NOS2 induction by inflammatory stimuli. In this study, we investigated the role of Ets transcription factors in the regulation of NOS2 by LPS and transforming growth factor (TGF)-beta 1. Transient transfection assays in macrophages showed that Ets-2 produced an increase in NOS2 promoter activity, whereas the induction by Ets-1 was modest and NERF2 had no effect. Elk-3 (Net/Erp/Sap-2a) markedly repressed NOS2 promoter activity in a dose-dependent fashion, and overexpression of Elk-3 blunted the induction of endogenous NOS2 message. Mutation of the Net inhibitory domain of Elk-3, but not the C-terminal-binding protein interaction domain, partially alleviated this repressive effect. We also found that deletion of the Ets domain of Elk-3 completely abolished its repressive effect on the NOS2 promoter. LPS administration to macrophages led to a dose-dependent decrease in endogenous Elk-3 mRNA levels, and this decrease in Elk-3 preceded the induction of NOS2 mRNA. In a mouse model of endotoxemia, the expression of Elk-3 in kidney, lung, and heart was significantly down-regulated after systemic administration of LPS, and this down-regulation also preceded NOS2 induction. Moreover, TGF-beta 1 significantly increased endogenous Elk-3 mRNA levels that had been down-regulated by LPS in macrophages. This increase in Elk-3 correlated with a TGF-beta 1-induced down-regulation of NOS2. Taken together, our data suggest that Elk-3 is a strong repressor of NOS2 promoter activity and mRNA levels and that endogenous expression of Elk-3 inversely correlates with NOS2. Thus, Elk-3 may serve as an important mediator of NOS2 gene expression. PMID:12896968

  1. Elevated Rocky Mountain elk numbers prevent positive effects of fire on quaking aspen (Populus tremuloides) recruitment

    USGS Publications Warehouse

    Smith, David Solance; Fettig, Stephen M.; Bowker, Matthew A.


    Quaking aspen (Populus tremuloides) is the most widespread tree species in North America and has supported a unique ecosystem for tens of thousands of years, yet is currently threatened by dramatic loss and possible local extinctions. While multiple factors such as climate change and fire suppression are thought to contribute to aspen’s decline, increased browsing by elk (Cervus elaphus), which have experienced dramatic population increases in the last ∼80 years, may severely inhibit aspen growth and regeneration. Fires are known to favor aspen recovery, but in the last several decades the spatial scale and intensity of wildfires has greatly increased, with poorly understood ramifications for aspen growth. Here, focusing on the 2000 Cerro Grande fire in central New Mexico – one of the earliest fires described as a “mega-fire” - we use three methods to examine the impact of elk browsing on aspen regeneration after a mega-fire. First, we use an exclosure experiment to show that aspen growing in the absence of elk were 3× taller than trees growing in the presence of elk. Further, aspen that were both protected from elk and experienced burning were 8.5× taller than unburned trees growing in the presence of elk, suggesting that the combination of release from herbivores and stimulation from fire creates the largest aspen growth rates. Second, using surveys at the landscape level, we found a correlation between elk browsing intensity and aspen height, such that where elk browsing was highest, aspen were shortest. This relationship between elk browsing intensity and aspen height was stronger in burned (r = −0.53) compared to unburned (r = −0.24) areas. Third, in conjunction with the landscape-level surveys, we identified possible natural refugia, microsites containing downed logs, shrubs etc. that may inhibit elk browsing by physically blocking aspen from elk or by impeding elk’s ability to move through the forest patch. We did not find any

  2. Fortuitous Encounters between Seagliders and Adult Female Northern Fur Seals (Callorhinus ursinus) off the Washington (USA) Coast: Upper Ocean Variability and Links to Top Predator Behavior

    PubMed Central

    Pelland, Noel A.; Sterling, Jeremy T.; Lea, Mary-Anne; Bond, Nicholas A.; Ream, Rolf R.; Lee, Craig M.; Eriksen, Charles C.


    Behavioral responses by top marine predators to oceanographic features such as eddies, river plumes, storms, and coastal topography suggest that biophysical interactions in these zones affect predators' prey, foraging behaviors, and potentially fitness. However, examining these pathways is challenged by the obstacles inherent in obtaining simultaneous observations of surface and subsurface environmental fields and predator behavior. In this study, migratory movements and, in some cases, diving behavior of 40 adult female northern fur seals (NFS; Callorhinus ursinus) were quantified across their range and compared to remotely-sensed environmental data in the Gulf of Alaska and California Current ecosystems, with a particular focus off the coast of Washington State (USA) – a known foraging ground for adult female NFS and where autonomous glider sampling allowed opportunistic comparison of seal behavior to subsurface biophysical measurements. The results show that in these ecosystems, adult female habitat utilization was concentrated near prominent coastal topographic, riverine, or inlet features and within 200 km of the continental shelf break. Seal dive depths, in most ecosystems, were moderated by surface light level (solar or lunar), mirroring known behaviors of diel vertically-migrating prey. However, seal dives differed in the California Current ecosystem due to a shift to more daytime diving concentrated at or below the surface mixed layer base. Seal movement models indicate behavioral responses to season, ecosystem, and surface wind speeds; individuals also responded to mesoscale eddies, jets, and the Columbia River plume. Foraging within small scale surface features is consistent with utilization of the inner coastal transition zone and habitats near coastal capes, which are known eddy and filament generation sites. These results contribute to our knowledge of NFS migratory patterns by demonstrating surface and subsurface behavioral responses to a spatially

  3. A randomized comparative trial of a combined oral contraceptive and azelaic acid to assess their effect on sleep quality in adult female acne patients.


    Albuquerque, Rachel Gimenes; da Rocha, Marco Alexandre Dias; Hirotsu, Camila; Hachul, Helena; Bagatin, Edileia; Tufik, Sergio; Andersen, Monica Levy


    Several studies have reported an increase in the prevalence of adult female acne. This subtype of acne presents particular characteristics, and can be triggered by several factors such as smoking, stress, the use of oily cosmetics and even by poor sleep. Sleep quality is related to well-being and the maintenance of body homeostasis. In addition, several skin diseases present a bidirectional relationship with sleep, demonstrating an important connection between skin and the central nervous system. With this in mind, we aimed to compare the effect of two types of treatment for adult female acne (azelaic acid or a combined oral contraceptive) on sleep quality and on concentrations of stress hormones. Also, we proposed to assess the correlation of sleep and hormonal parameters with acne severity. In order to do this, 32 women underwent a clinical evaluation, completed the Pittsburgh Sleep Quality Index (PSQI) questionnaire and had their blood collected for hormone assays. These procedures were performed at baseline and after 6 months of treatment. At baseline there were no differences between the groups in terms of body mass index, age, acne severity and hormone concentrations. Results showed that both treatments demonstrated effectiveness but that women treated with azelaic acid presented a better sleep quality after the treatment compared to baseline and to the group treated with the combined oral contraceptive. The combined oral contraceptive group presented an increase in cortisol and a decrease in free testosterone concentration in relation to baseline. These data suggest that both azelaic acid and combined oral contraceptive are effective in the treatment of adult female acne but, azelaic acid seems to be a more suitable option for those women who may benefit from a better subjective sleep quality. PMID:26472098

  4. Fortuitous encounters between seagliders and adult female northern fur seals (Callorhinus ursinus) off the Washington (USA) coast: upper ocean variability and links to top predator behavior.


    Pelland, Noel A; Sterling, Jeremy T; Lea, Mary-Anne; Bond, Nicholas A; Ream, Rolf R; Lee, Craig M; Eriksen, Charles C


    Behavioral responses by top marine predators to oceanographic features such as eddies, river plumes, storms, and coastal topography suggest that biophysical interactions in these zones affect predators' prey, foraging behaviors, and potentially fitness. However, examining these pathways is challenged by the obstacles inherent in obtaining simultaneous observations of surface and subsurface environmental fields and predator behavior. In this study, migratory movements and, in some cases, diving behavior of 40 adult female northern fur seals (NFS; Callorhinus ursinus) were quantified across their range and compared to remotely-sensed environmental data in the Gulf of Alaska and California Current ecosystems, with a particular focus off the coast of Washington State (USA)--a known foraging ground for adult female NFS and where autonomous glider sampling allowed opportunistic comparison of seal behavior to subsurface biophysical measurements. The results show that in these ecosystems, adult female habitat utilization was concentrated near prominent coastal topographic, riverine, or inlet features and within 200 km of the continental shelf break. Seal dive depths, in most ecosystems, were moderated by surface light level (solar or lunar), mirroring known behaviors of diel vertically-migrating prey. However, seal dives differed in the California Current ecosystem due to a shift to more daytime diving concentrated at or below the surface mixed layer base. Seal movement models indicate behavioral responses to season, ecosystem, and surface wind speeds; individuals also responded to mesoscale eddies, jets, and the Columbia River plume. Foraging within small scale surface features is consistent with utilization of the inner coastal transition zone and habitats near coastal capes, which are known eddy and filament generation sites. These results contribute to our knowledge of NFS migratory patterns by demonstrating surface and subsurface behavioral responses to a spatially

  5. A global assembly of adult female mosquito mark-release-recapture data to inform the control of mosquito-borne pathogens

    PubMed Central


    Background Pathogen transmission by mosquitos is known to be highly sensitive to mosquito bionomic parameters. Mosquito mark-release-recapture (MMRR) experiments are a standard method for estimating such parameters including dispersal, population size and density, survival, blood feeding frequency and blood meal host preferences. Methods We assembled a comprehensive database describing adult female MMRR experiments. Bibliographic searches were used to build a digital library of MMRR studies and selected data describing the reported outcomes were extracted. Results The resulting database contained 774 unique adult female MMRR experiments involving 58 vector mosquito species from the three main genera of importance to human health: Aedes, Anopheles and Culex. Crude examination of these data revealed patterns associated with geography as well as mosquito genus, consistent with bionomics varying by species-specific life history and ecological context. Recapture success varied considerably and was significantly different amongst genera, with 8, 4 and 1% of adult females recaptured for Aedes, Anopheles and Culex species, respectively. A large proportion of experiments (59%) investigated dispersal and survival and many allowed disaggregation of the release and recapture data. Geographic coverage was limited to just 143 localities around the world. Conclusions This MMRR database is a substantial contribution to the compilation of global data that can be used to better inform basic research and public health interventions, to identify and fill knowledge gaps and to enrich theory and evidence-based ecological and epidemiological studies of mosquito vectors, pathogen transmission and disease prevention. The database revealed limited geographic coverage and a relative scarcity of information for vector species of substantial public health relevance. It represents, however, a wealth of entomological information not previously compiled and of particular interest for mosquito

  6. Allometric variation among juvenile, adult male and female eastern bearded dragons Pogona barbata (Cuvier, 1829), with comments on the behavioural implications.


    Wotherspoon, Danny; Burgin, Shelley


    The functional significance of allometric change in reptiles has received limited attention and the reason for such changes has been regarded as 'obscure'. In this paper we report data on the Australian Pogona barbata, the eastern bearded dragon, from across their range and review changes in allometric growth among juveniles, and adult males and females and consider the functional relevance of these changes. There were significant differences in the population for mass, tail length, tail width, rear leg length and jaw length. These differences were consistent with differences required in locomotor performance and thus habitat use, together with access to different preferred dietary components. PMID:21236651

  7. Behavioral Differences Between Late Preweanling and Adult Female Sprague-Dawley Rat Exploration of Animate and Inanimate Stimuli and Food

    PubMed Central

    Smith, Kiersten S.; Morrell, Joan I.


    The late preweanling rat has potential as a preclinical model for disorders initially manifested in early childhood that are characterized by dysfunctional interactions with specific stimuli (e.g., obsessive-compulsive disorder and autism). No reports, however, of specific-stimulus exploration in the late preweanling rat are found in the literature. We examined the behavioral responses of normal late preweanling (PND 18-19) and adult rats when presented with exemplars of categorically-varied stimuli, including inanimate objects systematically varied in size and interactive properties, biological stimuli, and food. Preweanlings were faster to initiate specific stimulus exploration and were more interactive with most specific stimuli than adults; the magnitude of these preweanling-adult quantitative differences ranged from fairly small to very large depending upon the stimulus. In contrast, preweanlings were adult-like in their interaction with food and prey. Preweanling response to some stimuli, for example to live pups, was qualitatively different from that of adults; the preweanling behavioral repertoire was characterized by pup-seeking while the adult response was characterized by pup-avoidance. The specific stimulus interactions of preweanlings were less impacted than those of adults by the time of day of testing and placement of a stimulus in an anxiety-provoking location. The impact of novelty was stimulus dependent. The differences in interactions of preweanlings versus adults with specific stimuli suggests that CNS systems underlying these behavior patterns are at different stages of immaturity at PND 18 such that there may be an array of developmental trajectories for various categories of specific stimuli. These data provide a basis for the use of the preweanling as a preclinical model for understanding and medicating human disorders during development that are characterized by dysfunctional interactions with specific stimuli. PMID:21056059

  8. Sox9 and Sox8 protect the adult testis from male-to-female genetic reprogramming and complete degeneration

    PubMed Central

    Barrionuevo, Francisco J; Hurtado, Alicia; Kim, Gwang-Jin; Real, Francisca M; Bakkali, Mohammed; Kopp, Janel L; Sander, Maike; Scherer, Gerd; Burgos, Miguel; Jiménez, Rafael


    The new concept of mammalian sex maintenance establishes that particular key genes must remain active in the differentiated gonads to avoid genetic sex reprogramming, as described in adult ovaries after Foxl2 ablation. Dmrt1 plays a similar role in postnatal testes, but the mechanism of adult testis maintenance remains mostly unknown. Sox9 and Sox8 are required for postnatal male fertility, but their role in the adult testis has not been investigated. Here we show that after ablation of Sox9 in Sertoli cells of adult, fertile Sox8-/- mice, testis-to-ovary genetic reprogramming occurs and Sertoli cells transdifferentiate into granulosa-like cells. The process of testis regression culminates in complete degeneration of the seminiferous tubules, which become acellular, empty spaces among the extant Leydig cells. DMRT1 protein only remains in non-mutant cells, showing that SOX9/8 maintain Dmrt1 expression in the adult testis. Also, Sox9/8 warrant testis integrity by controlling the expression of structural proteins and protecting Sertoli cells from early apoptosis. Concluding, this study shows that, in addition to its crucial role in testis development, Sox9, together with Sox8 and coordinately with Dmrt1, also controls adult testis maintenance. DOI: PMID:27328324

  9. Sox9 and Sox8 protect the adult testis from male-to-female genetic reprogramming and complete degeneration.


    Barrionuevo, Francisco J; Hurtado, Alicia; Kim, Gwang-Jin; Real, Francisca M; Bakkali, Mohammed; Kopp, Janel L; Sander, Maike; Scherer, Gerd; Burgos, Miguel; Jiménez, Rafael


    The new concept of mammalian sex maintenance establishes that particular key genes must remain active in the differentiated gonads to avoid genetic sex reprogramming, as described in adult ovaries after Foxl2 ablation. Dmrt1 plays a similar role in postnatal testes, but the mechanism of adult testis maintenance remains mostly unknown. Sox9 and Sox8 are required for postnatal male fertility, but their role in the adult testis has not been investigated. Here we show that after ablation of Sox9 in Sertoli cells of adult, fertile Sox8(-/-) mice, testis-to-ovary genetic reprogramming occurs and Sertoli cells transdifferentiate into granulosa-like cells. The process of testis regression culminates in complete degeneration of the seminiferous tubules, which become acellular, empty spaces among the extant Leydig cells. DMRT1 protein only remains in non-mutant cells, showing that SOX9/8 maintain Dmrt1 expression in the adult testis. Also, Sox9/8 warrant testis integrity by controlling the expression of structural proteins and protecting Sertoli cells from early apoptosis. Concluding, this study shows that, in addition to its crucial role in testis development, Sox9, together with Sox8 and coordinately with Dmrt1, also controls adult testis maintenance. PMID:27328324

  10. Population Characteristics and Seasonal Movement Patterns of the Rattlesnake Hills Elk Herd - Status Report 2000

    SciTech Connect

    Tiller, B.L.; Zufelt, R.K.; Turner, S.; Cadwell, L.L.; Bender, L.; Turner, G.K.


    Population characteristics of the Rattlesnake Hills elk herd indicate reduced herd growth rates from the 1980s compared to the 1990s (McCorquodale 1988; Eberhardt 1996). However, the population continued to grow approximately 25% annually through the 1990s, reaching a high of 838 animals in summer 1999. Calf recruitment rates appear to be cyclic and are likely related to reduced calf survival during the first weeks of life; however, late-term abortions may also have occurred. The cause(s) could be predator-related and/or a function of shifts in nutritional condition (age-class distributions, assuming older-age cows are less likely to recruit calves, major climate shifts) or changes in the human-related disturbances during gestation, and/or calf rearing periods. In fall 1999 and spring 2000, the population was reduced from 838 individuals to 660 individuals. The primary controlling factors were modified hunting seasons on private and state lands and the large-scale roundup conducted in spring 2000. Continued removal of animals (particularly females) within the population will be pivotal to maintain the population at a level that minimizes land damage complaints, animal-vehicle collisions, use of central Hanford areas, and deterioration of natural resources.

  11. Intrauterine low-functional programming of IGF1 by prenatal nicotine exposure mediates the susceptibility to osteoarthritis in female adult rat offspring.


    Tie, Kai; Zhang, Xianrong; Tan, Yang; Deng, Yu; Li, Jing; Ni, Qubo; Wang, Hui; Chen, Liaobin


    This study aimed to evaluate whether female adult offspring born with intrauterine growth retardation induced by prenatal nicotine exposure (PNE) are susceptible to osteoarthritis (OA) and to explore the underlying programming mechanisms. Pregnant rats were treated with nicotine or saline at 2.0 mg/kg/d from gestational d 11 to 20. The female adult offspring with or without PNE were forced with a strenuous treadmill running for 6 wk to induce OA. Nicotine's effects on fetal articular chondrocytes were studied by exposing chondrocytes to nicotine for 10 d, and dihydro-β-erythroidine, a selective α4β2-nicotinic acetylcholine receptor (nAChR) inhibitor, was used to identify the change of nicotine's effect. For adult offspring, increased cartilage destruction and accelerated OA progression were observed in the PNE group with running; the expression of α1 chain of type II collagen (Col2A1), aggrecan, SRY-type high mobility group box 9 (Sox9), and IGF1 signaling molecules in the cartilage of PNE offspring were decreased. For fetuses, elevated serum corticosteroid and nicotine levels and suppressed IGF1 levels were observed; expression of Col2A1, aggrecan, Sox9, and IGF1 were reduced. The result of chondrocytes revealed that nicotine impeded the expression of Col2A1, aggrecan, and IGF1; blocking α4β2-nAChR rescued nicotine's suppression. In conclusion, PNE increases the susceptibility of adult offspring to OA; the potential mechanism involves IGF1 low-functional programming in articular cartilage caused directly by the action of nicotine on α4β2-nAChR. PMID:26499267

  12. Tumor necrosis factor-alpha during neonatal brain development affects anxiety- and depression-related behaviors in adult male and female mice.


    Babri, Shirin; Doosti, Mohammad-Hossein; Salari, Ali-Akbar


    A nascent literature suggests that neonatal infection is a risk factor for the development of brain, behavior and hypothalamic-pituitary-adrenal axis which can affect anxiety- and depression-related behaviors in later life. It has been documented that neonatal infection raises the concentrations of tumor necrosis factor-alpha (TNF-α) in neonate rodents and such infections may result in neonatal brain injury, at least in part, through pro-inflammatory cytokines. In addition, previous studies have shown that TNF-α is involved in cellular differentiation, neurogenesis and programmed cell death during the development of the central nervous system. We investigated for the first time whether neonatal exposure to TNF-α can affect body weight, stress-induced corticosterone (COR), anxiety- and depression-related behaviors in adult mice. In the present study, neonatal mice were treated to recombinant mouse TNF-α (0.2, 0.4, 0.7 and 1 μg/kg) or saline on postnatal days 3 and 5, then adult male and female mice were exposed to different behavioral tests. The results indicated that neonatal TNF-α treatment reduced body weight in neonatal period in both sexes. In addition, this study presents findings indicating that high doses of TNF- increase stress-induced COR levels, anxiety- and depression-related behaviors in adult males, but increase levels of anxiety without significantly influencing depression in adult female mice [corrected]. Our findings suggest that TNF-α exposure during neonatal period can alter brain and behavior development in a dose and sex-dependent manner in mice. PMID:24398264

  13. Reduced Ets Domain-containing Protein Elk1 Promotes Pulmonary Fibrosis via Increased Integrin αvβ6 Expression.


    Tatler, Amanda L; Habgood, Anthony; Porte, Joanne; John, Alison E; Stavrou, Anastasios; Hodge, Emily; Kerama-Likoko, Cheryl; Violette, Shelia M; Weinreb, Paul H; Knox, Alan J; Laurent, Geoffrey; Parfrey, Helen; Wolters, Paul John; Wallace, William; Alberti, Siegfried; Nordheim, Alfred; Jenkins, Gisli


    Idiopathic pulmonary fibrosis (IPF) is a progressive fibrotic lung disease with high mortality. Active TGFβ1 is considered central to the pathogenesis of IPF. A major mechanism of TGFβ1 activation in the lung involves the epithelially restricted αvβ6 integrin. Expression of the αvβ6 integrin is dramatically increased in IPF. How αvβ6 integrin expression is regulated in the pulmonary epithelium is unknown. Here we identify a region in the β6 subunit gene (ITGB6) promoter acting to markedly repress basal gene transcription, which responds to both the Ets domain-containing protein Elk1 (Elk1) and the glucocorticoid receptor (GR). Both Elk1 and GR can regulate αvβ6 integrin expression in vitro We demonstrate Elk1 binding to the ITGB6 promoter basally and that manipulation of Elk1 or Elk1 binding alters ITGB6 promoter activity, gene transcription, and αvβ6 integrin expression. Crucially, we find that loss of Elk1 causes enhanced Itgb6 expression and exaggerated lung fibrosis in an in vivo model of fibrosis, whereas the GR agonist dexamethasone inhibits Itgb6 expression. Moreover, Elk1 dysregulation is present in epithelium from patients with IPF. These data reveal a novel role for Elk1 regulating ITGB6 expression and highlight how dysregulation of Elk1 can contribute to human disease. PMID:26861876

  14. Reduced Ets Domain-containing Protein Elk1 Promotes Pulmonary Fibrosis via Increased Integrin αvβ6 Expression*

    PubMed Central

    Habgood, Anthony; Porte, Joanne; John, Alison E.; Stavrou, Anastasios; Hodge, Emily; Kerama-Likoko, Cheryl; Violette, Shelia M.; Weinreb, Paul H.; Knox, Alan J.; Laurent, Geoffrey; Parfrey, Helen; Wolters, Paul John; Wallace, William; Alberti, Siegfried; Nordheim, Alfred; Jenkins, Gisli


    Idiopathic pulmonary fibrosis (IPF) is a progressive fibrotic lung disease with high mortality. Active TGFβ1 is considered central to the pathogenesis of IPF. A major mechanism of TGFβ1 activation in the lung involves the epithelially restricted αvβ6 integrin. Expression of the αvβ6 integrin is dramatically increased in IPF. How αvβ6 integrin expression is regulated in the pulmonary epithelium is unknown. Here we identify a region in the β6 subunit gene (ITGB6) promoter acting to markedly repress basal gene transcription, which responds to both the Ets domain-containing protein Elk1 (Elk1) and the glucocorticoid receptor (GR). Both Elk1 and GR can regulate αvβ6 integrin expression in vitro. We demonstrate Elk1 binding to the ITGB6 promoter basally and that manipulation of Elk1 or Elk1 binding alters ITGB6 promoter activity, gene transcription, and αvβ6 integrin expression. Crucially, we find that loss of Elk1 causes enhanced Itgb6 expression and exaggerated lung fibrosis in an in vivo model of fibrosis, whereas the GR agonist dexamethasone inhibits Itgb6 expression. Moreover, Elk1 dysregulation is present in epithelium from patients with IPF. These data reveal a novel role for Elk1 regulating ITGB6 expression and highlight how dysregulation of Elk1 can contribute to human disease. PMID:26861876

  15. Influence of methoprene and temperature on diapause termination in adult females of the over-wintering solitary bee, Osmia rufa L.


    Wasielewski, Oskar; Wojciechowicz, Tatiana; Giejdasz, Karol; Krishnan, Natraj


    Females of Osmia rufa, as most species in this genus, enter an obligatory diapause, overwintering as an imago inside a cocoon until the ensuing spring when after emergence - mating, egg development and oviposition occur. Diapause in this species is initiated in November, undergoes 2 months of a pre-wintering period that is terminated at the end of January, after 1 month of maintenance. In this study, factors that affect the termination of adult diapause in the female of this species were investigated. The experimental material consisted of bees that were brought from nests kept in natural conditions 1 month prior to natural termination of diapause. Three different experimental treatments were planned to evaluate the potential effect of methoprene and temperature on diapause termination. During the 5 day experimental period the first group of females was kept at 4°C, the second group at 15°C and the last group of females was kept at 20°C. All groups of females were treated with methoprene topically at a dose of 200 μg. After methoprene application a significant increase (p<0.001) in the size of terminal oocytes was recorded in the three experimental groups. However, no changes in the size of terminal oocytes between acetone treated and untreated control groups were observed. The number of oocytes progressively increased following topical application of methoprene compared to non-treated or acetone treated females. In successive applications of 200 μg methoprene gradual changes in ovary and fat body protein concentration were observed. As compared to controls, protein content in ovaries isolated from methoprene-treated females increased, whereas it decreased in fat body. The least differences in oocyte size and protein concentration in ovary and fat body between control groups and with methoprene application occurred at 4°C. Differences increased and were higher in females kept at 20°C and increased rapidly after methoprene application. Exposure to increasing

  16. An Elk transcription factor is required for Runx-dependent survival signaling in the sea urchin embryo.


    Rizzo, Francesca; Coffman, James A; Arnone, Maria Ina


    Elk proteins are Ets family transcription factors that regulate cell proliferation, survival, and differentiation in response to ERK (extracellular-signal regulated kinase)-mediated phosphorylation. Here we report the embryonic expression and function of Sp-Elk, the single Elk gene of the sea urchin Strongylocentrotus purpuratus. Sp-Elk is zygotically expressed throughout the embryo beginning at late cleavage stage, with peak expression occurring at blastula stage. Morpholino antisense-mediated knockdown of Sp-Elk causes blastula-stage developmental arrest and embryo disintegration due to apoptosis, a phenotype that is rescued by wild-type Elk mRNA. Development is also rescued by Elk mRNA encoding a serine to aspartic acid substitution (S402D) that mimics ERK-mediated phosphorylation of a conserved site that enhances DNA binding, but not by Elk mRNA encoding an alanine substitution at the same site (S402A). This demonstrates both that the apoptotic phenotype of the morphants is specifically caused by Elk depletion, and that phosphorylation of serine 402 of Sp-Elk is critical for its anti-apoptotic function. Knockdown of Sp-Elk results in under-expression of several regulatory genes involved in cell fate specification, cell cycle control, and survival signaling, including the transcriptional regulator Sp-Runt-1 and its target Sp-PKC1, both of which were shown previously to be required for cell survival during embryogenesis. Both Sp-Runt-1 and Sp-PKC1 have sequences upstream of their transcription start sites that specifically bind Sp-Elk. These results indicate that Sp-Elk is the signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which actively suppresses apoptosis in the early embryo. PMID:27235147

  17. Early postnatal effects of noopept and piracetam on declarative and procedural memory of adult male and female rats.


    Trofimov, S S; Voronina, T A; Guzevatykh, L S


    We studied the effect of a new nootropic dipeptide Noopept and reference nootropic preparation piracetam injected subcutaneously on days 8-20 of life on learning of alternative feeding response in a 6-arm-maze in male and female rats. Early postnatal administration of Noopept disturbed the dynamics of learning by parameters of declarative and procedural memory. Piracetam impaired learning by parameters of procedural, but not declarative memory (only in males). Both preparations decreased the ratio of successfully learned males (but not females). The observed effects were not associated with changes in locomotor activity. PMID:16224581

  18. The Effects of Elk Velvet Antler Dietary Supplementation on Physical Growth and Bone Development in Growing Rats

    PubMed Central

    Chen, Jiongran; Yang, Yanfei; Abbasi, Sepideh; Hajinezhad, Daryoush; Kontulainen, Saija; Honaramooz, Ali


    Elk velvet antler (EVA) has been used in traditional Oriental medicine for centuries to promote general health; however, little evidence for its effect on bone development is available. We investigated the effects of lifelong exposure of Wistar rats to a diet containing 10% EVA on physical growth and bone development. Measurements included weekly body weights, blood chemistry and kidney and testis/ovary indices (sacrificed at 5, 9, or 16 weeks of age), and bone traits of the femur bones by peripheral quantitative computed tomography (pQCT). Mean body weights were higher in the EVA group at 4–8 weeks in males and at 5 weeks of age in females. The kidney indices were greater in EVA dietary supplemented male rats at 5 and 16 weeks of age, in females at 16 weeks of age, and testis/ovary indices at 5 weeks of age. The femoral length was increased in both males and females at 5 weeks, and several pQCT-measured parameters had increased in EVA males and females. The activity of alkaline phosphatase (ALP) increased in EVA group while the content of calcium and phosphorus did not differ among groups. Our results seem to support a role for dietary supplementation of EVA on growth and bone development in this model. PMID:26366186

  19. Sequential activation of Elk-1/Egr-1/GADD45α by arsenic

    PubMed Central

    Shi, Qiwen; Sutariya, Vijaykumar; Bishayee, Anupam; Bhatia, Deepak


    Long-term exposure to arsenic, an environmental contaminant, leads to increased risks of cancers. In the present study, we investigated the sequential regulation of Elk-1 and Egr-1 on As3+-induced GADD45α, an effector of G2/M checkpoint. We found that As3+ transcriptionally induced both Elk-1 and Egr-1, and NF-κB binding site was necessary for As3+-induced Egr-1 promoter activity. However, specific inhibition of JNK, ERK, and Elk-1 inhibited Egr-1 induction. Furthermore, silencing of Egr-1 downregulated As3+-induced expression of GADD45α and ChIP assay confirmed the direct binding of Egr-1 to GADD45α promoter. Taken together, our data indicated that the increase of GADD45α in response to As3+ was mediated sequentially by Elk-1 and Egr-1. PMID:25004251

  20. The relationship between exposure to alcohol-related content on Facebook and predictors of alcohol consumption among female emerging adults.


    Miller, Joseph; Prichard, Ivanka; Hutchinson, Amanda; Wilson, Carlene


    Consuming an unhealthy level of alcohol is a significant problem for some young women. Potential determinants of excess consumption include perceptions of usual consumption among peers-perceptions of what is "normal." The present study examined whether perceptions of social normative endorsement of drinking, operationalized by measures of perceived alcohol consumption of close friends (proximal norms), the consumption of the "average student" (distal norms), and the extent of alcohol-related content posted by peers on Facebook were related to alcohol-related attitudes and self-reported consumption. Female university students (n=129; Mage=21.48 years, SD=3.00) completed an online questionnaire assessing Facebook use, perceived alcohol-related norms, and self-reported alcohol attitudes and consumption. Perceptions of the consumption of the average female student were a negative predictor of attitudes. Positive alcohol attitudes, extent of own alcohol-related photographic posts on Facebook, average female student alcohol consumption, and report of male close friend consumption predicted self-report of own alcohol consumption. Interestingly, female close friend norms failed to predict consumption, whereas male close friend norms predicted consumption but not attitudes, suggesting the possibility of separate cognitive pathways for alcohol-related attitudes and behavior. This study builds on existing research by casting new light on predictors of alcohol-related attitudes, as well as describing the potential role of social networking sites such as Facebook in the formation of social norms and the modulation of drinking behavior. PMID:25489875

  1. Timing and size of daily pollen meals eaten by adult females of a solitary bee (Nomia melanderi)(Apiformes: Halictidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Solitary bees daily provision nest cells with pollen and nectar for their progeny, but little is known of their own eating habits for self-maintenance. The alimentary canals of nesting female alkali bees (Nomia melanderi) were dissected daily at different hours and days throughout their nesting live...

  2. Morphology of the external genitalia of the adult male and female mice as an endpoint of sex differentiation

    PubMed Central

    Weiss, Dana A.; Rodriguez, Esequiel; Cunha, Tristan; Menshenina, Julia; Barcellos, Dale; Chan, Lok Yun; Risbridger, Gail; Baskin, Laurence; Cunha, Gerald


    Adult external genitalia (ExG) are the endpoints of normal sex differentiation. Detailed morphometric analysis and comparison of adult mouse ExG has revealed 10 homologous features distinguishing the penis and clitoris that define masculine vs. feminine sex differentiation. These features have enabled the construction of a simple metric to evaluate various intersex conditions in mutant or hormonally manipulated mice. This review focuses on the morphology of the adult mouse penis and clitoris through detailed analysis of histologic sections, scanning electron microscopy, and three-dimensional reconstruction. We also present previous results from evaluation of “non-traditional” mammals, such as the spotted hyena and wallaby to demonstrate the complex process of sex differentiation that involves not only androgen-dependent processes, but also estrogen-dependent and hormone-independent mechanisms. PMID:21893161

  3. Morphology of the external genitalia of the adult male and female mice as an endpoint of sex differentiation.


    Weiss, Dana A; Rodriguez, Esequiel; Cunha, Tristan; Menshenina, Julia; Barcellos, Dale; Chan, Lok Yun; Risbridger, Gail; Baskin, Laurence; Cunha, Gerald


    Adult external genitalia (ExG) are the endpoints of normal sex differentiation. Detailed morphometric analysis and comparison of adult mouse ExG has revealed 10 homologous features distinguishing the penis and clitoris that define masculine vs. feminine sex differentiation. These features have enabled the construction of a simple metric to evaluate various intersex conditions in mutant or hormonally manipulated mice. This review focuses on the morphology of the adult mouse penis and clitoris through detailed analysis of histologic sections, scanning electron microscopy, and three-dimensional reconstruction. We also present previous results from evaluation of "non-traditional" mammals, such as the spotted hyena and wallaby to demonstrate the complex process of sex differentiation that involves not only androgen-dependent processes, but also estrogen-dependent and hormone-independent mechanisms. PMID:21893161

  4. Effect of arm position and foot placement on the five times sit-to-stand test completion times of female adults older than 50 years of age

    PubMed Central

    Ng, Shamay S.M.; Kwong, Patrick W.H.; Chau, Michael S.P.; Luk, Isaac C.Y.; Wan, Sam S.; Fong, Shirley S.M.


    The five times-sit-to stand test (FTSTS) is a clinical test which is commonly used to assessed the functional muscle strength of the lower limbs of older adults. The aim of this study was to examine the effect of different arm positions and foot placements on the FTSTS completion times of older female adults. [Subjects and Methods] Twenty-nine healthy female subjects, aged 63.1±5.3 years participated in this cross-sectional study. The times required to complete the FTSTS with 3 different arm positions (hands on thighs, arms crossed over chest, and an augmented arm position with the arms extended forward) and 2 foot placements (neutral and posterior) were recorded. The interaction effect and main effect of arm positions and foot placements were examined using a 3 (arm position) × 2 (foot placement) two-way repeated measures analysis of variance (ANOVA). [Results] There was no interaction effect among the 3 arm positions in the 2 foot placements. A significant main effect was identified for foot placement, but not arm position. Posterior foot placement led to a shorter FTSTS time compared to that of normal foot placement. [Conclusion] With the same arm position, FTSTS completion times with posterior foot placement tended to be shorter. Therefore, the standard foot placement should be used for FTSTS administration. PMID:26180314

  5. Postnatal testosterone exposure results in insulin resistance, enlarged mesenteric adipocytes, and an atherogenic lipid profile in adult female rats: comparisons with estradiol and dihydrotestosterone.