Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri
2012-03-01
The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.
Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V
2016-01-01
In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.
Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM
2008-01-01
Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265
Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M
2008-07-25
Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression
Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R
2008-05-01
Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.
2008-01-01
Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053
Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall
2010-12-01
The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.
Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching
NASA Astrophysics Data System (ADS)
Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai
1988-11-01
The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.
LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.
Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna
2012-12-01
The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.
LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub
Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna
2012-01-01
The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246
Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.
2011-01-01
In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841
2012-01-01
Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2
Alpha-globin gene haplotypes in South American Indians.
Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S
1995-08-01
The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.
Towards β-globin gene-targeting with integrase-defective lentiviral vectors.
Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous
2010-11-01
We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.
Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.
2015-01-01
Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787
Kim, Yea Woon; Yun, Won Ju; Kim, AeRi
2016-06-01
The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.
Sawado, T; Igarashi, K; Groudine, M
2001-08-28
The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.
Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.
Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J
2018-06-27
The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.
Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita
2015-01-01
The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.
Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation
Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu
2011-01-01
Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552
Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.
Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein
2016-10-01
β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.
Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas
2000-01-01
We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894
Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi
2014-04-01
TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.
Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi
2014-01-01
TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech
2014-01-01
The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378
Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi
2005-11-01
Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.
Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, A.D.; Bender, M.A.; Harris, E.A.S.
1988-11-01
Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less
Du, Mei-Jun; Lv, Xiang; Hao, De-Long; Zhao, Guo-Wei; Wu, Xue-Song; Wu, Feng; Liu, De-Pei; Liang, Chih-Chuan
2008-01-01
Evidences indicate that locus control region (LCR) of beta-globin spatially closes to the downstream active gene promoter to mediate the transcriptional activation by looping. DNA binding proteins may play an important role in the looping formation. NF-E2 is one of the key transcription factors in beta-globin gene transcriptional activation. To shed light on whether NF-E2 is involved in this process, DS19MafKsiRNA cell pools were established by specifically knocked down the expression of MafK/NF-E2 p18, one subunit of NF-E2 heterodimer. In the above cell pools, it was observed that the occupancy efficiency of NF-E2 on beta-globin gene locus and the expression level of beta-globin genes were decreased. H3 acetylation, H3-K4 methylation and the deposition of RNA polymerase II, but not the recruitment of GATA-1, were also found reduced at the beta-globin gene cluster. Chromosome Conformation Capture (3C) assay showed that the cross-linking frequency between the main NF-E2 binding site HS2 and downstream structural genes was reduced compared to the normal cell. This result demonstrated that MafK/NF-E2 p18 recruitment was involved in the physical proximity of LCR and active beta-globin genes upon beta-globin gene transcriptional activation.
Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L
2015-07-30
Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.
Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.
Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G
2014-05-09
The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Schwarze, Kim; Burmester, Thorsten
2013-09-01
The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of
NASA Astrophysics Data System (ADS)
Lau, Yun-Fai; Kan, Yuet Wai
1983-09-01
We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.
Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.
2012-01-01
Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307
Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R
2012-01-01
Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.
Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.
Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P
2009-12-01
Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.
Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.
Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R
2016-03-01
Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.
Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.
Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-01-01
In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.
Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen
2006-07-01
The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.
Fedosyuk, Halyna; Peterson, Kenneth R
2007-01-01
A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.
β-globin gene cluster haplotypes in ethnic minority populations of southwest China
Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing
2017-01-01
The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625
Structural polymorphism at LCR and its role in beta-globin gene regulation.
Kukreti, Shrikant; Kaur, Harpreet; Kaushik, Mahima; Bansal, Aparna; Saxena, Sarika; Kaushik, Shikha; Kukreti, Ritushree
2010-09-01
Information on the secondary structures and conformational manifestations of eukaryotic DNA and their biological significance with reference to gene regulation and expression is limited. The human beta-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression, is a contiguous piece of DNA with five tissue-specific DNase I-hypersensitive sites (HSs). Since these HSs have a high density of transcription factor binding sites, structural interdependencies between HSs and different promoters may directly or indirectly regulate LCR functions. Mutations and SNPs may stabilize or destabilize the local secondary structures, affecting the gene expression by changes in the protein-DNA recognition patterns. Various palindromic or quasi-palindromic segments within LCR, could cause structural polymorphism and geometrical switching of DNA. This emphasizes the importance of understanding of the sequence-dependent variations of the DNA structure. Such structural motifs might act as regulatory elements. The local conformational variability of a DNA segment or action of a DNA specific protein is key to create and maintain active chromatin domains and affect transcription of various tissue specific beta-globin genes. We, summarize here the current status of beta-globin LCR structure and function. Further structural studies at molecular level and functional genomics might solve the regulatory puzzles that control the beta-globin gene locus. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.
Marková, S; Searle, J B; Kotlík, P
2014-01-01
Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364
Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten
2015-06-15
Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-10-01
Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji
2010-05-07
Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina
2018-01-01
The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430
Okamura, Eiichi; Matsuzaki, Hitomi; Campbell, Andrew D; Engel, James Douglas; Fukamizu, Akiyoshi; Tanimoto, Keiji
2009-12-01
In primitive erythroid cells of human beta-globin locus transgenic mice (TgM), the locus control region (LCR)-proximal epsilon- and gamma-globin genes are transcribed, whereas the distal delta- and beta-globin genes are silent. It is generally accepted that the beta-globin gene is competitively suppressed by gamma-globin gene expression at this developmental stage. Previously, however, we observed that epsilon-globin gene expression was severely attenuated when its distance from the LCR was extended, implying that beta-globin gene might also be silenced because of its great distance from the LCR. Here, to clarify the beta-globin gene silencing mechanism, we established TgM lines carrying either gamma- or epsilon- plus gamma-globin promoter deletions, without significantly altering the distance between the beta-globin gene and the LCR. Precocious expression of delta- and beta-globin genes was observed in primitive erythroid cells of mutant, but not wild-type TgM, which was most evident when both the epsilon and gamma promoters were deleted. Thus, we clearly demonstrated that the repression of the delta- and beta-globin genes in primitive erythroid cells is dominated by competitive silencing by the epsilon- and gamma-globin gene promoters, and that epsilon- and the other beta-like globin genes might be activated by two distinct mechanisms by the LCR.
Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.
2015-01-01
Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about
Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.
2012-01-01
Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573
Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.
1998-01-01
The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789
Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F
2015-07-01
Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about
A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.
Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica
2016-01-01
Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.
Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.
Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold
2017-02-13
Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in
Townes, T M; Fitzgerald, M C; Lingrel, J B
1984-01-01
Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719
A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.
Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza
2014-07-01
In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.
The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran
Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye
2017-01-01
Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378
Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A
2008-01-01
Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697
Molecular basis of length polymorphism in the human zeta-globin gene complex.
Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J
1983-01-01
The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667
Specific repression of β-globin promoter activity by nuclear ferritin
Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.
2001-01-01
Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480
Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi
2015-01-01
We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.
Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S
1988-01-01
The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996
β-Globin chain abnormalities with coexisting α-thalassemia mutations
Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan
2012-01-01
Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075
Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao
2015-05-01
Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.
Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark
2003-04-15
To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.
Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier
2003-01-01
Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412
Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica
2009-05-27
Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.
Scheps, Karen G; Varela, Viviana
Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.
Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi
2015-01-01
Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787
Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P
1986-02-01
A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.
Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M
1995-12-01
Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.
Evolution and Expression of Tissue Globins in Ray-Finned Fishes.
Gallagher, Michael D; Macqueen, Daniel J
2017-01-01
The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.
Evolution and Expression of Tissue Globins in Ray-Finned Fishes
Gallagher, Michael D.
2017-01-01
The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090
Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia
2018-02-28
Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite
Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros
2011-09-01
Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.
Total alpha-globin gene cluster deletion has high frequency in Filipinos
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.
1994-09-01
Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bender, M.A.; Gelinas, R.E.; Miller
1989-04-01
Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less
Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.
Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E
2016-04-07
Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
β-Globin locus control region HS2 and HS3 interact structurally and functionally
Jackson, David A.; McDowell, Jennifer C.; Dean, Ann
2003-01-01
The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237
Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad
2015-01-01
α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.
Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri
2002-03-01
We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.
Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S
2008-02-01
The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.
A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.
Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François
2007-12-01
We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.
Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.
Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I
2012-06-15
Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.
Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S
2017-12-30
Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.
The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.
Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N
1985-01-01
The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.
Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark
2008-07-15
Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.
The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.
Sengupta, P K; Lavelle, D E; DeSimone, J
1994-03-01
Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.
Beta-globin locus activation regions: conservation of organization, structure, and function.
Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G
1990-01-01
The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034
Kim, Kihoon; Kim, AeRi
2010-09-01
Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2015-01-01
Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845
Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha
2018-02-01
Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.
Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A
2009-06-04
Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.
[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].
Li, W X; Ma, Q W; Zeng, F Y
2018-03-01
Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.
Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K
2017-07-01
In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.
Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides
NASA Astrophysics Data System (ADS)
Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard
1996-11-01
In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.
A Phylogenetic Analysis of the Globins in Fungi
Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.
2012-01-01
Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from
Hemoglobin genetics: recent contributions of GWAS and gene editing
Smith, Elenoe C.; Orkin, Stuart H.
2016-01-01
The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226
Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.
Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James
2008-04-11
The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of
Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*
Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.
2012-01-01
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007
Gene duplication and the evolution of hemoglobin isoform differentiation in birds.
Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F
2012-11-02
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.
Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P
2016-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran
2018-05-10
Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.
The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes
Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.
2016-01-01
Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371
High-Density SNP Genotyping to Define β-Globin Locus Haplotypes
Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.
2014-01-01
Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352
Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.
Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J
1986-01-01
The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903
Lacerra, Giuseppina; Fiorito, Mirella; Musollino, Gennaro; Di Noce, Francesca; Esposito, Maria; Nigro, Vincenzo; Gaudiano, Carlo; Carestia, Clementina
2004-10-01
The alpha-globin chains are encoded by two duplicated genes (HBA2 and HBA1, 5'-3') showing overall sequence homology >96% and average CG content >60%. alpha-Thalassemia, the most prevalent worldwide autosomal recessive disorder, is a hereditary anemia caused by sequence variations of these genes in about 25% of carriers. We evaluated the overall sensitivity and suitability of DHPLC and DG-DGGE in scanning both the alpha-globin genes by carrying out a retrospective analysis of 19 variant alleles in 29 genotypes. The HBA2 alleles c.1A>G, c.79G>A, and c.281T>G, and the HBA1 allele c.475C>A were new. Three pathogenic sequence variations were associated in cis with nonpathogenic variations in all families studied; they were the HBA2 variation c.2T>C associated with c.-24C>G, and the HBA2 variations c.391G>C and c.427T>C, both associated with c.565G>A. We set up original experimental conditions for DHPLC and DG-DGGE and analyzed 10 normal subjects, 46 heterozygotes, seven homozygotes, seven compound heterozygotes, and six compound heterozygotes for a hybrid gene. Both the methodologies gave reproducible results and no false-positive was detected. DHPLC showed 100% sensitivity and DG-DGGE nearly 90%. About 100% of the sequence from the cap site to the polyA addition site could be scanned by DHPLC, about 87% by DG-DGGE. It is noteworthy that the three most common pathogenic sequence variations (HBA2 alleles c.2T>C, c.95+2_95+6del, and c.523A>G) were unambiguously detected by both the methodologies. Genotype diagnosis must be confirmed with PCR sequencing of single amplicons or with an allele-specific method. This study can be helpful for scanning genes with high CG content and offers a model suitable for duplicated genes with high homology. Copyright 2004 Wiley-Liss, Inc.
THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE
Gay, Frederick P.; Robertson, T. Brailsford
1913-01-01
This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665
In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene
Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.
2011-01-01
Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues
Funnell, Alister P. W.; Mak, Ka Sin; Twine, Natalie A.; Pelka, Gregory J.; Norton, Laura J.; Radziewic, Tania; Power, Melinda; Wilkins, Marc R.; Bell-Anderson, Kim S.; Fraser, Stuart T.; Perkins, Andrew C.; Tam, Patrick P.; Pearson, Richard C. M.
2013-01-01
Krüppel-like factors 3 and 8 (KLF3 and KLF8) are highly related transcriptional regulators that bind to similar sequences of DNA. We have previously shown that in erythroid cells there is a regulatory hierarchy within the KLF family, whereby KLF1 drives the expression of both the Klf3 and Klf8 genes and KLF3 in turn represses Klf8 expression. While the erythroid roles of KLF1 and KLF3 have been explored, the contribution of KLF8 to this regulatory network has been unknown. To investigate this, we have generated a mouse model with disrupted KLF8 expression. While these mice are viable, albeit with a reduced life span, mice lacking both KLF3 and KLF8 die at around embryonic day 14.5 (E14.5), indicative of a genetic interaction between these two factors. In the fetal liver, Klf3 Klf8 double mutant embryos exhibit greater dysregulation of gene expression than either of the two single mutants. In particular, we observe derepression of embryonic, but not adult, globin expression. Taken together, these results suggest that KLF3 and KLF8 have overlapping roles in vivo and participate in the silencing of embryonic globin expression during development. PMID:23716600
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang
2005-08-01
Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.
The higher structure of chromatin in the LCR of the beta-globin locus changes during development.
Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang
2009-11-27
The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.
Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.
2011-01-01
β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846
The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.
Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel
2012-01-01
Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J.
1994-09-01
Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less
Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F
2014-06-01
Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.
Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-01-01
Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.
Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.
2014-01-01
β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969
α-Globin as a molecular target in the treatment of β-thalassemia
Mettananda, Sachith; Gibbons, Richard J.
2015-01-01
The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286
Developmental regulation of DNA replication timing at the human beta globin locus.
Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H
2001-11-01
The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.
2014-01-01
Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111
Xu, Longchang; Wu, Li; Zhang, Liang; Ma, Yuanzhu; Chen, Tingting; Gao, Shuang; Liang, Juqing; Guo, Hao; Qin, Danqing; Wang, Jicheng; Yuan, Tenglong; Wang, Yixia; Huang, Wei-wei; He, Wen-Fei; Zhang, Yanxia; Liu, Chang; Xia, Sujian; Chen, Qingshan; Zhao, Qingguo; Zhang, Xiaozhuang
2014-01-01
Objective To reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province. Methods A total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters. Results A high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers. Conclusions There was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province. PMID:24587075
Recent trends in the gene therapy of β-thalassemia
Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto
2015-01-01
The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641
Urbinati, Fabrizia; Hargrove, Philip W.; Geiger, Sabine; Romero, Zulema; Wherley, Jennifer; Kaufman, Michael L.; Hollis, Roger P.; Chambers, Christopher B.; Persons, Derek A.; Kohn, Donald B.; Wilber, Andrew
2015-01-01
Sickle cell disease (SCD) can be cured by allogeneic hematopoietic stem cell (HSC) transplant. However, this is only possible when a matched donor is available making the development of gene therapy using autologous HSCs a highly desired alternative. We used a culture model of human erythropoiesis to directly compare two insulated, self-inactivating, and erythroid-specific lentiviral vectors, encoding for γ-globin (V5m3-400) or a modified β-globin (βAS3-FB) for production of anti-sickling hemoglobin (Hb) and correction of red cell deformability after deoxygenation. Bone marrow CD34+ cells from three SCD patients were transduced using V5m3-400 or βAS3-FB and compared to mock transduced SCD or healthy donor CD34+ cells. Lentiviral transduction did not impair cell growth or differentiation, as gauged by proliferation and acquisition of erythroid markers. Vector copy number averaged ~1 copy per cell and corrective globin mRNA levels were increased more than 7-fold over mock-transduced controls. Erythroblasts derived from healthy donor and mock-transduced SCD cells produced a low level of HbF that was increased to 23.6 ± 4.1% per vector copy for cells transduced with V5m3-400. Equivalent levels of modified HbA of 17.6 ± 3.8% per vector copy were detected for SCD cells transduced with βAS3-FB. These levels of anti-sickling Hb production were sufficient to reduce sickling of terminal stage RBCs upon deoxygenation. We conclude that the achieved levels of HbF and modified HbA would likely prove therapeutic to SCD patients who lack matched donors. PMID:25681747
Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima
2015-01-01
Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820
Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John
2016-06-01
Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.
Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P
2015-01-01
High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.
Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848
Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi
2017-01-01
We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.
The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).
Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen
2005-03-01
In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.
Transcriptional regulation of fetal to adult hemoglobin switching: new therapeutic opportunities
Wilber, Andrew; Nienhuis, Arthur W.
2011-01-01
In humans, embryonic, fetal, and adult hemoglobins are sequentially expressed in developing erythroblasts during ontogeny. For the past 40 years, this process has been the subject of intensive study because of its value to enlighten the biology of developmental gene regulation and because fetal hemoglobin can significantly ameliorate the clinical manifestations of both sickle cell disease and β-thalassemia. Understanding the normal process of loss of fetal globin expression and activation of adult globin expression could potentially lead to new therapeutic approaches for these hemoglobin disorders. Herein, we briefly review the history of the study of hemoglobin switching and then focus on recent discoveries in the field that now make new therapeutic approaches seem feasible in the future. Erythroid-specific knockdown of fetal gene repressors or enforced expression of fetal gene activators may provide clinically applicable approaches for genetic treatment of hemoglobin disorders that would benefit from increased fetal hemoglobin levels. PMID:21321359
Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark
2006-08-15
The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.
Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P
1998-06-01
Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai
2014-01-01
Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381
Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C
2011-01-01
Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.
Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü
2016-10-01
Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.
Farashi, Samaneh; Garous, Negin F; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemeh; Imanian, Hashem; Azarkeivan, Azita; Giordano, Piero C; Najmabadi, Hossein
2015-01-01
We describe a case of Hb H disease associated with homozygosity for a two nucleotide deletion in the polyadenylation signal of the α2-globin gene (HBA2: c.*93_*94delAA). The patient, a 27-year-old son of a consanguineous couple, needs regular blood transfusions every 6 months.
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D
2011-01-25
The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads
Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.
2011-01-01
Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623
Distinct modes of gene regulation by a cell-specific transcriptional activator.
Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J
2009-03-17
The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Popp, R.A.; Lalley, P.A.; Whitney, J.B.
A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less
Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang
2007-01-05
High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.
Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein
2011-03-15
Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.
Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen
2016-04-14
The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.
Gene Therapy in a Patient with Sickle Cell Disease.
Ribeil, Jean-Antoine; Hacein-Bey-Abina, Salima; Payen, Emmanuel; Magnani, Alessandra; Semeraro, Michaela; Magrin, Elisa; Caccavelli, Laure; Neven, Benedicte; Bourget, Philippe; El Nemer, Wassim; Bartolucci, Pablo; Weber, Leslie; Puy, Hervé; Meritet, Jean-François; Grevent, David; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Ross, Robert W; Negre, Olivier; Veres, Gabor; Sandler, Laura; Soni, Sandeep; de Montalembert, Mariane; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina
2017-03-02
Sickle cell disease results from a homozygous missense mutation in the β-globin gene that causes polymerization of hemoglobin S. Gene therapy for patients with this disorder is complicated by the complex cellular abnormalities and challenges in achieving effective, persistent inhibition of polymerization of hemoglobin S. We describe our first patient treated with lentiviral vector-mediated addition of an antisickling β-globin gene into autologous hematopoietic stem cells. Adverse events were consistent with busulfan conditioning. Fifteen months after treatment, the level of therapeutic antisickling β-globin remained high (approximately 50% of β-like-globin chains) without recurrence of sickle crises and with correction of the biologic hallmarks of the disease. (Funded by Bluebird Bio and others; HGB-205 ClinicalTrials.gov number, NCT02151526 .).
NASA Astrophysics Data System (ADS)
Van Doorslaer, Sabine; Cuypers, Bert
2018-02-01
At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.
Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz
2005-01-01
The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.
Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe
2010-09-16
The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.
The globins of cyanobacteria and algae.
Johnson, Eric A; Lecomte, Juliette T J
2013-01-01
Approximately, 20 years ago, a haemoglobin gene was identified within the genome of the cyanobacterium Nostoc commune. Haemoglobins have now been confirmed in multiple species of photosynthetic microbes beyond N. commune, and the diversity of these proteins has recently come under increased scrutiny. This chapter summarizes the state of knowledge concerning the phylogeny, physiology and chemistry of globins in cyanobacteria and green algae. Sequence information is by far the best developed and the most rapidly expanding aspect of the field. Structural and ligand-binding properties have been described for just a few proteins. Physiological data are available for even fewer. Although activities such as nitric oxide dioxygenation and oxygen scavenging are strong candidates for cellular function, dedicated studies will be required to complete the story on this intriguing and ancient group of proteins. © 2013 Elsevier Ltd. All rights reserved.
Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina
2015-01-01
The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435
Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O
2018-05-01
Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo
2013-01-01
Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850
Genetic dissection of the α-globin super-enhancer in vivo
Hay, Deborah; Hughes, Jim R.; Rode, Christina; Li, Pik-Shan; Pennacchio, Len A.; Sloane-Stanley, Jacqueline A.; Ayyub, Helena; Butler, Sue; Sauka-Spengler, Tatjana; Gibbons, Richard J.; Smith, Andrew J.H.; Wood, William G.; Higgs, Douglas R.
2016-01-01
Many genes determining cell identity are regulated by clusters of mediator-bound enhancer elements collectively referred to as super-enhancers. These have been proposed to manifest higher-order properties important in development and disease. Here, we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer singly and in informative combinations, we demonstrate that each constituent enhancer appears to act independently and in an additive fashion with respect to hematologic phenotype, gene expression, chromatin structure and chromosome conformation, without clear evidence of synergistic or higher-order effects. Our study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation. PMID:27376235
Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.
Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten
2016-02-01
During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.
Insulation of the Chicken β-Globin Chromosomal Domain from a Chromatin-Condensing Protein, MENT
Istomina, Natalia E.; Shushanov, Sain S.; Springhetti, Evelyn M.; Karpov, Vadim L.; A. Krasheninnikov, Igor; Stevens, Kimberly; Zaret, Kenneth S.; Singh, Prim B.; Grigoryev, Sergei A.
2003-01-01
Active genes are insulated from developmentally regulated chromatin condensation in terminally differentiated cells. We mapped the topography of a terminal stage-specific chromatin-condensing protein, MENT, across the active chicken β-globin domain. We observed two sharp transitions of MENT concentration coinciding with the β-globin boundary elements. The MENT distribution profile was opposite to that of acetylated core histones but correlated with that of histone H3 dimethylated at lysine 9 (H3me2K9). Ectopic MENT expression in NIH 3T3 cells caused a large-scale and specific remodeling of chromatin marked by H3me2K9. MENT colocalized with H3me2K9 both in chicken erythrocytes and NIH 3T3 cells. Mutational analysis of MENT and experiments with deacetylase inhibitors revealed the essential role of the reaction center loop domain and an inhibitory affect of histone hyperacetylation on the MENT-induced chromatin remodeling in vivo. In vitro, the elimination of the histone H3 N-terminal peptide containing lysine 9 by trypsin blocked chromatin self-association by MENT, while reconstitution with dimethylated but not acetylated N-terminal domain of histone H3 specifically restored chromatin self-association by MENT. We suggest that histone H3 modification at lysine 9 directly regulates chromatin condensation by recruiting MENT to chromatin in a fashion that is spatially constrained from active genes by gene boundary elements and histone hyperacetylation. PMID:12944473
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J.
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less
Genetic dissection of the α-globin super-enhancer in vivo
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hay, Deborah; Hughes, Jim R.; Babbs, Christian
Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less
Genetic dissection of the α-globin super-enhancer in vivo
Hay, Deborah; Hughes, Jim R.; Babbs, Christian; ...
2016-07-04
Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less
Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.
2013-01-01
Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145
Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R
2017-09-04
β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.
Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François
2003-12-01
High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.
Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.
2009-01-01
Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341
Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul
2015-01-01
Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577
Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min
2012-07-15
Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.
Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.
2006-01-01
The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143
Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan
2015-07-01
To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J
2016-09-01
Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.
Waxman, Herbert S.
1970-01-01
The effects of iron, cobalt, hemin, and plasma on hemoglobin synthesis by suspensions of rabbit reticulocytes and nucleated bone marrow cells were studied. L-Leucine-14C and sodium pyruvate-3-14C were employed to measure globin and heme synthesis, respectively. Normal plasma (or serum) was found to stimulate the rate of globin synthesis in both systems. The stimulatory effects of iron and hemin were additive to those of plasma or serum only in the reticulocytes. Cobaltous ion, at concentrations less than 1.0 mmole/liter, was found to stimulate globin synthesis by reticulocytes as effectively as ferrous ion; cobalt was inhibitory only at concentrations greater than 3.0-5.0 mmoles/liter. Heme synthesis by reticulocytes was inhibited at all concentrations employed (0.2-5.0 mmoles/liter). In bone marrow nucleated erythroid cells, globin synthesis was markedly enhanced by exogenous hemin. In contrast to reticulocytes, however, bone marrow cells were unresponsive to either cobalt or transferrin-bound iron. Possible implications of these findings on regulation of the rate and mechanism of iron uptake and hemoglobin synthesis in vivo are discussed. PMID:5443172
Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus
2010-01-01
Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the
Running, swimming and diving modifies neuroprotecting globins in the mammalian brain
Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S
2007-01-01
The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537
Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).
Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E
2016-12-01
The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.
Alternative options for DNA-based experimental therapy of β-thalassemia.
Gambari, Roberto
2012-04-01
Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.
Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.
2010-01-01
Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759
Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar
2018-01-02
Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.
The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less
Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan
2014-01-01
Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.
Yu, Jia; Russell, J. Eric
2001-01-01
Human globins are encoded by mRNAs exhibiting high stabilities in transcriptionally silenced erythrocyte progenitors. Unlike α-globin mRNA, whose stability is enhanced by assembly of a specific messenger RNP (mRNP) α complex on its 3′ untranslated region (UTR), neither the structure(s) nor the mechanism(s) that effects the high-level stability of human β-globin mRNA has been identified. The present work describes an mRNP complex assembling on the 3′ UTR of the β-globin mRNA that exhibits many of the properties of the stability-enhancing α complex. The β-globin mRNP complex is shown to contain one or more factors homologous to αCP, a 39-kDa RNA-binding protein that is integral to α-complex assembly. Sequence analysis implicates a specific 14-nucleotide pyrimidine-rich track within its 3′ UTR as the site of β-globin mRNP assembly. The importance of this track to mRNA stability is subsequently verified in vivo using mice expressing human β-globin transgenes that contain informative mutations in this region. In combination, the in vitro and in vivo analyses indicate that the high stabilities of the α- and β-globin mRNAs are maintained through related mRNP complexes that may share a common regulatory pathway. PMID:11486027
Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.
Dong, Alisa C; Rivella, Stefano
2017-01-01
Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.
Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N
2015-11-05
Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.
Globins Scavenge Sulfur Trioxide Anion Radical*
Gardner, Paul R.; Gardner, Daniel P.; Gardner, Alexander P.
2015-01-01
Ferrous myoglobin was oxidized by sulfur trioxide anion radical (STAR) during the free radical chain oxidation of sulfite. Oxidation was inhibited by the STAR scavenger GSH and by the heme ligand CO. Bimolecular rate constants for the reaction of STAR with several ferrous globins and biomolecules were determined by kinetic competition. Reaction rate constants for myoglobin, hemoglobin, neuroglobin, and flavohemoglobin are large at 38, 120, 2,600, and ≥ 7,500 × 106 m−1 s−1, respectively, and correlate with redox potentials. Measured rate constants for O2, GSH, ascorbate, and NAD(P)H are also large at ∼100, 10, 130, and 30 × 106 m−1 s−1, respectively, but nevertheless allow for favorable competition by globins and a capacity for STAR scavenging in vivo. Saccharomyces cerevisiae lacking sulfite oxidase and deleted of flavohemoglobin showed an O2-dependent growth impairment with nonfermentable substrates that was exacerbated by sulfide, a precursor to mitochondrial sulfite formation. Higher O2 exposures inactivated the superoxide-sensitive mitochondrial aconitase in cells, and hypoxia elicited both aconitase and NADP+-isocitrate dehydrogenase activity losses. Roles for STAR-derived peroxysulfate radical, superoxide radical, and sulfo-NAD(P) in the mechanism of STAR toxicity and flavohemoglobin protection in yeast are suggested. PMID:26381408
Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.
Guerreiro, J F; Figueiredo, M S; Zago, M A
1994-01-01
We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.
Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe
2008-12-01
Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.
Rivella, Stefano
2015-04-01
β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.
Analysis of a Mouse α-Globin Gene Mutation Induced by Ethylnitrosourea
Popp, R. A.; Bailiff, E. G.; Skow, L. C.; Johnson, F. M.; Lewis, Susan E.
1983-01-01
A DBA/2 mouse treated with ethylnitrosourea sired an offspring whose hemoglobin showed an extra band following starch gel electrophoresis. The variant hemoglobin migrated to a more cathodal position in starch gel. Isoelectric focusing indicated that chain 5 of the mutant hemoglobin migrated to a more cathodal position than the normal chain 5 from DBA/2 mice and that the other α-globin, chain 1, was not affected. On focusing gels the phenotype of the mutant allele, Hbay9, was expressed without dominance to normal chain 5, and Hbay9/Hbay9 homozygotes were fully viable in the laboratory. The molecular basis for the germinal mutation was investigated by analyzing the amino acid sequence of chain 5y9, the mutant form of α-chain 5. A single amino acid substitution (His → Leu) at position 89 was found in chain 5y9. We propose that ethylnitrosourea induced an A → T transversion in the histidine codon at position 89 (CAC → CTC). This mutation has apparently not been observed previously in humans, mice or other mammals, and its novel occurrence may be indicative of other unusual mutational events that do not ordinarily occur in the absence of specific mutagen exposure. PMID:6618166
NASA Astrophysics Data System (ADS)
Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen
1993-03-01
We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.
Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.
Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen
2017-01-01
Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1 h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .
Neuroglobin and cytoglobin: two new members of globin family
Tosqui, Priscilla; Colombo, Marcio Francisco
2011-01-01
The globin family has long been defined by myoglobin and hemoglobin, proteins with the functions of oxygen storage and transportation, respectively. Recently, two new members of this family were discovered: neuroglobin present in neurons and retinal cells and cytoglobin found in various types of tissue. The increased expression of these proteins in hypoxic conditions first suggested a role in oxygen supply. However structural and functional differences, such as the hexacoordinated heme, a high autoxidation rate and different concentrations between different cellular types, have dismissed this hypothesis. The protective role of these globins has already been established. In vitro and in vivo studies have demonstrated increased survival of neurons under stress in the presence of neuroglobin and increased resistance to neurodegenerative diseases. However the mechanism remains unknown. Functions, including detoxification of nitric oxide, free radical scavenging and as an antioxidant and signaling of apoptosis, have also been suggested for neuroglobin and an antifibrotic function for cytoglobin. PMID:23049323
Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark
2006-01-01
We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039
Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein
2018-03-01
β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.
Comparison of ligand migration and binding in heme proteins of the globin family
NASA Astrophysics Data System (ADS)
Karin, Nienhaus; Ulrich Nienhaus, G.
2015-12-01
The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.
A Functional Element Necessary for Fetal Hemoglobin Silencing
Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.
2011-01-01
BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898
Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Forouzesh Pour, Fatemeh; Zeinali, Fatemeh; Rad, Fariba; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2016-01-01
α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects on the α-globin gene cluster can result in α-thal that may develop a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. In the present study, four Iranian individuals with hypochromic microcytic anemia, who revealed none of the known mutations responsible for α-thal, were subjected for further investigations. The thalassemic phenotype of these patients resulted from abnormal RNA splicing sites owing to a missense at the splice donor site, a truncated protein or hemoglobin (Hb) variants as a result of two different substitutions on the α1-globin gene. The clinical presentation of mild anemia in these individuals showed the contribution of these novel mutations in α-thal in spite of the dominantly expressed α2-globin gene. This study describes hematological manifestations of subjects carrying some novel mutations comparable to the reported phenotype of α(+)-thal trait.
Congote, L. F.; Hamilton, E. F.; Chow, J. C.; Perry, T. B.
1982-01-01
Three techniques for analysing hemoglobin synthesis in blood samples obtained by fetoscopy were evaluated. Of the fetuses studied, 12 were not at risk of genetic disorders, 10 were at risk of beta-thalassemia, 2 were at risk of sickle cell anemia and 1 was at risk of both diseases. The conventional method of prenatal diagnosis of hemoglobinopathies, involving the separation of globin chains labelled with a radioactive isotope on carboxymethyl cellulose (CMC) columns, was compared with a method involving globin-chain separation by high-pressure liquid chromatography (HPLC) and with direct analysis of labelled hemoglobin tetramers obtained from cell lysates by chromatography on ion-exchange columns. The last method is technically the simplest and can be used for diagnosing beta-thalassemia and sickle cell anemia. However, it gives spuriously high levels of adult hemoglobin in samples containing nonlabelled adult hemoglobin. HPLC is the fastest method for prenatal diagnosis of beta-thalassemia and may prove as reliable as the CMC method. Of the 13 fetuses at risk for hemoglobinopathies, 1 was predicted to be affected, and the diagnosis was confirmed in the abortus. Of 12 predicted to be unaffected, 1 was aborted spontaneously and was unavailable for confirmatory studies, as were 3 of the infants; however, the diagnosis was confirmed in seven cases and is awaiting confirmation when the infant in 6 months old in one case. Couples at risk of bearing a child with a hemoglobinopathy should be referred for genetic counselling before pregnancy or, at the latest, by the 12th week of gestation so that prenatal diagnosis can be attempted by amniocentesis, safer procedure, with restriction endonuclease analysis of the amniotic fluid cells. PMID:7139502
Conversion events in gene clusters
2011-01-01
Background Gene clusters containing multiple similar genomic regions in close proximity are of great interest for biomedical studies because of their associations with inherited diseases. However, such regions are difficult to analyze due to their structural complexity and their complicated evolutionary histories, reflecting a variety of large-scale mutational events. In particular, conversion events can mislead inferences about the relationships among these regions, as traced by traditional methods such as construction of phylogenetic trees or multi-species alignments. Results To correct the distorted information generated by such methods, we have developed an automated pipeline called CHAP (Cluster History Analysis Package) for detecting conversion events. We used this pipeline to analyze the conversion events that affected two well-studied gene clusters (α-globin and β-globin) and three gene clusters for which comparative sequence data were generated from seven primate species: CCL (chemokine ligand), IFN (interferon), and CYP2abf (part of cytochrome P450 family 2). CHAP is freely available at http://www.bx.psu.edu/miller_lab. Conclusions These studies reveal the value of characterizing conversion events in the context of studying gene clusters in complex genomes. PMID:21798034
Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J
1989-01-01
We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605
Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F
2017-03-01
Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.
Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios
2012-01-01
Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313
Three mouse models of human thalassemia.
Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F
1981-01-01
Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinell, J.; Whitney, J.B.; Popp, R.A.
Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less
Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto
2015-01-01
Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liebhaber, S.A.; Weiss, I.; Cash, F.E.
Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less
Adult mouse brain gene expression patterns bear an embryologic imprint
Zapala, Matthew A.; Hovatta, Iiris; Ellison, Julie A.; Wodicka, Lisa; Del Rio, Jo A.; Tennant, Richard; Tynan, Wendy; Broide, Ron S.; Helton, Rob; Stoveken, Barbara S.; Winrow, Christopher; Lockhart, Daniel J.; Reilly, John F.; Young, Warren G.; Bloom, Floyd E.; Lockhart, David J.; Barlow, Carrolee
2005-01-01
The current model to explain the organization of the mammalian nervous system is based on studies of anatomy, embryology, and evolution. To further investigate the molecular organization of the adult mammalian brain, we have built a gene expression-based brain map. We measured gene expression patterns for 24 neural tissues covering the mouse central nervous system and found, surprisingly, that the adult brain bears a transcriptional “imprint” consistent with both embryological origins and classic evolutionary relationships. Embryonic cellular position along the anterior–posterior axis of the neural tube was shown to be closely associated with, and possibly a determinant of, the gene expression patterns in adult structures. We also observed a significant number of embryonic patterning and homeobox genes with region-specific expression in the adult nervous system. The relationships between global expression patterns for different anatomical regions and the nature of the observed region-specific genes suggest that the adult brain retains a degree of overall gene expression established during embryogenesis that is important for regional specificity and the functional relationships between regions in the adult. The complete collection of extensively annotated gene expression data along with data mining and visualization tools have been made available on a publicly accessible web site (www.barlow-lockhart-brainmapnimhgrant.org). PMID:16002470
Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A
2009-01-01
Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the
Tong, Ann-Jay; Kollmann, Tobias R.; Smale, Stephen T.
2015-01-01
A variety of age-related differences in the innate and adaptive immune systems have been proposed to contribute to the increased susceptibility to infection of human neonates and older adults. The emergence of RNA sequencing (RNA-seq) provides an opportunity to obtain an unbiased, comprehensive, and quantitative view of gene expression differences in defined cell types from different age groups. An examination of ex vivo human monocyte responses to lipopolysaccharide stimulation or Listeria monocytogenes infection by RNA-seq revealed extensive similarities between neonates, young adults, and older adults, with an unexpectedly small number of genes exhibiting statistically significant age-dependent differences. By examining the differentially induced genes in the context of transcription factor binding motifs and RNA-seq data sets from mutant mouse strains, a previously described deficiency in interferon response factor-3 activity could be implicated in most of the differences between newborns and young adults. Contrary to these observations, older adults exhibited elevated expression of inflammatory genes at baseline, yet the responses following stimulation correlated more closely with those observed in younger adults. Notably, major differences in the expression of constitutively expressed genes were not observed, suggesting that the age-related differences are driven by environmental influences rather than cell-autonomous differences in monocyte development. PMID:26147648
Chu, L Y; Rhoads, R E
1978-06-13
The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.
Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.
Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan
2014-02-01
Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.
Estarellas Martin, Carolina; Seira Castan, Constantí; Luque Garriga, F Javier; Bidon-Chanal Badia, Axel
2015-10-01
Residue conformational changes and internal cavity migration processes play a key role in regulating the kinetics of ligand migration and binding events in globins. Molecular dynamics simulations have demonstrated their value in the study of these processes in different haemoglobins, but derivation of kinetic data demands the use of more complex techniques like enhanced sampling molecular dynamics methods. This review discusses the different methodologies that are currently applied to study the ligand migration process in globins and highlight those specially developed to derive kinetic data. Copyright © 2015 Elsevier Ltd. All rights reserved.
Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor
2016-01-01
Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702
Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.
Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro
2018-05-28
N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man
Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.
1985-01-01
A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762
Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto
2015-12-01
Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.
Factor IX gene haplotypes in Amerindians.
Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S
1997-02-01
We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.
Rahim, Fakher; Allahmoradi, Hossein; Salari, Fatemeh; Shahjahani, Mohammad; Fard, Ali Dehghani; Hosseini, Seyed Ahmad; Mousakhani, Hadi
2013-01-01
Potent induction of fetal hemoglobin (HbF) production results in alleviating the complications of β-thalassemia and sickle cell disease (SCD). HbF inducer agents can trigger several molecular signaling pathways critical for erythropoiesis. Janus kinase/Signal transducer and activator of transcription (JAK/STAT), mitogen activated protein kinas (MAPK) and Phosphoinositide 3-kinase (PI3K) are considered as main signaling pathways, which may play a significant role in HbF induction. All these signaling pathways are triggered by erythropoietin (EPO) as the main growth factor inducing erythroid differentiation, when it binds to its cell surface receptor, erythropoietin receptor (EPO-R) HbF inducer agents have been shown to upregulate HbF production level by triggering certain signaling pathways. As a result, understanding the pivotal signaling pathways influencing HbF induction leads to effective upregulation of HbF. In this mini review article, we try to consider the correlation between HbF inducer agents and their molecular mechanisms of γ-globin upregulation. Several studies suggest that activating P38 MAPK, RAS and STAT5 signaling pathways result in efficient HbF induction. Nevertheless, the role of other erythroid signaling pathways in HbF induction seems to be indispensible and should be emphasized.
Evaluation of Allelic Expression of Imprinted Genes in Adult Human Blood
Frost, Jennifer M.; Monk, Dave; Stojilkovic-Mikic, Taita; Woodfine, Kathryn; Chitty, Lyn S.; Murrell, Adele; Stanier, Philip; Moore, Gudrun E.
2010-01-01
Background Imprinted genes are expressed from only one allele in a parent-of-origin dependent manner. Loss of imprinted (LOI) expression can result in a variety of human disorders and is frequently reported in cancer. Biallelic expression of imprinted genes in adult blood has been suggested as a useful biomarker and is currently being investigated in colorectal cancer. In general, the expression profiles of imprinted genes are well characterised during human and mouse fetal development, but not in human adults. Methodology/Principal Findings We investigated quantitative expression of 36 imprinted genes in adult human peripheral blood leukocytes obtained from healthy individuals. Allelic expression was also investigated in B and T lymphocytes and myeloid cells. We found that 21 genes were essentially undetectable in adult blood. Only six genes were demonstrably monoallelic, and most importantly, we found that nine genes were either biallelic or showed variable expression in different individuals. Separated leukocyte populations showed the same expression patterns as whole blood. Differential methylation at each of the imprinting control loci analysed was maintained, including regions that contained biallelically expressed genes. This suggests in some cases methylation has become uncoupled from its role in regulating gene expression. Conclusions/Significance We conclude that only a limited set of imprinted genes, including IGF2 and SNRPN, may be useful for LOI cancer biomarker studies. In addition, blood is not a good tissue to use for the discovery of new imprinted genes. Finally, lymphocyte DNA methylation status in the adult may not always be a reliable indicator of monoallelic gene expression. PMID:21042416
Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique
2014-01-01
Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.
Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H
1995-01-01
The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582
Higgs, Douglas R; Engel, James Douglas; Stamatoyannopoulos, George
2012-01-28
Thalassaemia is one of the most common genetic diseases worldwide, with at least 60,000 severely affected individuals born every year. Individuals originating from tropical and subtropical regions are most at risk. Disorders of haemoglobin synthesis (thalassaemia) and structure (eg, sickle-cell disease) were among the first molecular diseases to be identified, and have been investigated and characterised in detail over the past 40 years. Nevertheless, treatment of thalassaemia is still largely dependent on supportive care with blood transfusion and iron chelation. Since 1978, scientists and clinicians in this specialty have met regularly in an international effort to improve the management of thalassaemia, with the aim of increasing the expression of unaffected fetal genes to improve the deficiency in adult β-globin synthesis. In this Seminar we discuss important advances in the understanding of the molecular and cellular basis of normal and abnormal expression of globin genes. We will summarise new approaches to the development of tailored pharmacological agents to alter regulation of globin genes, the first trial of gene therapy for thalassaemia, and future prospects of cell therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.
Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.
Thein, Swee Lay
2017-01-01
β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.
Gene expression profiling in the adult Down syndrome brain.
Lockstone, H E; Harris, L W; Swatton, J E; Wayland, M T; Holland, A J; Bahn, S
2007-12-01
The mechanisms by which trisomy 21 leads to the characteristic Down syndrome (DS) phenotype are unclear. We used whole genome microarrays to characterize for the first time the transcriptome of human adult brain tissue (dorsolateral prefrontal cortex) from seven DS subjects and eight controls. These data were coanalyzed with a publicly available dataset from fetal DS tissue and functional profiling was performed to identify the biological processes central to DS and those that may be related to late onset pathologies, particularly Alzheimer disease neuropathology. A total of 685 probe sets were differentially expressed between adult DS and control brains at a stringent significance threshold (adjusted p value (q) < 0.005), 70% of these being up-regulated in DS. Over 25% of genes on chromosome 21 were differentially expressed in comparison to a median of 4.4% for all chromosomes. The unique profile of up-regulation on chromosome 21, consistent with primary dosage effects, was accompanied by widespread transcriptional disruption. The critical Alzheimer disease gene, APP, located on chromosome 21, was not found to be up-regulated in adult brain by microarray or QPCR analysis. However, numerous other genes functionally linked to APP processing were dysregulated. Functional profiling of genes dysregulated in both fetal and adult datasets identified categories including development (notably Notch signaling and Dlx family genes), lipid transport, and cellular proliferation. In the adult brain these processes were concomitant with cytoskeletal regulation and vesicle trafficking categories, and increased immune response and oxidative stress response, which are likely linked to the development of Alzheimer pathology in individuals with DS.
Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula
2007-09-01
In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.
Gene therapy for sickle cell disease: An update.
Demirci, Selami; Uchida, Naoya; Tisdale, John F
2018-05-30
Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.
Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser
2017-03-01
Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less
Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.
Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D
1993-01-01
Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005
Two cloned β thalassemia genes are associated with amber mutations at codon 39
Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur
1981-01-01
Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453
Akperova, G A
2014-11-01
IThe purpose of this study was to evaluate of the efficiency of RDBH-method and Big DyeTM Terminator technology in an accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster. It was done a complete hematology analysis (HB, MCH, MCV, MCHC, RBC, Hct, HbA2, HbF, Serum iron, Serum ferritin at four children (males, 6-10 years old) and their parents. Molecular analysis included Reverse Dot-Blot Hybridization StripAssay (RDBH) and DNA sequencing on ABI PRISM Big DyeTM Terminator. Hematologic and molecular parameters were contradictory. The homozygosity for β0-thalassemia (β0IVS2.1[G>A] and β0codon 8[-AA]) at three boys with the mild clinical manifestation and heterozygosity of their parents for mutations, and the absence of β-globin mutations at parents and a boy who holds monthly transfusion was established by RDBH-analysis. DNA sequencing by technology Big DyeTM Terminator showed polymorphism at positions -551 and -521 of Cap5'-region (-650-250) - (AT)7(T)7 and (AT)8(T)5. Application of the integrated clinical-molecular approach is an ideal method for an accurate diagnosis, identification of asymptomatic carriers and a reduce of the risk of complications from β-thalassemia, moreover screening of γG-gene and the level of fetal hemoglobin in early childhood will help manage of β-thalassemia clinic and prevent heavy consequences of the disease.
Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.
Kim, Yea Woon; Kim, AeRi
2017-07-20
Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).
Ren, Chunli; Finkel, Steven E; Tower, John
2009-03-01
Immune function declines with age in Drosophila and humans, and autophagy is implicated in immune function. In addition, autophagy genes are required for life span extension caused by reduced insulin/IGF1-like signaling and dietary restriction in Caenorhabditiselegans. To test if the autophagy pathway might be limiting for immunity and/or life span in adult Drosophila, the Geneswitch system was used to cause conditional inactivation of the autophagy genes Atg5, Atg7 and Atg12 by RNAi. Conditional inhibition of Atg genes in adult flies reduced lysotracker staining of adult tissues, and reduced resistance to injected Escherichia coli, as evidenced by increased bacterial titers and reduced fly survival. However, survival of uninjected flies was unaffected by Atg gene inactivation. The data indicate that Atg gene activity is required for normal immune function in adult flies, and suggest that neither autophagy nor immune function are limiting for adult life span under typical laboratory conditions.
NASA Astrophysics Data System (ADS)
Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco
1980-02-01
Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.
Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska
2016-09-01
Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U
1984-01-01
A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198
USDA-ARS?s Scientific Manuscript database
A comprehensive transcriptome survey, or “Gene Atlas,” provides information essential for a complete understanding of the genomic biology of an organism. Using a digital gene expression approach, we developed a Gene Atlas of RNA abundance in 92 adult, juvenile and fetal cattle tissues. The samples...
Rapid and efficient gene delivery into the adult mouse brain via focal electroporation
Nomura, Tadashi; Nishimura, Yusuke; Gotoh, Hitoshi; Ono, Katsuhiko
2016-01-01
In vivo gene delivery is required for studying the cellular and molecular mechanisms of various biological events. Virus-mediated gene transfer or generation of transgenic animals is widely used; however, these methods are time-consuming and expensive. Here we show an improved electroporation technique for acute gene delivery into the adult mouse brain. Using a syringe-based microelectrode, local DNA injection and the application of electric current can be performed simultaneously; this allows rapid and efficient gene transduction of adult non-neuronal cells. Combining this technique with various expression vectors that carry specific promoters resulted in targeted gene expression in astrocytic cells. Our results constitute a powerful strategy for the genetic manipulation of adult brains in a spatio-temporally controlled manner. PMID:27430903
Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan
2017-01-01
The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia.
Thompson, Alexis A; Walters, Mark C; Kwiatkowski, Janet; Rasko, John E J; Ribeil, Jean-Antoine; Hongeng, Suradej; Magrin, Elisa; Schiller, Gary J; Payen, Emmanuel; Semeraro, Michaela; Moshous, Despina; Lefrere, Francois; Puy, Hervé; Bourget, Philippe; Magnani, Alessandra; Caccavelli, Laure; Diana, Jean-Sébastien; Suarez, Felipe; Monpoux, Fabrice; Brousse, Valentine; Poirot, Catherine; Brouzes, Chantal; Meritet, Jean-François; Pondarré, Corinne; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Teachey, David T; Anurathapan, Usanarat; Ho, P Joy; von Kalle, Christof; Kletzel, Morris; Vichinsky, Elliott; Soni, Sandeep; Veres, Gabor; Negre, Olivier; Ross, Robert W; Davidson, David; Petrusich, Alexandria; Sandler, Laura; Asmal, Mohammed; Hermine, Olivier; De Montalembert, Mariane; Hacein-Bey-Abina, Salima; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina
2018-04-19
Donor availability and transplantation-related risks limit the broad use of allogeneic hematopoietic-cell transplantation in patients with transfusion-dependent β-thalassemia. After previously establishing that lentiviral transfer of a marked β-globin (β A-T87Q ) gene could substitute for long-term red-cell transfusions in a patient with β-thalassemia, we wanted to evaluate the safety and efficacy of such gene therapy in patients with transfusion-dependent β-thalassemia. In two phase 1-2 studies, we obtained mobilized autologous CD34+ cells from 22 patients (12 to 35 years of age) with transfusion-dependent β-thalassemia and transduced the cells ex vivo with LentiGlobin BB305 vector, which encodes adult hemoglobin (HbA) with a T87Q amino acid substitution (HbA T87Q ). The cells were then reinfused after the patients had undergone myeloablative busulfan conditioning. We subsequently monitored adverse events, vector integration, and levels of replication-competent lentivirus. Efficacy assessments included levels of total hemoglobin and HbA T87Q , transfusion requirements, and average vector copy number. At a median of 26 months (range, 15 to 42) after infusion of the gene-modified cells, all but 1 of the 13 patients who had a non-β 0 /β 0 genotype had stopped receiving red-cell transfusions; the levels of HbA T87Q ranged from 3.4 to 10.0 g per deciliter, and the levels of total hemoglobin ranged from 8.2 to 13.7 g per deciliter. Correction of biologic markers of dyserythropoiesis was achieved in evaluated patients with hemoglobin levels near normal ranges. In 9 patients with a β 0 /β 0 genotype or two copies of the IVS1-110 mutation, the median annualized transfusion volume was decreased by 73%, and red-cell transfusions were discontinued in 3 patients. Treatment-related adverse events were typical of those associated with autologous stem-cell transplantation. No clonal dominance related to vector integration was observed. Gene therapy with autologous CD34
Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K
2009-09-01
The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.
CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.
Liang, Puping; Xu, Yanwen; Zhang, Xiya; Ding, Chenhui; Huang, Rui; Zhang, Zhen; Lv, Jie; Xie, Xiaowei; Chen, Yuxi; Li, Yujing; Sun, Ying; Bai, Yaofu; Songyang, Zhou; Ma, Wenbin; Zhou, Canquan; Huang, Junjiu
2015-05-01
Genome editing tools such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated system (Cas) have been widely used to modify genes in model systems including animal zygotes and human cells, and hold tremendous promise for both basic research and clinical applications. To date, a serious knowledge gap remains in our understanding of DNA repair mechanisms in human early embryos, and in the efficiency and potential off-target effects of using technologies such as CRISPR/Cas9 in human pre-implantation embryos. In this report, we used tripronuclear (3PN) zygotes to further investigate CRISPR/Cas9-mediated gene editing in human cells. We found that CRISPR/Cas9 could effectively cleave the endogenous β-globin gene (HBB). However, the efficiency of homologous recombination directed repair (HDR) of HBB was low and the edited embryos were mosaic. Off-target cleavage was also apparent in these 3PN zygotes as revealed by the T7E1 assay and whole-exome sequencing. Furthermore, the endogenous delta-globin gene (HBD), which is homologous to HBB, competed with exogenous donor oligos to act as the repair template, leading to untoward mutations. Our data also indicated that repair of the HBB locus in these embryos occurred preferentially through the non-crossover HDR pathway. Taken together, our work highlights the pressing need to further improve the fidelity and specificity of the CRISPR/Cas9 platform, a prerequisite for any clinical applications of CRSIPR/Cas9-mediated editing.
Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin
2007-08-10
The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle
Individual specific DNA fingerprints from a hypervariable region probe: alpha-globin 3'HVR.
Fowler, S J; Gill, P; Werrett, D J; Higgs, D R
1988-06-01
A probe detecting a hypervariable region (HVR) 3' to the alpha globin locus on chromosome 16 has been used to produce DNA fingerprints. Segregation analysis has revealed multiple, randomly dispersed DNA fragments inherited in a Mendelian fashion with minimal allelism and linkage. The fingerprints are highly polymorphic (probability of chance association between random individuals much less than 10(-14]. The probe is, therefore, a powerful discriminating tool: it is envisaged that this probe will have forensic applications, including paternity cases, and will be informative in linkage analysis.
Whole-Genome Duplication and the Functional Diversification of Teleost Fish Hemoglobins
Opazo, Juan C.; Butts, G. Tyler; Nery, Mariana F.; Storz, Jay F.; Hoffmann, Federico G.
2013-01-01
Subsequent to the two rounds of whole-genome duplication that occurred in the common ancestor of vertebrates, a third genome duplication occurred in the stem lineage of teleost fishes. This teleost-specific genome duplication (TGD) is thought to have provided genetic raw materials for the physiological, morphological, and behavioral diversification of this highly speciose group. The extreme physiological versatility of teleost fish is manifest in their diversity of blood–gas transport traits, which reflects the myriad solutions that have evolved to maintain tissue O2 delivery in the face of changing metabolic demands and environmental O2 availability during different ontogenetic stages. During the course of development, regulatory changes in blood–O2 transport are mediated by the expression of multiple, functionally distinct hemoglobin (Hb) isoforms that meet the particular O2-transport challenges encountered by the developing embryo or fetus (in viviparous or oviparous species) and in free-swimming larvae and adults. The main objective of the present study was to assess the relative contributions of whole-genome duplication, large-scale segmental duplication, and small-scale gene duplication in producing the extraordinary functional diversity of teleost Hbs. To accomplish this, we integrated phylogenetic reconstructions with analyses of conserved synteny to characterize the genomic organization and evolutionary history of the globin gene clusters of teleosts. These results were then integrated with available experimental data on functional properties and developmental patterns of stage-specific gene expression. Our results indicate that multiple α- and β-globin genes were present in the common ancestor of gars (order Lepisoteiformes) and teleosts. The comparative genomic analysis revealed that teleosts possess a dual set of TGD-derived globin gene clusters, each of which has undergone lineage-specific changes in gene content via repeated duplication and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, S.D.; Cooper, P.; Fung, J.
Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less
Illegitimate transcription: transcription of any gene in any cell type.
Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A
1989-01-01
Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532
The Role of Hox Genes in Female Reproductive Tract Development, Adult Function, and Fertility.
Du, Hongling; Taylor, Hugh S
2015-11-09
HOX genes convey positional identity that leads to the proper partitioning and adult identity of the female reproductive track. Abnormalities in reproductive tract development can be caused by HOX gene mutations or altered HOX gene expression. Diethylstilbestrol (DES) and other endocrine disruptors cause Müllerian defects by changing HOX gene expression. HOX genes are also essential regulators of adult endometrial development. Regulated HOXA10 and HOXA11 expression is necessary for endometrial receptivity; decreased HOXA10 or HOXA11 expression leads to decreased implantation rates. Alternation of HOXA10 and HOXA11 expression has been identified as a mechanism of the decreased implantation associated with endometriosis, polycystic ovarian syndrome, leiomyoma, polyps, adenomyosis, and hydrosalpinx. Alteration of HOX gene expression causes both uterine developmental abnormalities and impaired adult endometrial development that prevent implantation and lead to female infertility. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
Ow, Maria C.; Nichitean, Alexandra M.; Dorus, Steve; Hall, Sarah E.
2018-01-01
Environmental stress during early development in animals can have profound effects on adult phenotypes via programmed changes in gene expression. Using the nematode C. elegans, we demonstrated previously that adults retain a cellular memory of their developmental experience that is manifested by differences in gene expression and life history traits; however, the sophistication of this system in response to different environmental stresses, and how it dictates phenotypic plasticity in adults that contribute to increased fitness in response to distinct environmental challenges, was unknown. Using transcriptional profiling, we show here that C. elegans adults indeed retain distinct cellular memories of different environmental conditions. We identified approximately 500 genes in adults that entered dauer due to starvation that exhibit significant opposite (“seesaw”) transcriptional phenotypes compared to adults that entered dauer due to crowding, and are distinct from animals that bypassed dauer. Moreover, we show that two-thirds of the genes in the genome experience a 2-fold or greater seesaw trend in gene expression, and based upon the direction of change, are enriched in large, tightly linked regions on different chromosomes. Importantly, these transcriptional programs correspond to significant changes in brood size depending on the experienced stress. In addition, we demonstrate that while the observed seesaw gene expression changes occur in both somatic and germline tissue, only starvation-induced changes require a functional GLP-4 protein necessary for germline development, and both programs require the Argonaute CSR-1. Thus, our results suggest that signaling between the soma and the germ line can generate phenotypic plasticity as a result of early environmental experience, and likely contribute to increased fitness in adverse conditions and the evolution of the C. elegans genome. PMID:29447162
Diverse hematological phenotypes of β-thalassemia carriers.
Luo, Hong-Yuan; Chui, David H K
2016-03-01
Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.
Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G
1981-01-01
Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with Hb E-beta-thalassemia and Hb E trait. The initial rate of beta-globin synthesis (betaE/alpha=0.20-0.34) was less than expected on the basis of gene dosage, or comparable studies of other compound heterozygous states for beta-thalassemia and structurally abnormal beta-chains. betaE-globin synthesis was not only reduced during short-term incubations (1-5 min), but also remained relatively unchanged during long-term pulse or chase incubations up to 5h. Analysis of globin mRNA by cell-free translation and molecular hybridization confirmed that the unexpectedly low levels of betaE-globin synthesis were associated with comparable reduction in the levels of beta-globin mRNA. In Hb E-beta-thalassemia the betaA + betaE (alpha globin nRNA ratio observed were substantially lower than those obtained from reticulocytes of patients with heterozygous beta-thalassemia, or Hb S-betaO-thalassemia, while in Hb E trait, the betaA + betaE/alpha mRNA ratio was in the ranged observed for beta-thalassemia trait. The betaE-globin gene specifies reduced accumulation of betaE-globin mRNA, a property characteristic of other forms of beta-thalassemia. The beta-thalassemia phenotype associated with inheritance of Hb E is thus determined at the level of beta-globin mRNA metabolism. PMID:6166632
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath
2006-07-28
Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies
Exploring the Common Dynamics of Homologous Proteins. Application to the Globin Family
Maguid, Sandra; Fernandez-Alberti, Sebastian; Ferrelli, Leticia; Echave, Julian
2005-01-01
We present a procedure to explore the global dynamics shared between members of the same protein family. The method allows the comparison of patterns of vibrational motion obtained by Gaussian network model analysis. After the identification of collective coordinates that were conserved during evolution, we quantify the common dynamics within a family. Representative vectors that describe these dynamics are defined using a singular value decomposition approach. As a test case, the globin heme-binding family is considered. The two lowest normal modes are shown to be conserved within this family. Our results encourage the development of models for protein evolution that take into account the conservation of dynamical features. PMID:15749782
1976-01-01
Bone marrow from mature goats and sheep was cultured in plasma clots, and three erythropoietin (ESF)-dependent responses-growth (colony formation), differentiation (globin production), and initiation of hemoglobin C (alpha2beta2C) synthesis--were quantitated. ESF concentrations below 0.01 U/ml supported colony growth and adult hemoglobin production in cultures of goat marrow, while maximal hemoglobin C synthesis (70%), as measured between 72 and 96 h in culture, required a 100-fold higher ESF concentration. Sheep marrow was cultured in a medium enriched to enhance growth and to permit complete maturation of colonies. These colonies active in hemoglobin synthesis between 24 and 96 h produced mainly adult hemoglobin, and only between 96 and 120 h did sheep colonies develop which produced mainly hemoglobin C (up to 70%). A similar heterogeneity may exist among goat colonies. Thus, when goat bone marrow was fractionated by unit gravity sedimentation, more hemoglobin C synthesis was observed in colonies derived from cells of intermediate sedimentation velocity than in colonies derived from the most rapidly sedimenting cells. Brief exposure of sheep (in vivo) and goat (in vitro) bone marrow to a high ESF concentration committed precursor cells to the generation of colonies which, even at low ESF concentration, produced hemoglobin C. Committment to hemoglobin phenotype appears to be an early and probably irreversible event in the development of an erythroid cell. PMID:993267
Qiu, Caihong; Olivier, Emmanuel N; Velho, Michelle; Bouhassira, Eric E
2008-02-15
We have previously shown that coculture of human embryonic stem cells (hESCs) for 14 days with immortalized fetal hepatocytes yields CD34(+) cells that can be expanded in serum-free liquid culture into large numbers of megaloblastic nucleated erythroblasts resembling yolk sac-derived cells. We show here that these primitive erythroblasts undergo a switch in hemoglobin (Hb) composition during late terminal erythroid maturation with the basophilic erythroblasts expressing predominantly Hb Gower I (zeta(2)epsilon(2)) and the orthochromatic erythroblasts hemoglobin Gower II (alpha(2)epsilon(2)). This suggests that the switch from Hb Gower I to Hb Gower II, the first hemoglobin switch in humans is a maturation switch not a lineage switch. We also show that extending the coculture of the hESCs with immortalized fetal hepatocytes to 35 days yields CD34(+) cells that differentiate into more developmentally mature, fetal liver-like erythroblasts, that are smaller, express mostly fetal hemoglobin, and can enucleate. We conclude that hESC-derived erythropoiesis closely mimics early human development because the first 2 human hemoglobin switches are recapitulated, and because yolk sac-like and fetal liver-like cells are sequentially produced. Development of a method that yields erythroid cells with an adult phenotype remains necessary, because the most mature cells that can be produced with current systems express less than 2% adult beta-globin mRNA.
Constitutive gene expression and specification of tissue identity in adult planarian biology
Reddien, Peter W.
2011-01-01
Planarians are flatworms that constitutively maintain adult tissues through cell turnover and can regenerate entire organisms from tiny body fragments. In addition to requiring new cells (from neoblasts), these feats require mechanisms that specify tissue identity in the adult. Critical roles for Wnt and BMP signaling in regeneration and maintenance of the body axes have been uncovered, among other regulatory factors. Available data indicate that genes involved in positional identity regulation at key embryonic stages in other animals display persisting regionalized expression in adult planarians. These expression patterns suggest that a constitutively active gene expression map exists for maintenance of the planarian body. Planarians therefore present a fertile ground for identification of factors regulating regionalization of the metazoan body plan and for study of the attributes of these factors that can lead to maintenance and regeneration of adult tissues. PMID:21680047
Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth
2006-10-01
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.
Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi
2013-01-01
We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).
Alsultan, Abdulrahman; Alabdulaali, Mohammed K.; Griffin, Paula J.; AlSuliman, Ahmed M.; Ghabbour, Hazem A.; Sebastiani, Paola; Albuali, Waleed H.; Al-Ali, Amein K.; Chui, David H.K.; Steinberg, Martin H.
2014-01-01
Summary Sickle cell disease (SCD) in Saudi patients from the Eastern Province is associated with the Arab-Indian (AI) HBB (β-globin gene) haplotype. The phenotype of AI SCD in children was described as benign and was attributed to their high fetal haemoglobin (HbF). We conducted a hospital-based study to assess the pattern of SCD complications in adults. A total of 104 patients with average age of 27 years were enrolled. Ninety-six percent of these patients reported history of painful crisis; 47% had at least one episode of acute chest syndrome, however, only 15% had two or more episodes; symptomatic osteonecrosis was reported in 18%; priapism in 17%; overt stroke in 6%; none had leg ulcers. The majority of patients had persistent splenomegaly and 66% had gallstones. Half of the patients co-inherited α-thalassaemia and about one third had glucose-6-phosphate dehydrogenase deficiency. Higher HbF correlated with higher rate of splenic sequestration but not with other phenotypes. The phenotype of adult patients with AI SCD is not benign despite their relatively high HbF level. This is probably due to the continued decline in HbF level in adults and the heterocellular and variable distribution of HbF amongst F-cells. PMID:24224700
Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin
2007-01-01
Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence
Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso
2017-12-18
Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.
Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha
2010-01-01
Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.
Ohashi, Jun; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Brittenham, Gary; Looareesuwan, Sornchai; Clark, Andrew G; Tokunaga, Katsushi
2005-01-01
A binding site for the repressor protein BP1, which contains a tandem (AT)x(T)y repeat, is located approximately 530 bp 5' to the human beta-globin gene (HBB). There is accumulating evidence that BP1 binds to the (AT)9(T)5 allele more strongly than to other alleles, thereby reducing the expression of HBB. In this study, we investigated polymorphisms in the (AT)x(T)y repeat in 57 individuals living in Thailand, including three homozygotes for the hemoglobin E variant (HbE; beta26Glu-->Lys), 22 heterozygotes, and 32 normal homozygotes. We found that (AT)9(T)5 and (AT)7(T)7 alleles were predominant in the studied population and that the HbE variant is in strong linkage disequilibrium with the (AT)9(T)5 allele, which can explain why the betaE chain is inefficiently synthesized compared to the normal betaA chain. Moreover, the mildness of the HbE disease compared to other hemoglobinopathies in Thai may be due, in part, to the presence of the (AT)9(T)5 repeat on the HbE chromosome. In addition, a novel (AC)n polymorphism adjacent to the (AT)x(T)y repeat (i.e., (AC)3(AT)7(T)5) was found through the variation screening in this study.
May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H
2009-07-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.
Kaushik, Mahima; Kukreti, Shrikant
2006-01-01
Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.
Genetic therapy for beta-thalassemia: from the bench to the bedside.
Arumugam, Paritha; Malik, Punam
2010-01-01
Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
Ou, Xuan; Chae, Hee-Don; Wang, Rui-Hong; Shelley, William C.; Cooper, Scott; Taylor, Tammi; Kim, Young-June; Deng, Chu-Xia; Yoder, Mervin C.
2011-01-01
SIRT1 is a founding member of a sirtuin family of 7 proteins and histone deacetylases. It is involved in cellular resistance to stress, metabolism, differentiation, aging, and tumor suppression. SIRT1−/− mice demonstrate embryonic and postnatal development defects. We examined hematopoietic and endothelial cell differentiation of SIRT1−/− mouse embryonic stem cells (ESCs) in vitro, and hematopoietic progenitors in SIRT1+/++/−, and −/− mice. SIRT1−/− ESCs formed fewer mature blast cell colonies. Replated SIRT1−/− blast colony-forming cells demonstrated defective hematopoietic potential. Endothelial cell production was unaltered, but there were defects in formation of a primitive vascular network from SIRT1−/−-derived embryoid bodies. Development of primitive and definitive progenitors derived from SIRT1−/− ESCs were also delayed and/or defective. Differentiation delay/defects were associated with delayed capacity to switch off Oct4, Nanog and Fgf5 expression, decreased β-H1 globin, β-major globin, and Scl gene expression, and reduced activation of Erk1/2. Ectopic expression of SIRT1 rescued SIRT1−/− ESC differentiation deficiencies. SIRT1−/− yolk sacs manifested fewer primitive erythroid precursors. SIRT1−/− and SIRT1+/− adult marrow had decreased numbers and cycling of hematopoietic progenitors, effects more apparent at 5%, than at 20%, oxygen tension, and these progenitors survived less well in vitro under conditions of delayed growth factor addition. This suggests a role for SIRT1 in ESC differentiation and mouse hematopoiesis. PMID:20966168
Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.
Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2016-01-01
Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.
Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wirtz, M.K.; Samples, J.R.; Kramer, P.L.
1997-02-01
Glaucoma is the third-leading cause of blindness in the world, affecting >13.5 million people. Adult-on-set primary open-angle glaucoma (POAG) is the most common form of glaucoma in the United States. We present a family in which adult-onset POAG is inherited as an autosomal dominant trait. Twelve affected family members were identified from 44 at-risk individuals. The disease-causing gene was mapped to chromosome 3q21-24, with analysis of recombinant haplotypes suggesting a total inclusion region of 11.1 cM between markers D3S3637 and D3S1744. This is the first report of mapping of an adult-onset POAG gene to chromosome 3q, gene symbol GLC1C. 57more » refs., 3 figs., 3 tabs.« less
Laimins, L; Holmgren-König, M; Khoury, G
1986-01-01
The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279
Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R
2014-06-01
Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Louie, E.; Dietz, L.; Shafer, F.
A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less
β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.
Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal
2016-11-01
β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.
Genetic treatment of a molecular disorder: gene therapy approaches to sickle cell disease
Hoban, Megan D.; Bauer, Daniel E.
2016-01-01
Effective medical management for sickle cell disease (SCD) remains elusive. As a prevalent and severe monogenic disorder, SCD has been long considered a logical candidate for gene therapy. Significant progress has been made in moving toward this goal. These efforts have provided substantial insight into the natural regulation of the globin genes and illuminated challenges for genetic manipulation of the hematopoietic system. The initial γ-retroviral vectors, next-generation lentiviral vectors, and novel genome engineering and gene regulation approaches each share the goal of preventing erythrocyte sickling. After years of preclinical studies, several clinical trials for SCD gene therapies are now open. This review focuses on progress made toward achieving gene therapy, the current state of the field, consideration of factors that may determine clinical success, and prospects for future development. PMID:26758916
Novel mutations responsible for α-thalassemia in Iranian families.
Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein
2013-01-01
α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.
Chromosomal arrangement of leghemoglobin genes in soybean.
Lee, J S; Brown, G G; Verma, D P
1983-01-01
A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Production of Prnp-/- goats by gene targeting in adult fibroblasts.
Zhu, Caihong; Li, Bei; Yu, Guohua; Chen, Jianquan; Yu, Huiqing; Chen, Juan; Xu, Xujun; Wu, Youbing; Zhang, Aimin; Cheng, Guoxiang
2009-04-01
Homozygous mice devoid of functional Prnp are resistant to scrapie and prion propagation, but heterozygous mice for Prnp disruption still suffer from prion disease and prion deposition. We have previously generated heterozygous cloned goats with one allele of Prnp functional disruption. To obtain goats with both alleles of Prnp be disrupted which would be resistant to scrapie completely, a second-round gene targeting was applied to disrupt the wild type allele of Prnp in the heterozygous goats. By second-round gene targeting, we successfully disrupted the wild type allele of Prnp in primary Prnp (+/-) goat skin fibroblasts and obtained a Prnp (-/-) cell line without Prnp expression. This is the first report on successful targeting modification in primary adult somatic cells of animals. These cells were used as nuclear donors for somatic cell cloning to produce Prnp (-/-) goats. A total of 57 morulae or blastocytes developed from the reconstructed embryos were transferred to 31 recipients, which produced 7 pregnancies at day 35. At 73 days of gestation, we obtained one cloned fetus with Prnp (-/-) genotype. Our research not only indicated that multiple genetic modifications could be accomplished by multi-round gene targeting in primary somatic cells, but also provided strong evidence that gene targeting in adult cells other than fetal cells could be applied to introduce precise genetic modifications in animals without destroying the embryos.
Burns, Justin L; Jariwala, Parth B; Rivera, Shannon; Fontaine, Benjamin M; Briggs, Laura; Weinert, Emily E
2017-08-18
Bacterial pathogens utilize numerous signals to identify the presence of their host and coordinate changes in gene expression that allow for infection. Within plant pathogens, these signals typically include small molecules and/or proteins from their plant hosts and bacterial quorum sensing molecules to ensure sufficient bacterial cell density for successful infection. In addition, bacteria use environmental signals to identify conditions when the host defenses are weakened and potentially to signal entry into an appropriate host/niche for infection. A globin coupled sensor protein (GCS), termed PccGCS, within the soft rot bacterium Pectobacterium carotovorum ssp. carotovorum WPP14 has been identified as an O 2 sensor and demonstrated to alter virulence factor excretion and control motility, with deletion of PccGCS resulting in decreased rotting of a potato host. Using small molecules that modulate bacterial growth and quorum sensing, PccGCS signaling also has been shown to modulate quorum sensing pathways, resulting in the PccGCS deletion strain being more sensitive to plant-derived phenolic acids, which can function as quorum sensing inhibitors, and exhibiting increased N-acylhomoserine lactone (AHL) production. These findings highlight a role for GCS proteins in controlling key O 2 -dependent phenotypes of pathogenic bacteria and suggest that modulating GCS signaling to limit P. carotovorum motility may provide a means to decrease rotting of plant hosts.
Mayer-Blackwell, B.; Schlussman, S. D.; Butelman, E. R.; Ho, A.; Ott, J.; Kreek, M. J.; Zhang, Y.
2014-01-01
Illicit use of prescription opioid analgesics (e.g., oxycodone) in adolescence is a pressing public health issue. Our goal was to determine whether oxycodone self administration differentially affects striatal neurotransmitter receptor gene expression in the dorsal striatum of adolescent compared to adult C57BL/6J mice. Groups of adolescent mice (4 weeks old, n= 12) and of adult mice (11 weeks old, n= 11) underwent surgery during which a catheter was implanted into their jugular veins. After recovering from surgery, mice self administered oxycodone (0.25 mg/kg/infusion) 2 h/day for 14 consecutive days or served as yoked saline controls. Mice were sacrificed within 1 h after the last self-administration session and the dorsal striatum was isolated for mRNA analysis. Gene expression was analyzed with real time PCR using a commercially available neurotransmitter receptor PCR array containing 84 genes. We found that adolescent mice self administered less oxycodone than adult mice over the 14 days. Monoamine oxidase A (Maoa) and neuropeptide Y receptor 5 mRNA levels were lower in adolescent mice than in adult mice without oxycodone exposure. Oxycodone self administration increased Maoa mRNA levels compared to controls in both age groups. There was a positive correlation of the amount of oxycodone self administered in the last session or across 14 sessions with Maoa mRNA levels. Gastrin-releasing peptide receptor mRNA showed a significant Drug × Age interaction, with point-wise significance. More genes in the dorsal striatum of adolescents (19) changed in response to oxycodone self administration compared to controls than in adult (4) mice. Overall, this study demonstrates that repeated oxycodone self administration alters neurotransmitter receptors gene expression in the dorsal striatum of adolescent and adult mice. PMID:24220688
Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie
2017-10-01
We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.
Microarray Analysis of Differential Gene Expression Profile Between Human Fetal and Adult Heart.
Geng, Zhimin; Wang, Jue; Pan, Lulu; Li, Ming; Zhang, Jitai; Cai, Xueli; Chu, Maoping
2017-04-01
Although many changes have been discovered during heart maturation, the genetic mechanisms involved in the changes between immature and mature myocardium have only been partially elucidated. Here, gene expression profile changed between the human fetal and adult heart was characterized. A human microarray was applied to define the gene expression signatures of the fetal (13-17 weeks of gestation, n = 4) and adult hearts (30-40 years old, n = 4). Gene ontology analyses, pathway analyses, gene set enrichment analyses, and signal transduction network were performed to predict the function of the differentially expressed genes. Ten mRNAs were confirmed by quantificational real-time polymerase chain reaction. 5547 mRNAs were found to be significantly differentially expressed. "Cell cycle" was the most enriched pathway in the down-regulated genes. EFGR, IGF1R, and ITGB1 play a central role in the regulation of heart development. EGFR, IGF1R, and FGFR2 were the core genes regulating cardiac cell proliferation. The quantificational real-time polymerase chain reaction results were concordant with the microarray data. Our data identified the transcriptional regulation of heart development in the second trimester and the potential regulators that play a prominent role in the regulation of heart development and cardiac cells proliferation.
Genetic treatment of a molecular disorder: gene therapy approaches to sickle cell disease.
Hoban, Megan D; Orkin, Stuart H; Bauer, Daniel E
2016-02-18
Effective medical management for sickle cell disease (SCD) remains elusive. As a prevalent and severe monogenic disorder, SCD has been long considered a logical candidate for gene therapy. Significant progress has been made in moving toward this goal. These efforts have provided substantial insight into the natural regulation of the globin genes and illuminated challenges for genetic manipulation of the hematopoietic system. The initial γ-retroviral vectors, next-generation lentiviral vectors, and novel genome engineering and gene regulation approaches each share the goal of preventing erythrocyte sickling. After years of preclinical studies, several clinical trials for SCD gene therapies are now open. This review focuses on progress made toward achieving gene therapy, the current state of the field, consideration of factors that may determine clinical success, and prospects for future development. © 2016 by The American Society of Hematology.
Wu, Changlu; Jiang, Qiuyun; Wei, Lei; Cai, Zhongqiang; Chen, Jun; Yu, Wenchao; He, Cheng; Wang, Jiao; Guo, Wen; Wang, Xiaotong
2018-01-01
Light-sensitivity is important for mollusc survival, as it plays a vital role in reproduction and predator avoidance. Light-sensitivity has been demonstrated in the adult Pacific oyster Crassostrea gigas, but the genes associated with light-sensitivity remain unclear. In the present study, we designed experiments to identify the genes associated with light-sensitivity in adult oysters. First, we assessed the Pacific oyster genome and identified 368 genes annotated with the terms associated with light-sensitivity. Second, the function of the four rhodopsin-like superfamily member genes was tested by using RNAi. The results showed that the highest level of mRNA expression of the vision-related genes was in the mantle; however, this finding is not true for all oyster genes. Interestingly, we also found four rhodopsin-like superfamily member genes expressed at an very high level in the mantle tissue. In the RNAi experiment, when one of rhodopsin-like superfamily member genes (CGI_1001253) was inhibited, the light-sensitivity capacity of the injected oysters was significantly reduced, suggesting that CGI_10012534 may be associated with light-sensitivity in the adult Pacific oyster. PMID:29615921
Gene therapy for red-green colour blindness in adult primates
Mancuso, Katherine; Hauswirth, William W.; Li, Qiuhong; Connor, Thomas B.; Kuchenbecker, James A.; Mauck, Matthew C.; Neitz, Jay; Neitz, Maureen
2009-01-01
Red-green colour blindness, which results from the absence of either the long- (L) or middle- (M) wavelength-sensitive visual photopigments, is the most common single locus genetic disorder. Here, the possibility of curing colour blindness using gene therapy was explored in experiments on adult monkeys that had been colour blind since birth. A third type of cone pigment was added to dichromatic retinas, providing the receptoral basis for trichromatic colour vision. This opened a new avenue to explore the requirements for establishing the neural circuits for a new dimension of colour sensation. Classic visual deprivation experiments1 have led to the expectation that neural connections established during development would not appropriately process an input that was not present from birth. Therefore, it was believed that treatment of congenital vision disorders would be ineffective unless administered to the very young. Here, however, addition of a third opsin in adult red-green colour-deficient primates was sufficient to produce trichromatic colour vision behaviour. Thus, trichromacy can arise from a single addition of a third cone class and it does not require an early developmental process. This provides a positive outlook for the potential of gene therapy to cure adult vision disorders. PMID:19759534
Gene therapy for red-green colour blindness in adult primates.
Mancuso, Katherine; Hauswirth, William W; Li, Qiuhong; Connor, Thomas B; Kuchenbecker, James A; Mauck, Matthew C; Neitz, Jay; Neitz, Maureen
2009-10-08
Red-green colour blindness, which results from the absence of either the long- (L) or the middle- (M) wavelength-sensitive visual photopigments, is the most common single locus genetic disorder. Here we explore the possibility of curing colour blindness using gene therapy in experiments on adult monkeys that had been colour blind since birth. A third type of cone pigment was added to dichromatic retinas, providing the receptoral basis for trichromatic colour vision. This opened a new avenue to explore the requirements for establishing the neural circuits for a new dimension of colour sensation. Classic visual deprivation experiments have led to the expectation that neural connections established during development would not appropriately process an input that was not present from birth. Therefore, it was believed that the treatment of congenital vision disorders would be ineffective unless administered to the very young. However, here we show that the addition of a third opsin in adult red-green colour-deficient primates was sufficient to produce trichromatic colour vision behaviour. Thus, trichromacy can arise from a single addition of a third cone class and it does not require an early developmental process. This provides a positive outlook for the potential of gene therapy to cure adult vision disorders.
Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W
2010-03-01
Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.
Translation of globin messenger RNA by the mouse ovum
Brinster, R. L.; Chen, H. Y.; Trumbauer, M. E.; Avarbock, M. R.
2016-01-01
It has been demonstrated that the Xenopus oocyte can translate rabbit haemoglobin messenger RNA (mRNA) following microinjection of the message into the cell1. The Xenopus oocyte has since been shown to be capable of translating a variety of messenger RNAs from different species2–4. This system has proved useful in understanding the mechanism of message translation and has also provided information about the translation capability of the Xenopus oocyte5,6. Several other cell types, including HeLa cells and fibroblasts, can also translate exogenous message injected into the cell7,8. However, there have been no reports of injection of mRNA into oocytes or fertilised one-cell ova of mammalian species. Nevertheless, the latter system could be of considerable use in studying the processing of exogenous messages in a mammalian system undergoing development, as well as providing insight into the way the early embryo processes injected messages and the protein products of such messages. We report here the results of injecting message into the fertilised one-cell mouse ovum and show that both mouse and rabbit globin mRNA are translated in this system. PMID:7352032
Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.
Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole
2017-08-01
Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.
Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.
Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun
α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.
Buccheri, Maria A; Spina, Sonia; Ruberto, Concetta; Lombardo, Turi; Labie, Dominique; Ragusa, And Angela
2013-01-01
Fetal hemoglobin (Hb F) is the principal ameliorating factor of β-thalassemia (β-thal) and sickle cell disease. Persistent production in adult life is a quantitative trait regulated by loci inside or outside the β-globin gene cluster. From genome-wide association studies, principal quantitative trait loci (QTL) (accounting for 50.0% of Hb F variability in different populations) have been identified in the BCL11A gene, HBS1L-MYB intergenic polymorphism and the β-globin gene cluster itself. In this study, we analyzed quantitative trait haplotypes in two Sicilian families with extremely mild β-thal and unusually high Hb F expression, in order to examine possible genetic background variations in a similar β-thalassemic phenotype. This study redefines the linkage disequilibrium blocks at these loci, but also shows slight differences between probands in haplotype combinations which could reflect different mechanisms of high Hb F production in patients with β-thal. We proposed a haplotype-based approach as a useful tool for the understanding of β-thal phenotype variation in patients with similar β-thalassemic backgrounds in an attempt to answer the recurring question of why patients with the same β-thalassemic genotype show different phenotypes.
Thongchote, Kanogwun; Svasti, Saovaros; Teerapornpuntakit, Jarinthorn; Krishnamra, Nateetip; Charoenphandhu, Narattaphol
2014-06-15
A marked decrease in β-globin production led to β-thalassemia, a hereditary anemic disease associated with bone marrow expansion, bone erosion, and osteoporosis. Herein, we aimed to investigate changes in bone mineral density (BMD) and trabecular microstructure in hemizygous β-globin knockout thalassemic (BKO) mice and to determine whether endurance running (60 min/day, 5 days/wk for 12 wk in running wheels) could effectively alleviate bone loss in BKO mice. Both male and female BKO mice (1-2 mo old) showed growth retardation as indicated by smaller body weight and femoral length than their wild-type littermates. A decrease in BMD was more severe in female than in male BKO mice. Bone histomorphometry revealed that BKO mice had decreases in trabecular bone volume, trabecular number, and trabecular thickness, presumably due to suppression of osteoblast-mediated bone formation and activation of osteoclast-mediated bone resorption, the latter of which was consistent with elevated serum levels of osteoclastogenic cytokines IL-1α and -1β. As determined by peripheral quantitative computed tomography, running increased cortical density and thickness in the femoral and tibial diaphyses of BKO mice compared with those of sedentary BKO mice. Several histomorphometric parameters suggested an enhancement of bone formation (e.g., increased mineral apposition rate) and suppression of bone resorption (e.g., decreased osteoclast surface), which led to increases in trabecular bone volume and trabecular thickness in running BKO mice. In conclusion, BKO mice exhibited pervasive osteopenia and impaired bone microstructure, whereas running exercise appeared to be an effective intervention in alleviating bone microstructural defect in β-thalassemia. Copyright © 2014 the American Physiological Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thein, S.L.; Weatherall, D.J.; Sampietro, M.
[open quotes]Heterocellular hereditary persistence of fetal hemoglobin[close quotes] (HPFH) is the term used to describe the genetically determined persistence of fetal hemoglobin (Hb F) production into adult life, in the absence of any related hematological disorder. Whereas some forms are caused by mutations in the [beta]-globin gene cluster on chromosome 11, others segregate independently. While the latter are of particular interest with respect to the regulation of globin gene switching, it has not been possible to determine their chromosomal location, mainly because their mode of inheritance is not clear, but also because several other factors are known to modify Hbmore » F production. The authors have examined a large Asian Indian pedigree which includes individuals with heterocellular HPFH associated with [beta]-thalassemia and/or [alpha]-thalassemia. Segregation analysis was conducted on the HPFH trait FC, defined to be the percentage of Hb F-containing cells (F-cells), using the class D regressive model. The results provide evidence for the presence of a major gene, dominant or codominant, which controls the FC values with residual familial correlations. The major gene was detected when the effects of genetic modifiers, notably [beta]-thalassemia and the XmnI-[sup G][gamma] polymorphism, are accounted for in this analysis. Linkage with the [beta]-globin gene cluster is excluded. The transmission of the FC values in this pedigree is informative enough to allow detection of linkage with an appropriate marker(s). The analytical approach outlined in this study, using simple regression to allow for genetic modifiers and thus allowing the mode of inheritance of a trait to be dissected out, may be useful as a model for segregation and linkage analyses of other complex phenotypes. 39 refs., 4 figs., 6 tabs.« less
Coleman, Leon G.; He, Jun; Lee, Joohwi; Styner, Martin; Crews, Fulton T.
2013-01-01
Background Binge-drinking is common in human adolescents. The adolescent brain is undergoing structural maturation and has a unique sensitivity to alcohol neurotoxicity. Therefore, adolescent binge ethanol may have long-term effects on the adult brain that alter brain structure and behaviors that are relevant to alcohol use disorders. Methods In order to determine if adolescent ethanol binge drinking alters the adult brain, male C57BL/6 mice were treated with either water or ethanol during adolescence (5g/kg/day i.g., post-natal days P28-37) and assessed during adulthood (P60-P88). An array of neurotransmitter-specific genes, behavioral tests (i.e. reversal learning, prepulse inhibition, and open field), and post-mortem brain structure using MRI and immunohistochemistry, were employed to assess persistent alterations in adult brain. Results At P38, 24 hours after adolescent ethanol (AE) binge, many neurotransmitter genes, particularly cholinergic and dopaminergic, were reduced by ethanol treatment. Interestingly, dopamine receptor type 4 mRNA was reduced and confirmed using immunohistochemistry. Normal control maturation (P38-P88) resulted in decreased neurotransmitter mRNA, e.g. an average decrease of 56%. Following adolescent ethanol treatment, adults showed greater gene expression reductions than controls, averaging 73%. Adult spatial learning assessed in the Morris water maze was not changed by adolescent ethanol treatment, but reversal learning experiments revealed deficits. Assessment of adult brain region volumes using MRI indicated that the olfactory bulb and basal forebrain were smaller in adults following adolescent ethanol. Immunohistochemical analyses found reduced basal forebrain area and fewer basal forebrain cholinergic neurons. Conclusions Adolescent binge ethanol treatment reduces adult neurotransmitter gene expression, particularly cholinergic genes, reduces basal forebrain and olfactory bulb volumes, and causes a reduction in the density of basal
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Olfactory gene expression in migrating adult sockeye salmon Oncorhynchus nerka.
Bett, N N; Hinch, S G; Kaukinen, K H; Li, S; Miller, K M
2018-04-16
Expression of 12 olfactory genes was analysed in adult sockeye salmon Oncorhynchus nerka nearing spawning grounds and O. nerka that had strayed from their natal migration route. Variation was found in six of these genes, all of which were olfc olfactory receptors and had lower expression levels in salmon nearing spawning grounds. The results may reflect decreased sensitivity to natal water olfactory cues as these fish are no longer seeking the correct migratory route. The expression of olfactory genes during the olfactory-mediated spawning migration of Pacific salmon Oncorhynchus spp. is largely unexplored and these findings demonstrate a link between migratory behaviours and olfactory plasticity that provides a basis for future molecular research on salmon homing. © 2018 The Fisheries Society of the British Isles.
... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...
TREATING HEMOGLOBINOPATHIES USING GENE CORRECTION APPROACHES: PROMISES AND CHALLENGES
Cottle, Renee N.; Lee, Ciaran M.; Bao, Gang
2016-01-01
Hemoglobinopathies are genetic disorders caused by aberrant hemoglobin expression or structure changes, resulting in severe mortality and health disparities worldwide. Sickle cell disease (SCD) and β-thalassemia, the most common forms of hemoglobinopathies, are typically treated using transfusions and pharmacological agents. Allogeneic hematopoietic stem cell transplantation is the only curative therapy, but has limited clinical applicability. Although gene therapy approaches have been proposed based on the insertion and forced expression of wild-type or anti-sickling β-globin variants, safety concerns may impede their clinical application. A novel curative approach is nuclease-based gene correction, which involves the application of precision genome editing tools to correct the disease-causing mutation. This review describes the development and potential application of gene therapy and precision genome editing approaches for treating SCD and β-thalassemia. The opportunities and challenges in advancing a curative therapy for hemoglobinopathies are also discussed. PMID:27314256
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less
Nuzzolo, Eugenia R; Capodimonti, Sara; Martini, Maurizio; Iachininoto, Maria G; Bianchi, Maria; Cocomazzi, Alessandra; Zini, Gina; Leone, Giuseppe; Larocca, Luigi M; Teofili, Luciana
2014-01-01
Endothelial colony-forming cells (ECFC) are endowed with vascular regenerative ability in vivo and in vitro. In this study we compared the genotypic profile and the immunogenic potential of adult and cord blood ECFC, in order to explore the feasibility of using them as a cell therapy product. ECFC were obtained from cord blood samples not suitable for haematopoietic stem cell transplantation and from adult healthy blood donors after informed consent. Genotypes were analysed by commercially available microarray assays and results were confirmed by real-time polymerase chain reaction analysis. HLA antigen expression was evaluated by flow-cytometry. Immunogenic capacity was investigated by evaluating the activation of allogeneic lymphocytes and monocytes in co-cultures with ECFC. Microarray assays revealed that the genetic profile of cord blood and adult ECFC differed in about 20% of examined genes. We found that cord blood ECFC were characterised by lower pro-inflammatory and pro-thrombotic gene expression as compared to adult ECFC. Furthermore, whereas cord blood and adult ECFCs expressed similar amount of HLA molecules both at baseline and after incubation with γ-interferon, cord blood ECFC elicited a weaker expression of pro-inflammatory cytokine genes. Finally, we observed no differences in the amount of HLA antigens expressed among cord blood ECFC, adult ECFC and mesenchymal cells. Our observations suggest that cord blood ECFC have a lower pro-inflammatory and pro-thrombotic profile than adult ECFC. These preliminary data offer level-headed evidence to use cord blood ECFC as a cell therapy product in vascular diseases.
Epigenetic gene regulation in the adult mammalian brain: multiple roles in memory formation.
Lubin, Farah D
2011-07-01
Brain-derived neurotrophic factor (bdnf) is one of numerous gene products necessary for long-term memory formation and dysregulation of bdnf has been implicated in the pathogenesis of cognitive and mental disorders. Recent work indicates that epigenetic-regulatory mechanisms including the markings of histone proteins and associated DNA remain labile throughout the life-span and represent an attractive molecular process contributing to gene regulation in the brain. In this review, important information will be discussed on epigenetics as a set of newly identified dynamic transcriptional mechanisms serving to regulate gene expression changes in the adult brain with particular emphasis on bdnf transcriptional readout in learning and memory formation. This review will also highlight evidence for the role of epigenetics in aberrant bdnf gene regulation in the pathogenesis of cognitive dysfunction associated with seizure disorders, Rett syndrome, Schizophrenia, and Alzheimer's disease. Such research offers novel concepts for understanding epigenetic transcriptional mechanisms subserving adult cognition and mental health, and furthermore promises novel avenues for therapeutic approach in the clinic. Copyright © 2011 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Popp, R.A.; Marsh, C.L.; Skow, L.C.
Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less
Virally mediated gene manipulation in the adult CNS
Edry, Efrat; Lamprecht, Raphael; Wagner, Shlomo; Rosenblum, Kobi
2011-01-01
Understanding how the CNS functions poses one of the greatest challenges in modern life science and medicine. Studying the brain is especially challenging because of its complexity, the heterogeneity of its cellular composition, and the substantial changes it undergoes throughout its life-span. The complexity of adult brain neural networks results also from the diversity of properties and functions of neuronal cells, governed, inter alia, by temporally and spatially differential expression of proteins in mammalian brain cell populations. Hence, research into the biology of CNS activity and its implications to human and animal behavior must use novel scientific tools. One source of such tools is the field of molecular genetics—recently utilized more and more frequently in neuroscience research. Transgenic approaches in general, and gene targeting in rodents have become fundamental tools for elucidating gene function in the CNS. Although spectacular progress has been achieved over recent decades by using these approaches, it is important to note that they face a number of restrictions. One of the main challenges is presented by the temporal and spatial regulation of introduced genetic manipulations. Viral vectors provide an alternative approach to temporally regulated, localized delivery of genetic modifications into neurons. In this review we describe available technologies for gene transfer into the adult mammalian CNS that use both viral and non-viral tools. We discuss viral vectors frequently used in neuroscience, with emphasis on lentiviral vector (LV) systems. We consider adverse effects of LVs, and the use of LVs for temporally and spatially controllable manipulations. Especially, we highlight the significance of viral vector-mediated genetic manipulations in studying learning and memory processes, and how they may be effectively used to separate out the various phases of learning: acquisition, consolidation, retrieval, and maintenance. PMID:22207836
IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.
Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan
2017-01-01
Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.
Soares, Michelle Prioli Miranda; Barchuk, Angel Roberto; Simões, Ana Carolina Quirino; Dos Santos Cristino, Alexandre; de Paula Freitas, Flávia Cristina; Canhos, Luísa Lange; Bitondi, Márcia Maria Gentile
2013-08-28
The insect exoskeleton provides shape, waterproofing, and locomotion via attached somatic muscles. The exoskeleton is renewed during molting, a process regulated by ecdysteroid hormones. The holometabolous pupa transforms into an adult during the imaginal molt, when the epidermis synthe3sizes the definitive exoskeleton that then differentiates progressively. An important issue in insect development concerns how the exoskeletal regions are constructed to provide their morphological, physiological and mechanical functions. We used whole-genome oligonucleotide microarrays to screen for genes involved in exoskeletal formation in the honeybee thoracic dorsum. Our analysis included three sampling times during the pupal-to-adult molt, i.e., before, during and after the ecdysteroid-induced apolysis that triggers synthesis of the adult exoskeleton. Gene ontology annotation based on orthologous relationships with Drosophila melanogaster genes placed the honeybee differentially expressed genes (DEGs) into distinct categories of Biological Process and Molecular Function, depending on developmental time, revealing the functional elements required for adult exoskeleton formation. Of the 1,253 unique DEGs, 547 were upregulated in the thoracic dorsum after apolysis, suggesting induction by the ecdysteroid pulse. The upregulated gene set included 20 of the 47 cuticular protein (CP) genes that were previously identified in the honeybee genome, and three novel putative CP genes that do not belong to a known CP family. In situ hybridization showed that two of the novel genes were abundantly expressed in the epidermis during adult exoskeleton formation, strongly implicating them as genuine CP genes. Conserved sequence motifs identified the CP genes as members of the CPR, Tweedle, Apidermin, CPF, CPLCP1 and Analogous-to-Peritrophins families. Furthermore, 28 of the 36 muscle-related DEGs were upregulated during the de novo formation of striated fibers attached to the exoskeleton. A
The developmental genetics of human hemoglobin.
Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B
1985-01-01
Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that
Besson, Vanessa; Smeriglio, Piera; Wegener, Amélie; Relaix, Frédéric; Nait Oumesmar, Brahim; Sassoon, David A.; Marazzi, Giovanna
2011-01-01
A variety of markers are invaluable for identifying and purifying stem/progenitor cells. Here we report the generation of a murine reporter line driven by Pw1 that reveals cycling and quiescent progenitor/stem cells in all adult tissues thus far examined, including the intestine, blood, testis, central nervous system, bone, skeletal muscle, and skin. Neurospheres generated from the adult PW1-reporter mouse show near 100% reporter-gene expression following a single passage. Furthermore, epidermal stem cells can be purified solely on the basis of reporter-gene expression. These cells are clonogenic, repopulate the epidermal stem-cell niches, and give rise to new hair follicles. Finally, we demonstrate that only PW1 reporter-expressing epidermal cells give rise to follicles that are capable of self-renewal following injury. Our data demonstrate that PW1 serves as an invaluable marker for competent self-renewing stem cells in a wide array of adult tissues, and the PW1-reporter mouse serves as a tool for rapid stem cell isolation and characterization. PMID:21709251
Two Alzheimer’s disease risk genes increase entorhinal cortex volume in young adults
DiBattista, Amanda Marie; Stevens, Benson W.; Rebeck, G. William; Green, Adam E.
2014-01-01
Alzheimer’s disease (AD) risk genes alter brain structure and function decades before disease onset. Apolipoprotein E (APOE) is the strongest known genetic risk factor for AD, and a related gene, apolipoprotein J (APOJ), also affects disease risk. However, the extent to which these genes affect brain structure in young adults remains unclear. Here, we report that AD risk alleles of these two genes, APOE-ε4 and APOJ-C, cumulatively alter brain volume in young adults. Using voxel-based morphometry (VBM) in 57 individuals, we examined the entorhinal cortex, one of the earliest brain regions affected in AD pathogenesis. Apolipoprotein E-ε4 carriers exhibited higher right entorhinal cortex volume compared to non-carriers. Interestingly, APOJ-C risk genotype was associated with higher bilateral entorhinal cortex volume in non-APOE-ε4 carriers. To determine the combined disease risk of APOE and APOJ status per subject, we used cumulative odds ratios as regressors for volumetric measurements. Higher disease risk corresponded to greater right entorhinal cortex volume. These results suggest that, years before disease onset, two key AD genetic risk factors may exert influence on the structure of a brain region where AD pathogenesis takes root. PMID:25339884
Origa, Raffaella
2017-06-01
β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.
Townsend, Brigitte E; Johnson, Rodney W
2016-01-01
Increased neuroinflammation and oxidative stress resulting from heightened microglial activation are associated with age-related cognitive impairment. The objectives of this study were to examine the effects of the bioactive sulforaphane (SFN) on the nuclear factor E2-related factor 2 (Nrf2) pathway in BV2 microglia and primary microglia, and to evaluate proinflammatory cytokine expression in lipopolysaccharide (LPS)-stimulated primary microglia from adult and aged mice. BV2 microglia and primary microglia isolated from young adult and aged mice were treated with SFN and LPS. Changes in Nrf2 activity, expression of Nrf2 target genes, and levels of proinflammatory markers were assessed by quantitative PCR and immunoassay. SFN increased Nrf2 DNA-binding activity and upregulated Nrf2 target genes in BV2 microglia, while reducing LPS-induced interleukin (IL-)1β, IL-6, and inducible nitric oxide synthase (iNOS). In primary microglia from adult and aged mice, SFN increased expression of Nrf2 target genes and attenuated IL-1β, IL-6, and iNOS induced by LPS. These data indicate that SFN is a potential beneficial supplement that may be useful for reducing microglial mediated neuroinflammation and oxidative stress associated with aging. Copyright © 2015 Elsevier Inc. All rights reserved.
Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.
Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca
2015-01-01
β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.
Rieder, Ronald F.
1971-01-01
Hemoglobin Gun Hill is an unstable mutant hemoglobin associated with mild compensated hemolysis. This abnormal protein has a deletion of five amino acids in the β-chains. The deletion includes the heme-binding proximal histidine at position 92. The β-chains of hemoglobin Gun Hill lack heme groups. Approximately 32% of the circulating hemoglobin in heterozygous subjects consists of the mutant hemoglobin. When reticulocytes were incubated with radioactive amino acid the specific activity of hemoglobin Gun Hill was three to six times that of hemoglobin A. Total incorporation of radioactivity into hemoglobin Gun Hill was two to three times that into hemoglobin A. There were 20-50% more total counts in β-Gun Hill (βGH) than in βA. These results indicate that in reticulocytes there was greater synthesis of the abnormal β-chains than βA-chains. The ratio of the specific activities of the α-chains of hemoglobin Gun Hill to the α-chains of hemoglobin A was 20: 1. There was evidence of a free pool of α-chains in the reticulocytes containing hemoglobin Gun Hill. After 10 min of incubation approximately 40% of the total α-chain radioactivity was in the free pool. When protein synthesis was blocked by incubation of reticulocytes with puromycin, the specific activity of the α-chains of hemoglobin Gun Hill continued to increase due to direct exchange of α-subunits between the free pool and preformed hemoglobin Gun Hill. Studies of the assembly of βA and βGH revealed that the rates of translation of the two polypeptide chains were equal and uniform. No evidence was obtained for the existence of “slow points” in the process of globin chain assembly. The studies also suggest that lack of strong heme-globin binding does not hinder the synthesis of globin chains. PMID:5540175
Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling
2018-04-07
HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.
Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro
2007-06-01
To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.
Wojciechowska-Durczynska, Katarzyna; Krawczyk-Rusiecka, Kinga; Zygmunt, Arkadiusz; Stawerska, Renata; Lewinski, Andrzej
2016-01-01
Numerous genetic studies revealed several susceptibility genes of autoimmune thyroid diseases (AITD), including CTLA4, PTPN22 and FCRL3. These immune-modulating genes are involved in genetic background of AITD among children and adult patients. However, possible age-related differences in overexpression of these genes remain unclear. The goal of this single centre cohort study was evaluation of expression levels of three (3) genes CTLA4, PTPN22 and FCRL3 in adult patients and children with autoimmune thyroiditis. A total of 47 patients--24 adults (mean age--47.7 years) and 23 children (mean age--12.4 years) with autoimmune thyroiditis were assessed for the level of expression of CTLA4, PTPN22 and FCRL3 genes, utilizing ABI PRISM' 7500 Sequence Detection System (Applied Biosystem, Foster City, CA, USA). The overexpression of PTPN22 (mean RQ = 2.988) and FCRL3 (mean RQ = 2.544) genes were confirmed in adult patients with autoimmune thyroiditis, at the same time the expression level of CTLA4 gene was significantly decreased (mean RQ = 0.899) (p < 0.05). Similar discrepancies were not observed in children with autoimmune thyroiditis in whom overexpression of all three genes--CTLA4, PTPN22 and FCRL3--was observed. Differences in CTLA4 and FCRL3 genes expression levels in patients with autoimmune thyroiditis were found depending on the age, with increased expression levels of CTLA4 (mean RQ = 3.45 1) and FCRL3 (mean RQ = 7.410) in children when compared to adults (p < 0.05) (Mann-Whitney's U-test). There were moderate negative linear correlations between two genes in question (CTLA4 and FCRL3) expression level and patients' age [correlation coefficient (r) = -0.529 (p < 0.0002) and -0.423 (p < 0.0032), respectively; Spearman's rank correlation test]. Our results are consistent with the hypothesis that there are few age-dependent genetic differences as regards autoimmune thyroiditis in adults and children. Accordingly, CTLA4 and FCRL3 genes overexpression may play an
Ekman, Anna; Ilves, Mika; Iivanainen, Antti
2012-05-01
Fetal cattle B-cell development proceeds via a pre-B cell stage that is characterized by the expression of surrogate light chain and recombination activation genes. In this paper, we identify a new member of bovine pre-B lymphocyte genes, VPREB2. Using RT-qPCR, we assess the expression of VPREB2 and three other surrogate light chain genes as well as RAG1 and RAG2 in fetal and adult cattle tissues. The absence of VPREB1, IGLL1, RAG1 and RAG2 expression in adult tissues and the lack of B-lymphoid differentiation in adult bone marrow - OP9 stromal cell co-culture, suggest a decline of B lymphopoiesis in adult cattle. The marked differences in the expression profiles of VPREB2 and VPREB3 in comparison to those of VPREB1, IGLL1 and RAGs suggest that the biological roles of VPREB2 and VPREB3 are unrelated to the pre-B cells. Copyright © 2011 Elsevier Ltd. All rights reserved.
Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population
Esteban, Cristina; Audí, Laura; Carrascosa, Antonio; Fernández-Cancio, Mónica; Pérez-Arroyo, Annalisa; Ulied, Angels; Andaluz, Pilar; Arjona, Rosa; Albisu, Marian; Clemente, María; Gussinyé, Miquel; Yeste, Diego
2007-01-01
Objective GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions. The aim of the study was to establish the complete map of GH1 gene SNPs in our control normal population and to analyse its association with adult height. Design, subjects and measurements A systematic GH1 gene analysis was designed in a control population of 307 adults of both sexes with height normally distributed within normal range for the same population: −2 standard deviation scores (SDS) to +2 SDS. An analysis was performed on individual and combined genotype associations with adult height. Results Twenty-five SNPs presented a frequency over 1%: 11 in the promoter (P1 to P11), three in the 5′UTR region (P12 to P14), one in exon 1 (P15), three in intron 1 (P16 to P18), two in intron 2 (P19 and P20), two in exon 4 (P21 and P22) and three in intron 4 (P23 to P25). Twenty-nine additional changes with frequencies under 1% were found in 29 subjects. P8, P19, P20 and P25 had not been previously described. P6, P12, P17 and P25 accounted for 6·2% of the variation in adult height (P = 0·0007) in this population with genotypes A/G at P6, G/G at P6 and A/G at P12 decreasing height SDS (−0·063 ± 0·031, −0·693 ± 0·350 and −0·489 ± 0·265, Mean ± SE) and genotypes A/T at P17 and T/G at P25 increasing height SDS (+1·094 ± 0·456 and +1·184 ± 0·432). Conclusions This study established the GH1 gene sequence variation map in a normal adult height control population confirming the high density of SNPs in a relatively small gene. Our study shows that the more frequent SNPs did not significantly contribute to height determination, while only one promoter and two intronic SNPs contributed significantly to it. Studies in larger populations will have to confirm the associations and in vitro functional studies will elucidate the mechanisms involved. Systematic GH1 gene analysis in patients with growth delay and suspected
Regulation and Function of Adult Neurogenesis: From Genes to Cognition
Aimone, James B.; Li, Yan; Lee, Star W.; Clemenson, Gregory D.; Deng, Wei; Gage, Fred H.
2014-01-01
Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. This review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages of maturation, ultimately integrating into the adult dentate gyrus network. The increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders. PMID:25287858
Regulation and Function of Adult Neurogenesis. From Genes to Cognition
Aimone, J. B.; Li, Y.; Lee, S. W.; ...
2014-10-01
Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. Our review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages ofmore » maturation, ultimately integrating into the adult dentate gyrus network. Furthermore, the increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders.« less
Regulation and Function of Adult Neurogenesis. From Genes to Cognition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aimone, J. B.; Li, Y.; Lee, S. W.
Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. Our review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages ofmore » maturation, ultimately integrating into the adult dentate gyrus network. Furthermore, the increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders.« less
Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe
2010-07-01
Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.
2010-01-01
Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405
Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z
2018-04-01
To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Enriched expression of the ciliopathy gene Ick in cell proliferating regions of adult mice.
Tsutsumi, Ryotaro; Chaya, Taro; Furukawa, Takahisa
2018-04-07
Cilia are essential for sensory and motile functions across species. In humans, ciliary dysfunction causes "ciliopathies", which show severe developmental abnormalities in various tissues. Several missense mutations in intestinal cell kinase (ICK) gene lead to endocrine-cerebro-osteodysplasia syndrome or short rib-polydactyly syndrome, lethal recessive developmental ciliopathies. We and others previously reported that Ick-deficient mice exhibit neonatal lethality with developmental defects. Mechanistically, Ick regulates intraflagellar transport and cilia length at ciliary tips. Although Ick plays important roles during mammalian development, roles of Ick at the adult stage are poorly understood. In the current study, we investigated the Ick gene expression in adult mouse tissues. RT-PCR analysis showed that Ick is ubiquitously expressed, with enrichment in the retina, brain, lung, intestine, and reproductive system. In the adult brain, we found that Ick expression is enriched in the walls of the lateral ventricle, in the rostral migratory stream of the olfactory bulb, and in the subgranular zone of the hippocampal dentate gyrus by in situ hybridization analysis. We also observed that Ick staining pattern is similar to pachytene spermatocyte to spermatid markers in the mature testis and to an intestinal stem cell marker in the adult small intestine. These results suggest that Ick is expressed in proliferating regions in the adult mouse brain, testis, and intestine. Copyright © 2018 Elsevier B.V. All rights reserved.
Gong, Ping; Fanos, Joanna H; Korty, Lauren; Siskind, Carly E; Hanson-Kahn, Andrea K
2016-12-01
Huntington disease (HD) is an autosomal dominant, progressive neurodegenerative disorder for which there is no cure. Predictive testing for HD is available to asymptomatic at-risk individuals. Approximately half of the population undergoing predictive testing for HD consists of young adults (≤35 years old). Finishing one's education, starting a career, engaging in romantic relationships and becoming a parent are key milestones of young adulthood. We conducted a qualitative study to explore how testing gene-positive for HD influences young adults' attainment of these milestones, and to identify major challenges that pre-symptomatic young adults face to aid the development of targeted genetic counseling. Results of our study demonstrate that 1) knowing one's gene-positive status results in an urgency to reach milestones and positively changes young adults' approach to life; 2) testing positive influences young adults' education and career choices, romantic relationships, and family planning; 3) young adults desire flexible and tailored genetic counseling to address needs and concerns unique to this population. Findings of this study contribute to the understanding of the impact of predictive testing for HD on young adults, and highlight issues unique to this population that call for further research, intervention and advocacy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Popp, R.A.; Popp, D.M.; Johnson, F.M.
Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less
Precision Genome Editing for Treating Single-gene Disorders
NASA Astrophysics Data System (ADS)
Bao, Gang
There are an estimated 6,000 human single-gene disorders, most of them have no cure. This imposes a significant burden on human health worldwide. The recent advent in developing engineered nucleases, especially CRISPR/Cas9 (clustered, regularly interspaced, short palindromic repeats and CRISPR-associated protein 9) systems provides a powerful tool for precisely modifying the human genome, thus revolutionizing the treatment of single-gene disorders. In this talk, I will present recent work in my lab on developing new tools and methods for the design and optimization of CRISPR/Cas9 systems, and the efforts in developing a clinically applicable gene correction strategy for treating sickle cell disease (SCD), which is the first single-gene disorder with molecular understanding. We optimized CRISPR/Cas9 systems targeting the beta-globin gene, and systematically evaluated their on- and off-target cleavage in different cells. We also quantified the nuclease-induced gene modification rates in CD34+ cells from SCD patients, and demonstrated that CRISPR/Cas9 based genome editing is effective in generating normal hemoglobin (HbA) and reducing sickling hemoglobin (HbS). These studies significantly facilitated our pre-clinical investigation of SCD treatment using CRISPR/Cas9 and donor templates. The opportunities and challenges in developing nuclease-based genome editing strategies for treating single-gene disorders are discussed.
Contribution of long-range interactions to the secondary structure of an unfolded globin.
Fedyukina, Daria V; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C; Eun, Ye-Jin; Cavagnero, Silvia
2010-09-08
This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an alpha-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable alpha-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Contribution of Long-Range Interactions to the Secondary Structure of an Unfolded Globin
Fedyukina, Daria V.; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C.; Eun, Ye-Jin; Cavagnero, Silvia
2010-01-01
This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an α-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable α-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. PMID:20816043
Du, Wenxiao; Zeng, Fanrong
2016-12-14
Adults of the lady beetle species Harmonia axyridis (Pallas) are bred artificially en masse for classic biological control, which requires egg-laying by the H. axyridis ovary. Development-related genes may impact the growth of the H. axyridis adult ovary but have not been reported. Here, we used integrative time-series RNA-seq analysis of the ovary in H. axyridis adults to detect development-related genes. A total of 28,558 unigenes were functionally annotated using seven types of databases to obtain an annotated unigene database for ovaries in H. axyridis adults. We also analysed differentially expressed genes (DEGs) between samples. Based on a combination of the results of this bioinformatics analysis with literature reports and gene expression level changes in four different stages, we focused on the development of oocyte reproductive stem cell and yolk formation process and identified 26 genes with high similarity to development-related genes. 20 DEGs were randomly chosen for quantitative real-time PCR (qRT-PCR) to validate the accuracy of the RNA-seq results. This study establishes a robust pipeline for the discovery of key genes using high-throughput sequencing and the identification of a class of development-related genes for characterization.
Rava, Marta; Ahmed, Ismail; Kogevinas, Manolis; Le Moual, Nicole; Bouzigon, Emmanuelle; Curjuric, Ivan; Dizier, Marie-Hélène; Dumas, Orianne; Gonzalez, Juan R.; Imboden, Medea; Mehta, Amar J.; Tubert-Bitter, Pascale; Zock, Jan-Paul; Jarvis, Deborah; Probst-Hensch, Nicole M.; Demenais, Florence; Nadif, Rachel
2016-01-01
Background: The biological mechanisms by which cleaning products and disinfectants—an emerging risk factor—affect respiratory health remain incompletely evaluated. Studying genes by environment interactions (G × E) may help identify new genes related to adult-onset asthma. Objectives: We identified interactions between genetic polymorphisms of a large set of genes involved in the response to oxidative stress and occupational exposures to low molecular weight (LMW) agents or irritants on adult-onset asthma. Methods: Our data came from three large European cohorts: Epidemiological Family-based Study of the Genetics and Environment of Asthma (EGEA), Swiss Cohort Study on Air Pollution and Lung and Heart Disease in Adults (SAPALDIA), and European Community Respiratory Health Survey in Adults (ECRHS). A candidate pathway–based strategy identified 163 genes involved in the response to oxidative stress and potentially related to exposures to LMW agents/irritants. Occupational exposures were evaluated using an asthma job-exposure matrix and job-specific questionnaires for cleaners and healthcare workers. Logistic regression models were used to detect G × E interactions, adjusted for age, sex, and population ancestry, in 2,599 adults (mean age, 47 years; 60% women, 36% exposed, 18% asthmatics). p-Values were corrected for multiple comparisons. Results: Ever exposure to LMW agents/irritants was associated with current adult-onset asthma [OR = 1.28 (95% CI: 1.04, 1.58)]. Eight single nucleotide polymorphism (SNP) by exposure interactions at five loci were found at p < 0.005: PLA2G4A (rs932476, chromosome 1), near PLA2R1 (rs2667026, chromosome 2), near RELA (rs931127, rs7949980, chromosome 11), PRKD1 (rs1958980, rs11847351, rs1958987, chromosome 14), and PRKCA (rs6504453, chromosome 17). Results were consistent across the three studies and after accounting for smoking. Conclusions: Using a pathway-based selection process, we identified novel genes potentially involved
The effect of histone deacetylase inhibitors on AHSP expression
Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin
2018-01-01
Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05), except for the expression of BCL11A, which was down-regulated (p < 0.05) in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005) on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946
A role for exon sequences in alternative splicing of the human fibronectin gene.
Mardon, H J; Sebastio, G; Baralle, F E
1987-01-01
Exon EDIIIA of the fibronectin (Fn) gene is alternatively spliced via pathways which either skip or include the whole exon in the messenger RNA (mRNA). We have investigated the role of EDIIIA exon sequences in the human Fn gene in determining alternative splicing of this exon during transient expression of alpha globin/Fn minigene hybrids in HeLa cells. We demonstrate that a DNA sequence of 81bp within the central region of exon EDIIIA is required for alternative splicing during processing of the primary transcript to generate both EDIIIA+ and EDIIIA- mRNA's. Furthermore, alternative splicing of EDIIIA only occurs when this sequence is present in the correct orientation since when it is in antisense orientation splicing always occurs via exon-skipping generating EDIIIA- mRNA. Images PMID:3671064
Stevens, Benson W; DiBattista, Amanda M; William Rebeck, G; Green, Adam E
2014-08-01
Identifying pathways by which genetic Alzheimer׳s disease (AD) risk factors exert neurocognitive effects in young adults are essential for the effort to develop early interventions to forestall or prevent AD onset. Here, in a brain-imaging cohort of 59 young adults, we investigated effects of a variant within the clusterin (CLU) gene on working memory function and gray matter volume in cortical areas that support working memory. In addition, we investigated the extent to which effects of CLU genotype on working memory were independent of variation in the strongest AD risk factor gene apolipoprotein E (APOE). CLU is among the strongest genetic AD risk factors and, though it appears to share AD pathogenesis-related features with, APOE, it has been far less well studied. CLU genotype was associated with working memory performance in our study cohort. Notably, we found that variation in gray matter volume in a parietal region, previously implicated in maintenance of information for working memory, mediated the effect of CLU on working memory performance. APOE genotype did not affect working memory within our sample, and did not interact with CLU genotype. To our knowledge, this work represents the first evidence of a behavioral effect of CLU genotype in young people. In addition, this work identifies the first gene-brain-cognition mediation effect pathway for the transmission of the effect of an AD risk factor. Relative to conventional pairwise associations in cognitive neurogenetic research, gene-brain-cognition mediation modeling provides a more integrated understanding of how genetic effects transmit from gene to brain to cognitive function. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Epstein, N.; Than, K.A. Culp, K.M.
Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less
Lockyer, Anne E; Noble, Leslie R; Rollinson, David; Jones, Catherine S
2004-01-01
The freshwater tropical snail Biomphalaria glabrata is an intermediate host for Schistosoma mansoni, the causative agent of human intestinal schistosomiasis, and strains differ in their susceptibility to parasite infection. Changes in gene expression in response to parasite infection have been simultaneously examined in a susceptible strain (NHM1742) and a resistant strain (NHM1981) using a newly developed fluorescent-based differential display method. Such RNA profiling techniques allow the examination of changes in gene expression in response to parasite infection, without requiring previous sequence knowledge, or selecting candidate genes that may be involved in the complex neuroendocrine or defence systems of the snail. Thus, novel genes may be identified. Ten transcripts were initially identified, present only in the profiles derived from snails of the resistant strain when exposed to infection. The differential expression of five of these genes, including HSP70 and several novel transcripts with one containing at least two globin-like domains, has been confirmed by semi-quantitative RT-PCR.
Cannon, Matthew V.; Buchner, David A.; Hester, James; Miller, Hadley; Sehayek, Ephraim; Nadeau, Joseph H.; Serre, David
2014-01-01
Aims Epidemiological and animal studies have shown that maternal diet can influence metabolism in adult offspring. However, the molecular mechanisms underlying these changes remain poorly understood. Here, we characterize the phenotypes induced by maternal obesity in a mouse model and examine gene expression and epigenetic changes induced by maternal diet in adult offspring. Methods We analyzed genetically identical male mice born from dams fed a high- or low-fat diet throughout pregnancy and until day 21 postpartum. After weaning, half of the males of each group were fed a high-fat diet, the other half a low-fat diet. We first characterized the genome-wide gene expression patterns of six tissues of adult offspring - liver, pancreas, white adipose, brain, muscle and heart. We then measured DNA methylation patterns in liver at selected loci and throughout the genome. Results Maternal diet had a significant effect on the body weight of the offspring when they were fed an obesogenic diet after weaning. Our analyses showed that maternal diet had a pervasive effect on gene expression, with a pronounced effect in liver where it affected many genes involved in inflammation, cholesterol synthesis and RXR activation. We did not detect any effect of the maternal diet on DNA methylation in the liver. Conclusions Overall, our findings highlighted the persistent influence of maternal diet on adult tissue regulation and suggested that the transcriptional changes were unlikely to be caused by DNA methylation differences in adult liver. PMID:24594983
Bultman, Scott J.; Gebuhr, Thomas C.; Magnuson, Terry
2005-01-01
The Brg1 catalytic subunit of SWI/SNF-related complexes has been implicated in many developmental and physiological processes, but null homozygotes die as blastocysts prior to implantation. To circumvent this early embryonic lethality, we performed an ENU mutagenesis screen and generated a Brg1 hypomorph mutation in the ATPase domain. The mutant Brg1 protein is stable, assembles into SWI/SNF-related complexes, and exhibits normal ATPase activity but is unable to establish DNase I hypersensitivity sites characteristic of open chromatin. Mutant embryos develop normally until midgestation but then exhibit a distinct block in the development of the erythroid lineage, leading to anemia and death. The mutant Brg1 protein is recruited to the β-globin locus, but chromatin remodeling and transcription are perturbed. Histone acetylation and DNA methylation are also affected. To our knowledge, Brg1 is the first chromatin-modifying factor shown to be required for β-globin regulation and erythropoiesis in vivo. Not only does this mutation establish a role for Brg1 during organogenesis, it also demonstrates that ATPase activity can be uncoupled from chromatin remodeling. PMID:16287714
Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman
2018-07-01
A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.
Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A
2009-01-01
Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867
Liu, Jie; Xie, Yaxiong; Ducharme, Danica M K; Shen, Jun; Diwan, Bhalchandra A; Merrick, B Alex; Grissom, Sherry F; Tucker, Charles J; Paules, Richard S; Tennant, Raymond; Waalkes, Michael P
2006-03-01
Our previous work has shown that exposure to inorganic arsenic in utero produces hepatocellular carcinoma (HCC) in adult male mice. To explore further the molecular mechanisms of transplacental arsenic hepatocarcinogenesis, we conducted a second arsenic transplacental carcinogenesis study and used a genomewide microarray to profile arsenic-induced aberrant gene expression more extensively. Briefly, pregnant C3H mice were given drinking water containing 85 ppm arsenic as sodium arsenite or unaltered water from days 8 to 18 of gestation. The incidence of HCC in adult male offspring was increased 4-fold and tumor multiplicity 3-fold after transplacental arsenic exposure. Samples of normal liver and liver tumors were taken at autopsy for genomic analysis. Arsenic exposure in utero resulted in significant alterations (p < 0.001) in the expression of 2,010 genes in arsenic-exposed liver samples and in the expression of 2,540 genes in arsenic-induced HCC. Ingenuity Pathway Analysis revealed that significant alterations in gene expression occurred in a number of biological networks, and Myc plays a critical role in one of the primary networks. Real-time reverse transcriptase-polymerase chain reaction and Western blot analysis of selected genes/proteins showed > 90% concordance. Arsenic-altered gene expression included activation of oncogenes and HCC biomarkers, and increased expression of cell proliferation-related genes, stress proteins, and insulin-like growth factors and genes involved in cell-cell communications. Liver feminization was evidenced by increased expression of estrogen-linked genes and altered expression of genes that encode gender-related metabolic enzymes. These novel findings are in agreement with the biology and histology of arsenic-induced HCC, thereby indicating that multiple genetic events are associated with transplacental arsenic hepatocarcinogenesis.
The insulation of genes from external enhancers and silencing chromatin
Burgess-Beusse, Bonnie; Farrell, Catherine; Gaszner, Miklos; Litt, Michael; Mutskov, Vesco; Recillas-Targa, Felix; Simpson, Melanie; West, Adam; Felsenfeld, Gary
2002-01-01
Insulators are DNA sequence elements that can serve in some cases as barriers to protect a gene against the encroachment of adjacent inactive condensed chromatin. Some insulators also can act as blocking elements to protect against the activating influence of distal enhancers associated with other genes. Although most of the insulators identified so far derive from Drosophila, they also are found in vertebrates. An insulator at the 5′ end of the chicken β-globin locus marks a boundary between an open chromatin domain and a region of constitutively condensed chromatin. Detailed analysis of this element shows that it possesses both enhancer blocking activity and the ability to screen reporter genes against position effects. Enhancer blocking is associated with binding of the protein CTCF; sites that bind CTCF are found at other critical points in the genome. Protection against position effects involves other properties that appear to be associated with control of histone acetylation and methylation. Insulators thus are complex elements that can help to preserve the independent function of genes embedded in a genome in which they are surrounded by regulatory signals they must ignore. PMID:12154228
Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M
2015-08-01
Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.
Creswell, J. David; Irwin, Michael R.; Burklund, Lisa J.; Lieberman, Matthew D.; Arevalo, Jesusa M. G.; Ma, Jeffrey; Breen, Elizabeth Crabb; Cole, Steven W.
2013-01-01
Lonely older adults have increased expression of pro-inflammatory genes as well as increased risk for morbidity and mortality. Previous behavioral treatments have attempted to reduce loneliness and its concomitant health risks, but have had limited success. The present study tested whether the 8-week Mindfulness-Based Stress Reduction (MBSR) program (compared to a Wait-List control group) reduces loneliness and downregulates loneliness-related pro-inflammatory gene expression in older adults (N=40). Consistent with study predictions, mixed effect linear models indicated that the MBSR program reduced loneliness, compared to small increases in loneliness in the control group (treatment condition × time interaction: F(1,35)=7.86, p=.008). Moreover, at baseline, there was an association between reported loneliness and upregulated pro-inflammatory NF-κB-related gene expression in circulating leukocytes, and MBSR downregulated this NF-κB-associated gene expression profile at post-treatment. Finally, there was a trend for MBSR to reduce C Reactive Protein (treatment condition × time interaction: (F(1,33)=3.39, p=.075). This work provides an initial indication that MBSR may be a novel treatment approach for reducing loneliness and related pro-inflammatory gene expression in older adults. PMID:22820409
Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca
2017-06-01
Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.
NASA Astrophysics Data System (ADS)
Chai, Tingting; Cui, Feng; Mu, Pengqian; Yang, Yang; Xu, Nana; Yin, Zhiqiang; Jia, Qi; Yang, Shuming; Qiu, Jing; Wang, Chengju
2016-01-01
Enantioselective enrichment of chiral PCB149 (2,2’,3,4’,5’,6-hexachlorobiphenyl) was analysed in adult zebrafish (Danio rerio) exposed to the racemate, (-)-PCB149, and (+)-PCB149. Greater enrichment of (-)-PCB149 compared to (+) PCB149 was observed following 0.5 ng/L exposure; however, as the exposure time and concentration increased, racemic enrichment was observed in adult fish exposed to the racemate. No biotransformation between the two isomers was observed in fish exposed to single enantiomers. When zebrafish were exposed to different forms of chiral PCB149, enantioselective expression of genes associated with polychlorinated biphenyls (PCBs) was observed in brain and liver tissues and enantioselective correlations between bioconcentration and target gene expression levels were observed in brain and liver tissues. The strong positive correlations between expression levels of target genes (alox5a and alox12) and PCB149 bioconcentration suggest that prolonged exposure to the racemate of chiral PCB149 may result in inflammation-associated diseases. Prolonged exposure to (-)-PCB149 may also affect metabolic pathways such as dehydrogenation and methylation in the brain tissues of adult zebrafish. Hepatic expression levels of genes related to the antioxidant system were significantly negatively correlated with bioconcentration following exposure to (+)-PCB149.
Geyer, Henriette; Bauer, Michael; Neumann, Jennifer; Lüdde, Amy; Rennert, Paul; Friedrich, Nicole; Claus, Claudia; Perelygina, Ludmilla; Mankertz, Annette
2016-02-02
Rubella virus (RV) infection is usually a mild illness in children and adults. However, maternal infection during the first trimester of pregnancy can lead to congenital rubella syndrome (CRS) in the infant. Fetuses with CRS show damage to the endothelium of the heart and blood vessels; thus, it has been speculated that the clinical manifestations associated with CRS may be a result of endothelial cells persistently infected with RV. Here, we compared the effects of RV infection on gene expression in primary endothelial cells of fetal (HUVEC) and of adult (HSaVEC) origin by transcriptional profiling. More than 75 % of the genes differentially regulated following RV infection were identical in both cell types. Gene Ontology (GO) analysis of these commonly regulated genes showed an enrichment of terms involved in cytokine production and cytokine regulation. Increased accumulation of inflammatory cytokines following RV infection was verified by protein microarray. Interestingly, the chemokine CCL14, which is implicated in supporting embryo implantation at the fetal-maternal interface, was down-regulated following RV infection only in HUVEC. Most noticeably, when analyzing the uniquely regulated transcripts for each cell type, GO term-based cluster analysis of the down-regulated genes of HUVEC revealed an enrichment of the GO terms "sensory organ development", "ear development" and "eye development". Since impairment in vision and hearing are the most prominent clinical manifestations observed in CRS patients, the here detected down-regulated genes involved in the development of sensory organs sheds light on the molecular mechanisms that may contribute to the teratogenic effect of RV.
High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?
Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H
2016-08-01
Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.
Okada, Morihiro; Miller, Thomas C.; Fu, Liezhen
2015-01-01
The T3-dependent anuran metamorphosis resembles postembryonic development in mammals, the period around birth when plasma T3 levels peak. In particular, the remodeling of the intestine during metamorphosis mimics neonatal intestinal maturation in mammals when the adult intestinal epithelial self-renewing system is established. We have been using intestinal metamorphosis to investigate how the organ-specific adult stem cells are formed during vertebrate development. Early studies in Xenopus laevis have shown that this process involves complete degeneration of the larval epithelium and de novo formation of adult stem cells. A tissue-specific microarray analysis of intestinal gene expression during Xenopus laevis metamorphosis has identified a number of candidate stem cell genes. Here we have carried out detailed analyses of one such gene, amidohydrolase domain containing 1 (AMDHD1) gene, which encodes an enzyme in the histidine catabolic pathway. We show that AMDHD1 is exclusively expressed in the proliferating adult epithelial stem cells during metamorphosis with little expression in other intestinal tissues. We further provide evidence that T3 activates AMDHD1 gene expression directly at the transcription level through T3 receptor binding to the AMDHD1 gene in the intestine. In addition, we have reported earlier that histidine ammonia-lyase gene, another gene in histidine catabolic pathway, is similarly regulated by T3 in the intestine. These results together suggest that histidine catabolism plays a critical role in the formation and/or proliferation of adult intestinal stem cells during metamorphosis. PMID:26086244
Okada, Morihiro; Miller, Thomas C; Fu, Liezhen; Shi, Yun-Bo
2015-09-01
The T3-dependent anuran metamorphosis resembles postembryonic development in mammals, the period around birth when plasma T3 levels peak. In particular, the remodeling of the intestine during metamorphosis mimics neonatal intestinal maturation in mammals when the adult intestinal epithelial self-renewing system is established. We have been using intestinal metamorphosis to investigate how the organ-specific adult stem cells are formed during vertebrate development. Early studies in Xenopus laevis have shown that this process involves complete degeneration of the larval epithelium and de novo formation of adult stem cells. A tissue-specific microarray analysis of intestinal gene expression during Xenopus laevis metamorphosis has identified a number of candidate stem cell genes. Here we have carried out detailed analyses of one such gene, amidohydrolase domain containing 1 (AMDHD1) gene, which encodes an enzyme in the histidine catabolic pathway. We show that AMDHD1 is exclusively expressed in the proliferating adult epithelial stem cells during metamorphosis with little expression in other intestinal tissues. We further provide evidence that T3 activates AMDHD1 gene expression directly at the transcription level through T3 receptor binding to the AMDHD1 gene in the intestine. In addition, we have reported earlier that histidine ammonia-lyase gene, another gene in histidine catabolic pathway, is similarly regulated by T3 in the intestine. These results together suggest that histidine catabolism plays a critical role in the formation and/or proliferation of adult intestinal stem cells during metamorphosis.
Koleoglu, Gun; Goodwin, Paul H.; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md.; Guzman-Novoa, Ernesto
2017-01-01
Honey bee (Apis mellifera) gene expression related to immunity for hymenoptaecin (AmHym) and defensin-1 (AmDef-1), longevity for vitellogenin (AmVit2) and stem cell proliferation for poly U binding factor 68 kDa (AmPuf68) was compared following Varroa destructor parasitism, buffer injection and injection of V. destructor compounds in its homogenate. In adults, V. destructor parasitism decreased expression of all four genes, while buffer injection decreased expression of AmHym, AmPuf68 and AmVit2, and homogenate injection decreased expression of AmPuf68 and AmVit2 but increased expression of AmDef-1 relative to their respective controls. The effect of V. destructor parasitism in adults relative to the controls was not significantly different from buffer injection for AmHym and AmVit2 expression, and it was not significantly different from homogenate injection for AmPuf68 and AmVit2. In brood, V. destructor parasitism, buffer injection and homogenate injection decreased AmVit2 expression, whereas AmHym expression was decreased by V. destructor parasitism but increased by buffer and homogenate injection relative to the controls. The effect of varroa parasitism in brood was not significantly different from buffer or homogenate injection for AmPuf68 and AmVit2. Expression levels of the four genes did not correlate with detectable viral levels in either brood or adults. The results of this study indicate that the relative effects of V. destructor parasitism on honey bee gene expression are also shared with other types of stresses. Therefore, some of the effects of V. destructor on honey bees may be mostly due to wounding and injection of foreign compounds into the hemolymph of the bee during parasitism. Although both brood and adults are naturally parasitized by V. destructor, their gene expression responded differently, probably the result of different mechanisms of host responses during development. PMID:28081188
Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto
2017-01-01
Honey bee (Apis mellifera) gene expression related to immunity for hymenoptaecin (AmHym) and defensin-1 (AmDef-1), longevity for vitellogenin (AmVit2) and stem cell proliferation for poly U binding factor 68 kDa (AmPuf68) was compared following Varroa destructor parasitism, buffer injection and injection of V. destructor compounds in its homogenate. In adults, V. destructor parasitism decreased expression of all four genes, while buffer injection decreased expression of AmHym, AmPuf68 and AmVit2, and homogenate injection decreased expression of AmPuf68 and AmVit2 but increased expression of AmDef-1 relative to their respective controls. The effect of V. destructor parasitism in adults relative to the controls was not significantly different from buffer injection for AmHym and AmVit2 expression, and it was not significantly different from homogenate injection for AmPuf68 and AmVit2. In brood, V. destructor parasitism, buffer injection and homogenate injection decreased AmVit2 expression, whereas AmHym expression was decreased by V. destructor parasitism but increased by buffer and homogenate injection relative to the controls. The effect of varroa parasitism in brood was not significantly different from buffer or homogenate injection for AmPuf68 and AmVit2. Expression levels of the four genes did not correlate with detectable viral levels in either brood or adults. The results of this study indicate that the relative effects of V. destructor parasitism on honey bee gene expression are also shared with other types of stresses. Therefore, some of the effects of V. destructor on honey bees may be mostly due to wounding and injection of foreign compounds into the hemolymph of the bee during parasitism. Although both brood and adults are naturally parasitized by V. destructor, their gene expression responded differently, probably the result of different mechanisms of host responses during development.
Gasanov, N B; Toshchakov, S V; Georgiev, P G; Maksimenko, O G
2015-01-01
Mammalian cell lines are widely used to produce recombinant proteins. Stable transgenic cell lines usually contain many insertions of the expression vector in one genomic region. Transcription through transgene can be one of the reasons for target gene repression after prolonged cultivation of cell lines. In the present work, we used the known transcription terminators from the SV40 virus, as well as the human β- and γ-globin genes, to prevent transcription through transgene. The transcription terminators were shown to increase and stabilize the expression of the EGFP reporter gene in transgenic lines of Chinese hamster ovary (CHO) cells. Hence, transcription terminators can be used to create stable mammalian cells with a high and stable level of recombinant protein production.
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Temporal regulation of Stat5 activity in determination of cell differentiation program
Hoshino, Akemi; Fujii, Hodaka
2007-01-01
Although Stat5 is activated by various cytokines, only ethrytopoietin (Epo) and a small number of cytokines induce Stat5-dependent erythroid differentiation. Here, by using a reporter gene system to monitor transcriptional activity of Stat5, we showed that Epo but not interleukin (IL)-3 supports sustained activation of Stat5, which induces globin gene expression. IL-3 or IL-2 stimulation inhibits Epo-induced globin gene expression. The acidic region of the IL-2 receptor β chain was essential for this inhibition. These results underscore the importance of temporal regulation of Stat activity for regulation of cytokine-specific cell differentiation. PMID:17511959
Creswell, J David; Irwin, Michael R; Burklund, Lisa J; Lieberman, Matthew D; Arevalo, Jesusa M G; Ma, Jeffrey; Breen, Elizabeth Crabb; Cole, Steven W
2012-10-01
Lonely older adults have increased expression of pro-inflammatory genes as well as increased risk for morbidity and mortality. Previous behavioral treatments have attempted to reduce loneliness and its concomitant health risks, but have had limited success. The present study tested whether the 8-week Mindfulness-Based Stress Reduction (MBSR) program (compared to a Wait-List control group) reduces loneliness and downregulates loneliness-related pro-inflammatory gene expression in older adults (N = 40). Consistent with study predictions, mixed effect linear models indicated that the MBSR program reduced loneliness, compared to small increases in loneliness in the control group (treatment condition × time interaction: F(1,35) = 7.86, p = .008). Moreover, at baseline, there was an association between reported loneliness and upregulated pro-inflammatory NF-κB-related gene expression in circulating leukocytes, and MBSR downregulated this NF-κB-associated gene expression profile at post-treatment. Finally, there was a trend for MBSR to reduce C Reactive Protein (treatment condition × time interaction: (F(1,33) = 3.39, p = .075). This work provides an initial indication that MBSR may be a novel treatment approach for reducing loneliness and related pro-inflammatory gene expression in older adults. Copyright © 2012 Elsevier Inc. All rights reserved.
Du, Yijun; Lu, Yu; Wang, Xinglong; Qi, Jing; Liu, Jiyu; Hu, Yue; Li, Feng; Wu, Jiaqiang; Guo, Lihui; Liu, Junzhen; Tao, Haiying; Sun, Wenbo; Chen, Lei; Cong, Xiaoyan; Ren, Sufang; Shi, Jianli; Li, Jun; Wang, Jinbao; Huang, Baohua; Wan, Renzhong
2014-01-01
Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) had caused catastrophic losses in swine industry in China. The current inactivated vaccine provided only limited protection, and the attenuated live vaccine could protect piglets against the HP-PRRSV but there was a possibility that the attenuated virus returned to high virulence. In this study, the eukaryotic expression vector pVAX1© was modified under the control of rabbit β-globin intron II gene and the modified vector pMVAX1© was constructed. Porcine interleukin-2 (IL-2) and GP3-GP5 fusion protein of HP-PRRSV strain SD-JN were highly expressed by pMVAX1©. Mice inoculated with pMVAX1©-GP35 developed significantly higher PRRSV-specific antibody responses and T cell proliferation than those vaccinated with pVAX1©-GP35. pMVAX1©-GP35 was selected as PRRS DNA vaccine candidate and co-administrated with pVAX1©-IL-2 or pMVAX1©-IL-2 in pigs. pMVAX1©-IL-2+pMVAX1©-GP35 could provide enhanced PRRSV-specific antibody responses, T cell proliferation, Th1-type and Th2-type cytokine responses and CTL responses than pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35. Following homologous challenge with HP-PRRSV strain SD-JN, similar with attenuated PRRS vaccine group, pigs inoculated with pMVAX1©-IL-2+pMVAX1©-GP35 showed no clinical signs, almost no lung lesions and no viremia, as compared to those in pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35 groups. It indicated that pMVAX1©-IL-2 effectively increases humoral and cell mediated immune responses of pMVAX1©-GP35. Co-administration of pMVAX1©-IL-2 and pMVAX1©-GP35 might be attractive candidate vaccines for preventing HP-PRRSV infections.
Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M.; Evans, Ronald M.; Gage, Fred H.
2012-01-01
Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs. PMID:22194602
Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M; Evans, Ronald M; Gage, Fred H
2012-02-17
Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs.
Manning, Lois R.; Russell, J. Eric; Popowicz, Anthony M.; Manning, Robert S.; Padovan, Julio C.; Manning, James M.
2013-01-01
A previously unrecognized function of normal human hemoglobins occurring during protein assembly is described - - self-regulation of subunit pairings and their durations arising from the variable strengths of their subunit interactions. Although it is known that many mutant human hemoglobins have altered subunit interface strengths, those of the normal embryonic, fetal, and adult human hemoglobins have not been considered to differ significantly. However, in a comprehensive study of both types of subunit interfaces of seven of the eight normal oxy human hemoglobins, we found that the strength, i.e. the free energies of the tetramer-dimer interfaces, contrary to previous reports, differ by 3-orders of magnitude and display an undulating profile similar to the transitions (“switches”) of various globin subunit types over time. The dimer interface strengths are also variable and correlate linearly with their developmental profile; embryonic hemoglobins are the weakest, fetal hemoglobin is of intermediate strength, and adult hemoglobins are the strongest. The pattern also correlates generally with their different O2 affinities and responses to allosteric regulatory molecules. Acetylation of fetal hemoglobin weakens its unusually strong subunit interactions and occurs progressively as its expression diminishes and adult hemoglobin A formations begins; a causal relationship is suggested. The relative contributions of globin gene order and competition among subunits due to differences in their interface strengths were found to be complementary and establish a connection between genetics, thermodynamics, and development. PMID:19583196
NASA Astrophysics Data System (ADS)
Tripathi, Shubham; Deem, Michael W.
2015-02-01
Cancer progresses with a change in the structure of the gene network in normal cells. We define a measure of organizational hierarchy in gene networks of affected cells in adult acute myeloid leukemia (AML) patients. With a retrospective cohort analysis based on the gene expression profiles of 116 AML patients, we find that the likelihood of future cancer relapse and the level of clinical risk are directly correlated with the level of organization in the cancer related gene network. We also explore the variation of the level of organization in the gene network with cancer progression. We find that this variation is non-monotonic, which implies the fitness landscape in the evolution of AML cancer cells is non-trivial. We further find that the hierarchy in gene expression at the time of diagnosis may be a useful biomarker in AML prognosis.
Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda
2015-07-01
The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina
Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).
Bianchi, Nicoletta; Chiarabelli, Cristiano; Zuccato, Cristina; Lampronti, Ilaria; Borgatti, Monica; Amari, Gabriele; Delcanale, Maurizio; Chiavilli, Francesco; Prus, Eugenia; Fibach, Eitan; Gambari, Roberto
2015-04-05
Several investigations have demonstrated a mild clinical status in patients with β-globin disorders and congenital high persistence of foetal haemoglobin. This can be mimicked by a pharmacological increase of foetal γ-globin genes expression and foetal haemoglobin production. Our goal was to apply a multistep assay including few screening methods (benzidine staining, RT-PCR and HPLC analyses) and erythroid cellular model systems (the K562 cell line and erythroid precursors collected from peripheral blood) to select erythroid differentiation agents with foetal haemoglobin inducing potential. With this methodology, we have identified a butyric acid derivative, namely the 4174 cyclopropanecarboxylic acid compound, able to induce erythroid differentiation without antiproliferative effect in K562 cells and increase of γ-globin gene expression in erythroid precursor cells. The results are relevant for pharmacological treatments of haemoglobinopathies, including β-thalassaemia and sickle cell anaemia. Copyright © 2015 Elsevier B.V. All rights reserved.
Comprehensive gene- and pathway-based analysis of depressive symptoms in older adults.
Nho, Kwangsik; Ramanan, Vijay K; Horgusluoglu, Emrin; Kim, Sungeun; Inlow, Mark H; Risacher, Shannon L; McDonald, Brenna C; Farlow, Martin R; Foroud, Tatiana M; Gao, Sujuan; Callahan, Christopher M; Hendrie, Hugh C; Niculescu, Alexander B; Saykin, Andrew J
2015-01-01
Depressive symptoms are common in older adults and are particularly prevalent in those with or at elevated risk for dementia. Although the heritability of depression is estimated to be substantial, single nucleotide polymorphism-based genome-wide association studies of depressive symptoms have had limited success. In this study, we performed genome-wide gene- and pathway-based analyses of depressive symptom burden. Study participants included non-Hispanic Caucasian subjects (n = 6,884) from three independent cohorts, the Alzheimer's Disease Neuroimaging Initiative (ADNI), the Health and Retirement Study (HRS), and the Indiana Memory and Aging Study (IMAS). Gene-based meta-analysis identified genome-wide significant associations (ANGPT4 and FAM110A, q-value = 0.026; GRM7-AS3 and LRFN5, q-value = 0.042). Pathway analysis revealed enrichment of association in 105 pathways, including multiple pathways related to ERK/MAPK signaling, GSK3 signaling in bipolar disorder, cell development, and immune activation and inflammation. GRM7, ANGPT4, and LRFN5 have been previously implicated in psychiatric disorders, including the GRM7 region displaying association with major depressive disorder. The ERK/MAPK signaling pathway is a known target of antidepressant drugs and has important roles in neuronal plasticity, and GSK3 signaling has been previously implicated in Alzheimer's disease and as a promising therapeutic target for depression. Our results warrant further investigation in independent and larger cohorts and add to the growing understanding of the genetics and pathobiology of depressive symptoms in aging and neurodegenerative disorders. In particular, the genes and pathways demonstrating association with depressive symptoms may be potential therapeutic targets for these symptoms in older adults.
Gene expression profiling of adult female tissues in feeding Rhipicephalus microplus cattle ticks.
Stutzer, Christian; van Zyl, Willem A; Olivier, Nicholas A; Richards, Sabine; Maritz-Olivier, Christine
2013-06-01
The southern cattle tick, Rhipicephalus microplus, is an economically important pest, especially for resource-poor countries, both as a highly adaptive invasive species and prominent vector of disease. The increasing prevalence of resistance to chemical acaricides and variable efficacy of current tick vaccine candidates highlight the need for more effective control methods. In the absence of a fully annotated genome, the wealth of available expressed sequence tag sequence data for this species presents a unique opportunity to study the genes that are expressed in tissues involved in blood meal acquisition, digestion and reproduction during feeding. Utilising a custom oligonucleotide microarray designed from available singletons (BmiGI Version 2.1) and expressed sequence tag sequences of R. microplus, the expression profiles in feeding adult female midgut, salivary glands and ovarian tissues were compared. From 13,456 assembled transcripts, 588 genes expressed in all three tissues were identified from fed adult females 20 days post infestation. The greatest complement of genes relate to translation and protein turnover. Additionally, a number of unique transcripts were identified for each tissue that relate well to their respective physiological/biological function/role(s). These transcripts include secreted anti-hemostatics and defense proteins from the salivary glands for acquisition of a blood meal, proteases as well as enzymes and transporters for digestion and nutrient acquisition from ingested blood in the midgut, and finally proteins and associated factors involved in DNA replication and cell-cycle control for oogenesis in the ovaries. Comparative analyses of adult female tissues during feeding enabled the identification of a catalogue of transcripts that may be essential for successful feeding and reproduction in the cattle tick, R. microplus. Future studies will increase our understanding of basic tick biology, allowing the identification of shared proteins
Shiraki, Ayako; Saito, Fumiyo; Akane, Hirotoshi; Akahori, Yumi; Imatanaka, Nobuya; Itahashi, Megu; Yoshida, Toshinori; Shibutani, Makoto
2016-01-01
We previously found that developmental hypothyroidism changed the expression of genes in the rat hippocampal dentate gyrus, a brain region where adult neurogenesis is known to occur. In the present study, we performed brain region-specific global gene expression profiling in an adult rat hypothyroidism model to see if it reflected the developmental neurotoxicity we saw in the developmental hypothyroidism model. Starting when male rats were 5 weeks old, we administered 6-propyl-2-thiouracil at a doses of 0, 0.1 and 10 mg kg(-1) body weight by gavage for 28 days. We selected four brain regions to represent both cerebral and cerebellar tissues: hippocampal dentate gyrus, cerebral cortex, corpus callosum and cerebellar vermis. We observed significant alterations in the expression of genes related to neural development (Eph family genes and Robo3) in the cerebral cortex and hippocampal dentate gyrus and in the expression of genes related to myelination (Plp1 and Mbp) in the hippocampal dentate gyrus. We observed only minor changes in the expression of these genes in the corpus callosum and cerebellar vermis. We used real-time reverse-transcription polymerase chain reaction to confirm Chrdl1, Hes5, Mbp, Plp1, Slit1, Robo3 and the Eph family transcript expression changes. The most significant changes in gene expression were found in the dentate gyrus. Considering that the gene expression profile of the adult dentate gyrus closely related to neurogenesis, 28-day toxicity studies looking at gene expression changes in adult hippocampal dentate gyrus may also detect possible developmental neurotoxic effects. Copyright © 2015 John Wiley & Sons, Ltd.
Jin, Wenjie; Jia, Yishu; Tan, E; Xi, Gengsi
2017-10-30
Estrogen-related receptor gene (ERR) and ecdysone receptor gene (EcR) belong to the nuclear receptor gene superfamily, both of which are associated with the regulation of insect reproductive development. However, the relationship between ERR and EcR and whether ERR participates in the 20E signal pathway during male reproduction are unclear. In this paper, adult male crickets Teleogryllus emma Ohmschi & Matsumura were divided into the experimental group, negative group, and control group. Crickets of the experimental group were injected with TeERR or TeEcR-dsRNA, and those in the negative group received EGFP-dsRNA. The efficiency of TeERR and TeEcR-RNAi was detected in the experimental group. Furthermore, the transcription level, morphological characteristics as well as weight were analyzed in the TeERR or TeEcR knocked-down testis. Results showed that the expression level of TeERR or TeEcR was significantly down-regulated (P < 0.05) when treated with 2000 ng TeERR or TeEcR-dsRNA for 48 h. The expression level of TeERR could be down-regulated (P < 0.05) using TeEcR-RNAi and vice versa. TeERR and TeEcR-RNAi caused morphological changes in testes, but they had no obvious effect on weight (P > 0.05). These results indicate that TeERR and TeEcR are intimately related to each other. In addition, TeERR may be involved in the 20E signal pathway and maintain the function of adult cricket testis.
NASA Astrophysics Data System (ADS)
Jin, Wenjie; Jia, Yishu; Tan, E.; Xi, Gengsi
2017-12-01
Estrogen-related receptor gene ( ERR) and ecdysone receptor gene ( EcR) belong to the nuclear receptor gene superfamily, both of which are associated with the regulation of insect reproductive development. However, the relationship between ERR and EcR and whether ERR participates in the 20E signal pathway during male reproduction are unclear. In this paper, adult male crickets Teleogryllus emma Ohmschi & Matsumura were divided into the experimental group, negative group, and control group. Crickets of the experimental group were injected with TeERR or TeEcR-dsRNA, and those in the negative group received EGFP-dsRNA. The efficiency of TeERR and TeEcR-RNAi was detected in the experimental group. Furthermore, the transcription level, morphological characteristics as well as weight were analyzed in the TeERR or TeEcR knocked-down testis. Results showed that the expression level of TeERR or TeEcR was significantly down-regulated ( P < 0.05) when treated with 2000 ng TeERR or TeEcR-dsRNA for 48 h. The expression level of TeERR could be down-regulated ( P < 0.05) using TeEcR-RNAi and vice versa. TeERR and TeEcR-RNAi caused morphological changes in testes, but they had no obvious effect on weight ( P > 0.05). These results indicate that TeERR and TeEcR are intimately related to each other. In addition, TeERR may be involved in the 20E signal pathway and maintain the function of adult cricket testis.
Murao, Naoya; Matsubara, Shuzo; Matsuda, Taito; Noguchi, Hirofumi; Mutoh, Tetsuji; Mutoh, Masahiro; Koseki, Haruhiko; Namihira, Masakazu; Nakashima, Kinichi
2018-05-31
Adult neurogenesis is a process of generating new neurons from neural stem/precursor cells (NS/PCs) in restricted adult brain regions throughout life. It is now generally known that adult neurogenesis in the hippocampal dentate gyrus (DG) and subventricular zone participates in various higher brain functions, such as learning and memory formation, olfactory discrimination and repair after brain injury. However, the mechanisms underlying adult neurogenesis remain to be fully understood. Here, we show that Nuclear protein 95 KDa (Np95, also known as UHRF1 or ICBP90), which is an essential protein for maintaining DNA methylation during cell division, is involved in multiple processes of adult neurogenesis. Specific ablation of Np95 in adult NS/PCs (aNS/PCs) led to a decrease in their proliferation and an impairment of neuronal differentiation and to suppression of neuronal maturation associated with the impairment of dendritic formation in the hippocampal DG. We also found that deficiency of Np95 in NS/PCs increased the expression of tumor suppressor genes p16 and p53, and confirmed that expression of these genes in NS/PCs recapitulates the phenotype of Np95-deficient NS/PCs. Taken together, our findings suggest that Np95 plays an essential role in proliferation and differentiation of aNS/PCs through the regulation of tumor suppressor gene expression in adult neurogenesis. Copyright © 2018 Elsevier B.V. and Japan Neuroscience Society. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pirastu, M.; Galanello, R.; Doherty, M.A.
The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.
Vago, Luca; Oliveira, Giacomo; Bondanza, Attilio; Noviello, Maddalena; Soldati, Corrado; Ghio, Domenico; Brigida, Immacolata; Greco, Raffaella; Lupo Stanghellini, Maria Teresa; Peccatori, Jacopo; Fracchia, Sergio; Del Fiacco, Matteo; Traversari, Catia; Aiuti, Alessandro; Del Maschio, Alessandro; Bordignon, Claudio; Ciceri, Fabio; Bonini, Chiara
2012-08-30
The genetic modification of T cells with a suicide gene grants a mechanism of control of adverse reactions, allowing safe infusion after partially incompatible hematopoietic stem cell transplantation (HSCT). In the TK007 clinical trial, 22 adults with hematologic malignancies experienced a rapid and sustained immune recovery after T cell-depleted HSCT and serial infusions of purified donor T cells expressing the HSV thymidine kinase suicide gene (TK+ cells). After a first wave of circulating TK+ cells, the majority of T cells supporting long-term immune reconstitution did not carry the suicide gene and displayed high numbers of naive lymphocytes, suggesting the thymus-dependent development of T cells, occurring only upon TK+ -cell engraftment. Accordingly, after the infusions, we documented an increase in circulating TCR excision circles and CD31+ recent thymic emigrants and a substantial expansion of the active thymic tissue as shown by chest tomography scans. Interestingly, a peak in the serum level of IL-7 was observed after each infusion of TK+ cells, anticipating the appearance of newly generated T cells. The results of the present study show that the infusion of genetically modified donor T cells after HSCT can drive the recovery of thymic activity in adults, leading to immune reconstitution.
The effects of hyperthermia on spermatogenesis, apoptosis, gene expression and fertility in adult male mice
John C. Rockett1, Faye L. Mapp1, J. Brian Garges1, J. Christopher Luft1, Chisato Mori2 and David J. Dix1.
1Reproductive Toxicology Division, National Health and Envir...
Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi
2016-10-01
This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus ; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus .
PRENATAL ALCOHOL EXPOSURE ALTERS STEADY-STATE AND ACTIVATED GENE EXPRESSION IN THE ADULT RAT BRAIN
Stepien, Katarzyna A.; Lussier, Alexandre A.; Neumann, Sarah M.; Pavlidis, Paul; Kobor, Michael S.; Weinberg, Joanne
2016-01-01
Background Prenatal alcohol exposure (PAE) is associated with alterations in numerous physiological systems, including the stress and immune systems . We have previously shown that PAE increases the course and severity of arthritis in an adjuvant-induced arthritis (AA) model. While the molecular mechanisms underlying these effects are not fully known, changes in neural gene expression are emerging as important factors in the etiology of PAE effects. As the prefrontal cortex (PFC) and hippocampus (HPC) play key roles in neuroimmune function, PAE-induced alterations to their transcriptome may underlie abnormal steady-state functions and responses to immune challenge. The current study examined brains from adult PAE and control females from our recent AA study to determine whether PAE causes long-term alterations in gene expression and whether these mediate the altered severity and course of arthritis in PAE females Methods Adult females from PAE, pair-fed [PF], and ad libitum-fed control [C]) groups were injected with either saline or complete Freund’s adjuvant. Animals were terminated at the peak of inflammation or during resolution (days 16 and 39 post-injection, respectively); cohorts of saline-injected PAE, PF and C females were terminated in parallel. Gene expression was analyzed in the PFC and HPC using whole genome mRNA expression microarrays. Results Significant changes in gene expression in both the PFC and HPC were found in PAE compared to controls in response to ethanol exposure alone (saline-injected females), including genes involved in neurodevelopment, apoptosis, and energy metabolism. Moreover, in response to inflammation (adjuvant-injected females), PAE animals showed unique expression patterns, while failing to exhibit the activation of genes and regulators involved in the immune response observed in control and pair-fed animals. Conclusions These results support the hypothesis that PAE affects neuroimmune function at the level of gene expression
Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia
Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.
2013-01-01
Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047
Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis
2018-01-01
Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482
Wang, Wen-Chung; Lee, Ya-Ting; Lai, Yen-Chein
2017-03-27
Granulosa cell tumors are rare ovarian malignancies. Their characteristics include unpredictable indolent growth with malignant potential and late recurrence. Approximately 95% are of adult type. Recent molecular studies have characterized the FOXL2 402C > G mutation in adult granulosa cell tumor. Our previous case report showed that unique FOXL2 402C > G mutation and defective DNA mismatch repair system are associated with the development of adult granulosa cell tumor. In this study, the DNA sequences of four genes, MSH2, MLH1, MSH6, and PMS2, in the DNA mismatch repair system were determined via direct sequencing to elucidate the exact mechanism for the development of this granulosa cell tumor. The results showed that two missense germline mutations, T485K and N775L, inactivate the PMS2 gene. The results of this case study indicated that although FOXL2 402C > G mutation determines the development of granulosa cell tumor, PMS2 mutation may be the initial driver of carcinogenesis. Immunohistochemistry-based tumor testing for mismatch repair gene expression may be necessary for granulosa cell tumors to determine their malignant potential or if they are part of Lynch syndrome.
Coulon, Sandra M.; Wilson, Dawn K.; Van Horn, M. L.; Hand, Gregory A.; Kresovich, Stephen
2016-01-01
Background African-American adults are disproportionately affected by stress-related chronic conditions like high blood pressure (BP), and both environmental stress and genetic risk may play a role in its development. Purpose This study tested whether the dual risk of low neighborhood socioeconomic status (SES) and glucocorticoid genetic sensitivity interacted to predict waking cortisol and BP. Methods Cross-sectional waking cortisol and BP were collected from 208 African-American adults who were participating in a follow-up visit as part of the Positive Action for Today’s Health trial. Three single nucleotide polymorphisms were genotyped, salivary cortisol samples were collected, and neighborhood SES was calculated using 2010 Census data. Results The sample was mostly female (65%), with weight classified as overweight or obese (MBMI=32.74, SD=8.88), and a mean age of 55.64 (SD=15.21). The gene-by-neighborhood SES interaction predicted cortisol (B=0.235, p=.001, r2=.036), but not BP. For adults with high genetic risk, waking cortisol was lower with lower SES but higher with higher SES (B=0.87). Lower neighborhood SES was also related to higher systolic BP (B=−0.794, p=.028). Conclusions Findings demonstrated an interaction whereby African-American adults with high genetic sensitivity had high levels of waking cortisol with higher neighborhood SES, and low levels with lower neighborhood SES. This moderation effect is consistent with a differential susceptibility gene-environment pattern, rather than a dual-risk pattern. These findings contribute to a growing body of evidence that demonstrates the importance of investigating complex gene-environment relations in order to better understand stress-related health disparities. PMID:26685668
Bian, Hai-Xu; Ma, Hong-Fang; Zheng, Xi-Xi; Peng, Ming-Hui; Li, Yu-Ping; Su, Jun-Fang; Wang, Huan; Li, Qun; Xia, Run-Xi; Liu, Yan-Qun; Jiang, Xing-Fu
2017-05-24
The oriental armyworm Mythimna separate is an economically important insect with a wide distribution and strong migratory activity. However, knowledge about the molecular mechanisms regulating the physiological and behavioural responses of the oriental armyworm is scarce. In the present study, we took a transcriptomic approach to characterize the gene network in the adult head of M. separate. The sequencing and de novo assembly yielded 63,499 transcripts, which were further assembled into 46,459 unigenes with an N50 of 1,153 bp. In the head transcriptome data, unigenes involved in the 'signal transduction mechanism' are the most abundant. In total, 937 signal transduction unigenes were assigned to 22 signalling pathways. The circadian clock, melanin synthesis, and non-receptor protein of olfactory gene families were then identified, and phylogenetic analyses were performed with these M. separate genes, the model insect Bombyx mori and other insects. Furthermore, 1,372 simple sequence repeats of 2-6 bp in unit length were identified. The transcriptome data represent a comprehensive molecular resource for the adult head of M. separate, and these identified genes can be valid targets for further gene function research to address the molecular mechanisms regulating the migratory and olfaction genes of the oriental armyworm.
Luglio, Harry Freitag; Sulistyoningrum, Dian Caturini; Huriyati, Emy; Lee, Yi Yi; Wan Muda, Wan Abdul Manan
2017-07-07
Obesity has been associated with leptin resistance and this might be caused by genetic factors. The aim of this study was to investigate the gene-lifestyle interaction between -866G/A UCP2 (uncoupling protein 2) gene polymorphism, dietary intake and leptin in a population based study. This is a cross sectional study conducted in adults living at urban area of Yogyakarta, Indonesia. Data of adiposity, lifestyle, triglyceride, high density lipoprotein (HDL) cholesterol, leptin and UCP2 gene polymorphism were obtained in 380 men and female adults. UCP2 gene polymorphism was not significantly associated with adiposity, leptin, triglyceride, HDL cholesterol, dietary intake and physical activity (all p > 0.05). Leptin was lower in overweight subjects with AA + GA genotypes than those with GG genotype counterparts ( p = 0.029). In subjects with AA + GA genotypes there was a negative correlation between leptin concentration ( r = -0.324; p < 0.0001) and total energy intake and this correlation was not seen in GG genotype ( r = -0.111; p = 0.188). In summary, we showed how genetic variation in -866G/A UCP2 affected individual response to leptin production. AA + GA genotype had a better leptin sensitivity shown by its response in dietary intake and body mass index (BMI) and this explained the protective effect of A allele to obesity.
Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B
2015-05-01
Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.
ERIC Educational Resources Information Center
May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.
2009-01-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…
Apoptosis-Related Gene Expression in an Adult Cohort with Crimean-Congo Hemorrhagic Fever.
Guler, Nil; Eroglu, Cafer; Yilmaz, Hava; Karadag, Adil; Alacam, Hasan; Sunbul, Mustafa; Fletcher, Tom E; Leblebicioglu, Hakan
2016-01-01
Crimean-Congo Hemorrhagic Fever (CCHF) is a life threatening acute viral infection characterized by fever, bleeding, leukopenia and thrombocytopenia. It is a major emerging infectious diseases threat, but its pathogenesis remains poorly understood and few data exist for the role of apoptosis in acute infection. We aimed to assess apoptotic gene expression in leukocytes in a cross-sectional cohort study of adults with CCHF. Twenty participants with CCHF and 10 healthy controls were recruited at a tertiary CCHF unit in Turkey; at admission baseline blood tests were collected and total RNA was isolated. The RealTime ready Human Apoptosis Panel was used for real-time PCR, detecting differences in gene expression. Participants had CCHF severity grading scores (SGS) with low risk score (10 out of 20) and intermediate or high risk scores (10 out of 20) for mortality. Five of 20 participants had a fatal outcome. Gene expression analysis showed modulation of pro-apoptotic and anti-apoptotic genes that facilitate apoptosis in the CCHF patient group. Dominant extrinsic pathway activation, mostly related with TNF family members was observed. Severe and fatal cases suggest additional intrinsic pathway activation. The clinical significance of relative gene expression is not clear, and larger longitudinal studies with simultaneous measurement of host and viral factors are recommended.
PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis
Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki
2014-01-01
Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048
Lim, S K; Maquat, L E
1992-01-01
Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170
Genes and Pathways Involved in Adult Onset Disorders Featuring Muscle Mitochondrial DNA Instability
Ahmed, Naghia; Ronchi, Dario; Comi, Giacomo Pietro
2015-01-01
Replication and maintenance of mtDNA entirely relies on a set of proteins encoded by the nuclear genome, which include members of the core replicative machinery, proteins involved in the homeostasis of mitochondrial dNTPs pools or deputed to the control of mitochondrial dynamics and morphology. Mutations in their coding genes have been observed in familial and sporadic forms of pediatric and adult-onset clinical phenotypes featuring mtDNA instability. The list of defects involved in these disorders has recently expanded, including mutations in the exo-/endo-nuclease flap-processing proteins MGME1 and DNA2, supporting the notion that an enzymatic DNA repair system actively takes place in mitochondria. The results obtained in the last few years acknowledge the contribution of next-generation sequencing methods in the identification of new disease loci in small groups of patients and even single probands. Although heterogeneous, these genes can be conveniently classified according to the pathway to which they belong. The definition of the molecular and biochemical features of these pathways might be helpful for fundamental knowledge of these disorders, to accelerate genetic diagnosis of patients and the development of rational therapies. In this review, we discuss the molecular findings disclosed in adult patients with muscle pathology hallmarked by mtDNA instability. PMID:26251896
Bahal, Raman; Ali McNeer, Nicole; Quijano, Elias; Liu, Yanfeng; Sulkowski, Parker; Turchick, Audrey; Lu, Yi-Chien; Bhunia, Dinesh C.; Manna, Arunava; Greiner, Dale L.; Brehm, Michael A.; Cheng, Christopher J.; López-Giráldez, Francesc; Ricciardi, Adele; Beloor, Jagadish; Krause, Diane S.; Kumar, Priti; Gallagher, Patrick G.; Braddock, Demetrios T.; Mark Saltzman, W.; Ly, Danith H.; Glazer, Peter M.
2016-01-01
The blood disorder, β-thalassaemia, is considered an attractive target for gene correction. Site-specific triplex formation has been shown to induce DNA repair and thereby catalyse genome editing. Here we report that triplex-forming peptide nucleic acids (PNAs) substituted at the γ position plus stimulation of the stem cell factor (SCF)/c-Kit pathway yielded high levels of gene editing in haematopoietic stem cells (HSCs) in a mouse model of human β-thalassaemia. Injection of thalassemic mice with SCF plus nanoparticles containing γPNAs and donor DNAs ameliorated the disease phenotype, with sustained elevation of blood haemoglobin levels into the normal range, reduced reticulocytosis, reversal of splenomegaly and up to 7% β-globin gene correction in HSCs, with extremely low off-target effects. The combination of nanoparticle delivery, next generation γPNAs and SCF treatment may offer a minimally invasive treatment for genetic disorders of the blood that can be achieved safely and simply by intravenous administration. PMID:27782131
Liu, Lifang; Martínez, José L; Liu, Zihe; Petranovic, Dina; Nielsen, Jens
2014-01-01
Due to limitations associated with whole blood for transfusions (antigen compatibility, transmission of infections, supply and storage), the use of cell-free hemoglobin as an oxygen carrier substitute has been in the center of research interest for decades. Human hemoglobin has previously been synthesized in yeast, however the challenge is to balance the expression of the two different globin subunits, as well as the supply of the prosthetic heme required for obtaining the active hemoglobin (α2β2). In this work we evaluated the expression of different combinations of α and β peptides and combined this with metabolic engineering of the heme biosynthetic pathway. Through evaluation of several different strategies we showed that engineering the biosynthesis pathway can substantially increase the heme level in yeast cells, and this resulted in a significant enhancement of human hemoglobin production. Besides demonstration of improved hemoglobin production our work demonstrates a novel strategy for improving the production of complex proteins, especially multimers with a prosthetic group. © 2013 Published by International Metabolic Engineering Society on behalf of International Metabolic Engineering Society.
Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin
2016-06-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.
Stelnicki, E J; Kömüves, L G; Holmes, D; Clavin, W; Harrison, M R; Adzick, N S; Largman, C
1997-10-01
In order to identify homeobox genes which may regulate skin development and possibly mediate scarless fetal wound healing we have screened amplified human fetal skin cDNAs by polymerase chain reaction (PCR) using degenerate oligonucleotide primers designed against highly conserved regions within the homeobox. We identified three non-HOX homeobox genes, MSX-1, MSX-2, and MOX-1, which were differentially expressed in fetal and adult human skin. MSX-1 and MSX-2 were detected in the epidermis, hair follicles, and fibroblasts of the developing fetal skin by in situ hybridization. In contrast, MSX-1 and MSX-2 expression in adult skin was confined to epithelially derived structures. Immunohistochemical analysis of these two genes suggested that their respective homeoproteins may be differentially regulated. While Msx-1 was detected in the cell nucleus of both fetal and adult skin; Msx-2 was detected as a diffuse cytoplasmic signal in fetal epidermis and portions of the hair follicle and dermis, but was localized to the nucleus in adult epidermis. MOX-1 was expressed in a pattern similar to MSX early in gestation but then was restricted exclusively to follicular cells in the innermost layer of the outer root sheath by 21 weeks of development. Furthermore, MOX-1 expression was completely absent in adult cutaneous tissue. These data imply that each of these homeobox genes plays a specific role in skin development.
Ohba, Kenji; Singh, Brijesh Kumar; Sinha, Rohit Anthony; Lesmana, Ronny; Liao, Xiao-Hui; Ghosh, Sujoy; Refetoff, Samuel
2016-01-01
Clinical symptoms may vary and not necessarily reflect serum thyroid hormone (TH) levels during acute and chronic hyperthyroidism as well as recovery from hyperthyroidism. We thus examined changes in hepatic gene expression and serum TH/TSH levels in adult male mice treated either with a single T3 (20 μg per 100 g body weight) injection (acute T3) or daily injections for 14 days (chronic T3) followed by 10 days of withdrawal. Gene expression arrays from livers harvested at these time points showed that among positively-regulated target genes, 320 were stimulated acutely and 429 chronically by T3. Surprisingly, only 69 of 680 genes (10.1%) were induced during both periods, suggesting desensitization of the majority of acutely stimulated target genes. About 90% of positively regulated target genes returned to baseline expression levels after 10 days of withdrawal; however, 67 of 680 (9.9%) did not return to baseline despite normalization of serum TH/TSH levels. Similar findings also were observed for negatively regulated target genes. Chromatin immunoprecipitation analysis of representative positively regulated target genes suggested that acetylation of H3K9/K14 was associated with acute stimulation, whereas trimethylation of H3K4 was associated with chronic stimulation. In an in vivo model of chronic intrahepatic hyperthyroidism since birth, adult male monocarboxylate transporter-8 knockout mice also demonstrated desensitization of most acutely stimulated target genes that were examined. In summary, we have identified transcriptional desensitization and incomplete recovery of gene expression during chronic hyperthyroidism and recovery. Our findings may be a potential reason for discordance between clinical symptoms and serum TH levels observed in these conditions. PMID:26866609
Yang, Xin; Xie, Wen; Li, Ru-mei; Zhou, Xiao-mao; Wang, Shao-li; Wu, Qing-jun; Yang, Ni-na; Xia, Ji-xing; Yang, Ze-zong; Guo, Li-tao; Liu, Ya-ting; Zhang, You-jun
2017-01-01
Bemisia tabaci has developed a high level of resistance to thiamethoxam, a second generation neonicotinoid insecticide that has been widely used to control this pest. In this study, we investigated whether hydroxyacid-oxoacid transhydrogenase (HOT) is involved in resistance to the neonicotinoid insecticide thiamethoxam in the whitefly. We cloned the full-length gene that encodes HOT in B. tabaci. Its cDNA contains a 1428-bp open reading frame encoding 475 amino acid residues. Then we evaluated the mRNA expression level of HOT in different developmental stages, and found HOT expression was significantly greater in thiamethoxam resistance adults than in thiamethoxam susceptible adults. Subsequently, seven field populations of B. tabaci adults were sampled, the expression of mRNA level of HOT significant positive correlated with thiamethoxam resistance level. At last, we used a modified gene silencing system to knock-down HOT expression in B. tabaci adults. The results showed that the HOT mRNA levels decreased by 57% and thiamethoxam resistance decreased significantly after 2 days of feeding on a diet containing HOT dsRNA. The results indicated that down-regulation of HOT expression decreases thiamethoxam resistance in B. tabaci adults. PMID:28117358
Pathophysiology and Clinical Manifestations of the β-Thalassemias
Nienhuis, Arthur W.; Nathan, David G.
2012-01-01
The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183
Busey, Hannah A.; Linz, David M.; Tomoyasu, Yoshinori; Moczek, Armin P.
2016-01-01
The origin and integration of novel traits are fundamental processes during the developmental evolution of complex organisms. Yet how novel traits integrate into pre-existing contexts remains poorly understood. Beetle horns represent a spectacular evolutionary novelty integrated within the context of the adult dorsal head, a highly conserved trait complex present since the origin of insects. We investigated whether otd1/2 and six3, members of a highly conserved gene network that instructs the formation of the anterior end of most bilaterians, also play roles in patterning more recently evolved traits. Using ablation-based fate-mapping, comparative larval RNA interference (RNAi) and transcript sequencing, we found that otd1/2, but not six3, play a fundamental role in the post-embryonic formation of the adult dorsal head and head horns of Onthophagus beetles. By contrast, neither gene appears to pattern the adult head of Tribolium flour beetles even though all are expressed in the dorsal head epidermis of both Onthophagus and Tribolium. We propose that, at least in beetles, the roles of otd genes during post-embryonic development are decoupled from their embryonic functions, and that potentially non-functional post-embryonic expression in the dorsal head facilitated their co-option into a novel horn-patterning network during Onthophagus evolution. PMID:27412276
Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza
2018-04-01
Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (P<0.05). The allele frequency of positive result of XmnI polymorphism in individuals with increased HbF level was also significant, which showed an association with increased HbF level (P<0.05). To the best of our knowledge, this is the first report of p.Ser102Pro (c.304T>C) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.
LDB1-mediated enhancer looping can be established independent of mediator and cohesin.
Krivega, Ivan; Dean, Ann
2017-08-21
Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
A new stable alpha chain variant: Hb Basel [alpha14(A12)Trp-->Leu (alpha1)].
Hergersberg, Martin; Brunner-Agten, Saskia; Kühne, Thomas; Paulussen, Michael; Huber, Andreas R
2010-06-01
We describe a heterozygosity for a new missense mutation on the alpha1-globin gene of an 18-year-old woman of Portuguese ancestry with severe hypochromic anemia and iron deficiency. Hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) found a prominent peak constituting about 12% of total Hb. Sequencing of the globin genes of the index patient found the mutation alpha14(A12)Trp-->Leu (alpha1), HBA1:c.44G
Mori, Yoshifumi; Saito, Taku; Chang, Song Ho; Kobayashi, Hiroshi; Ladel, Christoph H.; Guehring, Hans; Chung, Ung-il; Kawaguchi, Hiroshi
2014-01-01
To identify genes that maintain the homeostasis of adult articular cartilage and regenerate its lesions, we initially compared four types of chondrocytes: articular (AA) versus growth plate (AG) cartilage chondrocytes in adult rats, and superficial layer (IS) versus deep layer (ID) chondrocytes of epiphyseal cartilage in infant rats. Microarray analyses revealed that 40 and 186 genes had ≥10-fold higher expression ratios of AA/AG and IS/ID, respectively, and 16 genes showed ≥10-fold of both AA/AG and IS/ID ratios. The results were validated by real-time RT-PCR analysis. Among them, Hoxd1, Fgf18, and Esm1 were expressed more strongly in AA than in IS. Fgf18 was the extracellular and secreted factor that decreased glycosaminoglycan release and depletion from the cartilage, and enhanced proliferation of articular chondrocytes. Fgf18 was strongly expressed in the articular cartilage chondrocytes of adult rats. In a surgical rat osteoarthritis model, a once-weekly injection of recombinant human FGF18 (rhFGF18) given 3 weeks after surgery prevented cartilage degeneration in a dose-dependent manner at 6 and 9 weeks after surgery, with significant effect at 10 μg/week of rhFGF18. As the underlying mechanism, rhFGF18 strongly up-regulated Timp1 expression in the cell and organ cultures, and inhibition of aggrecan release by rhFGF18 was restored by addition of an antibody to Timp1. In conclusion, we have identified Fgf18 as a molecule that protects articular cartilage by gene expression profiling, and the anticatabolic effects may at least partially be mediated by the Timp1 expression. PMID:24577103
Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul
2013-01-01
An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889
Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul
2013-01-01
An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.
Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck
2010-01-01
Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.
Bisphenol A Exposure Is Associated with in Vivo Estrogenic Gene Expression in Adults
Melzer, David; Harries, Lorna; Cipelli, Riccardo; Henley, William; Money, Cathryn; McCormack, Paul; Young, Anita; Guralnik, Jack; Ferrucci, Luigi; Bandinelli, Stefania; Corsi, Anna Maria
2011-01-01
Background: Bisphenol A (BPA) is a synthetic estrogen commonly used in polycarbonate plastic and resin-lined food and beverage containers. Exposure of animal and cell models to doses of BPA below the recommended tolerable daily intake (TDI) of 50 μg/kg/day have been shown to alter specific estrogen-responsive gene expression, but this has not previously been shown in humans. Objective: We investigated associations between BPA exposure and in vivo estrogenic gene expression in humans. Methods: We studied 96 adult men from the InCHIANTI population study and examined in vivo expression of six estrogen receptor, estrogen-related receptor, and androgen receptor genes in peripheral blood leukocytes. Results: The geometric mean urinary BPA concentration was 3.65 ng/mL [95% confidence interval (CI): 3.13, 4.28], giving an estimated mean excretion of 5.84 μg/day (95% CI: 5.00, 6.85), significantly below the current TDI. In age-adjusted models, there were positive associations between higher BPA concentrations and higher ESR2 [estrogen receptor 2 (ER beta)] expression (unstandardized linear regression coefficient = 0.1804; 95% CI: 0.0388, 0.3221; p = 0.013) and ESRRA (estrogen related receptor alpha) expression (coefficient = 0.1718; 95% CI: 0.0213, 0.3223; p = 0.026): These associations were little changed after adjusting for potential confounders, including obesity, serum lipid concentrations, and white cell subtype percentages. Upper-tertile BPA excretors (urinary BPA > 4.6 ng/mL) had 65% higher mean ESR2 expression than did lower-tertile BPA excretors (0–2.4 ng/mL). Conclusions: Because activation of nuclear-receptor–mediated pathways by BPA is consistently found in laboratory studies, such activation in humans provides evidence that BPA is likely to function as a xenoestrogen in this sample of adults. PMID:21831745
Zattara, Eduardo E; Busey, Hannah A; Linz, David M; Tomoyasu, Yoshinori; Moczek, Armin P
2016-07-13
The origin and integration of novel traits are fundamental processes during the developmental evolution of complex organisms. Yet how novel traits integrate into pre-existing contexts remains poorly understood. Beetle horns represent a spectacular evolutionary novelty integrated within the context of the adult dorsal head, a highly conserved trait complex present since the origin of insects. We investigated whether otd1/2 and six3, members of a highly conserved gene network that instructs the formation of the anterior end of most bilaterians, also play roles in patterning more recently evolved traits. Using ablation-based fate-mapping, comparative larval RNA interference (RNAi) and transcript sequencing, we found that otd1/2, but not six3, play a fundamental role in the post-embryonic formation of the adult dorsal head and head horns of Onthophagus beetles. By contrast, neither gene appears to pattern the adult head of Tribolium flour beetles even though all are expressed in the dorsal head epidermis of both Onthophagus and Tribolium We propose that, at least in beetles, the roles of otd genes during post-embryonic development are decoupled from their embryonic functions, and that potentially non-functional post-embryonic expression in the dorsal head facilitated their co-option into a novel horn-patterning network during Onthophagus evolution. © 2016 The Author(s).
Meng, Xianmei; Baylink, David J.; Sheng, Matilda; Wang, Hongjie; Gridley, Daila S.; Lau, K.-H. William; Zhang, Xiao-Bing
2012-01-01
Fibroblast growth factor-2 (FGF2) has been demonstrated to be a promising osteogenic factor for treating osteoporosis. Our earlier study shows that transplantation of mouse Sca-1+ hematopoietic stem/progenitor cells that are engineered to express a modified FGF2 leads to considerable endosteal/trabecular bone formation, but it also induces adverse effects like hypocalemia and osteomalacia. Here we report that the use of an erythroid specific promoter, β-globin, leads to a 5-fold decrease in the ratio of serum FGF2 to the FGF2 expression in the marrow cavity when compared to the use of a ubiquitous promoter spleen focus-forming virus (SFFV). The confined FGF2 expression promotes considerable trabeculae bone formation in endosteum and does not yield anemia and osteomalacia. The avoidance of anemia in the mice that received Sca1+ cells transduced with FGF2 driven by the β-globin promoter is likely due to attenuation of high-level serum FGF2-mediated stem cell mobilization observed in the SFFV-FGF2 animals. The prevention of osteomalacia is associated with substantially reduced serum Fgf23/hypophosphatemia, and less pronounced secondary hyperparathyroidism. Our improved stem cell gene therapy strategy represents one step closer to FGF2-based clinical therapy for systemic skeletal augmentation. PMID:22629419
Nikoleris, Lina; Hansson, Maria C
2015-01-15
Estrogen receptors (ers) not only are activated by hormones but also interact with many human-derived environmental contaminants. Here, we present evidence for four expressed er genes in Atlantic salmon cDNA - two more ers (erα2 and erβ2) than previously published. To determine if er gene expression differs between two adult life-stages we sampled 20 adult salmon from the feeding phase in the Baltic Sea and during migration in the River Mörrum, Sweden. Results show that all four er genes are present in the investigated tissues, except for erα2 not appearing in the spleen. Overall, a profile analysis reveals the erα1 gene to be the most highly expressed er gene in both female and male Baltic Sea salmon tissues, and also in female River Mörrum salmon. In contrast, this gene has the lowest gene expression level of the four er genes in male salmon from the River Mörrum. The erα2 gene is expressed at the lowest levels in both female/male Baltic Sea salmon and in female River Mörrum salmon. Statistical analyses indicate a significant and complex interaction where both sex and adult life stage can impact er gene expression. Regression analyses did not demonstrate any significant relationship between polychlorinated biphenyl (PCB) body burden and er gene expression level, suggesting that accumulated pollutants from the Baltic Sea may be deactivated inside the salmon's lipid tissues and have limited impact on er activity. This study is the first comprehensive analysis of four er gene expression levels in two wild salmon populations from two different adult life stages where information about PCB load is also available. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Stock, W; Tsai, T; Golden, C; Rankin, C; Sher, D; Slovak, M L; Pallavicini, M G; Radich, J P; Boldt, D H
2000-04-01
To test the hypothesis that cell cycle regulatory gene abnormalities are determinants of clinical outcome in adult acute lymphoblastic leukemia (ALL), we screened lymphoblasts from patients on a Southwest Oncology Group protocol for abnormalities of the genes, retinoblastoma (Rb), p53, p15(INK4B), and p16(INK4A). Aberrant expression occurred in 33 (85%) patients in the following frequencies: Rb, 51%; p16(INK4A), 41%; p53, 26%. Thirteen patients (33%) had abnormalities in 2 or more genes. Outcomes were compared in patients with 0 to 1 abnormality versus patients with multiple abnormalities. The 2 groups did not differ in a large number of clinical and laboratory characteristics. The CR rates for patients with 0 to 1 and multiple abnormalities were similar (69% and 54%, respectively). Patients with 0 to 1 abnormality had a median survival time of 25 months (n = 26; 95% CI, 13-46 months) versus 8 months (n = 13; 95% CI, 4-12 months) for those with multiple abnormalities (P <.01). Stem cells (CD34+lin-) were isolated from adult ALL bone marrows and tested for p16(INK4A) expression by immunocytochemistry. In 3 of 5 patients lymphoblasts and sorted stem cells lacked p16(INK4A) expression. In 2 other patients only 50% of sorted stem cells expressed p16(INK4A). By contrast, p16 expression was present in the CD34+ lin- compartment in 95% (median) of 9 patients whose lymphoblasts expressed p16(INK4A). Therefore, cell cycle regulatory gene abnormalities are frequently present in adult ALL lymphoblasts, and they may be important determinants of disease outcome. The presence of these abnormalities in the stem compartment suggests that they contribute to leukemogenesis. Eradication of the stem cell subset harboring these abnormalities may be important to achieve cure.
Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo
2003-08-01
The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baserga, S.J.; Benz, E.J. Jr.
A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less
Usein, C R; Damian, M; Tatu-Chitoiu, D; Capusa, C; Fagaras, R; Tudorache, D; Nica, M; Le Bouguénec, C
2001-01-01
A total of 78 E. coli strains isolated from adults with different types of urinary tract infections were screened by polymerase chain reaction for prevalence of genetic regions coding for virulence factors. The targeted genetic determinants were those coding for type 1 fimbriae (fimH), pili associated with pyelonephritis (pap), S and F1C fimbriae (sfa and foc), afimbrial adhesins (afa), hemolysin (hly), cytotoxic necrotizing factor (cnf), aerobactin (aer). Among the studied strains, the prevalence of genes coding for fimbrial adhesive systems was 86%, 36%, and 23% for fimH, pap, and sfa/foc,respectively. The operons coding for Afa afimbrial adhesins were identified in 14% of strains. The hly and cnf genes coding for toxins were amplified in 23% and 13% of strains, respectively. A prevalence of 54% was found for the aer gene. The various combinations of detected genes were designated as virulence patterns. The strains isolated from the hospitalized patients displayed a greater number of virulence genes and a diversity of gene associations compared to the strains isolated from the ambulatory subjects. A rapid assessment of the bacterial pathogenicity characteristics may contribute to a better medical approach of the patients with urinary tract infections.
Hemoglobin Adducts of Benzene Oxide in Neonatal and Adult Dried Blood Spots
Funk, William E.; Waidyanatha, Suramya; Chaing, Shu H.; Rappaport, Stephen M.
2010-01-01
Adducts of reactive chemicals with hemoglobin (Hb) or human serum albumin can be used as biomarkers of internal doses of carcinogens. Since dried blood spots (DBS) are easier to collect and store than conventional venous blood samples, they encourage applications of biomarkers of exposure in large epidemiology studies. Also, neonatal DBS can be used to investigate chemical exposures in utero. Here, we report a simple method to isolate Hb from DBS with high recovery and purity using the addition of ethanol to aqueous DBS extracts. To prove the concept that DBS-derived proteins can be used to assay for adducts, we measured Hb adducts of benzene oxide, a reactive metabolite of the ubiquitous air pollutant, benzene, in 9 neonatal and 9 adult DBS (from volunteer subjects), using a gas chromatography-mass spectrometry method that we had previously developed. For comparison, benzene oxide-Hb adducts (BO-Hb) were measured in the same 9 adult subjects, using Hb that had been isolated and purified using our conventional method for venous blood. The geometric mean BO-Hb levels in all DBS samples ranged from 27.7 to 33.1 pmol/g globin. Neither of the comparisons of mean (logged) BO-Hb levels between sources (adult conventional vs. adult DBS and adult DBS vs. newborn DBS) showed a significant difference. Based upon the estimated variance of the BO-Hb levels, we had 80% power to detect a 1.7-fold difference in geometric mean levels of BO-Hb in our samples of 9 subjects. PMID:18708378
Xu, Bowen; Cai, Ling; Butler, Jason M; Chen, Dongliang; Lu, Xiongdong; Allison, David F; Lu, Rui; Rafii, Shahin; Parker, Joel S; Zheng, Deyou; Wang, Gang Greg
2018-03-13
Self-renewal and differentiation of adult stem cells are tightly regulated partly through configuration of chromatin structure by chromatin remodelers. Using knockout mice, we here demonstrate that bromodomain PHD finger transcription factor (BPTF), a component of the nucleosome remodeling factor (NURF) chromatin-remodeling complex, is essential for maintaining the population size of hematopoietic stem/progenitor cells (HSPCs), including long-term hematopoietic stem cells (HSCs). Bptf-deficient HSCs are defective in reconstituted hematopoiesis, and hematopoietic-specific knockout of Bptf caused profound defects including bone marrow failure and anemia. Genome-wide transcriptome profiling revealed that BPTF loss caused downregulation of HSC-specific gene-expression programs, which contain several master transcription factors (Meis1, Pbx1, Mn1, and Lmo2) required for HSC maintenance and self-renewal. Furthermore, we show that BPTF potentiates the chromatin accessibility of key HSC "stemness" genes. These results demonstrate an essential requirement of the chromatin remodeler BPTF and NURF for activation of "stemness" gene-expression programs and proper function of adult HSCs. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Jorgez, Carolina J; Bischoff, Farideh Z
2009-01-01
Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.
Yang, Mei; Liang, Yimin; Sheng, Lingling; Shen, Guoxiong; Liu, Kai; Gu, Bin; Meng, Fanjun; Li, Qingfeng
2011-03-01
In adults, severely damaged skin heals by scar formation and cannot regenerate to the original skin structure. However, tissue expansion is an exception, as normal skin regenerates under the mechanical stretch resulting from tissue expansion. This technique has been used clinically for defect repair and organ reconstruction for decades. However, the phenomenon of adult skin regeneration during tissue expansion has caused little attention, and the mechanism of skin regeneration during tissue expansion has not been fully understood. In this study, microarray analysis was performed on expanded human skin and normal human skin. Significant difference was observed in 77 genes, which suggest a network of several integrated cascades, including cytokines, extracellular, cytoskeletal, transmembrane molecular systems, ion or ion channels, protein kinases and transcriptional systems, is involved in the skin regeneration during expansion. Among these, the significant expression of some regeneration related genes, such as HOXA5, HOXB2 and AP1, was the first report in tissue expansion. Data in this study suggest a list of candidate genes, which may help to elucidate the fundamental mechanism of skin regeneration during tissue expansion and which may have implications for postnatal skin regeneration and therapeutic interventions in wound healing.
Bale, Laurie K; West, Sally A; Conover, Cheryl A
2017-08-01
Pregnancy-associated plasma protein-A (PAPP-A) knockout (KO) mice, generated through homologous recombination in embryonic stem cells, have a significantly increased lifespan compared to wild-type littermates. However, it is unknown whether this longevity advantage would pertain to PAPP-A gene deletion in adult animals. In the present study, we used tamoxifen (Tam)-inducible Cre recombinase-mediated excision of the floxed PAPP-A (fPAPP-A) gene in mice at 5 months of age. fPAPP-A mice, which were either positive (pos) or negative (neg) for Tam-Cre, received Tam treatment with quarterly boosters. Only female mice could be used with this experimental design. fPAPP-A/neg and fPAPP-A/pos mice had similar weights at the start of the experiment and showed equivalent weight gain. We found that fPAPP-A/pos mice had a significant extension of life span (P = 0.005). The median life span was increased by 21% for fPAPP-A/pos compared to fPAPP-A/neg mice. Analysis of mortality in life span quartiles indicated that the proportion of deaths of fPAPP-A/pos mice were lower than fPAPP-A/neg mice at young adult ages (P = 0.002 for 601-800 days) and higher than fPAPP-A/neg mice at older ages (P = 0.004 for >1000 days). Thus, survival curves and age-specific mortality indicate that female mice with knockdown of PAPP-A gene expression as adults have an extended healthy life span. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
A Hemoglobin Variant Associated with Neonatal Cyanosis and Anemia
Crowley, Moira A.; Mollan, Todd L.; Abdulmalik, Osheisa Y.; Butler, Andrew D.; Goodwin, Emily F.; Sarkar, Arindam; Stolle, Catherine A.; Gow, Andrew J.; Olson, John S.; Weiss, Mitchell J.
2013-01-01
SUMMARY Globin-gene mutations are a rare but important cause of cyanosis. We identified a missense mutation in the fetal G γ-globin gene (HBG2) in a father and daughter with transient neonatal cyanosis and anemia. This new mutation modifies the ligand-binding pocket of fetal hemoglobin by means of two mechanisms. First, the relatively large side chain of methionine decreases both the affinity of oxygen for binding to the mutant hemoglobin subunit and the rate at which it does so. Second, the mutant methionine is converted to aspartic acid post-translationally, probably through oxidative mechanisms. The presence of this polar amino acid in the heme pocket is predicted to enhance hemoglobin denaturation, causing anemia. PMID:21561349
Carter-Timofte, Madalina E; Hansen, Anders F; Christiansen, Mette; Paludan, Søren R; Mogensen, Trine H
2018-05-01
Recently, deficiency in the cytosolic DNA sensor RNA Polymerase III was described in children with severe primary varicella-zoster virus (VZV) infection in the CNS and lungs. In the present study we examined adult patients with VZV CNS infection caused by viral reactivation. By whole exome sequencing we identified mutations in POL III genes in two of eight patients. These mutations were located in the coding regions of the subunits POLR3A and POLR3E. In functional assays, we found impaired expression of antiviral and inflammatory cytokines in response to the POL III agonist Poly(dA:dT) as well as increased viral replication in patient cells compared to controls. Altogether, this study provides significant extension on the current knowledge on susceptibility to VZV infection by demonstrating mutations in POL III genes associated with impaired immunological sensing of AT-rich DNA in adult patients with VZV CNS infection.
Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang
2015-05-01
The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.
Zhang, Vivian; Ludington, William B.; Eisen, Michael B.
2016-01-01
There is growing evidence that the microbes found in the digestive tracts of animals influence host biology, but we still do not understand how they accomplish this. Here, we evaluated how different microbial species commonly associated with laboratory-reared Drosophila melanogaster impact host biology at the level of gene expression in the dissected adult gut and in the entire adult organism. We observed that guts from animals associated from the embryonic stage with either zero, one or three bacterial species demonstrated indistinguishable transcriptional profiles. Additionally, we found that the gut transcriptional profiles of animals reared in the presence of the yeast Saccharomyces cerevisiae alone or in combination with bacteria could recapitulate those of conventionally-reared animals. In contrast, we found whole body transcriptional profiles of conventionally-reared animals were distinct from all of the treatments tested. Our data suggest that adult flies are insensitive to the ingestion of the bacteria found in their gut, but that prior to adulthood, different microbes impact the host in ways that lead to global transcriptional differences observable across the whole adult body. PMID:27898741
Transcriptional Mechanisms Underlying Hemoglobin Synthesis
Katsumura, Koichi R.; DeVilbiss, Andrew W.; Pope, Nathaniel J.; Johnson, Kirby D.; Bresnick, Emery H.
2013-01-01
The physiological switch in expression of the embryonic, fetal, and adult β-like globin genes has garnered enormous attention from investigators interested in transcriptional mechanisms and the molecular basis of hemoglobinopathies. These efforts have led to the discovery of cell type-specific transcription factors, unprecedented mechanisms of transcriptional coregulator function, genome biology principles, unique contributions of nuclear organization to transcription and cell function, and promising therapeutic targets. Given the vast literature accrued on this topic, this article will focus on the master regulator of erythroid cell development and function GATA-1, its associated proteins, and its frontline role in controlling hemoglobin synthesis. GATA-1 is a crucial regulator of genes encoding hemoglobin subunits and heme biosynthetic enzymes. GATA-1-dependent mechanisms constitute an essential regulatory core that nucleates additional mechanisms to achieve the physiological control of hemoglobin synthesis. PMID:23838521
Asmundson, Anna L.; Taber, Alexandria M.; van der Walde, Adella; Lin, Danielle H.; Olson, John S.; Anthony-Cahill, Spencer J.
2009-01-01
For the first time, a circularly permuted human β-globin (cpβ) has been coexpressed with human α-globin in bacterial cells and shown to associate to form α-cpβ hemoglobin in solution. Flash photolysis studies of α-cpβ show markedly biphasic CO and O2 kinetics with the amplitudes for the fast association phases being dominant due the presence of large amounts of high-affinity liganded hemoglobin dimers. Extensive dimerization of liganded but not deoxygenated α-cpβ was observed by gel chromatography. The rate constants for O2 and CO binding to the R state forms of α-cpβ are almost identical to those of native HbA (k′R(CO) ≈ 5.0 μM−1 s−1; k′R(O2) ≈ 50 μM−1 s−1), and the rate of O2 dissociation from fully oxygenated α-cpβ is also very similar to that observed for HbA (kR(O2) ≈ 21–28 s−1). When the equilibrium deoxyHb form of α-cpβ is reacted with CO in rapid mixing experiments, the observed time courses are monophasic and the observed bimolecular association rate constant is ∼1.0 μM−1 s−1, which is intermediate between the R state rate measured in partial photolysis experiments (∼5 μM−1 s−1) and that observed for T state deoxyHbA (k′T(CO) ≈ 0.1 to 0.2 μM−1 s−1). Thus the deoxygenated permutated β subunits generate an intermediate, higher affinity, deoxyHb quaternary state. This conclusion is supported by equilibrium oxygen binding measurements in which α-cpβ exhibits a P50 of ∼1.5 mmHg and a low n-value (∼1.3) at pH 7, 20 °C, compared to 8.5 mmHg and n ≈ 2.8 for native HbA under identical, dilute conditions. PMID:19397368
Schupf, Nicole; Lee, Annie; Park, Naeun; Dang, Lam-Ha; Pang, Deborah; Yale, Alexander; Oh, David Kyung-Taek; Krinsky-McHale, Sharon J; Jenkins, Edmund C; Luchsinger, José A; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Kisselev, Sergey; Clark, Lorraine; Lee, Joseph H
2015-10-01
We examined the contribution of candidates genes for Alzheimer's disease (AD) to individual differences in levels of beta amyloid peptides in adults with Down syndrom, a population at high risk for AD. Participants were 254 non-demented adults with Down syndrome, 30-78 years of age. Genomic deoxyribonucleic acid was genotyped using an Illumina GoldenGate custom array. We used linear regression to examine differences in levels of Aβ peptides associated with the number of risk alleles, adjusting for age, sex, level of intellectual disability, race and/or ethnicity, and the presence of the APOE ε4 allele. For Aβ42 levels, the strongest gene-wise association was found for a single nucleotide polymorphism (SNP) on CAHLM1; for Aβ40 levels, the strongest gene-wise associations were found for SNPs in IDE and SOD1, while the strongest gene-wise associations with levels of the Aβ42/Aβ40 ratio were found for SNPs in SORCS1. Broadly classified, variants in these genes may influence amyloid precursor protein processing (CALHM1, IDE), vesicular trafficking (SORCS1), and response to oxidative stress (SOD1). Copyright © 2015 Elsevier Inc. All rights reserved.
Killian, Christopher E; Croker, Lindsay; Wilt, Fred H
2010-01-01
The SpSM30 gene family of the sea urchin, Strongylocentrotus purpuratus, is comprised of six members, designated SpSM30A through SpSM30F (Livingston et al., 2006). The SpSM30 proteins are found uniquely in embryonic and adult mineralized tissues of the sea urchin. Previous studies have revealed that SpSM30 proteins are occluded within the embryonic endoskeleton and adult mineralized tissues (Killian and Wilt, 1996; Mann et al., 2008a,b; Urry et al., 2000). Furthermore, some of the SpSM30 proteins are among the most abundant of the approximately four-dozen integral matrix proteins of the larval spicule (Killian and Wilt, 1996). The amino acid sequence, protein domain architecture, and contiguity within the genome strongly support the supposition that the six genes constitute a gene family. Reverse transcription-polymerase chain reaction (RT-PCR) is used in the present study to describe the time course of expression of the family members during embryonic development, and their expression in adult tissues. SpSM30A, B, C and E are expressed, albeit at different levels, during overt spicule deposition in the embryo with some differences in the precise timing of expression. SpSM30D is not expressed in the embryo, and SpSM30F is expressed transiently and at low levels just prior to overt spicule formation. Whole mount in situ hybridization studies show that SpSM30A, B, C, and E are expressed exclusively in primary mesenchyme (PMC) cells and their descendants. In addition, tissue fractionation studies indicate that SpSM30F expression is highly enriched in PMCs. Each adult tissue examined expresses a different cohort of the SpSM30 family members at varying levels: SpSM30A mRNA is not expressed in adult tissues. Its expression is limited to the embryo. Conversely, SpSM30D mRNA is not expressed in the embryo, but is expressed in adult spines and teeth. SpSM30B and SpSM30C are expressed at modest levels in all mineralized adult tissues; SpSM30E is expressed highly in tooth and
Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.
Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves
2003-08-01
A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.
Zhang, Jie; He, Jing; Zeng, Xiao-Hong; Su, Jie; Chen, Hong; Xu, Yong-Mei; Pu, Jian; Zhu, Bao-Sheng
2016-02-01
To investigate the gene mutation spectrum of β-thalassemia in Dai ethnic population of 2 border region in Chinese Yunnan Province. The patients with β-thalassemia in Dai ethnic population of Dehong and Xishuangbanna autonamic prefecture were screened by using blood routine detection and capillary electrophoresis. The β-globin gene mutation in patients with β-thalassemia were detected by using PCR reverse dot-blot hybridization (PCR-RDB), the constitutive rate of gene mutation in patients with β-thalassemia of Dai ethnic population in two border regions was analyzed and compared. A total of 186 patients with gene mutation of β-thalassemia were confirmed. Among them, 10 gene mutation were found, and the 5 main gene mutations were CD26 (62.56%), CD41-42 (18.97%), CD17 (14.36%), CD71-72 (2.05%) and IVS-II-654 (1.54%). Among Dai ethinic population in Dehong region, 4 gene mutations were found including CD26 (80.31%), CD17 (11.02%), CD41-42 (6.30%) and CD71-72 (2.36%). Among Dai ethinic population in Xishuangbanna region, 6 gene mutations were found, out of them the more common gene mutations were CD41-42 (42.64%), CD26 (29.41%) and CD17 (20.59%). The gene mutations of β-thalassemia in Dai ethinic population of Yunnan province has been confirmed to be more genetic heterogenicity, the spectrums of β-thalassemia mutations in Dai ethinic population of different regions were significant different.
Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto
2017-01-01
The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086
El Sissy, Azza Hamdy; El Sissy, Maha H; Elmoamly, Shereef
2014-11-01
Factor V Leiden 1691G/A and prothrombin gene 20210G/A mutations are the most common genetic defects leading to thrombosis. This work aimed to study the FV Leiden and the prothrombin gene polymorphism in adult Egyptian patients with acute leukemia and their importance in thrombophilia screening. The study included 76 patients with acute leukemia and 100 healthy controls. Genotyping was done by real-time polymerase chain reaction technique. For factor V Leiden, the frequency of G/A mutation conferred more than 2.5-fold of increased risk of (OR 2.639 95 % CI 1.045-6.669). The frequency of factor V Leiden combined (G/A + A/A) genotypes conferred 2.83-fold of increased risk (OR 2.828, CI 1.13-7.075), The A allele conferred almost threefold increased risk (OR 2.824, 95 % CI 1.175-6.785). Despite higher frequency in patients compared to controls, there was no risk of association between prothrombin gene mutation and acute leukemia in adult Egyptians nor was there between combined genotypes of prothrombin gene mutation and factor V Leiden.
Drager, B J; Harkey, M A; Iwata, M; Whiteley, A H
1989-05-01
Adult tissues of the sea urchin, Strongylocentrotus purpuratus, were analyzed for the products of a set of genes whose expression, in the embryo, is restricted to the skeletogenic primary mesenchyme (PM). Three embryonic PM-specific mRNAs were found to be abundant in adult skeletal tissues (test and lantern), but not in a variety of soft tissues. Homologous mRNAs were also found in skeletal tissues of the congeneric sea urchin, S. droebachiensis, as well as a more distantly related echinoid, Dendraster excentricus, and an asteroid, Evasterias troschellii. The distributions of two of these RNAs were analyzed in regenerating spines of adult S. purpuratus using in situ hybridization. These gene products were localized primarily in the calcoblasts that accumulated at the regeneration site. In nonregenerating spines SpLM 18 RNAs, the most abundant of these gene products, were localized in a small population of noncalcoblast cells scattered through the spine shaft, and were absent from calcoblasts. These observations suggest that a program of gene expression associated with the process of calcification is conserved both developmentally through the period of metamorphosis and evolutionarily among the echinoderms.
Vanselow, Jens; Kucia, Marzena; Langhammer, Martina; Koczan, Dirk; Metges, Cornelia C
2016-04-01
Indirect effects of a high-protein maternal diet are not well understood. In this study, we analyzed short-term and sustainable effects of a prenatal versus early postnatal maternal high-protein diet on growth and hepatic gene expression in mouse offspring. Dams were exposed to an isoenergetic high-protein (HP, 40 % w/w) diet during pregnancy or lactation. Growth and hepatic expression profiles of male offspring were evaluated directly after weaning and 150 days after birth. Offspring from two dietary groups, high-protein diet during pregnancy and control diet during lactation (HPC), and control diet during pregnancy and high-protein diet during lactation (CHP), were compared with offspring (CC) from control-fed dams. Maternal CHP treatment was associated with sustained offspring growth retardation, but decreased numbers of affected hepatic genes in adults compared to weanlings. In contrast, offspring of the HPC group did not show persistent effects on growth parameters, but the number of affected hepatic genes was even increased at adult age. In both dietary groups, however, only a small subset of genes was affected in weanlings as well as in adults. We conclude that (1) prenatal and early postnatal maternal HP diet caused persistent, but (2) different effects and partially complementary trends on growth characteristics and on the hepatic transcriptome and associated pathways and that (3) only a small number of genes and associated upstream regulators might be involved in passing early diet-induced imprints to adulthood.
Iron-heme-Bach1 axis is involved in erythroblast adaptation to iron deficiency.
Kobayashi, Masahiro; Kato, Hiroki; Hada, Hiroshi; Itoh-Nakadai, Ari; Fujiwara, Tohru; Muto, Akihiko; Inoguchi, Yukihiro; Ichiyanagi, Kenji; Hojo, Wataru; Tomosugi, Naohisa; Sasaki, Hiroyuki; Harigae, Hideo; Igarashi, Kazuhiko
2017-03-01
Iron plays the central role in oxygen transport by erythrocytes as a constituent of heme and hemoglobin. The importance of iron and heme is also to be found in their regulatory roles during erythroblast maturation. The transcription factor Bach1 may be involved in their regulatory roles since it is deactivated by direct binding of heme. To address whether Bach1 is involved in the responses of erythroblasts to iron status, low iron conditions that induced severe iron deficiency in mice were established. Under iron deficiency, extensive gene expression changes and mitophagy disorder were induced during maturation of erythroblasts. Bach1 -/- mice showed more severe iron deficiency anemia in the developmental phase of mice and a retarded recovery once iron was replenished when compared with wild-type mice. In the absence of Bach1, the expression of globin genes and Hmox1 (encoding heme oxygenase-1) was de-repressed in erythroblasts under iron deficiency, suggesting that Bach1 represses these genes in erythroblasts under iron deficiency to balance the levels of heme and globin. Moreover, an increase in genome-wide DNA methylation was observed in erythroblasts of Bach1 -/- mice under iron deficiency. These findings reveal the principle role of iron as a regulator of gene expression in erythroblast maturation and suggest that the iron-heme-Bach1 axis is important for a proper adaptation of erythroblast to iron deficiency to avoid toxic aggregates of non-heme globin. Copyright© Ferrata Storti Foundation.
Cruz-Rodriguez, Nataly; Combita, Alba L; Enciso, Leonardo J; Quijano, Sandra M; Pinzon, Paula L; Lozano, Olga C; Castillo, Juan S; Li, Li; Bareño, Jose; Cardozo, Claudia; Solano, Julio; Herrera, Maria V; Cudris, Jennifer; Zabaleta, Jovanny
2016-04-05
B-Acute lymphoblastic leukemia (B-ALL) represents a hematologic malignancy with poor clinical outcome and low survival rates in adult patients. Remission rates in Hispanic population are almost 30% lower and Overall Survival (OS) nearly two years inferior than those reported in other ethnic groups. Only 61% of Colombian adult patients with ALL achieve complete remission (CR), median overall survival is 11.3 months and event-free survival (EFS) is 7.34 months. Identification of prognostic factors is crucial for the application of proper treatment strategies and subsequently for successful outcome. Our goal was to identify a gene expression signature that might correlate with response to therapy and evaluate the utility of these as prognostic tool in hispanic patients. We included 43 adult patients newly diagnosed with B-ALL. We used microarray analysis in order to identify genes that distinguish poor from good response to treatment using differential gene expression analysis. The expression profile was validated by real-time PCR (RT-PCT). We identified 442 differentially expressed genes between responders and non-responders to induction treatment. Hierarchical analysis according to the expression of a 7-gene signature revealed 2 subsets of patients that differed in their clinical characteristics and outcome. Our study suggests that response to induction treatment and clinical outcome of Hispanic patients can be predicted from the onset of the disease and that gene expression profiles can be used to stratify patient risk adequately and accurately. The present study represents the first that shows the gene expression profiling of B-ALL Colombian adults and its relevance for stratification in the early course of disease.
The REVEILLE Clock Genes Inhibit Growth of Juvenile and Adult Plants by Control of Cell Size.
Gray, Jennifer A; Shalit-Kaneh, Akiva; Chu, Dalena Nhu; Hsu, Polly Yingshan; Harmer, Stacey L
2017-04-01
The circadian clock is a complex regulatory network that enhances plant growth and fitness in a constantly changing environment. In Arabidopsis ( Arabidopsis thaliana ), the clock is composed of numerous regulatory feedback loops in which REVEILLE8 ( RVE8 ) and its homologs RVE4 and RVE6 act in a partially redundant manner to promote clock pace. Here, we report that the remaining members of the RVE8 clade, RVE3 and RVE5 , play only minor roles in the regulation of clock function. However, we find that RVE8 clade proteins have unexpected functions in the modulation of light input to the clock and the control of plant growth at multiple stages of development. In seedlings, these proteins repress hypocotyl elongation in a daylength- and sucrose-dependent manner. Strikingly, adult rve4 6 8 and rve3 4 5 6 8 mutants are much larger than wild-type plants, with both increased leaf area and biomass. This size phenotype is associated with a faster growth rate and larger cell size and is not simply due to a delay in the transition to flowering. Gene expression and epistasis analysis reveal that the growth phenotypes of rve mutants are due to the misregulation of PHYTOCHROME INTERACTING FACTOR4 ( PIF4 ) and PIF5 expression. Our results show that even small changes in PIF gene expression caused by the perturbation of clock gene function can have large effects on the growth of adult plants. © 2017 American Society of Plant Biologists. All Rights Reserved.
Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.
Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M
2007-08-01
Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Yarimizu, Tohru; Iwakiri, Ryo; Hoshida, Hisashi; Akada, Rinji
2015-08-01
Escherichia coli plasmids are commonly used for gene expression experiments in mammalian cells, while PCR-amplified DNAs are rarely used even though PCR is a much faster and easier method to construct recombinant DNAs. One difficulty may be the limited amount of DNA produced by PCR. For direct utilization of PCR-amplified DNA in transfection experiments, efficient transfection with a smaller amount of DNA should be attained. For this purpose, we investigated two enhancer reagents, polyethylene glycol and tRNA, for a chemical transfection method. The addition of the enhancers to a commercial transfection reagent individually and synergistically exhibited higher transfection efficiency applicable for several mammalian cell culture lines in a 96-well plate. By taking advantage of a simple transfection procedure using PCR-amplified DNA, SV40 and rabbit β-globin terminator lengths were minimized. The terminator length is short enough to design in oligonucleotides; thus, terminator primers can be used for the construction and analysis of numerous mutations, deletions, insertions, and tag-fusions at the 3'-terminus of any gene. The PCR-mediated gene manipulation with the terminator primers will transform gene expression by allowing for extremely simple and high-throughput experiments with small-scale, multi-well, and mammalian cell cultures.
Resolving stem and progenitor cells in the adult mouse incisor through gene co-expression analysis
Seidel, Kerstin; Marangoni, Pauline; Tang, Cynthia; Houshmand, Bahar; Du, Wen; Maas, Richard L; Murray, Steven; Oldham, Michael C; Klein, Ophir D
2017-01-01
Investigations into stem cell-fueled renewal of an organ benefit from an inventory of cell type-specific markers and a deep understanding of the cellular diversity within stem cell niches. Using the adult mouse incisor as a model for a continuously renewing organ, we performed an unbiased analysis of gene co-expression relationships to identify modules of co-expressed genes that represent differentiated cells, transit-amplifying cells, and residents of stem cell niches. Through in vivo lineage tracing, we demonstrated the power of this approach by showing that co-expression module members Lrig1 and Igfbp5 define populations of incisor epithelial and mesenchymal stem cells. We further discovered that two adjacent mesenchymal tissues, the periodontium and dental pulp, are maintained by distinct pools of stem cells. These findings reveal novel mechanisms of incisor renewal and illustrate how gene co-expression analysis of intact biological systems can provide insights into the transcriptional basis of cellular identity. DOI: http://dx.doi.org/10.7554/eLife.24712.001 PMID:28475038
Atalay, Erol O; Ustel, Emre; Yildiz, Sanem; Atalay, Ayfer
2006-01-01
The surface plasmon resonance (SPR) approach, being a relatively novel biophysical method, is used to detect many different targets by biomolecular interaction. The SPR system uses optical and evanescent wave phenomenon. This approach does not need any labels, such as enzymes or isotopes, and the monitored interactions are in real time. In DNA-DNA interaction, the SPR approach is Tm-independent. Here we report our preliminary results for the molecular detection of the Hb S (GAG -->GTG) mutation at codon 6 of the human beta-globin gene. Our preliminary results show that the SPR approach could be applied as an inexpensive and fast routine test system for the molecular diagnosis of abnormal hemoglobins (Hbs), especially in premarital screening programs.
The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.
Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E
1994-01-28
The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.
Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan
2015-01-01
Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
When do myopia genes have their effect? Comparison of genetic risks between children and adults.
Tideman, J Willem L; Fan, Qiao; Polling, Jan Roelof; Guo, Xiaobo; Yazar, Seyhan; Khawaja, Anthony; Höhn, René; Lu, Yi; Jaddoe, Vincent W V; Yamashiro, Kenji; Yoshikawa, Munemitsu; Gerhold-Ay, Aslihan; Nickels, Stefan; Zeller, Tanja; He, Mingguang; Boutin, Thibaud; Bencic, Goran; Vitart, Veronique; Mackey, David A; Foster, Paul J; MacGregor, Stuart; Williams, Cathy; Saw, Seang Mei; Guggenheim, Jeremy A; Klaver, Caroline C W
2016-12-01
Previous studies have identified many genetic loci for refractive error and myopia. We aimed to investigate the effect of these loci on ocular biometry as a function of age in children, adolescents, and adults. The study population consisted of three age groups identified from the international CREAM consortium: 5,490 individuals aged <10 years; 5,000 aged 10-25 years; and 16,274 aged >25 years. All participants had undergone standard ophthalmic examination including measurements of axial length (AL) and corneal radius (CR). We examined the lead SNP at all 39 currently known genetic loci for refractive error identified from genome-wide association studies (GWAS), as well as a combined genetic risk score (GRS). The beta coefficient for association between SNP genotype or GRS versus AL/CR was compared across the three age groups, adjusting for age, sex, and principal components. Analyses were Bonferroni-corrected. In the age group <10 years, three loci (GJD2, CHRNG, ZIC2) were associated with AL/CR. In the age group 10-25 years, four loci (BMP2, KCNQ5, A2BP1, CACNA1D) were associated; and in adults 20 loci were associated. Association with GRS increased with age; β = 0.0016 per risk allele (P = 2 × 10 -8 ) in <10 years, 0.0033 (P = 5 × 10 -15 ) in 10- to 25-year-olds, and 0.0048 (P = 1 × 10 -72 ) in adults. Genes with strongest effects (LAMA2, GJD2) had an early effect that increased with age. Our results provide insights on the age span during which myopia genes exert their effect. These insights form the basis for understanding the mechanisms underlying high and pathological myopia. © 2016 WILEY PERIODICALS, INC.
Sun, Ning; Zhao, Huimin
2014-05-01
Sickle cell disease (SCD) is the most common human genetic disease which is caused by a single mutation of human β-globin (HBB) gene. The lack of long-term treatment makes the development of reliable cell and gene therapies highly desirable. Disease-specific patient-derived human induced pluripotent stem cells (hiPSCs) have great potential for developing novel cell and gene therapies. With the disease-causing mutations corrected in situ, patient-derived hiPSCs can restore normal cell functions and serve as a renewable autologous cell source for the treatment of genetic disorders. Here we successfully utilized transcription activator-like effector nucleases (TALENs), a recently emerged novel genome editing tool, to correct the SCD mutation in patient-derived hiPSCs. The TALENs we have engineered are highly specific and generate minimal off-target effects. In combination with piggyBac transposon, TALEN-mediated gene targeting leaves no residual ectopic sequences at the site of correction and the corrected hiPSCs retain full pluripotency and a normal karyotype. Our study demonstrates an important first step of using TALENs for the treatment of genetic diseases such as SCD, which represents a significant advance toward hiPSC-based cell and gene therapies. © 2013 Wiley Periodicals, Inc.
Giardine, Belinda; Borg, Joseph; Higgs, Douglas R; Peterson, Kenneth R; Philipsen, Sjaak; Maglott, Donna; Singleton, Belinda K; Anstee, David J; Basak, A Nazli; Clark, Barnaby; Costa, Flavia C; Faustino, Paula; Fedosyuk, Halyna; Felice, Alex E; Francina, Alain; Galanello, Renzo; Gallivan, Monica V E; Georgitsi, Marianthi; Gibbons, Richard J; Giordano, Piero C; Harteveld, Cornelis L; Hoyer, James D; Jarvis, Martin; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N; Papadopoulos, Petros; Pavlovic, Sonja; Perseu, Lucia; Radmilovic, Milena; Riemer, Cathy; Satta, Stefania; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John S; Wiemann, Claudia; Zukic, Branka; Chui, David H K; Wajcman, Henri; Hardison, Ross C; Patrinos, George P
2011-03-20
We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.
Yamane, Hitomi; Nishikawa, Akio
2013-08-01
During Xenopus laevis metamorphosis, larval-to-adult muscle conversion depends on the differential responses of adult and larval myogenic cells to thyroid hormone. Essential differences in cell growth, differentiation, and hormone-dependent life-or-death fate have been reported between cultured larval (tail) and adult (hindlimb) myogenic cells. A previous study revealed that tail notochord cells suppress terminal differentiation in adult (but not larval) myogenic cells. However, little is known about the differences in expression patterns of myogenic regulatory factors (MRF) and the satellite cell marker Pax7 between adult and larval myogenic cells. In the present study, we compared mRNA expression of these factors between the two types. At first, reverse transcription polymerase chain reaction analysis of hindlimb buds showed sequential upregulation of myf5, myogenin, myod, and mrf4 during stages 50-54, when limb buds elongate and muscles begin to form. By contrast, in the tail, there was no such increase during the same period. Secondary, these results were duplicated in vitro: adult myogenic cells upregulated myf5, myod, and pax7 in the early culture period, followed by myogenin upregulation and myotube differentiation, while larval myogenic cells did not upregulate these genes and precociously started myotube differentiation. Thirdly, myf5 upregulation and early-phase proliferation in adult myogenic cells were potently inhibited by the presence of notochord cells, suggesting that notochord cells suppress adult myogenesis through inhibiting the transition from Myf5(-) stem cells to Myf5(+) committed myoblasts. All of the data presented here suggest that myf5 upregulation can be a good criterion for the activation of adult myogenesis during X. laevis metamorphosis.
Parichy, D M; Ransom, D G; Paw, B; Zon, L I; Johnson, S L
2000-07-01
Developmental mechanisms underlying traits expressed in larval and adult vertebrates remain largely unknown. Pigment patterns of fishes provide an opportunity to identify genes and cell behaviors required for postembryonic morphogenesis and differentiation. In the zebrafish, Danio rerio, pigment patterns reflect the spatial arrangements of three classes of neural crest-derived pigment cells: black melanocytes, yellow xanthophores and silver iridophores. We show that the D. rerio pigment pattern mutant panther ablates xanthophores in embryos and adults and has defects in the development of the adult pattern of melanocyte stripes. We find that panther corresponds to an orthologue of the c-fms gene, which encodes a type III receptor tyrosine kinase and is the closest known homologue of the previously identified pigment pattern gene, kit. In mouse, fms is essential for the development of macrophage and osteoclast lineages and has not been implicated in neural crest or pigment cell development. In contrast, our analyses demonstrate that fms is expressed and required by D. rerio xanthophore precursors and that fms promotes the normal patterning of melanocyte death and migration during adult stripe formation. Finally, we show that fms is required for the appearance of a late developing, kit-independent subpopulation of adult melanocytes. These findings reveal an unexpected role for fms in pigment pattern development and demonstrate that parallel neural crest-derived pigment cell populations depend on the activities of two essentially paralogous genes, kit and fms.
Timasheva, Y; Putku, M; Kivi, R; Kožich, V; Männik, J; Laan, M
2013-11-01
Given the physiological role of placental growth hormone (PGH) during intrauterine development and growth, genetic variation in the coding Growth hormone 2 (GH2) gene may modulate developmental programming of adult stature. Two major GH2 variants were described worldwide, determined by single polymorphism (rs2006123; c.171 + 50C > A). We sought to study whether GH2 variants may contribute to adult anthropometric measurements. Genotyping of GH2 SNP rs2006123 by RFLP, testing its genetic association with adult height and Body Mass Index (BMI) by linear regression analysis, and combining the results of three individual study samples in meta-analysis. HYPEST (Estonia), n = 1464 (506 men/958 women), CADCZ (Czech), n = 871 (518/353); UFA (Bashkortostan), n = 954 (655/299); meta-analysis, n = 3289 (1679/1610). Meta-analysis across HYPEST, CADCZ and UFA samples (n = 3289) resulted in significant association of GH2 rs2006123 with height (recessive model: AA-homozygote effect: beta (SE) = 1.26 (0.46), P = 5.90 × 10⁻³; additive model: A-allele effect: beta (SE) = 0.45 (0.18), P = 1.40 × 10⁻²). Among men (n = 1679), the association of the A-allele with taller stature remained significant after multiple-testing correction (additive effect: beta = 0.86 (0.28), P = 1.83 × 10⁻³). No association was detected with BMI. Notably, rs2006123 was in strong LD (r² ≥ 0.87) with SNPs significantly associated with height (rs2665838, rs7209435, rs11658329) and mapped near GH2 in three independent meta-analyses of GWA studies. This is the first study demonstrating a link between a placental gene variant and programming of growth potential in adulthood. The detected association between PGH encoding GH2 and adult height promotes further research on the role of placental genes in prenatal programming of human metabolism. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Kou, Shu-Jun; Wu, Xiao-Meng; Liu, Zheng; Liu, Yuan-Long; Xu, Qiang; Guo, Wen-Wu
2012-12-01
miRNAs have recently been reported to modulate somatic embryogenesis (SE), a key pathway of plant regeneration in vitro. For expression level detection and subsequent function dissection of miRNAs in certain biological processes, qRT-PCR is one of the most effective and sensitive techniques, for which suitable reference gene selection is a prerequisite. In this study, three miRNAs and eight non-coding RNAs (ncRNA) were selected as reference candidates, and their expression stability was inspected in developing citrus SE tissues cultured at 20, 25, and 30 °C. Stability of the eight non-miRNA ncRNAs was further validated in five adult tissues without temperature treatment. The best single reference gene for SE tissues was snoR14 or snoRD25, while for the adult tissues the best one was U4; although they were not as stable as the optimal multiple references snoR14 + U6 for SE tissues and snoR14 + U5 for adult tissues. For expression normalization of less abundant miRNAs in SE tissues, miR3954 was assessed as a viable reference. Single reference gene snoR14 outperformed multiple references for the overall SE and adult tissues. As one of the pioneer systematic studies on reference gene identification for plant miRNA normalization, this study benefits future exploration on miRNA function in citrus and provides valuable information for similar studies in other higher plants. Three miRNAs and eight non-coding RNAs were tested as reference candidates on developing citrus SE tissues. Best single references snoR14 or snoRD25 and optimal multiple references snoR14 + U6, snoR14 + U5 were identified.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muñoz, Alexandra; Chervona, Yana; Hall, Megan
Arsenic contamination of drinking water occurs globally and is associated with numerous diseases including skin, lung and bladder cancers, and cardiovascular disease. Recent research indicates that arsenic may be an endocrine disruptor. This study was conducted to evaluate the nature of gene expression changes among males and females exposed to arsenic contaminated water in Bangladesh at high and low doses. Twenty-nine (55% male) Bangladeshi adults with water arsenic exposure ranging from 50 to 1000 μg/L were selected from the Folic Acid Creatinine Trial. RNA was extracted from peripheral blood mononuclear cells for gene expression profiling using Affymetrix 1.0 ST arrays.more » Differentially expressed genes were assessed between high and low exposure groups for males and females separately and findings were validated using quantitative real-time PCR. There were 534 and 645 differentially expressed genes (p < 0.05) in the peripheral blood mononuclear cells of males and females, respectively, when high and low water arsenic exposure groups were compared. Only 43 genes overlapped between the two sexes, with 29 changing in opposite directions. Despite the difference in gene sets both males and females exhibited common biological changes including deregulation of 17β-hydroxysteroid dehydrogenase enzymes, deregulation of genes downstream of Sp1 (specificity protein 1) transcription factor, and prediction of estrogen receptor alpha as a key hub in cardiovascular networks. Arsenic-exposed adults exhibit sex-specific gene expression profiles that implicate involvement of the endocrine system. Due to arsenic's possible role as an endocrine disruptor, exposure thresholds for arsenic may require different parameters for males and females. - Highlights: • Males and females exhibit unique gene expression changes in response to arsenic. • Only 23 genes are common among the differentially expressed genes for the sexes. • Male and female gene lists exhibit common
Hamatani, Kiyohiro; Mukai, Mayumi; Takahashi, Keiko; Hayashi, Yuzo; Nakachi, Kei; Kusunoki, Yoichiro
2012-11-01
We previously noted that among atomic bomb survivors (ABS), the relative frequency of cases of adult papillary thyroid cancer (PTC) with chromosomal rearrangements (mainly RET/PTC) was significantly greater in those with relatively higher radiation exposure than those with lower radiation exposure. In contrast, the frequency of PTC cases with point mutations (mainly BRAF(V600E)) was significantly lower in patients with relatively higher radiation exposure than those with lower radiation exposure. We also found that among ABS, the frequency of PTC cases with no detectable gene alterations in RET, neurotrophic tyrosine kinase receptor 1 (NTRK1), BRAF, or RAS was significantly higher in patients with relatively higher radiation exposure than those with lower radiation exposure. However, in ABS with PTC, the relationship between the presence of the anaplastic lymphoma kinase (ALK) gene fused with other gene partners and radiation exposure has received little study. In this study, we tested the hypothesis that the relative frequency of rearranged ALK in ABS with PTC, and with no detectable gene alterations in RET, NTRK1, BRAF, or RAS, would be greater in those having relatively higher radiation exposures. The 105 subjects in the study were drawn from the Life Span Study cohort of ABS of Hiroshima and Nagasaki who were diagnosed with PTC between 1956 and 1993. Seventy-nine were exposed (>0 mGy), and 26 were not exposed to A-bomb radiation. In the 25 ABS with PTC, and with no detectable gene alterations in RET, NTRK1, BRAF, or RAS, we examined archival, formalin-fixed, paraffin-embedded PTC specimens for rearrangement of ALK using reverse transcription-polymerase chain reaction and 5' rapid amplification of cDNA ends (5' RACE). We found rearranged ALK in 10 of 19 radiation-exposed PTC cases, but none among 6 patients with PTC with no radiation exposure. In addition, solid/trabecular-like architecture in PTC was closely associated with ALK rearrangements, being observed in
Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain
Deverman, Benjamin E.; Pravdo, Piers L.; Simpson, Bryan P.; Kumar, Sripriya Ravindra; Chan, Ken Y.; Banerjee, Abhik; Wu, Wei-Li; Yang, Bin; Huber, Nina; Pasca, Sergiu P.; Gradinaru, Viviana
2015-01-01
Recombinant adeno-associated viruses (rAAVs) are commonly used vehicles for in vivo gene transfer1-6. However, the tropism repertoire of naturally occurring AAVs is limited, prompting a search for novel AAV capsids with desired characteristics7-13. Here we describe a capsid selection method, called Cre-recombination-based AAV targeted evolution (CREATE), that enables the development of AAV capsids that more efficiently transduce defined Cre-expressing cell populations in vivo. We use CREATE to generate AAV variants that efficiently and widely transduce the adult mouse central nervous system (CNS) after intravenous injection. One variant, AAV-PHP.B, transfers genes throughout the CNS with an efficiency that is at least 40-fold greater than that of the current standard, AAV914-17, and transduces the majority of astrocytes and neurons across multiple CNS regions. In vitro, it transduces human neurons and astrocytes more efficiently than does AAV9, demonstrating the potential of CREATE to produce customized AAV vectors for biomedical applications. PMID:26829320
Truzzi, Anna; Bornstein, Marc H.; Senese, Vincenzo P.; Shinohara, Kazuyuki; Setoh, Peipei; Esposito, Gianluca
2017-01-01
Adults' adaptive interactions with intimate partners enhance well-being. Here we hypothesized that adult males' physiological responses to opposite-sex conspecifics' distress result from an interaction between an environmental factor (early social interaction with caregivers) and a genetic factor (a polymorphism within the promoter region of the serotonin transporter gene, 5-HTTLPR). We assessed heart rate changes in 42 non-married male adults to distress vocalizations (female, infant, and bonobo cries). Males' early interaction with parents was assessed using the Parental Bonding Instrument. Buccal mucosa cell samples were collected to assess their 5-HTTLPR genotype. A significant interaction emerged between early experience and genetic predisposition. Males with a genetic predisposition for higher sensitivity to environmental factors showed atypical physiological responses to adult female cries according to their experienced early maternal parenting. Environmental experiences and genetic characteristics are associated with adult males' physiological responses to socially meaningfully stimuli. Understanding the mechanisms that modulate responses to opposite-sex conspecifics may improve personal well-being and social adaptiveness. PMID:28293197
Cruz-Rodriguez, Nataly; Combita, Alba L; Enciso, Leonardo J; Raney, Lauren F; Pinzon, Paula L; Lozano, Olga C; Campos, Alba M; Peñaloza, Niyireth; Solano, Julio; Herrera, Maria V; Zabaleta, Jovanny; Quijano, Sandra
2017-02-28
Survival of adults with B-Acute Lymphoblastic Leukemia requires accurate risk stratification of patients in order to provide the appropriate therapy. Contemporary techniques, using clinical and cytogenetic variables are incomplete for prognosis prediction. To improve the classification of adult patients diagnosed with B-ALL into prognosis groups, two strategies were examined and combined: the expression of the ID1/ID3/IGJ gene signature by RT-PCR and the immunophenotypic profile of 19 markers proposed in the EuroFlow protocol by Flow Cytometry in bone marrow samples. Both techniques were correlated to stratify patients into prognostic groups. An inverse relationship between survival and expression of the three-genes signature was observed and an immunophenotypic profile associated with clinical outcome was identified. Markers CD10 and CD20 were correlated with simultaneous overexpression of ID1, ID3 and IGJ. Patients with simultaneous expression of the poor prognosis gene signature and overexpression of CD10 or CD20, had worse Event Free Survival and Overall Survival than patients who had either the poor prognosis gene expression signature or only CD20 or CD10 overexpressed. By utilizing the combined evaluation of these two immunophenotypic markers along with the poor prognosis gene expression signature, the risk stratification can be significantly strengthened. Further studies including a large number of patients are needed to confirm these findings.
Lander, Sharon S; Linder-Shacham, Donna; Gaisler-Salomon, Inna
2017-01-01
Intact function of the medial prefrontal cortex (mPFC) function relies on proper development of excitatory and inhibitory neuronal populations and on integral myelination processes. Social isolation (SI) affects behavior and brain circuitry in adulthood, but previous rodent studies typically induced prolonged (post-weaning) exposure and failed to directly compare between the effects of SI in adolescent and adulthood. Here, we assessed the impact of a 3-week SI period, starting in mid-adolescence (around the onset of puberty) or adulthood, on a wide range of behaviors in adult male mice. Additionally, we asked whether adolescent SI would differentially affect the expression of excitatory and inhibitory neuronal markers and myelin-related genes in mPFC. Our findings indicate that mid-adolescent or adult SI increase anxiogenic behavior and locomotor activity. However, SI in adolescence uniquely affects the response to the psychotomimetic drug amphetamine, social and novelty exploration and performance in reversal and attentional set shifting tasks. Furthermore, adolescent but not adult SI increased the expression of glutamate markers in the adult mPFC. Our results imply that adolescent social deprivation is detrimental for normal development and may be particularly relevant to the investigation of developmental psychopathology. Copyright © 2016 Elsevier B.V. All rights reserved.
Changes in RNA polymerase II progression influence somatic hypermutation of Ig-related genes by AID
Kodgire, Prashant; Mukkawar, Priyanka; Ratnam, Sarayu; Martin, Terence E.
2013-01-01
Somatic hypermutation (SHM) of Ig genes is initiated by the activation-induced cytidine deaminase (AID), and requires target gene transcription. We previously proposed that AID may associate with the RNA polymerase II (Pol). Here, to determine aspects of the transcription process required for SHM, we knocked-in a transcription terminator into an Ig gene variable region in DT40 chicken B cell line. We found that the human β-globin terminator was an efficient inhibitor of downstream transcription in these cells. The terminator reduced mutations downstream of the poly(A) signal, suggesting that the process of transcription is essential for efficient SHM and that AID has better access to its target when Pol is in the elongating rather than terminating mode. Mutations upstream of the poly(A) site were almost doubled in the active terminator clones compared with an inactivated terminator, and this region showed more single-stranded DNA, indicating that Pol pausing assists SHM. Moreover, the nontranscribed DNA strand was the preferred SHM target upstream of the active terminator. Pol pausing during poly(A) site recognition may facilitate persistence of negative supercoils, exposing the coding single strand and possibly allowing the nascent RNA intermittent reannealing with the template strand, for prolonged access of AID. PMID:23752228
Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan
2006-01-01
Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.
Camats, Núria; Fernández-Cancio, Mónica; Carrascosa, Antonio; Andaluz, Pilar; Albisu, M Ángeles; Clemente, María; Gussinyé, Miquel; Yeste, Diego; Audí, Laura
2012-10-01
Molecular causes of isolated severe growth hormone deficiency (ISGHD) in several genes have been established. The aim of this study was to analyse the contribution of growth hormone-releasing hormone receptor (GHRHR) gene sequence variation to GH deficiency in a series of prepubertal ISGHD patients and to normal adult height. A systematic GHRHR gene sequence analysis was performed in 69 ISGHD patients and 60 normal adult height controls (NAHC). Four GHRHR single-nucleotide polymorphisms (SNPs) were genotyped in 248 additional NAHC. An analysis was performed on individual SNPs and combined genotype associations with diagnosis in ISGHD patients and with height-SDS in NAHC. Twenty-one SNPs were found. P3, P13, P15 and P20 had not been previously described. Patients and controls shared 12 SNPs (P1, P2, P4-P11, P16 and P21). Significantly different frequencies of the heterozygous genotype and alternate allele were detected in P9 (exon 4, rs4988498) and P12 (intron 6, rs35609199); P9 heterozygous genotype frequencies were similar in patients and the shortest control group (heights between -2 and -1 SDS) and significantly different in controls (heights between -1 and +2 SDS). GHRHR P9 together with 4 GH1 SNP genotypes contributed to 6·2% of height-SDS variation in the entire 308 NAHC. This study established the GHRHR gene sequence variation map in ISGHD patients and NAHC. No evidence of GHRHR mutation contribution to ISGHD was found in this population, although P9 and P12 SNP frequencies were significantly different between ISGHD and NAHC. Thus, the gene sequence may contribute to normal adult height, as demonstrated in NAHC. © 2012 Blackwell Publishing Ltd.
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
The REVEILLE Clock Genes Inhibit Growth of Juvenile and Adult Plants by Control of Cell Size1[OPEN
Gray, Jennifer A.; Chu, Dalena Nhu
2017-01-01
The circadian clock is a complex regulatory network that enhances plant growth and fitness in a constantly changing environment. In Arabidopsis (Arabidopsis thaliana), the clock is composed of numerous regulatory feedback loops in which REVEILLE8 (RVE8) and its homologs RVE4 and RVE6 act in a partially redundant manner to promote clock pace. Here, we report that the remaining members of the RVE8 clade, RVE3 and RVE5, play only minor roles in the regulation of clock function. However, we find that RVE8 clade proteins have unexpected functions in the modulation of light input to the clock and the control of plant growth at multiple stages of development. In seedlings, these proteins repress hypocotyl elongation in a daylength- and sucrose-dependent manner. Strikingly, adult rve4 6 8 and rve3 4 5 6 8 mutants are much larger than wild-type plants, with both increased leaf area and biomass. This size phenotype is associated with a faster growth rate and larger cell size and is not simply due to a delay in the transition to flowering. Gene expression and epistasis analysis reveal that the growth phenotypes of rve mutants are due to the misregulation of PHYTOCHROME INTERACTING FACTOR4 (PIF4) and PIF5 expression. Our results show that even small changes in PIF gene expression caused by the perturbation of clock gene function can have large effects on the growth of adult plants. PMID:28254761
Hemoglobins emerging roles in mental disorders. Metabolical, genetical and immunological aspects.
Altinoz, Meric A; Ince, Bahri
2017-10-01
Hemoglobin (Hb) expression in the central nervous system is recently shown. Cooccurences of mental disorders (mainly bipolar disorder (BD) and tic disorders) with β- or α-thalassemia trait or erythrocytosis were witnessed, which may be due to peripheral or central hypoxia/hyperoxia or haplotypal gene interactions. β-Globin genes reside at 11p15.5 close to tyrosine hydroxylase, dopamine receptor DRD4 and Brain Derived Neurotrophic Factor, which involve in psychiatric diseases. α-Globin genes reside at 16p13.3 which associates with BD, tic disorders, ATR-16 Syndrome and Rubinstein Taybi Syndrome (RTS). CREB-Binding Protein (CEBBP)-gene is mutated in RTS, which commonly associates with mood disorders. 16p13.3 region also contains GRIN2A gene encoding N-methyl-d-aspartate receptor-2A and SSTR5 (Somatostatin Receptor-5), again involving in mental disorders. We demonstrated a protective role of minor HbA2 against post-partum episodes in BD and association of higher minor HbF (fetal hemoglobin) levels with family history of psychosis in a BD-patient cohort. HbA2 increases in cardiac ischemia and in mountain dwellers indicating its likely protection against ischemia/hypoxia. HMGIY, a repressive transcription factor of δ-globin chain of HbA2 is increased in lymphocytes of schizophrenics. In autism, deletional mutations were found in BCL11A gene, which cause persistence of HbF at high levels in adulthood. Also, certain polymorphisms in BCL11A strongly associate with schizophrenia. Further, many drugs from anabolic steroids to antimalarial agents elevate HbF and may cause mania. We ascribe a protective role to HbA2 and a maladaptive detrimental role to HbF in psychopathology. We believe that future studies on hemoglobins may pave to discover novel pathogenesis mechanisms in mental disorders. Copyright © 2017 ISDN. Published by Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Stripe rust is one of major diseases in wheat production worldwide. The best economic and efficient method is to utilize resistant varieties. Alturas has high-temperature adult-plant resistance. In order to determine stripe rust resistance characteristics, resistance gene combination and molecular m...
Cure for thalassemia major – from allogeneic hematopoietic stem cell transplantation to gene therapy
Srivastava, Alok; Shaji, Ramachandran V.
2017-01-01
Allogeneic hematopoietic stem cell transplantation has been well established for several decades as gene replacement therapy for patients with thalassemia major, and now offers very high rates of cure for patients who have access to this therapy. Outcomes have improved tremendously over the last decade, even in high-risk patients. The limited data available suggests that the long-term outcome is also excellent, with a >90% survival rate, but for the best results, hematopoietic stem cell transplantation should be offered early, before any end organ damage occurs. However, access to this therapy is limited in more than half the patients by the lack of suitable donors. Inadequate hematopoietic stem cell transplantation services and the high cost of therapy are other reasons for this limited access, particularly in those parts of the world which have a high prevalence of this condition. As a result, fewer than 10% of eligible patients are actually able to avail of this therapy. Other options for curative therapies are therefore needed. Recently, gene correction of autologous hematopoietic stem cells has been successfully established using lentiviral vectors, and several clinical trials have been initiated. A gene editing approach to correct the β-globin mutation or disrupt the BCL11A gene to increase fetal hemoglobin production has also been reported, and is expected to be introduced in clinical trials soon. Curative possibilities for the major hemoglobin disorders are expanding. Providing access to these therapies around the world will remain a challenge. PMID:27909215
2014-01-01
Background X-linked Ornithine Transcarbamylase deficiency (OTCD) is often unrecognized in adults, as clinical manifestations are non-specific, often episodic and unmasked by precipitants, and laboratory findings can be normal outside the acute phase. It may thus be associated with significant mortality if not promptly recognized and treated. The aim of this study was to provide clues for recognition of OTCD in adults and analyze the environmental factors that, interacting with OTC gene mutations, might have triggered acute clinical manifestations. Methods We carried out a clinical, biochemical and molecular study on five unrelated adult patients (one female and four males) with late onset OTCD, who presented to the Emergency Department (ED) with initial fatal encephalopathy. The molecular study consisted of OTC gene sequencing in the probands and family members and in silico characterization of the newly detected mutations. Results We identified two new, c.119G>T (p.Arg40Leu) and c.314G>A (p.Gly105Glu), and three known OTC mutations. Both new mutations were predicted to cause a structural destabilization, correlating with late onset OTCD. We also identified, among the family members, 8 heterozygous females and 2 hemizygous asymptomatic males. Patients' histories revealed potential environmental triggering factors, including steroid treatment, chemotherapy, diet changes and hormone therapy for in vitro fertilization. Conclusions This report raises awareness of the ED medical staff in considering OTCD in the differential diagnosis of sudden neurological and behavioural disorders associated with hyperammonemia at any age and in both genders. It also widens the knowledge about combined effect of genetic and environmental factors in determining the phenotypic expression of OTCD. PMID:25026867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zucchi, Sara; Bluethgen, Nancy; University of Basel, Division of Molecular and Systems Toxicology, Department of Pharmaceutical Sciences, Klingelbergstrasse 50, CH-4056 Basel
Benzophenone-4 (BP-4) is frequently used as UV-absorber in cosmetics and materials protection. Despite its frequent detection in the aquatic environment potential effects on aquatic life are unknown. In this study, we evaluate the effects of BP-4 in eleuthero-embryos and in the liver, testis and brain of adult male fish on the transcriptional level by focusing on target genes involved in hormonal pathways to provide a more complete toxicological profile of this important UV-absorber. Eleuthero-embryos and males of zebrafish were exposed up to 3 days after hatching and for 14 days, respectively, to BP-4 concentrations between 30 and 3000 {mu}g/L. Inmore » eleuthero-embryos transcripts of vtg1, vtg3, esr1, esr2b, hsd17ss3, cyp19b cyp19a, hhex and pax8 were induced at 3000 {mu}g/L BP-4, which points to a low estrogenic activity and interference with early thyroid development, respectively. In adult males BP-4 displayed multiple effects on gene expression in different tissues. In the liver vtg1, vtg3, esr1 and esr2b were down-regulated, while in the brain, vtg1, vtg3 and cyp19b transcripts were up-regulated. In conclusion, the transcription profile revealed that BP-4 interferes with the expression of genes involved in hormonal pathways and steroidogenesis. The effects of BP-4 differ in life stages and adult tissues and point to an estrogenic activity in eleuthero-embryos and adult brain, and an antiestrogenic activity in the liver. The results indicate that BP-4 interferes with the sex hormone system of fish, which is important for the risk assessment of this UV-absorber.« less
Mukai, Mayumi; Takahashi, Keiko; Hayashi, Yuzo; Nakachi, Kei; Kusunoki, Yoichiro
2012-01-01
Background We previously noted that among atomic bomb survivors (ABS), the relative frequency of cases of adult papillary thyroid cancer (PTC) with chromosomal rearrangements (mainly RET/PTC) was significantly greater in those with relatively higher radiation exposure than those with lower radiation exposure. In contrast, the frequency of PTC cases with point mutations (mainly BRAFV600E) was significantly lower in patients with relatively higher radiation exposure than those with lower radiation exposure. We also found that among ABS, the frequency of PTC cases with no detectable gene alterations in RET, neurotrophic tyrosine kinase receptor 1 (NTRK1), BRAF, or RAS was significantly higher in patients with relatively higher radiation exposure than those with lower radiation exposure. However, in ABS with PTC, the relationship between the presence of the anaplastic lymphoma kinase (ALK) gene fused with other gene partners and radiation exposure has received little study. In this study, we tested the hypothesis that the relative frequency of rearranged ALK in ABS with PTC, and with no detectable gene alterations in RET, NTRK1, BRAF, or RAS, would be greater in those having relatively higher radiation exposures. Methods The 105 subjects in the study were drawn from the Life Span Study cohort of ABS of Hiroshima and Nagasaki who were diagnosed with PTC between 1956 and 1993. Seventy-nine were exposed (>0 mGy), and 26 were not exposed to A-bomb radiation. In the 25 ABS with PTC, and with no detectable gene alterations in RET, NTRK1, BRAF, or RAS, we examined archival, formalin-fixed, paraffin-embedded PTC specimens for rearrangement of ALK using reverse transcription–polymerase chain reaction and 5′ rapid amplification of cDNA ends (5′ RACE). Results We found rearranged ALK in 10 of 19 radiation-exposed PTC cases, but none among 6 patients with PTC with no radiation exposure. In addition, solid/trabecular-like architecture in PTC was closely associated with ALK
Wu, Jinghuan; Zhuo, Qin; Chen, Xi; Tian, Yuan; Piao, Jianhua; Yang, Xiaoguang
2016-05-01
To investigate the relationship of leptin receptor gene rs1137100 and rs1137101 single nucleotide polymorphrism (SNP) with metabolic syndrome (MS) in older Han adults from major cities in China. A total of 2082 older Han adults were selected from 18 major cities including 15 provinces/municipalities of China National Nutrition and Health Survey in 2002. According to the MS definition proposed by Joint Interim Statement (JIS), the subjects were divided into MS and control groups. Plasma leptin and insulin levels were measured. The genotypes of rs1137100 and rs1137101 were detected by Taqman method. Association of genotypes of leptin receptor gene SNPs with MS was investigated. The MS group showed higher body mass index (BMI), waist circumference, fasting serum glucose, systolic blood pressure (SBP) and diastolic blood pressure (DBP), triglycerides (TG), serum total cholesterol (TC), insulin, homeostasis model of assessment for insulin resistence index (HOMA-IR) and leptin levels than those of control individuals, while the high density lipoprotein cholesterol (HDL-c) was significantly lower than the control group. The, GG, AA, GA genotypes distribution and the A allele frequency of rs1137100 and rs1137101 were similar between the two groups. The DBP and SBP level were obviously higher in AA genotype. The HDL-c concentration Was significantly lower in AA and GA + AA genotype. The AA and GA genotypes carriers in rs1137100 had similar risk for MS when comparing with the GG genotypes, and the OR values were 1.23 (95% CI 0.90-1.67) and 2.23 (95% CI 0.83-6.44), respectively. The AA and GA genotypes carriers in rs1137101 had similar risk for MS when comparing with the GG genotypes, and the OR values were 1.23 (95% CI 0.90-1.67) and 2.23 (95% CI 0.83-6.44), respectively. Leptin receptor genes rs1137100 and rs1137101 are not associated with pathogenesis of MS in older Han adults, but it may relate with hypertension or lipid abnormality.
Sen Sarma, Moushumi; Whitfield, Charles W; Robinson, Gene E
2007-06-29
Honey bees are known for several striking social behaviors, including a complex pattern of behavioral maturation that gives rise to an age-related colony division of labor and a symbolic dance language, by which successful foragers communicate the location of attractive food sources to their nestmates. Our understanding of honey bees is mostly based on studies of the Western honey bee, Apis mellifera, even though there are 9-10 other members of genus Apis, showing interesting variations in social behavior relative to A. mellifera. To facilitate future in-depth genomic and molecular level comparisons of behavior across the genus, we performed a microarray analysis of brain gene expression for A. mellifera and three key species found in Asia, A. cerana, A. florea and A. dorsata. For each species we compared brain gene expression patterns between foragers and adult one-day-old bees on an A. mellifera cDNA microarray and calculated within-species gene expression ratios to facilitate cross-species analysis. The number of cDNA spots showing hybridization fluorescence intensities above the experimental threshold was reduced by an average of 16% in the Asian species compared to A. mellifera, but an average of 71% of genes on the microarray were available for analysis. Brain gene expression profiles between foragers and one-day-olds showed differences that are consistent with a previous study on A. mellifera and were comparable across species. Although 1772 genes showed significant differences in expression between foragers and one-day-olds, only 218 genes showed differences in forager/one-day-old expression between species (p < 0.001). Principal Components Analysis revealed dominant patterns of expression that clearly distinguished between the four species but did not reflect known differences in behavior and ecology. There were species differences in brain expression profiles for functionally related groups of genes. We conclude that the A. mellifera cDNA microarray can
Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi
2015-01-01
To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wang, Yixuan; Zheng, Chen-Guang; Jiang, Yonghua; Zhang, Jiqin; Chen, Jiayu; Yao, Chao; Zhao, Qingguo; Liu, Sheng; Chen, Ke; Du, Juan; Yang, Ze; Gao, Shaorong
2012-04-01
The generation of induced pluripotent stem cells (iPSCs) from differentiated somatic cells by over-expression of several transcription factors has the potential to cure many genetic and degenerative diseases currently recalcitrant to traditional clinical approaches. One such genetic disease is β-thalassemia major (Cooley's anemia). This disease is caused by either a point mutation or the deletion of several nucleotides in the β-globin gene, and it threatens the lives of millions of people in China. In the present study, we successfully generated iPSCs from fibroblasts collected from a 2-year-old patient who was diagnosed with a homozygous 41/42 deletion in his β-globin gene. More importantly, we successfully corrected this genetic mutation in the β-thalassemia iPSCs by homologous recombination. Furthermore, transplantation of the genetically corrected iPSCs-derived hematopoietic progenitors into sub-lethally irradiated immune deficient SCID mice showed improved hemoglobin production compared with the uncorrected iPSCs. Moreover, the generation of human β-globin could be detected in the mice transplanted with corrected iPSCs-derived hematopietic progenitors. Our study provides strong evidence that iPSCs generated from a patient with a genetic disease can be corrected by homologous recombination and that the corrected iPSCs have potential clinical uses.
Harridge, Stephen D R; Velloso, Cristiana P
2008-01-01
Gene doping is the misuse of gene therapy to enhance athletic performance. It has recently been recognised as a potential threat and subsequently been prohibited by the World Anti-Doping Agency. Despite concerns with safety and efficacy of gene therapy, the technology is progressing steadily. Many of the genes/proteins which are involved in determining key components of athletic performance have been identified. Naturally occurring mutations in humans as well as gene-transfer experiments in adult animals have shown that altered expression of these genes does indeed affect physical performance. For athletes, however, the gains in performance must be weighed against the health risks associated with the gene-transfer process, whereas the detection of such practices will provide new challenges for the anti-doping authorities.
Zubkov, Eugene A; Zorkina, Yana A; Orshanskaya, Elena V; Khlebnikova, Nadezhda N; Krupina, Natalia A; Chekhonin, Vladimir P
2017-01-01
Previous studies have shown the development of emotional and motivational disorders, such as anxiety-depression-like disorders with increased aggression in adolescent and adult Wistar rats, occurs after neonatal exposure to the dipeptidyl peptidase-IV (DPP-IV, EC 3.4.14.5) inhibitors diprotin A and sitagliptin (postnatal days 5-18). In this study, using real-time PCR, we evaluated changes in the gene expression of serine protease DPP-IV and prolyl endopeptidase (PREP, EC 3.4.21.26; dpp4 and prep genes), monoamine oxidase А (maoA) and B (maoB), and serotonin transporter (SERT; sert) in the brain structures from 3-month-old rats after postnatal action of DPP-IV inhibitors diprotin A and sitagliptin. Dpp4, sert, and maoB gene expression increased and maoA gene expression changed with a tendency to increase in the striatum of rats with neonatal sitagliptin action. The increase of maoA gene expression was also shown in the amygdala. An increase in prep gene expression was found in the striatum of rats with the neonatal action of diprotin A, and a decrease in maoB gene expression was observed in the amygdala. We detected a significant downward trend in sert gene expression in the frontal cortex and amygdala, as well as a tendency to increase in maoA gene expression in the hypothalamus. These findings suggest that changes in the expression of the abovementioned genes are associated with the development of anxiety and depression, with increased aggression caused by the neonatal action of diprotin A and sitagliptin. © 2018 S. Karger AG, Basel.
Pathophysiologically based drug treatment of sickle cell disease.
Steinberg, Martin H
2006-04-01
Sickle cell disease is a systemic disorder that is caused by a mutation (Glu6Val) in the gene that encodes beta globin. The sickle hemoglobin molecule (HbS) is a tetramer of two alpha-globin chains and two sickle beta-globin chains, and has the tendency to polymerize when deoxygenated. HbS facilitates abnormal interactions between the sickle erythrocyte and leukocytes and endothelial cells, which trigger a complex pathobiology. This multifaceted pathophysiology provides the opportunity to interrupt the disease at multiple sites, including polymerization of HbS, erythrocyte density and cell-cell interactions. For example, it is possible to induce higher concentrations of fetal hemoglobin, which disrupts the pathology-initiating step of HbS polymerization. Furthermore, it is possible to improve the hydration of sickle erythrocytes and it might be feasible to counteract the endothelial, inflammatory and oxidative abnormalities of sickle cell disease. A therapeutic approach that targets several sites of pathobiology might be most promising.
Sharma, Kirti; Kathait, Atul; Jain, Asha; Kujur, Karmila; Raghuwanshi, Shirish; Bharti, Alok Chandra; Saklani, Asha Chandola; Das, Bhudev Chandra
2015-01-01
Despite high prevalence of human papillomavirus (HPV) infection and cervical cancer in Indian women, no study has been done in tribal populations whose socio-sexual lifestyle is different. Therefore, HPV screening has been carried out in pre-adolescent, adolescent and young adult tribal girls using self-collected urine samples. 20-35 ml self-collected midstream urine samples were obtained from a total of 2278 healthy tribal girls (9-25 years) comprising pre-adolescent, adolescent and young adults from three Indian states: Madhya Pradesh, Jharkhand and Chhattisgarh. β-globin positive 2034 samples were employed for HPV detection and genotyping. The overall prevalence of HPV infection in tribal girls was 12.9% (262/2034). More than 65% (172/262) of them were infected with HR-HPV types of which HPV16 was the most predominant type (54%). Young adult girls aged 18-25 years showed a significantly higher prevalence of HPV infection (19.2%; OR = 3.36; 95% CI 2.97-6.34, P<0.001) as compared to that in adolescent (11.4%; OR = 1.82; 95% CI 1.20-2.76, P<0.01) or pre-adolescent girls (6.6%). This is a first study showing significantly a very high prevalence of HPV infection in adolescent and young adult tribal girls possibly due to different socio-sexual behavior, indicating a serious health concern for Indian tribal women.
Yap, Roseline Wai Kuan; Shidoji, Yoshihiro; Hon, Wei Min; Masaki, Motofumi
2011-01-01
The prevalence of lifestyle-related chronic diseases is increasing and gene-diet interaction studies are limited among the Malaysian population. This study was conducted to evaluate the association and interaction effects of vascular endothelial growth factor receptor-2(VEGFR2) gene polymorphisms and dietary patterns on anthropometric and biochemical risk factors of chronic diseases in 179 Chinese Malaysian adults. Genotyping of rs1870377 and rs2071559 was performed by real-time PCR using TaqMan probes. Dietary patterns were constructed from the food frequency questionnaire using factor analysis. Anthropometric measurements: body mass index (BMI), systolic and diastolic blood pressure and biomarkers: blood glucose, glycated hemoglobin A1c (HbA1c) and lipids were obtained. Two dietary patterns: 'Balanced diet' and 'Meat, rice and noodles diet' (MRND) were extracted. MRND was associated with higher BMI, blood pressure, blood glucose and lipids, while T alleles in both rs1870377 and rs2071559 were associated with higher blood lipids (p < 0.05). The interaction of MRND and rs1870377 had a borderline effect on blood HbA1c after adjusting for confounders (p = 0.057). A dietary pattern of MRND and VEGFR2 gene polymorphisms were both associated with increased health risks of lifestyle-related chronic diseases particularly blood glucose and lipid levels in Chinese Malaysian adults. Copyright © 2012 S. Karger AG, Basel.
Benzinou, Michael; Walley, Andrew; Lobbens, Stephan; Charles, Marie-Aline; Jouret, Béatrice; Fumeron, Frédéric; Balkau, Beverley; Meyre, David; Froguel, Philippe
2006-10-01
Bardet-Biedl syndrome (BBS) is a rare developmental disorder with the cardinal features of abdominal obesity, retinopathy, polydactyly, cognitive impairment, renal and cardiac anomalies, hypertension, and diabetes. BBS is genetically heterogeneous, with nine genes identified to date and evidence for additional loci. In this study, we performed mutation analysis of the coding and conserved regions of BBS1, BBS2, BBS4, and BBS6 in 48 French Caucasian individuals. Among the 36 variants identified, 12 were selected and genotyped in 1,943 French-Caucasian case subjects and 1,299 French-Caucasian nonobese nondiabetic control subjects. Variants in BBS2, BBS4, and BBS6 showed evidence of association with common obesity in an age-dependent manner, the BBS2 single nucleotide polymorphism (SNP) being associated with common adult obesity (P = 0.0005) and the BBS4 and BBS6 SNPs being associated with common early-onset childhood obesity (P = 0.0003) and common adult morbid obesity (0.0003 < P < 0.007). The association of the BBS4 rs7178130 variant was found to be supported by transmission disequilibrium testing (P = 0.006). The BBS6 variants also showed nominal evidence of association with quantitative components of the metabolic syndrome (e.g., dyslipidemia, hyperglycemia), a complication previously described in BBS patients. In summary, our preliminary data suggest that variations at BBS genes are associated with risk of common obesity.
Argos, Maria; Chen, Lin; Jasmine, Farzana; Tong, Lin; Pierce, Brandon L.; Roy, Shantanu; Paul-Brutus, Rachelle; Gamble, Mary V.; Harper, Kristin N.; Parvez, Faruque; Rahman, Mahfuzar; Rakibuz-Zaman, Muhammad; Slavkovich, Vesna; Baron, John A.; Graziano, Joseph H.; Kibriya, Muhammad G.
2014-01-01
Background: Inorganic arsenic is one of the most common naturally occurring contaminants found in the environment. Arsenic is associated with a number of health outcomes, with epigenetic modification suggested as a potential mechanism of toxicity. Objective: Among a sample of 400 adult participants, we evaluated the association between arsenic exposure, as measured by blood and urinary total arsenic concentrations, and epigenome-wide white blood cell DNA methylation. Methods: We used linear regression models to examine the associations between arsenic exposure and methylation at each CpG site, adjusted for sex, age, and batch. Differentially methylated loci were subsequently examined in relation to corresponding gene expression for functional evidence of gene regulation. Results: In adjusted analyses, we observed four differentially methylated CpG sites with urinary total arsenic concentration and three differentially methylated CpG sites with blood arsenic concentration, based on the Bonferroni-corrected significance threshold of p < 1 × 10–7. Methylation of PLA2G2C (probe cg04605617) was the most significantly associated locus in relation to both urinary (p = 3.40 × 10–11) and blood arsenic concentrations (p = 1.48 × 10–11). Three additional novel methylation loci—SQSTM1 (cg01225779), SLC4A4 (cg06121226), and IGH (cg13651690)—were also significantly associated with arsenic exposure. Further, there was evidence of methylation-related gene regulation based on gene expression for a subset of differentially methylated loci. Conclusions: We observed significant associations between arsenic exposure and gene-specific differential white blood cell DNA methylation, suggesting that epigenetic modifications may be an important pathway underlying arsenic toxicity. The specific differentially methylated loci identified may inform potential pathways for future interventions. Citation: Argos M, Chen L, Jasmine F, Tong L, Pierce BL, Roy S, Paul-Brutus R, Gamble MV
Ribasés, M; Ramos-Quiroga, J A; Hervás, A; Bosch, R; Bielsa, A; Gastaminza, X; Artigas, J; Rodriguez-Ben, S; Estivill, X; Casas, M; Cormand, B; Bayés, M
2009-01-01
Attention-deficit/hyperactivity disorder (ADHD) is a common psychiatric disorder in which different genetic and environmental susceptibility factors are involved. Several lines of evidence support the view that at least 30% of ADHD patients diagnosed in childhood continue to suffer the disorder during adulthood and that genetic risk factors may play an essential role in the persistence of the disorder throughout lifespan. Genetic, biochemical and pharmacological studies support the idea that the serotonin system participates in the etiology of ADHD. Based on these data, we aimed to analyze single nucleotide polymorphisms across 19 genes involved in the serotoninergic neurotransmission in a clinical sample of 451 ADHD patients (188 adults and 263 children) and 400 controls using a population-based association study. Several significant associations were found after correcting for multiple testing: (1) the DDC gene was strongly associated with both adulthood (P=0.00053; odds ratio (OR)=2.17) and childhood ADHD (P=0.0017; OR=1.90); (2) the MAOB gene was found specifically associated in the adult ADHD sample (P=0.0029; OR=1.90) and (3) the 5HT2A gene showed evidence of association only with the combined ADHD subtype both in adults (P=0.0036; OR=1.63) and children (P=0.0084; OR=1.49). Our data support the contribution of the serotoninergic system in the genetic predisposition to ADHD, identifying common childhood and adulthood ADHD susceptibility factors, associations that are specific to ADHD subtypes and one variant potentially involved in the continuity of the disorder throughout lifespan.
Azeredo, Lucas A de; De Nardi, Tatiana; Levandowski, Mateus L; Tractenberg, Saulo G; Kommers-Molina, Julia; Wieck, Andrea; Irigaray, Tatiana Q; Silva, Irênio G da; Grassi-Oliveira, Rodrigo
2017-01-01
Memory impairment is an important contributor to the reduction in quality of life experienced by older adults, and genetic risk factors seem to contribute to variance in age-related cognitive decline. Brain-derived neurotrophic factor (BDNF) is an important nerve growth factor linked with development and neural plasticity. The Val66Met polymorphism in the BDNF gene has been associated with impaired episodic memory in adults, but whether this functional variant plays a role in cognitive aging remains unclear. The purpose of this study was to investigate the effects of the BDNF Val66Met polymorphism on memory performance in a sample of elderly adults. Eighty-seven subjects aged > 55 years were recruited using a community-based convenience sampling strategy in Porto Alegre, Brazil. The logical memory subset of the Wechsler Memory Scale-Revised was used to assess immediate verbal recall (IVR), delayed verbal recall (DVR), and memory retention rate. BDNF Met allele carriers had lower DVR scores (p = 0.004) and a decline in memory retention (p = 0.017) when compared to Val/Val homozygotes. However, we found no significant differences in IVR between the two groups (p = 0.088). These results support the hypothesis of the BDNF Val66Met polymorphism as a risk factor associated with cognitive impairment, corroborating previous findings in young and older adults.
Yap, Roseline Wai Kuan; Shidoji, Yoshihiro; Yap, Wai Sum; Masaki, Motofumi
2017-01-01
Gene-diet interaction using a multifactorial approach is preferred to study the multiple risk factors of cardiovascular disease (CVD). This study examined the association and gene-diet interaction effects of the angiotensin II type 1 receptor (AGTR1) gene (rs5186), and type 2 receptor (AGTR2) gene (rs1403543) polymorphisms on metabolic risk factors of CVD in Malaysian adults. CVD parameters (BMI, blood pressure, glycated hemoglobin, total cholesterol (TC), triglycerides, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol (HDL-C), and TC/HDL-C ratio), and constructed dietary patterns “vegetables, fruits, and soy diet” (VFSD), and “rice, egg, and fish diet” (REFD) were obtained from previous studies. Genotyping analysis was performed by real-time PCR using Taqman probes. The subjects were 507 adults (151 Malays; 179 Chinese; and 177 Indians). Significant genetic associations were obtained on blood lipids for rs5186 in Malays and Chinese, and rs1403543 in Chinese females. The significant gene-diet interaction effects after adjusting for potential confounders were: rs5186 × VFSD on blood pressure in Malays (p = 0.016), and in Chinese on blood lipids for rs5186 × REFD (p = 0.009–0.023), and rs1403543 × VFSD in female subjects (p = 0.001–0.011). Malays and Chinese showed higher risk for blood pressure and/or lipids involving rs5186 and rs1403543 SNPs together with gene-diet interactions, but not Indians. PMID:28792482
Yap, Roseline Wai Kuan; Shidoji, Yoshihiro; Yap, Wai Sum; Masaki, Motofumi
2017-08-09
Gene-diet interaction using a multifactorial approach is preferred to study the multiple risk factors of cardiovascular disease (CVD). This study examined the association and gene-diet interaction effects of the angiotensin II type 1 receptor ( AGTR1 ) gene (rs5186), and type 2 receptor ( AGTR2 ) gene (rs1403543) polymorphisms on metabolic risk factors of CVD in Malaysian adults. CVD parameters (BMI, blood pressure, glycated hemoglobin, total cholesterol (TC), triglycerides, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol (HDL-C), and TC/HDL-C ratio), and constructed dietary patterns "vegetables, fruits, and soy diet" (VFSD), and "rice, egg, and fish diet" (REFD) were obtained from previous studies. Genotyping analysis was performed by real-time PCR using Taqman probes. The subjects were 507 adults (151 Malays; 179 Chinese; and 177 Indians). Significant genetic associations were obtained on blood lipids for rs5186 in Malays and Chinese, and rs1403543 in Chinese females. The significant gene-diet interaction effects after adjusting for potential confounders were: rs5186 × VFSD on blood pressure in Malays ( p = 0.016), and in Chinese on blood lipids for rs5186 × REFD ( p = 0.009-0.023), and rs1403543 × VFSD in female subjects ( p = 0.001-0.011). Malays and Chinese showed higher risk for blood pressure and/or lipids involving rs5186 and rs1403543 SNPs together with gene-diet interactions, but not Indians.
Tyrka, A R; Parade, S H; Welch, E S; Ridout, K K; Price, L H; Marsit, C; Philip, N S; Carpenter, L L
2016-07-05
Early adversity increases risk for developing psychopathology. Epigenetic modification of stress reactivity genes is a likely mechanism contributing to this risk. The glucocorticoid receptor (GR) gene is of particular interest because of the regulatory role of the GR in hypothalamic-pituitary-adrenal (HPA) axis function. Mounting evidence suggests that early adversity is associated with GR promoter methylation and gene expression. Few studies have examined links between GR promoter methylation and psychopathology, and findings to date have been mixed. Healthy adult participants (N=340) who were free of psychotropic medications reported on their childhood experiences of maltreatment and parental death and desertion. Lifetime depressive and anxiety disorders and past substance-use disorders were assessed using the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Methylation of exon 1F of the GR gene (NR3C1) was examined in leukocyte DNA via pyrosequencing. On a separate day, a subset of the participants (n=231) completed the dexamethasone/corticotropin-releasing hormone (Dex/CRH) test. Childhood adversity and a history of past substance-use disorder and current or past depressive or anxiety disorders were associated with lower levels of NR3C1 promoter methylation across the region as a whole and at individual CpG sites (P<0.05). The number of adversities was negatively associated with NR3C1 methylation in participants with no lifetime disorder (P=0.018), but not in those with a lifetime disorder. GR promoter methylation was linked to altered cortisol responses to the Dex/CRH test (P<0.05). This study presents evidence of reduced methylation of NR3C1 in association with childhood maltreatment and depressive, anxiety and substance-use disorders in adults. This finding stands in contrast to our prior work, but is consistent with emerging findings, suggesting complexity in the regulation of this gene.
Pang, Wanrong; Sun, Lei; Long, Ju; Weng, Xunjin; Ye, Xuehe; Wang, Junjie; Liao, Yan; Tang, Weijun; Fan, Zuqian; Wu, Suping; Song, Chuanlu; Wei, Xiaoying; Zhang, Chenghong
2016-06-01
The 2.4 kb (or -α(2.4)) deletion in the α-globin gene cluster (NG_000006.1) is an α(+)-thalassemia (α(+)-thal) allele. The molecular basis of -α(2.4) is a deletion from 36860 to 39251 of the α-globin gene cluster. It was reported by three research groups in 2005, 2012 and 2014, respectively. In routine thalassemia screening studies by this research group, we found an individual with the -α(2.4)/αα genotype and an Hb H (β4) disease patient whose genotype was - -(SEA)/-α(2.4). Samples from the parents of the carrier of the -α(2.4)/αα genotype were collected to perform pedigree analysis, and the proband's mother's genotype was diagnosed to be - -(SEA)/-α(2.4). The research revealed that the -α(2.4) allele exists in the population of southern Guangxi, People's Republic of China.
Jantzen, Carrie E; Annunziato, Kate M; Cooper, Keith R
2016-11-01
Perfluoroalkylated substances (PFAS) are a class of persistent anthropogenic chemicals that have been detected worldwide. PFASs consist of fluorinated carbon chains of varying length, terminal groups, and have a number of industrial uses. A previous zebrafish study from our laboratory showed that acute (3-120h post fertilization, 0.02-2.0μM), waterborne embryonic exposure to these chemicals resulted in chemical specific alterations at 5days post fertilization (dpf), and some effects persisted up to 14 dpf. Using a gene battery consisting of 100 transcripts identified several genes that were up or down regulated. This current study looks at the long-term impacts of PFASs in adult zebrafish using the same exposure regimen. It was hypothesized that sub-lethal exposure of perfluorooctane sulfonate (PFOS), perfluorononanoic acid (PFNA), or perfluorooctane sulfonate (PFOA) in embryonic zebrafish (3-120 hpf) would result in permanent morphometric, gene expression, and behavioral changes in adult fish similar to those observed at 5 and 14 dpf. Zebrafish were exposed to PFOS, PFOA, and PFNA (Control 0μM, 2.0μM) for the first five days post fertilization. At six months post fertilization, no PFAS treatment resulted in a significant change in total body length or weight. In terms of behavior, PFNA males showed a reduction in total distance traveled and time of immobility, and an increase in thigmotaxis behavior, aggressive attacks, and preference for the bright section of the tank. PFOS treated males had a reduced aggression behavior, and PFOA females preferred the dark section of the tank. Gene expression of slco2b1, slco1d1, and tgfb1a were analyzed because these transcripts were previously found to be affected by PFAS exposure in 5dpf and 14 dpf zebrafish and resulted in: significant decrease in expression of slco2b1 for both sexes in PFNA and PFOS treated groups, significant decrease of slco1d1 in all treatment groups for females and PFOS and PFOA exposed males
Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells.
Hoban, Megan D; Cost, Gregory J; Mendel, Matthew C; Romero, Zulema; Kaufman, Michael L; Joglekar, Alok V; Ho, Michelle; Lumaquin, Dianne; Gray, David; Lill, Georgia R; Cooper, Aaron R; Urbinati, Fabrizia; Senadheera, Shantha; Zhu, Allen; Liu, Pei-Qi; Paschon, David E; Zhang, Lei; Rebar, Edward J; Wilber, Andrew; Wang, Xiaoyan; Gregory, Philip D; Holmes, Michael C; Reik, Andreas; Hollis, Roger P; Kohn, Donald B
2015-04-23
Sickle cell disease (SCD) is characterized by a single point mutation in the seventh codon of the β-globin gene. Site-specific correction of the sickle mutation in hematopoietic stem cells would allow for permanent production of normal red blood cells. Using zinc-finger nucleases (ZFNs) designed to flank the sickle mutation, we demonstrate efficient targeted cleavage at the β-globin locus with minimal off-target modification. By co-delivering a homologous donor template (either an integrase-defective lentiviral vector or a DNA oligonucleotide), high levels of gene modification were achieved in CD34(+) hematopoietic stem and progenitor cells. Modified cells maintained their ability to engraft NOD/SCID/IL2rγ(null) mice and to produce cells from multiple lineages, although with a reduction in the modification levels relative to the in vitro samples. Importantly, ZFN-driven gene correction in CD34(+) cells from the bone marrow of patients with SCD resulted in the production of wild-type hemoglobin tetramers. © 2015 by The American Society of Hematology.
Ein-Dor, Tsachi; Verbeke, Willem J M I; Mokry, Michal; Vrtička, Pascal
2018-08-01
Attachment in the context of intimate pair bonds is most frequently studied in terms of the universal strategy to draw near, or away, from significant others at moments of personal distress. However, important interindividual differences in the quality of attachment exist, usually captured through secure versus insecure - anxious and/or avoidant - attachment orientations. Since Bowlby's pioneering writings on the theory of attachment, it has been assumed that attachment orientations are influenced by both genetic and social factors - what we would today describe and measure as gene by environment interaction mediated by epigenetic DNA modification - but research in humans on this topic remains extremely limited. We for the first time examined relations between intra-individual differences in attachment and epigenetic modification of the oxytocin receptor (OXTR) and glucocorticoid receptor (NR3C1) gene promoter in 109 young adult human participants. Our results revealed that attachment avoidance was significantly and specifically associated with increased OXTR and NR3C1 promoter methylation. These findings offer first tentative clues on the possible etiology of attachment avoidance in humans by showing epigenetic modification in genes related to both social stress regulation and HPA axis functioning.
Chater-Diehl, Eric J; Laufer, Benjamin I; Castellani, Christina A; Alberry, Bonnie L; Singh, Shiva M
2016-01-01
The molecular basis of Fetal Alcohol Spectrum Disorders (FASD) is poorly understood; however, epigenetic and gene expression changes have been implicated. We have developed a mouse model of FASD characterized by learning and memory impairment and persistent gene expression changes. Epigenetic marks may maintain expression changes over a mouse's lifetime, an area few have explored. Here, mice were injected with saline or ethanol on postnatal days four and seven. At 70 days of age gene expression microarray, methylated DNA immunoprecipitation microarray, H3K4me3 and H3K27me3 chromatin immunoprecipitation microarray were performed. Following extensive pathway analysis of the affected genes, we identified the top affected gene expression pathway as "Free radical scavenging". We confirmed six of these changes by droplet digital PCR including the caspase Casp3 and Wnt transcription factor Tcf7l2. The top pathway for all methylation-affected genes was "Peroxisome biogenesis"; we confirmed differential DNA methylation in the Acca1 thiolase promoter. Altered methylation and gene expression in oxidative stress pathways in the adult hippocampus suggests a novel interface between epigenetic and oxidative stress mechanisms in FASD.
Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A
2005-01-01
Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.
Differences in Hematological Traits between High- and Low-Altitude Lizards (Genus Phrynocephalus)
Lu, Songsong; Xin, Ying; Tang, Xiaolong; Yue, Feng; Wang, Huihui; Bai, Yucheng; Niu, Yonggang; Chen, Qiang
2015-01-01
Phrynocephalus erythrurus (Lacertilia: Agamidae) is considered to be the highest living reptile in the world (about 4500-5000 m above sea level), whereas Phrynocephalus przewalskii inhabits low altitudes (about 1000-1500 m above sea level). Here, we report the differences in hematological traits between these two different Phrynocephalus species. Compared with P. przewalskii, the results indicated that P. erythrurus own higher oxygen carrying capacity by increasing red blood cell count (RBC), hemoglobin concentration ([Hb]) and hematocrit (Hct) and these elevations could promote oxygen carrying capacity without disadvantage of high viscosity. The lower partial pressure of oxygen in arterial blood (PaO2) of P. erythrurus did not cause the secondary alkalosis, which may be attributed to an efficient pulmonary system for oxygen (O2) loading. The elevated blood-O2 affinity in P. erythrurus may be achieved by increasing intrinsic O2 affinity of isoHbs and balancing the independent effects of potential heterotropic ligands. We detected one α-globin gene and three β-globin genes with 1 and 33 amino acid substitutions between these two species, respectively. Molecular dynamics simulation results showed that amino acids substitutions in β-globin chains could lead to the elimination of hydrogen bonds in T-state Hb models of P. erythrurus. Based on the present data, we suggest that P. erythrurus have evolved an efficient oxygen transport system under the unremitting hypobaric hypoxia. PMID:25955247
Mice Expressing RHAG and RHD Human Blood Group Genes
Goossens, Dominique; da Silva, Nelly; Metral, Sylvain; Cortes, Ulrich; Callebaut, Isabelle; Picot, Julien; Mouro-Chanteloup, Isabelle; Cartron, Jean-Pierre
2013-01-01
Anti-RhD prophylaxis of haemolytic disease of the fetus and newborn (HDFN) is highly effective, but as the suppressive mechanism remains uncertain, a mouse model would be of interest. Here we have generated transgenic mice expressing human RhAG and RhD erythrocyte membrane proteins in the presence and, for human RhAG, in the absence, of mouse Rhag. Human RhAG associates with mouse Rh but not mouse Rhag on red blood cells. In Rhag knockout mice transgenic for human RHAG, the mouse Rh protein is “rescued” (re-expressed), and co-immunoprecipitates with human RhAG, indicating the presence of hetero-complexes which associate mouse and human proteins. RhD antigen was expressed from a human RHD gene on a BAC or from RHD cDNA under control of β-globin regulatory elements. RhD was never observed alone, strongly indicative that its expression absolutely depends on the presence of transgenic human RhAG. This first expression of RhD in mice is an important step in the creation of a mouse model of RhD allo-immunisation and HDFN, in conjunction with the Rh-Rhag knockout mice we have developed previously. PMID:24260394
Britto, Alan M A; Amoedo, Nívea D; Pezzuto, Paula; Afonso, Adriana O; Martínez, Ana M B; Silveira, Jussara; Sion, Fernando S; Machado, Elizabeth S; Soares, Marcelo A; Giannini, Ana L M
2013-07-31
TLRs (Toll-like receptors) and RLRs (RIG-I-like receptors) mediate innate immune responses by detecting microorganism invasion. RIG-I activation results in the production of interferon (IFN) type 1 and IFN responsive genes (ISGs). As the ubiquitin ligases RNF125 and TRIM25 are involved in regulating RIG-I function, our aim was to assess whether the levels of these three genes vary between healthy and HIV-infected individuals and whether these levels are related to disease progression. Gene expression analyses for RIG-I, RNF125, and TRIM25 were performed for HIV-infected adults and the children's peripheral blood mononuclear cells (PBMCs). Reverse transcription-quantitative PCRs (RT-qPCRs) were performed in order to quantify the expression levels of RIG-I, RNF125 and TRIM25 from PBMCs purified from control or HIV-infected individuals. Controls express higher levels of the three genes when compared to HIV-infected patients. These expressions are clearly distinct between healthy and progressors, and are reproduced in adults and children. In controls, RNF125 is the highest expressed gene, whereas in progressors, RIG-I is either the highest expressed gene or is expressed similarly to RNF125 and TRIM25. A pattern of expression of RIG-I, RNF125, and TRIM25 genes in HIV patients is evident. The high expression of RNF125 in healthy individuals reflects the importance of keeping RIG-I function off, inhibiting unnecessary IFN production. Consistent with this assumption, RNF125 levels are lower in HIV patients and importantly, the RNF125/RIG-I ratio is lower in patients who progress to AIDS. Our results might help to predict disease progression and unveil the role of poorly characterized host genes during HIV infection.
Functional genomics indicate that schizophrenia may be an adult vascular-ischemic disorder
Moises, H W; Wollschläger, D; Binder, H
2015-01-01
In search for the elusive schizophrenia pathway, candidate genes for the disorder from a discovery sample were localized within the energy-delivering and ischemia protection pathway. To test the adult vascular-ischemic (AVIH) and the competing neurodevelopmental hypothesis (NDH), functional genomic analyses of practically all available schizophrenia-associated genes from candidate gene, genome-wide association and postmortem expression studies were performed. Our results indicate a significant overrepresentation of genes involved in vascular function (P<0.001), vasoregulation (that is, perivascular (P<0.001) and shear stress (P<0.01), cerebral ischemia (P<0.001), neurodevelopment (P<0.001) and postischemic repair (P<0.001) among schizophrenia-associated genes from genetic association studies. These findings support both the NDH and the AVIH. The genes from postmortem studies showed an upregulation of vascular-ischemic genes (P=0.020) combined with downregulated synaptic (P=0.005) genes, and ND/repair (P=0.003) genes. Evidence for the AVIH and the NDH is critically discussed. We conclude that schizophrenia is probably a mild adult vascular-ischemic and postischemic repair disorder. Adult postischemic repair involves ND genes for adult neurogenesis, synaptic plasticity, glutamate and increased long-term potentiation of excitatory neurotransmission (i-LTP). Schizophrenia might be caused by the cerebral analog of microvascular angina. PMID:26261884
Functional genomics indicate that schizophrenia may be an adult vascular-ischemic disorder.
Moises, H W; Wollschläger, D; Binder, H
2015-08-11
In search for the elusive schizophrenia pathway, candidate genes for the disorder from a discovery sample were localized within the energy-delivering and ischemia protection pathway. To test the adult vascular-ischemic (AVIH) and the competing neurodevelopmental hypothesis (NDH), functional genomic analyses of practically all available schizophrenia-associated genes from candidate gene, genome-wide association and postmortem expression studies were performed. Our results indicate a significant overrepresentation of genes involved in vascular function (P < 0.001), vasoregulation (that is, perivascular (P < 0.001) and shear stress (P < 0.01), cerebral ischemia (P < 0.001), neurodevelopment (P < 0.001) and postischemic repair (P < 0.001) among schizophrenia-associated genes from genetic association studies. These findings support both the NDH and the AVIH. The genes from postmortem studies showed an upregulation of vascular-ischemic genes (P = 0.020) combined with downregulated synaptic (P = 0.005) genes, and ND/repair (P = 0.003) genes. Evidence for the AVIH and the NDH is critically discussed. We conclude that schizophrenia is probably a mild adult vascular-ischemic and postischemic repair disorder. Adult postischemic repair involves ND genes for adult neurogenesis, synaptic plasticity, glutamate and increased long-term potentiation of excitatory neurotransmission (i-LTP). Schizophrenia might be caused by the cerebral analog of microvascular angina.
Cypess, Aaron M; White, Andrew P; Vernochet, Cecile; Schulz, Tim J; Xue, Ruidan; Sass, Christina A; Huang, Tian Liang; Roberts-Toler, Carla; Weiner, Lauren S; Sze, Cathy; Chacko, Aron T; Deschamps, Laura N; Herder, Lindsay M; Truchan, Nathan; Glasgow, Allison L; Holman, Ashley R; Gavrila, Alina; Hasselgren, Per-Olof; Mori, Marcelo A; Molla, Michael; Tseng, Yu-Hua
2013-05-01
The imbalance between energy intake and expenditure is the underlying cause of the current obesity and diabetes pandemics. Central to these pathologies is the fat depot: white adipose tissue (WAT) stores excess calories, and brown adipose tissue (BAT) consumes fuel for thermogenesis using tissue-specific uncoupling protein 1 (UCP1). BAT was once thought to have a functional role in rodents and human infants only, but it has been recently shown that in response to mild cold exposure, adult human BAT consumes more glucose per gram than any other tissue. In addition to this nonshivering thermogenesis, human BAT may also combat weight gain by becoming more active in the setting of increased whole-body energy intake. This phenomenon of BAT-mediated diet-induced thermogenesis has been observed in rodents and suggests that activation of human BAT could be used as a safe treatment for obesity and metabolic dysregulation. In this study, we isolated anatomically defined neck fat from adult human volunteers and compared its gene expression, differentiation capacity and basal oxygen consumption to different mouse adipose depots. Although the properties of human neck fat vary substantially between individuals, some human samples share many similarities with classical, also called constitutive, rodent BAT.
Saas, J; Haag, J; Rueger, D; Chubinskaya, S; Sohler, F; Zimmer, R; Bartnik, E; Aigner, T
2006-10-01
Anabolic and catabolic cytokines and growth factors such as BMP-7 and IL-1beta play a central role in controlling the balance between degradation and repair of normal and (osteo)arthritic articular cartilage matrix. In this report, we investigated the response of articular chondrocytes to these factors IL-1beta and BMP-7 in terms of changes in gene expression levels. Large scale analysis was performed on primary human adult articular chondrocytes isolated from two human, independent donors cultured in alginate beads (non-stimulated and stimulated with IL-1beta and BMP-7 for 48 h) using Affymetrix gene chips (oligo-arrays). Biostatistical and bioinformatic evaluation of gene expression pattern was performed using the Resolver software (Rosetta). Part of the results were confirmed using real-time PCR. IL-1beta modulated significantly 909 out of 3459 genes detectable, whereas BMP-7 influenced only 36 out of 3440. BMP-7 induced mainly anabolic activation of chondrocytes including classical target genes such as collagen type II and aggrecan, while IL-1beta, both, significantly modulated the gene expression levels of numerous genes; namely, IL-1beta down-regulated the expression of anabolic genes and induced catabolic genes and mediators. Our data indicate that BMP-7 has only a limited effect on differentiated cells, whereas IL-1beta causes a dramatic change in gene expression pattern, i.e. induced or repressed much more genes. This presumably reflects the fact that BMP-7 signaling is effected via one pathway only (i.e. Smad-pathway) whereas IL-1beta is able to signal via a broad variety of intracellular signaling cascades involving the JNK, p38, NFkB and Erk pathways and even influencing BMP signaling.
Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena
2002-02-15
Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.
Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena
2002-01-01
Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (ɛ globin, p53 and γ interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to αλµοστ 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed. PMID:11842122
Tan, Wei; Dean, Michael; Law, Amanda J.
2010-01-01
ErbB4 is a growth factor receptor tyrosine kinase essential for neurodevelopment. Genetic variation in ErbB4 is associated with schizophrenia and risk-associated polymorphisms predict overexpression of ErbB4 CYT-1 isoforms in the brain in the disorder. The molecular mechanism of association is unclear because the polymorphisms flank exon 3 of the gene and reside 700 kb distal to the CYT-1 defining exon. We hypothesized that the polymorphisms are indirectly associated with ErbB4 CYT-1 via splicing of exon 3 on the CYT-1 background. We report via cloning and sequencing of adult and fetal human brain cDNA libraries the identification of novel splice isoforms of ErbB4, whereby exon 3 is skipped (del.3). ErbB4 del.3 transcripts exist as CYT-2 isoforms and are predicted to produce truncated proteins. Furthermore, our data refine the structure of the human ErbB4 gene, clarify that juxtamembrane (JM) splice variants of ErbB4, JM-a and JM-b respectively, are characterized by the replacement of a 75 nucleotide (nt) sequence with a 45-nt insertion, and demonstrate that there are four alternative exons in the gene. Our analyses reveal that novel splice variants of ErbB4 exist in the developing and adult human brain and, given the failure to identify ErbB4 del.3 CYT-1 transcripts, suggest that the association of risk polymorphisms in the ErbB4 gene with CYT-1 transcript levels is not mediated via an exon 3 splicing event. PMID:20886074
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.
Golpon, Heiko A.; Geraci, Mark W.; Moore, Mark D.; Miller, Heidi L.; Miller, Gary J.; Tuder, Rubin M.; Voelkel, Norbert F.
2001-01-01
HOX genes belong to the large family of homeodomain genes that function as transcription factors. Animal studies indicate that they play an essential role in lung development. We investigated the expression pattern of HOX genes in human lung tissue by using microarray and degenerate reverse transcriptase-polymerase chain reaction survey techniques. HOX genes predominantly from the 3′ end of clusters A and B were expressed in normal human adult lung and among them HOXA5 was the most abundant, followed by HOXB2 and HOXB6. In fetal (12 weeks old) and diseased lung specimens (emphysema, primary pulmonary hypertension) additional HOX genes from clusters C and D were expressed. Using in situ hybridization, transcripts for HOXA5 were predominantly found in alveolar septal and epithelial cells, both in normal and diseased lungs. A 2.5-fold increase in HOXA5 mRNA expression was demonstrated by quantitative reverse transcriptase-polymerase chain reaction in primary pulmonary hypertension lung specimens when compared to normal lung tissue. In conclusion, we demonstrate that HOX genes are selectively expressed in the human lung. Differences in the pattern of HOX gene expression exist among fetal, adult, and diseased lung specimens. The altered pattern of HOX gene expression may contribute to the development of pulmonary diseases. PMID:11238043