Science.gov

Sample records for adult pluripotent stem

  1. Generation of pluripotent stem cells from adult human testis.

    PubMed

    Conrad, Sabine; Renninger, Markus; Hennenlotter, Jörg; Wiesner, Tina; Just, Lothar; Bonin, Michael; Aicher, Wilhelm; Bühring, Hans-Jörg; Mattheus, Ulrich; Mack, Andreas; Wagner, Hans-Joachim; Minger, Stephen; Matzkies, Matthias; Reppel, Michael; Hescheler, Jürgen; Sievert, Karl-Dietrich; Stenzl, Arnulf; Skutella, Thomas

    2008-11-20

    Human primordial germ cells and mouse neonatal and adult germline stem cells are pluripotent and show similar properties to embryonic stem cells. Here we report the successful establishment of human adult germline stem cells derived from spermatogonial cells of adult human testis. Cellular and molecular characterization of these cells revealed many similarities to human embryonic stem cells, and the germline stem cells produced teratomas after transplantation into immunodeficient mice. The human adult germline stem cells differentiated into various types of somatic cells of all three germ layers when grown under conditions used to induce the differentiation of human embryonic stem cells. We conclude that the generation of human adult germline stem cells from testicular biopsies may provide simple and non-controversial access to individual cell-based therapy without the ethical and immunological problems associated with human embryonic stem cells.

  2. Multipotent (adult) and pluripotent stem cells for heart regeneration: what are the pros and cons?

    PubMed

    Liao, Song-Yan; Tse, Hung-Fat

    2013-12-24

    Heart failure after myocardial infarction is the leading cause of mortality and morbidity worldwide. Existing medical and interventional therapies can only reduce the loss of cardiomyocytes during myocardial infarction but are unable to replenish the permanent loss of cardiomyocytes after the insult, which contributes to progressive pathological left ventricular remodeling and progressive heart failure. As a result, cell-based therapies using multipotent (adult) stem cells and pluripotent stem cells (embryonic stem cells or induced pluripotent stem cells) have been explored as potential therapeutic approaches to restore cardiac function in heart failure. Nevertheless, the optimal cell type with the best therapeutic efficacy and safety for heart regeneration is still unknown. In this review, the potential pros and cons of different types of multipotent (adult) stem cells and pluripotent stem cells that have been investigated in preclinical and clinical studies are reviewed, and the future perspective of stem cell-based therapy for heart regeneration is discussed.

  3. A mystery unraveled: nontumorigenic pluripotent stem cells in human adult tissues

    PubMed Central

    Simerman, Ariel A; Perone, Marcelo J; Gimeno, María L; Dumesic, Daniel A; Chazenbalk, Gregorio D

    2014-01-01

    Introduction: Embryonic stem cells and induced pluripotent stem cells have emerged as the gold standard of pluripotent stem cells and the class of stem cell with the highest potential for contribution to regenerative and therapeutic application; however, their translational use is often impeded by teratoma formation, commonly associated with pluripotency. We discuss a population of nontumorigenic pluripotent stem cells, termed Multilineage Differentiating Stress Enduring (Muse) cells, which offer an innovative and exciting avenue of exploration for the potential treatment of various human diseases. Areas covered: This review discusses the origin of Muse cells, describes in detail their various unique characteristics, and considers future avenues of their application and investigation with respect to what is currently known of adult pluripotent stem cells in scientific literature. We begin by defining cell potency, then discuss both mesenchymal and various reported populations of pluripotent stem cells, and finally delve into Muse cells and the characteristics that set them apart from their contemporaries. Expert opinion: Muse cells derived from adipose tissue (Muse-AT) are efficiently, routinely and painlessly isolated from human lipoaspirate material, exhibit tripoblastic differentiation both spontaneously and under media-specific induction, and do not form teratomas. We describe qualities specific to Muse-AT cells and their potential impact on the field of regenerative medicine and cell therapy. PMID:24745973

  4. Human oocytes reprogram adult somatic nuclei of a type 1 diabetic to diploid pluripotent stem cells.

    PubMed

    Yamada, Mitsutoshi; Johannesson, Bjarki; Sagi, Ido; Burnett, Lisa Cole; Kort, Daniel H; Prosser, Robert W; Paull, Daniel; Nestor, Michael W; Freeby, Matthew; Greenberg, Ellen; Goland, Robin S; Leibel, Rudolph L; Solomon, Susan L; Benvenisty, Nissim; Sauer, Mark V; Egli, Dieter

    2014-06-26

    The transfer of somatic cell nuclei into oocytes can give rise to pluripotent stem cells that are consistently equivalent to embryonic stem cells, holding promise for autologous cell replacement therapy. Although methods to induce pluripotent stem cells from somatic cells by transcription factors are widely used in basic research, numerous differences between induced pluripotent stem cells and embryonic stem cells have been reported, potentially affecting their clinical use. Because of the therapeutic potential of diploid embryonic stem-cell lines derived from adult cells of diseased human subjects, we have systematically investigated the parameters affecting efficiency of blastocyst development and stem-cell derivation. Here we show that improvements to the oocyte activation protocol, including the use of both kinase and translation inhibitors, and cell culture in the presence of histone deacetylase inhibitors, promote development to the blastocyst stage. Developmental efficiency varied between oocyte donors, and was inversely related to the number of days of hormonal stimulation required for oocyte maturation, whereas the daily dose of gonadotropin or the total number of metaphase II oocytes retrieved did not affect developmental outcome. Because the use of concentrated Sendai virus for cell fusion induced an increase in intracellular calcium concentration, causing premature oocyte activation, we used diluted Sendai virus in calcium-free medium. Using this modified nuclear transfer protocol, we derived diploid pluripotent stem-cell lines from somatic cells of a newborn and, for the first time, an adult, a female with type 1 diabetes.

  5. Clonogenic neoblasts are pluripotent adult stem cells that underlie planarian regeneration.

    PubMed

    Wagner, Daniel E; Wang, Irving E; Reddien, Peter W

    2011-05-13

    Pluripotent cells in the embryo can generate all cell types, but lineage-restricted cells are generally thought to replenish adult tissues. Planarians are flatworms and regenerate from tiny body fragments, a process requiring a population of proliferating cells (neoblasts). Whether regeneration is accomplished by pluripotent cells or by the collective activity of multiple lineage-restricted cell types is unknown. We used ionizing radiation and single-cell transplantation to identify neoblasts that can form large descendant-cell colonies in vivo. These clonogenic neoblasts (cNeoblasts) produce cells that differentiate into neuronal, intestinal, and other known postmitotic cell types and are distributed throughout the body. Single transplanted cNeoblasts restored regeneration in lethally irradiated hosts. We conclude that broadly distributed, adult pluripotent stem cells underlie the remarkable regenerative abilities of planarians.

  6. Pluripotency of adult stem cells derived from human and rat pancreas

    NASA Astrophysics Data System (ADS)

    Kruse, C.; Birth, M.; Rohwedel, J.; Assmuth, K.; Goepel, A.; Wedel, T.

    Adult stem cells are undifferentiated cells found within fully developed tissues or organs of an adult individuum. Until recently, these cells have been considered to bear less self-renewal ability and differentiation potency compared to embryonic stem cells. In recent studies an undifferentiated cell type was found in primary cultures of isolated acini from exocrine pancreas termed pancreatic stellate cells. Here we show that pancreatic stellate-like cells have the capacity of extended self-renewal and are able to differentiate spontaneously into cell types of all three germ layers expressing markers for smooth muscle cells, neurons, glial cells, epithelial cells, chondrocytes and secretory cells (insulin, amylase). Differentiation and subsequent formation of three-dimensional cellular aggregates (organoid bodies) were induced by merely culturing pancreatic stellate-like cells in hanging drops. These cells were developed into stable, long-term, in vitro cultures of both primary undifferentiated cell lines as well as organoid cultures. Thus, evidence is given that cell lineages of endodermal, mesodermal, and ectodermal origin arise spontaneously from a single adult undifferentiated cell type. Based on the present findings it is assumed that pancreatic stellate-like cells are a new class of lineage uncommitted pluripotent adult stem cells with a remarkable self-renewal ability and differentiation potency. The data emphasize the versatility of adult stem cells and may lead to a reappraisal of their use for the treatment of inherited disorders or acquired degenerative diseases.

  7. A Hyaluronic Acid-Rich Node and Duct System in Which Pluripotent Adult Stem Cells Circulate.

    PubMed

    Rai, Rajani; Chandra, Vishal; Kwon, Byoung S

    2015-10-01

    Regenerative medicine is in demand of adult pluripotent stem cells (PSCs). The "Bonghan System (BHS)" was discovered and suggested to contain cells with regenerative capacity in the early 1960s. It had been ignored for a long time due to the lack of sufficient details of experiments, but about 37 years after the initial report, the BHS was rediscovered and named as the "primo vascular system." Recently, we have discovered a similar structure, which contained a high level of hyaluronic acid, and hence, named the structure as hyaluronic acid-rich node and duct system (HAR-NDS). Here we discuss the HAR-NDS concept starting from the discovery of BHS, and findings pointing to its importance in regenerative medicine. This HAR-NDS contained adult PSCs, called node and duct stem cells (NDSCs), which appeared to circulate in it. We describe the evidence that NDSCs can differentiate into hemangioblasts that further produced differentiated blood cells. The NDSCs had a potential to differentiate into neuronal cells and hepatocytes; thus, NDSCs had a capability to become cells from all three germ layers. This system appears to be a promising alternative source of adult stem cells that can be easily delivered to their target tissues and participate in tissue regeneration.

  8. Potential for a pluripotent adult stem cell treatment for acute radiation sickness

    PubMed Central

    Rodgerson, Denis O; Reidenberg, Bruce E; Harris, Alan G; Pecora, Andrew L

    2012-01-01

    Accidental radiation exposure and the threat of deliberate radiation exposure have been in the news and are a public health concern. Experience with acute radiation sickness has been gathered from atomic blast survivors of Hiroshima and Nagasaki and from civilian nuclear accidents as well as experience gained during the development of radiation therapy for cancer. This paper reviews the medical treatment reports relevant to acute radiation sickness among the survivors of atomic weapons at Hiroshima and Nagasaki, among the victims of Chernobyl, and the two cases described so far from the Fukushima Dai-Ichi disaster. The data supporting the use of hematopoietic stem cell transplantation and the new efforts to expand stem cell populations ex vivo for infusion to treat bone marrow failure are reviewed. Hematopoietic stem cells derived from bone marrow or blood have a broad ability to repair and replace radiation induced damaged blood and immune cell production and may promote blood vessel formation and tissue repair. Additionally, a constituent of bone marrow-derived, adult pluripotent stem cells, very small embryonic like stem cells, are highly resistant to ionizing radiation and appear capable of regenerating radiation damaged tissue including skin, gut and lung. PMID:24520532

  9. Isolation of pluripotent neural crest-derived stem cells from adult human tissues by connexin-43 enrichment.

    PubMed

    Pelaez, Daniel; Huang, Chun-Yuh Charles; Cheung, Herman S

    2013-11-01

    Identification and isolation of pluripotent stem cells in adult tissues represent an important advancement in the fields of stem cell biology and regenerative medicine. For several years, research has been performed on the identification of biomarkers that can isolate stem cells residing in neural crest (NC)-derived adult tissues. The NC is considered a good model in stem cell biology as cells from it migrate extensively and contribute to the formation of diverse tissues in the body during organogenesis. Migration of these cells is modulated, in part, by gap junction communication among the cell sheets. Here we present a study in which, selection of connexin 43 (Cx43) expressing cells from human adult periodontal ligament yields a novel pluripotent stem cell population. Cx43⁺ periodontal ligament stem cells express pluripotency-associated transcription factors OCT4, Nanog, and Sox2, as well as NC-specific markers Sox10, p75, and Nestin. When injected in vivo into an immunodeficient mouse model, these cells were capable of generating teratomas with tissues from the three embryological germ layers: endoderm, mesoderm, and ectoderm. Furthermore, the cells formed mature structures of tissues normally arising from the NC during embryogenesis such as eccrine sweat glands of the human skin, muscle, neuronal tissues, cartilage, and bone. Immunohistochemical analysis confirmed the human origin of the neoplastic cells as well as the ectodermal and endodermal nature of some of the structures found in the tumors. These results suggest that Cx43 may be used as a biomarker to select and isolate the remnant NC pluripotent stem cells from adult human tissues arising from this embryological structure. The isolation of these cells through routine medical procedures such as wisdom teeth extraction further enhances their applicability to the regenerative medicine field.

  10. A hypothesis for an embryonic origin of pluripotent Oct-4(+) stem cells in adult bone marrow and other tissues.

    PubMed

    Ratajczak, M Z; Machalinski, B; Wojakowski, W; Ratajczak, J; Kucia, M

    2007-05-01

    Accumulating evidence demonstrates that adult tissues contain a population of stem cells that express early developmental markers such as stage-specific embryonic antigen and transcription factors Oct-4 and Nanog. These are the markers characteristic for embryonic stem cells, epiblast stem cells and primordial germ cells. The presence of these stem cells in adult tissues including bone marrow, epidermis, bronchial epithelium, myocardium, pancreas and testes supports the concept that adult tissues contain some population of pluripotent stem cells that is deposited in embryogenesis during early gastrulation. In this review we will discuss these data and present a hypothesis that these cells could be direct descendants of the germ lineage. The germ lineage in order to pass genes on to the next generations creates soma and thus becomes a 'mother lineage' for all somatic cell lineages present in the adult body.

  11. Genetic regulators of a pluripotent adult stem cell system in planarians identified by RNAi and clonal analysis.

    PubMed

    Wagner, Daniel E; Ho, Jaclyn J; Reddien, Peter W

    2012-03-02

    Pluripotency is a central, well-studied feature of embryonic development, but the role of pluripotent cell regulation in somatic tissue regeneration remains poorly understood. In planarians, regeneration of entire animals from tissue fragments is promoted by the activity of adult pluripotent stem cells (cNeoblasts). We utilized transcriptional profiling to identify planarian genes expressed in adult proliferating, regenerative cells (neoblasts). We also developed quantitative clonal analysis methods for expansion and differentiation of cNeoblast descendants that, together with RNAi, revealed gene roles in stem cell biology. Genes encoding two zinc finger proteins, Vasa, a LIM domain protein, Sox and Jun-like transcription factors, two candidate RNA-binding proteins, a Setd8-like protein, and PRC2 (Polycomb) were required for proliferative expansion and/or differentiation of cNeoblast-derived clones. These findings suggest that planarian stem cells utilize molecular mechanisms found in germ cells and other pluripotent cell types and identify genetic regulators of the planarian stem cell system.

  12. Cellular and molecular dissection of pluripotent adult somatic stem cells in planarians.

    PubMed

    Shibata, Norito; Rouhana, Labib; Agata, Kiyokazu

    2010-01-01

    Freshwater planarians, Plathelminthes, have been an intriguing model animal of regeneration studies for more than 100 years. Their robust regenerative ability is one of asexual reproductive capacity, in which complete animals develop from tiny body fragments within a week. Pluripotent adult somatic stem cells, called neoblasts, assure this regenerative ability. Neoblasts give rise to not only all types of somatic cells, but also germline cells. During the last decade, several experimental techniques for the analysis of planarian neoblasts at the molecular level, such as in situ hybridization, RNAi and fluorescence activated cell sorting, have been established. Moreover, information about genes involved in maintenance and differentiation of neoblasts has been accumulated. One of the molecular features of neoblasts is the expression of many RNA regulators, which are involved in germline development in other animals, such as vasa and piwi family genes. In this review, we introduce physiological and molecular features of the neoblast, and discuss how germline genes regulate planarian neoblasts and what differences exist between neoblasts and germline cells.

  13. Heterogeneity of chromatoid bodies in adult pluripotent stem cells of planarian Dugesia japonica.

    PubMed

    Kashima, Makoto; Kumagai, Nobuyoshi; Agata, Kiyokazu; Shibata, Norito

    2016-02-01

    The robust regenerative ability of planarians is known to be dependent on adult pluripotent stem cells called neoblasts. One of the morphological features of neoblasts is cytoplasmic ribonucleoprotein granules (chromatoid bodies: CBs), which resemble germ granules present in germline cells in other animals. Previously, we showed by immuno-electron microscopic analysis that DjCBC-1, a planarian Me31B/Dhh1/DDX6 homologue, which is a component of ribonucleoprotein granules, was localized in CBs in the planarian Dugesia japonica. Also, recently it was reported using another planarian species that Y12 antibody recognizing symmetrical dimethylarginine (sDMA) specifically binds to CBs in which histone mRNA is co-localized. Here, we showed by double immunostaining and RNA interference (RNAi) that DjCBC-1-containing CBs and Y12-immunoreactive CBs are distinct structures, suggesting that CBs are composed of heterogeneous populations. We also found that the Y12-immunoreactive CBs specifically contained a cytoplasmic type of planarian PIWI protein (DjPiwiC). We revealed by RNAi experiments that Y12-immunoreactive CBs may have anti-transposable element activity involving the DjPiwiC protein in the neoblasts.

  14. How to mend a broken heart: adult and induced pluripotent stem cell therapy for heart repair and regeneration.

    PubMed

    Wegener, Marie; Bader, Augustinus; Giri, Shibashish

    2015-06-01

    The recently developed ability to differentiate primary adult stem cells and induced pluripotent stem cells (iPSCs) into cardiomyocytes is providing unprecedented opportunities to produce an unlimited supply of cardiomyocytes for use in patients with heart disease. Here, we examine the evidence for the preclinical use of such cells for successful heart regeneration. We also describe advances in the identification of new cardiac molecular and cellular targets to induce proliferation of cardiomyocytes for heart regeneration. Such new advances are paving the way for a new innovative drug development process for the treatment of heart disease.

  15. Generation and Characterization of Leukemia Inhibitory Factor-Dependent Equine Induced Pluripotent Stem Cells from Adult Dermal Fibroblasts

    PubMed Central

    Ovchinnikov, Dmitry A.; Sun, Jane; Fortuna, Patrick R.J.; Wolvetang, Ernst J.

    2014-01-01

    In this study we have reprogrammed dermal fibroblasts from an adult female horse into equine induced pluripotent stem cells (equiPSCs). These equiPSCs are dependent only on leukemia inhibitory factor (LIF), placing them in striking contrast to previously derived equiPSCs that have been shown to be co-dependent on both LIF and basic fibroblast growth factor (bFGF). These equiPSCs have a normal karyotype and have been maintained beyond 60 passages. They possess alkaline phosphatase activity and express eqNANOG, eqOCT4, and eqTERT mRNA. Immunocytochemistry confirmed that they produce NANOG, REX1, SSEA4, TRA1-60, and TRA1-81. While our equiPSCs are LIF dependent, bFGF co-stimulates their proliferation via the PI3K/AKT pathway. EquiPSCs lack expression of eqXIST and immunostaining for H3K27me3, suggesting that during reprogramming the inactive X chromosome has likely been reactivated to generate cells that have two active X chromosomes. EquiPSCs form embryoid bodies and in vitro teratomas that contain derivatives of all three germ layers. These LIF-dependent equiPSCs likely reflect a more naive state of pluripotency than equiPSCs that are co-dependent on both LIF and bFGF and so provide a novel resource for understanding pluripotency in the horse. PMID:24555755

  16. Germline and Pluripotent Stem Cells.

    PubMed

    Reik, Wolf; Surani, M Azim

    2015-11-02

    Epigenetic mechanisms play an essential role in the germline and imprinting cycle. Germ cells show extensive epigenetic programming in preparation for the generation of the totipotent state, which in turn leads to the establishment of pluripotent cells in blastocysts. The latter are the cells from which pluripotent embryonic stem cells are derived and maintained in culture. Following blastocyst implantation, postimplantation epiblast cells develop, which give rise to all somatic cells as well as primordial germ cells, the precursors of sperm and eggs. Pluripotent stem cells in culture can be induced to undergo differentiation into somatic cells and germ cells in culture. Understanding the natural cycles of epigenetic reprogramming that occur in the germline will allow the generation of better and more versatile stem cells for both therapeutic and research purposes.

  17. Comparison of gene-specific DNA methylation patterns in equine induced pluripotent stem cell lines with cells derived from equine adult and fetal tissues.

    PubMed

    Hackett, Catherine H; Greve, Line; Novakofski, Kira D; Fortier, Lisa A

    2012-07-01

    Cellular pluripotency is associated with expression of the homeobox transcription factor genes NANOG, SOX2, and POU5F1 (OCT3/4 protein). Some reports suggest that mesenchymal progenitor cells (MPCs) may express increased quantities of these genes, creating the possibility that MPCs are more "pluripotent" than other adult cell types. The objective of this study was to determine whether equine bone marrow-derived MPCs had gene expression or DNA methylation patterns that differed from either early fetal-derived or terminally differentiated adult cells. Specifically, this study compared DNA methylation of the NANOG and SOX2 promoter regions and concurrent gene expression of NANOG, SOX2, and POU5F1 in equine induced pluripotent stem (iPS) cells, fetal fibroblasts, fetal brain cells, adult chondrocytes, and MPCs. Results indicate that NANOG and POU5F1 were not detectable in appreciable quantities in tissues other than the equine iPS cell lines. Equine iPS cells expressed large quantities of all three genes examined. Significantly increased quantities of SOX2 were noted in iPS cells and both fetal-derived cell types compared with adult cells. MPCs and adult chondrocytes expressed equivalent, low quantities of SOX2. Further, NANOG and SOX2 expression inversely correlated with the DNA methylation pattern in the promoter region, such that as gene expression increased, DNA methylation decreased. The equine iPS cell lines examined demonstrated DNA methylation and gene expression patterns that were consistent with pluripotency features described in other species. Results do not support previous reports that NANOG, SOX2, and POU5F1 are poised for increased activity in MPCs compared with other adult cells.

  18. The advantages of hair follicle pluripotent stem cells over embryonic stem cells and induced pluripotent stem cells for regenerative medicine.

    PubMed

    Amoh, Yasuyuki; Katsuoka, Kensei; Hoffman, Robert M

    2010-12-01

    Multipotent adult stem cells have many potential therapeutic applications. Our recent findings suggest that hair follicles are a promising source of easily accessible multipotent stem cells. Stem cells in the hair follicle area express the neural stem cell marker nestin, suggesting that hair-follicle stem cells and neural stem cells have common features. Nestin-expressing hair follicle stem cells can form neurons and other cell types, and thus adult hair follicle stem cells could have important therapeutic applications, particularly for neurologic diseases. Transplanted hair follicle stem cells promote the functional recovery of injured peripheral nerve and spinal cord. Recent findings suggest that direct transplantation of hair-follicle stem cells without culture can promote nerve repair, which makes them potentially clinically practical. Human hair follicle stem cells as well as mouse hair follicle stem cells promote nerve repair and can be applied to test the hypothesis that human hair follicle stem cells can provide a readily available source of neurologically therapeutic stem cells. The use of hair follicle stem cells for nerve regeneration overcomes critical problems of embryonic stem cells or induced pluripotent stem cells in that the hair follicle stem cells are multipotent, readily accessible, non-oncogenic, and are not associated with ethical issues.

  19. Induced pluripotent stem cells for regenerative medicine.

    PubMed

    Hirschi, Karen K; Li, Song; Roy, Krishnendu

    2014-07-11

    With the discovery of induced pluripotent stem (iPS) cells, it is now possible to convert differentiated somatic cells into multipotent stem cells that have the capacity to generate all cell types of adult tissues. Thus, there is a wide variety of applications for this technology, including regenerative medicine, in vitro disease modeling, and drug screening/discovery. Although biological and biochemical techniques have been well established for cell reprogramming, bioengineering technologies offer novel tools for the reprogramming, expansion, isolation, and differentiation of iPS cells. In this article, we review these bioengineering approaches for the derivation and manipulation of iPS cells and focus on their relevance to regenerative medicine.

  20. Clinical potentials of human pluripotent stem cells.

    PubMed

    Mora, Cristina; Serzanti, Marialaura; Consiglio, Antonella; Memo, Maurizio; Dell'Era, Patrizia

    2017-02-08

    Aging, injuries, and diseases can be considered as the result of malfunctioning or damaged cells. Regenerative medicine aims to restore tissue homeostasis by repairing or replacing cells, tissues, or damaged organs, by linking and combining different disciplines including engineering, technology, biology, and medicine. To pursue these goals, the discipline is taking advantage of pluripotent stem cells (PSCs), a peculiar type of cell possessing the ability to differentiate into every cell type of the body. Human PSCs can be isolated from the blastocysts and maintained in culture indefinitely, giving rise to the so-called embryonic stem cells (ESCs). However, since 2006, it is possible to restore in an adult cell a pluripotent ESC-like condition by forcing the expression of four transcription factors with the rejuvenating reprogramming technology invented by Yamanaka. Then the two types of PSC can be differentiated, using standardized protocols, towards the cell type necessary for the regeneration. Although the use of these derivatives for therapeutic transplantation is still in the preliminary phase of safety and efficacy studies, a lot of efforts are presently taking place to discover the biological mechanisms underlying genetic pathologies, by differentiating induced PSCs derived from patients, and new therapies by challenging PSC-derived cells in drug screening.

  1. Muse Cells: Nontumorigenic Pluripotent Stem Cells Present in Adult Tissues—A Paradigm Shift in Tissue Regeneration and Evolution

    PubMed Central

    2016-01-01

    Muse cells are a novel population of nontumorigenic pluripotent stem cells, highly resistant to cellular stress. These cells are present in every connective tissue and intrinsically express pluripotent stem markers such as Nanog, Oct3/4, Sox2, and TRA1-60. Muse cells are able to differentiate into cells from all three embryonic germ layers both spontaneously and under media-specific induction. Unlike ESCs and iPSCs, Muse cells exhibit low telomerase activity and asymmetric division and do not undergo tumorigenesis or teratoma formation when transplanted into a host organism. Muse cells have a high capacity for homing into damaged tissue and spontaneous differentiation into cells of compatible tissue, leading to tissue repair and functional restoration. The ability of Muse cells to restore tissue function may demonstrate the role of Muse cells in a highly conserved cellular mechanism related to cell survival and regeneration, in response to cellular stress and acute injury. From an evolutionary standpoint, genes pertaining to the regenerative capacity of an organism have been lost in higher mammals from more primitive species. Therefore, Muse cells may offer insight into the molecular and evolutionary bases of autonomous tissue regeneration and elucidate the molecular and cellular mechanisms that prevent mammals from regenerating limbs and organs, as planarians, newts, zebrafish, and salamanders do. PMID:28070194

  2. Programming human pluripotent stem cells into white and brown adipocytes

    PubMed Central

    Ahfeldt, Tim; Schinzel, Robert T.; Lee, Youn-Kyoung; Hendrickson, David; Kaplan, Adam; Lum, David H.; Camahort, Raymond; Xia, Fang; Shay, Jennifer; Rhee, Eugene P.; Clish, Clary B.; Deo, Rahul C.; Shen, Tony; Lau, Frank H.; Cowley, Alicia; Mowrer, Greg; Al-Siddiqi, Heba; Nahrendorf, Matthias; Musunuru, Kiran; Gerszten, Robert E.; Rinn, John L.; Cowan, Chad A.

    2012-01-01

    The utility of human pluripotent stem cells is dependent on efficient differentiation protocols that convert these cells into relevant adult cell types. Here we report the robust and efficient differentiation of human pluripotent stem cells into white or brown adipocytes. We found that inducible expression of PPARG2 alone or combined with CEBPB and/or PRDM16 in mesenchymal progenitor cells derived from pluripotent stem cells programmed their development towards a white or brown adipocyte cell fate with efficiencies of 85%–90%. These adipocytes retained their identity independent of transgene expression, could be maintained in culture for several weeks, expressed mature markers and had mature functional properties such as lipid catabolism and insulin-responsiveness. When transplanted into mice, the programmed cells gave rise to ectopic fat pads with the morphological and functional characteristics of white or brown adipose tissue. These results indicate that the cells could be used to faithfully model human disease. PMID:22246346

  3. PLURIPOTENT STEM CELL APPLICATIONS FOR REGENERATIVE MEDICINE

    PubMed Central

    Angelos, Mathew G.; Kaufman, Dan S.

    2015-01-01

    Purpose of Review In this review, we summarize the current status of clinical trials using therapeutic cells produced from human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs). We also discuss combined cell and gene therapy via correction of defined mutations in human pluripotent stem cells and provide commentary on key obstacles facing wide-scale clinical adoption of pluripotent stem cell-based therapy. Recent Findings Initial data suggest hESC/hiPSC-derived cell products used for retinal repair and spinal cord injury are safe for human use. Early stage studies for treatment of cardiac injury and diabetes are also in progress. However, there remain key concerns regarding the safety and efficacy of these cells that need to be addressed in additional well-designed clinical trials. Advances using the CRISPR/Cas9 gene-editing system offer an improved tool for more rapid and on-target gene correction of genetic diseases. Combined gene and cell therapy using human pluripotent stem cells may provide an additional curative approach for disabling or lethal genetic and degenerative diseases where there are currently limited therapeutic opportunities. Summary Human pluripotent stem cells are emerging as a promising tool to produce cells and tissues suitable for regenerative therapy for a variety of genetic and degenerative diseases. PMID:26536430

  4. Alternative splicing regulates pluripotent state in pluripotent stem cells.

    PubMed

    He, Ling; Bai, Qiang; Tang, Liling

    2015-01-01

    Alternative splicing (AS) generates multiple mature mRNAs from a single pre-mRNA, so AS is the main contributor for the diversity of the proteins, participating in most of the cellular processes. For pluripotent stem cells (PSCs), great effort has been made to search for pluripotency-related genes and their regulatory mechanisms. However, the sophisticated regulation still remains to be clear. Recent studies indicate that stem cells undergo a unique AS pattern and have a different protein expression profile from differentiated cells, giving a new clue that AS switching or AS itself may play a significant role in the processes of differentiation and somatic reprogramming. Indeed, accumulating evidences prove that AS plays critical roles in maintaining pluripotent homeostasis in PSCs. In this review, we summarized recent researches on AS in ESCs and iPSCs, including some distinct AS events in pluripotent cells, and then discussed the new progress on mechanisms for AS in ESCs and iPSCs differentiation and somatic reprogramming.

  5. Pluripotent Stem Cells and Gene Therapy

    PubMed Central

    Simara, Pavel; Motl, Jason A.; Kaufman, Dan S.

    2013-01-01

    Human pluripotent stem cells represent an accessible cell source for novel cell-based clinical research and therapies. With the realization of induced pluripotent stem cells (iPSCs), it is possible to produce almost any desired cell type from any patient's cells. Current developments in gene modification methods have opened the possibility for creating genetically corrected human iPSCs for certain genetic diseases that could be used later in autologous transplantation. Promising preclinical studies have demonstrated correction of disease-causing mutations in a number of hematological, neuronal and muscular disorders. This review aims to summarize these recent advances with a focus on iPSC generation techniques, as well as gene modification methods. We will then further discuss some of the main obstacles remaining to be overcome before successful application of human pluripotent stem cell-based therapy arrives in the clinic and what the future of stem cell research may look like. PMID:23353080

  6. Induced Pluripotent Stem Cells: Characteristics and Perspectives

    NASA Astrophysics Data System (ADS)

    Cantz, Tobias; Martin, Ulrich

    The induction of pluripotency in somatic cells is widely considered as a major breakthrough in regenerative medicine, because this approach provides the basis for individualized stem cell-based therapies. Moreover, with respect to cell transplantation and tissue engineering, expertise from bioengineering to transplantation medicine is now meeting basic research of stem cell biology.

  7. In Vitro T-Cell Generation From Adult, Embryonic, and Induced Pluripotent Stem Cells: Many Roads to One Destination.

    PubMed

    Smith, Michelle J; Webber, Beau R; Mohtashami, Mahmood; Stefanski, Heather E; Zúñiga-Pflücker, Juan Carlos; Blazar, Bruce R

    2015-11-01

    T lymphocytes are critical mediators of the adaptive immune system and have the capacity to serve as therapeutic agents in the areas of transplant and cancer immunotherapy. While T cells can be isolated and expanded from patients, T cells derived in vitro from both hematopoietic stem/progenitor cells (HSPCs) and human pluripotent stem cells (hPSCs) offer great potential advantages in generating a self-renewing source of T cells that can be readily genetically modified. T-cell differentiation in vivo is a complex process requiring tightly regulated signals; providing the correct signals in vitro to induce T-cell lineage commitment followed by their development into mature, functional, single positive T cells, is similarly complex. In this review, we discuss current methods for the in vitro derivation of T cells from murine and human HSPCs and hPSCs that use feeder-cell and feeder-cell-free systems. Furthermore, we explore their potential for adoption for use in T-cell-based therapies.

  8. Pluripotent Stem Cell Derived Cardiomyocytes for Cardiac Repair

    PubMed Central

    Lundy, Scott D.; Gantz, Jay A.; Pagan, Chelsea M.; Filice, Dominic; Laflamme, Michael A.

    2014-01-01

    Opinion Statement The adult mammalian heart has limited capacity for generation, so a major injury such as a myocardial infarction results in the permanent loss of up to one billion cardiomyocytes. The field of cardiac cell therapy aims to replace these lost contractile units with de novo cardiomyocytes to restore lost systolic function and prevent progression to heart failure. Arguably the ideal cell for this application is the human cardiomyocyte itself, which can electromechanically couple with host myocardium and contribute active systolic force. Pluripotent stem cells from both human embryonic or induced pluripotent lineages are attractive sources for cardiomyocytes, and preclinical investigation of these cells is in progress. Recent work has focused on efficient generation and purification of cardiomyocytes, tissue engineering efforts, and examining the consequences of cell transplantation from mechanical, vascular, and electrical standpoints. Here we discuss historical and contemporary aspects of pluripotent stem cell-based cardiac cell therapy, with an emphasis on recent preclinical studies with translational goals. PMID:24838687

  9. Pluripotent Stem Cells for Gene Therapy of Degenerative Muscle Diseases.

    PubMed

    Loperfido, Mariana; Steele-Stallard, Heather B; Tedesco, Francesco Saverio; VandenDriessche, Thierry

    2015-01-01

    Human pluripotent stem cells represent a unique source for cell-based therapies and regenerative medicine. The intrinsic features of these cells such as their easy accessibility and their capacity to be expanded indefinitely overcome some limitations of conventional adult stem cells. Furthermore, the possibility to derive patient-specific induced pluripotent stem (iPS) cells in combination with the current development of gene modification methods could be used for autologous cell therapies of some genetic diseases. In particular, muscular dystrophies are considered to be a good candidate due to the lack of efficacious therapeutic treatments for patients to date, and in view of the encouraging results arising from recent preclinical studies. Some hurdles, including possible genetic instability and their efficient differentiation into muscle progenitors through vector/transgene-free methods have still to be overcome or need further optimization. Additionally, engraftment and functional contribution to muscle regeneration in pre-clinical models need to be carefully assessed before clinical translation. This review offers a summary of the advanced methods recently developed to derive muscle progenitors from pluripotent stem cells, as well as gene therapy by gene addition and gene editing methods using ZFNs, TALENs or CRISPR/Cas9. We have also discussed the main issues that need to be addressed for successful clinical translation of genetically corrected patient-specific pluripotent stem cells in autologous transplantation trials for skeletal muscle disorders.

  10. [Generation and application of pluripotent stem cells from spermatogonial stem cells].

    PubMed

    Zhang, Yan; Wu, Yingji

    2011-02-01

    Recent studies have confirmed that diverse adult tissue cells can be reprogrammed and induced to pluripotency, that is so-called induced pluripotent stem cells (iPS cells). But most of these dedifferentiated processes are induced by gene delivery with retroviral vectors. Some of the delivered genes are cancer causing. So, in current situation, these adult-derived embryonic stem-like cells cannot be used in clinical therapy to cure human diseases. Recently some articles that were published in the authoritative journals are receiving attentions. They show that, in mice and human, spermatogonial stem cells (SSCs) can be used for generating pluripotent stem cells without the exogenous genes and retroviruses, and they can also be used for autologous transplantation without ethical problems. These findings suggest that human SSCs may have considerable potential for cell-based, autologous organ regeneration therapy for various diseases. In this review, we describe and compare the methods that have been used to isolate, purificate and culture SSCs. We also describe the recent results in which SSCs can be transformed into pluripotent stem cells, and the pluripotent stem cells have potential applications in regenerative medicine and genetic medicine.

  11. Induced pluripotent stem cells and neurodegenerative diseases.

    PubMed

    Chen, Chao; Xiao, Shi-Fu

    2011-04-01

    Neurodegenerative diseases, including Parkinson's disease, Alzheimer's disease and Amyotrophic Lateral Sclerosis, are characterized by idiopathic neuron loss in different regions of the central nervous system, which contributes to the relevant dysfunctions in the patients. The application of cell replacement therapy using human embryonic stem (hES) cells, though having attracted much attention, has been hampered by the intrinsic ethical problems. It has been demonstrated that adult somatic cells can be reprogrammed into the embryonic state, called induced pluripotent stem (iPS) cells. It is soon realized that iPS cells may be an alternative source for cell replacement therapy, because it raises no ethical problems and using patient-specific iPS cells for autologous transplantation will not lead to immunological rejection. What's more, certain types of neurons derived from patient-specific iPS cells may display disease-relevant phenotypes. Thus, patient-specific iPS cells can provide a unique opportunity to directly investigate the pathological properties of relevant neural cells in individual patient, and to study the vulnerability of neural cells to pathogenic factors in vitro, which may help reveal the pathogenesis of many neurodegenerative diseases. In this review, the recent development in cellular treatment of neurodegenerative diseases using iPS cells was summarized, and the potential value of iPS cells in the modeling of neurodegenerative disease was discussed.

  12. SILAC proteomics of planarians identifies Ncoa5 as a conserved component of pluripotent stem cells.

    PubMed

    Böser, Alexander; Drexler, Hannes C A; Reuter, Hanna; Schmitz, Henning; Wu, Guangming; Schöler, Hans R; Gentile, Luca; Bartscherer, Kerstin

    2013-11-27

    Planarian regeneration depends on the presence of pluripotent stem cells in the adult. We developed an in vivo stable isotope labeling by amino acids in cell culture (SILAC) protocol in planarians to identify proteins that are enriched in planarian stem cells. Through a comparison of SILAC proteomes of normal and stem cell-depleted planarians and of a stem cell-enriched population of sorted cells, we identified hundreds of stem cell proteins. One of these is an ortholog of nuclear receptor coactivator-5 (Ncoa5/CIA), which is known to regulate estrogen-receptor-mediated transcription in human cells. We show that Ncoa5 is essential for the maintenance of the pluripotent stem cell population in planarians and that a putative mouse ortholog is expressed in pluripotent cells of the embryo. Our study thus identifies a conserved component of pluripotent stem cells, demonstrating that planarians, in particular, when combined with in vivo SILAC, are a powerful model in stem cell research.

  13. Current protocols in the generation of pluripotent stem cells: theoretical, methodological and clinical considerations

    PubMed Central

    Swelstad, Brad B; Kerr, Candace L

    2010-01-01

    Pluripotent stem cells have been derived from various embryonic, fetal and adult sources. Embryonic stem cells (ESCs) and parthenogenic ESCs (pESCs) are derived from the embryo proper while embryonic germ cells (EGCs), embryonal carcinoma cells (ECCs), and germ-line stem cells (GSC) are produced from germ cells. ECCs were the first pluripotent stem cell lines established from adult testicular tumors while EGCs are generated in vitro from primordial germ cells (PGCs) isolated in late embryonic development. More recently, studies have also demonstrated the ability to produce GSCs from adult germ cells, known as spermatogonial stem cells. Unlike ECCs, the source of GSCs are normal, non-cancerous adult tissue. The study of these unique cell lines has provided information that has led to the ability to reprogram somatic cells into an ESC-like state. These cells, called induced pluripotent stem cells (iPSCs), have been derived from a number of human fetal and adult origins. With the promises pluripotent stem cells bring to cell-based therapies there remain several considerations that need to be carefully studied prior to their clinical use. Many of these issues involve understanding key factors regulating their generation, including those which define pluripotency. In this regard, the following article discusses critical aspects of pluripotent stem cell derivation and current issues about their therapeutic potential. PMID:24198508

  14. An introduction to induced pluripotent stem cells.

    PubMed

    Hanley, Joanna; Rastegarlari, Ghasem; Nathwani, Amit C

    2010-10-01

    Recent landmark studies show that it is now possible to convert somatic cells, such as skin fibroblasts and B lymphocytes, into pluripotent stem cells that closely resemble embryonic stem cells. These induced pluripotent stem (iPS) cells can be generated without using human embryos or oocytes, thus bypassing some of the ethical issues that have limited the use of human embryonic stems (hES) cells. Additionally, they can be derived from the patient to be treated, thereby overcoming problems of immunological rejection associated with the use of allogeneic hES cell derived progenitors. Whilst these patient-specific iPS cells have great clinical potential, their immediate utility is likely to be in drug screening and for understanding the disease process. This review discusses the promise of iPS cells as well as the challenges to their use in the clinic.

  15. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach.

    PubMed

    Chou, Bin-Kuan; Gu, Haihui; Gao, Yongxing; Dowey, Sarah N; Wang, Ying; Shi, Jun; Li, Yanxin; Ye, Zhaohui; Cheng, Tao; Cheng, Linzhao

    2015-04-01

    Reprogramming human adult blood mononuclear cells (MNCs) cells by transient plasmid expression is becoming increasingly popular as an attractive method for generating induced pluripotent stem (iPS) cells without the genomic alteration caused by genome-inserting vectors. However, its efficiency is relatively low with adult MNCs compared with cord blood MNCs and other fetal cells and is highly variable among different adult individuals. We report highly efficient iPS cell derivation under clinically compliant conditions via three major improvements. First, we revised a combination of three EBNA1/OriP episomal vectors expressing five transgenes, which increased reprogramming efficiency by ≥10-50-fold from our previous vectors. Second, human recombinant vitronectin proteins were used as cell culture substrates, alleviating the need for feeder cells or animal-sourced proteins. Finally, we eliminated the previously critical step of manually picking individual iPS cell clones by pooling newly emerged iPS cell colonies. Pooled cultures were then purified based on the presence of the TRA-1-60 pluripotency surface antigen, resulting in the ability to rapidly expand iPS cells for subsequent applications. These new improvements permit a consistent and reliable method to generate human iPS cells with minimal clonal variations from blood MNCs, including previously difficult samples such as those from patients with paroxysmal nocturnal hemoglobinuria. In addition, this method of efficiently generating iPS cells under feeder-free and xeno-free conditions allows for the establishment of clinically compliant iPS cell lines for future therapeutic applications.

  16. A Facile Method to Establish Human Induced Pluripotent Stem Cells From Adult Blood Cells Under Feeder-Free and Xeno-Free Culture Conditions: A Clinically Compliant Approach

    PubMed Central

    Chou, Bin-Kuan; Gu, Haihui; Gao, Yongxing; Dowey, Sarah N.; Wang, Ying; Shi, Jun; Li, Yanxin; Ye, Zhaohui; Cheng, Tao

    2015-01-01

    Reprogramming human adult blood mononuclear cells (MNCs) cells by transient plasmid expression is becoming increasingly popular as an attractive method for generating induced pluripotent stem (iPS) cells without the genomic alteration caused by genome-inserting vectors. However, its efficiency is relatively low with adult MNCs compared with cord blood MNCs and other fetal cells and is highly variable among different adult individuals. We report highly efficient iPS cell derivation under clinically compliant conditions via three major improvements. First, we revised a combination of three EBNA1/OriP episomal vectors expressing five transgenes, which increased reprogramming efficiency by ≥10–50-fold from our previous vectors. Second, human recombinant vitronectin proteins were used as cell culture substrates, alleviating the need for feeder cells or animal-sourced proteins. Finally, we eliminated the previously critical step of manually picking individual iPS cell clones by pooling newly emerged iPS cell colonies. Pooled cultures were then purified based on the presence of the TRA-1-60 pluripotency surface antigen, resulting in the ability to rapidly expand iPS cells for subsequent applications. These new improvements permit a consistent and reliable method to generate human iPS cells with minimal clonal variations from blood MNCs, including previously difficult samples such as those from patients with paroxysmal nocturnal hemoglobinuria. In addition, this method of efficiently generating iPS cells under feeder-free and xeno-free conditions allows for the establishment of clinically compliant iPS cell lines for future therapeutic applications. PMID:25742692

  17. In vitro regeneration of kidney from pluripotent stem cells

    SciTech Connect

    Osafune, Kenji

    2010-10-01

    Although renal transplantation has proved a successful treatment for the patients with end-stage renal failure, the therapy is hampered by the problem of serious shortage of donor organs. Regenerative medicine using stem cells, including cell transplantation therapy, needs to be developed to solve the problem. We previously identified the multipotent progenitor cells in the embryonic mouse kidney that can give rise to several kinds of epithelial cells found in adult kidney, such as glomerular podocytes and renal tubular epithelia. Establishing the method to generate the progenitors from human pluripotent stem cells that have the capacity to indefinitely proliferate in vitro is required for the development of kidney regeneration strategy. We review the current status of the research on the differentiation of pluripotent stem cells into renal lineages and describe cues to promote this research field.

  18. Human induced pluripotent stem cell‐derived versus adult cardiomyocytes: an in silico electrophysiological study on effects of ionic current block

    PubMed Central

    Paci, M; Hyttinen, J; Rodriguez, B

    2015-01-01

    Background and Purpose Two new technologies are likely to revolutionize cardiac safety and drug development: in vitro experiments on human‐induced pluripotent stem cell‐derived cardiomyocytes (hiPSC‐CMs) and in silico human adult ventricular cardiomyocyte (hAdultV‐CM) models. Their combination was recently proposed as a potential replacement for the present hERG‐based QT study for pharmacological safety assessments. Here, we systematically compared in silico the effects of selective ionic current block on hiPSC‐CM and hAdultV‐CM action potentials (APs), to identify similarities/differences and to illustrate the potential of computational models as supportive tools for evaluating new in vitro technologies. Experimental Approach In silico AP models of ventricular‐like and atrial‐like hiPSC‐CMs and hAdultV‐CM were used to simulate the main effects of four degrees of block of the main cardiac transmembrane currents. Key Results Qualitatively, hiPSC‐CM and hAdultV‐CM APs showed similar responses to current block, consistent with results from experiments. However, quantitatively, hiPSC‐CMs were more sensitive to block of (i) L‐type Ca2+ currents due to the overexpression of the Na+/Ca2+ exchanger (leading to shorter APs) and (ii) the inward rectifier K+ current due to reduced repolarization reserve (inducing diastolic potential depolarization and repolarization failure). Conclusions and Implications In silico hiPSC‐CMs and hAdultV‐CMs exhibit a similar response to selective current blocks. However, overall hiPSC‐CMs show greater sensitivity to block, which may facilitate in vitro identification of drug‐induced effects. Extrapolation of drug effects from hiPSC‐CM to hAdultV‐CM and pro‐arrhythmic risk assessment can be facilitated by in silico predictions using biophysically‐based computational models. PMID:26276951

  19. Pluripotent Stem Cells: Current Understanding and Future Directions

    PubMed Central

    Romito, Antonio

    2016-01-01

    Pluripotent stem cells have the ability to undergo self-renewal and to give rise to all cells of the tissues of the body. However, this definition has been recently complicated by the existence of distinct cellular states that display these features. Here, we provide a detailed overview of the family of pluripotent cell lines derived from early mouse and human embryos and compare them with induced pluripotent stem cells. Shared and distinct features of these cells are reported as additional hallmark of pluripotency, offering a comprehensive scenario of pluripotent stem cells. PMID:26798367

  20. Metaboloepigenetic Regulation of Pluripotent Stem Cells

    PubMed Central

    Harvey, Alexandra J.; Gardner, David K.

    2016-01-01

    The differentiation of pluripotent stem cells is associated with extensive changes in metabolism, as well as widespread remodeling of the epigenetic landscape. Epigenetic regulation is essential for the modulation of differentiation, being responsible for cell type specific gene expression patterns through the modification of DNA and histones, thereby establishing cell identity. Each cell type has its own idiosyncratic pattern regarding the use of specific metabolic pathways. Rather than simply being perceived as a means of generating ATP and building blocks for cell growth and division, cellular metabolism can directly influence cellular regulation and the epigenome. Consequently, the significance of nutrients and metabolites as regulators of differentiation is central to understanding how cells interact with their immediate environment. This review serves to integrate studies on pluripotent stem cell metabolism, and the regulation of DNA methylation and acetylation and identifies areas in which current knowledge is limited. PMID:26839556

  1. Pluripotency of human embryonic and induced pluripotent stem cells for cardiac and vascular regeneration.

    PubMed

    Boheler, Kenneth R

    2010-07-01

    Cardiac and vascular abnormalities and disease syndromes are major causes of death both during human development and with aging. To identify the cause of congenital defects and to combat this epidemic in the aging population, new models must be created for scientific investigation and new therapies must be developed. Recent advances in pluripotent stem cell biology offer renewed hope for tackling these problems. Of particular importance has been the creation of induced pluripotent (iPS) cells from adult tissues and organs through the forced expression of two to four transcription factors. Moreover, iPS cells, which are phenotypically indistinguishable from embryonic stem (ES) cells, can be generated from any patient. This unique capacity when coupled with samples from patients who have congenital and genetic defects of unknown aetiology should permit the creation of new model systems that foment scientific investigation. Moreover, creation of patient-specific cells should overcome many of the immunological limitations that currently impede therapeutic applications associated with other pluripotent stem cells and their derivatives.The aims of this paper will be to discuss cardiac and vascular diseases and show how iPS cells may be employed to overcome some of the most significant scientific and clinical hurdles facing this field.

  2. Modeling Aggressive Medulloblastoma Using Human-Induced Pluripotent Stem Cells

    DTIC Science & Technology

    2015-07-01

    AWARD NUMBER: W81XWH-14-1-0176 TITLE: Modeling Aggressive Medulloblastoma Using Human-Induced Pluripotent Stem Cells PRINCIPAL INVESTIGATOR...Prescribed by ANSI Std. Z39.18 July 2015 Annual 01-July 2014 -- 30 Jun 2015 Modeling Aggressive Medulloblastoma Using Human-Induced Pluripotent Stem...induced pluripotent stem cells by Atoh1 induction can be efficiently transformed by MYC oncogene to form aggressive brain tumors that recapitulate human

  3. Induced Pluripotent Stem Cells Meet Genome Editing.

    PubMed

    Hockemeyer, Dirk; Jaenisch, Rudolf

    2016-05-05

    It is extremely rare for a single experiment to be so impactful and timely that it shapes and forecasts the experiments of the next decade. Here, we review how two such experiments-the generation of human induced pluripotent stem cells (iPSCs) and the development of CRISPR/Cas9 technology-have fundamentally reshaped our approach to biomedical research, stem cell biology, and human genetics. We will also highlight the previous knowledge that iPSC and CRISPR/Cas9 technologies were built on as this groundwork demonstrated the need for solutions and the benefits that these technologies provided and set the stage for their success.

  4. Concise Review: Cardiac Disease Modeling Using Induced Pluripotent Stem Cells.

    PubMed

    Yang, Chunbo; Al-Aama, Jumana; Stojkovic, Miodrag; Keavney, Bernard; Trafford, Andrew; Lako, Majlinda; Armstrong, Lyle

    2015-09-01

    Genetic cardiac diseases are major causes of morbidity and mortality. Although animal models have been created to provide some useful insights into the pathogenesis of genetic cardiac diseases, the significant species differences and the lack of genetic information for complex genetic diseases markedly attenuate the application values of such data. Generation of induced pluripotent stem cells (iPSCs) from patient-specific specimens and subsequent derivation of cardiomyocytes offer novel avenues to study the mechanisms underlying cardiac diseases, to identify new causative genes, and to provide insights into the disease aetiology. In recent years, the list of human iPSC-based models for genetic cardiac diseases has been expanding rapidly, although there are still remaining concerns on the level of functionality of iPSC-derived cardiomyocytes and their ability to be used for modeling complex cardiac diseases in adults. This review focuses on the development of cardiomyocyte induction from pluripotent stem cells, the recent progress in heart disease modeling using iPSC-derived cardiomyocytes, and the challenges associated with understanding complex genetic diseases. To address these issues, we examine the similarity between iPSC-derived cardiomyocytes and their ex vivo counterparts and how this relates to the method used to differentiate the pluripotent stem cells into a cardiomyocyte phenotype. We progress to examine categories of congenital cardiac abnormalities that are suitable for iPSC-based disease modeling.

  5. Deconstructing transcriptional heterogeneity in pluripotent stem cells.

    PubMed

    Kumar, Roshan M; Cahan, Patrick; Shalek, Alex K; Satija, Rahul; DaleyKeyser, A Jay; Li, Hu; Zhang, Jin; Pardee, Keith; Gennert, David; Trombetta, John J; Ferrante, Thomas C; Regev, Aviv; Daley, George Q; Collins, James J

    2014-12-04

    Pluripotent stem cells (PSCs) are capable of dynamic interconversion between distinct substates; however, the regulatory circuits specifying these states and enabling transitions between them are not well understood. Here we set out to characterize transcriptional heterogeneity in mouse PSCs by single-cell expression profiling under different chemical and genetic perturbations. Signalling factors and developmental regulators show highly variable expression, with expression states for some variable genes heritable through multiple cell divisions. Expression variability and population heterogeneity can be influenced by perturbation of signalling pathways and chromatin regulators. Notably, either removal of mature microRNAs or pharmacological blockage of signalling pathways drives PSCs into a low-noise ground state characterized by a reconfigured pluripotency network, enhanced self-renewal and a distinct chromatin state, an effect mediated by opposing microRNA families acting on the Myc/Lin28/let-7 axis. These data provide insight into the nature of transcriptional heterogeneity in PSCs.

  6. Deconstructing transcriptional heterogeneity in pluripotent stem cells

    PubMed Central

    Shalek, Alex K.; Satija, Rahul; DaleyKeyser, AJay; Li, Hu; Zhang, Jin; Pardee, Keith; Gennert, David; Trombetta, John J.; Ferrante, Thomas C.; Regev, Aviv; Daley, George Q.; Collins, James J.

    2014-01-01

    SUMMARY Pluripotent stem cells (PSCs) are capable of dynamic interconversion between distinct substates, but the regulatory circuits specifying these states and enabling transitions between them are not well understood. We set out to characterize transcriptional heterogeneity in PSCs by single-cell expression profiling under different chemical and genetic perturbations. Signaling factors and developmental regulators show highly variable expression, with expression states for some variable genes heritable through multiple cell divisions. Expression variability and population heterogeneity can be influenced by perturbation of signaling pathways and chromatin regulators. Strikingly, either removal of mature miRNAs or pharmacologic blockage of signaling pathways drives PSCs into a low-noise ground state characterized by a reconfigured pluripotency network, enhanced self-renewal, and a distinct chromatin state, an effect mediated by opposing miRNA families acting on the c-myc / Lin28 / let-7 axis. These data illuminate the nature of transcriptional heterogeneity in PSCs. PMID:25471879

  7. Differentiated Parkinson patient-derived induced pluripotent stem cells grow in the adult rodent brain and reduce motor asymmetry in Parkinsonian rats.

    PubMed

    Hargus, Gunnar; Cooper, Oliver; Deleidi, Michela; Levy, Adam; Lee, Kristen; Marlow, Elizabeth; Yow, Alyssa; Soldner, Frank; Hockemeyer, Dirk; Hallett, Penelope J; Osborn, Teresia; Jaenisch, Rudolf; Isacson, Ole

    2010-09-07

    Recent advances in deriving induced pluripotent stem (iPS) cells from patients offer new possibilities for biomedical research and clinical applications, as these cells could be used for autologous transplantation. We differentiated iPS cells from patients with Parkinson's disease (PD) into dopaminergic (DA) neurons and show that these DA neurons can be transplanted without signs of neurodegeneration into the adult rodent striatum. The PD patient iPS (PDiPS) cell-derived DA neurons survived at high numbers, showed arborization, and mediated functional effects in an animal model of PD as determined by reduction of amphetamine- and apomorphine-induced rotational asymmetry, but only a few DA neurons projected into the host striatum at 16 wk after transplantation. We next applied FACS for the neural cell adhesion molecule NCAM on differentiated PDiPS cells before transplantation, which resulted in surviving DA neurons with functional effects on amphetamine-induced rotational asymmetry in a 6-OHDA animal model of PD. Morphologically, we found that PDiPS cell-derived non-DA neurons send axons along white matter tracts into specific close and remote gray matter target areas in the adult brain. Such findings establish the transplantation of human PDiPS cell-derived neurons as a long-term in vivo method to analyze potential disease-related changes in a physiological context. Our data also demonstrate proof of principle of survival and functional effects of PDiPS cell-derived DA neurons in an animal model of PD and encourage further development of differentiation protocols to enhance growth and function of implanted PDiPS cell-derived DA neurons in regard to potential therapeutic applications.

  8. Induced pluripotent stem cells in dentistry

    PubMed Central

    Sunil, Paramel Mohan

    2016-01-01

    Induced pluripotent stem cells (iPSCs), a path-breaking invention, have revolutionized the regenerative medicine field. The biggest advantage of this technology is its patient-specific nature and so it is nonimmunogenic. It involves autologous tissues with limitless source of cells throughout life. The Nobel-winning concept involves the reprograming of terminally differentiated cells by external factors and has a tremendous role in the treatment of genetic disorders, regeneration of tissues, drug discovery, and disease modeling. This short review aims at the probable applications of iPSC technology in dentistry with respect to regeneration of oral and maxillofacial tissues and also its role in oral malignancies. PMID:27829740

  9. Induced pluripotent stem cells: the new patient?

    PubMed

    Bellin, Milena; Marchetto, Maria C; Gage, Fred H; Mummery, Christine L

    2012-11-01

    Worldwide increases in life expectancy have been paralleled by a greater prevalence of chronic and age-associated disorders, particularly of the cardiovascular, neural and metabolic systems. This has not been met by commensurate development of new drugs and therapies, which is in part owing to the difficulty in modelling human diseases in laboratory assays or experimental animals. Patient-specific induced pluripotent stem (iPS) cells are an emerging paradigm that may address this. Reprogrammed somatic cells from patients are already applied in disease modelling, drug testing and drug discovery, thus enabling researchers to undertake studies for treating diseases 'in a dish', which was previously inconceivable.

  10. Induced pluripotent stem cells in cartilage repair

    PubMed Central

    Lietman, Steven A

    2016-01-01

    Articular cartilage repair techniques are challenging. Human embryonic stem cells and induced pluripotent stem cells (iPSCs) theoretically provide an unlimited number of specialized cells which could be used in articular cartilage repair. However thus far chondrocytes from iPSCs have been created primarily by viral transfection and with the use of cocultured feeder cells. In addition chondrocytes derived from iPSCs have usually been formed in condensed cell bodies (resembling embryoid bodies) that then require dissolution with consequent substantial loss of cell viability and phenotype. All of these current techniques used to derive chondrocytes from iPSCs are problematic but solutions to these problems are on the horizon. These solutions will make iPSCs a viable alternative for articular cartilage repair in the near future. PMID:27004161

  11. APPLYING SHEAR STRESS TO PLURIPOTENT STEM CELLS

    PubMed Central

    Wolfe, Russell P.; Guidry, Julia B.; Messina, Stephanie L.; Ahsan, Tabassum

    2016-01-01

    Summary Thorough understanding of the effects of shear stress on stem cells is critical for the rationale design of large-scale production of cell-based therapies. This is of growing importance as emerging tissue engineering and regenerative medicine applications drive the need for clinically-relevant numbers of both pluripotent stem cells (PSCs) and cells derived from PSCs. Here we describe the use of a custom parallel plate bioreactor system to impose fluid shear stress on a layer of PSCs adhered to protein-coated glass slides. This system can be useful both for basic science studies in mechanotransduction and as a surrogate model for bioreactors used in large-scale production. PMID:25762292

  12. Disease-specific induced pluripotent stem cells.

    PubMed

    Park, In-Hyun; Arora, Natasha; Huo, Hongguang; Maherali, Nimet; Ahfeldt, Tim; Shimamura, Akiko; Lensch, M William; Cowan, Chad; Hochedlinger, Konrad; Daley, George Q

    2008-09-05

    Tissue culture of immortal cell strains from diseased patients is an invaluable resource for medical research but is largely limited to tumor cell lines or transformed derivatives of native tissues. Here we describe the generation of induced pluripotent stem (iPS) cells from patients with a variety of genetic diseases with either Mendelian or complex inheritance; these diseases include adenosine deaminase deficiency-related severe combined immunodeficiency (ADA-SCID), Shwachman-Bodian-Diamond syndrome (SBDS), Gaucher disease (GD) type III, Duchenne (DMD) and Becker muscular dystrophy (BMD), Parkinson disease (PD), Huntington disease (HD), juvenile-onset, type 1 diabetes mellitus (JDM), Down syndrome (DS)/trisomy 21, and the carrier state of Lesch-Nyhan syndrome. Such disease-specific stem cells offer an unprecedented opportunity to recapitulate both normal and pathologic human tissue formation in vitro, thereby enabling disease investigation and drug development.

  13. A Comparative Transcriptomic Analysis Reveals Conserved Features of Stem Cell Pluripotency in Planarians and Mammals

    PubMed Central

    Labbé, Roselyne M.; Irimia, Manuel; Currie, Ko W.; Lin, Alexander; Zhu, Shu Jun; Brown, David D.R.; Ross, Eric J.; Voisin, Veronique; Bader, Gary D.; Blencowe, Benjamin J.; Pearson, Bret J.

    2014-01-01

    Many long-lived species of animals require the function of adult stem cells throughout their lives. However, the transcriptomes of stem cells in invertebrates and vertebrates have not been compared, and consequently, ancestral regulatory circuits that control stem cell populations remain poorly defined. In this study, we have used data from high-throughput RNA sequencing to compare the transcriptomes of pluripotent adult stem cells from planarians with the transcriptomes of human and mouse pluripotent embryonic stem cells. From a stringently defined set of 4,432 orthologs shared between planarians, mice and humans, we identified 123 conserved genes that are ≥5-fold differentially expressed in stem cells from all three species. Guided by this gene set, we used RNAi screening in adult planarians to discover novel stem cell regulators, which we found to affect the stem cell-associated functions of tissue homeostasis, regeneration, and stem cell maintenance. Examples of genes that disrupted these processes included the orthologs of TBL3, PSD12, TTC27, and RACK1. From these analyses, we concluded that by comparing stem cell transcriptomes from diverse species, it is possible to uncover conserved factors that function in stem cell biology. These results provide insights into which genes comprised the ancestral circuitry underlying the control of stem cell self-renewal and pluripotency. PMID:22696458

  14. A comparative transcriptomic analysis reveals conserved features of stem cell pluripotency in planarians and mammals.

    PubMed

    Labbé, Roselyne M; Irimia, Manuel; Currie, Ko W; Lin, Alexander; Zhu, Shu Jun; Brown, David D R; Ross, Eric J; Voisin, Veronique; Bader, Gary D; Blencowe, Benjamin J; Pearson, Bret J

    2012-08-01

    Many long-lived species of animals require the function of adult stem cells throughout their lives. However, the transcriptomes of stem cells in invertebrates and vertebrates have not been compared, and consequently, ancestral regulatory circuits that control stem cell populations remain poorly defined. In this study, we have used data from high-throughput RNA sequencing to compare the transcriptomes of pluripotent adult stem cells from planarians with the transcriptomes of human and mouse pluripotent embryonic stem cells. From a stringently defined set of 4,432 orthologs shared between planarians, mice and humans, we identified 123 conserved genes that are ≥5-fold differentially expressed in stem cells from all three species. Guided by this gene set, we used RNAi screening in adult planarians to discover novel stem cell regulators, which we found to affect the stem cell-associated functions of tissue homeostasis, regeneration, and stem cell maintenance. Examples of genes that disrupted these processes included the orthologs of TBL3, PSD12, TTC27, and RACK1. From these analyses, we concluded that by comparing stem cell transcriptomes from diverse species, it is possible to uncover conserved factors that function in stem cell biology. These results provide insights into which genes comprised the ancestral circuitry underlying the control of stem cell self-renewal and pluripotency.

  15. Isolation and Characterization of Pluripotent Human Spermatogonial Stem Cell-Derived Cells

    PubMed Central

    Kossack, Nina; Meneses, Juanito; Shefi, Shai; Nguyen, Ha Nam; Chavez, Shawn; Nicholas, Cory; Gromoll, Joerg; Turek, Paul J; Reijo-Pera, Renee A

    2009-01-01

    Several reports have documented the derivation of pluripotent cells (multipotent germline stem cells) from spermatogonial stem cells obtained from the adult mouse testis. These spermatogonia-derived stem cells express embryonic stem cell markers and differentiate to the three primary germ layers, as well as the germline. Data indicate that derivation may involve reprogramming of endogenous spermatogonia in culture. Here, we report the derivation of human multipotent germline stem cells (hMGSCs) from a testis biopsy. The cells express distinct markers of pluripotency, form embryoid bodies that contain derivatives of all three germ layers, maintain a normal XY karyotype, are hypomethylated at the H19 locus, and express high levels of telomerase. Teratoma assays indicate the presence of human cells 8 weeks post-transplantation but limited teratoma formation. Thus, these data suggest the potential to derive pluripotent cells from human testis biopsies but indicate a need for novel strategies to optimize hMGSC culture conditions and reprogramming. PMID:18927477

  16. Directed differentiation of pluripotent stem cells to kidney cells.

    PubMed

    Lam, Albert Q; Freedman, Benjamin S; Bonventre, Joseph V

    2014-07-01

    Regenerative medicine affords a promising therapeutic strategy for the treatment of patients with chronic kidney disease. Nephron progenitor cell populations exist only during embryonic kidney development. Understanding the mechanisms by which these populations arise and differentiate is integral to the challenge of generating new nephrons for therapeutic purposes. Pluripotent stem cells (PSCs), comprising embryonic stem cells, and induced pluripotent stem cells (iPSCs) derived from adults, have the potential to generate functional kidney cells and tissue. Studies in mouse and human PSCs have identified specific approaches to the addition of growth factors, including Wnt and fibroblast growth factor, that can induce PSC differentiation into cells with phenotypic characteristics of nephron progenitor populations with the capacity to form kidney-like structures. Although significant progress has been made, further studies are necessary to confirm the production of functional kidney cells and to promote their three-dimensional organization into bona fide kidney tissue. Human PSCs have been generated from patients with kidney diseases, including polycystic kidney disease, Alport syndrome, and Wilms tumor, and may be used to better understand phenotypic consequences of naturally occurring genetic mutations and to conduct "clinical trials in a dish". The capability to generate human kidney cells from PSCs has significant translational applications, including the bioengineering of functional kidney tissue, use in drug development to test compounds for efficacy and toxicity, and in vitro disease modeling.

  17. Pluripotent stem cell energy metabolism: an update

    PubMed Central

    Teslaa, Tara; Teitell, Michael A

    2015-01-01

    Recent studies link changes in energy metabolism with the fate of pluripotent stem cells (PSCs). Safe use of PSC derivatives in regenerative medicine requires an enhanced understanding and control of factors that optimize in vitro reprogramming and differentiation protocols. Relative shifts in metabolism from naïve through “primed” pluripotent states to lineage-directed differentiation place variable demands on mitochondrial biogenesis and function for cell types with distinct energetic and biosynthetic requirements. In this context, mitochondrial respiration, network dynamics, TCA cycle function, and turnover all have the potential to influence reprogramming and differentiation outcomes. Shifts in cellular metabolism affect enzymes that control epigenetic configuration, which impacts chromatin reorganization and gene expression changes during reprogramming and differentiation. Induced PSCs (iPSCs) may have utility for modeling metabolic diseases caused by mutations in mitochondrial DNA, for which few disease models exist. Here, we explore key features of PSC energy metabolism research in mice and man and the impact this work is starting to have on our understanding of early development, disease modeling, and potential therapeutic applications. PMID:25476451

  18. Generating pluripotent stem cells: differential epigenetic changes during cellular reprogramming.

    PubMed

    Tobin, Stacey C; Kim, Kitai

    2012-08-31

    Pluripotent stem cells hold enomous potential for therapuetic applications in tissue replacement therapy. Reprogramming somatic cells from a patient donor to generate pluripotent stem cells involves both ethical concerns inherent in the use of embryonic and oocyte-derived stem cells, as well as issues of histocompatibility. Among the various pluripotent stem cells, induced pluripotent stem cells (iPSC)--derived by ectopic expression of four reprogramming factors in donor somatic cells--are superior in terms of ethical use, histocompatibility, and derivation method. However, iPSC also show genetic and epigenetic differences that limit their differentiation potential, functionality, safety, and potential clinical utility. Here, we discuss the unique characteristics of iPSC and approaches that are being taken to overcome these limitations.

  19. Generating pluripotent stem cells: Differential epigenetic changes during cellular reprogramming

    PubMed Central

    Tobin, Stacey C.; Kim, Kitai

    2013-01-01

    Pluripotent stem cells hold enomous potential for therapuetic applications in tissue replacement therapy. Reprogramming somatic cells from a patient donor to generate pluripotent stem cells involves both ethical concerns inherent in the use of embryonic and oocyte-derived stem cells, as well as issues of histocompatibility. Among the various pluripotent stem cells, induced pluripotent stem cells (iPSC)—derived by ectopic expression of four reprogramming factors in donor somatic cells—are superior in terms of ethical use, histocompatibility, and derivation method. However, iPSC also show genetic and epigenetic differences that limit their differentiation potential, functionality, safety, and potential clinical utility. Here, we discuss the unique characteristics of iPSC and approaches that are being taken to overcome these limitations. PMID:22819821

  20. Correspondence on: A Hyaluronic Acid-Rich Node and Duct System in Which Pluripotent Adult Stem Cells Circulate.

    PubMed

    Anastassova Kristeva, Marlene

    2016-09-01

    The origin of the wide spread node and duct system described by Rai et al. remains a mystery. The explanation came when another study on yolk sack hemopoiesis was compared with the "primo vascular system". It came out that the yolk sack hematogenic tissue, introduced to the embryo by the vitelline veins, does not disappear in adults, but continues to exist in form of nods and ducts along blood vessels and different organs.

  1. Induced Pluripotent Stem Cells from Nonhuman Primates.

    PubMed

    Mishra, Anuja; Qiu, Zhifang; Farnsworth, Steven L; Hemmi, Jacob J; Li, Miao; Pickering, Alexander V; Hornsby, Peter J

    2016-01-01

    Induced pluripotent stem cells from nonhuman primates (NHPs) have unique roles in cell biology and regenerative medicine. Because of the relatedness of NHPs to humans, NHP iPS cells can serve as a source of differentiated derivatives that can be used to address important questions in the comparative biology of primates. Additionally, when used as a source of cells for regenerative medicine, NHP iPS cells serve an invaluable role in translational experiments in cell therapy. Reprogramming of NHP somatic cells requires the same conditions as previously established for human cells. However, throughout the process, a variety of modifications to the human cell protocols must be made to accommodate significant species differences.

  2. [Dementia study using induced pluripotent stem cells].

    PubMed

    Matsuzono, Kosuke; Abe, Koji; Inoue, Haruhisa

    2016-03-01

    Recent developments in induced pluripotent stem cell (iPSC) technology have facilitated, and have contributed to overcome the difficulty of modeling dementia caused by Alzheimer's disease (AD), dementia with Lewy bodies (DLB), and frontotemporal lobar degeneration (FTLD), etc. The following models using iPSCs were reported: the pathophysiology caused by gene mutations such as presenilin or amyloid β precursor protein in AD, α-synuclein in DLB, and microtubule-associated protein tau, fused in sarcoma, progranulin, or chromosome 9 open reading frame 72 in FTLD, anti-AD drug screening, sortilin-related receptor L 1 haplotype influence in sporadic AD, and amyloid β secretion in Down syndrome. Patient-specific iPSC could be expected to reveal the disease pathology and lead to drug discoveries for dementia patients.

  3. Maintenance and Neuronal Differentiation of Chicken Induced Pluripotent Stem-Like Cells

    PubMed Central

    Rossello, Ricardo; Chen, Chun-chun; Kessler, Joeran; Davison, Ian; Jarvis, Erich D.

    2014-01-01

    Pluripotent stem cells have the potential to become any cell in the adult body, including neurons and glia. Avian stem cells could be used to study questions, like vocal learning, that would be difficult to examine with traditional mouse models. Induced pluripotent stem cells (iPSCs) are differentiated cells that have been reprogrammed to a pluripotent stem cell state, usually using inducing genes or other molecules. We recently succeeded in generating avian iPSC-like cells using mammalian genes, overcoming a limitation in the generation and use of iPSCs in nonmammalian species (Rosselló et al., 2013). However, there were no established optimal cell culture conditions for avian iPSCs to establish long-term cell lines and thus to study neuronal differentiation in vitro. Here we present an efficient method of maintaining chicken iPSC-like cells and for differentiating them into action potential generating neurons. PMID:25610469

  4. Maintenance and neuronal differentiation of chicken induced pluripotent stem-like cells.

    PubMed

    Dai, Rui; Rossello, Ricardo; Chen, Chun-Chun; Kessler, Joeran; Davison, Ian; Hochgeschwender, Ute; Jarvis, Erich D

    2014-01-01

    Pluripotent stem cells have the potential to become any cell in the adult body, including neurons and glia. Avian stem cells could be used to study questions, like vocal learning, that would be difficult to examine with traditional mouse models. Induced pluripotent stem cells (iPSCs) are differentiated cells that have been reprogrammed to a pluripotent stem cell state, usually using inducing genes or other molecules. We recently succeeded in generating avian iPSC-like cells using mammalian genes, overcoming a limitation in the generation and use of iPSCs in nonmammalian species (Rosselló et al., 2013). However, there were no established optimal cell culture conditions for avian iPSCs to establish long-term cell lines and thus to study neuronal differentiation in vitro. Here we present an efficient method of maintaining chicken iPSC-like cells and for differentiating them into action potential generating neurons.

  5. Non-coding RNAs in pluripotency and neural differentiation of human pluripotent stem cells

    PubMed Central

    Lukovic, Dunja; Moreno-Manzano, Victoria; Klabusay, Martin; Stojkovic, Miodrag; Bhattacharya, Shomi S.; Erceg, Slaven

    2014-01-01

    Several studies have demonstrated the important role of non-coding RNAs as regulators of posttranscriptional processes, including stem cells self-renewal and neural differentiation. Human embryonic stem cells (hESCs) and induced pluripotent stem cells (ihPSCs) show enormous potential in regenerative medicine due to their capacity to differentiate to virtually any type of cells of human body. Deciphering the role of non-coding RNAs in pluripotency, self-renewal and neural differentiation will reveal new molecular mechanisms involved in induction and maintenances of pluripotent state as well as triggering these cells toward clinically relevant cells for transplantation. In this brief review we will summarize recently published studies which reveal the role of non-coding RNAs in pluripotency and neural differentiation of hESCs and ihPSC. PMID:24860598

  6. Induced pluripotent stem cells from ALS patients for disease modeling

    PubMed Central

    Richard, Jean-Philippe; Maragakis, Nicholas J.

    2014-01-01

    The ability to reprogram adult somatic cells into pluripotent stem cells that can differentiate into all three germ layers of the developing human has fundamentally changed the landscape of biomedical research. For a neurodegenerative disease like Amyotrophic Lateral Sclerosis (ALS), which does not manifest itself until adulthood and is a heterogeneous disease with few animal models, this technology may be particularly important. Induced pluripotent stem cells (iPSC) have been created from patients with several familial forms of ALS as well as some sporadic forms of ALS. These cells have been differentiated into ALS-relevant cell subtypes including motor neurons and astrocytes, among others. ALS-relevant pathologies have also been identified in motor neurons from these cells and may provide a window into understanding disease mechanisms in vitro. Given that this is a relatively new field of research, numerous challenges remain before iPSC methodologies can fulfill their potential as tools for modeling ALS as well as providing a platform for the investigation of ALS therapeutics. PMID:25223906

  7. Strategies to generate induced pluripotent stem cells.

    PubMed

    Hayes, Michael; Zavazava, Nicholas

    2013-01-01

    The isolation of embryonic stem cells (ESCs) has furthered our understanding of normal embryonic development and fueled the progression of stem cell derived therapies. However, the generation of ESCs requires the destruction of an embryo, making the use of these cells ethically controversial. In 2006 the Yamanaka group overcame this ethical controversy when they described a protocol whereby somatic cells could be dedifferentiated into a pluripotent state following the transduction of a four transcription factor cocktail. Following this initial study numerous groups have described protocols to generate induced pluripotent stem cells (iPSCs). These protocols have simplified the reprogramming strategy by employing polycistronic reprogramming cassettes and flanking such polycistronic cassettes with loxP or piggyBac recognition sequences. Thus, these strategies allow for excision of the entire transgene cassette, limiting the potential for the integration of exogenous transgenes to have detrimental effect. Others have prevented the potentially deleterious effects of integrative reprogramming strategies by using non-integrating adenoviral vectors, traditional recombinant DNA transfection, transfection of minicircle DNA, or transfection of episomally maintained EBNA1/OriP plasmids. Interestingly, transfection of mRNA or miRNA has also been shown to be capable of reprogramming cells, and multiple groups have developed protocols using cell penetrating peptide tagged reprogramming factors to de-differentiate somatic cells in the absence of exogenous nucleic acid. Despite the numerous different reprogramming strategies that have been developed, the reprogramming process remains extremely inefficient. To overcome this inefficiency multiple groups have successfully used small molecules such as valproic acid, sodium butyrate, PD0325901, and others to generate iPSCs.The fast paced field of cellular reprogramming has recently produced protocols to generate iPSCs using non

  8. Induction of pluripotent stem cells transplantation therapy for ischemic stroke.

    PubMed

    Jiang, Mei; Lv, Lei; Ji, Haifeng; Yang, Xuelian; Zhu, Wei; Cai, Liying; Gu, Xiaju; Chai, Changfeng; Huang, Shu; Sun, Jian; Dong, Qiang

    2011-08-01

    Stroke can cause permanent neurological damage, complications, and even death. However, there is no treatment exists to restore its lost function. Human embryonic stems transplantation therapy was a novel and potential therapeutic approach for stroke. However, as we have seen, the ethical controversy pertains to embryonic stem cell research. Human induced pluripotent stem cells (iPSCs) are the latest generation of stem cells that may be a solution to the controversy of using embryonic cells. In our study, we generated iPSCs from adult human fibroblasts by introduction of four defined transcription factors (Oct4, Sox2, Nanog, and Lin-28). And then, we investigated the efficacy of iPSCs transplantation therapy for stroke on the animal models of middle cerebral artery occlusion. Surprisingly, we found that transplanted iPSCs migrated to injured brain areas, and differentiated into neuron-like cells successfully. After 4-16 days iPSCs grafting, sensorimotor function of rats has been improved significantly. In one word, we may prove that iPSCs therapy in stroke to be an effective form of treatment.

  9. Cell therapy using induced pluripotent stem cells or somatic stem cells: this is the question.

    PubMed

    Somoza, Rodrigo A; Rubio, Francisco J

    2012-05-01

    A lot of effort has been developed to bypass the use of embryonic stem cells (ES) in human therapies, because of several concerns and ethical issues. Some unsolved problems of using stem cells for human therapies, excluding the human embryonic origin, are: how to regulate cell plasticity and proliferation, immunological compatibility, potential adverse side-effects when stem cells are systemically administrated, and the in vivo signals to rule out a specific cell fate after transplantation. Currently, it is known that almost all tissues of an adult organism have somatic stem cells (SSC). Whereas ES are primary involved in the genesis of new tissues and organs, SSC are involved in regeneration processes, immuno-regulatory and homeostasis mechanisms. Although the differentiating potential of ES is higher than SSC, several studies suggest that some types of SSC, such as mesenchymal stem cells (MSC), can be induced epigenetically to differentiate into tissue-specific cells of different lineages. This unexpected pluripotency and the variety of sources that they come from, can make MSC-like cells suitable for the treatment of diverse pathologies and injuries. New hopes for cell therapy came from somatic/mature cells and the discovery that could be reprogrammed to a pluripotent stage similar to ES, thus generating induced pluripotent stem cells (iPS). For this, it is necessary to overexpress four main reprogramming factors, Sox2, Oct4, Klf4 and c-Myc. The aim of this review is to analyze the potential and requirements of cellular based tools in human therapy strategies, focusing on the advantage of using MSC over iPS.

  10. Interspecies Chimerism with Mammalian Pluripotent Stem Cells.

    PubMed

    Wu, Jun; Platero-Luengo, Aida; Sakurai, Masahiro; Sugawara, Atsushi; Gil, Maria Antonia; Yamauchi, Takayoshi; Suzuki, Keiichiro; Bogliotti, Yanina Soledad; Cuello, Cristina; Morales Valencia, Mariana; Okumura, Daiji; Luo, Jingping; Vilariño, Marcela; Parrilla, Inmaculada; Soto, Delia Alba; Martinez, Cristina A; Hishida, Tomoaki; Sánchez-Bautista, Sonia; Martinez-Martinez, M Llanos; Wang, Huili; Nohalez, Alicia; Aizawa, Emi; Martinez-Redondo, Paloma; Ocampo, Alejandro; Reddy, Pradeep; Roca, Jordi; Maga, Elizabeth A; Esteban, Concepcion Rodriguez; Berggren, W Travis; Nuñez Delicado, Estrella; Lajara, Jeronimo; Guillen, Isabel; Guillen, Pedro; Campistol, Josep M; Martinez, Emilio A; Ross, Pablo Juan; Izpisua Belmonte, Juan Carlos

    2017-01-26

    Interspecies blastocyst complementation enables organ-specific enrichment of xenogenic pluripotent stem cell (PSC) derivatives. Here, we establish a versatile blastocyst complementation platform based on CRISPR-Cas9-mediated zygote genome editing and show enrichment of rat PSC-derivatives in several tissues of gene-edited organogenesis-disabled mice. Besides gaining insights into species evolution, embryogenesis, and human disease, interspecies blastocyst complementation might allow human organ generation in animals whose organ size, anatomy, and physiology are closer to humans. To date, however, whether human PSCs (hPSCs) can contribute to chimera formation in non-rodent species remains unknown. We systematically evaluate the chimeric competency of several types of hPSCs using a more diversified clade of mammals, the ungulates. We find that naïve hPSCs robustly engraft in both pig and cattle pre-implantation blastocysts but show limited contribution to post-implantation pig embryos. Instead, an intermediate hPSC type exhibits higher degree of chimerism and is able to generate differentiated progenies in post-implantation pig embryos.

  11. Mesenchymal and induced pluripotent stem cells: general insights and clinical perspectives

    PubMed Central

    Zomer, Helena D; Vidane, Atanásio S; Gonçalves, Natalia N; Ambrósio, Carlos E

    2015-01-01

    Mesenchymal stem cells have awakened a great deal of interest in regenerative medicine due to their plasticity, and immunomodulatory and anti-inflammatory properties. They are high-yield and can be acquired through noninvasive methods from adult tissues. Moreover, they are nontumorigenic and are the most widely studied. On the other hand, induced pluripotent stem (iPS) cells can be derived directly from adult cells through gene reprogramming. The new iPS technology avoids the embryo destruction or manipulation to generate pluripotent cells, therefore, are exempt from ethical implication surrounding embryonic stem cell use. The pre-differentiation of iPS cells ensures the safety of future approaches. Both mesenchymal stem cells and iPS cells can be used for autologous cell transplantations without the risk of immune rejection and represent a great opportunity for future alternative therapies. In this review we discussed the therapeutic perspectives using mesenchymal and iPS cells. PMID:26451119

  12. [Current progress and application prospects of induced pluripotent stem cells].

    PubMed

    Qin, Tong; Miao, Xiang-Yang

    2010-12-01

    Induced pluripotent stem (iPS) cells can be directly generated from somatic cells by transduction of a few defined transcription factors. This technique avoids immunological rejection and ethical difficulties, which is a great revolution in life sciences. Like embryonic stem (ES) cells, iPS cells have the ability to self-renew through mitotic cell division and thus remain in its undifferentiated state and the ability to differentiate into not only all derivatives of the three primary germ layers: ectoderm, endoderm, and mesoderm, but also many mature cells in vitro. Therefore, iPS cells are important for theoretic study and therapeutic application. Here, we discuss recent advances in generating induced pluripotent stem cells, different reprogramming methods, and clinical applications of iPS cells. Finally, current problems of iPS cells and its prospects in transgenic animals are also discussed. This article is a summary of current research advances in reprogramming cells into induced pluripotent stem cells.

  13. Transcriptional control of embryonic and induced pluripotent stem cells.

    PubMed

    Guenther, Matthew G

    2011-06-01

    Embryonic stem cells (ESCs) have the potential to generate virtually any cell type or tissue type in the body. This remarkable plasticity has yielded great interest in using these cells to understand early development and in treating human disease. In an effort to understand the basis of ESC pluripotency, genetic and genomic studies have revealed transcriptional regulatory circuitry that maintains the pluripotent cell state and poises the genome for downstream activation. Critical components of this circuitry include ESC transcription factors, chromatin regulators, histone modifications, signaling molecules and regulatory RNAs. This article will focus on our current understanding of these components and how they influence ESC and induced pluripotent stem cell states. Emerging themes include regulation of the pluripotent genome by a core set of transcription factors, transcriptional poising of developmental genes by chromatin regulatory complexes and the establishment of multiple layers of repression at key genomic loci.

  14. Cytoskeletal Expression and Remodeling in Pluripotent Stem Cells

    PubMed Central

    Boraas, Liana C.; Guidry, Julia B.; Pineda, Emma T.; Ahsan, Tabassum

    2016-01-01

    Many emerging cell-based therapies are based on pluripotent stem cells, though complete understanding of the properties of these cells is lacking. In these cells, much is still unknown about the cytoskeletal network, which governs the mechanoresponse. The objective of this study was to determine the cytoskeletal state in undifferentiated pluripotent stem cells and remodeling with differentiation. Mouse embryonic stem cells (ESCs) and reprogrammed induced pluripotent stem cells (iPSCs), as well as the original un-reprogrammed embryonic fibroblasts (MEFs), were evaluated for expression of cytoskeletal markers. We found that pluripotent stem cells overall have a less developed cytoskeleton compared to fibroblasts. Gene and protein expression of smooth muscle cell actin, vimentin, lamin A, and nestin were markedly lower for ESCs than MEFs. Whereas, iPSC samples were heterogeneous with most cells expressing patterns of cytoskeletal proteins similar to ESCs with a small subpopulation similar to MEFs. This indicates that dedifferentiation during reprogramming is associated with cytoskeletal remodeling to a less developed state. In differentiation studies, it was found that shear stress-mediated differentiation resulted in an increase in expression of cytoskeletal intermediate filaments in ESCs, but not in iPSC samples. In the embryoid body model of spontaneous differentiation of pluripotent stem cells, however, both ESCs and iPSCs had similar gene expression for cytoskeletal proteins during early differentiation. With further differentiation, however, gene levels were significantly higher for iPSCs compared to ESCs. These results indicate that reprogrammed iPSCs more readily reacquire cytoskeletal proteins compared to the ESCs that need to form the network de novo. The strategic selection of the parental phenotype is thus critical not only in the context of reprogramming but also the ultimate functionality of the iPSC-differentiated cell population. Overall, this

  15. Advances and applications of induced pluripotent stem cells.

    PubMed

    Pietronave, Stefano; Prat, Maria

    2012-03-01

    Direct reprogramming of somatic cells into pluripotent cells is an emerging technology for creating patient-specific cells, and potentially opens new scenarios in medical and pharmacological fields. From the discovery of Shinya Yamanaka, who first obtained pluripotent cells from fibroblasts by retrovirus-derived ectopic expression of defined embryonic transcription factors, new methods have been developed to generate safe induced pluripotent stem (iPS) cells without genomic manipulations. This review will focus on the recent advances in iPS technology and their application in pharmacology and medicine.

  16. CCL2 enhances pluripotency of human induced pluripotent stem cells by activating hypoxia related genes.

    PubMed

    Hasegawa, Yuki; Tang, Dave; Takahashi, Naoko; Hayashizaki, Yoshihide; Forrest, Alistair R R; Suzuki, Harukazu

    2014-06-24

    Standard culture of human induced pluripotent stem cells (hiPSCs) requires basic Fibroblast Growth Factor (bFGF) to maintain the pluripotent state, whereas hiPSC more closely resemble epiblast stem cells than true naïve state ES which requires LIF to maintain pluripotency. Here we show that chemokine (C-C motif) ligand 2 (CCL2) enhances the expression of pluripotent marker genes through the phosphorylation of the signal transducer and activator of transcription 3 (STAT3) protein. Moreover, comparison of transcriptomes between hiPSCs cultured with CCL2 versus with bFGF, we found that CCL2 activates hypoxia related genes, suggesting that CCL2 enhanced pluripotency by inducing a hypoxic-like response.Further, we show that hiPSCs cultured with CCL2 can differentiate at a higher efficiency than culturing withjust bFGF and we show CCL2 can be used in feeder-free conditions [corrected]. Taken together, our finding indicates the novel functions of CCL2 in enhancing its pluripotency in hiPSCs.

  17. Derivation of porcine pluripotent stem cells for biomedical research.

    PubMed

    Shiue, Yow-Ling; Yang, Jenn-Rong; Liao, Yu-Jing; Kuo, Ting-Yung; Liao, Chia-Hsin; Kang, Ching-Hsun; Tai, Chein; Anderson, Gary B; Chen, Lih-Ren

    2016-07-01

    Pluripotent stem cells including embryonic stem cells (ESCs), embryonic germ cells (EGCs), and induced pluripotent stem cells (iPSCs) are capable of self-renew and limitlessly proliferating in vitro with undifferentiated characteristics. They are able to differentiate in vitro, spontaneously or responding to suitable signals, into cells of all three primary germ layers. Consequently, these pluripotent stem cells will be valuable sources for cell replacement therapy in numerous disorders. However, the promise of human ESCs and EGCs is cramped by the ethical argument about destroying embryos and fetuses for cell line creation. Moreover, there are still carcinogenic risks existing toward the goal of clinical application for human ESCs, EGCs, and iPSCs. Therefore, a suitable animal model for stem cell research will benefit the further development of human stem cell technology. The pigs, on the basis of their similarity in anatomy, immunology, physiology, and biochemical properties, have been wide used as model animals in the study of various human diseases. The development of porcine pluripotent stem cell lines will hold the opportunity to provide an excellent material for human counterpart to the transplantation in biomedical research and further development of cell-based therapeutic strategy.

  18. Perspectives of induced pluripotent stem cells for cardiovascular system regeneration

    PubMed Central

    Csöbönyeiová, Mária; Polák, Štefan

    2015-01-01

    Induced pluripotent stem cells (iPSCs) hold great promise for basic research and regenerative medicine. They offer the same advantages as embryonic stem cells (ESCs) and moreover new perspectives for personalized medicine. iPSCs can be generated from adult somatic tissues by over-expression of a few defined transcription factors, including Oct4, Sox2, Klf4, and c-myc. For regenerative medicine in particular, the technology provides great hope for patients with incurable diseases or potentially fatal disorders such as heart failure. The endogenous regenerative potentials of adult hearts are extremely limited and insufficient to compensate for myocardial loss occurring after myocardial infarction. Recent discoveries have demonstrated that iPSCs have the potential to significantly advance future cardiovascular regenerative therapies. Moreover, iPSCs can be generated from somatic cells of patients with genetic basis for their disease. This human iPSC derivates offer tremendous potential for new disease models. This paper reviews current applications of iPSCs in cardiovascular regenerative medicine and discusses progress in modeling cardiovascular diseases using iPSCs-derived cardiac cells. PMID:25595188

  19. Embryonic stem cells and induced pluripotent stem cells for skeletal regeneration.

    PubMed

    Park, Siyeon; Im, Gun-Il

    2014-10-01

    Tissue engineering for skeletal tissues including bone and cartilage have been focused on the use of adult stem cells. Although there are several pioneering researches on skeletal tissue regeneration from embryonic stem cells (ESCs), ethical issues and the possibility of immune rejection clouded further attention to the application of ESCs for nonlethal orthopedic conditions. However, the recent discovery of induced pluripotent stem cells (iPSCs) led to reconsider the use of these pluripotential cells for skeletal regeneration. The purpose of this review was to summarize the current knowledge of osteogenic and chondrogenic induction from ESCs and iPSCs and to provide a perspective on the application of iPSCs for skeletal regeneration.

  20. Generation of Viable Mice from Induced Pluripotent Stem Cells (iPSCs) Through Tetraploid Complementation.

    PubMed

    Kang, Lan; Gao, Shaorong

    2015-01-01

    Tetraploid complementation assay is the most rigorous criteria for pluripotency characterization of pluripotent stem cells including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Pluripotent stem cells could complement the developmental deficiency of tetraploid embryos and thus support the full-term mice development. Here we describe the protocol for tetraploid complementation using iPSCs to produce viable all-iPSC mice.

  1. Amniotic Fluid Cells Are More Efficiently Reprogrammed to Pluripotency Than Adult Cells

    PubMed Central

    Galende, Elisa; Karakikes, Ioannis; Edelmann, Lisa; Desnick, Robert J.; Kerenyi, Thomas; Khoueiry, Georges; Lafferty, James; McGinn, Joseph T.; Brodman, Michael; Fuster, Valentin; Hajjar, Roger J.

    2010-01-01

    Abstract Recently, cultured human adult skin cells were reprogrammed to induced pluripotent stem (iPS) cells, which have characteristics similar to human embryonic stem (hES) cells. Patient-derived iPS cells offer genetic and immunologic advantages for cell and tissue replacement or engineering. The efficiency of generating human iPS cells has been very low; therefore an easily and efficiently reprogrammed cell type is highly desired. Here, we demonstrate that terminally differentiated human amniotic fluid (AF) skin cells provide an accessible source for efficiently generating abundant-induced pluripotent stem (AF-iPS) cells. By induction of pluripotency with the transcription factor quartet (OCT3/4, SOX2, KLF4, and c-MYC) the terminally differentiated, cultured AF skin cells formed iPS colonies approximately twice as fast and yielded nearly a two-hundred percent increase in number, compared to cultured adult skin cells. AF-iPS cells were identical to hES cells for morphological and growth characteristics, antigenic stem cell markers, stem cell gene expression, telomerase activity, in vitro and in vivo differentiation into the three germ layers and for their capacity to form embryoid bodies (EBs) and teratomas. Our findings provide a biological interesting conclusion that these fetal AF cells are more rapidly, easily, and efficiently reprogrammed to pluripotency than neonatal and adult cells. AF-iPS cells may have a “young,” more embryonic like epigenetic background, which may facilitate and accelerate pluripotency. The ability to efficiently and rapidly reprogram terminally differentiated AF skin cells and generate induced pluripotent stem cells provides an abundant iPS cell source for various basic studies and a potential for future patient-specific personalized therapies. PMID:20677926

  2. Induced pluripotent stem (iPS) cells from human fetal stem cells.

    PubMed

    Guillot, Pascale V

    2016-02-01

    Pluripotency defines the ability of stem cells to differentiate into all the lineages of the three germ layers and self-renew indefinitely. Somatic cells can regain the developmental potential of embryonic stem cells following ectopic expression of a set of transcription factors or, in certain circumstances, via modulation of culture conditions and supplementation with small molecule, that is, induced pluripotent stem (iPS) cells. Here, we discuss the use of fetal tissues for reprogramming, focusing in particular on stem cells derived from human amniotic fluid, and the development of chemical reprogramming. We next address the advantages and disadvantages of deriving pluripotent cells from fetal tissues and the potential clinical applications.

  3. Generation of induced pluripotent stem cells from human kidney mesangial cells.

    PubMed

    Song, Bi; Niclis, Jonathan C; Alikhan, Maliha A; Sakkal, Samy; Sylvain, Aude; Kerr, Peter G; Laslett, Andrew L; Bernard, Claude A; Ricardo, Sharon D

    2011-07-01

    Glomerular injury and podocyte loss leads to secondary tubulointerstitial damage and the development of fibrosis. The possibility of genetically reprogramming adult cells, termed induced pluripotent stem cells (iPS), may pave the way for patient-specific stem-cell-based therapies. Here, we reprogrammed normal human mesangial cells to pluripotency by retroviral transduction using defined factors (OCT4, SOX2, KLF4 and c-Myc). The kidney iPS (kiPS) cells resembled human embryonic stem-cell-like colonies in morphology and gene expression: They were alkaline phosphatase-positive; expressed OCT3/4, TRA-1 to 60 and TRA-1 to 81 proteins; and showed downregulation of mesangial cell markers. Quantitative (qPCR) showed that kiPS cells expressed genes analogous to embryonic stem cells and exhibited silencing of the retroviral transgenes by the fourth passage of differentiation. Furthermore, kiPS cells formed embryoid bodies and expressed markers of all three germ layers. The injection of undifferentiated kiPS colonies into immunodeficient mice formed teratomas, thereby demonstrating pluripotency. These results suggest that reprogrammed kidney induced pluripotent stem cells may aid the study of genetic kidney diseases and lead to the development of novel therapies.

  4. Back to the future: how human induced pluripotent stem cells will transform regenerative medicine

    PubMed Central

    Svendsen, Clive N.

    2013-01-01

    Based on cloning studies in mammals, all adult human cells theoretically contain DNA that is capable of creating a whole new person. Cells are maintained in their differentiated state by selectively activating some genes and silencing. The dogma until recently was that cell differentiation was largely fixed unless exposed to the environment of an activated oocyte. However, it is now possible to activate primitive pluripotent genes within adult human cells that take them back in time to a pluripotent state (termed induced pluripotent stem cells). This technology has grown at an exponential rate over the past few years, culminating in the Nobel Prize in medicine. Discussed here are recent developments in the field as they relate to regenerative medicine, with an emphasis on creating functional cells, editing their genome, autologous transplantation and how this ground-breaking field may eventually impact human aging. PMID:23945396

  5. The role of DNA repair in the pluripotency and differentiation of human stem cells.

    PubMed

    Rocha, Clarissa Ribeiro Reily; Lerner, Leticia Koch; Okamoto, Oswaldo Keith; Marchetto, Maria Carolina; Menck, Carlos Frederico Martins

    2013-01-01

    All living cells utilize intricate DNA repair mechanisms to address numerous types of DNA lesions and to preserve genomic integrity, and pluripotent stem cells have specific needs due to their remarkable ability of self-renewal and differentiation into different functional cell types. Not surprisingly, human stem cells possess a highly efficient DNA repair network that becomes less efficient upon differentiation. Moreover, these cells also have an anaerobic metabolism, which reduces the mitochondria number and the likelihood of oxidative stress, which is highly related to genomic instability. If DNA lesions are not repaired, human stem cells easily undergo senescence, cell death or differentiation, as part of their DNA damage response, avoiding the propagation of stem cells carrying mutations and genomic alterations. Interestingly, cancer stem cells and typical stem cells share not only the differentiation potential but also their capacity to respond to DNA damage, with important implications for cancer therapy using genotoxic agents. On the other hand, the preservation of the adult stem cell pool, and the ability of cells to deal with DNA damage, is essential for normal development, reducing processes of neurodegeneration and premature aging, as one can observe on clinical phenotypes of many human genetic diseases with defects in DNA repair processes. Finally, several recent findings suggest that DNA repair also plays a fundamental role in maintaining the pluripotency and differentiation potential of embryonic stem cells, as well as that of induced pluripotent stem (iPS) cells. DNA repair processes also seem to be necessary for the reprogramming of human cells when iPS cells are produced. Thus, the understanding of how cultured pluripotent stem cells ensure the genetic stability are highly relevant for their safe therapeutic application, at the same time that cellular therapy is a hope for DNA repair deficient patients.

  6. Embryonic template-based generation and purification of pluripotent stem cell-derived cardiomyocytes for heart repair.

    PubMed

    Dierickx, Pieterjan; Doevendans, Pieter A; Geijsen, Niels; van Laake, Linda W

    2012-10-01

    Cardiovascular disease remains a leading cause of death in Western countries. Many types of cardiovascular diseases are due to a loss of functional cardiomyocytes, which can result in irreversible cardiac failure. Since the adult human heart has limited regenerative potential, cardiac transplantation is still the only effective therapy to address this cardiomyocyte loss. However, drawbacks, such as immune rejection and insufficient donor availability, are limiting this last-resort solution. Recent developments in the stem cell biology field have improved the potential of cardiac regeneration. Improvements in reprogramming strategies of differentiated adult cells into induced pluripotent stem cells, together with increased efficiency of directed differentiation of pluripotent stem cells toward cardiac myocytes, have brought cell-based heart muscle regeneration a few steps closer to the clinic. In this review, we outline the status of research on cardiac regeneration with a focus on directed differentiation of pluripotent stem cells toward the cardiac lineage.

  7. Human induced pluripotent stem cells: A disruptive innovation.

    PubMed

    De Vos, J; Bouckenheimer, J; Sansac, C; Lemaître, J-M; Assou, S

    2016-01-01

    This year (2016) will mark the 10th anniversary of the discovery of induced pluripotent stem cells (iPSCs). The finding that the transient expression of four transcription factors can radically remodel the epigenome, transcriptome and metabolome of differentiated cells and reprogram them into pluripotent stem cells has been a major and groundbreaking technological innovation. In this review, we discuss the major applications of this technology that we have grouped in nine categories: a model to study cell fate control; a model to study pluripotency; a model to study human development; a model to study human tissue and organ physiology; a model to study genetic diseases in a dish; a tool for cell rejuvenation; a source of cells for drug screening; a source of cells for regenerative medicine; a tool for the production of human organs in animals.

  8. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells

    PubMed Central

    Trevisan, Marta; Desole, Giovanna; Costanzi, Giulia; Lavezzo, Enrico; Palù, Giorgio; Barzon, Luisa

    2017-01-01

    Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs. PMID:28117672

  9. Concise review: reprogramming strategies for cardiovascular regenerative medicine: from induced pluripotent stem cells to direct reprogramming.

    PubMed

    Budniatzky, Inbar; Gepstein, Lior

    2014-04-01

    Myocardial cell-replacement therapies are emerging as novel therapeutic paradigms for myocardial repair but are hampered by the lack of sources of autologous human cardiomyocytes. The recent advances in stem cell biology and in transcription factor-based reprogramming strategies may provide exciting solutions to this problem. In the current review, we describe the different reprogramming strategies that can give rise to cardiomyocytes for regenerative medicine purposes. Initially, we describe induced pluripotent stem cell technology, a method by which adult somatic cells can be reprogrammed to yield pluripotent stem cells that could later be coaxed ex vivo to differentiate into cardiomyocytes. The generated induced pluripotent stem cell-derived cardiomyocytes could then be used for myocardial cell transplantation and tissue engineering strategies. We also describe the more recent direct reprogramming approaches that aim to directly convert the phenotype of one mature cell type (fibroblast) to another (cardiomyocyte) without going through a pluripotent intermediate cell type. The advantages and shortcomings of each strategy for cardiac regeneration are discussed, along with the hurdles that need to be overcome on the road to clinical translation.

  10. Identifiability and privacy in pluripotent stem cell research.

    PubMed

    Isasi, Rosario; Andrews, Peter W; Baltz, Jay M; Bredenoord, Annelien L; Burton, Paul; Chiu, Ing-Ming; Hull, Sara Chandros; Jung, Ji-Won; Kurtz, Andreas; Lomax, Geoffrey; Ludwig, Tenneille; McDonald, Michael; Morris, Clive; Ng, Huck Hui; Rooke, Heather; Sharma, Alka; Stacey, Glyn N; Williams, Clare; Zeng, Fanyi; Knoppers, Bartha Maria

    2014-04-03

    Data sharing is an essential element of research; however, recent scientific and social developments have challenged conventional methods for protecting privacy. Here we provide guidance for determining data sharing thresholds for human pluripotent stem cell research aimed at a wide range of stakeholders, including research consortia, biorepositories, policy-makers, and funders.

  11. Reprogramming of two somatic nuclei in the same ooplasm leads to pluripotent embryonic stem cells.

    PubMed

    Pfeiffer, Martin J; Esteves, Telma C; Balbach, Sebastian T; Araúzo-Bravo, Marcos J; Stehling, Martin; Jauch, Anna; Houghton, Franchesca D; Schwarzer, Caroline; Boiani, Michele

    2013-11-01

    The conversion of the nuclear program of a somatic cell from a differentiated to an undifferentiated state can be accomplished by transplanting its nucleus to an enucleated oocyte (somatic cell nuclear transfer [SCNT]) in a process termed "reprogramming." This process achieves pluripotency and occasionally also totipotency. Exploiting the obstacle of tetraploidy to full development in mammals, we show that mouse ooplasts transplanted with two somatic nuclei simultaneously (double SCNT) support preimplantation development and derivation of novel tetraploid SCNT embryonic stem cells (tNT-ESCs). Although the double SCNT embryos do not recapitulate the expression pattern of the pluripotency-associated gene Oct4 in fertilized embryos, derivative tNT-ESCs have characteristics of genuine pluripotency: in vitro they differentiate into neurons, cardiomyocytes, and endodermal cells; in vivo, tNT-ESCs form teratomas, albeit at reduced rates compared to diploid counterparts. Global transcriptome analysis revealed only few specific alterations, for example, in the quantitative expression of gastrulation-associated genes. In conclusion, we have shown that the oocyte's reprogramming capacity is in excess of a single nucleus and that double nucleus-transplanted embryos and derivative ESCs are very similar to their diploid counterparts. These results have key implications for reprogramming studies based on pluripotency: while reprogramming in the tetraploid state was known from fusion-mediated reprogramming and from fetal and adult hepatocyte-derived induced pluripotent stem cells, we have now accomplished it with enucleated oocytes.

  12. Induced pluripotent stem cells in hematology: current and future applications

    PubMed Central

    Focosi, D; Amabile, G; Di Ruscio, A; Quaranta, P; Tenen, D G; Pistello, M

    2014-01-01

    Reprogramming somatic cells into induced pluripotent stem (iPS) cells is nowadays approaching effectiveness and clinical grade. Potential uses of this technology include predictive toxicology, drug screening, pathogenetic studies and transplantation. Here, we review the basis of current iPS cell technology and potential applications in hematology, ranging from disease modeling of congenital and acquired hemopathies to hematopoietic stem and other blood cell transplantation. PMID:24813079

  13. Cryopreservation of human pluripotent stem cells: a general protocol.

    PubMed

    Miyazaki, Takamichi; Suemori, Hirofumi

    2015-01-01

    Cryopreservation is an essential technique to preserve stem cells, semipermanently sustaining their potentials. There are two main approaches of cryopreservation for human pluripotent stem cells (hPSCs). The first is the vitrification, which involves instantaneous freeze and thaw of hPSCs. The second is the conventional slow-cooling method and a rapid thaw. Both cryopreservation protocols have been standardized and optimized to yield high survivability of hPSCs.

  14. A practical and efficient cellular substrate for the generation of induced pluripotent stem cells from adults: blood-derived endothelial progenitor cells.

    PubMed

    Geti, Imbisaat; Ormiston, Mark L; Rouhani, Foad; Toshner, Mark; Movassagh, Mehregan; Nichols, Jennifer; Mansfield, William; Southwood, Mark; Bradley, Allan; Rana, Amer Ahmed; Vallier, Ludovic; Morrell, Nicholas W

    2012-12-01

    Induced pluripotent stem cells (iPSCs) have the potential to generate patient-specific tissues for disease modeling and regenerative medicine applications. However, before iPSC technology can progress to the translational phase, several obstacles must be overcome. These include uncertainty regarding the ideal somatic cell type for reprogramming, the low kinetics and efficiency of reprogramming, and karyotype discrepancies between iPSCs and their somatic precursors. Here we describe the use of late-outgrowth endothelial progenitor cells (L-EPCs), which possess several favorable characteristics, as a cellular substrate for the generation of iPSCs. We have developed a protocol that allows the reliable isolation of L-EPCs from peripheral blood mononuclear cell preparations, including frozen samples. As a proof-of-principle for clinical applications we generated EPC-iPSCs from both healthy individuals and patients with heritable and idiopathic forms of pulmonary arterial hypertension. L-EPCs grew clonally; were highly proliferative, passageable, and bankable; and displayed higher reprogramming kinetics and efficiencies compared with dermal fibroblasts. Unlike fibroblasts, the high efficiency of L-EPC reprogramming allowed for the reliable generation of iPSCs in a 96-well format, which is compatible with high-throughput platforms. Array comparative genome hybridization analysis of L-EPCs versus donor-matched circulating monocytes demonstrated that L-EPCs have normal karyotypes compared with their subject's reference genome. In addition, >80% of EPC-iPSC lines tested did not acquire any copy number variations during reprogramming compared with their parent L-EPC line. This work identifies L-EPCs as a practical and efficient cellular substrate for iPSC generation, with the potential to address many of the factors currently limiting the translation of this technology.

  15. Banking of pluripotent adult stem cells as an unlimited source for red blood cell production: potential applications for alloimmunized patients and rare blood challenges.

    PubMed

    Peyrard, Thierry; Bardiaux, Laurent; Krause, Claire; Kobari, Ladan; Lapillonne, Hélène; Andreu, Georges; Douay, Luc

    2011-07-01

    The transfusion of red blood cells (RBCs) is now considered a well-settled and essential therapy. However, some difficulties and constraints still occur, such as long-term blood product shortage, blood donor population aging, known and yet unknown transfusion-transmitted infectious agents, growing cost of the transfusion supply chain management, and the inescapable blood group polymorphism barrier. Red blood cells can be now cultured in vitro from human hematopoietic, human embryonic, or human-induced pluripotent stem cells (hiPSCs). The highly promising hiPSC technology represents a potentially unlimited source of RBCs and opens the door to the revolutionary development of a new generation of allogeneic transfusion products. Assuming that in vitro large-scale cultured RBC production efficiently operates in the near future, we draw here some futuristic but realistic scenarios regarding potential applications for alloimmunized patients and those with a rare blood group. We retrospectively studied a cohort of 16,486 consecutive alloimmunized patients (10-year period), showing 1 to 7 alloantibodies with 361 different antibody combinations. We showed that only 3 hiPSC clones would be sufficient to match more than 99% of the 16,486 patients in need of RBC transfusions. The study of the French National Registry of People with a Rare Blood Phenotype/Genotype (10-year period) shows that 15 hiPSC clones would cover 100% of the needs in patients of white ancestry. In addition, one single hiPSC clone would meet 73% of the needs in alloimmunized patients with sickle cell disease for whom rare cryopreserved RBC units were required. As a result, we consider that a very limited number of RBC clones would be able to not only provide for the need for most alloimmunized patients and those with a rare blood group but also efficiently allow for a policy for alloimmunization prevention in multiply transfused patients.

  16. Biomedical Application of Dental Tissue-Derived Induced Pluripotent Stem Cells.

    PubMed

    Lee, Jung-Hwan; Seo, Seog-Jin

    2016-01-01

    The academic researches and clinical applications in recent years found interest in induced pluripotent stem cells (iPSCs-) based regenerative medicine due to their pluripotency able to differentiate into any cell types in the body without using embryo. However, it is limited in generating iPSCs from adult somatic cells and use of these cells due to the low stem cell potency and donor site morbidity. In biomedical applications, particularly, dental tissue-derived iPSCs have been getting attention as a type of alternative sources for regenerating damaged tissues due to high potential of stem cell characteristics, easy accessibility and attainment, and their ectomesenchymal origin, which allow them to have potential for nerve, vessel, and dental tissue regeneration. This paper will cover the overview of dental tissue-derived iPSCs and their application with their advantages and drawbacks.

  17. Biomedical Application of Dental Tissue-Derived Induced Pluripotent Stem Cells

    PubMed Central

    Lee, Jung-Hwan; Seo, Seog-Jin

    2016-01-01

    The academic researches and clinical applications in recent years found interest in induced pluripotent stem cells (iPSCs-) based regenerative medicine due to their pluripotency able to differentiate into any cell types in the body without using embryo. However, it is limited in generating iPSCs from adult somatic cells and use of these cells due to the low stem cell potency and donor site morbidity. In biomedical applications, particularly, dental tissue-derived iPSCs have been getting attention as a type of alternative sources for regenerating damaged tissues due to high potential of stem cell characteristics, easy accessibility and attainment, and their ectomesenchymal origin, which allow them to have potential for nerve, vessel, and dental tissue regeneration. This paper will cover the overview of dental tissue-derived iPSCs and their application with their advantages and drawbacks. PMID:26989423

  18. Reverse engineering human neurodegenerative disease using pluripotent stem cell technology.

    PubMed

    Liu, Ying; Deng, Wenbin

    2016-05-01

    With the technology of reprogramming somatic cells by introducing defined transcription factors that enables the generation of "induced pluripotent stem cells (iPSCs)" with pluripotency comparable to that of embryonic stem cells (ESCs), it has become possible to use this technology to produce various cells and tissues that have been difficult to obtain from living bodies. This advancement is bringing forth rapid progress in iPSC-based disease modeling, drug screening, and regenerative medicine. More and more studies have demonstrated that phenotypes of adult-onset neurodegenerative disorders could be rather faithfully recapitulated in iPSC-derived neural cell cultures. Moreover, despite the adult-onset nature of the diseases, pathogenic phenotypes and cellular abnormalities often exist in early developmental stages, providing new "windows of opportunity" for understanding mechanisms underlying neurodegenerative disorders and for discovering new medicines. The cell reprogramming technology enables a reverse engineering approach for modeling the cellular degenerative phenotypes of a wide range of human disorders. An excellent example is the study of the human neurodegenerative disease amyotrophic lateral sclerosis (ALS) using iPSCs. ALS is a progressive neurodegenerative disease characterized by the loss of upper and lower motor neurons (MNs), culminating in muscle wasting and death from respiratory failure. The iPSC approach provides innovative cell culture platforms to serve as ALS patient-derived model systems. Researchers have converted iPSCs derived from ALS patients into MNs and various types of glial cells, all of which are involved in ALS, to study the disease. The iPSC technology could be used to determine the role of specific genetic factors to track down what's wrong in the neurodegenerative disease process in the "disease-in-a-dish" model. Meanwhile, parallel experiments of targeting the same specific genes in human ESCs could also be performed to control

  19. Lost in translation: pluripotent stem cell-derived hematopoiesis

    PubMed Central

    Ackermann, Mania; Liebhaber, Steffi; Klusmann, Jan-Henning; Lachmann, Nico

    2015-01-01

    Pluripotent stem cells (PSCs) such as embryonic stem cells or induced pluripotent stem cells represent a promising cell type to gain novel insights into human biology. Understanding the differentiation process of PSCs in vitro may allow for the identification of cell extrinsic/intrinsic factors, driving the specification process toward all cell types of the three germ layers, which may be similar to the human in vivo scenario. This would not only lay the ground for an improved understanding of human embryonic development but would also contribute toward the generation of novel cell types used in cell replacement therapies. In this line, especially the developmental process of mesodermal cells toward the hematopoietic lineage is of great interest. Therefore, this review highlights recent progress in the field of hematopoietic specification of pluripotent stem cell sources. In addition, we would like to shed light on emerging factors controlling primitive and definitive hematopoietic development and to highlight recent approaches to improve the differentiation potential of PSC sources toward hematopoietic stem/progenitor cells. While the generation of fully defined hematopoietic stem cells from PSCs remains challenging in vitro, we here underline the instructive role of cell extrinsic factors such as cytokines for the generation of PSC-derived mature hematopoietic cells. Thus, we have comprehensively examined the role of cytokines for the derivation of mature hematopoietic cell types such as macrophages, granulocytes, megakaryocytes, erythrocytes, dendritic cells, and cells of the B- and T-cell lineage. PMID:26174486

  20. Mesenchymal stem cells as an appropriate feeder layer for prolonged in vitro culture of human induced pluripotent stem cells.

    PubMed

    Havasi, Parvaneh; Nabioni, Mohammad; Soleimani, Masoud; Bakhshandeh, Behnaz; Parivar, Kazem

    2013-04-01

    Feeder layers have been applied extensively to support the growth and stemness potential of stem cells for in vitro cultures. Mouse embryonic fibroblast and mouse fibroblast cell line (SNL) are common feeder cells for human induced pluripotent stem cells (hiPSCs) culture. Because of some problems in the use of these animal feeders and in order to simplify the therapeutic application of hiPSCs, we tested human adult bone marrow mesenchymal stem cells (hMSCs) as a potent feeder system. This method benefits from prevention of possible contamination of animal origin feeder systems. hiPSCs transferred onto mitotically inactivated hMSCs and passaged every 5 days. Prior to this culture, MSCs were characterized by flow cytometry of their surface markers and evaluation of their osteogenic and adipogenic differentiation potentials. The morphology, expressions of some specific pluripotency markers such as SSEA-3, NANOG and TRA-1-60, alkaline phosphates activity, formation embryoid bodies and their differentiation potentials of iPSCs on SNL and MSC feeder layers were evaluated. To investigate the prolonged maintenance of pluripotency, the quantitative transcriptions of some pluripotency markers including OCT4, SOX2, NANOG and REX1 were compared in the iPS clones on SNL or MSC feeders. Human iPSCs cultured on human MSCs feeder were slightly thinner and flatter than ones on the other feeder system. Interestingly MSCs supported the prolonged in vitro proliferation of hiPSCs along with maintenance of their pluripotency. Altogether our results suggest human mesenchymal stem cells as an appropriate feeder layer for human iPSCs culture for clinical applications and cell therapy.

  1. Stem Cell Technology in Cardiac Regeneration: A Pluripotent Stem Cell Promise.

    PubMed

    Duelen, Robin; Sampaolesi, Maurilio

    2017-01-27

    Despite advances in cardiovascular biology and medical therapy, heart disorders are the leading cause of death worldwide. Cell-based regenerative therapies become a promising treatment for patients affected by heart failure, but also underline the need for reproducible results in preclinical and clinical studies for safety and efficacy. Enthusiasm has been tempered by poor engraftment, survival and differentiation of the injected adult stem cells. The crucial challenge is identification and selection of the most suitable stem cell type for cardiac regenerative medicine. Human pluripotent stem cells (PSCs) have emerged as attractive cell source to obtain cardiomyocytes (CMs), with potential applications, including drug discovery and toxicity screening, disease modelling and innovative cell therapies. Lessons from embryology offered important insights into the development of stem cell-derived CMs. However, the generation of a CM population, uniform in cardiac subtype, adult maturation and functional properties, is highly recommended. Moreover, hurdles regarding tumorigenesis, graft cell death, immune rejection and arrhythmogenesis need to be overcome in clinical practice. Here we highlight the recent progression in PSC technologies for the regeneration of injured heart. We review novel strategies that might overcome current obstacles in heart regenerative medicine, aiming at improving cell survival and functional integration after cell transplantation.

  2. Identification of unsafe human induced pluripotent stem cell lines using a robust surrogate assay for pluripotency.

    PubMed

    Polanco, Juan Carlos; Ho, Mirabelle S H; Wang, Bei; Zhou, Qi; Wolvetang, Ernst; Mason, Elizabeth; Wells, Christine A; Kolle, Gabriel; Grimmond, Sean M; Bertoncello, Ivan; O'Brien, Carmel; Laslett, Andrew L

    2013-08-01

    Human induced pluripotent stem cells (hiPSC) have the potential to generate healthy cells and tissues for the study and medical treatment of a large number of diseases. The utility of putative hiPSC-based therapies is constrained by a lack of robust quality-control assays that address the stability of the cells or their capacity to form teratomas after differentiation. Here we report that virally derived hiPSC, but not human embryonic stem cells (hESC) or hiPSC derived using episomal nonintegrating vectors, exhibit a propensity to revert to a pluripotent phenotype following differentiation. This instability was revealed using our published method to identify pluripotent cells undergoing very early-stage differentiation in standard hESC cultures, by fluorescence activated cell sorting (FACS) based on expression of the cell surface markers TG30 (CD9) and GCTM-2. Differentiated cells cultured post-FACS fractionation from virally derived hiPSC lines reacquired immunoreactivity to TG30 (CD9) and GCTM-2, formed stem cell-like colonies, and re-expressed canonical pluripotency markers. Furthermore, differentiated cells from pluripotency-reverting hiPSC lines generated teratomas in immunocompromised mice, raising concerns about their safety in downstream applications. In contrast, differentiated cell populations from hESC and episomally derived hiPSC did not show any of these abnormalities. Our assays may be used to identify "unsafe" hiPSC cell lines and this information should be considered when selecting hiPSC lines for clinical use and indicate that experiments using these "unsafe" hiPSC lines should be interpreted carefully.

  3. Present and future challenges of induced pluripotent stem cells

    PubMed Central

    Ohnuki, Mari; Takahashi, Kazutoshi

    2015-01-01

    Growing old is our destiny. However, the mature differentiated cells making up our body can be rejuvenated to an embryo-like fate called pluripotency which is an ability to differentiate into all cell types by enforced expression of defined transcription factors. The discovery of this induced pluripotent stem cell (iPSC) technology has opened up unprecedented opportunities in regenerative medicine, disease modelling and drug discovery. In this review, we introduce the applications and future perspectives of human iPSCs and we also show how iPSC technology has evolved along the way. PMID:26416678

  4. Induced pluripotent stem cells in research and therapy.

    PubMed

    Teoh, Hoon-Koon; Cheong, Soon-Keng

    2012-06-01

    Induced pluripotent stem cells (iPSC) are derived from human somatic cells through ectopic expression of transcription factors. This landmark discovery has been considered as a major development towards patient-specific iPSC for various biomedical applications. Unlimited self renewal capacity, pluripotency and ease of accessibility to donor tissues contribute to the versatility of iPSC. The therapeutic potential of iPSC in regenerative medicine, cell-based therapy, disease modelling and drug discovery is indeed very promising. Continuous progress in iPSC technology provides clearer understanding of disease pathogenesis and ultimately new optimism in developing treatment or cure for human diseases.

  5. Towards Personalized Regenerative Cell Therapy: Mesenchymal Stem Cells Derived from Human Induced Pluripotent Stem Cells.

    PubMed

    Lin, Lin; Bolund, Lars; Luo, Yonglun

    2016-01-01

    Mesenchymal stem cells (MSCs) are adult stem cells with the capacity of self-renewal and multilineage differentiation, and can be isolated from several adult tissues. However, isolating MSCs from adult tissues for cell therapy is hampered by the invasive procedure, the rarity of the cells and their attenuated proliferation capacity when cultivated and expanded in vitro. Human MSCs derived from induced pluripotent stem cells (iPSC-MSCs) have now evolved as a promising alternative cell source for MSCs and regenerative medicine. Several groups, including ours, have reported successful derivation of functional iPSC-MSCs and applied these cells in MSC-based therapeutic testing. Still, the current experience and understanding of iPSC-MSCs with respect to production methods, safety and efficacy are primitive. In this review, we highlight the methodological progress in iPSC-MSC research, describing the importance of choosing the right sources of iPSCs, iPSC reprogramming methods, iPSC culture systems, embryoid body intermediates, pathway inhibitors, basal medium, serum, growth factors and culture surface coating. We also highlight some progress in the application of iPSC-MSCs in direct cell therapy, tissue engineering and gene therapy.

  6. Production of hepatocyte like cells from human pluripotent stem cells

    PubMed Central

    Hannan, Nicholas R.F; Segeritz, Charis-Patricia; Touboul, Thomas; Vallier, Ludovic

    2013-01-01

    Large scale production of hepatocytes from a variety of genetic backgrounds would be beneficial for drug screening and to provide a source of cells to be used as a substitute for liver transplantation. However, fully functional primary hepatocytes remain difficult to expand in vitro and circumventing this problem by using an alternative source of cells is desirable. Here, we describe a 25 day protocol to direct the differentiation of human pluripotent stem cells into a near homogenous population of hepatocyte-like cells. As cells progress through this protocol they express genes in a chronological manner similar to that described during in-vivo hepatic development. The protocol relies on culture systems devoid of serum, feeders or complex extra-cellular matrices enabling molecular analyses without interference from unknown factors. This approach works efficiently with human embryonic stem cells and human induced pluripotent stem cells and was recently used to model liver diseases in vitro. PMID:23424751

  7. Human pluripotent stem cells: an emerging model in developmental biology.

    PubMed

    Zhu, Zengrong; Huangfu, Danwei

    2013-02-01

    Developmental biology has long benefited from studies of classic model organisms. Recently, human pluripotent stem cells (hPSCs), including human embryonic stem cells and human induced pluripotent stem cells, have emerged as a new model system that offers unique advantages for developmental studies. Here, we discuss how studies of hPSCs can complement classic approaches using model organisms, and how hPSCs can be used to recapitulate aspects of human embryonic development 'in a dish'. We also summarize some of the recently developed genetic tools that greatly facilitate the interrogation of gene function during hPSC differentiation. With the development of high-throughput screening technologies, hPSCs have the potential to revolutionize gene discovery in mammalian development.

  8. Induced Pluripotent Stem Cells: Development in the Ophthalmologic Field

    PubMed Central

    2016-01-01

    Human induced pluripotent stem cells (iPSCs) are a type of stem cells that can be derived from human somatic cells by introducing certain transcription factors. Induced pluripotent stem cells can divide indefinitely and are able to differentiate into every cell type, which make them viable for transplantation and individual disease modeling. Recently, various ocular cells, including corneal epithelial-like cells, retinal pigment epithelium (RPE) cells displaying functions similar to native RPE, photoreceptors, and retinal ganglion cells, have all been successfully derived from iPSCs. Transplantation of these cells in animal models showed great promise for reversing blindness, and the first clinical trial on humans started in 2013. Despite these promising results, more research is in demand for preventing inadvertent tumor growth, developing precise functionality of the cells, and promoting integration into the host tissue. PMID:27594887

  9. Induced Pluripotent Stem Cells: Emerging Techniques for Nuclear Reprogramming

    PubMed Central

    Han, Ji Woong

    2011-01-01

    Abstract Introduction of four transcription factors, Oct3/4, Sox2, Klf4, and c-Myc, can successfully reprogram somatic cells into embryonic stem (ES)-like cells. These cells, which are referred to as induced pluripotent stem (iPS) cells, closely resemble embryonic stem cells in genomic, cell biologic, and phenotypic characteristics, and the creation of these special cells was a major triumph in cell biology. In contrast to pluripotent stem cells generated by somatic cell nuclear-transfer (SCNT) or ES cells derived from the inner cell mass (ICM) of the blastocyst, direct reprogramming provides a convenient and reliable means of generating pluripotent stem cells. iPS cells have already shown incredible potential for research and for therapeutic applications in regenerative medicine within just a few years of their discovery. In this review, current techniques of generating iPS cells and mechanisms of nuclear reprogramming are reviewed, and the potential for therapeutic applications is discussed. Antioxid. Redox Signal. 15, 1799–1820. PMID:21194386

  10. Adult stem cells: hopes and hypes of regenerative medicine.

    PubMed

    Dulak, Józef; Szade, Krzysztof; Szade, Agata; Nowak, Witold; Józkowicz, Alicja

    2015-01-01

    Stem cells are self-renewing cells that can differentiate into specialized cell type(s). Pluripotent stem cells, i.e. embryonic stem cells (ESC) or induced pluripotent stem cells (iPSC) differentiate into cells of all three embryonic lineages. Multipotent stem cells, like hematopoietic stem cells (HSC), can develop into multiple specialized cells in a specific tissue. Unipotent cells differentiate only into one cell type, like e.g. satellite cells of skeletal muscle. There are many examples of successful clinical applications of stem cells. Over million patients worldwide have benefited from bone marrow transplantations performed for treatment of leukemias, anemias or immunodeficiencies. Skin stem cells are used to heal severe burns, while limbal stem cells can regenerate the damaged cornea. Pluripotent stem cells, especially the patient-specific iPSC, have a tremendous therapeutic potential, but their clinical application will require overcoming numerous drawbacks. Therefore, the use of adult stem cells, which are multipotent or unipotent, can be at present a more achievable strategy. Noteworthy, some studies ascribed particular adult stem cells as pluripotent. However, despite efforts, the postulated pluripotency of such events like "spore-like cells", "very small embryonic-like stem cells" or "multipotent adult progenitor cells" have not been confirmed in stringent independent studies. Also plasticity of the bone marrow-derived cells which were suggested to differentiate e.g. into cardiomyocytes, has not been positively verified, and their therapeutic effect, if observed, results rather from the paracrine activity. Here we discuss the examples of recent studies on adult stem cells in the light of current understanding of stem cell biology.

  11. Transgene Reactivation in Induced Pluripotent Stem Cell Derivatives and Reversion to Pluripotency of Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells

    PubMed Central

    Galat, Yekaterina; Perepitchka, Mariana; Jennings, Lawrence J.; Iannaccone, Philip M.; Hendrix, Mary J.C.

    2016-01-01

    Induced pluripotent stem cells (iPSCs) have enormous potential in regenerative medicine and disease modeling. It is now felt that clinical trials should be performed with iPSCs derived with nonintegrative constructs. Numerous studies, however, including those describing disease models, are still being published using cells derived from iPSCs generated with integrative constructs. Our experimental work presents the first evidence of spontaneous transgene reactivation in vitro in several cellular types. Our results show that the transgenes were predominantly silent in parent iPSCs, but in mesenchymal and endothelial iPSC derivatives, the transgenes experienced random upregulation of Nanog and c-Myc. Additionally, we provide evidence of spontaneous secondary reprogramming and reversion to pluripotency in mesenchymal stem cells derived from iPSCs. These findings strongly suggest that the studies, which use cellular products derived from iPSCs generated with retro- or lentiviruses, should be evaluated with consideration of the possibility of transgene reactivation. The in vitro model described here provides insight into the earliest events of culture transformation and suggests the hypothesis that reversion to pluripotency may be responsible for the development of tumors in cell replacement experiments. The main goal of this work, however, is to communicate the possibility of transgene reactivation in retro- or lenti-iPSC derivatives and the associated loss of cellular fidelity in vitro, which may impact the outcomes of disease modeling and related experimentation. PMID:27193052

  12. Challenges and strategies for generating therapeutic patient-specific hemangioblasts and hematopoietic stem cells from human pluripotent stem cells

    PubMed Central

    PETERS, ANN; BURRIDGE, PAUL W.; PRYZHKOVA, MARINA V.; LEVINE, MICHAL A.; PARK, TEA-SOON; ROXBURY, CHRISTOPHER; YUAN, XUAN; PÉAULT, BRUNO; ZAMBIDIS, ELIAS T.

    2012-01-01

    Recent characterization of hemangioblasts differentiated from human embryonic stem cells (hESC) has further confirmed evidence from murine, zebrafish and avian experimental systems that hematopoietic and endothelial lineages arise from a common progenitor. Such progenitors may provide a valuable resource for delineating the initial developmental steps of human hemato-endotheliogenesis, which is a process normally difficult to study due to the very limited accessibility of early human embryonic/fetal tissues. Moreover, efficient hemangioblast and hematopoietic stem cell (HSC) generation from patient-specific pluripotent stem cells has enormous potential for regenerative medicine, since it could lead to strategies for treating a multitude of hematologic and vascular disorders. However, significant scientific challenges remain in achieving these goals, and the generation of transplantable hemangioblasts and HSC derived from hESC currently remains elusive. Our previous work has suggested that the failure to derive engraftable HSC from hESC is due to the fact that current methodologies for differentiating hESC produce hematopoietic progenitors developmentally similar to those found in the human yolk sac, and are therefore too immature to provide adult-type hematopoietic reconstitution. Herein, we outline the nature of this challenge and propose targeted strategies for generating engraftable human pluripotent stem cell-derived HSC from primitive hemangioblasts using a developmental approach. We also focus on methods by which reprogrammed somatic cells could be used to derive autologous pluripotent stem cells, which in turn could provide unlimited sources of patient-specific hemangioblasts and HSC. PMID:20563986

  13. Induced pluripotent stem cells: a new revolution for clinical neurology?

    PubMed

    Mattis, Virginia B; Svendsen, Clive N

    2011-04-01

    Why specific neuronal populations are uniquely susceptible in neurodegenerative diseases remains a mystery. Brain tissue samples from patients are rarely available for testing, and animal models frequently do not recapitulate all features of a specific disorder; therefore, pathophysiological investigations are difficult. An exciting new avenue for neurological research and drug development is the discovery that patients' somatic cells can be reprogrammed to a pluripotent state; these cells are known as induced pluripotent stem cells. Once pluripotency is reinstated, cell colonies can be expanded and differentiated into specific neural populations. The availability of these cells enables the monitoring in vitro of temporal features of disease initiation and progression, and testing of new drug treatments on the patient's own cells. Hence, this swiftly growing area of research has the potential to contribute greatly to our understanding of the pathophysiology of neurodegenerative and neurodevelopmental diseases.

  14. Reprogramming T cell Lymphocytes to Induced Pluripotent Stem Cells

    NASA Astrophysics Data System (ADS)

    Bared, Kalia

    The discovery of induced pluripotent stem cells (iPSC) provided a novel technology for the study of development and pharmacology and complement embryonic stem cells (ES) for cell therapy applications. Though iPSC are derived from adult tissue they are comparable to ES cells in their behavior; multi-lineage differentiation and self-renewal. This makes iPSC research appealing because they can be studied in great detail and expanded in culture broadly. Fibroblasts were the first cell type reprogrammed to an iPSC using a retrovirus vector, since then alternative cell types including lymphocytes have been used to generate iPSC. Different types of vectors have also been developed to enhance iPSC formation and quality. However, specific T lymphocyte subsets have not been shown to reprogram to a pluripotent state to date. Here, we proposed to derive iPSC from peripheral blood effector and central memory T cells, reasoning that the resultant iPSC will maintain the epigenetic memory of a T lymphocyte, including the T cell receptor (TCR) gene rearrangement. This epigenetic memory will enable the differentiation and expansion of T cell iPSC into professional T cells containing a specific TCR. These could then be used for cell therapy to target specific antigens, as well as to improve culture techniques to expand T cells in vitro. We studied different gene delivery methods to derive iPSC from different types of T lymphocytes. We assessed the viability of viral transduction using flow cytometry to detect green fluorescent marker contained in the viral construct and quantitative real time polymerase chain reaction (qRT-PCR) to detect Oct4, Klf4, Sox2, and c-Myc gene expression. Our results demonstrate that the Sendai virus construct is the most feasible platform to reprogram T lymphocytes. We anticipate that this platform will provide an efficient and safe approach to derive iPSC from different T cell subsets, including memory T cells.

  15. Using Human Induced Pluripotent Stem Cells to Model Skeletal Diseases.

    PubMed

    Barruet, Emilie; Hsiao, Edward C

    2016-01-01

    Musculoskeletal disorders affecting the bones and joints are major health problems among children and adults. Major challenges such as the genetic origins or poor diagnostics of severe skeletal disease hinder our understanding of human skeletal diseases. The recent advent of human induced pluripotent stem cells (human iPS cells) provides an unparalleled opportunity to create human-specific models of human skeletal diseases. iPS cells have the ability to self-renew, allowing us to obtain large amounts of starting material, and have the potential to differentiate into any cell types in the body. In addition, they can carry one or more mutations responsible for the disease of interest or be genetically corrected to create isogenic controls. Our work has focused on modeling rare musculoskeletal disorders including fibrodysplasia ossificans progressive (FOP), a congenital disease of increased heterotopic ossification. In this review, we will discuss our experiences and protocols differentiating human iPS cells toward the osteogenic lineage and their application to model skeletal diseases. A number of critical challenges and exciting new approaches are also discussed, which will allow the skeletal biology field to harness the potential of human iPS cells as a critical model system for understanding diseases of abnormal skeletal formation and bone regeneration.

  16. Making gametes from pluripotent stem cells--a promising role for very small embryonic-like stem cells.

    PubMed

    Bhartiya, Deepa; Hinduja, Indira; Patel, Hiren; Bhilawadikar, Rashmi

    2014-11-24

    The urge to have one's own biological child supersedes any desire in life. Several options have been used to obtain gametes including pluripotent stem cells (embryonic ES and induced pluripotent iPS stem cells); gonadal stem cells (spermatogonial SSCs, ovarian OSCs stem cells), bone marrow, mesenchymal cells and fetal skin. However, the field poses a huge challenge including inefficient existing protocols for differentiation, epigenetic and genetic changes associated with extensive in vitro manipulation and also ethical/regulatory constraints. A tremendous leap in the field occurred using mouse ES and iPS cells wherein they were first differentiated into epiblast-like cells and then primordial germ cell-like cells. These on further development produced sperm, oocytes and live offspring (had associated genetic problems). Evidently differentiating pluripotent stem cells into primordial germ cells (PGCs) remains a major bottleneck. Against this backdrop, we propose that a novel population of pluripotent stem cells termed very small embryonic-like stem cells (VSELs) may serve as an alternative, potential source of autologus gametes, keeping in mind that they are indeed PGCs surviving in adult mammalian ovaries and testes. Both VSELs and PGCs are pluripotent, relatively quiescent because of epigenetic modifications of parentally imprinted genes loci like Igf2-H19 and KCNQ1p57, share several markers like Stella, Fragilis, Mvh, Dppa2, Dppa4, Sall4, Blimp1 and functional receptors. VSELs are localized in the basement membrane of seminiferous tubules in testis and in the ovary surface epithelium. Ovarian stem cells from mouse, rabbit, sheep, marmoset and humans (menopausal women and those with premature ovarian failure) spontaneously differentiate into oocyte-like structures in vitro with no additional requirement of growth factors. Thus a more pragmatic option to obtain autologus gametes may be the pluripotent VSELs and if we could manipulate them in vivo - existing

  17. Human induced pluripotent stem cells can reach complete terminal maturation: in vivo and in vitro evidence in the erythropoietic differentiation model

    PubMed Central

    Kobari, Ladan; Yates, Frank; Oudrhiri, Noufissa; Francina, Alain; Kiger, Laurent; Mazurier, Christelle; Rouzbeh, Shaghayegh; El-Nemer, Wassim; Hebert, Nicolas; Giarratana, Marie-Catherine; François, Sabine; Chapel, Alain; Lapillonne, Hélène; Luton, Dominique; Bennaceur-Griscelli, Annelise; Douay, Luc

    2012-01-01

    Background Human induced pluripotent stem cells offer perspectives for cell therapy and research models for diseases. We applied this approach to the normal and pathological erythroid differentiation model by establishing induced pluripotent stem cells from normal and homozygous sickle cell disease donors. Design and Methods We addressed the question as to whether these cells can reach complete erythroid terminal maturation notably with a complete switch from fetal to adult hemoglobin. Sickle cell disease induced pluripotent stem cells were differentiated in vitro into red blood cells and characterized for their terminal maturation in terms of hemoglobin content, oxygen transport capacity, deformability, sickling and adherence. Nucleated erythroblast populations generated from normal and pathological induced pluripotent stem cells were then injected into non-obese diabetic severe combined immunodeficiency mice to follow the in vivo hemoglobin maturation. Results We observed that in vitro erythroid differentiation results in predominance of fetal hemoglobin which rescues the functionality of red blood cells in the pathological model of sickle cell disease. We observed, in vivo, the switch from fetal to adult hemoglobin after infusion of nucleated erythroid precursors derived from either normal or pathological induced pluripotent stem cells into mice. Conclusions These results demonstrate that human induced pluripotent stem cells: i) can achieve complete terminal erythroid maturation, in vitro in terms of nucleus expulsion and in vivo in terms of hemoglobin maturation; and ii) open the way to generation of functionally corrected red blood cells from sickle cell disease induced pluripotent stem cells, without any genetic modification or drug treatment. PMID:22733021

  18. Derivation of novel human ground state naive pluripotent stem cells.

    PubMed

    Gafni, Ohad; Weinberger, Leehee; Mansour, Abed AlFatah; Manor, Yair S; Chomsky, Elad; Ben-Yosef, Dalit; Kalma, Yael; Viukov, Sergey; Maza, Itay; Zviran, Asaf; Rais, Yoach; Shipony, Zohar; Mukamel, Zohar; Krupalnik, Vladislav; Zerbib, Mirie; Geula, Shay; Caspi, Inbal; Schneir, Dan; Shwartz, Tamar; Gilad, Shlomit; Amann-Zalcenstein, Daniela; Benjamin, Sima; Amit, Ido; Tanay, Amos; Massarwa, Rada; Novershtern, Noa; Hanna, Jacob H

    2013-12-12

    Mouse embryonic stem (ES) cells are isolated from the inner cell mass of blastocysts, and can be preserved in vitro in a naive inner-cell-mass-like configuration by providing exogenous stimulation with leukaemia inhibitory factor (LIF) and small molecule inhibition of ERK1/ERK2 and GSK3β signalling (termed 2i/LIF conditions). Hallmarks of naive pluripotency include driving Oct4 (also known as Pou5f1) transcription by its distal enhancer, retaining a pre-inactivation X chromosome state, and global reduction in DNA methylation and in H3K27me3 repressive chromatin mark deposition on developmental regulatory gene promoters. Upon withdrawal of 2i/LIF, naive mouse ES cells can drift towards a primed pluripotent state resembling that of the post-implantation epiblast. Although human ES cells share several molecular features with naive mouse ES cells, they also share a variety of epigenetic properties with primed murine epiblast stem cells (EpiSCs). These include predominant use of the proximal enhancer element to maintain OCT4 expression, pronounced tendency for X chromosome inactivation in most female human ES cells, increase in DNA methylation and prominent deposition of H3K27me3 and bivalent domain acquisition on lineage regulatory genes. The feasibility of establishing human ground state naive pluripotency in vitro with equivalent molecular and functional features to those characterized in mouse ES cells remains to be defined. Here we establish defined conditions that facilitate the derivation of genetically unmodified human naive pluripotent stem cells from already established primed human ES cells, from somatic cells through induced pluripotent stem (iPS) cell reprogramming or directly from blastocysts. The novel naive pluripotent cells validated herein retain molecular characteristics and functional properties that are highly similar to mouse naive ES cells, and distinct from conventional primed human pluripotent cells. This includes competence in the generation

  19. Introduction to Hair-Follicle-Associated Pluripotent Stem Cells.

    PubMed

    Hoffman, Robert M

    2016-01-01

    Nestin-expressing stem cells of the hair follicle, discovered by our laboratory, have been shown to be able to form outer-root sheaths of the follicle as well as neurons and many other non-follicle cell types. We have termed the nestin-expressing stem cells of the hair follicle as hair-follicle-associated pluripotent (HAP) stem cells. We have shown that the HAP stem cells from the hair follicle can effect the repair of peripheral nerve and spinal cord injury. The hair follicle stem cells differentiate into neuronal and glial cells after transplantation to the injured peripheral nerve and spinal cord, and enhance injury repair and locomotor recovery. When the excised hair follicle with its nerve stump was placed in Gelfoam(®) 3D histoculture, HAP stem cells grew and extended the hair follicle nerve which consisted of βIII-tubulin-positive fibers with F-actin expression at the tip. These findings indicate that βIII-tubulin-positive fibers elongating from the whisker follicle sensory nerve stump were growing axons. The growing whisker sensory nerve was highly enriched in HAP stem cells, which appeared to play a major role in its elongation and interaction with other nerves in 3D Gelfoam(®) histoculture, including the sciatic nerve, the trigeminal nerve, and the trigeminal nerve ganglion. These results suggest that a major function of the HAP stem cells in the hair follicle is for growth of the follicle sensory nerve. Recently, we have shown that HAP stem cells can differentiate into beating cardiac muscle cells. HAP stem cells have critical advantages for regenerative medicine over embryonic stem (ES) cells and induced pluripotent stem (iPS) cells in that they are highly accessible from each patient, thereby eliminating immunological issues since they are autologous, require no genetic manipulation, are non-tumorigenic, and do not present ethical issues.

  20. Livestock Models for Exploiting the Promise of Pluripotent Stem Cells

    PubMed Central

    Roberts, R. Michael; Yuan, Ye; Genovese, Nicholas; Ezashi, Toshihiko

    2015-01-01

    Livestock species are widely used as biomedical models. Pigs, in particular, are beginning to have a significant role in regenerative medicine for testing the applicability, success, and safety of grafts derived from induced pluripotent stem cells. Animal testing must always be performed before any clinical trials are performed in humans, and pigs may sometimes be the species of choice because of their physiological and anatomical similarities to humans. Induced pluripotent stem cells (iPSC) have been generated with some success from livestock species by a variety of reprogramming procedures, but authenticated embryonic stem cells (ESC) have not. There are now several studies in which porcine iPSC have been tested for their ability to provide functional grafts in pigs. Pigs have also served as recipients for grafts derived from human iPSC. There have also been recent advances in creating pigs with severe combined immunodeficiency (SCID). Like SCID mice, these pigs are expected to be graft tolerant. Additionally, chimeric, partially humanized pigs could be sources of human organs. Another potential application of pluripotent stem cells from livestock is for the purpose of differentiating the cells into skeletal muscle, which, in turn, could be used either to produce cultured meat or to engraft into damaged muscle. None of these technologies has advanced to a stage that they have become mainstream, however. Despite the value of livestock models in regenerative medicine, only a limited number of institutions are able to use these animals. PMID:25991700

  1. [Induced pluripotent stem cells. A new resource in modern medicine].

    PubMed

    Liebau, S; Stockmann, M; Illing, A; Seufferlein, T; Kleger, A

    2014-04-01

    Pluripotent stem cells possess a remarkable unlimited self-renewal capacity and offer unparalleled in vitro differentiation potential. This provides a unique model system not only to study early human development but also gives renewed hope in terms of developing cell therapies and regenerative medicine. S. Yamanaka, a medical doctor and researcher, reported the possibility of reprogramming somatic cells to so-called induced pluripotent stem cells via the ectopic expression of four transcription factors, namely Oct4, Sox2, Klf4 and c-Myc. This Nobel Prize winning work has since revolutionized stem cell research and paved the way for countless new avenues within regenerative medicine. This includes disease modeling in a patient-specific context with the ultimate aim of individually tailored pharmaceutical therapy. Additionally, genetic correction studies have rapidly increased in basic science and thus there is hope that these can be effectively and efficiently translated into clinical applications. Addressing the medical community this review gives a broad general overview about the state of the research field and possible clinical applications of pluripotent stem cells.

  2. Potential of pluripotent stem cells for diabetes therapy.

    PubMed

    Schroeder, Insa S

    2012-10-01

    Diabetes mellitus type 1 (T1DM) and type 2 (T2DM) are common diseases. To date, it is widely accepted that all forms of DM lead to the loss of beta cells. Therefore, to avoid the debilitating comorbidities when glycemic control cannot be fully achieved, some would argue that beta cell replacement is the only way to cure the disease. Due to organ donor shortage, other cell sources for beta cell replacement strategies have to be employed. Pluripotent stem cells, including embryonic stem (ES) and induced pluripotent stem (iPS) cells offer a valuable alternative to provide the necessary cells to substitute organ transplants but also to serve as a model to study the onset and progression of the disease, resulting in better treatment regimens. This review will summarize recent progress in the establishment of pluripotent stem cells, their differentiation into the pancreatic lineage with a focus on two-dimensional (2D) and three-dimensional (3D) differentiation settings, the special role of iPS cells in the analysis of genetic predispositions to diabetes, and techniques that help to move current approaches to clinical applications. Particular attention, however, is also given to the long-term challenges that have to be addressed before ES or iPS cell-based therapies will become a broadly accepted treatment option.

  3. Effect of Induced Pluripotent Stem Cell Technology in Blood Banking

    PubMed Central

    Focosi, Daniele

    2016-01-01

    Summary Population aging has imposed cost-effective alternatives to blood donations. Artificial blood is still at the preliminary stages of development, and the need for viable cells seems unsurmountable. Because large numbers of viable cells must be promptly available for clinical use, stem cell technologies, expansion, and banking represent ideal tools to ensure a regular supply. Provided key donors can be identified, induced pluripotent stem cell (iPSC) technology could pave the way to a new era in transfusion medicine, just as it is already doing in many other fields of medicine. The present review summarizes the current state of research on iPSC technology in the field of blood banking, highlighting hurdles, and promises. Significance The aging population in Western countries is causing a progressive reduction of blood donors and a constant increase of blood recipients. Because blood is the main therapeutic option to treat acute hemorrhage, cost-effective alternatives to blood donations are being actively investigated. The enormous replication capability of induced pluripotent stem cells and their promising results in many other fields of medicine could be an apt solution to produce the large numbers of viable cells required in transfusion and usher in a new era in transfusion medicine. The present report describes the potentiality, technological hurdles, and promises of induced pluripotent stem cells to generate red blood cells by redifferentiation. PMID:26819256

  4. Generation of motor neurons from pluripotent stem cells.

    PubMed

    Chipman, Peter H; Toma, Jeremy S; Rafuse, Victor F

    2012-01-01

    Alpha motor neurons (also known as lower or skeletal motor neurons) have been studied extensively for over 100 years. Motor neurons control the contraction of skeletal muscles and thus are the final common pathway in the nervous system responsible for motor behavior. Muscles become paralyzed when their innervating motor neurons die because of injury or disease. Motor neuron diseases (MNDs), such as Amyotrophic Lateral Sclerosis, progressively destroy motor neurons until those inflicted succumb to the illness due to respiratory failure. One strategy being explored to study and treat muscle paralysis due to motor neuron loss involves deriving surrogate motor neurons from pluripotent stem cells. Guided by decades of research on the development of the spinal cord, recent advances in neurobiology have shown that functional motor neurons can be derived from mouse and human embryonic stem (ES) cells. Furthermore, ES cell-derived motor neurons restore motor behavior when transplanted into animal models of motor dysfunction. The recent discovery that mouse and human motor neurons can be derived from induced pluripotent stem (iPS) cells (i.e., somatic cells converted to pluripotency) has set the stage for the development of patient-specific therapies designed to treat movement disorders. Indeed, there is now hope within the scientific community that motor neurons derived from pluripotent stem cells will be used to treat MNDs through cell transplantation and/or to screen molecules that will prevent motor neuron death. In this chapter, we review the journey that led to the generation of motor neurons from ES and iPS cells, how stem cell-derived motor neurons have been used to treat/study motor dysfunction, and where the technology will likely lead to in the future.

  5. The use of pluripotent stem cell for personalized cell therapies against neurological disorders.

    PubMed

    Ha, Hye-Yeong; Jang, Si-Hyong; Jung, Ji-Won

    2011-01-01

    Although there are a number of weaknesses for clinical use, pluripotent stem cells are valuable sources for patient-specific cell therapies against various diseases. Backed-up by a huge number of basic researches, neuronal differentiation mechanism is well established and pluripotent stem cell therapies against neurological disorders are getting closer to clinical application. However, there are increasing needs for standardization of the sourcing pluripotent stem cells by establishing stem cell registries and banking. Global harmonization will accelerate practical use of personalized therapies using pluripotent stem cells.

  6. Hunt for pluripotent stem cell -- regenerative medicine search for almighty cell.

    PubMed

    Ratajczak, Mariusz Z; Zuba-Surma, Ewa K; Wysoczynski, Marcin; Wan, Wu; Ratajczak, Janina; Wojakowski, Wojciech; Kucia, Magda

    2008-05-01

    Regenerative medicine and tissue engineering are searching for a novel stem cell based therapeutic strategy that will allow for efficient treatment or even potential replacement of damaged organs. The pluripotent stem cell (PSC), which gives rise to cells from all three germ lineages, seems to be the most ideal candidate for such therapies. PSC could be extracted from developing embryos. However, since this source of stem cells for potential therapeutic purposes remains controversial, stem cell researchers look for PSC that could be isolated from the adult tissues or generated from already differentiated cells. True PSC should possess both potential for multilineage differentiation in vitro and, more importantly, also be able to complement in vivo blastocyst development. This review will summarize current approaches and limitations to isolate PSC from adult tissues or, alternatively, to generate it by nuclear reprogramming from already differentiated somatic cells.

  7. Passage number affects the pluripotency of mouse embryonic stem cells as judged by tetraploid embryo aggregation.

    PubMed

    Li, Xiang-Yun; Jia, Qing; Di, Ke-Qian; Gao, Shu-Min; Wen, Xiao-Hui; Zhou, Rong-Yan; Wei, Wei; Wang, Li-Ze

    2007-03-01

    The aim of this study was to determine whether the number of passages affected the developmental pluripotency of embryonic stem (ES) cells as measured by the attainment of adult fertile mice derived from embryonic stem (ES) cell/tetraploid embryo complementation. Thirty-six newborns were produced by the aggregation of tetraploid embryos and hybrid ES cells after various numbers of passages. These newborns were entirely derived from ES cells as judged by microsatellite DNA, coat-color phenotype, and germline transmission. Although 15 survived to adulthood, 17 died of respiratory failure, and four were eaten by their foster mother. From the 15 mice that reached adulthood and that could reproduce, none arose from ES cells at passage level 15 or more. All 15 arose from cells at passages 3-11. Our results demonstrate that the number of passages affects the developmental pluripotency of ES cells.

  8. Site-Specific Genome Engineering in Human Pluripotent Stem Cells

    PubMed Central

    Merkert, Sylvia; Martin, Ulrich

    2016-01-01

    The possibility to generate patient-specific induced pluripotent stem cells (iPSCs) offers an unprecedented potential of applications in clinical therapy and medical research. Human iPSCs and their differentiated derivatives are tools for diseases modelling, drug discovery, safety pharmacology, and toxicology. Moreover, they allow for the engineering of bioartificial tissue and are promising candidates for cellular therapies. For many of these applications, the ability to genetically modify pluripotent stem cells (PSCs) is indispensable, but efficient site-specific and safe technologies for genetic engineering of PSCs were developed only recently. By now, customized engineered nucleases provide excellent tools for targeted genome editing, opening new perspectives for biomedical research and cellular therapies. PMID:27347935

  9. [Research for cell therapy by induced pluripotent stem cell].

    PubMed

    Sakurai, Hidetoshi; Yamanaka, Shinya

    2011-12-01

    Induced pluripotent stem (iPS) cells, which are generated from somatic cells, are expected to be a hopeful source for cell therapy to treat intractable diseases due to its unlimited proliferation potential, differentiation potentials and the capability of autotransplantation characteristics. In this review, we have summarized the extension of iPS cell researches into cell therapy and the new researches associated with iPS cell technology. However, transplantation of iPS cell-derived tissue is considered to have a risk of tumorigenesis which is one of the major hurdles of using pluripotent stem cell in clinical application. This review is also focused on new strategies for reducing a risk of tumorigenesis.

  10. Site-Specific Genome Engineering in Human Pluripotent Stem Cells.

    PubMed

    Merkert, Sylvia; Martin, Ulrich

    2016-06-24

    The possibility to generate patient-specific induced pluripotent stem cells (iPSCs) offers an unprecedented potential of applications in clinical therapy and medical research. Human iPSCs and their differentiated derivatives are tools for diseases modelling, drug discovery, safety pharmacology, and toxicology. Moreover, they allow for the engineering of bioartificial tissue and are promising candidates for cellular therapies. For many of these applications, the ability to genetically modify pluripotent stem cells (PSCs) is indispensable, but efficient site-specific and safe technologies for genetic engineering of PSCs were developed only recently. By now, customized engineered nucleases provide excellent tools for targeted genome editing, opening new perspectives for biomedical research and cellular therapies.

  11. Pluripotent stem cell-based heart regeneration: from the developmental and immunological perspectives.

    PubMed

    Lui, Kathy O; Bu, Lei; Li, Ronald A; Chan, Camie W

    2012-03-01

    Heart diseases such as myocardial infarction cause massive loss of cardiomyocytes, but the human heart lacks the innate ability to regenerate. In the adult mammalian heart, a resident progenitor cell population, termed epicardial progenitors, has been identified and reported to stay quiescent under uninjured conditions; however, myocardial infarction induces their proliferation and de novo differentiation into cardiac cells. It is conceivable to develop novel therapeutic approaches for myocardial repair by targeting such expandable sources of cardiac progenitors, thereby giving rise to new muscle and vasculatures. Human pluripotent stem cells such as embryonic stem cells and induced pluripotent stem cells can self-renew and differentiate into the three major cell types of the heart, namely cardiomyocytes, smooth muscle, and endothelial cells. In this review, we describe our current knowledge of the therapeutic potential and challenges associated with the use of pluripotent stem cell and progenitor biology in cell therapy. An emphasis is placed on the contribution of paracrine factors in the growth of myocardium and neovascularization as well as the role of immunogenicity in cell survival and engraftment.

  12. Induced pluripotent stem cells and their use in cardiac and neural regenerative medicine.

    PubMed

    Skalova, Stepanka; Svadlakova, Tereza; Shaikh Qureshi, Wasay Mohiuddin; Dev, Kapil; Mokry, Jaroslav

    2015-02-13

    Stem cells are unique pools of cells that are crucial for embryonic development and maintenance of adult tissue homeostasis. The landmark Nobel Prize winning research by Yamanaka and colleagues to induce pluripotency in somatic cells has reshaped the field of stem cell research. The complications related to the usage of pluripotent embryonic stem cells (ESCs) in human medicine, particularly ESC isolation and histoincompatibility were bypassed with induced pluripotent stem cell (iPSC) technology. The human iPSCs can be used for studying embryogenesis, disease modeling, drug testing and regenerative medicine. iPSCs can be diverted to different cell lineages using small molecules and growth factors. In this review we have focused on iPSC differentiation towards cardiac and neuronal lineages. Moreover, we deal with the use of iPSCs in regenerative medicine and modeling diseases like myocardial infarction, Timothy syndrome, dilated cardiomyopathy, Parkinson's, Alzheimer's and Huntington's disease. Despite the promising potential of iPSCs, genome contamination and low efficacy of cell reprogramming remain significant challenges.

  13. Stem cells on the brain: modeling neurodevelopmental and neurodegenerative diseases using human induced pluripotent stem cells.

    PubMed

    Srikanth, Priya; Young-Pearse, Tracy L

    2014-01-01

    Seven years have passed since the initial report of the generation of induced pluripotent stem cells (iPSCs) from adult human somatic cells, and in the intervening time the field of neuroscience has developed numerous disease models using this technology. Here, we review progress in the field and describe both the advantages and potential pitfalls of modeling neurodegenerative and neurodevelopmental diseases using this technology. We include tables with information on neural differentiation protocols and studies that developed human iPSC lines to model neurological diseases. We also discuss how one can: investigate effects of genetic mutations with iPSCs, examine cell fate-specific phenotypes, best determine the specificity of a phenotype, and bring in vivo relevance to this in vitro technique.

  14. Pluripotent versus totipotent plant stem cells: dependence versus autonomy?

    PubMed

    Verdeil, Jean-Luc; Alemanno, Laurence; Niemenak, Nicolas; Tranbarger, Timothy John

    2007-06-01

    Little is known of the mechanisms that induce the dedifferentiation of a single somatic cell into a totipotent embryogenic cell that can either be regenerated or develop into an embryo and subsequently an entire plant. In this Opinion article, we examine the cellular, physiological and molecular similarities and differences between different plant stem cell types. We propose to extend the plant stem cell concept to include single embryogenic cells as a totipotent stem cell based on their capacity to regenerate or develop into an embryo under certain conditions. Our survey suggests that differences in chromatin structure might ensure that meristem-localized stem cells have supervised freedom and are pluripotent, and that embryogenic stem cells are unsupervised, autonomous and, hence, freely totipotent.

  15. Generation of induced pluripotent stem cells with high efficiency from human embryonic renal cortical cells

    PubMed Central

    Yao, Ling; Chen, Ruifang; Wang, Pu; Zhang, Qi; Tang, Hailiang; Sun, Huaping

    2016-01-01

    Reprogramming of somatic cells into induced pluripotent stem cells (iPSCs) emerges as a prospective therapeutic angle in regenerative medicine and a tool for drug screening. Although increasing numbers of iPSCs from different sources have been generated, there has been limited progress in yield of iPSC. Here, we show that four Yamanaka factors Oct4, Sox2, Klf4 and c-Myc can convert human embryonic renal cortical cells (hERCCs) to pluripotent stem cells with a roughly 40-fold higher reprogramming efficiency compared with that of adult human dermal fibroblasts. These iPSCs show pluripotency in vitro and in vivo, as evidenced by expression of pluripotency associated genes, differentiation into three embryonic germ layers by teratoma tests, as well as neuronal fate specification by embryoid body formation. Moreover, the four exogenous genes are effectively silenced in these iPSCs. This study highlights the use of hERCCs to generate highly functional human iPSCs which may aid the study of genetic kidney diseases and accelerate the development of cell-based regenerative therapy. PMID:27904699

  16. Generation of Induced Pluripotent Stem Cells from Mammalian Endangered Species.

    PubMed

    Ben-Nun, Inbar Friedrich; Montague, Susanne C; Houck, Marlys L; Ryder, Oliver; Loring, Jeanne F

    2015-01-01

    For some highly endangered species there are too few reproductively capable animals to maintain adequate genetic diversity, and extraordinary measures are necessary to prevent their extinction. Cellular reprogramming is a means to capture the genomes of individual animals as induced pluripotent stem cells (iPSCs), which may eventually facilitate reintroduction of genetic material into breeding populations. Here, we describe a method for generating iPSCs from fibroblasts of mammalian endangered species.

  17. Tumors originating from induced pluripotent stem cells and methods for their prevention.

    PubMed

    Duinsbergen, Dirk; Salvatori, Daniela; Eriksson, Malin; Mikkers, Harald

    2009-09-01

    Pluripotent stem cells represent an almost unlimited source of most somatic cell types, providing them with great potential for cell-based therapies. The earliest methods used for generating human pluripotent stem cells as embryonic stem cells from human embryos suffered from ethical and technical drawbacks. These problems have been solved in part through the efficient induction of pluripotency in somatic cells using forced expression of a tetrad of factors. Here, we describe the formation of rhabdomyosarcomas originating from factor-induced pluripotent stem (iPS) cells derived from mouse neural stem cells. This underscores the commonly accepted notion that the use of retroviral delivery methods for inducing pluripotency will not be suited for clinical applications. However, the iPS cell field is developing rapidly. Safer protocols are now available for producing pluripotent stem cells. Here the current state-of-the-art in this field will be discussed.

  18. Mechanisms underlying the formation of induced pluripotent stem cells.

    PubMed

    González, Federico; Huangfu, Danwei

    2016-01-01

    Human pluripotent stem cells (hPSCs) offer unique opportunities for studying human biology, modeling diseases, and therapeutic applications. The simplest approach so far to generate human PSC lines is through reprogramming of somatic cells from an individual by defined factors, referred to simply as reprogramming. Reprogramming circumvents the ethical controversies associated with human embryonic stem cells (hESCs) and nuclear transfer hESCs (nt-hESCs), and the resulting induced pluripotent stem cells (hiPSCs) retain the same basic genetic makeup as the somatic cell used for reprogramming. Since the first report of iPSCs by Takahashi and Yamanaka (Cell 2006, 126:663-676), the molecular mechanisms of reprogramming have been extensively investigated. A better mechanistic understanding of reprogramming is fundamental not only to iPSC biology and improving the quality of iPSCs for therapeutic use, but also to our understanding of the molecular basis of cell identity, pluripotency, and plasticity. Here, we summarize the genetic, epigenetic, and cellular events during reprogramming, and the roles of various factors identified thus far in the reprogramming process. WIREs Dev Biol 2016, 5:39-65. doi: 10.1002/wdev.206 For further resources related to this article, please visit the WIREs website.

  19. [Progress and potential applications of induced pluripotent stem cell technology].

    PubMed

    Wu, Cui-Ling; Zhang, Yu-Ming

    2014-08-01

    Differentiated somatic cells can be reprogrammed to a pluripotent state through ectopic expression of specific transcription factors. These reprogrammed cells, which were designated as induced pluripotent stem (iPS) cells, are detected to exhibit unlimited self-renewal capacity and pluripotency. This breakthrough in stem cell research provides a powerful and novel tool for the studies on pathogenesis of diseases, reprogramming mechanism and development of new therapies. For this reason, the iPSC technology has currently become one of the hot topics in stem cells research. Recently, major progress in this field has been achieved: initially, researchers succeeded in inducing the reprogramming of mouse fibroblasts by retroviral transduction of four specific transcription factors; in succession, the accelerated development of iPSC technology by employing non-integrating viral vectors, non-viral vectors or removing the introduced foreign genes via gene knock-out has ensured the yields of much safer iPSC; meanwhile, some researches discovered the proofs that a number of micro molecular compounds were potent in accelerating the cellular reprogramming. For a prospect, iPSC are highly promising for regenerative medicine, disease modeling and drug screening. In this review, the recent progress in the generation of iPSC, prospects of their possible clinical applications and problems in the iPSC research are summarized and discussed.

  20. Generation of parthenogenetic induced pluripotent stem cells from parthenogenetic neural stem cells.

    PubMed

    Do, Jeong Tae; Joo, Jin Young; Han, Dong Wook; Araúzo-Bravo, Marcos J; Kim, Min Jung; Greber, Boris; Zaehres, Holm; Sobek-Klocke, Ingeborg; Chung, Hyung Min; Schöler, Hans R

    2009-12-01

    Somatic cells can achieve a pluripotent cell state in a process called pluripotential reprogramming. Multipotent stem cells can differentiate into cells of only one lineage, but pluripotent stem cells can give rise to cells of all three germ layers of an organism. In this study, we generated induced pluripotent stem (iPS) cells from bimaternal (uniparental) parthenogenetic neural stem cells (pNSCs) by transduction with either four (4F: Oct4, Klf4, Sox2, and c-Myc) or two (2F: Oct4 and Klf4) transcription factors. The resultant maternal iPS cells, which were reprogrammed directly from pNSCs, were capable of generating germ line-competent chimeras. Interestingly, analysis of global gene expression and imprinting status revealed that parthenogenetic iPS cells clustered closer to parthenogenetic ESCs than to female ESCs, with patterns that were clearly distinct from those of pNSCs.

  1. Deriving blood stem cells from pluripotent stem cells for research and therapy.

    PubMed

    Daley, George Q

    2014-01-01

    Embryonic stem cells and induced pluripotent stem cells offer promise for research and treatment of hematologic diseases. While broad clinical application in humans is still a distant prospect, there are promising near-term applications in transfusion of platelets and red blood cells.

  2. Expression of stem cell pluripotency factors during regeneration in newts.

    PubMed

    Maki, Nobuyasu; Suetsugu-Maki, Rinako; Tarui, Hiroshi; Agata, Kiyokazu; Del Rio-Tsonis, Katia; Tsonis, Panagiotis A

    2009-06-01

    In this study, we present data indicating that mammalian stem cell pluripotency-inducing factors are expressed during lens and limb regeneration in newts. The apparent expression even in intact tissues and the ensued regulation during regeneration raises the possibility that these factors might regulate tissue-specific reprogramming and regeneration. Furthermore, these factors should enable us to understand the similarities and differences between animal regeneration in the newt and stem cell strategies in mammals. Developmental Dynamics 238:1613-1616, 2009. (c) 2009 Wiley-Liss, Inc.

  3. Current state of the opportunities for derivation of germ-like cells from pluripotent stem cells: are you a man, or a mouse?

    PubMed Central

    Petkova, Rumena; Arabadjiev, Borislav; Chakarov, Stoyan; Pankov, Roumen

    2014-01-01

    The concept of pluripotency as a prerogative of cells of early mammal embryos and cultured embryonic stem cells (ESC) has been invalidated with the advent of induced pluripotent stem cells. Later, it became clear that the ability to generate all cell types of the adult organism is also a questionable aspect of pluripotency, as there are cell types, such as germ cells, which are difficult to produce from pluripotent stem cells. Recently it has been proposed that there are at least two different states of pluripotency; namely, the naïve, or ground state, and the primed state, which may differ radically in terms of timeline of existence, signalling mechanisms, cell properties, capacity for differentiation into different cell types, etc. Germ-like male and female rodent cells have been successfully produced in vitro from ESC and induced pluripotent stem cells. The attempts to derive primate primordial germ cells (PGC) and germ cells in vitro from pluripotent stem cells, however, still have a low success rate, especially with the female germline. The paper reviews the properties of rodent and primate ESC with regard to their capacity for differentiation in vitro to germ-like cells, outlining the possible caveats to derivation of PGC and germ cells from primate and human pluripotent cells. PMID:26019504

  4. Big Animal Cloning Using Transgenic Induced Pluripotent Stem Cells: A Case Study of Goat Transgenic Induced Pluripotent Stem Cells.

    PubMed

    Song, Hui; Li, Hui; Huang, Mingrui; Xu, Dan; Wang, Ziyu; Wang, Feng

    2016-02-01

    Using of embryonic stem cells (ESCs) could improve production traits and disease resistance by improving the efficiency of somatic cell nuclear transfer (SCNT) technology. However, robust ESCs have not been established from domestic ungulates. In the present study, we generated goat induced pluripotent stem cells (giPSCs) and transgenic cloned dairy goat induced pluripotent stem cells (tgiPSCs) from dairy goat fibroblasts (gFs) and transgenic cloned dairy goat fibroblasts (tgFs), respectively, using lentiviruses that contained hOCT4, hSOX2, hMYC, and hKLF4 without chemical compounds. The giPSCs and tgiPSCs expressed endogenous pluripotent markers, including OCT4, SOX2, MYC, KLF4, and NANOG. Moreover, they were able to maintain a normal karyotype and differentiate into derivatives from all three germ layers in vitro and in vivo. Using SCNT, tgFs and tgiPSCs were used as donor cells to produce embryos, which were named tgF-Embryos and tgiPSC-Embryos. The fusion rates and cleavage rates had no significant differences between tgF-Embryos and tgiPSC-Embryos. However, the expression of IGF-2, which is an important gene associated with embryonic development, was significantly lower in tgiPSC-Embryos than in tgF-Embryos and was not significantly different from vivo-Embryos.

  5. Vascular potential of human pluripotent stem cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cardiovascular disease is the number one cause of death and disability in the US. Understanding the biological activity of stem and progenitor cells, and their ability to contribute to the repair, regeneration and remodeling of the heart and blood vessels affected by pathological processes is an ess...

  6. The application of induced pluripotent stem cells for bone regeneration: current progress and prospects.

    PubMed

    Teng, Songsong; Liu, Chaoxu; Krettek, Christian; Jagodzinski, Michael

    2014-08-01

    Loss of healthy bone tissue and dysosteogenesis are still common and significant problems in clinics. Cell-based therapy using mesenchymal stem cells (MSCs) has been performed in patients for quite some time, but the inherent drawbacks of these cells, such as the reductions in proliferation rate and osteogenic differentiation potential that occur with aging, greatly limit their further application. Moreover, embryonic stem cells (ESCs) have brought new hope to osteoregenerative medicine because of their full pluripotent differentiation potential and excellent performance in bone regeneration. However, the ethical issues involved in destroying human embryos and the immune reactions that occur after transplantation are two major stumbling blocks impeding the clinical application of ESCs. Instead, induced pluripotent stem cells (iPSCs), which are ESC-like pluripotent cells that are reprogrammed from adult somatic cells using defined transcription factors, are considered a more promising source of cells for regenerative medicine because they present no ethical or immunological issues. Here, we summarize the primary technologies for generating iPSCs and the biological properties of these cells, review the current advances in iPSC-based bone regeneration and, finally, discuss the remaining challenges associated with these cells, particularly safety issues and their potential application for osteoregenerative medicine.

  7. Genome editing in pluripotent stem cells: research and therapeutic applications.

    PubMed

    Deleidi, Michela; Yu, Cong

    2016-05-06

    Recent progress in human pluripotent stem cell (hPSC) and genome editing technologies has opened up new avenues for the investigation of human biology in health and disease as well as the development of therapeutic applications. Gene editing approaches with programmable nucleases have been successfully established in hPSCs and applied to study gene function, develop novel animal models and perform genetic and chemical screens. Several studies now show the successful editing of disease-linked alleles in somatic and patient-derived induced pluripotent stem cells (iPSCs) as well as in animal models. Importantly, initial clinical trials have shown the safety of programmable nucleases for ex vivo somatic gene therapy. In this context, the unlimited proliferation potential and the pluripotent properties of iPSCs may offer advantages for gene targeting approaches. However, many technical and safety issues still need to be addressed before genome-edited iPSCs are translated into the clinical setting. Here, we provide an overview of the available genome editing systems and discuss opportunities and perspectives for their application in basic research and clinical practice, with a particular focus on hPSC based research and gene therapy approaches. Finally, we discuss recent research on human germline genome editing and its social and ethical implications.

  8. In Vitro Derivation and Propagation of Spermatogonial Stem Cell Activity from Mouse Pluripotent Stem Cells.

    PubMed

    Ishikura, Yukiko; Yabuta, Yukihiro; Ohta, Hiroshi; Hayashi, Katsuhiko; Nakamura, Tomonori; Okamoto, Ikuhiro; Yamamoto, Takuya; Kurimoto, Kazuki; Shirane, Kenjiro; Sasaki, Hiroyuki; Saitou, Mitinori

    2016-12-06

    The in vitro derivation and propagation of spermatogonial stem cells (SSCs) from pluripotent stem cells (PSCs) is a key goal in reproductive science. We show here that when aggregated with embryonic testicular somatic cells (reconstituted testes), primordial germ cell-like cells (PGCLCs) induced from mouse embryonic stem cells differentiate into spermatogonia-like cells in vitro and are expandable as cells that resemble germline stem cells (GSCs), a primary cell line with SSC activity. Remarkably, GSC-like cells (GSCLCs), but not PGCLCs, colonize adult testes and, albeit less effectively than GSCs, contribute to spermatogenesis and fertile offspring. Whole-genome analyses reveal that GSCLCs exhibit aberrant methylation at vulnerable regulatory elements, including those critical for spermatogenesis, which may restrain their spermatogenic potential. Our study establishes a strategy for the in vitro derivation of SSC activity from PSCs, which, we propose, relies on faithful epigenomic regulation.

  9. From cloned frogs to patient matched stem cells: induced pluripotency or somatic cell nuclear transfer?

    PubMed

    Yamada, Mitsutoshi; Byrne, James; Egli, Dieter

    2015-10-01

    Nuclear transfer has seen a remarkable comeback in the past few years. Three groups have independently reported the derivation of stem cell lines by somatic cell nuclear transfer, from either adult, neonatal or fetal cells. Though the ability of human oocytes to reprogram somatic cells to stem cells had long been anticipated, success did not arrive on a straightforward path. Little was known about human oocyte biology, and nuclear transfer protocols developed in animals required key changes to become effective with human eggs. By overcoming these challenges, human nuclear transfer research has contributed to a greater understanding of oocyte biology, provided a point of reference for the comparison of induced pluripotent stem cells, and delivered a method for the generation of personalized stem cells with therapeutic potential.

  10. Nitric Oxide And Hypoxia Response In Pluripotent Stem Cells.

    PubMed

    Infantes, Estefanía Caballano; Prados, Ana Belén Hitos; Contreras, Irene Díaz; Cahuana, Gladys M; Hmadcha, Abdelkrim; Bermudo, Franz Martín; Soria, Bernat; Huamán, Juan R Tejedo; Bergua, Francisco J Bedoya

    2015-08-01

    The expansion of pluripotent cells (ESCs and iPSCs) under conditions that maintain their pluripotency is necessary to implement a cell therapy program. Previously, we have described that low nitric oxide (NO) donor diethylenetriamine/nitric oxide adduct (DETA-NO) added to the culture medium, promote the expansion of these cell types. The molecular mechanisms are not yet known. We present evidences that ESC and iPSCs in normoxia in presence of low NO triggers a similar response to hypoxia, thus maintaining the pluripotency. We have studied the stability of HIF-1α (Hypoxia Inducible Factor) in presence of low NO. Because of the close relationship between hypoxia, metabolism, mitochondrial function and pluripotency we have analyzed by q RT-PCR the expression of genes involved in the glucose metabolism such as: HK2, LDHA and PDK1; besides other HIF-1α target gene. We further analyzed the expression of genes involved in mitochondrial biogenesis such as PGC1α, TFAM and NRF1 and we have observed that low NO maintains the same pattern of expression that in hypoxia. The study of the mitochondrial membrane potential using Mito-Tracker dye showed that NO decrease the mitochondrial function. We will analyze other metabolic parameters, to determinate if low NO regulates mitochondrial function and mimics Hypoxia Response. The knowledge of the role of NO in the Hypoxia Response and the mechanism that helps to maintain self-renewal in pluripotent cells in normoxia, can help to the design of culture media where NO could be optimal for stem cell expansion in the performance of future cell therapies.

  11. Characterization of Induced Pluripotent Stem Cell Microvesicle Genesis, Morphology and Pluripotent Content

    PubMed Central

    Zhou, Jing; Ghoroghi, Shima; Benito-Martin, Alberto; Wu, Hao; Unachukwu, Uchenna John; Einbond, Linda Saxe; Guariglia, Sara; Peinado, Hector; Redenti, Stephen

    2016-01-01

    Microvesicles (MVs) are lipid bilayer-covered cell fragments that range in diameter from 30 nm–1uM and are released from all cell types. An increasing number of studies reveal that MVs contain microRNA, mRNA and protein that can be detected in the extracellular space. In this study, we characterized induced pluripotent stem cell (iPSC) MV genesis, content and fusion to retinal progenitor cells (RPCs) in vitro. Nanoparticle tracking revealed that iPSCs released approximately 2200 MVs cell/hour in the first 12 hrs with an average diameter of 122 nm. Electron and light microscopic analysis of iPSCs showed MV release via lipid bilayer budding. The mRNA content of iPSC MVs was characterized and revealed the presence of the transcription factors Oct-3/4, Nanog, Klf4, and C-Myc. The protein content of iPSCs MVs, detected by immunogold electron microscopy, revealed the presence of the Oct-3/4 and Nanog. Isolated iPSC MVs were shown to fuse with RPCs in vitro at multiple points along the plasma membrane. These findings demonstrate that the mRNA and protein cargo in iPSC MVs have established roles in maintenance of pluripotency. Building on this work, iPSC derived MVs may be shown to be involved in maintaining cellular pluripotency and may have application in regenerative strategies for neural tissue. PMID:26797168

  12. Advances in genetic modification of pluripotent stem cells.

    PubMed

    Fontes, Andrew; Lakshmipathy, Uma

    2013-11-15

    Genetically engineered stem cells aid in dissecting basic cell function and are valuable tools for drug discovery, in vivo cell tracking, and gene therapy. Gene transfer into pluripotent stem cells has been a challenge due to their intrinsic feature of growing in clusters and hence not amenable to common gene delivery methods. Several advances have been made in the rapid assembly of DNA elements, optimization of culture conditions, and DNA delivery methods. This has lead to the development of viral and non-viral methods for transient or stable modification of cells, albeit with varying efficiencies. Most methods require selection and clonal expansion that demand prolonged culture and are not suited for cells with limited proliferative potential. Choosing the right platform based on preferred length, strength, and context of transgene expression is a critical step. Random integration of the transgene into the genome can be complicated due to silencing or altered regulation of expression due to genomic effects. An alternative to this are site-specific methods that target transgenes followed by screening to identify the genomic loci that support long-term expression with stem cell proliferation and differentiation. A highly precise and accurate editing of the genome driven by homology can be achieved using traditional methods as well as the newer technologies such as zinc finger nuclease, TAL effector nucleases and CRISPR. In this review, we summarize the different genetic engineering methods that have been successfully used to create modified embryonic and induced pluripotent stem cells.

  13. Mitochondrial function in pluripotent stem cells and cellular reprogramming.

    PubMed

    Bukowiecki, Raul; Adjaye, James; Prigione, Alessandro

    2014-01-01

    Mitochondria are organelles playing pivotal roles in a range of diverse cellular functions, from energy generation to redox homeostasis and apoptosis regulation. Their loss of functionality may indeed contribute to the development of aging and age-related neurodegenerative disorders. Recently, mitochondria have been shown to exhibit peculiar features in pluripotent stem cells (PSCs). Moreover, an extensive restructuring of mitochondria has been observed during the process of cellular reprogramming, i.e. the conversion of somatic cells into induced pluripotent stem cells (iPSCs). These transformation events impact mitochondrial number, morphology, activity, cellular metabolism, and mtDNA integrity. PSCs retain the capability to self-renew indefinitely and to give rise to virtually any cell type of the body and thus hold great promise in medical research. Understanding the mitochondrial properties of PSCs, and how to modulate them, may thus help to shed light on the features of stemness and possibly increase our knowledge on cellular identity and differentiation pathways. Here, we review these recent findings and discuss their implications in the context of stem cell biology, aging research, and regenerative medicine.

  14. Derivation of endodermal progenitors from pluripotent stem cells†

    PubMed Central

    Ikonomou, Laertis; Kotton, Darrell N.

    2014-01-01

    Stem and progenitor cells play important roles in organogenesis during development and in tissue homeostasis and response to injury postnatally. As the regenerative capacity of many human tissues is limited, cell replacement therapies hold great promise for human disease management. Pluripotent stem cells such as embryonic stem (ES) cells and induced pluripotent stem (iPS) cells are prime candidates for the derivation of unlimited quantities of clinically relevant cell types through development of directed differentiation protocols, i.e. the recapitulation of developmental milestones in in vitro cell culture. Tissue-specific progenitors, including progenitors of endodermal origin, are important intermediates in such protocols since they give rise to all mature parenchymal cells. In this review, we focus on the in vivo biology of embryonic endodermal progenitors in terms of key transcription factors and signaling pathways. We critically review the emerging literature aiming to apply this basic knowledge to achieve the efficient and reproducible in vitro derivation of endodermal progenitors such as pancreas, liver and lung precursor cells. PMID:25160562

  15. [The prospect of pluripotent stem cell-based therapy].

    PubMed

    Borisenko, G G

    2009-01-01

    Human embrional stem cells (hESC) are able to maintain pluripotency in culture, to proliferate indefinitely and to differentiate into any somatic cell type. Due to these unique properties, hESC may become an exceptional source of tissues for transplantation and have great potential for the therapy of incurable diseases. Here, we review new developments in the area of embrional stem cells and discuss major challenges--standartization of protocols for cell derivation and cultivation, identification of specific molecular markers, development of new aprouches for directed differentiation etc.--which remain to be settled, prior to safe and successful clinical application of stem cells. We appraise several potential approaches of hESC therapy including derivation of autologous cells via therapeutic cloning (1), generation of immune tolerance to allogenic donor cells via hematopoetic chimerism (2), and development of the banks of hESC lines (3). In addition, we discuss brifly induced pluripotent cells, which are derived via genetic modification of autologous somatic cells and are analogous to ESC. Our analysis demonstrates that uncontrollable differentiation in vivo and teratogenic potential of hESC are critical limitations of their application in clinic. Therefore, the major direction of hESC use is derivation of a specific differentiated progeny, which has lower proliferative potential and immune privilege, yet poses fewer risks. Finally, cell therapy is far more complex and resource-consuming process as compared to drug-based medicine; pluripotent stem cell biology and technology is in need of further investigation and development before these cells can be used in clinics.

  16. Retinal Organoids from Pluripotent Stem Cells Efficiently Recapitulate Retinogenesis.

    PubMed

    Völkner, Manuela; Zschätzsch, Marlen; Rostovskaya, Maria; Overall, Rupert W; Busskamp, Volker; Anastassiadis, Konstantinos; Karl, Mike O

    2016-04-12

    The plasticity of pluripotent stem cells provides new possibilities for studying development, degeneration, and regeneration. Protocols for the differentiation of retinal organoids from embryonic stem cells have been developed, which either recapitulate complete eyecup morphogenesis or maximize photoreceptor genesis. Here, we have developed a protocol for the efficient generation of large, 3D-stratified retinal organoids that does not require evagination of optic-vesicle-like structures, which so far limited the organoid yield. Analysis of gene expression in individual organoids, cell birthdating, and interorganoid variation indicate efficient, reproducible, and temporally regulated retinogenesis. Comparative analysis of a transgenic reporter for PAX6, a master regulator of retinogenesis, shows expression in similar cell types in mouse in vivo, and in mouse and human retinal organoids. Early or late Notch signaling inhibition forces cell differentiation, generating organoids enriched with cone or rod photoreceptors, respectively, demonstrating the power of our improved organoid system for future research in stem cell biology and regenerative medicine.

  17. Pluripotency of embryo-derived stem cells from rodents, lagomorphs, and primates: Slippery slope, terrace and cliff.

    PubMed

    Savatier, Pierre; Osteil, Pierre; Tam, Patrick P L

    2017-01-17

    The diverse cell states and in vitro conditions for the derivation and maintenance of the mammalian embryo-derived pluripotent stem cells raise the questions of whether there are multiple states of pluripotency of the stem cells of each species, and if there are innate species-specific variations in the pluripotency state. We will address these questions by taking a snapshot of our knowledge of the properties of the pluripotent stem cells, focusing on the maintenance of pluripotency and inter-conversion of the different types of pluripotent stem cells from rodents, lagomorphs and primates. We conceptualize pluripotent stem cells acquiring a series of cellular states represented as terraces on a slope of descending gradient of pluripotency. We propose that reprogramming pluripotent stem cells from a primed to a naive state is akin to moving upstream over a steep cliff to a higher terrace.

  18. Choices for Induction of Pluripotency: Recent Developments in Human Induced Pluripotent Stem Cell Reprogramming Strategies.

    PubMed

    Brouwer, Marinka; Zhou, Huiqing; Nadif Kasri, Nael

    2016-02-01

    The ability to generate human induced pluripotent stem cells (iPSCs) from somatic cells provides tremendous promises for regenerative medicine and its use has widely increased over recent years. However, reprogramming efficiencies remain low and chromosomal instability and tumorigenic potential are concerns in the use of iPSCs, especially in clinical settings. Therefore, reprogramming methods have been under development to generate safer iPSCs with higher efficiency and better quality. Developments have mainly focused on the somatic cell source, the cocktail of reprogramming factors, the delivery method used to introduce reprogramming factors and culture conditions to maintain the generated iPSCs. This review discusses the developments on these topics and briefly discusses pros and cons of iPSCs in comparison with human embryonic stem cells generated from somatic cell nuclear transfer.

  19. Modeling Fragile X Syndrome Using Human Pluripotent Stem Cells

    PubMed Central

    Mor-Shaked, Hagar; Eiges, Rachel

    2016-01-01

    Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from a loss-of-function mutation by a CGG repeat expansion at the 5′ untranslated region of the X-linked fragile X mental retardation 1 (FMR1) gene. Expansion of the CGG repeats beyond 200 copies results in protein deficiency by leading to aberrant methylation of the FMR1 promoter and the switch from active to repressive histone modifications. Additionally, the CGGs become increasingly unstable, resulting in high degree of variation in expansion size between and within tissues of affected individuals. It is still unclear how the FMR1 protein (FMRP) deficiency leads to disease pathology in neurons. Nor do we know the mechanisms by which the CGG expansion results in aberrant DNA methylation, or becomes unstable in somatic cells of patients, at least in part due to the lack of appropriate animal or cellular models. This review summarizes the current contribution of pluripotent stem cells, mutant human embryonic stem cells, and patient-derived induced pluripotent stem cells to disease modeling of FXS for basic and applied research, including the development of new therapeutic approaches. PMID:27690107

  20. Induced pluripotent stem cells and neurological disease models.

    PubMed

    Cai, Sa; Chan, Ying-Shing; Shum, Daisy Kwok-Yan

    2014-02-25

    The availability of human stem cells heralds a new era for in vitro cell-based modeling of neurodevelopmental and neurodegenerative diseases. Adding to the excitement is the discovery that somatic cells of patients can be reprogrammed to a pluripotent state from which neural lineage cells that carry the disease genotype can be derived. These in vitro cell-based models of neurological diseases hold promise for monitoring of disease initiation and progression, and for testing of new drug treatments on the patient-derived cells. In this review, we focus on the prospective applications of different stem cell types for disease modeling and drug screening. We also highlight how the availability of patient-specific induced pluripotent stem cells (iPS cells) offers a unique opportunity for studying and modeling human neurodevelopmental and neurodegenerative diseases in vitro and for testing small molecules or other potential therapies for these disorders. Finally, the limitations of this technology from the standpoint of reprogramming efficiency and therapeutic safety are discussed.

  1. Xeno-free culture of human pluripotent stem cells.

    PubMed

    Bergström, Rosita; Ström, Susanne; Holm, Frida; Feki, Anis; Hovatta, Outi

    2011-01-01

    Stem cell culture systems that rely on undefined animal-derived components introduce variability to the cultures and complicate their therapeutic use. The derivation of human embryonic stem cells and the development of methods to produce induced pluripotent stem cells combined with their potential to treat human diseases have accelerated the drive to develop xenogenic-free, chemically defined culture systems that support pluripotent self-renewal and directed differentiation. In this chapter, we describe four xeno-free culture systems that have been successful in supporting undifferentiated growth of hPSCs as well as methods for xeno-free subculture and cryopreservation of hPSCs. Each culture system consists of a xeno-free growth medium and xeno-free substratum: (1) TeSR2™ with human recombinant laminin (LN-511); (2) NutriStem™ with LN-511; (3) RegES™ with human foreskin fibroblasts (hFFs); (4) KO-SR Xeno-Free™/GF cocktail with CELLstart™ matrix.

  2. hPSCreg--the human pluripotent stem cell registry.

    PubMed

    Seltmann, Stefanie; Lekschas, Fritz; Müller, Robert; Stachelscheid, Harald; Bittner, Marie-Sophie; Zhang, Weiping; Kidane, Luam; Seriola, Anna; Veiga, Anna; Stacey, Glyn; Kurtz, Andreas

    2016-01-04

    The human pluripotent stem cell registry (hPSCreg), accessible at http://hpscreg.eu, is a public registry and data portal for human embryonic and induced pluripotent stem cell lines (hESC and hiPSC). Since their first isolation the number of hESC lines has steadily increased to over 3000 and new iPSC lines are generated in a rapidly growing number of laboratories as a result of their potentially broad applicability in biomedicine and drug testing. Many of these lines are deposited in stem cell banks, which are globally established to store tens of thousands of lines from healthy and diseased donors. The Registry provides comprehensive and standardized biological and legal information as well as tools to search and compare information from multiple hPSC sources and hence addresses a translational research need. To facilitate unambiguous identification over different resources, hPSCreg automatically creates a unique standardized name for each cell line registered. In addition to biological information, hPSCreg stores extensive data about ethical standards regarding cell sourcing and conditions for application and privacy protection. hPSCreg is the first global registry that holds both, manually validated scientific and ethical information on hPSC lines, and provides access by means of a user-friendly, mobile-ready web application.

  3. Induced Pluripotent Stem Cell Technology in Regenerative Medicine and Biology

    NASA Astrophysics Data System (ADS)

    Pei, Duanqing; Xu, Jianyong; Zhuang, Qiang; Tse, Hung-Fat; Esteban, Miguel A.

    The potential of human embryonic stem cells (ESCs) for regenerative medicine is unquestionable, but practical and ethical considerations have hampered clinical application and research. In an attempt to overcome these issues, the conversion of somatic cells into pluripotent stem cells similar to ESCs, commonly termed nuclear reprogramming, has been a top objective of contemporary biology. More than 40 years ago, King, Briggs, and Gurdon pioneered somatic cell nuclear reprogramming in frogs, and in 1981 Evans successfully isolated mouse ESCs. In 1997 Wilmut and collaborators produced the first cloned mammal using nuclear transfer, and then Thomson obtained human ESCs from in vitro fertilized blastocysts in 1998. Over the last 2 decades we have also seen remarkable findings regarding how ESC behavior is controlled, the importance of which should not be underestimated. This knowledge allowed the laboratory of Shinya Yamanaka to overcome brilliantly conceptual and technical barriers in 2006 and generate induced pluripotent stem cells (iPSCs) from mouse fibroblasts by overexpressing defined combinations of ESC-enriched transcription factors. Here, we discuss some important implications of human iPSCs for biology and medicine and also point to possible future directions.

  4. hPSCreg—the human pluripotent stem cell registry

    PubMed Central

    Seltmann, Stefanie; Lekschas, Fritz; Müller, Robert; Stachelscheid, Harald; Bittner, Marie-Sophie; Zhang, Weiping; Kidane, Luam; Seriola, Anna; Veiga, Anna; Stacey, Glyn; Kurtz, Andreas

    2016-01-01

    The human pluripotent stem cell registry (hPSCreg), accessible at http://hpscreg.eu, is a public registry and data portal for human embryonic and induced pluripotent stem cell lines (hESC and hiPSC). Since their first isolation the number of hESC lines has steadily increased to over 3000 and new iPSC lines are generated in a rapidly growing number of laboratories as a result of their potentially broad applicability in biomedicine and drug testing. Many of these lines are deposited in stem cell banks, which are globally established to store tens of thousands of lines from healthy and diseased donors. The Registry provides comprehensive and standardized biological and legal information as well as tools to search and compare information from multiple hPSC sources and hence addresses a translational research need. To facilitate unambiguous identification over different resources, hPSCreg automatically creates a unique standardized name for each cell line registered. In addition to biological information, hPSCreg stores extensive data about ethical standards regarding cell sourcing and conditions for application and privacy protection. hPSCreg is the first global registry that holds both, manually validated scientific and ethical information on hPSC lines, and provides access by means of a user-friendly, mobile-ready web application. PMID:26400179

  5. Induced pluripotent stem cell technology in regenerative medicine and biology.

    PubMed

    Pei, Duanqing; Xu, Jianyong; Zhuang, Qiang; Tse, Hung-Fat; Esteban, Miguel A

    2010-01-01

    The potential of human embryonic stem cells (ESCs) for regenerative medicine is unquestionable, but practical and ethical considerations have hampered clinical application and research. In an attempt to overcome these issues, the conversion of somatic cells into pluripotent stem cells similar to ESCs, commonly termed nuclear reprogramming, has been a top objective of contemporary biology. More than 40 years ago, King, Briggs, and Gurdon pioneered somatic cell nuclear reprogramming in frogs, and in 1981 Evans successfully isolated mouse ESCs. In 1997 Wilmut and collaborators produced the first cloned mammal using nuclear transfer, and then Thomson obtained human ESCs from in vitro fertilized blastocysts in 1998. Over the last 2 decades we have also seen remarkable findings regarding how ESC behavior is controlled, the importance of which should not be underestimated. This knowledge allowed the laboratory of Shinya Yamanaka to overcome brilliantly conceptual and technical barriers in 2006 and generate induced pluripotent stem cells (iPSCs) from mouse fibroblasts by overexpressing defined combinations of ESC-enriched transcription factors. Here, we discuss some important implications of human iPSCs for biology and medicine and also point to possible future directions.

  6. Defining the nature of human pluripotent stem cell progeny.

    PubMed

    Patterson, Michaela; Chan, David N; Ha, Iris; Case, Dana; Cui, Yongyan; Van Handel, Ben; Mikkola, Hanna Ka; Lowry, William E

    2012-01-01

    While it is clear that human pluripotent stem cells (hPSCs) can differentiate to generate a panoply of various cell types, it is unknown how closely in vitro development mirrors that which occurs in vivo. To determine whether human embryonic stem cells (hESCs) and human-induced pluripotent stem cells (hiPSCs) make equivalent progeny, and whether either makes cells that are analogous to tissue-derived cells, we performed comprehensive transcriptome profiling of purified PSC derivatives and their tissue-derived counterparts. Expression profiling demonstrated that hESCs and hiPSCs make nearly identical progeny for the neural, hepatic, and mesenchymal lineages, and an absence of re-expression from exogenous reprogramming factors in hiPSC progeny. However, when compared to a tissue-derived counterpart, the progeny of both hESCs and hiPSCs maintained expression of a subset of genes normally associated with early mammalian development, regardless of the type of cell generated. While pluripotent genes (OCT4, SOX2, REX1, and NANOG) appeared to be silenced immediately upon differentiation from hPSCs, genes normally unique to early embryos (LIN28A, LIN28B, DPPA4, and others) were not fully silenced in hPSC derivatives. These data and evidence from expression patterns in early human fetal tissue (3-16 weeks of development) suggest that the differentiated progeny of hPSCs are reflective of very early human development (< 6 weeks). These findings provide support for the idea that hPSCs can serve as useful in vitro models of early human development, but also raise important issues for disease modeling and the clinical application of hPSC derivatives.

  7. Characteristics of induced human pluripotent stem cells using DNA microarray technology.

    PubMed

    Medvedev, S P; Smetanina, M A; Shevchenko, A I; Zakharova, I S; Malakhova, A A; Grigor'eva, E V; Dementyeva, E V; Aleksandrova, M A; Poltavtseva, R A; Veriasov, V N; Filipenko, M L; Sukhikh, G T; Pokushalov, E A; Zakian, S M

    2013-05-01

    We performed transcriptome analysis of some human induced pluripotent stem cells, embryonic stem cells, and human somatic cells using DNA microarrays. PluriTest bioinformatic system was used for evaluation of cell pluripotency. Changes in the genome structure and status of X-chromosome gene expression was analyzed using microarray technology.

  8. Pluripotent Stem Cells and Skeletal Regeneration – Promise and Potential

    PubMed Central

    Wu, Joy Y.

    2015-01-01

    Bone is a regenerative tissue, capable of healing itself after fractures. However, some circumstances such as critical size defects, malformations, and tumor destruction may exceed the skeleton’s capacity for self-repair. In addition, bone mass and strength decline with age, leading to an increase in fragility fractures. Therefore the ability to generate large numbers of patient-specific osteoblasts would have enormous clinical implications for the treatment of skeletal defects and diseases. This review will highlight recent advances in the derivation of pluripotent stem cells, and in their directed differentiation towards bone-forming osteoblasts. PMID:26260198

  9. Fluorescence lifetime imaging of induced pluripotent stem cells

    NASA Astrophysics Data System (ADS)

    Uchugonova, Aisada; Batista, Ana; König, Karsten

    2014-02-01

    The multiphoton FLIM tomograph MPTflex with its flexible scan head, articulated arm, and the tunable femtosecond laser source was employed to study cell monolayers and 3D cell clusters. FLIM was performed with 250 ps temporal resolution and submicron special resolution using time-correlated single photon counting. The autofluorescence based on NAD(P)H and flavins/flavoproteins has been measured in mouse embryonic fibroblasts, induced pluripotent stem cells (iPS cells) originated from mouse embryonic fibroblasts and non-proliferative mouse embryonic fibroblasts.

  10. Tracking the embryonic stem cell transition from ground state pluripotency.

    PubMed

    Kalkan, Tüzer; Olova, Nelly; Roode, Mila; Mulas, Carla; Lee, Heather J; Nett, Isabelle; Marks, Hendrik; Walker, Rachael; Stunnenberg, Hendrik G; Lilley, Kathryn S; Nichols, Jennifer; Reik, Wolf; Bertone, Paul; Smith, Austin

    2017-04-01

    Mouse embryonic stem (ES) cells are locked into self-renewal by shielding from inductive cues. Release from this ground state in minimal conditions offers a system for delineating developmental progression from naïve pluripotency. Here, we examine the initial transition process. The ES cell population behaves asynchronously. We therefore exploited a short-half-life Rex1::GFP reporter to isolate cells either side of exit from naïve status. Extinction of ES cell identity in single cells is acute. It occurs only after near-complete elimination of naïve pluripotency factors, but precedes appearance of lineage specification markers. Cells newly departed from the ES cell state display features of early post-implantation epiblast and are distinct from primed epiblast. They also exhibit a genome-wide increase in DNA methylation, intermediate between early and late epiblast. These findings are consistent with the proposition that naïve cells transition to a distinct formative phase of pluripotency preparatory to lineage priming.

  11. Cripto is essential to capture mouse epiblast stem cell and human embryonic stem cell pluripotency.

    PubMed

    Fiorenzano, Alessandro; Pascale, Emilia; D'Aniello, Cristina; Acampora, Dario; Bassalert, Cecilia; Russo, Francesco; Andolfi, Gennaro; Biffoni, Mauro; Francescangeli, Federica; Zeuner, Ann; Angelini, Claudia; Chazaud, Claire; Patriarca, Eduardo J; Fico, Annalisa; Minchiotti, Gabriella

    2016-09-02

    Known molecular determinants of developmental plasticity are mainly transcription factors, while the extrinsic regulation of this process has been largely unexplored. Here we identify Cripto as one of the earliest epiblast markers and a key extracellular determinant of the naive and primed pluripotent states. We demonstrate that Cripto sustains mouse embryonic stem cell (ESC) self-renewal by modulating Wnt/β-catenin, whereas it maintains mouse epiblast stem cell (EpiSC) and human ESC pluripotency through Nodal/Smad2. Moreover, we provide unprecedented evidence that Cripto controls the metabolic reprogramming in ESCs to EpiSC transition. Remarkably, Cripto deficiency attenuates ESC lineage restriction in vitro and in vivo, and permits ESC transdifferentiation into trophectoderm lineage, suggesting that Cripto has earlier functions than previously recognized. All together, our studies provide novel insights into the current model of mammalian pluripotency and contribute to the understanding of the extrinsic regulation of the first cell lineage decision in the embryo.

  12. Cripto is essential to capture mouse epiblast stem cell and human embryonic stem cell pluripotency

    PubMed Central

    Fiorenzano, Alessandro; Pascale, Emilia; D'Aniello, Cristina; Acampora, Dario; Bassalert, Cecilia; Russo, Francesco; Andolfi, Gennaro; Biffoni, Mauro; Francescangeli, Federica; Zeuner, Ann; Angelini, Claudia; Chazaud, Claire; Patriarca, Eduardo J.; Fico, Annalisa; Minchiotti, Gabriella

    2016-01-01

    Known molecular determinants of developmental plasticity are mainly transcription factors, while the extrinsic regulation of this process has been largely unexplored. Here we identify Cripto as one of the earliest epiblast markers and a key extracellular determinant of the naive and primed pluripotent states. We demonstrate that Cripto sustains mouse embryonic stem cell (ESC) self-renewal by modulating Wnt/β-catenin, whereas it maintains mouse epiblast stem cell (EpiSC) and human ESC pluripotency through Nodal/Smad2. Moreover, we provide unprecedented evidence that Cripto controls the metabolic reprogramming in ESCs to EpiSC transition. Remarkably, Cripto deficiency attenuates ESC lineage restriction in vitro and in vivo, and permits ESC transdifferentiation into trophectoderm lineage, suggesting that Cripto has earlier functions than previously recognized. All together, our studies provide novel insights into the current model of mammalian pluripotency and contribute to the understanding of the extrinsic regulation of the first cell lineage decision in the embryo. PMID:27586544

  13. Pluripotent plasticity of stem cells and liver repopulation.

    PubMed

    Gennero, Luisa; Roos, Maria Augusta; Sperber, Kirk; Denysenko, Tetyana; Bernabei, Paola; Calisti, Gian Franco; Papotti, Mauro; Cappia, Susanna; Pagni, Roberto; Aimo, Giuseppe; Mengozzi, Giulio; Cavallo, Giovanni; Reguzzi, Stefano; Pescarmona, Gian Piero; Ponzetto, Antonio

    2010-04-01

    Different types of stem cells have a role in liver regeneration or fibrous repair during and after several liver diseases. Otherwise, the origin of hepatic and/or extra-hepatic stem cells in reactive liver repopulation is under controversy. The ability of the human body to self-repair and replace the cells and tissues of some organs is often evident. It has been estimated that complete renewal of liver tissue takes place in about a year. Replacement of lost liver tissues is accomplished by proliferation of mature hepatocytes, hepatic oval stem cells differentiation, and sinusoidal cells as support. Hepatic oval cells display a distinct phenotype and have been shown to be a bipotential progenitor of two types of epithelial cells found in the liver, hepatocytes, and bile ductular cells. In gastroenterology and hepatology, the first attempts to translate stem cell basic research into novel therapeutic strategies have been made for the treatment of several disorders, such as inflammatory bowel diseases, diabetes mellitus, celiachy, and acute or chronic hepatopaties. In the future, pluripotent plasticity of stem cells will open a variety of clinical application strategies for the treatment of tissue injuries, degenerated organs. The promise of liver stem cells lie in their potential to provide a continuous and readily available source of liver cells that can be used for gene therapy, cell transplant, bio-artificial liver-assisted devices, drug toxicology testing, and use as an in vitro model to understand the developmental biology of the liver.

  14. Irradiation strongly reduces tumorigenesis of human induced pluripotent stem cells.

    PubMed

    Inui, Shoki; Minami, Kazumasa; Ito, Emiko; Imaizumi, Hiromasa; Mori, Seiji; Koizumi, Masahiko; Fukushima, Satsuki; Miyagawa, Shigeru; Sawa, Yoshiki; Matsuura, Nariaki

    2017-03-03

    Induced pluripotent stem (iPS) cells have demonstrated they can undergo self-renewal, attain pluripotency, and differentiate into various types of functional cells. In clinical transplantation of iPS cells, however, a major problem is the prevention of tumorigenesis. We speculated that tumor formation could be inhibited by means of irradiation. Since the main purpose of this study was to explore the prevention of tumor formation in human iPS (hiPS) cells, we tested the effects of irradiation on tumor-associated factors such as radiosensitivity, pluripotency and cell death in hiPS cells. The irradiated hiPS cells showed much higher radiosensitivity, because the survival fraction of hiPS cells irradiated with 2 Gy was < 10%, and there was no change of pluripotency. Irradiation with 2 and 4 Gy caused substantial cell death, which was mostly the result of apoptosis. Irradiation with 2 Gy was detrimental enough to cause loss of proliferation capability and trigger substantial cell death in vitro. The hiPS cells irradiated with 2 Gy were injected into NOG mice (NOD/Shi-scid, IL-2 Rγnull) for the analysis of tumor formation. The group of mice into which hiPS cells irradiated with 2 Gy was transplanted showed significant suppression of tumor formation in comparison with that of the group into which non-irradiated hiPS cells were transplanted. It can be presumed that this diminished rate of tumor formation was due to loss of proliferation and cell death caused by irradiation. Our findings suggest that tumor formation following cell therapy or organ transplantation induced by hiPS cells may be prevented by irradiation.

  15. Clonal reversal of ageing-associated stem cell lineage bias via a pluripotent intermediate

    PubMed Central

    Wahlestedt, Martin; Erlandsson, Eva; Kristiansen, Trine; Lu, Rong; Brakebusch, Cord; Weissman, Irving L.; Yuan, Joan; Martin-Gonzalez, Javier; Bryder, David

    2017-01-01

    Ageing associates with significant alterations in somatic/adult stem cells and therapies to counteract these might have profound benefits for health. In the blood, haematopoietic stem cell (HSC) ageing is linked to several functional shortcomings. However, besides the recent realization that individual HSCs might be preset differentially already from young age, HSCs might also age asynchronously. Evaluating the prospects for HSC rejuvenation therefore ultimately requires approaching those HSCs that are functionally affected by age. Here we combine genetic barcoding of aged murine HSCs with the generation of induced pluripotent stem (iPS) cells. This allows us to specifically focus on aged HSCs presenting with a pronounced lineage skewing, a hallmark of HSC ageing. Functional and molecular evaluations reveal haematopoiesis from these iPS clones to be indistinguishable from that associating with young mice. Our data thereby provide direct support to the notion that several key functional attributes of HSC ageing can be reversed. PMID:28224997

  16. Chemically Induced Reprogramming of Somatic Cells to Pluripotent Stem Cells and Neural Cells.

    PubMed

    Biswas, Dhruba; Jiang, Peng

    2016-02-06

    The ability to generate transplantable neural cells in a large quantity in the laboratory is a critical step in the field of developing stem cell regenerative medicine for neural repair. During the last few years, groundbreaking studies have shown that cell fate of adult somatic cells can be reprogrammed through lineage specific expression of transcription factors (TFs)-and defined culture conditions. This key concept has been used to identify a number of potent small molecules that could enhance the efficiency of reprogramming with TFs. Recently, a growing number of studies have shown that small molecules targeting specific epigenetic and signaling pathways can replace all of the reprogramming TFs. Here, we provide a detailed review of the studies reporting the generation of chemically induced pluripotent stem cells (ciPSCs), neural stem cells (ciNSCs), and neurons (ciN). We also discuss the main mechanisms of actions and the pathways that the small molecules regulate during chemical reprogramming.

  17. Cardiac regeneration using pluripotent stem cells--progression to large animal models.

    PubMed

    Chong, James J H; Murry, Charles E

    2014-11-01

    Pluripotent stem cells (PSCs) have indisputable cardiomyogenic potential and therefore have been intensively investigated as a potential cardiac regenerative therapy. Current directed differentiation protocols are able to produce high yields of cardiomyocytes from PSCs and studies in small animal models of cardiovascular disease have proven sustained engraftment and functional efficacy. Therefore, the time is ripe for cardiac regenerative therapies using PSC derivatives to be tested in large animal models that more closely resemble the hearts of humans. In this review, we discuss the results of our recent study using human embryonic stem cell derived cardiomyocytes (hESC-CM) in a non-human primate model of ischemic cardiac injury. Large scale remuscularization, electromechanical coupling and short-term arrhythmias demonstrated by our hESC-CM grafts are discussed in the context of other studies using adult stem cells for cardiac regeneration.

  18. Chemically Induced Reprogramming of Somatic Cells to Pluripotent Stem Cells and Neural Cells

    PubMed Central

    Biswas, Dhruba; Jiang, Peng

    2016-01-01

    The ability to generate transplantable neural cells in a large quantity in the laboratory is a critical step in the field of developing stem cell regenerative medicine for neural repair. During the last few years, groundbreaking studies have shown that cell fate of adult somatic cells can be reprogrammed through lineage specific expression of transcription factors (TFs)-and defined culture conditions. This key concept has been used to identify a number of potent small molecules that could enhance the efficiency of reprogramming with TFs. Recently, a growing number of studies have shown that small molecules targeting specific epigenetic and signaling pathways can replace all of the reprogramming TFs. Here, we provide a detailed review of the studies reporting the generation of chemically induced pluripotent stem cells (ciPSCs), neural stem cells (ciNSCs), and neurons (ciN). We also discuss the main mechanisms of actions and the pathways that the small molecules regulate during chemical reprogramming. PMID:26861316

  19. In vivo differentiation of induced pluripotent stem cells into neural stem cells by chimera formation

    PubMed Central

    Choi, Hyun Woo; Hong, Yean Ju; Kim, Jong Soo; Song, Hyuk; Cho, Ssang Gu; Bae, Hojae; Kim, Changsung; Byun, Sung June; Do, Jeong Tae

    2017-01-01

    Like embryonic stem cells, induced pluripotent stem cells (iPSCs) can differentiate into all three germ layers in an in vitro system. Here, we developed a new technology for obtaining neural stem cells (NSCs) from iPSCs through chimera formation, in an in vivo environment. iPSCs contributed to the neural lineage in the chimera, which could be efficiently purified and directly cultured as NSCs in vitro. The iPSC-derived, in vivo-differentiated NSCs expressed NSC markers, and their gene-expression pattern more closely resembled that of fetal brain-derived NSCs than in vitro-differentiated NSCs. This system could be applied for differentiating pluripotent stem cells into specialized cell types whose differentiation protocols are not well established. PMID:28141814

  20. Induced pluripotent stem cell technology and aquatic animal species.

    PubMed

    Temkin, Alexis M; Spyropoulos, Demetri D

    2014-06-01

    Aquatic animal species are the overall leaders in the scientific investigation of tough but important global health issues, including environmental toxicants and climate change. Historically, aquatic animal species also stand at the forefront of experimental biology, embryology and stem cell research. Over the past decade, intensive and high-powered investigations principally involving mouse and human cells have brought the generation and study of induced pluripotent stem cells (iPSCs) to a level that facilitates widespread use in a spectrum of species. A review of key features of these investigations is presented here as a primer for the use of iPSC technology to enhance ongoing aquatic animal species studies. iPSC and other cutting edge technologies create the potential to study individuals from "the wild" closer to the level of investigation applied to sophisticated inbred mouse models. A wide variety of surveys and hypothesis-driven investigations can be envisioned using this new capability, including comparisons of organism-specific development and exposure response and the testing of fundamental dogmas established using inbred mice. However, with these new capabilities, also come new criteria for rigorous baseline assessments and testing. Both the methods for inducing pluripotency and the source material can negatively impact iPSC quality and bourgeoning applications. Therefore, more rigorous strategies not required for inbred mouse models will have to be implemented to approach global health issues using individuals from "the wild" for aquatic animal species.

  1. Induced pluripotent stem cells with a pathological mitochondrial DNA deletion

    PubMed Central

    Cherry, Anne B. C.; Gagne, Katelyn E.; McLoughlin, Erin M.; Baccei, Anna; Gorman, Bryan; Hartung, Odelya; Miller, Justine D.; Zhang, Jin; Zon, Rebecca L.; Ince, Tan A.; Neufeld, Ellis J.; Lerou, Paul H.; Fleming, Mark D.; Daley, George Q.; Agarwal, Suneet

    2013-01-01

    In congenital mitochondrial DNA (mtDNA) disorders, a mixture of normal and mutated mtDNA (termed heteroplasmy) exists at varying levels in different tissues, which determines the severity and phenotypic expression of disease. Pearson marrow pancreas syndrome (PS) is a congenital bone marrow failure disorder caused by heteroplasmic deletions in mtDNA. The cause of the hematopoietic failure in PS is unknown, and adequate cellular and animal models are lacking. Induced pluripotent stem (iPS) cells are particularly amenable for studying mtDNA disorders, as cytoplasmic genetic material is retained during direct reprogramming. Here we derive and characterize iPS cells from a patient with PS. Taking advantage of the tendency for heteroplasmy to change with cell passage, we isolated isogenic PS-iPS cells without detectable levels of deleted mtDNA. We found that PS-iPS cells carrying a high burden of deleted mtDNA displayed differences in growth, mitochondrial function, and hematopoietic phenotype when differentiated in vitro, compared to isogenic iPS cells without deleted mtDNA. Our results demonstrate that reprogramming somatic cells from patients with mtDNA disorders can yield pluripotent stem cells with varying burdens of heteroplasmy that might be useful in the study and treatment of mitochondrial diseases. PMID:23400930

  2. Modeling Hippocampal Neurogenesis Using Human Pluripotent Stem Cells

    PubMed Central

    Yu, Diana Xuan; Di Giorgio, Francesco Paolo; Yao, Jun; Marchetto, Maria Carolina; Brennand, Kristen; Wright, Rebecca; Mei, Arianna; Mchenry, Lauren; Lisuk, David; Grasmick, Jaeson Michael; Silberman, Pedro; Silberman, Giovanna; Jappelli, Roberto; Gage, Fred H.

    2014-01-01

    Summary The availability of human pluripotent stem cells (hPSCs) offers the opportunity to generate lineage-specific cells to investigate mechanisms of human diseases specific to brain regions. Here, we report a differentiation paradigm for hPSCs that enriches for hippocampal dentate gyrus (DG) granule neurons. This differentiation paradigm recapitulates the expression patterns of key developmental genes during hippocampal neurogenesis, exhibits characteristics of neuronal network maturation, and produces PROX1+ neurons that functionally integrate into the DG. Because hippocampal neurogenesis has been implicated in schizophrenia (SCZD), we applied our protocol to SCZD patient-derived human induced pluripotent stem cells (hiPSCs). We found deficits in the generation of DG granule neurons from SCZD hiPSC-derived hippocampal NPCs with lowered levels of NEUROD1, PROX1, and TBR1, reduced neuronal activity, and reduced levels of spontaneous neurotransmitter release. Our approach offers important insights into the neurodevelopmental aspects of SCZD and may be a promising tool for drug screening and personalized medicine. PMID:24672753

  3. Modeling hippocampal neurogenesis using human pluripotent stem cells.

    PubMed

    Yu, Diana Xuan; Di Giorgio, Francesco Paolo; Yao, Jun; Marchetto, Maria Carolina; Brennand, Kristen; Wright, Rebecca; Mei, Arianna; McHenry, Lauren; Lisuk, David; Grasmick, Jaeson Michael; Silberman, Pedro; Silberman, Giovanna; Jappelli, Roberto; Gage, Fred H

    2014-03-11

    The availability of human pluripotent stem cells (hPSCs) offers the opportunity to generate lineage-specific cells to investigate mechanisms of human diseases specific to brain regions. Here, we report a differentiation paradigm for hPSCs that enriches for hippocampal dentate gyrus (DG) granule neurons. This differentiation paradigm recapitulates the expression patterns of key developmental genes during hippocampal neurogenesis, exhibits characteristics of neuronal network maturation, and produces PROX1+ neurons that functionally integrate into the DG. Because hippocampal neurogenesis has been implicated in schizophrenia (SCZD), we applied our protocol to SCZD patient-derived human induced pluripotent stem cells (hiPSCs). We found deficits in the generation of DG granule neurons from SCZD hiPSC-derived hippocampal NPCs with lowered levels of NEUROD1, PROX1, and TBR1, reduced neuronal activity, and reduced levels of spontaneous neurotransmitter release. Our approach offers important insights into the neurodevelopmental aspects of SCZD and may be a promising tool for drug screening and personalized medicine.

  4. Non integrative strategy decreases chromosome instability and improves endogenous pluripotency genes reactivation in porcine induced pluripotent-like stem cells

    PubMed Central

    Congras, Annabelle; Barasc, Harmonie; Canale-Tabet, Kamila; Plisson-Petit, Florence; Delcros, Chantal; Feraud, Olivier; Oudrhiri, Noufissa; Hadadi, Eva; Griscelli, Franck; Bennaceur-Griscelli, Annelise; Turhan, Ali; Afanassieff, Marielle; Ferchaud, Stéphane; Pinton, Alain; Yerle-Bouissou, Martine; Acloque, Hervé

    2016-01-01

    The pig is an emerging animal model, complementary to rodents for basic research and for biomedical and agronomical purposes. However despite the progress made on mouse and rat models to produce genuine pluripotent cells, it remains impossible to produce porcine pluripotent cell lines with germline transmission. Reprogramming of pig somatic cells using conventional integrative strategies remains also unsatisfactory. In the present study, we compared the outcome of both integrative and non-integrative reprogramming strategies on pluripotency and chromosome stability during pig somatic cell reprogramming. The porcine cell lines produced with integrative strategies express several pluripotency genes but they do not silence the integrated exogenes and present a high genomic instability upon passaging. In contrast, pig induced pluripotent-like stem cells produced with non-integrative reprogramming system (NI-iPSLCs) exhibit a normal karyotype after more than 12 months in culture and reactivate endogenous pluripotency markers. Despite the persistent expression of exogenous OCT4 and MYC, these cells can differentiate into derivatives expressing markers of the three embryonic germ layers and we propose that these NI-iPSLCs can be used as a model to bring new insights into the molecular factors controlling and maintaining pluripotency in the pig and other non-rodent mammalians. PMID:27245508

  5. Human pluripotent stem cells: Towards therapeutic development for the treatment of lifestyle diseases.

    PubMed

    Nishio, Miwako; Nakahara, Masako; Yuo, Akira; Saeki, Kumiko

    2016-02-26

    There are two types of human pluripotent stem cells: Embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), both of which launched themselves on clinical trials after having taken measures to overcome problems: Blocking rejections by immunosuppressants regarding ESCs and minimizing the risk of tumorigenicity by depleting exogenous gene components regarding iPSCs. It is generally assumed that clinical applications of human pluripotent stem cells should be limited to those cases where there are no alternative measures for treatments because of the risk in transplanting those cells to living bodies. Regarding lifestyle diseases, we have already several therapeutic options, and thus, development of human pluripotent stem cell-based therapeutics tends to be avoided. Nevertheless, human pluripotent stem cells can contribute to the development of new therapeutics in this field. As we will show, there is a case where only a short-term presence of human pluripotent stem-derived cells can exert long-term therapeutic effects even after they are rejected. In those cases, immunologically rejections of ESC- or allogenic iPSC-derived cells may produce beneficial outcomes by nullifying the risk of tumorigenesis without deterioration of therapeutic effects. Another utility of human pluripotent stem cells is the provision of an innovative tool for drug discovery that are otherwise unavailable. For example, clinical specimens of human classical brown adipocytes (BAs), which has been attracting a great deal of attention as a new target of drug discovery for the treatment of metabolic disorders, are unobtainable from living individuals due to scarcity, fragility and ethical problems. However, BA can easily be produced from human pluripotent stem cells. In this review, we will contemplate potential contribution of human pluripotent stem cells to therapeutic development for lifestyle diseases.

  6. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2012-10-01

    Pluripotent Stem Cell -Derived Astrocyte Transplantation in ALS PRINCIPAL INVESTIGATOR: Nicholas J. Maragakis, M.D...Pluripotent Stem Cell -Derived Astrocyte Transplantation in ALS 5b. GRANT NUMBER W81XWH-10-1-0520 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d...into astrocytes following transplantation. 15. SUBJECT TERMS Stem Cells , iPS cells , astrocytes, familial ALS 16. SECURITY CLASSIFICATION OF

  7. Prospect of Human Pluripotent Stem Cell-Derived Neural Crest Stem Cells in Clinical Application

    PubMed Central

    Zhu, Qian; Lu, Qiqi; Gao, Rong

    2016-01-01

    Neural crest stem cells (NCSCs) represent a transient and multipotent cell population that contributes to numerous anatomical structures such as peripheral nervous system, teeth, and cornea. NCSC maldevelopment is related to various human diseases including pigmentation abnormalities, disorders affecting autonomic nervous system, and malformations of teeth, eyes, and hearts. As human pluripotent stem cells including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) can serve as an unlimited cell source to generate NCSCs, hESC/hiPSC-derived NCSCs can be a valuable tool to study the underlying mechanisms of NCSC-associated diseases, which paves the way for future therapies for these abnormalities. In addition, hESC/hiPSC-derived NCSCs with the capability of differentiating to various cell types are highly promising for clinical organ repair and regeneration. In this review, we first discuss NCSC generation methods from human pluripotent stem cells and differentiation mechanism of NCSCs. Then we focus on the clinical application potential of hESC/hiPSC-derived NCSCs on peripheral nerve injuries, corneal blindness, tooth regeneration, pathological melanogenesis, Hirschsprung disease, and cardiac repair and regeneration. PMID:28090209

  8. Derivation of induced pluripotent stem cells from pig somatic cells.

    PubMed

    Ezashi, Toshihiko; Telugu, Bhanu Prakash V L; Alexenko, Andrei P; Sachdev, Shrikesh; Sinha, Sunilima; Roberts, R Michael

    2009-07-07

    For reasons that are unclear the production of embryonic stem cells from ungulates has proved elusive. Here, we describe induced pluripotent stem cells (iPSC) derived from porcine fetal fibroblasts by lentiviral transduction of 4 human (h) genes, hOCT4, hSOX2, hKLF4, and hc-MYC, the combination commonly used to create iPSC in mouse and human. Cells were cultured on irradiated mouse embryonic fibroblasts (MEF) and in medium supplemented with knockout serum replacement and FGF2. Compact colonies of alkaline phosphatase-positive cells emerged after approximately 22 days, providing an overall reprogramming efficiency of approximately 0.1%. The cells expressed porcine OCT4, NANOG, and SOX2 and had high telomerase activity, but also continued to express the 4 human transgenes. Unlike human ESC, the porcine iPSC (piPSC) were positive for SSEA-1, but negative for SSEA-3 and -4. Transcriptional profiling on Affymetrix (porcine) microarrays and real time RT-PCR supported the conclusion that reprogramming to pluripotency was complete. One cell line, ID6, had a normal karyotype, a cell doubling time of approximately 17 h, and has been maintained through >220 doublings. The ID6 line formed embryoid bodies, expressing genes representing all 3 germ layers when cultured under differentiating conditions, and teratomas containing tissues of ectoderm, mesoderm, and endoderm origin in nude mice. We conclude that porcine somatic cells can be reprogrammed to form piPSC. Such cell lines derived from individual animals could provide a means for testing the safety and efficacy of stem cell-derived tissue grafts when returned to the same pigs at a later age.

  9. Induced Pluripotent Stem Cells: Challenges and Opportunities for Cancer Immunotherapy

    PubMed Central

    Sachamitr, Patty; Hackett, Simon; Fairchild, Paul Jonathan

    2014-01-01

    Despite recent advances in cancer treatment over the past 30 years, therapeutic options remain limited and do not always offer a cure for malignancy. Given that tumor-associated antigens (TAA) are, by definition, self-proteins, the need to productively engage autoreactive T cells remains at the heart of strategies for cancer immunotherapy. These have traditionally focused on the administration of autologous monocyte-derived dendritic cells (moDC) pulsed with TAA, or the ex vivo expansion and adoptive transfer of tumor-infiltrating lymphocytes (TIL) as a source of TAA-specific cytotoxic T cells (CTL). Although such approaches have shown some efficacy, success has been limited by the poor capacity of moDC to cross present exogenous TAA to the CD8+ T-cell repertoire and the potential for exhaustion of CTL expanded ex vivo. Recent advances in induced pluripotency offer opportunities to generate patient-specific stem cell lines with the potential to differentiate in vitro into cell types whose properties may help address these issues. Here, we review recent success in the differentiation of NK cells from human induced pluripotent stem (iPS) cells as well as minor subsets of dendritic cells (DCs) with therapeutic potential, including CD141+XCR1+ DC, capable of cross presenting TAA to naïve CD8+ T cells. Furthermore, we review recent progress in the use of TIL as the starting material for the derivation of iPSC lines, thereby capturing their antigen specificity in a self-renewing stem cell line, from which potentially unlimited numbers of naïve TAA-specific T cells may be differentiated, free of the risks of exhaustion. PMID:24860566

  10. Maturation of Induced Pluripotent Stem Cell Derived Hepatocytes by 3D-Culture

    PubMed Central

    Gieseck III, Richard L.; Hannan, Nicholas R. F.; Bort, Roque; Hanley, Neil A.; Drake, Rosemary A. L.; Cameron, Grant W. W.; Wynn, Thomas A.; Vallier, Ludovic

    2014-01-01

    Induced pluripotent stem cell derived hepatocytes (IPSC-Heps) have the potential to reduce the demand for a dwindling number of primary cells used in applications ranging from therapeutic cell infusions to in vitro toxicology studies. However, current differentiation protocols and culture methods produce cells with reduced functionality and fetal-like properties compared to adult hepatocytes. We report a culture method for the maturation of IPSC-Heps using 3-Dimensional (3D) collagen matrices compatible with high throughput screening. This culture method significantly increases functional maturation of IPSC-Heps towards an adult phenotype when compared to conventional 2D systems. Additionally, this approach spontaneously results in the presence of polarized structures necessary for drug metabolism and improves functional longevity to over 75 days. Overall, this research reveals a method to shift the phenotype of existing IPSC-Heps towards primary adult hepatocytes allowing such cells to be a more relevant replacement for the current primary standard. PMID:24466060

  11. Proteomics and glycoproteomics of pluripotent stem-cell surface proteins.

    PubMed

    Sun, Bingyun

    2015-03-01

    Pluripotent stem cells are a unique cell type with promising potential in regenerative and personalized medicine. Yet the difficulty to understand and coax their seemingly stochastic differentiation and spontaneous self-renewal have largely limited their clinical applications. A call has been made by numerous researchers for a better characterization of surface proteins on these cells, in search of biomarkers that can dictate developmental stages and lineage specifications, and can help formulate mechanistic insight of stem-cell fate choices. In the past two decades, proteomics has gained significant recognition in profiling surface proteins at high throughput. This review will summarize the impact of these studies on stem-cell biology, and discuss the used proteomic techniques. A systematic comparison of all the techniques and their results is also attempted here to help reveal pros, cons, and the complementarity of the existing methods. This awareness should assist in selecting suitable strategies for stem-cell related research, and shed light on technical improvements that can be explored in the future.

  12. Achilles' heel of pluripotent stem cells: genetic, genomic and epigenetic variations during prolonged culture.

    PubMed

    Rebuzzini, Paola; Zuccotti, Maurizio; Redi, Carlo Alberto; Garagna, Silvia

    2016-07-01

    Pluripotent stem cells differentiate into almost any specialized adult cell type of an organism. PSCs can be derived either from the inner cell mass of a blastocyst-giving rise to embryonic stem cells-or after reprogramming of somatic terminally differentiated cells to obtain ES-like cells, named induced pluripotent stem cells. The potential use of these cells in the clinic, for investigating in vitro early embryonic development or for screening the effects of new drugs or xenobiotics, depends on capability to maintain their genome integrity during prolonged culture and differentiation. Both human and mouse PSCs are prone to genomic and (epi)genetic instability during in vitro culture, a feature that seriously limits their real potential use. Culture-induced variations of specific chromosomes or genes, are almost all unpredictable and, as a whole, differ among independent cell lines. They may arise at different culture passages, suggesting the absence of a safe passage number maintaining genome integrity and rendering the control of genomic stability mandatory since the very early culture passages. The present review highlights the urgency for further studies on the mechanisms involved in determining (epi)genetic and chromosome instability, exploiting the knowledge acquired earlier on other cell types.

  13. Concise review: induced pluripotent stem cells and lineage reprogramming: prospects for bone regeneration.

    PubMed

    Illich, Damir J; Demir, Necati; Stojković, Miodrag; Scheer, Martin; Rothamel, Daniel; Neugebauer, Jörg; Hescheler, Jürgen; Zöller, Joachim E

    2011-04-01

    Bone tissue for transplantation therapies is in high demand in clinics. Osteodegenerative diseases, in particular, osteoporosis and osteoarthritis, represent serious public health issues affecting a respectable proportion of the elderly population. Furthermore, congenital indispositions from the spectrum of craniofacial malformations such as cleft palates and systemic disorders including osteogenesis imperfecta are further increasing the need for bone tissue. Additionally, the reconstruction of fractured bone elements after accidents and the consumption of bone parts during surgical tumor excisions represent frequent clinical situations with deficient availability of healthy bone tissue for therapeutic transplantations. Epigenetic reprogramming represents a powerful technology for the generation of healthy patient-specific cells to replace or repair diseased or damaged tissue. The recent generation of induced pluripotent stem cells (iPSCs) is probably the most promising among these approaches dominating the literature of current stem cell research. It allows the generation of pluripotent stem cells from adult human skin cells from which potentially all cell types of the human body could be obtained. Another technique to produce clinically interesting cell types is direct lineage reprogramming (LR) with the additional advantage that it can be applied directly in vivo to reconstitute a damaged organ. Here, we want to present the two technologies of iPSCs and LR, to outline the current states of research, and to discuss possible strategies for their implementation in bone regeneration.

  14. The Decision on the “Optimal” Human Pluripotent Stem Cell

    PubMed Central

    Rosner, Margit; Schipany, Katharina

    2014-01-01

    Summary Because of recent advances, the array of human pluripotent stem cells now contains embryonic stem cells, derived from “surplus” in vitro fertilization embryos or from cloned embryos; induced pluripotent stem cells; and amniotic fluid stem cells. Here, we compare these stem cell types regarding ethical and legal concerns, cultivation conditions, genomic stability, tumor developing potentials, and applicability for disease modeling and human therapy. This overview highlights that in the future appropriate methodological management must include a decision on the “optimal” stem cell to use before the specific application PMID:24692589

  15. Human amniotic fluid stem cells support undifferentiated propagation and pluripotency of human embryonic stem cell without b-FGF in a density dependent manner.

    PubMed

    Ma, Xiaorong; Li, Huanqi; Xin, Shujia; Ma, Yueting; Ouyang, Tianxiang

    2014-01-01

    Human embryonic stem cells (hESCs) are pluripotent cells which can give rise to almost all adult cell lineages. Culture system of hESCs is complex, requiring exogenous b-FGF and feeder cell layer. Human mesenchymal stem cells (MSCs) not only synthesize soluble cytokines or factors such as b-FGF, but also provide other mechanism which might play positive role on sustaining hESCs propagation and pluripotency. Human amniotic fluid stem (AFS) cells, which share characteristics of both embryonic and adult stem cells, have been regarded as promising cells for regenerative medicine. Taking advantage by AFS cells, we studied the ability of AFS cells in supporting undifferentiated propagation and pluripotency of Chinese population derived X-01 hESCs. Human AF-type amniotic fluid stem cells (hAF-AFSCs) transcribed genes including Activin A, TGF-β1, Noggin and b-FGF, which involved in maintaining pluripotency and self-renewal of hESCs. Compared to mouse embryonic fibroblasts (MEFs), hAF-AFSCs secreted higher concentration of b-FGF which was important in hESCs culture (P < 0.05). The hESCs were propagated more than 30 passages on hAF-AFSCs layer with exogenous b-FGF supplementation, keeping undifferentiated status. While exogenous b-FGF was obviated, propagation of hESCs with undifferentiated status was dependent on density of hAF-AFSC feeder layer. Lower density of hAF-AFSCs resulted in rapid decline in undifferentiated clone number, while higher ones hindered the growth of colonies. The most appropriate hAF-AFSCs feeder density to maintain the X-01 hESC line without exogenous b-FGF was 15-20×10(4)/well. To the best of our knowledge, this is the first study demonstrating that hAF-AFSCs could support undifferentiated propagation and pluripotency of Chinese population derived hESCs without exogenous b-FGF supplementation.

  16. Comparison of American mink embryonic stem and induced pluripotent stem cell transcriptomes

    PubMed Central

    2015-01-01

    Background Recently fibroblasts of many mammalian species have been reprogrammed to pluripotent state using overexpression of several transcription factors. This technology allows production of induced pluripotent stem (iPS) cells with properties similar to embryonic stem (ES) cells. The completeness of reprogramming process is well studied in such species as mouse and human but there is not enough data on other species. We produced American mink (Neovison vison) ES and iPS cells and compared these cells using transcriptome analysis. Results We report the generation of 10 mink ES and 22 iPS cell lines. The majority of the analyzed cell lines had normal diploid chromosome number. The only ES cell line with XX chromosome set had both X-chromosomes in active state that is characteristic of pluripotent cells. The pluripotency of ES and iPS cell lines was confirmed by formation of teratomas with cell types representing all three germ layers. Transcriptome analysis of mink embryonic fibroblasts (EF), two ES and two iPS cell lines allowed us to identify 11831 assembled contigs which were annotated. These led to a number of 6891 unique genes. Of these 3201 were differentially expressed between mink EF and ES cells. We analyzed expression levels of these genes in iPS cell lines. This allowed us to show that 80% of genes were correctly reprogrammed in iPS cells, whereas approximately 6% had an intermediate expression pattern, about 7% were not reprogrammed and about 5% had a "novel" expression pattern. We observed expression of pluripotency marker genes such as Oct4, Sox2 and Rex1 in ES and iPS cell lines with notable exception of Nanog. Conclusions We had produced and characterized American mink ES and iPS cells. These cells were pluripotent by a number of criteria and iPS cells exhibited effective reprogramming. Interestingly, we had showed lack of Nanog expression and consider it as a species-specific feature. PMID:26694224

  17. Induced pluripotent stem cells: from Nobel Prizes to clinical applications.

    PubMed

    Rashid, S Tamir; Alexander, Graeme J M

    2013-03-01

    Advances in basic hepatology have been constrained for many years by the inability to culture primary hepatocytes in vitro, until just over five years ago when the scientific playing field was changed beyond recognition with the demonstration that human skin fibroblasts could be reprogrammed to resemble embryonic cells. The reprogrammed cells, known as induced pluripotent stem cells (iPSCs), were then shown to have the capacity to re-differentiate into almost any human cell type, including hepatocytes. The unlimited number and isogenic nature of the cells that can be generated from tiny fragments of tissue have massive implications for the study of human liver diseases in vitro. Of more immediate clinical importance were recent data demonstrating precision gene therapy on patient specific iPSCs, which opens up the real and exciting possibility of autologous hepatocyte transplantation as a substitute for allogeneic whole liver transplantation, which has been an effective approach to end-stage liver disease, but one that has now been outstripped by demand. In this review, we describe the historical development, current technology and potential clinical applications of induced pluripotency, concluding with a perspective on possible future directions in this dynamic field.

  18. Genotoxic Effects of Culture Media on Human Pluripotent Stem Cells

    PubMed Central

    Prakash Bangalore, Megha; Adhikarla, Syama; Mukherjee, Odity; Panicker, Mitradas M.

    2017-01-01

    Culture conditions play an important role in regulating the genomic integrity of Human Pluripotent Stem Cells (HPSCs). We report that HPSCs cultured in Essential 8 (E8) and mTeSR, two widely used media for feeder-free culturing of HPSCs, had many fold higher levels of ROS and higher mitochondrial potential than cells cultured in Knockout Serum Replacement containing media (KSR). HPSCs also exhibited increased levels of 8-hydroxyguanosine, phospho-histone-H2a.X and p53, as well as increased sensitivity to γ-irradiation in these two media. HPSCs in E8 and mTeSR had increased incidence of changes in their DNA sequence, indicating genotoxic stress, in addition to changes in nucleolar morphology and number. Addition of antioxidants to E8 and mTeSR provided only partial rescue. Our results suggest that it is essential to determine cellular ROS levels in addition to currently used criteria i.e. pluripotency markers, differentiation into all three germ layers and normal karyotype through multiple passages, in designing culture media. PMID:28176872

  19. Generation of functional platelets from canine induced pluripotent stem cells.

    PubMed

    Nishimura, Toshiya; Hatoya, Shingo; Kanegi, Ryoji; Sugiura, Kikuya; Wijewardana, Viskam; Kuwamura, Mitsuru; Tanaka, Miyuu; Yamate, Jyoji; Izawa, Takeshi; Takahashi, Masahiro; Kawate, Noritoshi; Tamada, Hiromichi; Imai, Hiroshi; Inaba, Toshio

    2013-07-15

    Thrombocytopenia (TTP) is a blood disease common to canines and human beings. Currently, there is no valid therapy for this disease except blood transfusion. In this study, we report the generation of canine induced pluripotent stem cells (ciPSCs) from canine embryonic fibroblasts, and a novel protocol for creating mature megakaryocytes (MKs) and functional platelets from ciPSCs. The ciPSCs were generated using lentiviral vectors, and differentiated into MKs and platelets on OP9 stromal cells supplemented with growth factors. Our ciPSCs presented in a tightly domed shape and showed expression of a critical pluripotency marker, REX1, and normal karyotype. Additionally, ciPSCs differentiated into cells derived from three germ layers via the formation of an embryoid body. The MKs derived from ciPSCs had hyperploidy and transformed into proplatelets. The proplatelets released platelets early on that expressed specific MK and platelet marker CD41/61. Interestingly, these platelets, when activated with adenosine diphosphate or thrombin, bind to fibrinogen. Moreover, electron microscopy showed that the platelets had the same ultrastructure as peripheral platelets. Thus, we have demonstrated for the first time the generation of ciPSCs that are capable of differentiating into MKs and release functional platelets in vitro. Our system for differentiating ciPSCs into MKs and platelets promises a critical therapy for canine TTP and appears to be extensible in principle to resolve human TTP.

  20. Epigenetic Silencing of the Key Antioxidant Enzyme Catalase in Karyotypically Abnormal Human Pluripotent Stem Cells

    PubMed Central

    Konki, Mikko; Pasumarthy, Kalyan; Malonzo, Maia; Sainio, Annele; Valensisi, Cristina; Söderström, Mirva; Emani, Maheswara Reddy; Stubb, Aki; Närvä, Elisa; Ghimire, Bishwa; Laiho, Asta; Järveläinen, Hannu; Lahesmaa, Riitta; Lähdesmäki, Harri; Hawkins, R. David; Lund, Riikka J.

    2016-01-01

    Epigenomic regulation is likely to be important in the maintenance of genomic integrity of human pluripotent stem cells, however, the mechanisms are unknown. We explored the epigenomes and transcriptomes of human pluripotent stem cells before and after spontaneous transformation to abnormal karyotypes and in correlation to cancer cells. Our results reveal epigenetic silencing of Catalase, a key regulator of oxidative stress and DNA damage control in abnormal cells. Our findings provide novel insight into the mechanisms associated with spontaneous transformation of human pluripotent stem cells towards malignant fate. The same mechanisms may control the genomic stability of cells in somatic tissues. PMID:26911679

  1. Young at Heart: Pioneering Approaches to Model Nonischaemic Cardiomyopathy with Induced Pluripotent Stem Cells

    PubMed Central

    Gowran, Aoife; Rasponi, Marco; Perrucci, Gianluca L.; Righetti, Stefano; Zanobini, Marco; Pompilio, Giulio

    2016-01-01

    A mere 9 years have passed since the revolutionary report describing the derivation of induced pluripotent stem cells from human fibroblasts and the first in-patient translational use of cells obtained from these stem cells has already been achieved. From the perspectives of clinicians and researchers alike, the promise of induced pluripotent stem cells is alluring if somewhat beguiling. It is now evident that this technology is nascent and many areas for refinement have been identified and need to be considered before induced pluripotent stem cells can be routinely used to stratify, treat and cure patients, and to faithfully model diseases for drug screening purposes. This review specifically addresses the pioneering approaches to improve induced pluripotent stem cell based models of nonischaemic cardiomyopathy. PMID:27110250

  2. Training the next generation of pluripotent stem cell researchers.

    PubMed

    Schwartz, Philip Hitchins

    2008-07-23

    Human pluripotent stem cells (PSCs) have the unique properties of being able to proliferate indefinitely in their undifferentiated state and of being able to differentiate into any somatic cell type. These cells are thus posited to be extremely useful for furthering our understanding of both normal and abnormal human development, providing a human cell preparation that can be used to screen for new reagents or therapeutic agents, and generating large numbers of differentiated cells that can be used for transplantation purposes. PSCs in culture have a specific morphology and they express characteristic surface antigens and nuclear transcription factors; thus, PSC culture is very specific and requires a core skill set for successful propagation of these unique cells. Specialized PSC training courses have been extremely valuable in seeding the scientific community with researchers that possess this skill set.

  3. Induced pluripotent stem cells for modeling of pediatric neurological disorders.

    PubMed

    Jang, Jiho; Quan, Zhejiu; Yum, Yunjin J; Song, Hyo Sook; Paek, Seonyeol; Kang, Hoon-Chul

    2014-07-01

    The pathophysiological mechanisms underlying childhood neurological disorders have remained obscure due to a lack of suitable disease models reflecting human pathogenesis. Using induced pluripotent stem cell (iPSC) technology, various neurological disorders can now be extensively modeled. Specifically, iPSC technology has aided the study and treatment of early-onset pediatric neurodegenerative diseases such as Rett syndrome, Down syndrome, Angelman syndrome. Prader-Willi syndrome, Friedreich's ataxia, spinal muscular atrophy (SMA), fragile X syndrome, X-linked adrenoleukodystrophy (ALD), and SCN1A gene-related epilepsies. In this paper, we provide an overview of various gene delivery systems for generating iPSCs, the current state of modeling early-onset neurological disorders and the ultimate application of these in vitro models in cell therapy through the correction of disease-specific mutations.

  4. Functional Human Beige Adipocytes from Induced Pluripotent Stem Cells.

    PubMed

    Guénantin, Anne-Claire; Briand, Nolwenn; Capel, Emilie; Dumont, Florent; Morichon, Romain; Provost, Claire; Stillitano, Francesca; Jeziorowska, Dorota; Siffroi, Jean-Pierre; Hajjar, Roger J; Fève, Bruno; Hulot, Jean-Sébastien; Collas, Philippe; Capeau, Jacqueline; Vigouroux, Corinne

    2017-03-07

    Activation of thermogenic beige adipocytes has recently emerged as a promising therapeutic target in obesity and diabetes. Relevant human models for beige adipocyte differentiation are essential to implement such therapeutic strategies. We report a straightforward and efficient protocol to generate functional human beige adipocytes from induced pluripotent stem cells (hiPSCs). Without overexpression of exogenous adipogenic genes, our method recapitulates an adipogenic developmental pathway through successive mesodermal and adipogenic progenitor stages. hiPSC-derived adipocytes are insulin-sensitive and display beige-specific markers and functional properties including upregulation of thermogenic genes, increased mitochondrial content and increased oxygen consumption upon activation with cAMP analogues. Engraftment of hiPSC-derived adipocytes in mice produces well-organized and vascularized adipose tissue, capable of β-adrenergic-responsive glucose uptake. Our model of human beige adipocyte development provides a new and scalable tool for disease modeling and therapeutic screening.

  5. Generation of PDGFRα+ Cardioblasts from Pluripotent Stem Cells

    PubMed Central

    Hong, Seon Pyo; Song, Sukhyun; Cho, Sung Woo; Lee, Seungjoo; Koh, Bong Ihn; Bae, Hosung; Kim, Kyun Hoo; Park, Jin-Sung; Do, Hyo-Sang; Im, Ilkyun; Heo, Hye Jin; Ko, Tae Hee; Park, Jae-Hyeong; Youm, Jae Boum; Kim, Seong-Jin; Kim, Injune; Han, Jin; Han, Yong-Mahn; Koh, Gou Young

    2017-01-01

    Isolating actively proliferating cardioblasts is the first crucial step for cardiac regeneration through cell implantation. However, the origin and identity of putative cardioblasts are still unclear. Here, we uncover a novel class of cardiac lineage cells, PDGFRα+Flk1− cardioblasts (PCBs), from mouse and human pluripotent stem cells induced using CsAYTE, a combination of the small molecules Cyclosporin A, the rho-associated coiled-coil kinase inhibitor Y27632, the antioxidant Trolox, and the ALK5 inhibitor EW7197. This novel population of actively proliferating cells is cardiac lineage–committed but in a morphologically and functionally immature state compared to mature cardiomyocytes. Most important, most of CsAYTE-induced PCBs spontaneously differentiated into functional αMHC+ cardiomyocytes (M+CMs) and could be a potential cellular resource for cardiac regeneration. PMID:28165490

  6. Induced pluripotent stem cells in the study of neurological diseases

    PubMed Central

    2011-01-01

    Five years after their initial derivation from mouse somatic cells, induced pluripotent stem (iPS) cells are an important tool for the study of neurological diseases. By offering an unlimited source of patient-specific disease-relevant neuronal and glial cells, iPS cell-based disease models hold enormous promise for identification of disease mechanisms, discovery of molecular targets and development of phenotypic screens for drug discovery. The present review focuses on the recent advancements in modeling neurological disorders, including the demonstration of disease-specific phenotypes in iPS cell-derived neurons generated from patients with spinal muscular atrophy, familial dysautonomia, Rett syndrome, schizophrenia and Parkinson disease. The ability of this approach to detect treatment effects from known therapeutic compounds has also been demonstrated, providing proof of principle for the use of iPS cell-derived cells in drug discovery. PMID:21936964

  7. Multiple sclerosis: getting personal with induced pluripotent stem cells

    PubMed Central

    Di Ruscio, A; Patti, F; Welner, R S; Tenen, D G; Amabile, G

    2015-01-01

    Human induced pluripotent stem (iPS) cells can be derived from lineage-restricted cells and represent an important tool to develop novel patient-specific cell therapies and research models for inherited and acquired diseases. Recently, patient-derived iPS cells, containing donor genetic background, have offered a breakthrough approach to study human genetics of neurodegenerative diseases. By offering an unlimited source of patient-specific disease-relevant cells, iPS cells hold great promise for understanding disease mechanisms, identifying molecular targets and developing phenotypic screens for drug discovery. This review will discuss the potential impact of using iPS cell-derived models in multiple sclerosis (MS) research and highlight some of the current challenges and prospective for generating novel therapeutic treatments for MS patients. PMID:26158512

  8. Generation of serotonin neurons from human pluripotent stem cells

    PubMed Central

    Lu, Jianfeng; Zhong, Xuefei; Liu, Huisheng; Hao, Ling; Huang, Cindy Tzu-Ling; Sherafat, Mohammad Amin; Jones, Jeffrey; Ayala, Melvin; Li, Lingjun; Zhang, Su-Chun

    2016-01-01

    Serotonin neurons located in the raphe nucleus of the hindbrain have crucial roles in regulating brain functions and have been implicated in various psychiatric disorders. Yet functional human serotonin neurons are not available for in vitro studies. Through manipulation of the WNT pathway, we demonstrate efficient differentiation of human pluripotent stem cells (hPSCs) to cells resembling central serotonin neurons, primarily those located in the rhombomeric segments 2–3 of the rostral raphe, which participate in high-order brain functions. The serotonin neurons express a series of molecules essential for serotonergic development, including tryptophan hydroxylase 2, exhibit typical electrophysiological properties and release serotonin in an activity-dependent manner. When treated with the FDA-approved drugs tramadol and escitalopram oxalate, they release or uptake serotonin in a dose- and time-dependent manner, suggesting the utility of these cells for the evaluation of drug candidates. PMID:26655496

  9. Hematopoietic stem cells are pluripotent and not just "hematopoietic".

    PubMed

    Ogawa, Makio; LaRue, Amanda C; Mehrotra, Meenal

    2013-06-01

    Over a decade ago, several preclinical transplantation studies suggested the striking concept of the tissue-reconstituting ability (often referred to as HSC plasticity) of hematopoietic stem cells (HSCs). While this heralded an exciting time of radically new therapies for disorders of many organs and tissues, the concept was soon mired in controversy and remained dormant for almost a decade. This commentary provides a concise review of evidence for HSC plasticity, including more recent findings based on single HSC transplantation in mouse and clinical transplantation studies. There is strong evidence for the concept that HSCs are pluripotent and are the source for the majority, if not all, of the cell types in our body. Also discussed are some biological and experimental issues that need to be considered in the future investigation of HSC plasticity.

  10. Generation of serotonin neurons from human pluripotent stem cells.

    PubMed

    Lu, Jianfeng; Zhong, Xuefei; Liu, Huisheng; Hao, Ling; Huang, Cindy Tzu-Ling; Sherafat, Mohammad Amin; Jones, Jeffrey; Ayala, Melvin; Li, Lingjun; Zhang, Su-Chun

    2016-01-01

    Serotonin neurons located in the raphe nucleus of the hindbrain have crucial roles in regulating brain functions and have been implicated in various psychiatric disorders. Yet functional human serotonin neurons are not available for in vitro studies. Through manipulation of the WNT pathway, we demonstrate efficient differentiation of human pluripotent stem cells (hPSCs) to cells resembling central serotonin neurons, primarily those located in the rhombomeric segments 2-3 of the rostral raphe, which participate in high-order brain functions. The serotonin neurons express a series of molecules essential for serotonergic development, including tryptophan hydroxylase 2, exhibit typical electrophysiological properties and release serotonin in an activity-dependent manner. When treated with the FDA-approved drugs tramadol and escitalopram oxalate, they release or uptake serotonin in a dose- and time-dependent manner, suggesting the utility of these cells for the evaluation of drug candidates.

  11. Calcium Imaging in Pluripotent Stem Cell-Derived Cardiac Myocytes.

    PubMed

    Walter, Anna; Šarić, Tomo; Hescheler, Jürgen; Papadopoulos, Symeon

    2016-01-01

    The possibility to generate cardiomyocytes (CMs) from disease-specific induced pluripotent stem cells (iPSCs) is a powerful tool for the investigation of various cardiac diseases in vitro. The pathological course of various cardiac conditions, causatively heterogeneous, often converges into disturbed cellular Ca(2+) cycling. The gigantic Ca(2+) channel of the intracellular Ca(2+) store of CMs, the ryanodine receptor type 2 (RyR2), controls Ca(2+) release and therefore plays a crucial role in Ca(2+) cycling of CMs. In the present protocol we describe ways to measure and analyze global as well as local cellular Ca(2+) release events in CMs derived from a patient carrying a CPVT-causing RyR2 mutation.

  12. Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

    PubMed Central

    2014-01-01

    Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

  13. Auxetic nuclei in embryonic stem cells exiting pluripotency.

    PubMed

    Pagliara, Stefano; Franze, Kristian; McClain, Crystal R; Wylde, George W; Fisher, Cynthia L; Franklin, Robin J M; Kabla, Alexandre J; Keyser, Ulrich F; Chalut, Kevin J

    2014-06-01

    Embryonic stem cells (ESCs) self-renew in a state of naïve pluripotency in which they are competent to generate all somatic cells. It has been hypothesized that, before irreversibly committing, ESCs pass through at least one metastable transition state. This transition would represent a gateway for differentiation and reprogramming of somatic cells. Here, we show that during the transition, the nuclei of ESCs are auxetic: they exhibit a cross-sectional expansion when stretched and a cross-sectional contraction when compressed, and their stiffness increases under compression. We also show that the auxetic phenotype of transition ESC nuclei is driven at least in part by global chromatin decondensation. Through the regulation of molecular turnover in the differentiating nucleus by external forces, auxeticity could be a key element in mechanotransduction. Our findings highlight the importance of nuclear structure in the regulation of differentiation and reprogramming.

  14. Generation of functional podocytes from human induced pluripotent stem cells.

    PubMed

    Ciampi, Osele; Iacone, Roberto; Longaretti, Lorena; Benedetti, Valentina; Graf, Martin; Magnone, Maria Chiara; Patsch, Christoph; Xinaris, Christodoulos; Remuzzi, Giuseppe; Benigni, Ariela; Tomasoni, Susanna

    2016-07-01

    Generating human podocytes in vitro could offer a unique opportunity to study human diseases. Here, we describe a simple and efficient protocol for obtaining functional podocytes in vitro from human induced pluripotent stem cells. Cells were exposed to a three-step protocol, which induced their differentiation into intermediate mesoderm, then into nephron progenitors and, finally, into mature podocytes. After differentiation, cells expressed the main podocyte markers, such as synaptopodin, WT1, α-Actinin-4, P-cadherin and nephrin at the protein and mRNA level, and showed the low proliferation rate typical of mature podocytes. Exposure to Angiotensin II significantly decreased the expression of podocyte genes and cells underwent cytoskeleton rearrangement. Cells were able to internalize albumin and self-assembled into chimeric 3D structures in combination with dissociated embryonic mouse kidney cells. Overall, these findings demonstrate the establishment of a robust protocol that, mimicking developmental stages, makes it possible to derive functional podocytes in vitro.

  15. Differentiation of pluripotent stem cells for regenerative medicine.

    PubMed

    Li, Ke; Kong, Yan; Zhang, Mingliang; Xie, Fei; Liu, Peng; Xu, Shaohua

    2016-02-26

    A long-standing goal in regenerative medicine is to obtain scalable functional cells on demand to replenish cells lost in various conditions, including relevant diseases, injuries, and aging. As an unlimited cell source, pluripotent stem cells (PSCs) are invaluable for regenerative medicine, because they have the potential to give rise to any cell type in an organism. For therapeutic purposes, it is important to develop specific approach to directing PSC differentiation towards desired cell types efficiently. Through directed differentiation, PSCs could give rise to scalable, clinically relevant cells for in vivo transplantation, as well as for studying diseases in vitro and discovering drugs to treat them. Over the past few years, significant progress has been made in directing differentiation of PSCs into a variety of cell types. In this review, we discuss recent progress in directed differentiation of PSCs, clinical translation of PSC-based cell replacement therapies, and remaining challenges.

  16. Derivation and application of pluripotent stem cells for regenerative medicine.

    PubMed

    Wang, Jiaqiang; Zhou, Qi

    2016-06-01

    Pluripotent stem cells (PSCs) are cells that can differentiate into any type of cells in the body, therefore have valuable promise in regenerative medicine of cell replacement therapies and tissue/organ engineering. PSCs can be derived either from early embryos or directly from somatic cells by epigenetic reprogramming that result in customized cells from patients. Here we summarize the methods of deriving PSCs, the various types of PSCs generated with different status, and their versatile applications in both clinical and embryonic development studies. We also discuss an intriguing potential application of PSCs in constructing tissues/organs in large animals by interspecies chimerism. All these emerging findings are likely to contribute to the breakthroughs in biological research and the prosperous prospects of regenerative medicine.

  17. Induced pluripotent stem cells and their implication for regenerative medicine.

    PubMed

    Csobonyeiova, Maria; Polak, Stefan; Koller, Jan; Danisovic, Lubos

    2015-06-01

    In 2006 Yamanaka's group showed that stem cells with properties similar to embryonic stem cells could be generated from mouse fibroblasts by introducing four genes. These cells were termed induced pluripotent stem cells (iPSCs). Because iPSCs avoid many of ethical concerns associated with the use of embryonic material, they have great potential in cell-based regenerative medicine. They are suitable also for other various purposes, including disease modelling, personalized cell therapy, drug or toxicity screening and basic research. Moreover, in the future, there might become possible to generate organs for human transplantation. Despite these progresses, several studies have raised the concern for genetic and epigenetic abnormalities of iPSCs that could contribute to immunogenicity of some cells differentiated from iPSCs. Recent methodological improvements are increasing the ease and efficacy of reprogramming, and reducing the genomic modification. However, to minimize or eliminate genetic alternations in the derived iPSC line creation, factor-free human iPSCs are necessary. In this review we discuss recent possibilities of using iPSCs for clinical applications and new advances in field of their reprogramming methods. The main goal of present article was to review the current knowledge about iPSCs and to discuss their potential for regenerative medicine.

  18. Modeling human neurological disorders with induced pluripotent stem cells.

    PubMed

    Imaizumi, Yoichi; Okano, Hideyuki

    2014-05-01

    Human induced pluripotent stem (iPS) cells obtained by reprogramming technology are a source of great hope, not only in terms of applications in regenerative medicine, such as cell transplantation therapy, but also for modeling human diseases and new drug development. In particular, the production of iPS cells from the somatic cells of patients with intractable diseases and their subsequent differentiation into cells at affected sites (e.g., neurons, cardiomyocytes, hepatocytes, and myocytes) has permitted the in vitro construction of disease models that contain patient-specific genetic information. For example, disease-specific iPS cells have been established from patients with neuropsychiatric disorders, including schizophrenia and autism, as well as from those with neurodegenerative diseases, including Parkinson's disease and Alzheimer's disease. A multi-omics analysis of neural cells originating from patient-derived iPS cells may thus enable investigators to elucidate the pathogenic mechanisms of neurological diseases that have heretofore been unknown. In addition, large-scale screening of chemical libraries with disease-specific iPS cells is currently underway and is expected to lead to new drug discovery. Accordingly, this review outlines the progress made via the use of patient-derived iPS cells toward the modeling of neurological disorders, the testing of existing drugs, and the discovery of new drugs. The production of human induced pluripotent stem (iPS) cells from the patients' somatic cells and their subsequent differentiation into specific cells have permitted the in vitro construction of disease models that contain patient-specific genetic information. Furthermore, innovations of gene-editing technologies on iPS cells are enabling new approaches for illuminating the pathogenic mechanisms of human diseases. In this review article, we outlined the current status of neurological diseases-specific iPS cell research and described recently obtained

  19. Induction of Trabecular Meshwork Cells From Induced Pluripotent Stem Cells

    PubMed Central

    Ding, Qiong J.; Zhu, Wei; Cook, Amy C.; Anfinson, Kristin R.; Tucker, Budd A.; Kuehn, Markus H.

    2014-01-01

    Purpose. Loss or dysfunction of trabecular meshwork (TM) cells has been associated with the development of pathologically elevated IOP, and it is conceivable that replacement of damaged TM cells could restore function to the TM. We propose that the use of TM-like cells derived from induced pluripotent stem cells (iPSCs) created from a patient's own dermal fibroblasts offers the best solution to this challenge. Here we demonstrate that mouse iPSCs can be induced to differentiate into TM-like cells suitable for autologous transplantation. Methods. Directed induction of stem cell differentiation was achieved through coculture of mouse iPSCs with human TM cells for up to 21 days. The resultant TM-like cells (iPSC-TM) were characterized morphologically, immunohistochemically, and functionally. Results. The iPSC-TM cells closely resembled cultured human TM cells morphologically and began to express many markers of TM cells while ceasing to express pluripotency markers such as Nanog, Oct4, and Sox2. Functionally, these cells developed the ability to phagocytose particles. Finally, exposure to dexamethasone or phorbol 12-myristate acetate caused a distinct increase in the production and secretion of myocilin and matrix metalloproteinase-3, respectively, behavior characteristic of TM cells. Conclusions. Our data demonstrate that iPSCs can be induced to assume a phenotype that resembles native TM cells in many important aspects. Not only do these cells represent a valuable research tool, but transplantation into glaucomatous eyes with elevated IOP may also restore function to the TM, resulting in re-establishment of IOP. PMID:25298418

  20. Graphene for improved femtosecond laser based pluripotent stem cell transfection.

    PubMed

    Mthunzi, Patience; He, Kuang; Ngcobo, Sandile; Khanyile, Thulile; Warner, Jamie H

    2014-05-01

    Pluripotent stem cells are hugely attractive in the tissue engineering research field as they can self-renew and be selectively differentiated into various cell types. For stem cell and tissue engineering research it is important to develop new, biocompatible scaffold materials and graphene has emerged as a promising material in this area as it does not compromise cell proliferation and accelerates specific cell differentiation. Previous studies have shown a non-invasive optical technique for mouse embryonic stem (mES) cell differentiation and transfection using femtosecond (fs) laser pulses. To investigate cellular responses to the influence of graphene and laser irradiation, here we present for the first time a study of mES cell fs laser transfection on graphene coated substrates. First we studied the impact of graphene on Chinese Hamster Ovary (CHO-K1) cell viability and cell cytotoxicity in the absence of laser exposure. These were tested via evaluating the mitochondrial activity through adenosine triphosphates (ATP) luminescence and breakages on the cell plasma membrane assessed using cytosolic lactate dehydrogenase (LDH) screening. Secondly, the effects of fs laser irradiation on cell viability and cytotoxicity at 1064 and 532 nm for cells plated and grown on graphene and pure glass were assessed. Finally, optical transfection of CHO-K1 and mES cells was performed on graphene coated versus plain glass substrates. Our results show graphene stimulated cell viability whilst triggering a mild release of intracellular LDH. We also observed that compared to pure glass substrates; laser irradiation at 1064 nm on graphene plates was less cytotoxic. Finally, in mES cells efficient optical transfection at 1064 (82%) and 532 (25%) nm was obtained due to the presence of a graphene support as compared to pristine glass. Here we hypothesize an up-regulation of cell adhesion promoting peptides or laminin-related receptors of the extracellular matrix (ECM) in cell samples

  1. A highly efficient method for generation of therapeutic quality human pluripotent stem cells by using naive induced pluripotent stem cells nucleus for nuclear transfer.

    PubMed

    Sanal, Madhusudana Girija

    2014-01-01

    Even after several years since the discovery of human embryonic stem cells and induced pluripotent stem cells (iPSC), we are still unable to make any significant therapeutic benefits out of them such as cell therapy or generation of organs for transplantation. Recent success in somatic cell nuclear transfer (SCNT) made it possible to generate diploid embryonic stem cells, which opens up the way to make high-quality pluripotent stem cells. However, the process is highly inefficient and hence expensive compared to the generation of iPSC. Even with the latest SCNT technology, we are not sure whether one can make therapeutic quality pluripotent stem cell from any patient's somatic cells or by using oocytes from any donor. Combining iPSC technology with SCNT, that is, by using the nucleus of the candidate somatic cell which got reprogrammed to pluripotent state instead that of the unmodified nucleus of the candidate somatic cell, would boost the efficiency of the technique, and we would be able to generate therapeutic quality pluripotent stem cells. Induced pluripotent stem cell nuclear transfer (iPSCNT) combines the efficiency of iPSC generation with the speed and natural reprogramming environment of SCNT. The new technique may be called iPSCNT. This technique could prove to have very revolutionary benefits for humankind. This could be useful in generating organs for transplantation for patients and for reproductive cloning, especially for childless men and women who cannot have children by any other techniques. When combined with advanced gene editing techniques (such as CRISPR-Cas system) this technique might also prove useful to those who want to have healthy children but suffer from inherited diseases. The current code of ethics may be against reproductive cloning. However, this will change with time as it happened with most of the revolutionary scientific breakthroughs. After all, it is the right of every human to have healthy offspring and it is the question of

  2. Production of embryonic and fetal-like red blood cells from human induced pluripotent stem cells.

    PubMed

    Chang, Chan-Jung; Mitra, Koyel; Koya, Mariko; Velho, Michelle; Desprat, Romain; Lenz, Jack; Bouhassira, Eric E

    2011-01-01

    We have previously shown that human embryonic stem cells can be differentiated into embryonic and fetal type of red blood cells that sequentially express three types of hemoglobins recapitulating early human erythropoiesis. We report here that we have produced iPS from three somatic cell types: adult skin fibroblasts as well as embryonic and fetal mesenchymal stem cells. We show that regardless of the age of the donor cells, the iPS produced are fully reprogrammed into a pluripotent state that is undistinguishable from that of hESCs by low and high-throughput expression and detailed analysis of globin expression patterns by HPLC. This suggests that reprogramming with the four original Yamanaka pluripotency factors leads to complete erasure of all functionally important epigenetic marks associated with erythroid differentiation regardless of the age or the tissue type of the donor cells, at least as detected in these assays. The ability to produce large number of erythroid cells with embryonic and fetal-like characteristics is likely to have many translational applications.

  3. Induced Accelerated Aging in Induced Pluripotent Stem Cell Lines from Patients with Parkinson’s Disease

    DTIC Science & Technology

    2014-07-01

    Induced Pluripotent Stem Cell Lines from Patients with Parkinson’s Disease PRINCIPAL INVESTIGATOR: Dr. Birgitt Schuele CONTRACTING...contained in this report are those of the author( s ) and should not be construed as an official Department of the Army position, policy or decision...Aging in Induced Pluripotent Stem Cell Lines from Patients with Parkinson’s Disease 5b. GRANT NUMBER W81XWH-12-1-0003 5c. PROGRAM ELEMENT NUMBER

  4. A Novel Role for miR-1305 in Regulation of Pluripotency-Differentiation Balance, Cell Cycle, and Apoptosis in Human Pluripotent Stem Cells.

    PubMed

    Jin, Shibo; Collin, Joseph; Zhu, Lili; Montaner, David; Armstrong, Lyle; Neganova, Irina; Lako, Majlinda

    2016-09-01

    Human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) are defined as pluripotent in view of their self-renewal ability and potential to differentiate to cells of all three germ layers. Recent studies have indicated that microRNAs (miRNAs) play an important role in the maintenance of pluripotency and cell cycle regulation. We used a microarray based approach to identify miRNAs that were enriched in hESCs when compared to differentiated cells and at the same time showed significant expression changes between different phases of cell cycle. We identified 34 candidate miRNAs and performed functional studies on one of these, miR-1305, which showed the highest expression change during cell cycle transition. Overexpression of miR-1305 induced differentiation of pluripotent stem cells, increased cell apoptosis and sped up G1/S transition, while its downregulation facilitated the maintenance of pluripotency and increased cell survival. Using target prediction software and luciferase based reporter assays we identified POLR3G as a downstream target by which miR-1305 regulates the fine balance between maintenance of pluripotency and onset of differentiation. Overexpression of POLR3G rescued pluripotent stem cell differentiation induced by miR-1305 overexpression. In contrast, knock-down of POLR3G expression abolished the miR-1305-knockdown mediated enhancement of pluripotency, thus validating its role as miR-1305 target in human pluripotent stem cells. Together our data point to an important role for miR-1305 as a novel regulator of pluripotency, cell survival and cell cycle and uncovers new mechanisms and networks by which these processes are intertwined in human pluripotent stem cells. Stem Cells 2016;34:2306-2317.

  5. Differentiation of oligodendrocyte progenitor cells from dissociated monolayer and feeder-free cultured pluripotent stem cells

    PubMed Central

    Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya

    2017-01-01

    Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a

  6. Differentiation of oligodendrocyte progenitor cells from dissociated monolayer and feeder-free cultured pluripotent stem cells.

    PubMed

    Yamashita, Tomoko; Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya

    2017-01-01

    Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a

  7. Induced pluripotent stem cells for modeling neurological disorders.

    PubMed

    Russo, Fabiele B; Cugola, Fernanda R; Fernandes, Isabella R; Pignatari, Graciela C; Beltrão-Braga, Patricia C B

    2015-12-24

    Several diseases have been successfully modeled since the development of induced pluripotent stem cell (iPSC) technology in 2006. Since then, methods for increased reprogramming efficiency and cell culture maintenance have been optimized and many protocols for differentiating stem cell lines have been successfully developed, allowing the generation of several cellular subtypes in vitro. Gene editing technologies have also greatly advanced lately, enhancing disease-specific phenotypes by creating isogenic cell lines, allowing mutations to be corrected in affected samples or inserted in control lines. Neurological disorders have benefited the most from iPSC-disease modeling for its capability for generating disease-relevant cell types in vitro from the central nervous system, such as neurons and glial cells, otherwise only available from post-mortem samples. Patient-specific iPSC-derived neural cells can recapitulate the phenotypes of these diseases and therefore, considerably enrich our understanding of pathogenesis, disease mechanism and facilitate the development of drug screening platforms for novel therapeutic targets. Here, we review the accomplishments and the current progress in human neurological disorders by using iPSC modeling for Alzheimer's disease, Parkinson's disease, Huntington's disease, spinal muscular atrophy, amyotrophic lateral sclerosis, duchenne muscular dystrophy, schizophrenia and autism spectrum disorders, which include Timothy syndrome, Fragile X syndrome, Angelman syndrome, Prader-Willi syndrome, Phelan-McDermid, Rett syndrome as well as Nonsyndromic Autism.

  8. Pluripotent stem cells in neurodegenerative and neurodevelopmental diseases.

    PubMed

    Marchetto, Maria C N; Winner, Beate; Gage, Fred H

    2010-04-15

    Most of our current knowledge about cellular phenotypes in neurodevelopmental and neurodegenerative diseases in humans was gathered from studies in postmortem brain tissues. These samples often represent the end-stage of the disease and therefore are not always a fair representation of how the disease developed. Moreover, under these circumstances, the pathology observed could be a secondary effect rather than the authentic disease cellular phenotype. Likewise, the rodent models available do not always recapitulate the pathology from human diseases. In this review, we will examine recent literature on the use of induced pluripotent stem cells to model neurodegenerative and neurodevelopmental diseases. We highlight the characteristics of diseases like spinal muscular atrophy and familial dysautonomia that allowed partial modeling of the disease phenotype. We review human stem cell literature on common neurodegenerative late-onset diseases such as Parkinson's disease and amyotrophic lateral sclerosis where patients' cells have been successfully reprogrammed but a disease phenotype has not yet been described. So far, the technique is of great interest for early onset monogenetic neurodevelopmental diseases. We speculate about potential further experimental requirements and settings for reprogrammed neurons for in vitro disease modeling and drug discovery.

  9. Recent Advances in Therapeutic Applications of Induced Pluripotent Stem Cells.

    PubMed

    Rami, Farzaneh; Beni, Shamsi Naderi; Kahnamooi, Mahboobeh Mojaver; Rahimmanesh, Ilnaz; Salehi, Ahmad Reza; Salehi, Rasoul

    2017-04-01

    Induced pluripotent stem (iPS) cells are generated by reprogramming of differentiated somatic cells. These cells are identical to human embryonic stem cells (hESCs) in gene expression pattern and the ability to differentiate. iPS cells can be used in in vitro modeling of diseases, testing drugs, assessing gene therapy methods, and cell therapy. Yet, the most important and promising application of iPS cells is in regenerative medicine. Regenerative medicine is a novel area in medicine aiming at the treatment of impaired or lost tissues by replacing them with functional and healthy ones. Currently, organ transplantation, which is considered the only treatment and cure for a number of diseases, is limited by shortage of organ donors and availability of the right match. Therefore, utilization of an alternative source of cells and tissues is critical in transplantation therapy. In this study, we review recent advances in therapeutic application of iPS cells in diseases where organ transplantation remains the only solution and will discuss the potential and usage of iPS cells in different areas of regenerative medicine. The primary theory of using iPS cells in regenerative medicine has brought lots of promises due to its potential for solving the immunological, social, and ethical problems of using ESCs. Nevertheless, several issues and problems have to be resolved before applying iPS cells in therapeutic applications.

  10. Generating trunk neural crest from human pluripotent stem cells.

    PubMed

    Huang, Miller; Miller, Matthew L; McHenry, Lauren K; Zheng, Tina; Zhen, Qiqi; Ilkhanizadeh, Shirin; Conklin, Bruce R; Bronner, Marianne E; Weiss, William A

    2016-01-27

    Neural crest cells (NCC) are stem cells that generate different lineages, including neuroendocrine, melanocytic, cartilage, and bone. The differentiation potential of NCC varies according to the level from which cells emerge along the neural tube. For example, only anterior "cranial" NCC form craniofacial bone, whereas solely posterior "trunk" NCC contribute to sympathoadrenal cells. Importantly, the isolation of human fetal NCC carries ethical and scientific challenges, as NCC induction typically occur before pregnancy is detectable. As a result, current knowledge of NCC biology derives primarily from non-human organisms. Important differences between human and non-human NCC, such as expression of HNK1 in human but not mouse NCC, suggest a need to study human NCC directly. Here, we demonstrate that current protocols to differentiate human pluripotent stem cells (PSC) to NCC are biased toward cranial NCC. Addition of retinoic acid drove trunk-related markers and HOX genes characteristic of a posterior identity. Subsequent treatment with bone morphogenetic proteins (BMPs) enhanced differentiation to sympathoadrenal cells. Our approach provides methodology for detailed studies of human NCC, and clarifies roles for retinoids and BMPs in the differentiation of human PSC to trunk NCC and to sympathoadrenal lineages.

  11. Current progress and prospects of induced pluripotent stem cells.

    PubMed

    Chen, LingYi; Liu, Lin

    2009-07-01

    Induced pluripotent stem (iPS) cells are derived from somatic cells by ectopic expression of few transcription factors. Like embryonic stem (ES) cells, iPS cells are able to self-renew indefinitely and to differentiate into all types of cells in the body. iPS cells hold great promise for regenerative medicine, because iPS cells circumvent not only immunological rejection but also ethical issues. Since the first report on the derivation of iPS cells in 2006, many laboratories all over the world started research on iPS cells and have made significant progress. This paper reviews recent progress in iPS cell research, including the methods to generate iPS cells, the molecular mechanism of reprogramming in the formation of iPS cells, and the potential applications of iPS cells in cell replacement therapy. Current problems that need to be addressed and the prospects for iPS research are also discussed.

  12. Induced pluripotent stem cells for modeling neurological disorders

    PubMed Central

    Russo, Fabiele B; Cugola, Fernanda R; Fernandes, Isabella R; Pignatari, Graciela C; Beltrão-Braga, Patricia C B

    2015-01-01

    Several diseases have been successfully modeled since the development of induced pluripotent stem cell (iPSC) technology in 2006. Since then, methods for increased reprogramming efficiency and cell culture maintenance have been optimized and many protocols for differentiating stem cell lines have been successfully developed, allowing the generation of several cellular subtypes in vitro. Gene editing technologies have also greatly advanced lately, enhancing disease-specific phenotypes by creating isogenic cell lines, allowing mutations to be corrected in affected samples or inserted in control lines. Neurological disorders have benefited the most from iPSC-disease modeling for its capability for generating disease-relevant cell types in vitro from the central nervous system, such as neurons and glial cells, otherwise only available from post-mortem samples. Patient-specific iPSC-derived neural cells can recapitulate the phenotypes of these diseases and therefore, considerably enrich our understanding of pathogenesis, disease mechanism and facilitate the development of drug screening platforms for novel therapeutic targets. Here, we review the accomplishments and the current progress in human neurological disorders by using iPSC modeling for Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, spinal muscular atrophy, amyotrophic lateral sclerosis, duchenne muscular dystrophy, schizophrenia and autism spectrum disorders, which include Timothy syndrome, Fragile X syndrome, Angelman syndrome, Prader-Willi syndrome, Phelan-McDermid, Rett syndrome as well as Nonsyndromic Autism. PMID:26722648

  13. Pluripotent stem cells in neurodegenerative and neurodevelopmental diseases

    PubMed Central

    Marchetto, Maria C.N.; Winner, Beate; Gage, Fred H.

    2010-01-01

    Most of our current knowledge about cellular phenotypes in neurodevelopmental and neurodegenerative diseases in humans was gathered from studies in postmortem brain tissues. These samples often represent the end-stage of the disease and therefore are not always a fair representation of how the disease developed. Moreover, under these circumstances, the pathology observed could be a secondary effect rather than the authentic disease cellular phenotype. Likewise, the rodent models available do not always recapitulate the pathology from human diseases. In this review, we will examine recent literature on the use of induced pluripotent stem cells to model neurodegenerative and neurodevelopmental diseases. We highlight the characteristics of diseases like spinal muscular atrophy and familial dysautonomia that allowed partial modeling of the disease phenotype. We review human stem cell literature on common neurodegenerative late-onset diseases such as Parkinson's disease and amyotrophic lateral sclerosis where patients' cells have been successfully reprogrammed but a disease phenotype has not yet been described. So far, the technique is of great interest for early onset monogenetic neurodevelopmental diseases. We speculate about potential further experimental requirements and settings for reprogrammed neurons for in vitro disease modeling and drug discovery. PMID:20418487

  14. Generation of kidney tubular organoids from human pluripotent stem cells

    PubMed Central

    Yamaguchi, Shintaro; Morizane, Ryuji; Homma, Koichiro; Monkawa, Toshiaki; Suzuki, Sayuri; Fujii, Shizuka; Koda, Muneaki; Hiratsuka, Ken; Yamashita, Maho; Yoshida, Tadashi; Wakino, Shu; Hayashi, Koichi; Sasaki, Junichi; Hori, Shingo; Itoh, Hiroshi

    2016-01-01

    Recent advances in stem cell research have resulted in methods to generate kidney organoids from human pluripotent stem cells (hPSCs), which contain cells of multiple lineages including nephron epithelial cells. Methods to purify specific types of cells from differentiated hPSCs, however, have not been established well. For bioengineering, cell transplantation, and disease modeling, it would be useful to establish those methods to obtain pure populations of specific types of kidney cells. Here, we report a simple two-step differentiation protocol to generate kidney tubular organoids from hPSCs with direct purification of KSP (kidney specific protein)-positive cells using anti-KSP antibody. We first differentiated hPSCs into mesoderm cells using a glycogen synthase kinase-3β inhibitor for 3 days, then cultured cells in renal epithelial growth medium to induce KSP+ cells. We purified KSP+ cells using flow cytometry with anti-KSP antibody, which exhibited characteristics of all segments of kidney tubular cells and cultured KSP+ cells in 3D Matrigel, which formed tubular organoids in vitro. The formation of tubular organoids by KSP+ cells induced the acquisition of functional kidney tubules. KSP+ cells also allowed for the generation of chimeric kidney cultures in which human cells self-assembled into 3D tubular structures in combination with mouse embryonic kidney cells. PMID:27982115

  15. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    PubMed

    Miranda, Alberto; Pericuesta, Eva; Ramírez, Miguel Ángel; Gutierrez-Adan, Alfonso

    2011-04-04

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  16. Live fluorescent RNA-based detection of pluripotency gene expression in embryonic and induced pluripotent stem cells of different species.

    PubMed

    Lahm, Harald; Doppler, Stefanie; Dreßen, Martina; Werner, Astrid; Adamczyk, Klaudia; Schrambke, Dominic; Brade, Thomas; Laugwitz, Karl-Ludwig; Deutsch, Marcus-André; Schiemann, Matthias; Lange, Rüdiger; Moretti, Alessandra; Krane, Markus

    2015-02-01

    The generation of induced pluripotent stem (iPS) cells has successfully been achieved in many species. However, the identification of truly reprogrammed iPS cells still remains laborious and the detection of pluripotency markers requires fixation of cells in most cases. Here, we report an approach with nanoparticles carrying Cy3-labeled sense oligonucleotide reporter strands coupled to gold-particles. These molecules are directly added to cultured cells without any manipulation and gene expression is evaluated microscopically after overnight incubation. To simultaneously detect gene expression in different species, probe sequences were chosen according to interspecies homology. With a common target-specific probe we could successfully demonstrate expression of the GAPDH house-keeping gene in somatic cells and expression of the pluripotency markers NANOG and GDF3 in embryonic stem cells and iPS cells of murine, human, and porcine origin. The population of target gene positive cells could be purified by fluorescence-activated cell sorting. After lentiviral transduction of murine tail-tip fibroblasts Nanog-specific probes identified truly reprogrammed murine iPS cells in situ during development based on their Cy3-fluorescence. The intensity of Nanog-specific fluorescence correlated positively with an increased capacity of individual clones to differentiate into cells of all three germ layers. Our approach offers a universal tool to detect intracellular gene expression directly in live cells of any desired origin without the need for manipulation, thus allowing conservation of the genetic background of the target cell. Furthermore, it represents an easy, scalable method for efficient screening of pluripotency which is highly desirable during high-throughput cell reprogramming and after genomic editing of pluripotent stem cells.

  17. Naive Pluripotent Stem Cells Derived Directly from Isolated Cells of the Human Inner Cell Mass

    PubMed Central

    Guo, Ge; von Meyenn, Ferdinand; Santos, Fatima; Chen, Yaoyao; Reik, Wolf; Bertone, Paul; Smith, Austin; Nichols, Jennifer

    2016-01-01

    Summary Conventional generation of stem cells from human blastocysts produces a developmentally advanced, or primed, stage of pluripotency. In vitro resetting to a more naive phenotype has been reported. However, whether the reset culture conditions of selective kinase inhibition can enable capture of naive epiblast cells directly from the embryo has not been determined. Here, we show that in these specific conditions individual inner cell mass cells grow into colonies that may then be expanded over multiple passages while retaining a diploid karyotype and naive properties. The cells express hallmark naive pluripotency factors and additionally display features of mitochondrial respiration, global gene expression, and genome-wide hypomethylation distinct from primed cells. They transition through primed pluripotency into somatic lineage differentiation. Collectively these attributes suggest classification as human naive embryonic stem cells. Human counterparts of canonical mouse embryonic stem cells would argue for conservation in the phased progression of pluripotency in mammals. PMID:26947977

  18. Induced pluripotent stem cell-derived gamete-associated proteins incite rejection of induced pluripotent stem cells in syngeneic mice.

    PubMed

    Kim, Eun-Mi; Manzar, Gohar; Zavazava, Nicholas

    2017-02-10

    The safety of induced pluripotent stem cells (iPSCs) in autologous recipients has been questioned after iPSCs, but not embryonic stem cells (ESCs), were reported to be rejected in syngeneic mice. This important topic has remained controversial because there has not been a mechanistic explanation for this phenomenon. Here, we hypothesize that iPSCs, but not ESCs, readily differentiate into gamete-forming cells that express meiotic antigens normally found in immune-privileged gonads. Because peripheral blood T cells are not tolerized to these antigens in the thymus, gamete-associated-proteins (GAPs) sensitize T cells leading to rejection. Here, we provide evidence that GAPs expressed in iPSC teratomas, but not in ESC teratomas, are responsible for the immunological rejection of iPSCs. Furthermore, silencing the expression of Stra8, 'the master regulator of meiosis', in iPSCs, using short hairpin RNA led to significant abrogation of the rejection of iPSCs, supporting our central hypothesis that GAPs expressed after initiation of meiosis in iPSCs were responsible for rejection. In contrast to iPSCs, iPSC-derivatives, such as haematopoietic progenitor cells, are able to engraft long-term into syngeneic recipients because they no longer express GAPs. Our findings, for the first time, provide a unifying explanation of why iPSCs, but not ESCs, are rejected in syngeneic recipients, ending the current controversy on the safety of iPSCs and their derivatives.

  19. Present state and future perspectives of using pluripotent stem cells in toxicology research

    PubMed Central

    Löser, Peter

    2011-01-01

    The use of novel drugs and chemicals requires reliable data on their potential toxic effects on humans. Current test systems are mainly based on animals or in vitro–cultured animal-derived cells and do not or not sufficiently mirror the situation in humans. Therefore, in vitro models based on human pluripotent stem cells (hPSCs) have become an attractive alternative. The article summarizes the characteristics of pluripotent stem cells, including embryonic carcinoma and embryonic germ cells, and discusses the potential of pluripotent stem cells for safety pharmacology and toxicology. Special attention is directed to the potential application of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) for the assessment of developmental toxicology as well as cardio- and hepatotoxicology. With respect to embryotoxicology, recent achievements of the embryonic stem cell test (EST) are described and current limitations as well as prospects of embryotoxicity studies using pluripotent stem cells are discussed. Furthermore, recent efforts to establish hPSC-based cell models for testing cardio- and hepatotoxicity are presented. In this context, methods for differentiation and selection of cardiac and hepatic cells from hPSCs are summarized, requirements and implications with respect to the use of these cells in safety pharmacology and toxicology are presented, and future challenges and perspectives of using hPSCs are discussed. PMID:21225242

  20. Induced pluripotent stem cells from human hair follicle mesenchymal stem cells.

    PubMed

    Wang, Yimei; Liu, Jinyu; Tan, Xiaohua; Li, Gaofeng; Gao, Yunhe; Liu, Xuejuan; Zhang, Lihong; Li, Yulin

    2013-08-01

    Reprogramming of somatic cells into inducible pluripotent stem cells (iPSCs) provides an alternative to using embryonic stem cells (ESCs). Mesenchymal stem cells derived from human hair follicles (hHF-MSCs) are easily accessible, reproducible by direct plucking of human hairs. Whether these hHF-MSCs can be reprogrammed has not been previously reported. Here we report the generation of iPSCs from hHF-MSCs obtained by plucking several hairs. hHF-MSCs were isolated from hair follicle tissues and their mesenchymal nature confirmed by detecting cell surface antigens and multilineage differentiation potential towards adipocytes and osteoblasts. They were then reprogrammed into iPSCs by lentiviral transduction with Oct4, Sox2, c-Myc and Klf4. hHF-MSC-derived iPSCs appeared indistinguishable from human embryonic stem cells (hESCs) in colony morphology, expression of alkaline phosphotase, and expression of specific hESCs surface markers, SSEA-3, SSEA-4, Tra-1-60, Tra-1-81, Nanog, Oct4, E-Cadherin and endogenous pluripotent genes. When injected into immunocompromised mice, hHF-MSC-derived iPSCs formed teratomas containing representatives of all three germ layers. This is the first study to report reprogramming of hHF-MSCs into iPSCs.

  1. Shear stress influences the pluripotency of murine embryonic stem cells in stirred suspension bioreactors.

    PubMed

    Gareau, Tia; Lara, Giovanna G; Shepherd, Robert D; Krawetz, Roman; Rancourt, Derrick E; Rinker, Kristina D; Kallos, Michael S

    2014-04-01

    Pluripotent embryonic stem cells (ESCs) have been used increasingly in research as primary material for various tissue-engineering applications. Pluripotency, or the ability to give rise to all cells of the body, is an important characteristic of ESCs. Traditional methods use leukaemia inhibitory factor (LIF) to maintain murine embryonic stem cell (mESC) pluripotency in static and bioreactor cultures. When LIF is removed from mESCs in static cultures, pluripotency genes are downregulated and the cultures will spontaneously differentiate. Recently we have shown the maintenance of pluripotency gene expression of mESCs in stirred suspension bioreactors during differentiation experiments in the absence of LIF. This is undesired in a differentiation experiment, where the goal is downregulation of pluripotency gene expression and upregulation of gene expression characteristic to the differentiation. Thus, the objective of this study was to examine how effectively different levels of shear stress [100 rpm (6 dyne/cm(2) ), 60 rpm (3 dyne/cm(2) )] maintained and influenced pluripotency in suspension bioreactors. The pluripotency markers Oct-4, Nanog, Sox-2 and Rex-1 were assessed using gene expression profiles and flow-cytometry analysis and showed that shear stress does maintain and influence the gene expression of certain pluripotency markers. Some significant differences between the two levels of shear stress were seen and the combination of shear stress and LIF was observed to synergistically increase the expression of certain pluripotency markers. Overall, this study provides a better understanding of the environmental conditions within suspension bioreactors and how these conditions affect the pluripotency of mESCs.

  2. Podocalyxin as a major pluripotent marker and novel keratan sulfate proteoglycan in human embryonic and induced pluripotent stem cells.

    PubMed

    Toyoda, Hidenao; Nagai, Yuko; Kojima, Aya; Kinoshita-Toyoda, Akiko

    2017-04-01

    Podocalyxin (PC) was first identified as a heavily sialylated transmembrane protein of glomerular podocytes. Recent studies suggest that PC is a remarkable glycoconjugate that acts as a universal glyco-carrier. The glycoforms of PC are responsible for multiple functions in normal tissue, human cancer cells, human embryonic stem cells (hESCs), and human induced pluripotent stem cells (hiPSCs). PC is employed as a major pluripotent marker of hESCs and hiPSCs. Among the general antibodies for human PC, TRA-1-60 and TRA-1-81 recognize the keratan sulfate (KS)-related structures. Therefore, It is worthwhile to summarize the outstanding chemical characteristic of PC, including the KS-related structures. Here, we review the glycoforms of PC and discuss the potential of PC as a novel KS proteoglycan in undifferentiated hESCs and hiPSCs.

  3. Development of iPS (induced pluripotent stem cells) using natural product from extract of fish oocyte to provide stem cell for regenerative therapy

    NASA Astrophysics Data System (ADS)

    Meilany, Sofy; Firdausiyah, Qonitha S.; Naroeni, Aroem

    2017-02-01

    In this study, we developed a method to induce pluripotency of adult cells (fibroblast) into stem cells using a natural product, extract of fish oocyte, by comparing the extract concentration, 1 mg/ml and 2 mg/ml. The analyses were done by measuring the Nanog gene expression in cells using qPCR and detecting fibroblast marker anti H2-KK. The results revealed existence of a colony of stem cells in the cell that was induced with 2mg/ml concentration of oocytes. Nanoggene expression was analyzed by qPCR and the results showed expression of Nanog gene compared to the control. Analysis of result of fibroblast using Tali Cytometer and anti H2KK antibody showed loss of expression of Anti H2KK meaning there was transformation from fibroblast type cell to pluripotent cell type.

  4. Induced pluripotent stem cell-derived cardiomyocytes: boutique science or valuable arrhythmia model?

    PubMed

    Knollmann, Björn C

    2013-03-15

    This article reviews the strengths and limitations of induced pluripotent stem cell-derived cardiomyocytes (iPSC-CM) as models of cardiac arrhythmias. Specifically, the article attempts to answer the following questions: Which clinical arrhythmias can be modeled by iPSC-CM? How well can iPSC-CM model adult ventricular myocytes? What are the strengths and limitations of published iPSC-CM arrhythmia models? What new mechanistic insight has been gained? What is the evidence that would support using iPSC-CM to personalize antiarrhythmic drug therapy? The review also discusses the pros and cons of using the iPSC-CM technology for modeling specific genetic arrhythmia disorders, such as long QT syndrome, Brugada Syndrome, or Catecholaminergic Polymorphic Ventricular Tachycardia.

  5. Limiting replication stress during somatic cell reprogramming reduces genomic instability in induced pluripotent stem cells

    PubMed Central

    Ruiz, Sergio; Lopez-Contreras, Andres J.; Gabut, Mathieu; Marion, Rosa M.; Gutierrez-Martinez, Paula; Bua, Sabela; Ramirez, Oscar; Olalde, Iñigo; Rodrigo-Perez, Sara; Li, Han; Marques-Bonet, Tomas; Serrano, Manuel; Blasco, Maria A.; Batada, Nizar N.; Fernandez-Capetillo, Oscar

    2015-01-01

    The generation of induced pluripotent stem cells (iPSC) from adult somatic cells is one of the most remarkable discoveries in recent decades. However, several works have reported evidence of genomic instability in iPSC, raising concerns on their biomedical use. The reasons behind the genomic instability observed in iPSC remain mostly unknown. Here we show that, similar to the phenomenon of oncogene-induced replication stress, the expression of reprogramming factors induces replication stress. Increasing the levels of the checkpoint kinase 1 (CHK1) reduces reprogramming-induced replication stress and increases the efficiency of iPSC generation. Similarly, nucleoside supplementation during reprogramming reduces the load of DNA damage and genomic rearrangements on iPSC. Our data reveal that lowering replication stress during reprogramming, genetically or chemically, provides a simple strategy to reduce genomic instability on mouse and human iPSC. PMID:26292731

  6. Production of De Novo Cardiomyocytes: Human Pluripotent Stem Cell Differentiation and Direct Reprogramming

    PubMed Central

    Burridge, Paul W.; Keller, Gordon; Gold, Joseph D.; Wu, Joseph C.

    2012-01-01

    SUMMARY Cardiovascular disease is a leading cause of death worldwide. The limited capability of heart tissue to regenerate has prompted method developments for creating de novo cardiomyocytes, both in vitro and in vivo. Beyond uses in cell replacement therapy, patient-specific cardiomyocytes may find applications in drug testing, drug discovery, and disease modeling. Recently, approaches for generating cardiomyocytes have expanded to encompass three major sources of starting cells: human pluripotent stem cells (hPSCs), adult heart-derived cardiac progenitor cells (CPCs), and reprogrammed fibroblasts. We discuss state-of-the-art methods for generating de novo cardiomyocytes from hPSC and reprogrammed fibroblasts, highlighting potential applications and future challenges. PMID:22226352

  7. Bioengineering Approaches to Mature Human Pluripotent Stem Cell-Derived Cardiomyocytes.

    PubMed

    Sun, Xuetao; Nunes, Sara S

    2017-01-01

    Human pluripotent stem cell-derived cardiomyocytes (hPSC-CM) represent a potential unlimited cell supply for cardiac tissue engineering and possibly regenerative medicine applications. However, hPSC-CMs produced by current protocols are not representative of native adult human cardiomyocytes as they display immature gene expression profile, structure and function. In order to improve hPSC-CM maturity and function, various approaches have been developed, including genetic manipulations to induce gene expression, delivery of biochemical factors, such as triiodothyronine and alpha-adrenergic agonist phenylephrine, induction of cell alignment in 3D tissues, mechanical stress as a mimic of cardiac load and electrical stimulation/pacing or a combination of these. In this mini review, we discuss biomimetic strategies for the maturation for hPSC-CMs with a particular focus on electromechanical conditioning methods.

  8. Bioengineering Approaches to Mature Human Pluripotent Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Sun, Xuetao; Nunes, Sara S.

    2017-01-01

    Human pluripotent stem cell-derived cardiomyocytes (hPSC-CM) represent a potential unlimited cell supply for cardiac tissue engineering and possibly regenerative medicine applications. However, hPSC-CMs produced by current protocols are not representative of native adult human cardiomyocytes as they display immature gene expression profile, structure and function. In order to improve hPSC-CM maturity and function, various approaches have been developed, including genetic manipulations to induce gene expression, delivery of biochemical factors, such as triiodothyronine and alpha-adrenergic agonist phenylephrine, induction of cell alignment in 3D tissues, mechanical stress as a mimic of cardiac load and electrical stimulation/pacing or a combination of these. In this mini review, we discuss biomimetic strategies for the maturation for hPSC-CMs with a particular focus on electromechanical conditioning methods. PMID:28337437

  9. Modeling ALS with motor neurons derived from human induced pluripotent stem cells.

    PubMed

    Sances, Samuel; Bruijn, Lucie I; Chandran, Siddharthan; Eggan, Kevin; Ho, Ritchie; Klim, Joseph R; Livesey, Matt R; Lowry, Emily; Macklis, Jeffrey D; Rushton, David; Sadegh, Cameron; Sareen, Dhruv; Wichterle, Hynek; Zhang, Su-Chun; Svendsen, Clive N

    2016-04-01

    Directing the differentiation of induced pluripotent stem cells into motor neurons has allowed investigators to develop new models of amyotrophic lateral sclerosis (ALS). However, techniques vary between laboratories and the cells do not appear to mature into fully functional adult motor neurons. Here we discuss common developmental principles of both lower and upper motor neuron development that have led to specific derivation techniques. We then suggest how these motor neurons may be matured further either through direct expression or administration of specific factors or coculture approaches with other tissues. Ultimately, through a greater understanding of motor neuron biology, it will be possible to establish more reliable models of ALS. These in turn will have a greater chance of validating new drugs that may be effective for the disease.

  10. Modeling ALS using motor neurons derived from human induced pluripotent stem cells

    PubMed Central

    Sances, S; Bruijn, LI; Chandran, S; Eggan, K; Ho, R; Klim, J; Livesey, MR; Lowry, E; Macklis, JD; Rushton, D; Sadegh, C; Sareen, D; Wichterle, H; Zhang, SC; Svendsen, CN

    2016-01-01

    Directing the differentiation of induced pluripotent stem cells into motor neurons has allowed investigators to develop novel models of ALS. However, techniques vary between laboratories and the cells do not appear to mature into fully functional adult motor neurons. Here we discuss common developmental principles of both lower and upper motor neuron development that have led to specific derivation techniques. We then suggest how these motor neurons may be matured further either through direct expression or administration of specific factors or co-culture approaches with other tissues. Ultimately, through a greater understanding of motor neuron biology, it will be possible to establish more reliable models of ALS. These in turn will have a greater chance of validating new drugs that may be effective for the disease. PMID:27021939

  11. The business of exploiting induced pluripotent stem cells

    PubMed Central

    Prescott, Catherine

    2011-01-01

    Induced pluripotent stem cells (iPS cells) can be exploited for both research and clinical applications. The first part of this review seeks to provide an understanding of the financial drivers and key elements of a successful business strategy that underpin a company focused on developing iPS-related products and services targeted at the research market. The latter part of the review highlights some of the reasons as to why the reprogramming of somatic cells is currently being used to develop cell-based models to screen for small molecules with drug-like properties rather than to develop cell-based regenerative medicines per se. The latter may be used to repair or replace a patient's damaged cells and thereby have the potential to ‘cure’ a disease and, in doing so, prevent or delay the onset of associated medical conditions. However, the cost of an expensive regenerative medicine and time to accrue any benefit linked to a decrease in co-morbidity expenditure may not outweigh the benefit for a healthcare community that has finite resources. The implications of this are discussed together with evidence that the UK National Institute for Health and Clinical Excellence (NICE) and the National Health Service (NHS) have established a precedent for a cost-sharing strategy with the pharmaceutical industry. PMID:21727138

  12. Engineering bone tissue substitutes from human induced pluripotent stem cells.

    PubMed

    de Peppo, Giuseppe Maria; Marcos-Campos, Iván; Kahler, David John; Alsalman, Dana; Shang, Linshan; Vunjak-Novakovic, Gordana; Marolt, Darja

    2013-05-21

    Congenital defects, trauma, and disease can compromise the integrity and functionality of the skeletal system to the extent requiring implantation of bone grafts. Engineering of viable bone substitutes that can be personalized to meet specific clinical needs represents a promising therapeutic alternative. The aim of our study was to evaluate the utility of human-induced pluripotent stem cells (hiPSCs) for bone tissue engineering. We first induced three hiPSC lines with different tissue and reprogramming backgrounds into the mesenchymal lineages and used a combination of differentiation assays, surface antigen profiling, and global gene expression analysis to identify the lines exhibiting strong osteogenic differentiation potential. We then engineered functional bone substitutes by culturing hiPSC-derived mesenchymal progenitors on osteoconductive scaffolds in perfusion bioreactors and confirmed their phenotype stability in a subcutaneous implantation model for 12 wk. Molecular analysis confirmed that the maturation of bone substitutes in perfusion bioreactors results in global repression of cell proliferation and an increased expression of lineage-specific genes. These results pave the way for growing patient-specific bone substitutes for reconstructive treatments of the skeletal system and for constructing qualified experimental models of development and disease.

  13. Modeling Rett Syndrome Using Human Induced Pluripotent Stem Cells.

    PubMed

    Andoh-Noda, Tomoko; Inouye, Michiko O; Miyake, Kunio; Kubota, Takeo; Okano, Hideyuki; Akamatsu, Wado

    2016-01-01

    Rett syndrome (RTT) is one of a group of neurodevelopmental disorders typically characterized by deficits in the X-linked gene MECP2 (methyl-CpG binding protein 2). The MECP2 gene encodes a multifunctional protein involved in transcriptional repression, transcriptional activation, chromatin remodeling, and RNA splicing. Genetic deletion of Mecp2 in mice revealed neuronal disabilities including RTT-like phenotypes and provided an excellent platform for understanding the pathogenesis of RTT. So far, there are no effective pharmacological treatments for RTT because the role of MECP2 in RTT is incompletely understood. Recently, human induced pluripotent stem cell (hiPSC) technologies have improved our knowledge of neurological and neurodevelopmental diseases including RTT because neurons derived from RTT-hiPSCs can be used for disease modeling to understand RTT phenotypes and to perform high throughput pharmaceutical drug screening. In this review, we provide an overview of RTT, including MeCP2 function and mouse models of RTT. In addition, we introduce recent advances in disease modeling of RTT using hiPSC-derived neural cells.

  14. Generating kidney organoids from human pluripotent stem cells

    PubMed Central

    Takasato, Minoru; Er, Pei X; Chiu, Han S; Little, Melissa H

    2016-01-01

    The human kidney develops from four progenitor populations; nephron progenitors, ureteric epithelial progenitors, renal interstitial progenitors and endothelial progenitors; resulting in the formation of maximally 2 million nephrons. Until recently, methods differentiating human pluripotent stem cells (hPSCs) into either nephron progenitor or ureteric epithelial progenitor had been reported, consequently forming only nephrons or collecting ducts, respectively. Here, we detail a protocol that simultaneously induces all four progenitors to generate kidney organoids within which segmented nephrons are connected to collecting ducts and surrounded by renal interstitial cells and an endothelial network. As evidence of functional maturity, proximal tubules within organoids display megalin-mediated and cubilin-mediated endocytosis, and respond to a nephrotoxicant to undergo apoptosis. This protocol consists of 7 days of monolayer culture for intermediate mesoderm induction followed by 18 days of three-dimensional culture to facilitate self-organising renogenic events leading to organoid formation. Personnel experienced in culturing hPSCs are required to conduct this protocol. PMID:27560173

  15. Pluripotent Stem Cell Derived Cardiac Cells for Myocardial Repair.

    PubMed

    Zhu, Wuqiang; Gao, Ling; Zhang, Jianyi

    2017-02-03

    Human induced pluripotent stem cells (hiPSCs) must be fully differentiated into specific cell types before administration, but conventional protocols for differentiating hiPSCs into cardiomyocytes (hiPSC-CMs), endothelial cells (hiPSC-ECs), and smooth muscle cells (SMCs) are often limited by low yield, purity, and/or poor phenotypic stability. Here, we present novel protocols for generating hiPSC-CMs, -ECs, and -SMCs that are substantially more efficient than conventional methods, as well as a method for combining cell injection with a cytokine-containing patch created over the site of administration. The patch improves both the retention of the injected cells, by sealing the needle track to prevent the cells from being squeezed out of the myocardium, and cell survival, by releasing insulin-like growth factor (IGF) over an extended period. In a swine model of myocardial ischemia-reperfusion injury, the rate of engraftment was more than two-fold greater when the cells were administered with the cytokine-containing patch comparing to the cells without patch, and treatment with both the cells and the patch, but not with the cells alone, was associated with significant improvements in cardiac function and infarct size.

  16. Human-induced pluripotent stem cells: potential for neurodegenerative diseases.

    PubMed

    Ross, Christopher A; Akimov, Sergey S

    2014-09-15

    The cell biology of human neurodegenerative diseases has been difficult to study till recently. The development of human induced pluripotent stem cell (iPSC) models has greatly enhanced our ability to model disease in human cells. Methods have recently been improved, including increasing reprogramming efficiency, introducing non-viral and non-integrating methods of cell reprogramming, and using novel gene editing techniques for generating genetically corrected lines from patient-derived iPSCs, or for generating mutations in control cell lines. In this review, we highlight accomplishments made using iPSC models to study neurodegenerative disorders such as Huntington's disease, Parkinson's disease, Amyotrophic Lateral Sclerosis, Fronto-Temporal Dementia, Alzheimer's disease, Spinomuscular Atrophy and other polyglutamine diseases. We review disease-related phenotypes shown in patient-derived iPSCs differentiated to relevant neural subtypes, often with stressors or cell "aging", to enhance disease-specific phenotypes. We also discuss prospects for the future of using of iPSC models of neurodegenerative disorders, including screening and testing of therapeutic compounds, and possibly of cell transplantation in regenerative medicine. The new iPSC models have the potential to greatly enhance our understanding of pathogenesis and to facilitate the development of novel therapeutics.

  17. Modeling complex neuropsychiatric disorders with human induced pluripotent stem cells.

    PubMed

    Tobe, Brian T D; Snyder, Evan Y; Nye, Jeffrey S

    2011-10-01

    Identifying the molecular and cellular basis of complex neuropsychiatric disorders (cNPDs) has been limited by the inaccessibility of central neurons, variability within broad diagnostic classifications, and the interplay of genetic and environmental factors. Recent work utilizing neuronally differentiated human induced pluripotent stem cells (hiPSCs) from Mendelian and polygenic cNPDs is beginning to illuminate neuritic, synaptic or cell body variations accompanied by specific gene or protein expression alterations largely mimicking known pathology. In some cases, phenotypes have only emerged after application of cellular stress or long duration of differentiation. Pathological and cellular expression features are fully or partially responsive to pharmacological treatment highlighting the potential utility of differentiated hiPSCs for discovery of personalized therapeutics and for identifying pathogenetically relevant targets in subgroups of patients within a broad syndromic classification. Because of the inherent variability in developing and differentiating hiPSC lines and the multiple comparisons implicit in 'omics' technologies, rigorous algorithms for assuring statistical significance and independent confirmation of results, will be required for robust modeling of cNPDs.

  18. The silver lining of induced pluripotent stem cell variation

    PubMed Central

    Jain, Tanya; Sevilla, Ana

    2016-01-01

    Induced pluripotent stem cells (iPSCs) are being generated using various reprogramming methods and from different cell sources. Hence, a lot of effort has been devoted to evaluating the differences among iPSC lines, in particular with respect to their differentiation capacity. While line-to-line variability should mainly reflect the genetic diversity within the human population, here we review some studies that have brought attention to additional variation caused by genomic and epigenomic alterations. We discuss strategies to evaluate aberrant changes and to minimize technical and culture-induced noise, in order to generate safe cells for clinical applications. We focus on the findings from a recent study, which compared the differentiation capacity of several iPSC lines committed to the hematopoietic lineage and correlated the differential maturation capacity with aberrant DNA methylations. Although iPSC variation represents a challenge for the field, we embrace the authors’ perspective that iPSC variations should be used to our advantage for predicting and selecting the best performing iPSC lines, depending on the desired application. PMID:28066788

  19. Induced Pluripotent Stem Cell Therapies for Cervical Spinal Cord Injury

    PubMed Central

    Doulames, Vanessa M.; Plant, Giles W.

    2016-01-01

    Cervical-level injuries account for the majority of presented spinal cord injuries (SCIs) to date. Despite the increase in survival rates due to emergency medicine improvements, overall quality of life remains poor, with patients facing variable deficits in respiratory and motor function. Therapies aiming to ameliorate symptoms and restore function, even partially, are urgently needed. Current therapeutic avenues in SCI seek to increase regenerative capacities through trophic and immunomodulatory factors, provide scaffolding to bridge the lesion site and promote regeneration of native axons, and to replace SCI-lost neurons and glia via intraspinal transplantation. Induced pluripotent stem cells (iPSCs) are a clinically viable means to accomplish this; they have no major ethical barriers, sources can be patient-matched and collected using non-invasive methods. In addition, the patient’s own cells can be used to establish a starter population capable of producing multiple cell types. To date, there is only a limited pool of research examining iPSC-derived transplants in SCI—even less research that is specific to cervical injury. The purpose of the review herein is to explore both preclinical and clinical recent advances in iPSC therapies with a detailed focus on cervical spinal cord injury. PMID:27070598

  20. The business of exploiting induced pluripotent stem cells.

    PubMed

    Prescott, Catherine

    2011-08-12

    Induced pluripotent stem cells (iPS cells) can be exploited for both research and clinical applications. The first part of this review seeks to provide an understanding of the financial drivers and key elements of a successful business strategy that underpin a company focused on developing iPS-related products and services targeted at the research market. The latter part of the review highlights some of the reasons as to why the reprogramming of somatic cells is currently being used to develop cell-based models to screen for small molecules with drug-like properties rather than to develop cell-based regenerative medicines per se. The latter may be used to repair or replace a patient's damaged cells and thereby have the potential to 'cure' a disease and, in doing so, prevent or delay the onset of associated medical conditions. However, the cost of an expensive regenerative medicine and time to accrue any benefit linked to a decrease in co-morbidity expenditure may not outweigh the benefit for a healthcare community that has finite resources. The implications of this are discussed together with evidence that the UK National Institute for Health and Clinical Excellence (NICE) and the National Health Service (NHS) have established a precedent for a cost-sharing strategy with the pharmaceutical industry.

  1. Generation of induced pluripotent stem cells from domestic goats.

    PubMed

    Sandmaier, Shelley E S; Nandal, Anjali; Powell, Anne; Garrett, Wesley; Blomberg, Leann; Donovan, David M; Talbot, Neil; Telugu, Bhanu P

    2015-09-01

    The creation of genetically modified goats provides a powerful approach for improving animal health, enhancing production traits, animal pharming, and for ensuring food safety all of which are high-priority goals for animal agriculture. The availability of goat embryonic stem cells (ESCs) that are characteristically immortal in culture would be of enormous benefit for developing genetically modified animals. As an alternative to long-sought goat ESCs, we generated induced pluripotent stem cells (iPSC) by forced expression of bovine POU5F1, SOX2, MYC, KLF4, LIN-28, and NANOG reprogramming factors in combination with a MIR302/367 cluster, delivered by lentiviral vectors. In order to minimize integrations, the reprogramming factor coding sequences were assembled with porcine teschovirus-1 2A (P2A) self-cleaving peptides that allowed for tri-cistronic expression from each vector. The lentiviral-transduced cells were cultured on irradiated mouse feeder cells in a semi-defined, serum-free medium containing fibroblast growth factor (FGF) and/or leukemia inhibitory factor (LIF). The resulting goat iPSC exhibit cell and colony morphology typical of human and mouse ESCs-that is, well-defined borders, a high nuclear-to-cytoplasmic ratio, a short cell-cycle interval, alkaline phosphatase expression, and the ability to generate teratomas in vivo. Additionally, these goat iPSC demonstrated the ability to differentiate into directed lineages in vitro. These results constitute the first steps in establishing integration and footprint-free iPSC from ruminants. Mol. Reprod. Dev. 82: 709-721, 2015. © 2015 Wiley Periodicals, Inc.

  2. A Method to Identify and Isolate Pluripotent Human Stem Cells and Mouse Epiblast Stem Cells Using Lipid Body-Associated Retinyl Ester Fluorescence

    PubMed Central

    Muthusamy, Thangaselvam; Mukherjee, Odity; Menon, Radhika; Megha, P.B.; Panicker, Mitradas M.

    2014-01-01

    Summary We describe the use of a characteristic blue fluorescence to identify and isolate pluripotent human embryonic stem cells and human-induced pluripotent stem cells. The blue fluorescence emission (450–500 nm) is readily observed by fluorescence microscopy and correlates with the expression of pluripotency markers (OCT4, SOX2, and NANOG). It allows easy identification and isolation of undifferentiated human pluripotent stem cells, high-throughput fluorescence sorting and subsequent propagation. The fluorescence appears early during somatic reprogramming. We show that the blue fluorescence arises from the sequestration of retinyl esters in cytoplasmic lipid bodies. The retinoid-sequestering lipid bodies are specific to human and mouse pluripotent stem cells of the primed or epiblast-like state and absent in naive mouse embryonic stem cells. Retinol, present in widely used stem cell culture media, is sequestered as retinyl ester specifically by primed pluripotent cells and also can induce the formation of these lipid bodies. PMID:25068130

  3. Perspectives for induced pluripotent stem cell technology: new insights into human physiology involved in somatic mosaicism.

    PubMed

    Nagata, Naoki; Yamanaka, Shinya

    2014-01-31

    Induced pluripotent stem cell technology makes in vitro reprogramming of somatic cells from individuals with various genetic backgrounds possible. By applying this technology, it is possible to produce pluripotent stem cells from biopsy samples of arbitrarily selected individuals with various genetic backgrounds and to subsequently maintain, expand, and stock these cells. From these induced pluripotent stem cells, target cells and tissues can be generated after certain differentiation processes. These target cells/tissues are expected to be useful in regenerative medicine, disease modeling, drug screening, toxicology testing, and proof-of-concept studies in drug development. Therefore, the number of publications concerning induced pluripotent stem cells has recently been increasing rapidly, demonstrating that this technology has begun to infiltrate many aspects of stem cell biology and medical applications. In this review, we discuss the perspectives of induced pluripotent stem cell technology for modeling human diseases. In particular, we focus on the cloning event occurring through the reprogramming process and its ability to let us analyze the development of complex disease-harboring somatic mosaicism.

  4. The iCRISPR platform for rapid genome editing in human pluripotent stem cells.

    PubMed

    Zhu, Zengrong; González, Federico; Huangfu, Danwei

    2014-01-01

    Human pluripotent stem cells (hPSCs) have the potential to generate all adult cell types, including rare or inaccessible human cell populations, thus providing a unique platform for disease studies. To realize this promise, it is essential to develop methods for efficient genetic manipulations in hPSCs. Established using TALEN (transcription activator-like effector nuclease) and CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) systems, the iCRISPR platform supports a variety of genome-engineering approaches with high efficiencies. Here, we first describe the establishment of the iCRISPR platform through TALEN-mediated targeting of inducible Cas9 expression cassettes into the AAVS1 locus. Next, we provide a series of technical procedures for using iCRISPR to achieve one-step knockout of one or multiple gene(s), "scarless" introduction of precise nucleotide alterations, as well as inducible knockout during hPSC differentiation. We present an optimized workflow, as well as guidelines for the selection of CRISPR targeting sequences and the design of single-stranded DNA (ssDNA) homology-directed DNA repair templates for the introduction of specific nucleotide alterations. We have successfully used these protocols in four different hPSC lines, including human embryonic stem cells and induced pluripotent stem cells. Once the iCRISPR platform is established, clonal lines with desired genetic modifications can be established in as little as 1 month. The methods described here enable a wide range of genome-engineering applications in hPSCs, thus providing a valuable resource for the creation of diverse hPSC-based disease models with superior speed and ease.

  5. Prospects and Challenges of Induced Pluripotent Stem Cells in Equine Health

    PubMed Central

    Donadeu, F. Xavier; Esteves, Cristina L.

    2015-01-01

    Pluripotent stem cells (PSCs) hold, through the capacity to differentiate into virtually all body cell types, unprecedented promise for human and animal medicine. PSCs are naturally found in the early embryo, and in rodents and humans they can be robustly harvested and grown in culture in the form of embryonic stem cells (ESCs); however, the availability of ESCs from horses is limited. ES-like cells named induced pluripotent stem cells (iPSCs) can be derived in vitro by transcription factor-mediated reprogramming of adult cells. As such, iPSCs can be generated in a patient-specific manner providing unmatched potential for tissue transplantation and in vitro disease modeling. In humans, clinical trials using iPSC-derived cells are already taking place and the use of in vitro iPSC models has identified novel mechanisms of disease and therapeutic targets. Although to a more limited extent, iPSCs have also been generated from horses, a species in which, after humans, these cells are likely to hold the greatest potential in regenerative medicine. Before a clinical use can be envisioned, however, significant challenges will need to be addressed in relation to the robust derivation, long-term culture, differentiation, and clinical safety of equine iPSCs. Toward this objective, recent studies have reported significant improvement in culture conditions and the successful derivation for the first time of functional cell types from equine iPSCs. Given the wide range of exciting applications they could have, it is hoped future research will make the biomedical promise of iPSCs a reality not only for humans but also horses. PMID:26664986

  6. The role of nanotechnology in induced pluripotent and embryonic stem cells research.

    PubMed

    Chen, Lukui; Qiu, Rong; Li, Lushen

    2014-12-01

    This paper reviews the recent studies on development of nanotechnology in the field of induced pluripotent and embryonic stem cells. Stem cell therapy is a promising therapy that can improve the quality of life for patients with refractory diseases. However, this option is limited by the scarcity of tissues, ethical problem, and tumorigenicity. Nanotechnology is another promising therapy that can be used to mimic the extracellular matrix, label the implanted cells, and also can be applied in the tissue engineering. In this review, we briefly introduce implementation of nanotechnology in induced pluripotent and embryonic stem cells research. Finally, the potential application of nanotechnology in tissue engineering and regenerative medicine is also discussed.

  7. Generation of Multipotent Foregut Stem Cells from Human Pluripotent Stem Cells

    PubMed Central

    Hannan, Nicholas R.F.; Fordham, Robert P.; Syed, Yasir A.; Moignard, Victoria; Berry, Andrew; Bautista, Ruben; Hanley, Neil A.; Jensen, Kim B.; Vallier, Ludovic

    2013-01-01

    Summary Human pluripotent stem cells (hPSCs) could provide an infinite source of clinically relevant cells with potential applications in regenerative medicine. However, hPSC lines vary in their capacity to generate specialized cells, and the development of universal protocols for the production of tissue-specific cells remains a major challenge. Here, we have addressed this limitation for the endodermal lineage by developing a defined culture system to expand and differentiate human foregut stem cells (hFSCs) derived from hPSCs. hFSCs can self-renew while maintaining their capacity to differentiate into pancreatic and hepatic cells. Furthermore, near-homogenous populations of hFSCs can be obtained from hPSC lines which are normally refractory to endodermal differentiation. Therefore, hFSCs provide a unique approach to bypass variability between pluripotent lines in order to obtain a sustainable source of multipotent endoderm stem cells for basic studies and to produce a diversity of endodermal derivatives with a clinical value. PMID:24319665

  8. Induced pluripotent stem cells from pigs and other ungulate species: an alternative to embryonic stem cells?

    PubMed

    Ezashi, T; Telugu, B P V L; Roberts, R M

    2012-08-01

    Robust embryonic stem cell (ESC) lines from livestock species have been difficult to derive and maintain, and unlike mouse ESC, have not contributed to our ability to understand directed differentiation in vitro. Nor have such cells yet provided a simpler means than pronuclear injection to manipulate the genomes of agriculturally important species, such as cattle, sheep and pigs. Induced pluripotent stem cells (iPSC) generated by reprogramming somatic cells, such as fibroblasts, with a set of stemness genes, most usually but not exclusively POU5F1, SOX2, KLF4 and c-MYC, offer an alternative to ESC in these regards, as they exhibit a pluripotent phenotype resembling that of ESC, yet are readily generated in the laboratory. Accordingly, such cells, in association with cloning technologies, may be useful for introducing complex genetic changes into livestock, although this potential has yet to be demonstrated. Porcine iPSC may be especially valuable because the pig is a prime biomedical model for tissue transplantation. In general, iPSC from livestock, like those from humans, are of the epiblast type and depend upon FGF2 and activin/nodal signalling systems to maintain their pluripotency and growth. Recent experiments, in which newly reprogrammed porcine and bovine cells were selected on a LIF-based medium in presence of specific protein kinase inhibitors, have allowed iPSC cells of the naïve type, resembling the more amenable blastocyst-derived mouse ESC and iPSC to be isolated. However, hurdles still remain if such cells are to achieve their biotechnological promise.

  9. The impact of developmental biology on pluripotent stem cell research: successes and challenges.

    PubMed

    Rossant, Janet

    2011-07-19

    Research on developmental pathways in model organisms provides key information on how to isolate, maintain, and differentiate human pluripotent stem cells. However, details of developmental pathways differ even across mammalian species. Full realization of the potential of stem cells will require more direct studies of human or primate developmental biology.

  10. A murine-ES like state facilitates transgenesis and homologous recombination in human pluripotent stem cells

    PubMed Central

    Buecker, Christa; Chen, Hsu-Hsin; Polo, Jose; Daheron, Laurence; Bu, Lei; Barakat, Tahsin Stefan; Okwieka, Patricia; Porter, Andrew; Gribnau, Joost; Hochedlinger, Konrad; Geijsen, Niels

    2010-01-01

    Murine embryonic stem cells have been shown to exist in two functionally distinct pluripotent states, embryonic stem cells (ES cell)- and epiblast stem cells (EpiSCs), which are defined by the culture growth factor conditions. Human ES cells appear to exist in an epiblast-like state, which in comparison to their murine counterparts, is relatively difficult to propagate and manipulate. As a result, gene targeting is difficult and to-date only a handful of human knock-in or knock-out cell lines exist. We explored whether an alternative stem cell state exists for human stem cells as well, and demonstrate that manipulation of the growth factor milieu allows the derivation of a novel human stem cell type that displays morphological, molecular and functional properties of murine ES cells and facilitates gene targeting. As such, the murine ES-like state provides a powerful tool for the generation of recombinant human pluripotent stem cell lines. PMID:20569691

  11. Development of patient-specific hematopoietic stem and progenitor cell grafts from pluripotent stem cells, in vitro.

    PubMed

    Klump, H; Teichweyde, N; Meyer, C; Horn, P A

    2013-06-01

    Pluripotent stem cells hold great promise for future applications in many areas of regenerative medicine. Their defining property of differentiation towards any of the three germ layers and all derivatives thereof, including somatic stem cells, explains the special interest of the biomedical community in this cell type. In this review, we focus on the current state of directed differentiation of pluripotent stem cells towards hematopoietic stem cells (HSCs). HSCs are especially interesting because they are the longest known and, thus, most intensively investigated somatic stem cells. They were the first stem cells successfully used for regenerative purposes in clinical human medicine, namely in bone marrow transplantation, and also the first stem cells to be genetically altered for the first successful gene therapy trial in humans. However, because of the technical difficulties associated with this rare type of cell, such as the current incapability of prospective isolation, in vitro expansion and gene repair by homologous recombination, there is great interest in using pluripotent stem cells, such as Embryonic Stem (ES-) cells, as a source for generating and genetically altering HSCs, ex vivo. This has been hampered by ethical concerns associated with the use of human ES-cells. However, since Shinya Yamanaka´s successful attempts to reprogram somatic cells of mice and men to an ES-cell like state, so-called induced pluripotent stem (iPS) cells, this field of research has experienced a huge boost. In this brief review, we will reflect on the status quo of directed hematopoietic differentiation of human and mouse pluripotent stem cells.

  12. Large animal induced pluripotent stem cells as pre-clinical models for studying human disease.

    PubMed

    Plews, Jordan R; Gu, Mingxia; Longaker, Michael T; Wu, Joseph C

    2012-06-01

    The path to induced pluripotency Discovery of a pan-species pluripotency network Animal iPSCs and disease modelling Issues with large animal iPSCs Conclusions The derivation of human embryonic stem cells and subsequently human induced pluripotent stem cells (iPSCs) has energized regenerative medicine research and enabled seemingly limitless applications. Although small animal models, such as mouse models, have played an important role in the progression of the field, typically, they are poor representations of the human disease phenotype. As an alternative, large animal models should be explored as a potentially better approach for clinical translation of cellular therapies. However, only fragmented information regarding the derivation, characterization and clinical usefulness of pluripotent large animal cells is currently available. Here, we briefly review the latest advances regarding the derivation and use of large animal iPSCs.

  13. Inference of Transcriptional Network for Pluripotency in Mouse Embryonic Stem Cells

    NASA Astrophysics Data System (ADS)

    Aburatani, S.

    2015-01-01

    In embryonic stem cells, various transcription factors (TFs) maintain pluripotency. To gain insights into the regulatory system controlling pluripotency, I inferred the regulatory relationships between the TFs expressed in ES cells. In this study, I applied a method based on structural equation modeling (SEM), combined with factor analysis, to 649 expression profiles of 19 TF genes measured in mouse Embryonic Stem Cells (ESCs). The factor analysis identified 19 TF genes that were regulated by several unmeasured factors. Since the known cell reprogramming TF genes (Pou5f1, Sox2 and Nanog) are regulated by different factors, each estimated factor is considered to be an input for signal transduction to control pluripotency in mouse ESCs. In the inferred network model, TF proteins were also arranged as unmeasured factors that control other TFs. The interpretation of the inferred network model revealed the regulatory mechanism for controlling pluripotency in ES cells.

  14. Induced pluripotent stem cells as a cellular model for studying Down Syndrome

    PubMed Central

    Brigida, Anna Lisa; Siniscalco, Dario

    2016-01-01

    Down Syndrome (DS), or Trisomy 21 Syndrome, is one of the most common genetic diseases. It is a chromosomal abnormality caused by a duplication of chromosome 21. DS patients show the presence of a third copy (or a partial third copy) of chromosome 21 (trisomy), as result of meiotic errors. These patients suffer of many health problems, such as intellectual disability, congenital heart disease, duodenal stenosis, Alzheimer’s disease, leukemia, immune system deficiencies, muscle hypotonia and motor disorders. About one in 1000 babies born each year are affected by DS. Alterations in the dosage of genes located on chromosome 21 (also called HSA21) are responsible for the DS phenotype. However, the molecular pathogenic mechanisms of DS triggering are still not understood; newest evidences suggest the involvement of epigenetic mechanisms. For obvious ethical reasons, studies performed on DS patients, as well as on human trisomic tissues are limited. Some authors have proposed mouse models of this syndrome. However, not all the features of the syndrome are represented. Stem cells are considered the future of molecular and regenerative medicine. Several types of stem cells could provide a valid approach to offer a potential treatment for some untreatable human diseases. Stem cells also represent a valid system to develop new cell-based drugs and/or a model to study molecular disease pathways. Among stem cell types, patient-derived induced pluripotent stem (iPS) cells offer some advantages for cell and tissue replacement, engineering and studying: self-renewal capacity, pluripotency and ease of accessibility to donor tissues. These cells can be reprogrammed into completely different cellular types. They are derived from adult somatic cells via reprogramming with ectopic expression of four transcription factors (Oct3/4, Sox2, c-Myc and Klf4; or, Oct3/4, Sox2, Nanog, and Lin28). By reprogramming cells from DS patients, it is possible to obtain new tissue with the same

  15. A molecular roadmap of definitive erythropoiesis from human induced pluripotent stem cells.

    PubMed

    Razaq, Muhammad A; Taylor, Stephen; Roberts, David J; Carpenter, Lee

    2017-03-01

    Human induced pluripotent stem cells (hiPSCs) are being considered for use in understanding haematopoietic disorders and as a potential source of in vitro manufactured red cells. Here, we show that hiPSCs are able to recapitulate various stages of developmental erythropoiesis. We show that primitive erythroblasts arise first, express CD31(+) with CD235a(+) , embryonic globins and red cell markers, but fail to express the hallmark red cell transcripts of adult erythropoiesis. When hiPSC-derived CD45(+) CD235a(-) haematopoietic progenitors are isolated on day 12 and further differentiated on OP9 stroma, they selectively express CD36(+) and CD235a(+) , adult erythroid transcripts for transcription factors (e.g., BCL11A, KLF1) and fetal/adult globins (HBG1/2, HBB). Importantly, hiPSC- and cord-derived CD36(+) CD235a(+) erythroblasts show a striking homology by transcriptome array profiling (only 306 transcripts with a 2Log fold change >1·5- or 2·8-fold). Phenotypic and transcriptome profiling of CD45(+) CD117(+) CD235a(+) pro-erythroblasts and terminally differentiated erythroblasts is also provided, including evidence of a HbF (fetal) to HbA (adult) haemoglobin switch and enucleation, that mirrors their definitive erythroblast cord-derived counterparts. These findings provide a molecular roadmap of developmental erythropoiesis from hiPSC sources at several critical stages, but also helps to inform on their use for clinical applications and modelling human haematopoietic disease.

  16. Totipotent, pluripotent or unipotent stem cells: a complex regulatory enigma and fascinating biology.

    PubMed

    de Kretser, David

    2007-10-01

    The search for sources of human stem cells has become a controversial topic from an ethical point of view primarily as it has required the destruction of human embryos. The development of alternative techniques that enable the generation of pluripotent stem cells from adult cells has opened new avenues of research but the generation of such cells has again been controversial since it requires the use of human eggs, using a technique called somatic cell nuclear transfer. Since the cells so generated have a very small potential to generate an "embryo" and since the production of the cell lines requires destruction of that "embryo", a further ethical issue arises. This article discusses these issues and suggests a framework that may assist their consideration. Finally, the article reviews some recent developments that have the potential to remove the need for the use of eggs or embryos in the generation of stem cell lines and highlights the danger of developing legislation on only our current knowledge.

  17. Pluripotent stem cells for cardiac regeneration: Overview of recent advances & emerging trends

    PubMed Central

    Pawani, Harsha; Bhartiya, Deepa

    2013-01-01

    Cell based regenerative therapy has emerged as one of the most promising options of treatment for patients suffering from heart failure. Various adult stem cells types have undergone extensive clinical trials with limited success which is believed to be more of a cytokine effect rather than cell therapy. Pluripotent human embryonic stem cells (hESCs) have emerged as an attractive candidate stem cell source for obtaining cardiomyocytes (CMs) because of their tremendous capacity for expansion and unquestioned potential to differentiate into CMs. Studies carried out in animal models indicate that ES-derived CMs can partially remuscularize infarcted hearts and improve contractile function; however, the effect was not sustained over long follow up periods due to their limited capacity of cell division in vivo. Thus, the concept of transplanting multipotent cardiovascular progenitors derived from ES cells has emerged since the progenitors retain robust proliferative ability and multipotent nature enabling repopulation of other myocardial elements also in addition to CMs. Transplantation of CMs (progenitors) seeded in biodegradable scaffold and gel based engineered constructs has met with modest success due to issues like cell penetration, nutrient and oxygen availability and inflammation triggered during scaffold degradation inversely affecting the seeded cells. Recently cell sheet based tissue engineering involving culturing cells on ‘intelligent’ polymers has been evolved. Generation of a 3-D pulsatile myocardial tissue has been achieved. However, these advances have to be looked at with cautious optimism as many challenges need to be overcome before using these in clinical practice. PMID:23563370

  18. Pluripotent stem cells for cardiac regeneration: overview of recent advances & emerging trends.

    PubMed

    Pawani, Harsha; Bhartiya, Deepa

    2013-02-01

    Cell based regenerative therapy has emerged as one of the most promising options of treatment for patients suffering from heart failure. Various adult stem cells types have undergone extensive clinical trials with limited success which is believed to be more of a cytokine effect rather than cell therapy. Pluripotent human embryonic stem cells (hESCs) have emerged as an attractive candidate stem cell source for obtaining cardiomyocytes (CMs) because of their tremendous capacity for expansion and unquestioned potential to differentiate into CMs. Studies carried out in animal models indicate that ES-derived CMs can partially remuscularize infarcted hearts and improve contractile function; however, the effect was not sustained over long follow up periods due to their limited capacity of cell division in vivo. Thus, the concept of transplanting multipotent cardiovascular progenitors derived from ES cells has emerged since the progenitors retain robust proliferative ability and multipotent nature enabling repopulation of other myocardial elements also in addition to CMs. Transplantation of CMs (progenitors) seeded in biodegradable scaffold and gel based engineered constructs has met with modest success due to issues like cell penetration, nutrient and oxygen availability and inflammation triggered during scaffold degradation inversely affecting the seeded cells. Recently cell sheet based tissue engineering involving culturing cells on 'intelligent' polymers has been evolved. Generation of a 3-D pulsatile myocardial tissue has been achieved. However, these advances have to be looked at with cautious optimism as many challenges need to be overcome before using these in clinical practice.

  19. A highly efficient method for generation of therapeutic quality human pluripotent stem cells by using naive induced pluripotent stem cells nucleus for nuclear transfer

    PubMed Central

    2014-01-01

    Even after several years since the discovery of human embryonic stem cells and induced pluripotent stem cells (iPSC), we are still unable to make any significant therapeutic benefits out of them such as cell therapy or generation of organs for transplantation. Recent success in somatic cell nuclear transfer (SCNT) made it possible to generate diploid embryonic stem cells, which opens up the way to make high-quality pluripotent stem cells. However, the process is highly inefficient and hence expensive compared to the generation of iPSC. Even with the latest SCNT technology, we are not sure whether one can make therapeutic quality pluripotent stem cell from any patient’s somatic cells or by using oocytes from any donor. Combining iPSC technology with SCNT, that is, by using the nucleus of the candidate somatic cell which got reprogrammed to pluripotent state instead that of the unmodified nucleus of the candidate somatic cell, would boost the efficiency of the technique, and we would be able to generate therapeutic quality pluripotent stem cells. Induced pluripotent stem cell nuclear transfer (iPSCNT) combines the efficiency of iPSC generation with the speed and natural reprogramming environment of SCNT. The new technique may be called iPSCNT. This technique could prove to have very revolutionary benefits for humankind. This could be useful in generating organs for transplantation for patients and for reproductive cloning, especially for childless men and women who cannot have children by any other techniques. When combined with advanced gene editing techniques (such as CRISPR-Cas system) this technique might also prove useful to those who want to have healthy children but suffer from inherited diseases. The current code of ethics may be against reproductive cloning. However, this will change with time as it happened with most of the revolutionary scientific breakthroughs. After all, it is the right of every human to have healthy offspring and it is the question of

  20. Trophoblast lineage cells derived from human induced pluripotent stem cells

    SciTech Connect

    Chen, Ying; Wang, Kai; Chandramouli, Gadisetti V.R.; Knott, Jason G.; Leach, Richard

    2013-07-12

    Highlights: •Epithelial-like phenotype of trophoblast lineage cells derived from human iPS cells. •Trophoblast lineage cells derived from human iPS cells exhibit trophoblast function. •Trophoblasts from iPS cells provides a proof-of-concept in regenerative medicine. -- Abstract: Background: During implantation, the blastocyst trophectoderm attaches to the endometrial epithelium and continues to differentiate into all trophoblast subtypes, which are the major components of a placenta. Aberrant trophoblast proliferation and differentiation are associated with placental diseases. However, due to ethical and practical issues, there is almost no available cell or tissue source to study the molecular mechanism of human trophoblast differentiation, which further becomes a barrier to the study of the pathogenesis of trophoblast-associated diseases of pregnancy. In this study, our goal was to generate a proof-of-concept model for deriving trophoblast lineage cells from induced pluripotency stem (iPS) cells from human fibroblasts. In future studies the generation of trophoblast lineage cells from iPS cells established from patient’s placenta will be extremely useful for studying the pathogenesis of individual trophoblast-associated diseases and for drug testing. Methods and results: Combining iPS cell technology with BMP4 induction, we derived trophoblast lineage cells from human iPS cells. The gene expression profile of these trophoblast lineage cells was distinct from fibroblasts and iPS cells. These cells expressed markers of human trophoblasts. Furthermore, when these cells were differentiated they exhibited invasive capacity and placental hormone secretive capacity, suggesting extravillous trophoblasts and syncytiotrophoblasts. Conclusion: Trophoblast lineage cells can be successfully derived from human iPS cells, which provide a proof-of-concept tool to recapitulate pathogenesis of patient placental trophoblasts in vitro.

  1. Role of bioinspired polymers in determination of pluripotent stem cell fate

    PubMed Central

    Abraham, Sheena; Eroshenko, Nikolai; Rao, Raj R

    2009-01-01

    Human pluripotent stem cells, including embryonic and induced pluripotent stem cells, hold enormous potential for the treatment of many diseases, owing to their ability to generate cell types useful for therapeutic applications. Currently, many stem cell culture propagation and differentiation systems incorporate animal-derived components for promoting self-renewal and differentiation. However, use of these components is labor intensive, carries the risk of xenogeneic contamination and yields compromised experimental results that are difficult to duplicate. From a biomaterials perspective, the generation of an animal- and cell-free biomimetic microenvironment that provides the appropriate physical and chemical cues for stem cell self-renewal or differentiation into specialized cell types would be ideal. This review presents the use of natural and synthetic polymers that support propagation and differentiation of stem cells, in an attempt to obtain a clear understanding of the factors responsible for the determination of stem cell fate. PMID:19580405

  2. Alternative Routes to Induce Naïve Pluripotency in Human Embryonic Stem Cells.

    PubMed

    Duggal, Galbha; Warrier, Sharat; Ghimire, Sabitri; Broekaert, Dorien; Van der Jeught, Margot; Lierman, Sylvie; Deroo, Tom; Peelman, Luc; Van Soom, Ann; Cornelissen, Ria; Menten, Björn; Mestdagh, Pieter; Vandesompele, Jo; Roost, Matthias; Slieker, Roderick C; Heijmans, Bastiaan T; Deforce, Dieter; De Sutter, Petra; De Sousa Lopes, Susana Chuva; Heindryckx, Björn

    2015-09-01

    Human embryonic stem cells (hESCs) closely resemble mouse epiblast stem cells exhibiting primed pluripotency unlike mouse ESCs (mESCs), which acquire a naïve pluripotent state. Efforts have been made to trigger naïve pluripotency in hESCs for subsequent unbiased lineage-specific differentiation, a common conundrum faced by primed pluripotent hESCs due to heterogeneity in gene expression existing within and between hESC lines. This required either ectopic expression of naïve genes such as NANOG and KLF2 or inclusion of multiple pluripotency-associated factors. We report here a novel combination of small molecules and growth factors in culture medium (2i/LIF/basic fibroblast growth factor + Ascorbic Acid + Forskolin) facilitating rapid induction of transgene-free naïve pluripotency in hESCs, as well as in mESCs, which has not been shown earlier. The converted naïve hESCs survived long-term single-cell passaging, maintained a normal karyotype, upregulated naïve pluripotency genes, and exhibited dependence on signaling pathways similar to naïve mESCs. Moreover, they undergo global DNA demethylation and show a distinctive long noncoding RNA profile. We propose that in our medium, the FGF signaling pathway via PI3K/AKT/mTORC induced the conversion of primed hESCs toward naïve pluripotency. Collectively, we demonstrate an alternate route to capture naïve pluripotency in hESCs that is fast, reproducible, supports naïve mESC derivation, and allows efficient differentiation.

  3. Systematic evaluation of markers used for the identification of human induced pluripotent stem cells

    PubMed Central

    Bharathan, Sumitha Prameela; Manian, Kannan Vrindavan; Aalam, Syed Mohammed Musheer; Palani, Dhavapriya; Deshpande, Prashant Ajit; Pratheesh, Mankuzhy Damodaran; Srivastava, Alok

    2017-01-01

    ABSTRACT Low efficiency of somatic cell reprogramming and heterogeneity among human induced pluripotent stem cells (hiPSCs) demand extensive characterization of isolated clones before their use in downstream applications. By monitoring human fibroblasts undergoing reprogramming for their morphological changes and expression of fibroblast (CD13), pluripotency markers (SSEA-4 and TRA-1-60) and a retrovirally expressed red fluorescent protein (RV-RFP), we compared the efficiency of these features to identify bona fide hiPSC colonies. The co-expression kinetics of fibroblast and pluripotency markers in the cells being reprogrammed and the emerging colonies revealed the heterogeneity within SSEA-4+ and TRA-1-60+ cells, and the inadequacy of these commonly used pluripotency markers for the identification of bona fide hiPSC colonies. The characteristic morphological changes in the emerging hiPSC colonies derived from fibroblasts expressing RV-RFP showed a good correlation between hiPSC morphology acquisition and silencing of RV-RFP and facilitated the easy identification of hiPSCs. The kinetics of retroviral silencing and pluripotency marker expression in emerging colonies suggested that combining both these markers could demarcate the stages of reprogramming with better precision than with pluripotency markers alone. Our results clearly demonstrate that the pluripotency markers that are routinely analyzed for the characterization of established iPSC colonies are not suitable for the isolation of pluripotent cells in the early stages of reprogramming, and silencing of retrovirally expressed reporter genes helps in the identification of colonies that have attained a pluripotent state and the morphology of human embryonic stem cells (hESCs). PMID:28089995

  4. The quantitative proteomes of human-induced pluripotent stem cells and embryonic stem cells.

    PubMed

    Munoz, Javier; Low, Teck Y; Kok, Yee J; Chin, Angela; Frese, Christian K; Ding, Vanessa; Choo, Andre; Heck, Albert J R

    2011-11-22

    Assessing relevant molecular differences between human-induced pluripotent stem cells (hiPSCs) and human embryonic stem cells (hESCs) is important, given that such differences may impact their potential therapeutic use. Controversy surrounds recent gene expression studies comparing hiPSCs and hESCs. Here, we present an in-depth quantitative mass spectrometry-based analysis of hESCs, two different hiPSCs and their precursor fibroblast cell lines. Our comparisons confirmed the high similarity of hESCs and hiPSCS at the proteome level as 97.8% of the proteins were found unchanged. Nevertheless, a small group of 58 proteins, mainly related to metabolism, antigen processing and cell adhesion, was found significantly differentially expressed between hiPSCs and hESCs. A comparison of the regulated proteins with previously published transcriptomic studies showed a low overlap, highlighting the emerging notion that differences between both pluripotent cell lines rather reflect experimental conditions than a recurrent molecular signature.

  5. An ex vivo gene therapy approach to treat muscular dystrophy using inducible pluripotent stem cells.

    PubMed

    Filareto, Antonio; Parker, Sarah; Darabi, Radbod; Borges, Luciene; Iacovino, Michelina; Schaaf, Tory; Mayerhofer, Timothy; Chamberlain, Jeffrey S; Ervasti, James M; McIvor, R Scott; Kyba, Michael; Perlingeiro, Rita C R

    2013-01-01

    Duchenne muscular dystrophy is a progressive and incurable neuromuscular disease caused by genetic and biochemical defects of the dystrophin-glycoprotein complex. Here we show the regenerative potential of myogenic progenitors derived from corrected dystrophic induced pluripotent stem cells generated from fibroblasts of mice lacking both dystrophin and utrophin. We correct the phenotype of dystrophic induced pluripotent stem cells using a Sleeping Beauty transposon system carrying the micro-utrophin gene, differentiate these cells into skeletal muscle progenitors and transplant them back into dystrophic mice. Engrafted muscles displayed large numbers of micro-utrophin-positive myofibers, with biochemically restored dystrophin-glycoprotein complex and improved contractile strength. The transplanted cells seed the satellite cell compartment, responded properly to injury and exhibit neuromuscular synapses. We also detect muscle engraftment after systemic delivery of these corrected progenitors. These results represent an important advance towards the future treatment of muscular dystrophies using genetically corrected autologous induced pluripotent stem cells.

  6. Generation of tumor-targeted human T lymphocytes from induced pluripotent stem cells for cancer therapy.

    PubMed

    Themeli, Maria; Kloss, Christopher C; Ciriello, Giovanni; Fedorov, Victor D; Perna, Fabiana; Gonen, Mithat; Sadelain, Michel

    2013-10-01

    Progress in adoptive T-cell therapy for cancer and infectious diseases is hampered by the lack of readily available, antigen-specific, human T lymphocytes. Pluripotent stem cells could provide an unlimited source of T lymphocytes, but the therapeutic potential of human pluripotent stem cell-derived lymphoid cells generated to date remains uncertain. Here we combine induced pluripotent stem cell (iPSC) and chimeric antigen receptor (CAR) technologies to generate human T cells targeted to CD19, an antigen expressed by malignant B cells, in tissue culture. These iPSC-derived, CAR-expressing T cells display a phenotype resembling that of innate γδ T cells. Similar to CAR-transduced, peripheral blood γδ T cells, the iPSC-derived T cells potently inhibit tumor growth in a xenograft model. This approach of generating therapeutic human T cells 'in the dish' may be useful for cancer immunotherapy and other medical applications.

  7. Generation of thyroid follicular cells from pluripotent stem cells: potential for regenerative medicine.

    PubMed

    Sewell, Will; Lin, Reigh-Yi

    2014-01-01

    Nearly 12% of the population in the United States will be afflicted with a thyroid related disorder during their lifetime. Common treatment approaches are tailored to the specific disorder and include surgery, radioactive iodine ablation, antithyroid drugs, thyroid hormone replacement, external beam radiation, and chemotherapy. Regenerative medicine endeavors to combat disease by replacing or regenerating damaged, diseased, or dysfunctional body parts. A series of achievements in pluripotent stem cell research have transformed regenerative medicine in many ways by demonstrating "repair" of a number of body parts in mice, of which, the thyroid has now been inducted into this special group. Seminal work in pluripotent cells, namely embryonic stem cells and induced pluripotent stem cells, have made possible their path to becoming key tools and biological building blocks for cell-based regenerative medicine to combat the gamut of human diseases, including those affecting the thyroid.

  8. Expression of pluripotent stem cell markers in mouse uterine tissue during estrous cycle

    PubMed Central

    Choobineh, Kolsum; Zavareh, Saeed; Salehnia, Mojdeh; Ghorbanian, Mohamad Taghi; paylakhi, Seyed Hassan

    2016-01-01

    It was assumed that uterine stem cells are responsible for the unique regenerative capacity of uterine. Therefore, the aim of the present study was to investigate the expression of the pluripotent stem cell markers in the mice uterine tissue during different stages of estrous cycles. Twelve virgin female NMRI mice (6 to 8 weeks old) were considered at proestrus, estrus, metestrus and diestrus according to the cell types observed in the vaginal smear and underwent hysterectomy operation. Quantitative real-time polymerase chain reaction (PCR) and immunohistochemical staining for pluripotent stem cell markers (SOX2, OCT4, KLF4, and NANOG) were performed. Immunofluorescence staining revealed that expression and localization of the pluripotency markers SOX2, OCT4, KLF4, and NANOG at the protein level were not different throughout estrous cycle. Also, mRNA of pluripotency markers was detected in all tested samples. However, there were no significant differences in their genes expression at each stage and during the estrous cycle. Different hormonal profile during the estrous cycle could not affect expression of pluripotent stem cell markers in uterine tissue. PMID:27872713

  9. Potent tumor tropism of induced pluripotent stem cells and induced pluripotent stem cell-derived neural stem cells in the mouse intracerebral glioma model.

    PubMed

    Yamazoe, Tomohiro; Koizumi, Shinichiro; Yamasaki, Tomohiro; Amano, Shinji; Tokuyama, Tsutomu; Namba, Hiroki

    2015-01-01

    Although neural and mesenchymal stem cells have been well-known to have a strong glioma tropism, this activity in induced pluripotent stem cells (iPSCs) has not yet been fully studied. In the present study, we tested tumor tropic activity of mouse iPSCs and neural stem cells derived from the iPSC (iPS-NSCs) using in vitro Matrigel invasion chamber assay and in vivo mouse intracranial tumor model. Both iPSC and iPS-NSC had a similar potent in vitro tropism for glioma conditioned media. The migrated iPSCs to the gliomas kept expressing Nanog-GFP gene, suggesting no neuronal or glial differentiation. iPSCs or iPS-NSCs labeled with 5-bromo-2-deoxyuridine were intracranially implanted in the contralateral hemisphere to the GL261 glioma cell implantation in the allogeneic C57BL/6 mouse. Active migration of both stem cells was observed 7 days after implantation. Again, the iPSCs located in the tumor area expressed Nanog-GFP gene, suggesting that the migrated cells were still iPSCs. These findings demonstrated that both iPSCs and iPS-NSCs had potent glioma tropism and could be candidates as vehicles in stem cell-based glioma therapy.

  10. Global gene expression analysis of very small embryonic-like stem cells reveals that the Ezh2-dependent bivalent domain mechanism contributes to their pluripotent state.

    PubMed

    Shin, Dong-Myung; Liu, Rui; Wu, Wan; Waigel, Sabine J; Zacharias, Wolfgang; Ratajczak, Mariusz Z; Kucia, Magda

    2012-07-01

    Recently, we identified a population of Oct4(+)Sca-1(+)Lin(-)CD45(-) very small embryonic-like stem cells (VSELs) in murine and human adult tissues. VSELs can differentiate in vitro into cells from all 3 germ layers and in vivo tissue-committed stem cells. Open chromatin structure of core pluripotency transcription factors (TFs) supports the pluripotent state of VSELs. However, it has been difficult to determine how primitive VSELs maintain pluripotency, owing to their limited number in adult tissues. Here, we demonstrate by genome-wide gene-expression analysis with a small number of highly purified murine bone marrow-derived VSELs that Oct4(+) VSELs (i) express a similar, yet nonidentical, transcriptome as embryonic stem cells (ESCs), (ii) highly express cell cycle checkpoint genes, (iii) express at a low level genes involved in protein turnover and mitogenic pathways, and (iv) highly express enhancer of zeste drosophila homolog 2 (Ezh2), a polycomb group protein. Furthermore, as a result of high expression of Ezh2, VSELs, like ESCs, exhibit bivalently modified nucleosomes (trimethylated H3K27 and H3K4) at promoters of important homeodomain-containing developmental TFs, thus preventing premature activation of the lineage-committing factors. Notably, spontaneous or RNA interference-enforced downregulation of Ezh2 during VSEL differentiation removes the bivalent domain (BD) structure, which leads to de-repression of several BD-regulated genes. Therefore, we suggest that Oct4(+) VSELs, like other pluripotent stem cells, maintain their pluripotent state through an Ezh2-dependent BD-mediated epigenetic mechanism. Furthermore, our global survey of VSEL gene expression signature would not only advance our understanding of biological process for their pluripotency, differentiation, and quiescence but should also help to develop better protocols for ex vivo expansion of VSELs.

  11. Neural stem cells differentiated from iPS cells spontaneously regain pluripotency.

    PubMed

    Choi, Hyun Woo; Kim, Jong Soo; Choi, Sol; Hong, Yean Ju; Kim, Min Jung; Seo, Han Geuk; Do, Jeong Tae

    2014-10-01

    Differentiated somatic cells can be reprogrammed into pluripotent stem cells by transduction of exogenous reprogramming factors. After induced pluripotent stem (iPS) cells are established, exogenous genes are silenced. In the pluripotent state, retroviral genes integrated in the host genome are kept inactive through epigenetic transcriptional regulation. In this study, we tried to determine whether exogenous genes remain silenced or are reactivated upon loss of pluripotency or on differentiation using an in vitro system. We induced differentiation of iPS cells into neural stem cells (NSCs) in vitro; the NSCs appeared morphologically indistinguishable from brain-derived NSCs and stained positive for the NSC markers Nestin and Sox2. These iPS cell-derived NSCs (iPS-NSCs) were also capable of differentiating into all three neural subtypes. Interestingly, iPS-NSCs spontaneously formed aggregates on long-term culture and showed reactivation of the Oct4-GFP marker, which was followed by the formation of embryonic stem cell-like colonies. The spontaneously reverted green fluorescent protein (GFP)-positive (iPS-NSC-GFP(+) ) cells expressed high levels of pluripotency markers (Oct4 and Nanog) and formed germline chimeras, indicating that iPS-NSC-GFP(+) cells had the same pluripotency as the original iPS cells. The reactivation of silenced exogenous genes was tightly correlated with the downregulation of DNA methyltransferases (Dnmts) during differentiation of iPS cells. This phenomenon was not observed in doxycycline-inducible iPS cells, where the reactivation of exogenous genes could be induced only by doxycycline treatment. These results indicate that pluripotency can be regained through reactivation of exogenous genes, which is associated with dynamic change of Dnmt levels during differentiation of iPS cells.

  12. Teratomas produced from human pluripotent stem cells xenografted into immunodeficient mice - a histopathology atlas

    PubMed Central

    Damjanov, Ivan; Andrews, Peter W.

    2017-01-01

    This atlas illustrates the microscopic features of tumors produced from human pluripotent stem cells (hPSCs) xenografted into immunosuppressed mice, according to the generally accepted protocols for performing this teratoma assay of stem cell pluripotency. Microphotographs depict various hematoxylin and eosin (H&E) stained tissues derived from all three embryonic germ layers (ectoderm, mesoderm and endoderm). The appearance of persistent hPSC in teratomas is also described with special emphasis on the morphogenesis of embryoid bodies and yolk sac components surrounding them. The use of immunohistochemistry for analyzing hPSC-derived teratomas is also illustrated. PMID:28000905

  13. Mucin-Inspired Thermoresponsive Synthetic Hydrogels Induce Stasis in Human Pluripotent Stem Cells and Human Embryos

    PubMed Central

    2016-01-01

    Human pluripotent stem cells (hPSCs; both embryonic and induced pluripotent) rapidly proliferate in adherent culture to maintain their undifferentiated state. However, for mammals exhibiting delayed gestation (diapause), mucin-coated embryos can remain dormant for days or months in utero, with their constituent PSCs remaining pluripotent under these conditions. Here we report cellular stasis for both hPSC colonies and preimplantation embryos immersed in a wholly synthetic thermoresponsive gel comprising poly(glycerol monomethacrylate)-poly(2-hydroxypropyl methacrylate) [PGMA55-PHPMA135] diblock copolymer worms. This hydroxyl-rich mucin-mimicking nonadherent 3D gel maintained PSC viability and pluripotency in the quiescent G0 state without passaging for at least 14 days. Similarly, gel-coated human embryos remain in a state of suspended animation (diapause) for up to 8 days. The discovery of a cryptic cell arrest mechanism for both hPSCs and embryos suggests an important connection between the cellular mechanisms that evoke embryonic diapause and pluripotency. Moreover, such synthetic worm gels offer considerable utility for the short-term (weeks) storage of either pluripotent stem cells or human embryos without cryopreservation. PMID:27163030

  14. Mucin-Inspired Thermoresponsive Synthetic Hydrogels Induce Stasis in Human Pluripotent Stem Cells and Human Embryos.

    PubMed

    Canton, Irene; Warren, Nicholas J; Chahal, Aman; Amps, Katherine; Wood, Andrew; Weightman, Richard; Wang, Eugenia; Moore, Harry; Armes, Steven P

    2016-02-24

    Human pluripotent stem cells (hPSCs; both embryonic and induced pluripotent) rapidly proliferate in adherent culture to maintain their undifferentiated state. However, for mammals exhibiting delayed gestation (diapause), mucin-coated embryos can remain dormant for days or months in utero, with their constituent PSCs remaining pluripotent under these conditions. Here we report cellular stasis for both hPSC colonies and preimplantation embryos immersed in a wholly synthetic thermoresponsive gel comprising poly(glycerol monomethacrylate)-poly(2-hydroxypropyl methacrylate) [PGMA55-PHPMA135] diblock copolymer worms. This hydroxyl-rich mucin-mimicking nonadherent 3D gel maintained PSC viability and pluripotency in the quiescent G0 state without passaging for at least 14 days. Similarly, gel-coated human embryos remain in a state of suspended animation (diapause) for up to 8 days. The discovery of a cryptic cell arrest mechanism for both hPSCs and embryos suggests an important connection between the cellular mechanisms that evoke embryonic diapause and pluripotency. Moreover, such synthetic worm gels offer considerable utility for the short-term (weeks) storage of either pluripotent stem cells or human embryos without cryopreservation.

  15. Establishment of Hepatocellular Cancer Induced Pluripotent Stem Cells Using a Reprogramming Technique

    PubMed Central

    Kim, Han Joon; Jeong, Jaemin; Park, Sunhoo; Jin, Young-Woo; Lee, Seung-Sook; Lee, Seung Bum; Choi, Dongho

    2017-01-01

    Background/Aims Cancer is known to be a disease by many factors. However, specific results of reprogramming by pluripotency-related transcription factors remain to be scarcely reported. Here, we verified potential effects of pluripotent-related genes in hepatocellular carcinoma cancer cells. Methods To better understand reprogramming of cancer cells in different genetic backgrounds, we used four liver cancer cell lines representing different states of p53 (HepG2, Hep3B, Huh7 and PLC). Retroviral-mediated introduction of reprogramming related genes (KLF4, Oct4, Sox2, and Myc) was used to induce the expression of proteins related to a pluripotent status in liver cancer cells. Results Hep3B cells (null p53) exhibited a higher efficiency of reprogramming in comparison to the other liver cancer cell lines. The reprogrammed Hep3B cells acquired similar characteristics to pluripotent stem cells. However, loss of stemness in Hep3B-iPCs was detected during continual passage. Conclusions We demonstrated that reprogramming was achieved in tumor cells through retroviral induction of genes associated with reprogramming. Interestingly, the reprogrammed pluripotent cancer cells (iPCs) were very different from original cancer cells in terms of colony shape and expressed markers. The induction of pluripotency of liver cancer cells correlated with the status of p53, suggesting that different expression level of p53 in cancer cells may affect their reprogramming. PMID:27728962

  16. Multiple Roles of MYC in Integrating Regulatory Networks of Pluripotent Stem Cells

    PubMed Central

    Fagnocchi, Luca; Zippo, Alessio

    2017-01-01

    Pluripotent stem cells (PSCs) are defined by their self-renewal potential, which permits their unlimited propagation, and their pluripotency, being able to generate cell of the three embryonic lineages. These properties render PSCs a valuable tool for both basic and medical research. To induce and stabilize the pluripotent state, complex circuitries involving signaling pathways, transcription regulators and epigenetic mechanisms converge on a core transcriptional regulatory network of PSCs, thus determining their cell identity. Among the transcription factors, MYC represents a central hub, which modulates and integrates multiple mechanisms involved both in the maintenance of pluripotency and in cell reprogramming. Indeed, it instructs the PSC-specific cell cycle, metabolism and epigenetic landscape, contributes to limit exit from pluripotency and modulates signaling cascades affecting the PSC identity. Moreover, MYC extends its regulation on pluripotency by controlling PSC-specific non-coding RNAs. In this report, we review the MYC-controlled networks, which support the pluripotent state and discuss how their perturbation could affect cell identity. We further discuss recent finding demonstrating a central role of MYC in triggering epigenetic memory in PSCs, which depends on the establishment of a WNT-centered self-reinforcing circuit. Finally, we comment on the therapeutic implications of the role of MYC in affecting PSCs. Indeed, PSCs are used for both disease and cancer modeling and to derive cells for regenerative medicine. For these reasons, unraveling the MYC-mediated mechanism in those cells is fundamental to exploit their full potential and to identify therapeutic targets. PMID:28217689

  17. Intricacies of Pluripotency

    PubMed Central

    Bhartiya, Deepa

    2015-01-01

    Pluripotent stem cells have the potential to differentiate into 200 odd cell types present in adult body. Pluripotent stem cells available for regenerative medicine include embryonic stem (ES) cells, induced pluripotent stem (iPS) cells and very small ES-like stem (VSELs) cells. Nuclear OCT-4 is one of the crucial factors that dictate pluripotent state. Compared to ES/iPS cells grown in Petri dish, VSELs exist in adult body organs and results are emerging to suggest that they may have better potential to regenerate adult organs. This is because of their distinct epigenetic status as they are closer to the primordial germ cells from the epiblast-stage embryo compared to inner cell mass from which ES cells are obtained in vitro. We need to make special efforts to study them as they are very small in size and tend to get lost during processing. VSELs exist in adult organs, get mobilized in response to stress, undergo asymmetric cell divisions to give rise to tissue specific progenitors which further differentiate into various cell types and are possibly better candidates for regenerative medicine because they have no associated risk of tumor formation or immunological rejection. They are possibly also the ‘embryonic remnants’ in adult organs responsible for initiating cancer. Thus, rather than not accepting VSELs because they neither form teratoma nor divide in vitro like ES cells, it is time that scientific community should think of revising the definition of the term ‘pluripotency’. PMID:26195889

  18. Suspension culture of pluripotent stem cells: effect of shear on stem cell fate.

    PubMed

    Keller, Kevin C; Rodrigues, Beatriz; zur Nieden, Nicole I

    2014-01-01

    Despite significant promise, the routine usage of suspension cell culture to manufacture stem cell-derived differentiated cells has progressed slowly. Suspension culture is an innovative way of either expanding or differentiating cells and sometimes both are combined into a single bioprocess. Its advantages over static 2D culturing include a homogeneous and controllable culture environment and producing a large quantity of cells in a fraction of time. This feature makes suspension cell culture ideal for use in stem cell research and eventually ideal in the large-scale production of differentiated cells for regenerative medicine. Because of their tremendous differentiation capacities and unlimited growth properties, pluripotent stem cells (PSCs) in particular are considered potential sources for future cell-replacement therapies. Currently, expansion of PSCs is accomplished in 2D, which only permits a limited amount of cell growth per culture flask before cells need to be passaged. However, before stem cells can be applied clinically, several aspects of their expansion, such as directed growth, but also differentiation, need to be better controlled. This review will summarize recent advantages in suspension culture of PSCs, while at the same time highlighting current challenges.

  19. Pluripotent stem cells derived from mouse primordial germ cells by small molecule compounds.

    PubMed

    Kimura, Tohru; Kaga, Yoshiaki; Sekita, Yoichi; Fujikawa, Keita; Nakatani, Tsunetoshi; Odamoto, Mika; Funaki, Soichiro; Ikawa, Masahito; Abe, Kuniya; Nakano, Toru

    2015-01-01

    Primordial germ cells (PGCs) can give rise to pluripotent stem cells known as embryonic germ cells (EGCs) when cultured with basic fibroblast growth factor (bFGF), stem cell factor (SCF), and leukemia inhibitory factor. Somatic cells can give rise to induced pluripotent stem cells (iPSCs) by introduction of the reprogramming transcription factors Oct4, Sox2, and Klf4. The effects of Sox2 and Klf4 on somatic cell reprogramming can be reproduced using the small molecule compounds, transforming growth factor-β receptor (TGFβR) inhibitor and Kempaullone, respectively. Here we examined the effects of TGFβR inhibitor and Kempaullone on EGC derivation from PGCs. Treatment of PGCs with TGFβR inhibitor and/or Kempaullone generated pluripotent stem cells under standard embryonic stem cell (ESC) culture conditions without bFGF and SCF, which we termed induced EGCs (iEGCs). The derivation efficiency of iEGCs was dependent on the differentiation stage and sex. DNA methylation levels of imprinted genes in iEGCs were reduced, with the exception of the H19 gene. The promoters of genes involved in germline development were generally hypomethylated in PGCs, but three germline genes showed comparable DNA methylation levels among iEGs, ESCs, and iPSCs. These results show that PGCs can be reprogrammed into pluripotent state using small molecule compounds, and that DNA methylation of these germline genes is not maintained in iEGCs.

  20. The moral value of induced pluripotent stem cells: a Japanese bioethics perspective on human embryo research.

    PubMed

    Sawai, Tsutomu

    2014-11-01

    In contemporary Japan, at least in the field of regenerative medicine, human induced pluripotent stem cells (hiPSCs) are given no moral status and are treated in a purely instrumental way. However, some authors have mentioned the potentiality of hiPSCs in that 'tetraploid complementation' would make it possible to create humans directly from human embryonic stem cells (hESCs) and hiPSCs. A blastocyst consists of inner cell mass (ICM) cells and a trophoblast. The tetraploid complementation technique demonstrates that hESCs and hiPSCs both have the same capacity as ICM cells. If ICM cells, hESCs and hiPSCs were all provided with a trophoblast or a substitute with the same function, which would work as a placenta, they would have the same potential to develop into embryos, fetuses and adult human beings. Thus hiPSCs could be regarded as potential humans. However, no authority or guideline in Japan has specifically considered the status and use of hiPSCs. In this paper, I will address the extent to which the existing recommendations apply to hiPSCs and develop a novel Japanese bioethical perspective on the status of hiPSCs and its implications for hiPSC research, based on the reasoning in the report, 'The fundamental way of thinking in treating the human embryo' presented by the Bioethics Committee of the Council for Science and Technology Policy in 2004, and broader consideration of Japanese culture.

  1. Human Developmental Chondrogenesis as a Basis for Engineering Chondrocytes from Pluripotent Stem Cells

    PubMed Central

    Wu, Ling; Bluguermann, Carolina; Kyupelyan, Levon; Latour, Brooke; Gonzalez, Stephanie; Shah, Saumya; Galic, Zoran; Ge, Sundi; Zhu, Yuhua; Petrigliano, Frank A.; Nsair, Ali; Miriuka, Santiago G.; Li, Xinmin; Lyons, Karen M.; Crooks, Gay M.; McAllister, David R.; Van Handel, Ben; Adams, John S.; Evseenko, Denis

    2013-01-01

    Summary Joint injury and osteoarthritis affect millions of people worldwide, but attempts to generate articular cartilage using adult stem/progenitor cells have been unsuccessful. We hypothesized that recapitulation of the human developmental chondrogenic program using pluripotent stem cells (PSCs) may represent a superior approach for cartilage restoration. Using laser-capture microdissection followed by microarray analysis, we first defined a surface phenotype (CD166low/negCD146low/negCD73+CD44lowBMPR1B+) distinguishing the earliest cartilage committed cells (prechondrocytes) at 5–6 weeks of development. Functional studies confirmed these cells are chondrocyte progenitors. From 12 weeks, only the superficial layers of articular cartilage were enriched in cells with this progenitor phenotype. Isolation of cells with a similar immunophenotype from differentiating human PSCs revealed a population of CD166low/negBMPR1B+ putative cartilage-committed progenitors. Taken as a whole, these data define a developmental approach for the generation of highly purified functional human chondrocytes from PSCs that could enable substantial progress in cartilage tissue engineering. PMID:24371811

  2. Human developmental chondrogenesis as a basis for engineering chondrocytes from pluripotent stem cells.

    PubMed

    Wu, Ling; Bluguermann, Carolina; Kyupelyan, Levon; Latour, Brooke; Gonzalez, Stephanie; Shah, Saumya; Galic, Zoran; Ge, Sundi; Zhu, Yuhua; Petrigliano, Frank A; Nsair, Ali; Miriuka, Santiago G; Li, Xinmin; Lyons, Karen M; Crooks, Gay M; McAllister, David R; Van Handel, Ben; Adams, John S; Evseenko, Denis

    2013-01-01

    Joint injury and osteoarthritis affect millions of people worldwide, but attempts to generate articular cartilage using adult stem/progenitor cells have been unsuccessful. We hypothesized that recapitulation of the human developmental chondrogenic program using pluripotent stem cells (PSCs) may represent a superior approach for cartilage restoration. Using laser-capture microdissection followed by microarray analysis, we first defined a surface phenotype (CD166(low/neg)CD146(low/neg)CD73(+)CD44(low)BMPR1B(+)) distinguishing the earliest cartilage committed cells (prechondrocytes) at 5-6 weeks of development. Functional studies confirmed these cells are chondrocyte progenitors. From 12 weeks, only the superficial layers of articular cartilage were enriched in cells with this progenitor phenotype. Isolation of cells with a similar immunophenotype from differentiating human PSCs revealed a population of CD166(low/neg)BMPR1B(+) putative cartilage-committed progenitors. Taken as a whole, these data define a developmental approach for the generation of highly purified functional human chondrocytes from PSCs that could enable substantial progress in cartilage tissue engineering.

  3. Induced pluripotent stem cells: Mechanisms, achievements and perspectives in farm animals

    PubMed Central

    Kumar, Dharmendra; Talluri, Thirumala R; Anand, Taruna; Kues, Wilfried A

    2015-01-01

    Pluripotent stem cells are unspecialized cells with unlimited self-renewal, and they can be triggered to differentiate into desired specialized cell types. These features provide the basis for an unlimited cell source for innovative cell therapies. Pluripotent cells also allow to study developmental pathways, and to employ them or their differentiated cell derivatives in pharmaceutical testing and biotechnological applications. Via blastocyst complementation, pluripotent cells are a favoured tool for the generation of genetically modified mice. The recently established technology to generate an induced pluripotency status by ectopic co-expression of the transcription factors Oct4, Sox2, Klf4 and c-Myc allows to extending these applications to farm animal species, for which the derivation of genuine embryonic stem cells was not successful so far. Most induced pluripotent stem (iPS) cells are generated by retroviral or lentiviral transduction of reprogramming factors. Multiple viral integrations into the genome may cause insertional mutagenesis and may increase the risk of tumour formation. Non-integration methods have been reported to overcome the safety concerns associated with retro and lentiviral-derived iPS cells, such as transient expression of the reprogramming factors using episomal plasmids, and direct delivery of reprogramming mRNAs or proteins. In this review, we focus on the mechanisms of cellular reprogramming and current methods used to induce pluripotency. We also highlight problems associated with the generation of iPS cells. An increased understanding of the fundamental mechanisms underlying pluripotency and refining the methodology of iPS cell generation will have a profound impact on future development and application in regenerative medicine and reproductive biotechnology of farm animals. PMID:25815117

  4. Stem cells and clinical practice: new advances and challenges at the time of emerging problems with induced pluripotent stem cell therapies.

    PubMed

    Ratajczak, Mariusz Z; Bujko, Kamila; Wojakowski, Wojciech

    2016-11-10

    Humans, like other species that reproduce sexually, originate from a fertilized oocyte (zygote), which is a totipotent stem cell giving rise to an adult organism. During the process of embryogenesis, stem cells at different levels of the developmental hierarchy establish all 3 germ layers and give rise to tissue‑committed stem cells, which are responsible for rejuvenation of a given tissue or organ. The robustness of the stem cell compartment is one of the major factors that directly impact life quality as well as lifespan. Stem cells continuously replace cells and tissues that are used up during life; however, this replacement occurs at a different pace in various organs. The rapidly developing field of regenerative medicine is taking advantage of these physiological properties of stem cells and is attempting to employ them in clinical settings to regenerate damaged organs (eg, the heart, liver or bone). For this purpose, the stem cells most successfully employed so far are adult tissue-derived stem cells isolated mainly from bone marrow, mobilized peripheral blood, umbilical cord blood, fat tissue, and even myocardial biopsies. At the same time, attempts to employ embryonic stem cells and induced pluripotent stem cells in the clinic have failed due to their genomic instability and the risk of tumor formation. In this review, we will discuss the various potential sources of stem cells that are currently employed in regenerative medicine and the mechanisms that explain their beneficial effects. We will also highlight the preliminary results of clinical trials as well as the emerging problems relating to stem cell therapies in cardiology.

  5. Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes Afford New Opportunities in Inherited Cardiovascular Disease Modeling

    PubMed Central

    Bayzigitov, Daniel R.; Medvedev, Sergey P.; Dementyeva, Elena V.; Bayramova, Sevda A.; Pokushalov, Evgeny A.; Karaskov, Alexander M.; Zakian, Suren M.

    2016-01-01

    Fundamental studies of molecular and cellular mechanisms of cardiovascular disease pathogenesis are required to create more effective and safer methods of their therapy. The studies can be carried out only when model systems that fully recapitulate pathological phenotype seen in patients are used. Application of laboratory animals for cardiovascular disease modeling is limited because of physiological differences with humans. Since discovery of induced pluripotency generating induced pluripotent stem cells has become a breakthrough technology in human disease modeling. In this review, we discuss a progress that has been made in modeling inherited arrhythmias and cardiomyopathies, studying molecular mechanisms of the diseases, and searching for and testing drug compounds using patient-specific induced pluripotent stem cell-derived cardiomyocytes. PMID:27110425

  6. Derivation of Patient Specific Pluripotent Stem Cells Using Clinically Discarded Cumulus Cells

    PubMed Central

    Xu, Jie; Lin, Chen-Ju; Wang, Sheng-Wen; Cheng, An-Sheng; Lu, Jean; Lu, Chung-Hao; Sung, Li-Ying

    2016-01-01

    Induced pluripotent stem cells (iPSCs) are powerful tools for basic and translational research, as well as regenerative medicine. In routine human in vitro fertilization (IVF) practices, cumulus cells (CCs) are discarded, representing a potential source of biological materials for regenerative medicine. In this study, we derived patient-specific iPSCs using CCs from human infertility clinics for the first time. The human cumulus cell derived iPSCs (hc-iPSCs) were characterized for growth, karyotype, expression of pluripotency genes, and were subjected to embryoid bodies (EBs) and teratoma assays to evaluate their differentiation capacity. Hc-iPSCs display typical iPSC characteristics, and are capable of differentiating into all germ layers in vitro and in vivo. We further show that putative primordial germ cell like cells (PGCLCs) can be derived using hc-iPSCs. Our data demonstrate the feasibility of deriving patient-specific pluripotent stem cells using CCs. PMID:27802323

  7. An improved ScoreCard to assess the differentiation potential of human pluripotent stem cells

    PubMed Central

    Tsankov, Alexander M.; Akopian, Veronika; Pop, Ramona; Chetty, Sundari; Gifford, Casey A.; Daheron, Laurence; Melton, Douglas A.; Tsankova, Nadejda M.; Meissner, Alexander

    2015-01-01

    Research on human pluripotent stem cells has been hampered by the lack of a standardized, quantitative, scalable assay of pluripotency. We have previously described an assay called ScoreCard that used gene expression signatures to quantify differentiation efficiency. Here we report an improved version of the assay based on qPCR that enables faster, more quantitative assessment of functional pluripotency. We provide an in-depth characterization of the revised signature panel through embryoid body and directed differentiation experiments as well as a detailed comparison to the teratoma assay. We also show that the improved ScoreCard enables applications such as screening of small molecules, genetic perturbations and assessment of culture conditions. Beyond stem cell applications, this approach can in principle be extended to other cell types and lineages. PMID:26501952

  8. Directed differentiation of human pluripotent cells to neural crest stem cells.

    PubMed

    Menendez, Laura; Kulik, Michael J; Page, Austin T; Park, Sarah S; Lauderdale, James D; Cunningham, Michael L; Dalton, Stephen

    2013-01-01

    Multipotent neural crest stem cells (NCSCs) have the potential to generate a wide range of cell types including melanocytes; peripheral neurons; and smooth muscle, bone, cartilage and fat cells. This protocol describes in detail how to perform a highly efficient, lineage-specific differentiation of human pluripotent cells to a NCSC fate. The approach uses chemically defined media under feeder-free conditions, and it uses two small-molecule compounds to achieve efficient conversion of human pluripotent cells to NCSCs in ~15 d. After completion of this protocol, NCSCs can be used for numerous applications, including the generation of sufficient cell numbers to perform drug screens, for the development of cell therapeutics on an industrial scale and to provide a robust model for human disease. This protocol can be also be applied to patient-derived induced pluripotent stem cells and thus used to further the knowledge of human disease associated with neural crest development, for example, Treacher-Collins Syndrome.

  9. Genome editing of human pluripotent stem cells to generate human cellular disease models.

    PubMed

    Musunuru, Kiran

    2013-07-01

    Disease modeling with human pluripotent stem cells has come into the public spotlight with the awarding of the Nobel Prize in Physiology or Medicine for 2012 to Drs John Gurdon and Shinya Yamanaka for the discovery that mature cells can be reprogrammed to become pluripotent. This discovery has opened the door for the generation of pluripotent stem cells from individuals with disease and the differentiation of these cells into somatic cell types for the study of disease pathophysiology. The emergence of genome-editing technology over the past few years has made it feasible to generate and investigate human cellular disease models with even greater speed and efficiency. Here, recent technological advances in genome editing, and its utility in human biology and disease studies, are reviewed.

  10. Generation of induced pluripotent stem cells from buffalo (Bubalus bubalis) fetal fibroblasts with buffalo defined factors.

    PubMed

    Deng, Yanfei; Liu, Qingyou; Luo, Chan; Chen, Shibei; Li, Xiangping; Wang, Caizhu; Liu, Zhenzhen; Lei, Xiaocan; Zhang, Huina; Sun, Hongliang; Lu, Fenghua; Jiang, Jianrong; Shi, Deshun

    2012-09-01

    Ectopically, expression of defined factors could reprogram mammalian somatic cells into induced pluripotent stem cells (iPSCs), which initiates a new strategy to obtain pluripotent stem cell lines. Attempts have been made to generate buffalo pluripotent stem cells by culturing primary germ cells or inner cell mass, but the efficiency is extremely low. Here, we report a successful method to reprogram buffalo fetal fibroblasts (BFFs) into pluripotent stem cells [buffalo induced pluripotent stem cell (biPSCs)] by transduction of buffalo defined factors (Oct4, Sox2, Klf4, and c-Myc) using retroviral vectors. The established biPSCs displayed typical morphological characteristics of pluripotent stem cells, normal karyotype, positive staining of alkaline phosphatase, and expressed pluripotent markers including Oct4, Sox2, Nanog, Lin28, E-Cadherin, SSEA-1, SSEA-4, TRA-1-81, STAT3, and FOXD3. They could form embryoid bodies (EBs) in vitro and teratomas after injecting into the nude BALB/C mice, and 3 germ layers were identified in the EBs and teratomas. Methylation assay revealed that the promoters of Oct4 and Nanog were hypomethylated in biPSCs compared with BFFs and pre-biPSCs, while the promoters of Sox2 and E-Cadherin were hypomethylated in both BFFs and biPSCs. Further, inhibiting p53 expression by coexpression of SV40 large T antigen and buffalo defined factors in BFFs or treating BFFs with p53 inhibitor pifithrin-a (PFT) could increase the efficiency of biPSCs generation up to 3-fold, and nuclear transfer embryos reconstructed with biPSCs could develop to blastocysts. These results indicate that BFFs can be reprogrammed into biPSCs by buffalo defined factors, and the generation efficiency of biPSCs can be increased by inhibition of p53 expression. These efforts will provide a feasible approach for investigating buffalo stem cell signal pathways, establishing buffalo stem cell lines, and producing genetic modification buffaloes in the future.

  11. Therapeutic Potential of Lung Epithelial Progenitor Cells Derived from Embryonic and Induced Pluripotent Stem Cells

    PubMed Central

    Wetsel, Rick A.; Wang, Dachun; Calame, Daniel G.

    2015-01-01

    Embryonic stem (ES) cells derived from preimplantation blastocysts and induced pluripotent stem (iPS) cells generated from somatic cell sources are pluripotent and capable of indefinite expansion in vitro. They provide a possible unlimited source of cells that could be differentiated into lung progenitor cells for potential clinical use in pulmonary regenerative medicine. Because of inherent difficulties in deriving endodermal cells from undifferentiated cell cultures, applications using lung epithelial cells derived from ES and iPS cells have lagged behind similar efforts devoted to other tissues, such as the heart and spinal cord. However, during the past several years, significant advances in culture, differentiation, and purification protocols, as well as in bioengineering methodologies, have fueled enthusiasm for the development of stem cell–based lung therapeutics. This article provides an overview of recent research achievements and discusses future technical challenges that must be met before the promise of stem cell applications for lung disease can be realized. PMID:21226612

  12. Transcriptome of human foetal heart compared with cardiomyocytes from pluripotent stem cells.

    PubMed

    van den Berg, Cathelijne W; Okawa, Satoshi; Chuva de Sousa Lopes, Susana M; van Iperen, Liesbeth; Passier, Robert; Braam, Stefan R; Tertoolen, Leon G; del Sol, Antonio; Davis, Richard P; Mummery, Christine L

    2015-09-15

    Differentiated derivatives of human pluripotent stem cells (hPSCs) are often considered immature because they resemble foetal cells more than adult, with hPSC-derived cardiomyocytes (hPSC-CMs) being no exception. Many functional features of these cardiomyocytes, such as their cell morphology, electrophysiological characteristics, sarcomere organization and contraction force, are underdeveloped compared with adult cardiomyocytes. However, relatively little is known about how their gene expression profiles compare with the human foetal heart, in part because of the paucity of data on the human foetal heart at different stages of development. Here, we collected samples of matched ventricles and atria from human foetuses during the first and second trimester of development. This presented a rare opportunity to perform gene expression analysis on the individual chambers of the heart at various stages of development, allowing us to identify not only genes involved in the formation of the heart, but also specific genes upregulated in each of the four chambers and at different stages of development. The data showed that hPSC-CMs had a gene expression profile similar to first trimester foetal heart, but after culture in conditions shown previously to induce maturation, they cluster closer to the second trimester foetal heart samples. In summary, we demonstrate how the gene expression profiles of human foetal heart samples can be used for benchmarking hPSC-CMs and also contribute to determining their equivalent stage of development.

  13. Excitation–contraction coupling of human induced pluripotent stem cell-derived cardiomyocytes

    PubMed Central

    Kane, Christopher; Couch, Liam; Terracciano, Cesare M. N.

    2015-01-01

    Induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) hold enormous potential in many fields of cardiovascular research. Overcoming many of the limitations of their embryonic counterparts, the application of iPSC-CMs ranges from facilitating investigation of familial cardiac disease and pharmacological toxicity screening to personalized medicine and autologous cardiac cell therapies. The main factor preventing the full realization of this potential is the limited maturity of iPSC-CMs, which display a number of substantial differences in comparison to adult cardiomyocytes. Excitation–contraction (EC) coupling, a fundamental property of cardiomyocytes, is often described in iPSC-CMs as being more analogous to neonatal than adult cardiomyocytes. With Ca2+ handling linked, directly or indirectly, to almost all other properties of cardiomyocytes, a solid understanding of this process will be crucial to fully realizing the potential of this technology. Here, we discuss the implications of differences in EC coupling when considering the potential applications of human iPSC-CMs in a number of areas as well as detailing the current understanding of this fundamental process in these cells. PMID:26484342

  14. Expand and Regularize Federal Funding for Human Pluripotent Stem Cell Research

    ERIC Educational Resources Information Center

    Owen-Smith, Jason; Scott, Christopher Thomas; McCormick, Jennifer B.

    2012-01-01

    Human embryonic stem cell (hESC) research has sparked incredible scientific and public excitement, as well as significant controversy. hESCs are pluripotent, which means, in theory, that they can be differentiated into any type of cell found in the human body. Thus, they evoke great enthusiasm about potential clinical applications. They are…

  15. Pluripotent stem cell derivation and differentiation toward cardiac muscle: novel techniques and advances in patent literature.

    PubMed

    Quattrocelli, Mattia; Thorrez, Lieven; Sampaolesi, Maurilio

    2013-04-01

    Pluripotent stem cells hold unprecedented potential for regenerative medicine, disease modeling and drug screening. Embryonic stem cells (ESCs), standard model for pluripotency studies, have been recently flanked by induced pluripotent stem cells (iPSCs). iPSCs are obtained from somatic cells via epigenetic and transcriptional reprogramming, overcoming ESC-related ethical issues and enabling the possibility of donor-matching pluripotent cell lines. Since the European Court of Justice banned patents involving embryo disaggregation to generate human ESCs, iPSCs can now fuel the willingness of European companies to invest in treatments based on stem cells. Moreover, iPSCs share many unique features of ESCs, such as unlimited self-renewal potential and broad differentiation capability, even though iPSCs seem more susceptible to genomic instability and display epigenetic biases as compared to ESCs. Both ESCs and iPSCs have been intensely investigated for cardiomyocyte production and cardiac muscle regeneration, both in human and animal models. In vitro and in vivo studies are continuously expanding and refining this field via genetic manipulation and cell conditioning, trying to achieve standard and reproducible products, eligible for clinical and biopharmaceutical scopes. This review focuses on the recently growing body of patents, concerning technical advances in production, expansion and cardiac differentiation of ESCs and iPSCs.

  16. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2013-10-01

    profiling 3 Abstract ( words) The generation of human induced pluripotent stem cells (hiPSCs) represents an exciting advancement with...Sensys KAF-1400 CCD camera (Roper Scientific) or on a Zeiss laser confocal microscope. Transplanted cells were localized by staining for human...GGAAAAATTGTCAGTAGTGCAATGGAACCAGATCGGGAATACCATTTTGGACAAGCA GTACGGTTTGTATGTAACTCAGGCTACAAGATTGAAGGAGATG 36 NES NM_006617.1 2345- 2445

  17. Identification of Epigenetic Changes in Prostate Cancer using Induced Pluripotent Stem Cells

    DTIC Science & Technology

    2014-04-01

    the prostatic epithelium . 15. SUBJECT TERMS- prostate cancer, induced pluripotent stem cells, epigenetics 16. SECURITY CLASSIFICATION OF...epithelial, secretory epithelial, and neuroendocrine) that encompass the prostate epithelium as well as cancer cells that resemble the parental primary...differentiation in mice. 15 Moreover, Nkx3.1, the earliest known marker of prostate epithelium during embryogenesis, was identified as a significant

  18. MicroRNA-302 switch to identify and eliminate undifferentiated human pluripotent stem cells

    PubMed Central

    Parr, Callum J. C.; Katayama, Shota; Miki, Kenji; Kuang, Yi; Yoshida, Yoshinori; Morizane, Asuka; Takahashi, Jun; Yamanaka, Shinya; Saito, Hirohide

    2016-01-01

    The efficiency of pluripotent stem cell differentiation is highly variable, often resulting in heterogeneous populations that contain undifferentiated cells. Here we developed a sensitive, target-specific, and general method for removing undesired cells before transplantation. MicroRNA-302a-5p (miR-302a) is highly and specifically expressed in human pluripotent stem cells and gradually decreases to basal levels during differentiation. We synthesized a new RNA tool, miR-switch, as a live-cell reporter mRNA for miR-302a activity that can specifically detect human induced pluripotent stem cells (hiPSCs) down to a spiked level of 0.05% of hiPSCs in a heterogeneous population and can prevent teratoma formation in an in vivo tumorigenicity assay. Automated and selective hiPSC-elimination was achieved by controlling puromycin resistance using the miR-302a switch. Our system uniquely provides sensitive detection of pluripotent stem cells and partially differentiated cells. In addition to its ability to eliminate undifferentiated cells, miR-302a switch also holds great potential in investigating the dynamics of differentiation and/or reprograming of live-cells based on intracellular information. PMID:27608814

  19. Optimization of adenovirus vectors for transduction in embryonic stem cells and induced pluripotent stem cells.

    PubMed

    Tashiro, Katsuhisa

    2011-01-01

      Because embryonic stem (ES) cells and induced pluripotent stem (iPS) cells can differentiate into various types of cells in vitro, they are considered as a valuable model to understand the processes involved in the differentiation into functional cells as well as an unlimited source of cells for therapeutic applications. Efficient gene transduction method is one of the powerful tools for the basic researches and for differentiating ES and iPS cells into lineage-committed cells. Recently, we have developed an adenovirus (Ad) vector for efficient transduction into ES and iPS cells. We showed that Ad vectors containing the cytomegalovirus enhancer/β-actin promoter with β-actin intron (CA) promoter or the elongation factor (EF)-1α promoter were the appropriate for the transduction into ES and iPS cells. We also found that enforced expression of a PPARγ gene or a Runx2 gene into mouse ES and iPS cells by an optimized Ad vector markedly augmented the differentiation of adipocytes or osteoblasts, respectively. Thus, a gene transfer technique using an Ad vector could be an advantage for the regulation of stem cell differentiation and could be applied to regenerative medicine based on ES and iPS cells.

  20. Doxycycline Enhances Survival and Self-Renewal of Human Pluripotent Stem Cells

    PubMed Central

    Chang, Mi-Yoon; Rhee, Yong-Hee; Yi, Sang-Hoon; Lee, Su-Jae; Kim, Rae-Kwon; Kim, Hyongbum; Park, Chang-Hwan; Lee, Sang-Hun

    2014-01-01

    Summary We here report that doxycycline, an antibacterial agent, exerts dramatic effects on human embryonic stem and induced pluripotent stem cells (hESC/iPSCs) survival and self-renewal. The survival-promoting effect was also manifest in cultures of neural stem cells (NSCs) derived from hESC/iPSCs. These doxycycline effects are not associated with its antibacterial action, but mediated by direct activation of a PI3K-AKT intracellular signal. These findings indicate doxycycline as a useful supplement for stem cell cultures, facilitating their growth and maintenance. PMID:25254347

  1. Application of Induced Pluripotent Stem Cell Technology to the Study of Hematological Diseases

    PubMed Central

    Li, Mailin; Cascino, Pasquale; Ummarino, Simone; Di Ruscio, Annalisa

    2017-01-01

    The burst of reprogramming technology in recent years has revolutionized the field of stem cell biology, offering new opportunities for personalized, regenerative therapies. The direct reprogramming of somatic cells to induced pluripotent stem cells (iPSCs) has provided an invaluable tool to study and model a wide range of human diseases. Here, we review the transforming potential of such a strategy in research and in therapies applicable to the hematology field. PMID:28282903

  2. New frontiers in human cell biology and medicine: can pluripotent stem cells deliver?

    PubMed

    Goldstein, Lawrence S B

    2012-11-12

    Human pluripotent stem cells provide enormous opportunities to treat disease using cell therapy. But human stem cells can also drive biomedical and cell biological discoveries in a human model system, which can be directly linked to understanding disease or developing new therapies. Finally, rigorous scientific studies of these cells can and should inform the many science and medical policy issues that confront the translation of these technologies to medicine. In this paper, I discuss these issues using amyotrophic lateral sclerosis as an example.

  3. Human pluripotent stem cell-derived limbal epithelial stem cells on bioengineered matrices for corneal reconstruction.

    PubMed

    Mikhailova, Alexandra; Ilmarinen, Tanja; Ratnayake, Anjula; Petrovski, Goran; Uusitalo, Hannu; Skottman, Heli; Rafat, Mehrdad

    2016-05-01

    Corneal epithelium is renewed by limbal epithelial stem cells (LESCs), a type of tissue-specific stem cells located in the limbal palisades of Vogt at the corneo-scleral junction. Acute trauma or inflammatory disorders of the ocular surface can destroy these stem cells, leading to limbal stem cell deficiency (LSCD) - a painful and vision-threatening condition. Treating these disorders is often challenging and complex, especially in bilateral cases with extensive damage. Human pluripotent stem cells (hPSCs) provide new opportunities for corneal reconstruction using cell-based therapy. Here, we investigated the use of hPSC-derived LESC-like cells on bioengineered collagen matrices in serum-free conditions, aiming for clinical applications to reconstruct the corneal epithelium and partially replace the damaged stroma. Differentiation of hPSCs towards LESC-like cells was directed using small-molecule induction followed by maturation in corneal epithelium culture medium. After four to five weeks of culture, differentiated cells were seeded onto bioengineered matrices fabricated as transparent membranes of uniform thickness, using medical-grade porcine collagen type I and a hybrid cross-linking technology. The bioengineered matrices were fully transparent, with high water content and swelling capacity, and parallel lamellar microstructure. Cell proliferation of hPSC-LESCs was significantly higher on bioengineered matrices than on collagen-coated control wells after two weeks of culture, and LESC markers p63 and cytokeratin 15, along with proliferation marker Ki67 were expressed even after 30 days in culture. Overall, hPSC-LESCs retained their capacity to self-renew and proliferate, but were also able to terminally differentiate upon stimulation, as suggested by protein expression of cytokeratins 3 and 12. We propose the use of bioengineered collagen matrices as carriers for the clinically-relevant hPSC-derived LESC-like cells, as a novel tissue engineering approach for

  4. Investigating the functionality of an OCT4-short response element in human induced pluripotent stem cells

    PubMed Central

    Vega-Crespo, Agustin; Truong, Brian; Hermann, Kip J; Awe, Jason P; Chang, Katherine M; Lee, Patrick C; Schoenberg, Benjamen E; Wu, Lily; Byrne, James A; Lipshutz, Gerald S

    2016-01-01

    Pluripotent stem cells offer great therapeutic promise for personalized treatment platforms for numerous injuries, disorders, and diseases. Octamer-binding transcription factor 4 (OCT4) is a key regulatory gene maintaining pluripotency and self-renewal of mammalian cells. With site-specific integration for gene correction in cellular therapeutics, use of the OCT4 promoter may have advantages when expressing a suicide gene if pluripotency remains. However, the human OCT4 promoter region is 4 kb in size, limiting the capacity of therapeutic genes and other regulatory components for viral vectors, and decreasing the efficiency of homologous recombination. The purpose of this investigation was to characterize the functionality of a novel 967bp OCT4-short response element during pluripotency and to examine the OCT4 titer-dependent response during differentiation to human derivatives not expressing OCT4. Our findings demonstrate that the OCT4-short response element is active in pluripotency and this activity is in high correlation with transgene expression in vitro, and the OCT4-short response element is inactivated when pluripotent cells differentiate. These studies demonstrate that this shortened OCT4 regulatory element is functional and may be useful as part of an optimized safety component in a site-specific gene transferring system that could be used as an efficient and clinically applicable safety platform for gene transfer in cellular therapeutics. PMID:27500178

  5. Roles of TGF-β family signals in the fate determination of pluripotent stem cells.

    PubMed

    Itoh, Fumiko; Watabe, Tetsuro; Miyazono, Kohei

    2014-08-01

    Members of the transforming growth factor-β (TGF-β) family have been implicated in embryogenesis as well as in the determination of the cell fates of mouse and human embryonic stem (ES) cells, which are characterized by their self-renewal and pluripotency. The cellular responses to TGF-β family signals are divergent depending on the cellular context and local environment. TGF-β family signals play critical roles both in the maintenance of the pluripotent state of ES cells by inducing the expression of Nanog, Oct4, and Sox2, and in their differentiation into various cell types by regulating the expression of master regulatory genes. Moreover, multiple lines of evidence have suggested the importance of TGF-β family signals in establishing induced pluripotent stem (iPS) cells. Since ES and iPS cells have great potential for applications in regenerative medicine, it is critical to figure out the mechanisms underlying their self-renewal, pluripotency, and differentiation. Here, we discuss the roles of TGF-β family ligands and their downstream signaling molecules, Smad proteins, in the maintenance of the pluripotency and lineage specification of mouse and human ES and iPS cells.

  6. Nanog RNA-binding proteins YBX1 and ILF3 affect pluripotency of embryonic stem cells.

    PubMed

    Guo, Chuanliang; Xue, Yan; Yang, Guanheng; Yin, Shang; Shi, Wansheng; Cheng, Yan; Yan, Xiaoshuang; Fan, Shuyue; Zhang, Huijun; Zeng, Fanyi

    2016-08-01

    Nanog is a well-known transcription factor that plays a fundamental role in stem cell self-renewal and the maintenance of their pluripotent cell identity. There remains a large data gap with respect to the spectrum of the key pluripotency transcription factors' interaction partners. Limited information is available concerning Nanog-associated RNA-binding proteins (RBPs), and the intrinsic protein-RNA interactions characteristic of the regulatory activities of Nanog. Herein, we used an improved affinity protocol to purify Nanog-interacting RBPs from mouse embryonic stem cells (ESCs), and 49 RBPs of Nanog were identified. Among them, the interaction of YBX1 and ILF3 with Nanog mRNA was further confirmed by in vitro assays, such as Western blot, RNA immunoprecipitation (RIP), and ex vivo methods, such as immunofluorescence staining and fluorescent in situ hybridization (FISH), MS2 in vivo biotin-tagged RNA affinity purification (MS2-BioTRAP). Interestingly, RNAi studies revealed that YBX1 and ILF3 positively affected the expression of Nanog and other pluripotency-related genes. Particularly, downregulation of YBX1 or ILF3 resulted in high expression of mesoderm markers. Thus, a reduction in the expression of YBX1 and ILF3 controls the expression of pluripotency-related genes in ESCs, suggesting their roles in further regulation of the pluripotent state of ESCs.

  7. Comparative computational analysis of pluripotency in human and mouse stem cells

    PubMed Central

    Ernst, Mathias; Dawud, Raed Abu; Kurtz, Andreas; Schotta, Gunnar; Taher, Leila; Fuellen, Georg

    2015-01-01

    Pluripotent cells can be subdivided into two distinct states, the naïve and the primed state, the latter being further advanced on the path of differentiation. There are substantial differences in the regulation of pluripotency between human and mouse, and in humans only stem cells that resemble the primed state in mouse are readily available. Reprogramming of human stem cells into a more naïve-like state is an important research focus. Here, we developed a pipeline to reanalyze transcriptomics data sets that describe both states, naïve and primed pluripotency, in human and mouse. The pipeline consists of identifying regulated start-ups/shut-downs in terms of molecular interactions, followed by functional annotation of the genes involved and aggregation of results across conditions, yielding sets of mechanisms that are consistently regulated in transitions towards similar states of pluripotency. Our results suggest that one published protocol for naïve human cells gave rise to human cells that indeed share putative mechanisms with the prototypical naïve mouse pluripotent cells, such as DNA damage response and histone acetylation. However, cellular response and differentiation-related mechanisms are similar between the naïve human state and the primed mouse state, so the naïve human state did not fully reflect the naïve mouse state. PMID:25604210

  8. Identification of the early and late responder genes during the generation of induced pluripotent stem cells from mouse fibroblasts

    PubMed Central

    Ham, Seokjin; Hong, Chang-Pyo; Seo, Seonghye; Choe, Moon Kyung; Shin, So-I; Lee, Choon-Soo; Kim, Hyo-Soo

    2017-01-01

    Background The generation of induced pluripotent stem cell (iPSC), a substitute for embryonic stem cell (ESC), requires the proper orchestration of a transcription program at the chromatin level. Our recent approach for the induction of pluripotent stem cells from fibroblasts using protein extracts from mouse ESCs could overcome the potential tumorigenicity risks associated with random retroviral integration. Here, we examine the epigenetic modifications and the transcriptome of two types of iPSC and of partially reprogrammed iPSCs (iPSCp) generated independently from adult cardiac and skin fibroblasts to assess any perturbations of the transcription program during reprogramming. Results The comparative dissection of the transcription profiles and histone modification patterns at lysines 4 and 27 of histone H3 of the iPSC, iPSCp, ESC, and somatic cells revealed that the iPSC was almost completely comparable to the ESC, regardless of their origins, whereas the genes of the iPSCp were dysregulated to a larger extent. Regardless of the origins of the somatic cells, the fibroblasts induced using the ESC protein extracts appear to be completely reprogrammed into pluripotent cells, although they show unshared marginal differences in their gene expression programs, which may not affect the maintenance of stemness. A comparative investigation of the iPSCp generated by unwanted reprogramming showed that the two groups of genes on the pathway from somatic cells to iPSC might function as sequential reprogramming-competent early and late responders to the induction stimulus. Moreover, some of the divergent genes expressed only in the iPSCp were associated with many tumor-related pathways. Conclusions Faithful transcriptional reprogramming should follow epigenetic alterations to generate induced pluripotent stem cells from somatic cells. This genome-wide comparison enabled us to define the early and late responder genes during the cell reprogramming process to iPSC. Our results

  9. Induction of Skin-Derived Precursor Cells from Human Induced Pluripotent Stem Cells

    PubMed Central

    Sugiyama-Nakagiri, Yoriko; Fujimura, Tsutomu; Moriwaki, Shigeru

    2016-01-01

    The generation of full thickness human skin from dissociated cells is an attractive approach not only for treating skin diseases, but also for treating many systemic disorders. However, it is currently not possible to obtain an unlimited number of skin dermal cells. The goal of this study was to develop a procedure to produce skin dermal stem cells from induced pluripotent stem cells (iPSCs). Skin-derived precursor cells (SKPs) were isolated as adult dermal precursors that could differentiate into both neural and mesodermal progenies and could reconstitute the dermis. Thus, we attempted to generate SKPs from iPSCs that could reconstitute the skin dermis. Human iPSCs were initially cultured with recombinant noggin and SB431542, an inhibitor of activin/nodal and TGFβ signaling, to induce neural crest progenitor cells. Those cells were then treated with SKP medium that included CHIR99021, a WNT signal activator. The induction efficacy from neural crest progenitor cells to SKPs was more than 97%. No other modifiers tested were able to induce those cells. Those human iPSC-derived SKPs (hiPSC-SKPs) showed a similar gene expression signature to SKPs isolated from human skin dermis. Human iPSC-SKPs differentiated into neural and mesodermal progenies, including adipocytes, skeletogenic cell types and Schwann cells. Moreover, they could be induced to follicular type keratinization when co-cultured with human epidermal keratinocytes. We here provide a new efficient protocol to create human skin dermal stem cells from hiPSCs that could contribute to the treatment of various skin disorders. PMID:27992514

  10. From “ES-like” cells to induced pluripotent stem cells: A historical perspective in domestic animals

    PubMed Central

    Koh, Sehwon; Piedrahita, Jorge A.

    2013-01-01

    Pluripotent stem cells such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) provide great potential as cell sources for gene editing to generate genetically modified animals, as well as in the field of regenerative medicine. Stable, long-term ESCs have been established in laboratory mouse and rat, however, isolation of true pluripotent ESCs in domesticated animals such as pigs and dogs have been less successful. Initially, domesticated animal pluripotent cell lines were referred to as “ES-like” cells due to similar morphological characteristics to mouse ESCs but accompanied by a limited ability to proliferate in vitro in an undifferentiated state. That is, they shared some but not all the characteristics of true ESCs. More recently, advances in reprogramming using exogenous transcription factors, combined with the utilization of small chemical inhibitors of key biochemical pathways, have led to the isolation of induced pluripotent stem cells. In this review, we provide a historical perspective of the isolation of various types of pluripotent stem cells in domesticated animals. In addition, we summarize the latest progress and limitations in the derivation and application of induced pluripotent stem cells. PMID:24274415

  11. Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine

    PubMed Central

    Medvedev, S.P.; Shevchenko, A.I.

    2010-01-01

    Induced pluripotent stem cells (iPSCs) are a new type of pluripotent cells that can be obtained by reprogramming animal and human differentiated cells. In this review, issues related to the nature of iPSCs are discussed and different methods of iPSC production are described. We particularly focused on methods of iPSC production without the genetic modification of the cell genome and with means for increasing the iPSC production efficiency. The possibility and issues related to the safety of iPSC use in cell replacement therapy of human diseases and a study of new medicines are considered. PMID:22649638

  12. Radiation response of mesenchymal stem cells derived from bone marrow and human pluripotent stem cells.

    PubMed

    Islam, Mohammad S; Stemig, Melissa E; Takahashi, Yutaka; Hui, Susanta K

    2015-03-01

    Mesenchymal stem cells (MSCs) isolated from human pluripotent stem cells are comparable with bone marrow-derived MSCs in their function and immunophenotype. The purpose of this exploratory study was comparative evaluation of the radiation responses of mesenchymal stem cells derived from bone marrow- (BMMSCs) and from human embryonic stem cells (hESMSCs). BMMSCs and hESMSCs were irradiated at 0 Gy (control) to 16 Gy using a linear accelerator commonly used for cancer treatment. Cells were harvested immediately after irradiation, and at 1 and 5 days after irradiation. Cell cycle analysis, colony forming ability (CFU-F), differentiation ability, and expression of osteogenic-specific runt-related transcription factor 2 (RUNX2), adipogenic peroxisome proliferator-activated receptor gamma (PPARγ), oxidative stress-specific dismutase-1 (SOD1) and Glutathione peroxidase (GPX1) were analyzed. Irradiation arrested cell cycle progression in BMMSCs and hESMSCs. Colony formation ability of irradiated MSCs decreased in a dose-dependent manner. Irradiated hESMSCs showed higher adipogenic differentiation compared with BMMSCs, together with an increase in the adipogenic PPARγ expression. PPARγ expression was upregulated as early as 4 h after irradiation, along with the expression of SOD1. More than 70% downregulation was found in Wnt3A, Wnt4, Wnt 7A, Wnt10A and Wnt11 in BMMSCs, but not in hESMSCs. hESMSCs are highly proliferative but radiosensitive compared with BMMSCs. Increased PPARγ expression relative to RUNX2 and downregulation of Wnt ligands in irradiated MSCs suggest Wnt mediated the fate determination of irradiated MSCs.

  13. Development of a Modular Automated System for Maintenance and Differentiation of Adherent Human Pluripotent Stem Cells.

    PubMed

    Crombie, Duncan E; Daniszewski, Maciej; Liang, Helena H; Kulkarni, Tejal; Li, Fan; Lidgerwood, Grace E; Conquest, Alison; Hernández, Damian; Hung, Sandy S; Gill, Katherine P; De Smit, Elisabeth; Kearns, Lisa S; Clarke, Linda; Sluch, Valentin M; Chamling, Xitiz; Zack, Donald J; Wong, Raymond C B; Hewitt, Alex W; Pébay, Alice

    2017-03-01

    Patient-specific induced pluripotent stem cells (iPSCs) have tremendous potential for development of regenerative medicine, disease modeling, and drug discovery. However, the processes of reprogramming, maintenance, and differentiation are labor intensive and subject to intertechnician variability. To address these issues, we established and optimized protocols to allow for the automated maintenance of reprogrammed somatic cells into iPSCs to enable the large-scale culture and passaging of human pluripotent stem cells (PSCs) using a customized TECAN Freedom EVO. Generation of iPSCs was performed offline by nucleofection followed by selection of TRA-1-60-positive cells using a Miltenyi MultiMACS24 Separator. Pluripotency markers were assessed to confirm pluripotency of the generated iPSCs. Passaging was performed using an enzyme-free dissociation method. Proof of concept of differentiation was obtained by differentiating human PSCs into cells of the retinal lineage. Key advantages of this automated approach are the ability to increase sample size, reduce variability during reprogramming or differentiation, and enable medium- to high-throughput analysis of human PSCs and derivatives. These techniques will become increasingly important with the emergence of clinical trials using stem cells.

  14. Generation of LIF-independent induced pluripotent stem cells from canine fetal fibroblasts.

    PubMed

    Gonçalves, N J N; Bressan, F F; Roballo, K C S; Meirelles, F V; Xavier, P L P; Fukumasu, H; Williams, C; Breen, M; Koh, S; Sper, R; Piedrahita, J; Ambrósio, C E

    2017-04-01

    Takahashi and Yamanaka established the first technique in which transcription factors related to pluripotency are incorporated into the genome of somatic cells to enable reprogramming of these cells. The expression of these transcription factors enables a differentiated somatic cell to reverse its phenotype to an embryonic state, generating induced pluripotent stem cells (iPSCs). iPSCs from canine fetal fibroblasts were produced through lentiviral polycistronic human and mouse vectors (hOSKM/mOSKM), aiming to obtain pluripotent stem cells with similar features to embryonic stem cells (ESC) in this animal model. The cell lines obtained in this study were independent of LIF or any other supplemental inhibitors, resistant to enzymatic procedure (TrypLE Express Enzyme), and dependent on bFGF. Clonal lines were obtained from slightly different protocols with maximum reprogramming efficiency of 0.001%. All colonies were positive for alkaline phosphatase, embryoid body formation, and spontaneous differentiation and expressed high levels of endogenous OCT4 and SOX2. Canine iPSCs developed tumors at 120 days post-injection in vivo. Preliminary chromosomal evaluations were performed by FISH hybridization, revealing no chromosomal abnormality. To the best of our knowledge, this report is the first to describe the ability to reprogram canine somatic cells via lentiviral vectors without supplementation and with resistance to enzymatic action, thereby demonstrating the pluripotency of these cell lines.

  15. Conserved Role of bFGF and a Divergent Role of LIF for Pluripotency Maintenance and Survival in Canine Pluripotent Stem Cells.

    PubMed

    Luo, Jiesi; Cibelli, Jose B

    2016-09-19

    Dogs have been widely used as a preclinical model for human disease. With the successful generation of canine induced pluripotent stem cells (ciPSCs), the biomedical community has a unique opportunity to study therapeutic interventions using autologous stem cells that can benefit dogs and humans. Unlike mice and human pluripotent cells, which are leukemia inhibitory factor (LIF)- and basic fibroblast growth factor (bFGF)-dependent, respectively, dog iPSCs require both growth factors simultaneously. In an effort to elucidate the role of each factor in the control of ciPSC self-renewal, we performed a series of experiments aiming at understanding the signaling pathways activated by them. We found that bFGF regulates pluripotency by indirectly activating the SMAD2/3 pathway in the presence of feeder cells, exclusively targeting NANOG expression, and inhibiting spontaneous differentiation toward ectoderm and mesoderm. LIF activates the JAK-STAT3 pathway but does not function in the typical manner described in mouse naïve embryonic stem cells. These results show that a unique mechanism for maintenance of pluripotency is present in ciPSC. These findings should be taken into account when establishing stem cell differentiation protocols and may provide more insight into pluripotency regulation in species other than mice and humans.

  16. [CRISPR/Cas system for genome editing in pluripotent stem cells].

    PubMed

    Vasil'eva, E A; Melino, D; Barlev, N A

    2015-01-01

    Genome editing systems based on site-specific nucleases became very popular for genome editing in modern bioengineering. Human pluripotent stem cells provide a unique platform for genes function study, disease modeling, and drugs testing. Consequently, technology for fast, accurate and well controlled genome manipulation is required. CRISPR/Cas (clustered regularly interspaced short palindromic repeat/CRISPR-associated) system could be employed for these purposes. This system is based on site-specific programmable nuclease Cas9. Numerous advantages of the CRISPR/Cas system and its successful application to human stem cells provide wide opportunities for genome therapy and regeneration medicine. In this publication, we describe and compare the main genome editing systems based on site-specific programmable nucleases and discuss opportunities and perspectives of the CRISPR/Cas system for application to pluripotent stem cells.

  17. Pluripotent stem cell derived hepatocytes: using materials to define cellular differentiation and tissue engineering

    PubMed Central

    Lucendo-Villarin, B.; Rashidi, H.; Cameron, K.

    2016-01-01

    Pluripotent stem cell derived liver cells (hepatocytes) represent a promising alternative to primary tissue for biological and clinical applications. To date, most hepatocyte maintenance and differentiation systems have relied upon the use of animal derived components. This serves as a significant barrier to large scale production and application of stem cell derived hepatocytes. Recently, the use of defined biologics has overcome those limitations in two-dimensional monolayer culture. In order to improve the cell phenotype further, three-dimensional culture systems have been employed to better mimic the in vivo situation, drawing upon materials chemistry, engineering and biology. In this review we discuss efforts in the field, to differentiate pluripotent stem cells towards hepatocytes under defined conditions. PMID:27746914

  18. Pluripotent stem cell derived hepatocytes: using materials to define cellular differentiation and tissue engineering.

    PubMed

    Lucendo-Villarin, B; Rashidi, H; Cameron, K; Hay, D C

    2016-05-28

    Pluripotent stem cell derived liver cells (hepatocytes) represent a promising alternative to primary tissue for biological and clinical applications. To date, most hepatocyte maintenance and differentiation systems have relied upon the use of animal derived components. This serves as a significant barrier to large scale production and application of stem cell derived hepatocytes. Recently, the use of defined biologics has overcome those limitations in two-dimensional monolayer culture. In order to improve the cell phenotype further, three-dimensional culture systems have been employed to better mimic the in vivo situation, drawing upon materials chemistry, engineering and biology. In this review we discuss efforts in the field, to differentiate pluripotent stem cells towards hepatocytes under defined conditions.

  19. Human Pluripotent Stem Cell-Derived Cardiomyocytes as Research and Therapeutic Tools

    PubMed Central

    Pesl, Martin; Lacampagne, Alain; Dvorak, Petr; Rotrekl, Vladimir; Meli, Albano C.

    2014-01-01

    Human pluripotent stem cells (hPSCs), namely, embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), with their ability of indefinite self-renewal and capability to differentiate into cell types derivatives of all three germ layers, represent a powerful research tool in developmental biology, for drug screening, disease modelling, and potentially cell replacement therapy. Efficient differentiation protocols that would result in the cell type of our interest are needed for maximal exploitation of these cells. In the present work, we aim at focusing on the protocols for differentiation of hPSCs into functional cardiomyocytes in vitro as well as achievements in the heart disease modelling and drug testing on the patient-specific iPSC-derived cardiomyocytes (iPSC-CMs). PMID:24800237

  20. "The state of the heart": Recent advances in engineering human cardiac tissue from pluripotent stem cells.

    PubMed

    Sirabella, Dario; Cimetta, Elisa; Vunjak-Novakovic, Gordana

    2015-08-01

    The pressing need for effective cell therapy for the heart has led to the investigation of suitable cell sources for tissue replacement. In recent years, human pluripotent stem cell research expanded tremendously, in particular since the derivation of human-induced pluripotent stem cells. In parallel, bioengineering technologies have led to novel approaches for in vitro cell culture. The combination of these two fields holds potential for in vitro generation of high-fidelity heart tissue, both for basic research and for therapeutic applications. However, this new multidisciplinary science is still at an early stage. Many questions need to be answered and improvements need to be made before clinical applications become a reality. Here we discuss the current status of human stem cell differentiation into cardiomyocytes and the combined use of bioengineering approaches for cardiac tissue formation and maturation in developmental studies, disease modeling, drug testing, and regenerative medicine.

  1. Long-term maintenance of human induced pluripotent stem cells by automated cell culture system

    PubMed Central

    Konagaya, Shuhei; Ando, Takeshi; Yamauchi, Toshiaki; Suemori, Hirofumi; Iwata, Hiroo

    2015-01-01

    Pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells, are regarded as new sources for cell replacement therapy. These cells can unlimitedly expand under undifferentiated conditions and be differentiated into multiple cell types. Automated culture systems enable the large-scale production of cells. In addition to reducing the time and effort of researchers, an automated culture system improves the reproducibility of cell cultures. In the present study, we newly designed a fully automated cell culture system for human iPS maintenance. Using an automated culture system, hiPS cells maintained their undifferentiated state for 60 days. Automatically prepared hiPS cells had a potency of differentiation into three germ layer cells including dopaminergic neurons and pancreatic cells. PMID:26573336

  2. Revisiting Mitochondrial Function and Metabolism in Pluripotent Stem Cells: Where Do We Stand in Neurological Diseases?

    PubMed

    Lopes, Carla; Rego, A Cristina

    2017-04-01

    Pluripotent stem cells (PSCs) are powerful cellular tools that can generate all the different cell types of the body, and thus overcome the often limited access to human disease tissues; this becomes highly relevant when aiming to investigate cellular (dys)function in diseases affecting the central nervous system. Recent studies have demonstrated that PSC and differentiated cells show altered mitochondrial function and metabolic profiles and production of reactive oxygen species. This raises an emerging paradigm about the role of mitochondria in stem cell biology and urges the need to identify mitochondrial pathways involved in these processes. In this respect, this review focuses on the metabolic profile of PSC and how mitochondrial function can influence the reprogramming and differentiation processes. Indeed, both embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) favor the glycolytic pathway as a major source of energy production over oxidative phosphorylation. PSC mitochondria are characterized by a spherical shape, low copy number of mitochondrial DNA, and a hyperpolarized state. Indeed, mitochondria appear to have a crucial role in reprogramming iPSC, in the maintenance of a pluripotent state, and in differentiation. Moreover, an increase in mitochondrial oxidative phosphorylation has to occur for differentiation to succeed. Therefore, in vitro differentiation of neural stem cells (NSCs) into neurons can be compromised if those mechanisms are impaired. Future research should shed light on how mitochondrial impairment occurring in pre differentiation neural stages (e.g., in NSC or premature neurons) may contribute for the etiopathogenesis of neurodevelopmental and neurological disorders.

  3. Mammalian genes induce partially reprogrammed pluripotent stem cells in non-mammalian vertebrate and invertebrate species

    PubMed Central

    Rosselló, Ricardo Antonio; Chen, Chun-Chun; Dai, Rui; Howard, Jason T; Hochgeschwender, Ute; Jarvis, Erich D

    2013-01-01

    Cells are fundamental units of life, but little is known about evolution of cell states. Induced pluripotent stem cells (iPSCs) are once differentiated cells that have been re-programmed to an embryonic stem cell-like state, providing a powerful platform for biology and medicine. However, they have been limited to a few mammalian species. Here we found that a set of four mammalian transcription factor genes used to generate iPSCs in mouse and humans can induce a partially reprogrammed pluripotent stem cell (PRPSCs) state in vertebrate and invertebrate model organisms, in mammals, birds, fish, and fly, which span 550 million years from a common ancestor. These findings are one of the first to show cross-lineage stem cell-like induction, and to generate pluripotent-like cells for several of these species with in vivo chimeras. We suggest that the stem-cell state may be highly conserved across a wide phylogenetic range. DOI: http://dx.doi.org/10.7554/eLife.00036.001 PMID:24015354

  4. Molecular analyses of human induced pluripotent stem cells and embryonic stem cells

    PubMed Central

    Chin, Mark H.; Pellegrini, Matteo; Plath, Kathrin; Lowry, William E.

    2012-01-01

    Recent work from our group and others has argued that human induced pluripotent stem cells (hiPSCs) generated by the introduction of four viruses bearing reprogramming factors differ from human embryonic stem cells (hESCs) at the level of gene expression. Many of the differences seen were common across independent labs and, at least to some extent, are thought to be a result of residual expression of donor cell-specific genes (Chin et al., 2009; Ghosh et al., 2010; Marchetto et al., 2009). Two new reports re-analyze similar expression datasets as those used in Chin et al., (Chin et al., 2009) and come to different conclusions (Newman et al., 2010, Guenther et al., 2010). Here, we compare various approaches to perform gene expression meta-analysis that all support our original conclusions and present new data to demonstrate that polycistronic delivery of the reprogramming factors and extended culture brings hiPSCs transcriptionally much closer to hESCs than older methods. PMID:20682452

  5. Progress and obstacles towards generating hematopoietic stem cells from pluripotent stem cells

    PubMed Central

    Lee, Jungmin; Dykstra, Brad; Sackstein, Robert; Rossi, Derrick J.

    2015-01-01

    Purpose of review Human pluripotent stem cells (PSCs) have the potential to provide an inexhaustible source of hematopoietic stem cells (HSCs) that could be used in disease modeling and in clinical applications such as transplantation. Although the goal of deriving definitive HSCs from PSCs has not been achieved, recent studies indicate that progress is being made. This review will provide information on the current status of deriving HSCs from PSCs, and will highlight existing challenges and obstacles. Recent findings Recent strides in HSC generation from PSCs has included derivation of developmental intermediates, identification of transcription factors and small molecules that support hematopoietic derivation, and the development of strategies to recapitulate niche-like conditions. Summary Despite considerable progress in defining the molecular events driving derivation of hematopoietic progenitor cells (HPCs) from PSCs, the generation of robust transplantable HSCs from PSCs remains elusive. We propose that this goal can be facilitated by better understanding of the regulatory pathways governing HSC identity, development of HSC supportive conditions, and examining the marrow homing properties of PSC-derived HSCs. PMID:26049752

  6. Human embryonic stem cells vs human induced pluripotent stem cells for cardiac repair.

    PubMed

    Barad, Lili; Schick, Revital; Zeevi-Levin, Naama; Itskovitz-Eldor, Joseph; Binah, Ofer

    2014-11-01

    Human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) have the capacity to differentiate into any specialized cell type, including cardiomyocytes. Therefore, hESC-derived and hiPSC-derived cardiomyocytes (hESC-CMs and hiPSC-CMs, respectively) offer great potential for cardiac regenerative medicine. Unlike some organs, the heart has a limited ability to regenerate, and dysfunction resulting from significant cardiomyocyte loss under pathophysiological conditions, such as myocardial infarction (MI), can lead to heart failure. Unfortunately, for patients with end-stage heart failure, heart transplantation remains the main alternative, and it is insufficient, mainly because of the limited availability of donor organs. Although left ventricular assist devices are progressively entering clinical practice as a bridge to transplantation and even as an optional therapy, cell replacement therapy presents a plausible alternative to donor organ transplantation. During the past decade, multiple candidate cells were proposed for cardiac regeneration, and their mechanisms of action in the myocardium have been explored. The purpose of this article is to critically review the comprehensive research involving the use of hESCs and hiPSCs in MI models and to discuss current controversies, unresolved issues, challenges, and future directions.

  7. Isolation and cultivation of stem cells from adult mouse testes.

    PubMed

    Guan, Kaomei; Wolf, Frieder; Becker, Alexander; Engel, Wolfgang; Nayernia, Karim; Hasenfuss, Gerd

    2009-01-01

    The successful isolation and cultivation of spermatogonial stem cells (SSCs) as well as induction of SSCs into pluripotent stem cells will allow us to study their biological characteristics and their applications in therapeutic approaches. Here we provide step-by-step procedures on the basis of previous work in our laboratory for: the isolation of testicular cells from adolescent mice by a modified enzymatic procedure; the enrichment of undifferentiated spermatogonia by laminin selection or genetic selection using Stra8-EGFP (enhanced green fluorescent protein) transgenic mice; the cultivation and conversion of undifferentiated spermatogonia into embryonic stem-like cells, so-called multipotent adult germline stem cells (maGSCs); and characterization of these cells. Normally, it will take about 16 weeks to obtain stable maGSC lines starting from the isolation of testicular cells.

  8. Small molecule-based approaches to adult stem cell therapies.

    PubMed

    Lairson, Luke L; Lyssiotis, Costas A; Zhu, Shoutian; Schultz, Peter G

    2013-01-01

    There is considerable interest in the development of stem cell-based strategies for the treatment of a broad range of human diseases, including neurodegenerative, autoimmune, cardiovascular, and musculoskeletal diseases. To date, such regenerative approaches have focused largely on the development of cell transplantation therapies using cells derived from pluripotent embryonic stem cells (ESCs). Although there have been exciting preliminary reports describing the efficacy of ESC-derived replacement therapies, approaches involving ex vivo manipulated ESCs are hindered by issues of mutation, immune rejection, and ethical controversy. An alternative approach involves direct in vivo modulation or ex vivo expansion of endogenous adult stem cell populations using drug-like small molecules. Here we describe chemical approaches to the regulation of somatic stem cell biology that are yielding new biological insights and that may ultimately lead to innovative new medicines.

  9. Defining an optimal surface chemistry for pluripotent stem cell culture in 2D and 3D

    NASA Astrophysics Data System (ADS)

    Zonca, Michael R., Jr.

    Surface chemistry is critical for growing pluripotent stem cells in an undifferentiated state. There is great potential to engineer the surface chemistry at the nanoscale level to regulate stem cell adhesion. However, the challenge is to identify the optimal surface chemistry of the substrata for ES cell attachment and maintenance. Using a high-throughput polymerization and screening platform, a chemically defined, synthetic polymer grafted coating that supports strong attachment and high expansion capacity of pluripotent stem cells has been discovered using mouse embryonic stem (ES) cells as a model system. This optimal substrate, N-[3-(Dimethylamino)propyl] methacrylamide (DMAPMA) that is grafted on 2D synthetic poly(ether sulfone) (PES) membrane, sustains the self-renewal of ES cells (up to 7 passages). DMAPMA supports cell attachment of ES cells through integrin beta1 in a RGD-independent manner and is similar to another recently reported polymer surface. Next, DMAPMA has been able to be transferred to 3D by grafting to synthetic, polymeric, PES fibrous matrices through both photo-induced and plasma-induced polymerization. These 3D modified fibers exhibited higher cell proliferation and greater expression of pluripotency markers of mouse ES cells than 2D PES membranes. Our results indicated that desirable surfaces in 2D can be scaled to 3D and that both surface chemistry and structural dimension strongly influence the growth and differentiation of pluripotent stem cells. Lastly, the feasibility of incorporating DMAPMA into a widely used natural polymer, alginate, has been tested. Novel adhesive alginate hydrogels have been successfully synthesized by either direct polymerization of DMAPMA and methacrylic acid blended with alginate, or photo-induced DMAPMA polymerization on alginate nanofibrous hydrogels. In particular, DMAPMA-coated alginate hydrogels support strong ES cell attachment, exhibiting a concentration dependency of DMAPMA. This research provides a

  10. Expansion of Multipotent Stem Cells from the Adult Human Brain

    PubMed Central

    Murrell, Wayne; Palmero, Emily; Bianco, John; Stangeland, Biljana; Joel, Mrinal; Paulson, Linda; Thiede, Bernd; Grieg, Zanina; Ramsnes, Ingunn; Skjellegrind, Håvard K.; Nygård, Ståle; Brandal, Petter; Sandberg, Cecilie; Vik-Mo, Einar; Palmero, Sheryl; Langmoen, Iver A.

    2013-01-01

    The discovery of stem cells in the adult human brain has revealed new possible scenarios for treatment of the sick or injured brain. Both clinical use of and preclinical research on human adult neural stem cells have, however, been seriously hampered by the fact that it has been impossible to passage these cells more than a very few times and with little expansion of cell numbers. Having explored a number of alternative culturing conditions we here present an efficient method for the establishment and propagation of human brain stem cells from whatever brain tissue samples we have tried. We describe virtually unlimited expansion of an authentic stem cell phenotype. Pluripotency proteins Sox2 and Oct4 are expressed without artificial induction. For the first time multipotency of adult human brain-derived stem cells is demonstrated beyond tissue boundaries. We characterize these cells in detail in vitro including microarray and proteomic approaches. Whilst clarification of these cells’ behavior is ongoing, results so far portend well for the future repair of tissues by transplantation of an adult patient’s own-derived stem cells. PMID:23967194

  11. Induced pluripotent stem cells as a new strategy for cardiac regeneration and disease modeling.

    PubMed

    Iglesias-García, Olalla; Pelacho, Beatriz; Prósper, Felipe

    2013-09-01

    The possibility to induce pluripotency in somatic cells or, even further, to induce cell transdifferentiation through the forced expression of reprogramming factors has offered new, attractive options for cardiovascular regenerative medicine. In fact, recent discoveries have demonstrated that induced pluripotent stem (iPS) cells can be differentiated into cardiomyocytes, suggesting that iPS cells have the potential to significantly advance future cardiac regenerative therapies. Herein, we provide an overview of the characteristics and differentiation potential associated with iPS cells. In addition, we discuss current methods for inducing their specification towards a cardiovascular phenotype as well as in vivo evidence supporting the therapeutic benefit of iPS-derived cardiac cells. Finally, we describe recent findings regarding the use of iPS-derived cells for modeling several genetic cardiac disorders, which have indicated that these pluripotent cells represent an ideal tool for drug testing and might contribute to the development of future personalized regenerative cell therapies.

  12. Mitochondria: a sulfhydryl oxidase and fission GTPase connect mitochondrial dynamics with pluripotency in embryonic stem cells.

    PubMed

    Wilkerson, Donald C; Sankar, Uma

    2011-09-01

    Mitochondria have long been recognized as cellular energy power houses that also regulate cellular redox signaling to arbitrate cell survival. Recent studies of mitochondria in stem cells (SCs) demonstrate that they have critical roles beyond this traditional view. Embryonic (E) SCs, termed pluripotent for their ability to differentiate into all cell types within an organism, maintain a limited number of morphologically undifferentiated (electron translucent and poorly formed cristae) mitochondria. As these cells differentiate, their mitochondria undergo a tightly choreographed gain of number, mass and morphological complexity. Therefore, mechanisms that regulate mitochondrial growth, localization, division and partition must play active roles in the maintenance of pluripotency and execution of differentiation. Aberrant mitochondrial dynamics are associated with a plethora of human disorders, for which SCs hold curative potential. Hence, a comprehensive understanding of the mechanisms that regulate mitochondrial dynamics and function in SCs and their overall relationship to the maintenance of pluripotency is pivotal for the progression of therapeutic regenerative medicine.

  13. Interactions between pluripotency factors specify cis-regulation in embryonic stem cells

    PubMed Central

    Fiore, Chris; Cohen, Barak A.

    2016-01-01

    We investigated how interactions between pluripotency transcription factors (TFs) affect cis-regulation. We created hundreds of synthetic cis-regulatory elements (CREs) comprised of combinations of binding sites for pluripotency TFs and measured their expression in mouse embryonic stem (ES) cells. A thermodynamic model that incorporates interactions between TFs explains a large portion (72%) of the variance in expression of these CREs. These interactions include three favorable heterotypic interactions between TFs. The model also predicts an unfavorable homotypic interaction between TFs, helping to explain the observation that homotypic chains of binding sites express at low levels. We further investigated the expression driven by CREs comprised of homotypic chains of KLF4 binding sites. Our results suggest that KLF homologs make unique contributions to regulation by these CREs. We conclude that a specific set of interactions between pluripotency TFs plays a large role in setting the levels of expression driven by CREs in ES cells. PMID:27197208

  14. Epigenetic regulation in pluripotent stem cells: a key to breaking the epigenetic barrier.

    PubMed

    Watanabe, Akira; Yamada, Yasuhiro; Yamanaka, Shinya

    2013-01-05

    The differentiation and reprogramming of cells are accompanied by drastic changes in the epigenetic profiles of cells. Waddington's classical model clearly describes how differentiating cells acquire their cell identity as the developmental potential of an individual cell population declines towards the terminally differentiated state. The recent discovery of induced pluripotent stem cells as well as of somatic cell nuclear transfer provided evidence that the process of differentiation can be reversed. The identity of somatic cells is strictly protected by an epigenetic barrier, and these cells acquire pluripotency by breaking the epigenetic barrier by reprogramming factors such as Oct3/4, Sox2, Klf4, Myc and LIN28. This review covers the current understanding of the spatio-temporal regulation of epigenetics in pluripotent and differentiated cells, and discusses how cells determine their identity and overcome the epigenetic barrier during the reprogramming process.

  15. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells.

    PubMed

    Iyer, Dharini; Gambardella, Laure; Bernard, William G; Serrano, Felipe; Mascetti, Victoria L; Pedersen, Roger A; Talasila, Amarnath; Sinha, Sanjay

    2015-04-15

    The epicardium has emerged as a multipotent cardiovascular progenitor source with therapeutic potential for coronary smooth muscle cell, cardiac fibroblast (CF) and cardiomyocyte regeneration, owing to its fundamental role in heart development and its potential ability to initiate myocardial repair in injured adult tissues. Here, we describe a chemically defined method for generating epicardium and epicardium-derived smooth muscle cells (EPI-SMCs) and CFs from human pluripotent stem cells (HPSCs) through an intermediate lateral plate mesoderm (LM) stage. HPSCs were initially differentiated to LM in the presence of FGF2 and high levels of BMP4. The LM was robustly differentiated to an epicardial lineage by activation of WNT, BMP and retinoic acid signalling pathways. HPSC-derived epicardium displayed enhanced expression of epithelial- and epicardium-specific markers, exhibited morphological features comparable with human foetal epicardial explants and engrafted in the subepicardial space in vivo. The in vitro-derived epicardial cells underwent an epithelial-to-mesenchymal transition when treated with PDGF-BB and TGFβ1, resulting in vascular SMCs that displayed contractile ability in response to vasoconstrictors. Furthermore, the EPI-SMCs displayed low density lipoprotein uptake and effective lowering of lipoprotein levels upon treatment with statins, similar to primary human coronary artery SMCs. Cumulatively, these findings suggest that HPSC-derived epicardium and EPI-SMCs could serve as important tools for studying human cardiogenesis, and as a platform for vascular disease modelling and drug screening.

  16. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells

    PubMed Central

    Iyer, Dharini; Gambardella, Laure; Bernard, William G.; Serrano, Felipe; Mascetti, Victoria L.; Pedersen, Roger A.; Talasila, Amarnath; Sinha, Sanjay

    2015-01-01

    The epicardium has emerged as a multipotent cardiovascular progenitor source with therapeutic potential for coronary smooth muscle cell, cardiac fibroblast (CF) and cardiomyocyte regeneration, owing to its fundamental role in heart development and its potential ability to initiate myocardial repair in injured adult tissues. Here, we describe a chemically defined method for generating epicardium and epicardium-derived smooth muscle cells (EPI-SMCs) and CFs from human pluripotent stem cells (HPSCs) through an intermediate lateral plate mesoderm (LM) stage. HPSCs were initially differentiated to LM in the presence of FGF2 and high levels of BMP4. The LM was robustly differentiated to an epicardial lineage by activation of WNT, BMP and retinoic acid signalling pathways. HPSC-derived epicardium displayed enhanced expression of epithelial- and epicardium-specific markers, exhibited morphological features comparable with human foetal epicardial explants and engrafted in the subepicardial space in vivo. The in vitro-derived epicardial cells underwent an epithelial-to-mesenchymal transition when treated with PDGF-BB and TGFβ1, resulting in vascular SMCs that displayed contractile ability in response to vasoconstrictors. Furthermore, the EPI-SMCs displayed low density lipoprotein uptake and effective lowering of lipoprotein levels upon treatment with statins, similar to primary human coronary artery SMCs. Cumulatively, these findings suggest that HPSC-derived epicardium and EPI-SMCs could serve as important tools for studying human cardiogenesis, and as a platform for vascular disease modelling and drug screening. PMID:25813541

  17. Using human induced pluripotent stem cells to model cerebellar disease: hope and hype.

    PubMed

    Wiethoff, Sarah; Arber, Charles; Li, Abi; Wray, Selina; Houlden, Henry; Patani, Rickie

    2015-01-01

    The cerebellum forms a highly ordered and indispensible component of motor function within the adult neuraxis, consisting of several distinct cellular subtypes. Cerebellar disease, through a variety of genetic and acquired causes, results in the loss of function of defined subclasses of neurons, and remains a significant and untreatable health care burden. The scarcity of therapies in this arena can partially be explained by unresolved disease mechanisms due to inaccessibility of human cerebellar neurons in a relevant experimental context where initiating disease mechanisms could be functionally elucidated, or drug screens conducted. In this review we discuss the potential promise of human induced pluripotent stem cells (hiPSCs) for regenerative neurology, with a particular emphasis on in vitro modelling of cerebellar degeneration. We discuss progress made thus far using hiPSC-based models of neurodegeneration, noting the relatively slower pace of discovery made in modelling cerebellar dysfunction. We conclude by speculating how strategies attempting cerebellar differentiation from hiPSCs can be refined to allow the generation of accurate disease models. This in turn will permit a greater understanding of cerebellar pathophysiology to inform mechanistically rationalised therapies, which are desperately needed in this field.

  18. Assessment of functional competence of endothelial cells from human pluripotent stem cells in zebrafish embryos.

    PubMed

    Orlova, Valeria V; Drabsch, Yvette; ten Dijke, Peter; Mummery, Christine L

    2014-01-01

    Human pluripotent stem cells (hPSCs) are proving to be a valuable source of endothelial cells (ECs), pericytes, and vascular smooth muscle cells (vSMCs). Although an increasing number of phenotypic markers are becoming available to determine the phenotypes of these cells in vitro, the ability to integrate and form functional vessels in the host organism, typically mouse, remains critical for the assessment of EC functional competence. However, current mouse models require relatively large numbers of cells that might be difficult to derive simultaneously from multiple hPSCs lines. Therefore, there is an urgent need for new functional assays that are robust and can be performed with small numbers of cells. Here we describe a novel zebrafish xenograft model to test functionality of hPSC-derived ECs. The assay can be performed in 10 days and requires only ~100-400 human cells per embryo. Thus, the zebrafish xenograft model can be useful for the accurate and rapid assessment of functionality of hPSC-derived ECs in a lower vertebrate model that is widely viewed by regulatory authorities as a more acceptable alternative to adult mice.

  19. Cardiomyocytes from human pluripotent stem cells: From laboratory curiosity to industrial biomedical platform.

    PubMed

    Denning, Chris; Borgdorff, Viola; Crutchley, James; Firth, Karl S A; George, Vinoj; Kalra, Spandan; Kondrashov, Alexander; Hoang, Minh Duc; Mosqueira, Diogo; Patel, Asha; Prodanov, Ljupcho; Rajamohan, Divya; Skarnes, William C; Smith, James G W; Young, Lorraine E

    2016-07-01

    Cardiomyocytes from human pluripotent stem cells (hPSCs-CMs) could revolutionise biomedicine. Global burden of heart failure will soon reach USD $90bn, while unexpected cardiotoxicity underlies 28% of drug withdrawals. Advances in hPSC isolation, Cas9/CRISPR genome engineering and hPSC-CM differentiation have improved patient care, progressed drugs to clinic and opened a new era in safety pharmacology. Nevertheless, predictive cardiotoxicity using hPSC-CMs contrasts from failure to almost total success. Since this likely relates to cell immaturity, efforts are underway to use biochemical and biophysical cues to improve many of the ~30 structural and functional properties of hPSC-CMs towards those seen in adult CMs. Other developments needed for widespread hPSC-CM utility include subtype specification, cost reduction of large scale differentiation and elimination of the phenotyping bottleneck. This review will consider these factors in the evolution of hPSC-CM technologies, as well as their integration into high content industrial platforms that assess structure, mitochondrial function, electrophysiology, calcium transients and contractility. This article is part of a Special Issue entitled: Cardiomyocyte Biology: Integration of Developmental and Environmental Cues in the Heart edited by Marcus Schaub and Hughes Abriel.

  20. Functional Neurons Generated from T Cell-Derived Induced Pluripotent Stem Cells for Neurological Disease Modeling

    PubMed Central

    Matsumoto, Takuya; Fujimori, Koki; Andoh-Noda, Tomoko; Ando, Takayuki; Kuzumaki, Naoko; Toyoshima, Manabu; Tada, Hirobumi; Imaizumi, Kent; Ishikawa, Mitsuru; Yamaguchi, Ryo; Isoda, Miho; Zhou, Zhi; Sato, Shigeto; Kobayashi, Tetsuro; Ohtaka, Manami; Nishimura, Ken; Kurosawa, Hiroshi; Yoshikawa, Takeo; Takahashi, Takuya; Nakanishi, Mahito; Ohyama, Manabu; Hattori, Nobutaka; Akamatsu, Wado; Okano, Hideyuki

    2016-01-01

    Summary Modeling of neurological diseases using induced pluripotent stem cells (iPSCs) derived from the somatic cells of patients has provided a means of elucidating pathogenic mechanisms and performing drug screening. T cells are an ideal source of patient-specific iPSCs because they can be easily obtained from samples. Recent studies indicated that iPSCs retain an epigenetic memory relating to their cell of origin that restricts their differentiation potential. The classical method of differentiation via embryoid body formation was not suitable for T cell-derived iPSCs (TiPSCs). We developed a neurosphere-based robust differentiation protocol, which enabled TiPSCs to differentiate into functional neurons, despite differences in global gene expression between TiPSCs and adult human dermal fibroblast-derived iPSCs. Furthermore, neurons derived from TiPSCs generated from a juvenile patient with Parkinson's disease exhibited several Parkinson's disease phenotypes. Therefore, we conclude that TiPSCs are a useful tool for modeling neurological diseases. PMID:26905201

  1. Human-induced pluripotent stem cell-derived cardiomyocytes for studies of cardiac ion transporters

    PubMed Central

    Fine, Michael; Lu, Fang-Min; Lin, Mei-Jung; Moe, Orson; Wang, Hao-Ran

    2013-01-01

    Human-induced pluripotent stem cells (hiPSCs) can differentiate into functional cardiomyocytes (iCell Cardiomyocytes) with ion channel activities that are remarkably similar to adult cardiomyocytes. Here, we extend this characterization to cardiac ion transporters. Additionally, we document facile molecular biological manipulation of iCell Cardiomyocytes to overexpress and knockdown transporters and regulatory proteins. Na/Ca exchange (NCX1) and Na/K pump currents were recorded via patch clamp, and Na/H and Cl/OH exchanges were recorded via oscillating proton-selective microelectrodes during patch clamp. Flux densities of all transport systems are similar to those of nonrodent adult cardiomyocytes. NCX1 protein and NCX1 currents decline after NCX1 small interfering (si)RNA transfection with similar time courses (τ ≈ 2 days), and an NCX1-Halo fusion protein is internalized after its extracellular labeling by AlexaFluor488 Ligand with a similar time course. Loss of the cardiac regulatory protein phospholemman (PLM) occurs over a longer time course (τ ≈ 60 h) after PLM small interfering RNA transfection. Similar to multiple previous reports for adult cardiomyocytes, Na/K pump currents in iCell Cardiomyocytes are not enhanced by activating cAMP production with either maximal or submaximal cytoplasmic Na and using either forskolin or isoproterenol to activate adenylate cyclases. Finally, we describe Ca influx-dependent changes of iCell Cardiomyocyte capacitance (Cm). Large increases of Cm occur during Ca influx via NCX1, thereby documenting large internal membrane reserves that can fuse to the sarcolemma, and subsequent declines of Cm document active endocytic processes. Together, these results document a great potential of iCell Cardiomyocytes for both short- and long-term studies of cardiac ion transporters and their regulation. PMID:23804202

  2. A Stable Chimeric Fibroblast Growth Factor (FGF) Can Successfully Replace Basic FGF in Human Pluripotent Stem Cell Culture

    PubMed Central

    Onuma, Yasuko; Higuchi, Kumiko; Aiki, Yasuhiko; Shu, Yujing; Asada, Masahiro; Asashima, Makoto; Suzuki, Masashi; Imamura, Toru; Ito, Yuzuru

    2015-01-01

    Fibroblast growth factors (FGFs) are essential for maintaining self-renewal in human embryonic stem cells and induced pluripotent stem cells. Recombinant basic FGF (bFGF or FGF2) is conventionally used to culture pluripotent stem cells; however, because of the instability of bFGF, repeated addition of fresh bFGF into the culture medium is required in order to maintain its concentration. In this study, we demonstrate that a heat-stable chimeric variant of FGF, termed FGFC, can be successfully used for maintaining human pluripotent stem cells. FGFC is a chimeric protein composed of human FGF1 and FGF2 domains that exhibits higher thermal stability and protease resistance than do both FGF1 and FGF2. Both human embryonic stem cells and induced pluripotent stem cells were maintained in ordinary culture medium containing FGFC instead of FGF2. Comparison of cells grown in FGFC with those grown in conventional FGF2 media showed no significant differences in terms of the expression of pluripotency markers, global gene expression, karyotype, or differentiation potential in the three germ lineages. We therefore propose that FGFC may be an effective alternative to FGF2, for maintenance of human pluripotent stem cells. PMID:25850016

  3. Deficiency of microRNA miR-34a expands cell fate potential in pluripotent stem cells.

    PubMed

    Choi, Yong Jin; Lin, Chao-Po; Risso, Davide; Chen, Sean; Kim, Thomas Aquinas; Tan, Meng How; Li, Jin Billy; Wu, Yalei; Chen, Caifu; Xuan, Zhenyu; Macfarlan, Todd; Peng, Weiqun; Lloyd, K C Kent; Kim, Sang Yong; Speed, Terence P; He, Lin

    2017-02-10

    Embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) efficiently generate all embryonic cell lineages but rarely generate extraembryonic cell types. We found that microRNA miR-34a deficiency expands the developmental potential of mouse pluripotent stem cells, yielding both embryonic and extraembryonic lineages and strongly inducing MuERV-L (MERVL) endogenous retroviruses, similar to what is seen with features of totipotent two-cell blastomeres. miR-34a restricts the acquisition of expanded cell fate potential in pluripotent stem cells, and it represses MERVL expression through transcriptional regulation, at least in part by targeting the transcription factor Gata2. Our studies reveal a complex molecular network that defines and restricts pluripotent developmental potential in cultured ESCs and iPSCs.

  4. Endogenous Fluorescence Signatures in Living Pluripotent Stem Cells Change with Loss of Potency

    PubMed Central

    Squirrell, Jayne M.; Fong, Jimmy J.; Ariza, Carlos A.; Mael, Amber; Meyer, Kassondra; Shevde, Nirupama K.; Roopra, Avtar; Lyons, Gary E.; Kamp, Timothy J.; Eliceiri, Kevin W.; Ogle, Brenda M.

    2012-01-01

    The therapeutic potential of stem cells is limited by the non-uniformity of their phenotypic state. Thus it would be advantageous to noninvasively monitor stem cell status. Driven by this challenge, we employed multidimensional multiphoton microscopy to quantify changes in endogenous fluorescence occurring with pluripotent stem cell differentiation. We found that global and cellular-scale fluorescence lifetime of human embryonic stem cells (hESC) and murine embryonic stem cells (mESC) consistently decreased with differentiation. Less consistent were trends in endogenous fluorescence intensity with differentiation, suggesting intensity is more readily impacted by nuances of species and scale of analysis. What emerges is a practical and accessible approach to evaluate, and ultimately enrich, living stem cell populations based on changes in metabolism that could be exploited for both research and clinical applications. PMID:22952742

  5. Existence of reserve quiescent stem cells in adults, from amphibians to humans.

    PubMed

    Young, H E

    2004-01-01

    Several theories have been proposed to explain the phenomenon of tissue restoration in amphibians and higher order animals. These theories include dedifferentiation of damaged tissues, transdifferentiation of lineage-committed stem cells, and activation of quiescent stem cells. Young and colleagues demonstrated that connective tissues throughout the body contain multiple populations of quiescent lineage-committed progenitor stem cells and lineage-uncommitted pluripotent stem cells. Subsequent cloning and cell sorting studies identified quiescent lineage-uncommitted pluripotent mesenchymal stem cells, capable of forming any mesodermal cell type, and pluripotent epiblastic-like stem cells, capable of forming any somatic cell type. Based on their studies, they propose at least 11 categories of quiescent reserve stem cells resident within postnatal animals, including humans. These categories are pluripotent epiblastic-like stem cells, pluripotent ectodermal stem cells, pluripotent epidermal stem cells, pluripotent neuronal stem cells, pluripotent neural crest stem cells, pluripotent mesenchymal (mesodermal) stem cells, pluripotent endodermal stem cells, multipotent progenitor stem cells, tripotent progenitor stem cells, bipotent progenitor stem cells, and unipotent progenitor stem cells. Thus, activation of quiescent reserve stem cells, i.e., lineage-committed progenitor stem cells and lineage-uncommitted pluripotent stem cells, resident within the connective tissues could provide for the continual maintenance and repair of the postnatal organism after birth.

  6. Association of expression levels of pluripotency/stem cell markers with the differentiation outcome of Wharton's jelly mesenchymal stem cells into insulin producing cells.

    PubMed

    Kassem, Dina H; Kamal, Mohamed M; El-Kholy, Abd El-Latif G; El-Mesallamy, Hala O

    2016-08-01

    Recently, there has been much attention towards generation of insulin producing cells (IPCs) from stem cells, especially from Wharton's jelly mesenchymal stem cells (WJ-MSCs). However, generation of mature IPCs remains a challenge. Assessment of generation of IPCs was usually done by examining β-cell markers, however, assessment of pluripotency/stem cell markers drew less attention. Therefore, the purpose of this study was to investigate the levels of pluripotency/stem cell markers during differentiation of WJ-MSCs into IPCs and the association of these levels with differentiation outcomes. WJ-MSCs were isolated, characterized then induced to differentiate into IPCs using three different protocols namely A, B and C. Differentiated IPCs were assessed by the expression of pluripotency/stem cell markers, together with β-cell markers using qRT-PCR, and functionally by measuring glucose stimulated insulin secretion. Differentiated cells from protocol A showed lowest expression of pluripotency/stem cell markers and relatively best GSIS. However, protocol B showed concomitant expression of pluripotency/stem cell and β-cell markers with relatively less insulin secretion as compared to protocol A. Protocol C failed to generate glucose-responsive IPCs. In conclusion, sustained expression of pluripotency/stem cell markers could be associated with the incomplete differentiation of WJ-MSCs into IPCs. A novel finding for which further investigations are warranted.

  7. Efficient derivation of microglia-like cells from human pluripotent stem cells

    PubMed Central

    Muffat, Julien; Li, Yun; Yuan, Bingbing; Mitalipova, Maisam; Omer, Attya; Corcoran, Sean; Bakiasi, Grisilda; Tsai, Li-Huei; Aubourg, Patrick; Ransohoff, Richard M.

    2016-01-01

    Microglia, the only lifelong resident immune cells of the central nervous system (CNS), are highly specialized macrophages which have been recognized to play a crucial role in neurodegenerative diseases such as Alzheimer’s, Parkinson’s and Adrenoleukodystrophy (ALD). However, in contrast to other cell types of the human CNS, bona fide microglia have not yet been derived from cultured human pluripotent stem cells. Here we establish a robust and efficient protocol for the rapid production of microglia-like cells from human embryonic stem (ES) and induced pluripotent stem (iPS) cells that uses defined serum-free culture conditions. These in vitro pluripotent stem cell-derived microglia-like cells (termed pMGLs) faithfully recapitulate the expected ontogeny and characteristics of their in vivo counterparts and resemble primary fetal human and mouse microglia. We generated these cells from multiple disease-specific cell lines, and find that pMGLs derived from MeCP2 mutant hES cells are smaller than their isogenic controls. We further describe a culture platform to study integration and live behavior of pMGLs in organotypic 3D-cultures. This modular differentiation system allows the study of microglia in highly defined conditions, as they mature in response to developmentally relevant cues, and provides a framework to study the long-term interactions of microglia residing in a tissue-like environment. PMID:27668937

  8. New Monoclonal Antibodies to Defined Cell Surface Proteins on Human Pluripotent Stem Cells.

    PubMed

    O'Brien, Carmel M; Chy, Hun S; Zhou, Qi; Blumenfeld, Shiri; Lambshead, Jack W; Liu, Xiaodong; Kie, Joshua; Capaldo, Bianca D; Chung, Tung-Liang; Adams, Timothy E; Phan, Tram; Bentley, John D; McKinstry, William J; Oliva, Karen; McMurrick, Paul J; Wang, Yu-Chieh; Rossello, Fernando J; Lindeman, Geoffrey J; Chen, Di; Jarde, Thierry; Clark, Amander T; Abud, Helen E; Visvader, Jane E; Nefzger, Christian M; Polo, Jose M; Loring, Jeanne F; Laslett, Andrew L

    2017-03-01

    The study and application of human pluripotent stem cells (hPSCs) will be enhanced by the availability of well-characterized monoclonal antibodies (mAbs) detecting cell-surface epitopes. Here, we report generation of seven new mAbs that detect cell surface proteins present on live and fixed human ES cells (hESCs) and human iPS cells (hiPSCs), confirming our previous prediction that these proteins were present on the cell surface of hPSCs. The mAbs all show a high correlation with POU5F1 (OCT4) expression and other hPSC surface markers (TRA-160 and SSEA-4) in hPSC cultures and detect rare OCT4 positive cells in differentiated cell cultures. These mAbs are immunoreactive to cell surface protein epitopes on both primed and naive state hPSCs, providing useful research tools to investigate the cellular mechanisms underlying human pluripotency and states of cellular reprogramming. In addition, we report that subsets of the seven new mAbs are also immunoreactive to human bone marrow-derived mesenchymal stem cells (MSCs), normal human breast subsets and both normal and tumorigenic colorectal cell populations. The mAbs reported here should accelerate the investigation of the nature of pluripotency, and enable development of robust cell separation and tracing technologies to enrich or deplete for hPSCs and other human stem and somatic cell types. Stem Cells 2017;35:626-640.

  9. Propagation of human embryonic and induced pluripotent stem cells in an indirect co-culture system

    PubMed Central

    Abraham, Sheena; Sheridan, Steven D.; Laurent, Louise C.; Albert, Kelsey; Stubban, Christopher; Ulitsky, Igor; Miller, Bradley; Loring, Jeanne F.; Rao, Raj R.

    2010-01-01

    We have developed and validated a microporous poly(ethylene terephthalate) membrane-based indirect co-culture system for human pluripotent stem cell (hPSC) propagation, which allows real-time conditioning of the culture medium with human fibroblasts while maintaining the complete separation of the two cell types. The propagation and pluripotent characteristics of a human embryonic stem cell (hESC) line and a human induced pluripotent stem cell (hiPSC) line were studied in prolonged culture in this system. We report that hPSCs cultured on membranes by indirect co-culture with fibroblasts were indistinguishable by multiple criteria from hPSCs cultured directly on a fibroblast feeder layer. Thus this co-culture system is a significant advance in hPSC culture methods, providing a facile stem cell expansion system with continuous medium conditioning while preventing mixing of hPSCs and feeder cells. This membrane culture method will enable testing of novel feeder cells and differentiation studies using co-culture with other cell types, and will simplify stepwise changes in culture conditions for staged differentiation protocols. PMID:20117095

  10. Reprogramming triggers endogenous L1 and Alu retrotransposition in human induced pluripotent stem cells.

    PubMed

    Klawitter, Sabine; Fuchs, Nina V; Upton, Kyle R; Muñoz-Lopez, Martin; Shukla, Ruchi; Wang, Jichang; Garcia-Cañadas, Marta; Lopez-Ruiz, Cesar; Gerhardt, Daniel J; Sebe, Attila; Grabundzija, Ivana; Merkert, Sylvia; Gerdes, Patricia; Pulgarin, J Andres; Bock, Anja; Held, Ulrike; Witthuhn, Anett; Haase, Alexandra; Sarkadi, Balázs; Löwer, Johannes; Wolvetang, Ernst J; Martin, Ulrich; Ivics, Zoltán; Izsvák, Zsuzsanna; Garcia-Perez, Jose L; Faulkner, Geoffrey J; Schumann, Gerald G

    2016-01-08

    Human induced pluripotent stem cells (hiPSCs) are capable of unlimited proliferation and can differentiate in vitro to generate derivatives of the three primary germ layers. Genetic and epigenetic abnormalities have been reported by Wissing and colleagues to occur during hiPSC derivation, including mobilization of engineered LINE-1 (L1) retrotransposons. However, incidence and functional impact of endogenous retrotransposition in hiPSCs are yet to be established. Here we apply retrotransposon capture sequencing to eight hiPSC lines and three human embryonic stem cell (hESC) lines, revealing endogenous L1, Alu and SINE-VNTR-Alu (SVA) mobilization during reprogramming and pluripotent stem cell cultivation. Surprisingly, 4/7 de novo L1 insertions are full length and 6/11 retrotransposition events occurred in protein-coding genes expressed in pluripotent stem cells. We further demonstrate that an intronic L1 insertion in the CADPS2 gene is acquired during hiPSC cultivation and disrupts CADPS2 expression. These experiments elucidate endogenous retrotransposition, and its potential consequences, in hiPSCs and hESCs.

  11. Efficient derivation of microglia-like cells from human pluripotent stem cells.

    PubMed

    Muffat, Julien; Li, Yun; Yuan, Bingbing; Mitalipova, Maisam; Omer, Attya; Corcoran, Sean; Bakiasi, Grisilda; Tsai, Li-Huei; Aubourg, Patrick; Ransohoff, Richard M; Jaenisch, Rudolf

    2016-11-01

    Microglia, the only lifelong resident immune cells of the central nervous system (CNS), are highly specialized macrophages that have been recognized to have a crucial role in neurodegenerative diseases such as Alzheimer's, Parkinson's and adrenoleukodystrophy (ALD). However, in contrast to other cell types of the human CNS, bona fide microglia have not yet been derived from cultured human pluripotent stem cells. Here we establish a robust and efficient protocol for the rapid production of microglia-like cells from human (h) embryonic stem (ES) and induced pluripotent stem (iPS) cells that uses defined serum-free culture conditions. These in vitro pluripotent stem cell-derived microglia-like cells (termed pMGLs) faithfully recapitulate the expected ontogeny and characteristics of their in vivo counterparts, and they resemble primary fetal human and mouse microglia. We generated these cells from multiple disease-specific cell lines and find that pMGLs derived from an hES model of Rett syndrome are smaller than their isogenic controls. We further describe a platform to study the integration and live behavior of pMGLs in organotypic 3D cultures. This modular differentiation system allows for the study of microglia in highly defined conditions as they mature in response to developmentally relevant cues, and it provides a framework in which to study the long-term interactions of microglia residing in a tissue-like environment.

  12. Small Molecule Mesengenic Induction of Human Induced Pluripotent Stem Cells to Generate Mesenchymal Stem/Stromal Cells

    PubMed Central

    Chen, Yen Shun; Ellis, Rebecca L.; Horne, Rachel; Wolvetang, Ernst J.; Fisk, Nicholas M.

    2012-01-01

    The translational potential of mesenchymal stem/stromal cells (MSCs) is limited by their rarity in somatic organs, heterogeneity, and need for harvest by invasive procedures. Induced pluripotent stem cells (iPSCs) could be an advantageous source of MSCs, but attempts to derive MSCs from pluripotent cells have required cumbersome or untranslatable techniques, such as coculture, physical manipulation, sorting, or viral transduction. We devised a single-step method to direct mesengenic differentiation of human embryonic stem cells (ESCs) and iPSCs using a small molecule inhibitor. First, epithelial-like monolayer cells were generated by culturing ESCs/iPSCs in serum-free medium containing the transforming growth factor-β pathway inhibitor SB431542. After 10 days, iPSCs showed upregulation of mesodermal genes (MSX2, NCAM, HOXA2) and downregulation of pluripotency genes (OCT4, LEFTY1/2). Differentiation was then completed by transferring cells into conventional MSC medium. The resultant development of MSC-like morphology was associated with increased expression of genes, reflecting epithelial-to-mesenchymal transition. Both ESC- and iPSC-derived MSCs exhibited a typical MSC immunophenotype, expressed high levels of vimentin and N-cadherin, and lacked expression of pluripotency markers at the protein level. Robust osteogenic and chondrogenic differentiation was induced in vitro in ES-MSCs and iPS-MSCs, whereas adipogenic differentiation was limited, as reported for primitive fetal MSCs and ES-MSCs derived by other methods. We conclude that treatment with SB431542 in two-dimensional cultures followed by culture-induced epithelial-to-mesenchymal transition leads to rapid and uniform MSC conversion of human pluripotent cells without the need for embryoid body formation or feeder cell coculture, providing a robust, clinically applicable, and efficient system for generating MSCs from human iPSCs. PMID:23197756

  13. Comparative gene expression profiling in human-induced pluripotent stem cell--derived cardiocytes and human and cynomolgus heart tissue.

    PubMed

    Puppala, Dinesh; Collis, Leon P; Sun, Sunny Z; Bonato, Vinicius; Chen, Xian; Anson, Blake; Pletcher, Mathew; Fermini, Bernard; Engle, Sandra J

    2013-01-01

    Cardiotoxicity is one of the leading causes of drug attrition. Current in vitro models insufficiently predict cardiotoxicity, and there is a need for alternative physiologically relevant models. Here we describe the gene expression profile of human-induced pluripotent stem cell-derived cardiocytes (iCC) postthaw over a period of 42 days in culture and compare this profile to human fetal and adult as well as adult cynomolgus nonhuman primate (NHP, Macaca fascicularis) heart tissue. Our results indicate that iCC express relevant cardiac markers such as ion channels (SCN5A, KCNJ2, CACNA1C, KCNQ1, and KCNH2), tissue-specific structural markers (MYH6, MYLPF, MYBPC3, DES, TNNT2, and TNNI3), and transcription factors (NKX2.5, GATA4, and GATA6) and lack the expression of stem cell markers (FOXD3, GBX2, NANOG, POU5F1, SOX2, and ZFP42). Furthermore, we performed a functional evaluation of contractility of the iCC and showed functional and pharmacological correlations with myocytes isolated from adult NHP hearts. These results suggest that stem cell-derived cardiocytes may represent a novel in vitro model to study human cardiac toxicity with potential ex vivo and in vivo translation.

  14. Porcine Pluripotent Stem Cells Derived from IVF Embryos Contribute to Chimeric Development In Vivo.

    PubMed

    Xue, Binghua; Li, Yan; He, Yilong; Wei, Renyue; Sun, Ruizhen; Yin, Zhi; Bou, Gerelchimeg; Liu, Zhonghua

    2016-01-01

    Although the pig is considered an important model of human disease and an ideal animal for the preclinical testing of cell transplantation, the utility of this model has been hampered by a lack of genuine porcine embryonic stem cells. Here, we derived a porcine pluripotent stem cell (pPSC) line from day 5.5 blastocysts in a newly developed culture system based on MXV medium and a 5% oxygen atmosphere. The pPSCs had been passaged more than 75 times over two years, and the morphology of the colony was similar to that of human embryonic stem cells. Characterization and assessment showed that the pPSCs were alkaline phosphatase (AKP) positive, possessed normal karyotypes and expressed classic pluripotent markers, including OCT4, SOX2 and NANOG. In vitro differentiation through embryonic body formation and in vivo differentiation via teratoma formation in nude mice demonstrated that the pPSCs could differentiate into cells of the three germ layers. The pPSCs transfected with fuw-DsRed (pPSC-FDs) could be passaged with a stable expression of both DsRed and pluripotent markers. Notably, when pPSC-FDs were used as donor cells for somatic nuclear transfer, 11.52% of the reconstructed embryos developed into blastocysts, which was not significantly different from that of the reconstructed embryos derived from porcine embryonic fibroblasts. When pPSC-FDs were injected into day 4.5 blastocysts, they became involved in the in vitro embryonic development and contributed to the viscera of foetuses at day 50 of pregnancy as well as the developed placenta after the chimeric blastocysts were transferred into recipients. These findings indicated that the pPSCs were porcine pluripotent cells; that this would be a useful cell line for porcine genetic engineering and a valuable cell line for clarifying the molecular mechanism of pluripotency regulation in pigs.

  15. Microarray analysis of embryo-derived bovine pluripotent cells: The vulnerable state of bovine embryonic stem cells

    PubMed Central

    Kim, Daehwan; Jung, Yeon-Gil

    2017-01-01

    Although there are many studies about pluripotent stem cells, little is known about pluripotent pathways and the difficulties of maintaining the pluripotency of bovine cells in vitro. Here, we investigated differently expressed genes (DEG) in bovine embryo-derived stem-like cells (eSLCs) from various origins to validate their distinct characteristics of pluripotency and differentiation. We identified core pluripotency markers and additional markers which were not determined as pluripotency markers yet in bovine eSLCs. Using the KEGG database, TGFβ, WNT, and LIF signaling were related to the maintenance of pluripotency. In contrast, some DEGs related to the LIF pathway were down-regulated, suggesting that reactivation of the pathway may be required for the establishment of true bovine embryonic stem cells (ESCs). Interestingly, oncogenes were co-down-regulated, while tumor suppressor genes were co-up-regulated in eSLCs, implying that this pattern may induce abnormal teratomas. These data analyses of signaling pathways provide essential information on authentic ESCs in addition to providing evidence for pluripotency in bovine eSLCs. PMID:28257460

  16. Gata6 potently initiates reprograming of pluripotent and differentiated cells to extraembryonic endoderm stem cells

    PubMed Central

    Wamaitha, Sissy E.; del Valle, Ignacio; Cho, Lily T.Y.; Wei, Yingying; Fogarty, Norah M.E.; Blakeley, Paul; Sherwood, Richard I.; Ji, Hongkai; Niakan, Kathy K.

    2015-01-01

    Transcription factor-mediated reprograming is a powerful method to study cell fate changes. In this study, we demonstrate that the transcription factor Gata6 can initiate reprograming of multiple cell types to induced extraembryonic endoderm stem (iXEN) cells. Intriguingly, Gata6 is sufficient to drive iXEN cells from mouse pluripotent cells and differentiated neural cells. Furthermore, GATA6 induction in human embryonic stem (hES) cells also down-regulates pluripotency gene expression and up-regulates extraembryonic endoderm (ExEn) genes, revealing a conserved function in mediating this cell fate switch. Profiling transcriptional changes following Gata6 induction in mES cells reveals step-wise pluripotency factor disengagement, with initial repression of Nanog and Esrrb, then Sox2, and finally Oct4, alongside step-wise activation of ExEn genes. Chromatin immunoprecipitation and subsequent high-throughput sequencing analysis shows Gata6 enrichment near pluripotency and endoderm genes, suggesting that Gata6 functions as both a direct repressor and activator. Together, this demonstrates that Gata6 is a versatile and potent reprograming factor that can act alone to drive a cell fate switch from diverse cell types. PMID:26109048

  17. X-inactivation and X-reactivation: epigenetic hallmarks of mammalian reproduction and pluripotent stem cells.

    PubMed

    Payer, Bernhard; Lee, Jeannie T; Namekawa, Satoshi H

    2011-08-01

    X-chromosome inactivation is an epigenetic hallmark of mammalian development. Chromosome-wide regulation of the X-chromosome is essential in embryonic and germ cell development. In the male germline, the X-chromosome goes through meiotic sex chromosome inactivation, and the chromosome-wide silencing is maintained from meiosis into spermatids before the transmission to female embryos. In early female mouse embryos, X-inactivation is imprinted to occur on the paternal X-chromosome, representing the epigenetic programs acquired in both parental germlines. Recent advances revealed that the inactive X-chromosome in both females and males can be dissected into two elements: repeat elements versus unique coding genes. The inactive paternal X in female preimplantation embryos is reactivated in the inner cell mass of blastocysts in order to subsequently allow the random form of X-inactivation in the female embryo, by which both Xs have an equal chance of being inactivated. X-chromosome reactivation is regulated by pluripotency factors and also occurs in early female germ cells and in pluripotent stem cells, where X-reactivation is a stringent marker of naive ground state pluripotency. Here we summarize recent progress in the study of X-inactivation and X-reactivation during mammalian reproduction and development as well as in pluripotent stem cells.

  18. Modelling and treating amyotrophic lateral sclerosis through induced-pluripotent stem cells technology.

    PubMed

    Bohl, Delphine; Pochet, Roland; Mitrecic, Dinko; Nicaise, Charles

    2016-01-01

    Amyotrophic lateral sclerosis (ALS) is an adult-onset neurodegenerative disease affecting primarily the population of motor neurons, even though a non-cell autonomous component, involving neighbouring non-neuronal cells, is more and more described. Despite 140 years of disease experience, still no efficient treatment exists against ALS. The inability to readily obtain the faulty cell types relevant to ALS has impeded progress in drug discovery for decades. However, the pioneer work of Shinya Yamanaka in 2007 in the stem cell field was a real breakthrough. Recent advances in cell reprogramming now grant access to significant quantities of CNS disease-affected cells. Induced pluripotent stem cells (iPSc) have been recently derived from patients carrying mutations linked to familial forms of ALS as well as from sporadic patients. Precise and mature protocols allow now their differentiation into ALS-relevant cell subtypes; sustainable and renewable sources of human motor neurons or glia are being available for ALS disease modelling, drug screening or for the development of cell therapies. In few years, the proof-of-concept was made that ALS disease-related phenotypes can be reproduced with iPSc and despite some remaining challenges, we are now not so far to provide platforms for the investigation of ALS therapeutics. This paper also reviews the pioneering studies regarding the applicability of iPSc technology in ALS animal models. From modest slowing down of ALS progression to no severe adverse effects, iPSc-based cell therapy resulted in promising premises in ALS preclinical paradigms, although long-term surveys are highly recommended.

  19. Generation of induced pluripotent stem cells from the pig

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The value of stem cells has become increasingly evident in recent years with the advent of genetic engineering tools that allow site-specific modifications to the genome. The use of stem cells to induce modifications has several potential benefits for the livestock industry including improving anim...

  20. Generation and characterization of integration-free induced pluripotent stem cells from patients with autoimmune disease.

    PubMed

    Son, Mi-Young; Lee, Mi-Ok; Jeon, Hyejin; Seol, Binna; Kim, Jung Hwa; Chang, Jae-Suk; Cho, Yee Sook

    2016-05-13

    Autoimmune diseases (AIDs), a heterogeneous group of immune-mediated disorders, are a major and growing health problem. Although AIDs are currently treated primarily with anti-inflammatory and immunosuppressive drugs, the use of stem cell transplantation in patients with AIDs is becoming increasingly common. However, stem cell transplantation therapy has limitations, including a shortage of available stem cells and immune rejection of cells from nonautologous sources. Induced pluripotent stem cell (iPSC) technology, which allows the generation of patient-specific pluripotent stem cells, could offer an alternative source for clinical applications of stem cell therapies in AID patients. We used nonintegrating oriP/EBNA-1-based episomal vectors to reprogram dermal fibroblasts from patients with AIDs such as ankylosing spondylitis (AS), Sjögren's syndrome (SS) and systemic lupus erythematosus (SLE). The pluripotency and multilineage differentiation capacity of each patient-specific iPSC line was validated. The safety of these iPSCs for use in stem cell transplantation is indicated by the fact that all AID-specific iPSCs are integrated transgene free. Finally, all AID-specific iPSCs derived in this study could be differentiated into cells of hematopoietic and mesenchymal lineages in vitro as shown by flow cytometric analysis and induction of terminal differentiation potential. Our results demonstrate the successful generation of integration-free iPSCs from patients with AS, SS and SLE. These findings support the possibility of using iPSC technology in autologous and allogeneic cell replacement therapy for various AIDs, including AS, SS and SLE.

  1. Induced pluripotent stem cells in regenerative medicine: an argument for continued research on human embryonic stem cells.

    PubMed

    Lee, Han; Park, Jung; Forget, Bernard G; Gaines, Peter

    2009-09-01

    Human embryonic stem cells (ESCs) can be induced to differentiate into a wide range of tissues that soon could be used for therapeutic applications in regenerative medicine. Despite their developmental potential, sources used to generate human ESC lines raise serious ethical concerns, which recently prompted efforts to reprogram somatic cells back to a pluripotent state. These efforts resulted in the generation of induced pluripotent stem (iPS) cells that are functionally similar to ESCs. However, the genetic manipulations required to generate iPS cells may complicate their growth and developmental characteristics, which poses serious problems in predicting how they will behave when used for tissue-regenerative purposes. In this article we summarize the recently developed methodologies used to generate iPS cells, including those that minimize their genetic manipulation, and discuss several important complicating features of iPS cells that may compromise their future use for therapies in regenerative medicine.

  2. Adult stem cell therapy: dream or reality?

    PubMed

    Moraleda, Jose M; Blanquer, Miguel; Bleda, Patricia; Iniesta, Paqui; Ruiz, Francisco; Bonilla, Sonia; Cabanes, Carmen; Tabares, Lucía; Martinez, Salvador

    2006-12-01

    Adult stem cells may be an invaluable source of plastic cells for tissue regeneration. The bone marrow contains different subpopulations of adult stem cells easily accessible for transplantation. However the therapeutic value of adult stem cell is a question of debate in the scientific community. We have investigated the potential benefits of adult hematopoietic stem cell transplantation in animal models of demyelinating and motor neuron diseases. Our results suggest that transplantation of HSC have direct and indirect neuroregenerative and neuroprotective effects.

  3. From Genomics to Gene Therapy: Induced Pluripotent Stem Cells Meet Genome Editing.

    PubMed

    Hotta, Akitsu; Yamanaka, Shinya

    2015-01-01

    The advent of induced pluripotent stem (iPS) cells has opened up numerous avenues of opportunity for cell therapy, including the initiation in September 2014 of the first human clinical trial to treat dry age-related macular degeneration. In parallel, advances in genome-editing technologies by site-specific nucleases have dramatically improved our ability to edit endogenous genomic sequences at targeted sites of interest. In fact, clinical trials have already begun to implement this technology to control HIV infection. Genome editing in iPS cells is a powerful tool and enables researchers to investigate the intricacies of the human genome in a dish. In the near future, the groundwork laid by such an approach may expand the possibilities of gene therapy for treating congenital disorders. In this review, we summarize the exciting progress being made in the utilization of genomic editing technologies in pluripotent stem cells and discuss remaining challenges toward gene therapy applications.

  4. Optimizing neuronal differentiation from induced pluripotent stem cells to model ASD

    PubMed Central

    Kim, Dae-Sung; Ross, P. Joel; Zaslavsky, Kirill; Ellis, James

    2014-01-01

    Autism spectrum disorder (ASD) is an early-onset neurodevelopmental disorder characterized by deficits in social communication, and restricted and repetitive patterns of behavior. Despite its high prevalence, discovery of pathophysiological mechanisms underlying ASD has lagged due to a lack of appropriate model systems. Recent advances in induced pluripotent stem cell (iPSC) technology and neural differentiation techniques allow for detailed functional analyses of neurons generated from living individuals with ASD. Refinement of cortical neuron differentiation methods from iPSCs will enable mechanistic studies of specific neuronal subpopulations that may be preferentially impaired in ASD. In this review, we summarize recent accomplishments in differentiation of cortical neurons from human pluripotent stems cells and efforts to establish in vitro model systems to study ASD using personalized neurons. PMID:24782713

  5. Directed differentiation of induced pluripotent stem cells into chondrogenic lineages for articular cartilage treatment

    PubMed Central

    Lach, Michał; Richter, Magdalena; Pawlicz, Jarosław; Suchorska, Wiktoria M

    2014-01-01

    In recent years, increases in the number of articular cartilage injuries caused by environmental factors or pathological conditions have led to a notable rise in the incidence of premature osteoarthritis. Osteoarthritis, considered a disease of civilization, is the leading cause of disability. At present, standard methods for treating damaged articular cartilage, including autologous chondrocyte implantation or microfracture, are short-term solutions with important side effects. Emerging treatments include the use of induced pluripotent stem cells, a technique that could provide a new tool for treatment of joint damage. However, research in this area is still early, and no optimal protocol for transforming induced pluripotent stem cells into chondrocytes has yet been established. Developments in our understanding of cartilage developmental biology, together with the use of modern technologies in the field of tissue engineering, provide an opportunity to create a complete functional model of articular cartilage. PMID:25383175

  6. Genome damage in induced pluripotent stem cells: assessing the mechanisms and their consequences.

    PubMed

    Hussein, Samer M I; Elbaz, Judith; Nagy, Andras A

    2013-03-01

    In 2006, Shinya Yamanaka and colleagues discovered how to reprogram terminally differentiated somatic cells to a pluripotent stem cell state. The resulting induced pluripotent stem cells (iPSCs) made a paradigm shift in the field, further nailing down the disproval of the long-held dogma that differentiation is unidirectional. The prospect of using iPSCs for patient-specific cell-based therapies has been enticing. This promise, however, has been questioned in the last two years as several studies demonstrated intrinsic epigenetic and genomic anomalies in these cells. Here, we not only review the recent critical studies addressing the genome integrity during the reprogramming process, but speculate about the underlying mechanisms that could create de novo genome damage in iPSCs. Finally, we discuss how much an elevated mutation load really matters considering the safety of future therapies with cells heavily cultured in vitro.

  7. Differentiation of murine embryonic stem and induced pluripotent stem cells to renal lineage in vitro

    SciTech Connect

    Morizane, Ryuji; Monkawa, Toshiaki; Itoh, Hiroshi

    2009-12-25

    Embryonic stem (ES) cells which have the unlimited proliferative capacity and extensive differentiation potency can be an attractive source for kidney regeneration therapies. Recent breakthroughs in the generation of induced pluripotent stem (iPS) cells have provided with another potential source for the artificially-generated kidney. The purpose of this study is to know how to differentiate mouse ES and iPS cells into renal lineage. We used iPS cells from mouse fibroblasts by transfection of four transcription factors, namely Oct4, Sox2, c-Myc and Klf4. Real-time PCR showed that renal lineage markers were expressed in both ES and iPS cells after the induction of differentiation. It also showed that a tubular specific marker, KSP progressively increased to day 18, although the differentiation of iPS cells was slower than ES cells. The results indicated that renal lineage cells can be differentiated from both murine ES and iPS cells. Several inducing factors were tested whether they influenced on cell differentiation. In ES cells, both of GDNF and BMP7 enhanced the differentiation to metanephric mesenchyme, and Activin enhanced the differentiation of ES cells to tubular cells. Activin also enhanced the differentiation of iPS cells to tubular cells, although the enhancement was lower than in ES cells. ES and iPS cells have a potential to differentiate to renal lineage cells, and they will be an attractive resource of kidney regeneration therapy. This differentiation is enhanced by Activin in both ES and iPS cells.

  8. Combinatorial development of biomaterials for clonal growth of human pluripotent stem cells

    NASA Astrophysics Data System (ADS)

    Mei, Ying; Saha, Krishanu; Bogatyrev, Said R.; Yang, Jing; Hook, Andrew L.; Kalcioglu, Z. Ilke; Cho, Seung-Woo; Mitalipova, Maisam; Pyzocha, Neena; Rojas, Fredrick; van Vliet, Krystyn J.; Davies, Martyn C.; Alexander, Morgan R.; Langer, Robert; Jaenisch, Rudolf; Anderson, Daniel G.

    2010-09-01

    Both human embryonic stem cells and induced pluripotent stem cells can self-renew indefinitely in culture; however, present methods to clonally grow them are inefficient and poorly defined for genetic manipulation and therapeutic purposes. Here we develop the first chemically defined, xeno-free, feeder-free synthetic substrates to support robust self-renewal of fully dissociated human embryonic stem and induced pluripotent stem cells. Material properties including wettability, surface topography, surface chemistry and indentation elastic modulus of all polymeric substrates were quantified using high-throughput methods to develop structure-function relationships between material properties and biological performance. These analyses show that optimal human embryonic stem cell substrates are generated from monomers with high acrylate content, have a moderate wettability and employ integrin αvβ3 and αvβ5 engagement with adsorbed vitronectin to promote colony formation. The structure-function methodology employed herein provides a general framework for the combinatorial development of synthetic substrates for stem cell culture.

  9. Discovery of a Novel Polymer for Human Pluripotent Stem Cell Expansion and Multilineage Differentiation.

    PubMed

    Celiz, Adam D; Smith, James G W; Patel, Asha K; Hook, Andrew L; Rajamohan, Divya; George, Vinoj T; Flatt, Luke; Patel, Minal J; Epa, Vidana C; Singh, Taranjit; Langer, Robert; Anderson, Daniel G; Allen, Nicholas D; Hay, David C; Winkler, David A; Barrett, David A; Davies, Martyn C; Young, Lorraine E; Denning, Chris; Alexander, Morgan R

    2015-07-15

    A scalable and cost-effective synthetic polymer substrate that supports robust expansion and subsequent multilineage differentiation of human pluripotent stem cells (hPSCs) with defined commercial media is presented. This substrate can be applied to common cultureware and used off-the-shelf after long-term storage. Expansion and differentiation of hPSCs are performed entirely on the polymeric surface, enabling the clinical potential of hPSC-derived cells to be realized.

  10. Molecular analyses of neurogenic defects in a human pluripotent stem cell model of fragile X syndrome.

    PubMed

    Boland, Michael J; Nazor, Kristopher L; Tran, Ha T; Szücs, Attila; Lynch, Candace L; Paredes, Ryder; Tassone, Flora; Sanna, Pietro Paolo; Hagerman, Randi J; Loring, Jeanne F

    2017-03-01

    New research suggests that common pathways are altered in many neurodevelopmental disorders including autism spectrum disorder; however, little is known about early molecular events that contribute to the pathology of these diseases. The study of monogenic, neurodevelopmental disorders with a high incidence of autistic behaviours, such as fragile X syndrome, has the potential to identify genes and pathways that are dysregulated in autism spectrum disorder as well as fragile X syndrome. In vitro generation of human disease-relevant cell types provides the ability to investigate aspects of disease that are impossible to study in patients or animal models. Differentiation of human pluripotent stem cells recapitulates development of the neocortex, an area affected in both fragile X syndrome and autism spectrum disorder. We have generated induced human pluripotent stem cells from several individuals clinically diagnosed with fragile X syndrome and autism spectrum disorder. When differentiated to dorsal forebrain cell fates, our fragile X syndrome human pluripotent stem cell lines exhibited reproducible aberrant neurogenic phenotypes. Using global gene expression and DNA methylation profiling, we have analysed the early stages of neurogenesis in fragile X syndrome human pluripotent stem cells. We discovered aberrant DNA methylation patterns at specific genomic regions in fragile X syndrome cells, and identified dysregulated gene- and network-level correlates of fragile X syndrome that are associated with developmental signalling, cell migration, and neuronal maturation. Integration of our gene expression and epigenetic analysis identified altered epigenetic-mediated transcriptional regulation of a distinct set of genes in fragile X syndrome. These fragile X syndrome-aberrant networks are significantly enriched for genes associated with autism spectrum disorder, giving support to the idea that underlying similarities exist among these neurodevelopmental diseases.

  11. Generation and Characterization of Induced Pluripotent Stem Cells from Patients with mtDNA Mutations.

    PubMed

    Hämäläinen, Riikka H; Suomalainen, Anu

    2016-01-01

    Generation of induced pluripotent stem cells from patient cells has revolutionized disease modeling in recent years. One research area, where disease models have previously been scarce, is disorders with mutations in mitochondrial DNA. These are a common cause for human disease and often cause very tissue specific phenotypes with vast clinical heterogeneity. iPS technology has now opened up new possibilities for mechanistic studies of these diseases.

  12. Advances in Induced Pluripotent Stem Cells, Genomics, Biomarkers, and Antiplatelet Therapy

    PubMed Central

    Barbato, Emanuele; Lara-Pezzi, Enrique; Stolen, Craig; Taylor, Angela; Barton, Paul J.; Bartunek, Jozef; Iaizzo, Paul; Judge, Daniel P.; Kirshenbaum, Lorrie; Blaxall, Burns C.; Terzic, Andre; Hall, Jennifer L.

    2014-01-01

    The Journal provides the clinician and scientist with the latest advances in discovery research, emerging technologies, pre-clinical research design and testing, and clinical trials. We highlight advances in areas of induced pluripotent stem cells, genomics, biomarkers, multi-modality imaging and antiplatelet biology and therapy. The top publications are critically discussed and presented along with anatomical reviews and FDA insight to provide context. PMID:24659088

  13. Induced pluripotent stem cells: An unlimited source of organs for transplantation.

    PubMed

    De Vos, J; Assou, S

    2016-12-07

    Organ production outside the human body could address the shortage of organs for transplantation. However, in vitro organ production is still a faraway perspective, particularly because of the difficulty in establishing an effective vascularization. A new emerging technology proposes to use carrier animals for the development of human organs. In this approach, induced pluripotent stem cells (iPSC) are injected in animal embryos to produce chimeric animals that contain autologous human organs.

  14. Blood Derived Induced Pluripotent Stem Cells (iPSCs): Benefits, Challenges and the Road Ahead

    PubMed Central

    El Hokayem, Jimmy; Dykxhoorn, Derek M

    2016-01-01

    Since the creation of induced Pluripotent Stem Cells (iPSCs) ten years ago, hundreds of publications have demonstrated their considerable impact on disease modeling and therapy. In this commentary, we will summarize key milestones, benefits and challenges in the iPSC field. Furthermore, we will highlight blood as an effective and easily accessible source for patient-specific iPSCs derivation in the context of work done in our laboratory and others. PMID:27882265

  15. Induced pluripotent stem cells (iPSCs) and neurological disease modeling: progress and promises

    PubMed Central

    Marchetto, Maria C.; Brennand, Kristen J.; Boyer, Leah F.; Gage, Fred H.

    2011-01-01

    The systematic generation of neurons from patients with neurological disorders can provide important insights into disease pathology, progression and mechanism. This review will discuss recent progress in modeling neurodegenerative and neurodevelopmental diseases using induced pluripotent stem cells (iPSCs) and highlight some of the current challenges in the field. Combined with other technologies previously used to study brain disease, iPSC modeling has the promise to influence modern medicine on several fronts: early diagnosis, drug development and effective treatment. PMID:21828073

  16. Evaluating Cell Processes, Quality, and Biomarkers in Pluripotent Stem Cells Using Video Bioinformatics

    PubMed Central

    Lin, Sabrina C.; Bays, Brett C.; Omaiye, Esther; Bhanu, Bir; Talbot, Prue

    2016-01-01

    There is a foundational need for quality control tools in stem cell laboratories engaged in basic research, regenerative therapies, and toxicological studies. These tools require automated methods for evaluating cell processes and quality during in vitro passaging, expansion, maintenance, and differentiation. In this paper, an unbiased, automated high-content profiling toolkit, StemCellQC, is presented that non-invasively extracts information on cell quality and cellular processes from time-lapse phase-contrast videos. Twenty four (24) morphological and dynamic features were analyzed in healthy, unhealthy, and dying human embryonic stem cell (hESC) colonies to identify those features that were affected in each group. Multiple features differed in the healthy versus unhealthy/dying groups, and these features were linked to growth, motility, and death. Biomarkers were discovered that predicted cell processes before they were detectable by manual observation. StemCellQC distinguished healthy and unhealthy/dying hESC colonies with 96% accuracy by non-invasively measuring and tracking dynamic and morphological features over 48 hours. Changes in cellular processes can be monitored by StemCellQC and predictions can be made about the quality of pluripotent stem cell colonies. This toolkit reduced the time and resources required to track multiple pluripotent stem cell colonies and eliminated handling errors and false classifications due to human bias. StemCellQC provided both user-specified and classifier-determined analysis in cases where the affected features are not intuitive or anticipated. Video analysis algorithms allowed assessment of biological phenomena using automatic detection analysis, which can aid facilities where maintaining stem cell quality and/or monitoring changes in cellular processes are essential. In the future StemCellQC can be expanded to include other features, cell types, treatments, and differentiating cells. PMID:26848582

  17. Myocardial commitment from human pluripotent stem cells: Rapid production of human heart grafts.

    PubMed

    Garreta, Elena; de Oñate, Lorena; Fernández-Santos, M Eugenia; Oria, Roger; Tarantino, Carolina; Climent, Andreu M; Marco, Andrés; Samitier, Mireia; Martínez, Elena; Valls-Margarit, Maria; Matesanz, Rafael; Taylor, Doris A; Fernández-Avilés, Francisco; Izpisua Belmonte, Juan Carlos; Montserrat, Nuria

    2016-08-01

    Genome editing on human pluripotent stem cells (hPSCs) together with the development of protocols for organ decellularization opens the door to the generation of autologous bioartificial hearts. Here we sought to generate for the first time a fluorescent reporter human embryonic stem cell (hESC) line by means of Transcription activator-like effector nucleases (TALENs) to efficiently produce cardiomyocyte-like cells (CLCs) from hPSCs and repopulate decellularized human heart ventricles for heart engineering. In our hands, targeting myosin heavy chain locus (MYH6) with mCherry fluorescent reporter by TALEN technology in hESCs did not alter major pluripotent-related features, and allowed for the definition of a robust protocol for CLCs production also from human induced pluripotent stem cells (hiPSCs) in 14 days. hPSCs-derived CLCs (hPSCs-CLCs) were next used to recellularize acellular cardiac scaffolds. Electrophysiological responses encountered when hPSCs-CLCs were cultured on ventricular decellularized extracellular matrix (vdECM) correlated with significant increases in the levels of expression of different ion channels determinant for calcium homeostasis and heart contractile function. Overall, the approach described here allows for the rapid generation of human cardiac grafts from hPSCs, in a total of 24 days, providing a suitable platform for cardiac engineering and disease modeling in the human setting.

  18. Direct Differentiation of Human Pluripotent Stem Cells into Haploid Spermatogenic Cells

    PubMed Central

    Easley, Charles A.; Phillips, Bart T.; McGuire, Megan M.; Barringer, Jennifer M.; Valli, Hanna; Hermann, Brian P.; Simerly, Calvin R.; Rajkovic, Aleksander; Miki, Toshio; Orwig, Kyle E.; Schatten, Gerald P.

    2013-01-01

    Summary Human embryonic (hESCs) and induced pluripotent stem cells (hiPSCs) have been shown to differentiate into primordial germ cells (PGCs) but not into spermatogonia nor haploid spermatocytes or spermatids. Here we show that hESCs and hiPSCs differentiate directly into advanced male germ cell lineages including post-meiotic, spermatid-like cells in vitro without genetic manipulation. Furthermore, our procedure mirrors spermatogenesis in vivo by differentiating pluripotent stem cells into UTF1, PLZF and CDH1-positive spermatogonia-like cells, HIWI and HILI-positive spermatocyte-like cells, and haploid cells expressing acrosin, transition protein 1 and protamine 1, proteins found uniquely in either spermatids and/or sperm. These spermatids show uniparental genomic imprints similar to human sperm on two loci: H19 and IGF2. These results demonstrate that male pluripotent stem cells have the capability to directly differentiate into advanced germ cell lineages and may represent a novel strategy for studying spermatogenesis in vitro. PMID:22921399

  19. In vitro pathological modelling using patient-specific induced pluripotent stem cells: the case of progeria.

    PubMed

    Nissan, Xavier; Blondel, Sophie; Peschanski, Marc

    2011-12-01

    Progeria, also known as HGPS (Hutchinson-Gilford progeria syndrome), is a rare fatal genetic disease characterized by an appearance of accelerated aging in children. This syndrome is typically caused by mutations in codon 608 (C1804T) of the gene encoding lamins A and C, LMNA, leading to the production of a truncated form of the protein called progerin. Owing to their unique potential to self-renew and to differentiate into any cell types of the organism, pluripotent stem cells offer a unique tool to study molecular and cellular mechanisms related to this global and systemic disease. Recent studies have exploited this potential by generating human induced pluripotent stem cells from HGPS patients' fibroblasts displaying several phenotypic defects characteristic of HGPS such as nuclear abnormalities, progerin expression, altered DNA-repair mechanisms and premature senescence. Altogether, these findings provide new insights on the use of pluripotent stem cells for pathological modelling and may open original therapeutic perspectives for diseases that lack pre-clinical in vitro human models, such as HGPS.

  20. [Establishment of induced pluripotent stem cells from adipose tissue-derived stem cells for dendritic cell-based cancer vaccines].

    PubMed

    Matsushita, Norimasa; Kobayashi, Hajime; Aruga, Atsushi; Yamamoto, Masakazu

    2014-04-01

    Recently, studies on regenerative stem cell therapy are being encouraged, and efforts to generate dendritic cells, which play important roles in cancer immunotherapy, from stem cells are being made in the field of tumor immunology. Therapeutic acquisition of stem cells has important clinical applications. Studies on induced pluripotent stem(iPS)cells generated from somatic cells with pluripotent genes have advanced in recent years. Stem cells are reported to be found in adipose tissue (adipose-derived stem cells, ADSC). Our goal is to develop a new cancer vaccine by using dendritic cells generated from ADSC. In a preliminary study, we examined whether iPS cells can be generated from ADSC to serve as a source of dendritic cells.We introduced a plasmid with pluripotent genes(OCT3/4, KLF4, SOX2, L-MYC, LIN28, p53-shRNA)into an ADSC strain derived from adipose tissue by electroporation and subsequently cultured the cells for further examination. A colony sugges- tive of iPS cells from ADSC was observed. OCT3/4, KLF4, SOX2, L-MYC, and LIN28 mRNAs were expressed in the cultured cells, as confirmed by reverse transcriptase-polymerase chain reaction(RT-PCR). On the basis of these results, we confirmed that iPS cells were generated from ADSC. The method of inducing dendritic cells from iPS cells has already been reported, and the results of this study suggest that ADSC is a potential source of dendritic cells.

  1. Efficient and Rapid Derivation of Primitive Neural Stem Cells and Generation of Brain Subtype Neurons From Human Pluripotent Stem Cells

    PubMed Central

    Yan, Yiping; Shin, Soojung; Jha, Balendu Shekhar; Liu, Qiuyue; Sheng, Jianting; Li, Fuhai; Zhan, Ming; Davis, Janine; Bharti, Kapil; Zeng, Xianmin; Rao, Mahendra; Malik, Nasir

    2013-01-01

    Human pluripotent stem cells (hPSCs), including human embryonic stem cells and human induced pluripotent stem cells, are unique cell sources for disease modeling, drug discovery screens, and cell therapy applications. The first step in producing neural lineages from hPSCs is the generation of neural stem cells (NSCs). Current methods of NSC derivation involve the time-consuming, labor-intensive steps of an embryoid body generation or coculture with stromal cell lines that result in low-efficiency derivation of NSCs. In this study, we report a highly efficient serum-free pluripotent stem cell neural induction medium that can induce hPSCs into primitive NSCs (pNSCs) in 7 days, obviating the need for time-consuming, laborious embryoid body generation or rosette picking. The pNSCs expressed the neural stem cell markers Pax6, Sox1, Sox2, and Nestin; were negative for Oct4; could be expanded for multiple passages; and could be differentiated into neurons, astrocytes, and oligodendrocytes, in addition to the brain region-specific neuronal subtypes GABAergic, dopaminergic, and motor neurons. Global gene expression of the transcripts of pNSCs was comparable to that of rosette-derived and human fetal-derived NSCs. This work demonstrates an efficient method to generate expandable pNSCs, which can be further differentiated into central nervous system neurons and glia with temporal, spatial, and positional cues of brain regional heterogeneity. This method of pNSC derivation sets the stage for the scalable production of clinically relevant neural cells for cell therapy applications in good manufacturing practice conditions. PMID:24113065

  2. Leukemia inhibitory factor (LIF)-dependent, pluripotent stem cells established from inner cell mass of porcine embryos.

    PubMed

    Telugu, Bhanu Prakash V L; Ezashi, Toshihiko; Sinha, Sunilima; Alexenko, Andrei P; Spate, Lee; Prather, Randall S; Roberts, R Michael

    2011-08-19

    The pig is important for agriculture and as an animal model in human and veterinary medicine, yet despite over 20 years of effort, there has been a failure to generate pluripotent stem cells analogous to those derived from mouse embryos. Here we report the production of leukemia inhibitory factor-dependent, so-called naive type, pluripotent stem cells from the inner cell mass of porcine blastocysts by up-regulating expression of KLF4 and POU5F1. The alkaline phosphatase-positive colonies resulting from reprogramming resemble mouse embryonic stem cells in colony morphology, cell cycle interval, transcriptome profile, and expression of pluripotent markers, such as POU5F1, SOX2, and surface marker SSEA1. They are dependent on leukemia inhibitory factor signaling for maintenance of pluripotency, can be cultured over extended passage, and have the ability to form teratomas. These cells derived from the inner cell mass of pig blastocysts are clearly distinct from the FGF2-dependent "primed" induced pluripotent stem cells described recently from porcine mesenchymal cells. The data are consistent with the hypothesis that the up-regulation of KLF4, as well as POU5F1, is required to create and stabilize the naive pluripotent state and may explain why the derivation of embryonic stem cells from pigs and other ungulates has proved so difficult.

  3. Maturation-Based Model of Arrhythmogenic Right Ventricular Dysplasia Using Patient-Specific Induced Pluripotent Stem Cells.

    PubMed

    Wen, Jian-Yan; Wei, Chuan-Yu; Shah, Khooshbu; Wong, Johnson; Wang, Cheng; Chen, Huei-Sheng Vincent

    2015-01-01

    Cellular reprogramming of somatic cells to patient-specific induced pluripotent stem cells (iPSCs) enables in-vitro modeling of human cardiac disorders for pathogenic and therapeutic investigations. However, using iPSC-derived cardiomyocytes (iPSC-CMs) to model an adult-onset heart disease remains challenging because of the uncertainty regarding the ability of relatively immature iPSC-CMs to fully recapitulate adult disease phenotypes. Arrhythmogenic right ventricular dysplasia (ARVD) is an inherited cardiomyopathy characterized by pathological fibrofatty infiltration and cardiomyocyte (CM) loss predominantly in the right ventricle (RV), leading to heart failure and lethal arrhythmias. Over 50% of affected individuals have desmosome gene mutations, most commonly inPKP2encoding plakophilin-2. Using Yamanaka's pluripotent factors, we generated iPSC lines from ARVD patients withPKP2mutations. We first developed a method to induce metabolic maturation of iPSC-CMs and showed that induction of adult-like metabolic energetics from an embryonic/glycolytic state is essential to model an adult-onset cardiac disease using patient-specific iPSCs. Furthermore, we showed that coactivation of normal peroxisome proliferator-activated receptor (PPAR)-α and abnormal PPARγ pathways in ARVD iPSC-CMs resulted in exaggerated CM lipogenesis, CM apoptosis, Na(+)channel downregulation and defective intracellular calcium handling, recapitulating the pathological signatures of ARVD. Using this model, we revealed novel pathogenic insights that metabolic derangement in an adult-like metabolic milieu underlies ARVD pathologies, enabling us to propose novel disease-modifying therapeutic strategies.

  4. Direct reprogramming of adult cells: avoiding the pluripotent state.

    PubMed

    Kelaini, Sophia; Cochrane, Amy; Margariti, Andriana

    2014-01-01

    The procedure of using mature, fully differentiated cells and inducing them toward other cell types while bypassing an intermediate pluripotent state is termed direct reprogramming. Avoiding the pluripotent stage during cellular conversions can be achieved either through ectopic expression of lineage-specific factors (transdifferentiation) or a direct reprogramming process that involves partial reprogramming toward the pluripotent stage. Latest advances in the field seek to alleviate concerns that include teratoma formation or retroviral usage when it comes to delivering reprogramming factors to cells. They also seek to improve efficacy and efficiency of cellular conversion, both in vitro and in vivo. The final products of this reprogramming approach could be then directly implemented in regenerative and personalized medicine.

  5. Cancer stem cells, pluripotency, and cellular heterogeneity: a WNTer perspective.

    PubMed

    Atlasi, Yaser; Looijenga, Leendert; Fodde, Riccardo

    2014-01-01

    Cancer stem cells (CSCs) are thought to represent the "beating heart" of malignant growth as they continuously fuel tumors through their ability to self-renew and differentiate. Moreover, they are also believed to underlie malignant behavior, local invasion, and metastasis in distal organ sites upon reversible epithelial-to-mesenchymal transitions (EMTs). Nevertheless, the CSC concept has been the object of controversy, mainly due to the absence of robust operational definitions and to the lack of consistency in the use of the often incorrect nomenclature employed to refer to these cells. Notwithstanding the controversies, it is now generally accepted that primary cancers are organized in hierarchical fashion with neoplastic stem-like cells able to give rise to new CSCs and to more committed malignant cells. Notably, these hierarchical structures are not unidirectional, but are rather characterized by a more dynamic equilibrium where stem-like and more committed cancer cells transit from one meta-state to the other partly because of cues from the microenvironment (niche), but also because of intrinsic and yet incompletely understood characteristics in the activation/silencing of specific signal transduction pathways. Here, we will focus on the Wnt/β-catenin signaling pathway as one of the major regulator of stemness in homeostasis and cancer, and on germ cell tumors as the type of malignancy that most closely mimics normal embryonic development and as such serve as a unique model to study the role of stem cells in neoplasia.

  6. A microparticle approach to morphogen delivery within pluripotent stem cell aggregates

    PubMed Central

    Bratt-Leal, Andrés M.; Nguyen, Anh H.; Hammersmith, Katy A.; Singh, Ankur; McDevitt, Todd C.

    2013-01-01

    Stem cell fate and specification is largely controlled by extrinsic cues that comprise the 3D microenvironment. Biomaterials can serve to control the spatial and temporal presentation of morphogenic molecules in order to direct stem cell fate decisions. Here we describe a microparticle (MP)-based approach to deliver growth factors within multicellular aggregates to direct pluripotent stem cell differentiation. Compared to conventional soluble delivery methods, gelatin MPs laden with BMP4 or noggin induced efficient gene expression of mesoderm and ectoderm lineages, respectively, despite using nearly 12-fold less total growth factor. BMP4-laden MPs increased the percentage of cells expressing GFP under the control of the Brachyury-T promoter as visualized by whole-mount confocal imaging and quantified by flow cytometry. Furthermore, the ability to localize MPs laden with different morphogens within a particular hemisphere of stem cell aggregates allowed for spatial control of differentiation within 3D cultures. Overall, localized delivery of growth factors within multicellular aggregates from microparticle delivery vehicles is an important step towards scalable differentiation technologies and the study of morphogen gradients in pluripotent stem cell differentiation. PMID:23827184

  7. Induction of pluripotency in human umbilical cord mesenchymal stem cells in feeder layer-free condition.

    PubMed

    Daneshvar, Nasibeh; Rasedee, Abdullah; Shamsabadi, Fatemeh Tash; Moeini, Hassan; Mehrboud, Parvaneh; Rahman, Heshu Sulaiman; Boroojerdi, Mohadeseh Hashem; Vellasamy, Shalini

    2015-12-01

    Induced Pluripotent Stem Cells (iPSCs) has been produced by the reprogramming of several types of somatic cells through the expression of different sets of transcription factors. This study consists of a technique to obtain iPSCs from human umbilical cord mesenchymal stem cells (UC-MSCs) in a feeder layer-free process using a mini-circle vector containing defined reprogramming genes, Lin28, Nanog, Oct4 and Sox2. The human MSCs transfected with the minicircle vector were cultured in iPSCs medium. Human embryonic stem cell (ESC)-like colonies with tightly packed domelike structures appeared 7-10 days after the second transfection. In the earliest stages, the colonies were green fluorescence protein (GFP)-positive, while upon continuous culture and passage, genuine hiPSC clones expressing GFP were observed. The induced cells, based on the ectopic expression of the pluripotent markers, exhibited characteristics similar to the embryonic stem cells. These iPSCs demonstrated in vitro capabilities for differentiation into the three main embryonic germ layers by embryoid bodies formation. There was no evidence of transgenes integration into the genome of the iPSCs in this study. In conclusion, this method offers a means of producing iPSCs without viral delivery that could possibly overcome ethical concerns and immune rejection in the use of stem cells in medical applications.

  8. Embryonic stem cells remain highly pluripotent following long term expansion as aggregates in suspension bioreactors.

    PubMed

    zur Nieden, Nicole I; Cormier, Jaymi T; Rancourt, Derrick E; Kallos, Michael S

    2007-05-01

    Increasing attention has been drawn towards pluripotent embryonic stem cells (ESCs) and their potential use as the primary material in various tissue engineering applications. Successful clinical implementation of this technology would require a quality controlled reproducible culture system for the expansion of the cells to be used in the generation of functional tissues. Recently, we showed that suspension bioreactors could be used in the regulated large-scale expansion of highly pluripotent murine ESCs. The current study illustrates that these bioreactor protocols can be adapted for long term culture and that murine ESC cultures remain highly undifferentiated, when serially passaged in suspension bioreactors for extended periods. Flow cytometry analysis and gene expression profiles of several pluripotency markers, in addition to colony and embryoid body (EB) formation tests were conducted at the start and end of the experiment and all showed that the ESC cultures remained highly undifferentiated over extended culture time in suspension. In vivo teratoma formation and in vitro differentiation into neural, cardiomyocyte, osteoblast and chondrocyte lineages, performed at the end of the long term culture, further supported the presence of functional and undifferentiated ESCs in the expanded population. Overall, this system enables the controlled expansion of highly pluripotent murine ESC populations.

  9. C/EBPα poises B cells for rapid reprogramming into induced pluripotent stem cells.

    PubMed

    Di Stefano, Bruno; Sardina, Jose Luis; van Oevelen, Chris; Collombet, Samuel; Kallin, Eric M; Vicent, Guillermo P; Lu, Jun; Thieffry, Denis; Beato, Miguel; Graf, Thomas

    2014-02-13

    CCAAT/enhancer binding protein-α (C/EBPα) induces transdifferentiation of B cells into macrophages at high efficiencies and enhances reprogramming into induced pluripotent stem (iPS) cells when co-expressed with the transcription factors Oct4 (Pou5f1), Sox2, Klf4 and Myc (hereafter called OSKM). However, how C/EBPα accomplishes these effects is unclear. Here we find that in mouse primary B cells transient C/EBPα expression followed by OSKM activation induces a 100-fold increase in iPS cell reprogramming efficiency, involving 95% of the population. During this conversion, pluripotency and epithelial-mesenchymal transition genes become markedly upregulated, and 60% of the cells express Oct4 within 2 days. C/EBPα acts as a 'path-breaker' as it transiently makes the chromatin of pluripotency genes more accessible to DNase I. C/EBPα also induces the expression of the dioxygenase Tet2 and promotes its translocation to the nucleus where it binds to regulatory regions of pluripotency genes that become demethylated after OSKM induction. In line with these findings, overexpression of Tet2 enhances OSKM-induced B-cell reprogramming. Because the enzyme is also required for efficient C/EBPα-induced immune cell conversion, our data indicate that Tet2 provides a mechanistic link between iPS cell reprogramming and B-cell transdifferentiation. The rapid iPS reprogramming approach described here should help to fully elucidate the process and has potential clinical applications.

  10. Scalable topographies to support proliferation and Oct4 expression by human induced pluripotent stem cells

    PubMed Central

    Reimer, Andreas; Vasilevich, Aliaksei; Hulshof, Frits; Viswanathan, Priyalakshmi; van Blitterswijk, Clemens A.; de Boer, Jan; Watt, Fiona M.

    2016-01-01

    It is well established that topographical features modulate cell behaviour, including cell morphology, proliferation and differentiation. To define the effects of topography on human induced pluripotent stem cells (iPSC), we plated cells on a topographical library containing over 1000 different features in medium lacking animal products (xeno-free). Using high content imaging, we determined the effect of each topography on cell proliferation and expression of the pluripotency marker Oct4 24 h after seeding. Features that maintained Oct4 expression also supported proliferation and cell-cell adhesion at 24 h, and by 4 days colonies of Oct4-positive, Sox2-positive cells had formed. Computational analysis revealed that small feature size was the most important determinant of pluripotency, followed by high wave number and high feature density. Using this information we correctly predicted whether any given topography within our library would support the pluripotent state at 24 h. This approach not only facilitates the design of substrates for optimal human iPSC expansion, but also, potentially, identification of topographies with other desirable characteristics, such as promoting differentiation. PMID:26757610

  11. Heightened potency of human pluripotent stem cell lines created by transient BMP4 exposure.

    PubMed

    Yang, Ying; Adachi, Katsuyuki; Sheridan, Megan A; Alexenko, Andrei P; Schust, Danny J; Schulz, Laura C; Ezashi, Toshihiko; Roberts, R Michael

    2015-05-05

    Human pluripotent stem cells (PSCs) show epiblast-type pluripotency that is maintained with ACTIVIN/FGF2 signaling. Here, we report the acquisition of a unique stem cell phenotype by both human ES cells (hESCs) and induced pluripotent stem cells (iPSCs) in response to transient (24-36 h) exposure to bone morphogenetic protein 4 (BMP4) plus inhibitors of ACTIVIN signaling (A83-01) and FGF2 (PD173074), followed by trypsin dissociation and recovery of colonies capable of growing on a gelatin substratum in standard medium for human PSCs at low but not high FGF2 concentrations. The self-renewing cell lines stain weakly for CDX2 and strongly for NANOG, can be propagated clonally on either Matrigel or gelatin, and are morphologically distinct from human PSC progenitors on either substratum but still meet standard in vitro criteria for pluripotency. They form well-differentiated teratomas in immune-compromised mice that secrete human chorionic gonadotropin (hCG) into the host mouse and include small areas of trophoblast-like cells. The cells have a distinct transcriptome profile from the human PSCs from which they were derived (including higher expression of NANOG, LEFTY1, and LEFTY2). In nonconditioned medium lacking FGF2, the colonies spontaneously differentiated along multiple lineages, including trophoblast. They responded to PD173074 in the absence of both FGF2 and BMP4 by conversion to trophoblast, and especially syncytiotrophoblast, whereas an A83-01/PD173074 combination favored increased expression of HLA-G, a marker of extravillous trophoblast. Together, these data suggest that the cell lines exhibit totipotent potential and that BMP4 can prime human PSCs to a self-renewing alternative state permissive for trophoblast development. The results may have implications for regulation of lineage decisions in the early embryo.

  12. Hydrogel microfluidics for the patterning of pluripotent stem cells

    PubMed Central

    Cosson, S.; Lutolf, M. P.

    2014-01-01

    Biomolecular signaling is of utmost importance in governing many biological processes such as the patterning of the developing embryo where biomolecules regulate key cell-fate decisions. In vivo, these factors are presented in a spatiotemporally tightly controlled fashion. Although state-of-the-art microfluidic technologies allow precise biomolecule delivery in time and space, long-term (stem) cell culture at the micro-scale is often far from ideal due to medium evaporation, limited space for cell growth or shear stress. To overcome these challenges, we here introduce a concept based on hydrogel microfluidics for decoupling conventional, macro-scale cell culture from precise biomolecule delivery through a gel layer. We demonstrate the spatiotemporally controlled neuronal commitment of mouse embryonic stem cells via delivery of retinoic acid gradients. This technique should be useful for testing the effect of dose and timing of biomolecules, singly or in combination, on stem cell fate. PMID:24662945

  13. Human pluripotent stem cell differentiation into authentic striatal projection neurons.

    PubMed

    Delli Carri, Alessia; Onorati, Marco; Castiglioni, Valentina; Faedo, Andrea; Camnasio, Stefano; Toselli, Mauro; Biella, Gerardo; Cattaneo, Elena

    2013-08-01

    Here we present the principles and steps of a protocol that we have recently developed for the differentiation of hES/iPS cells into the authentic human striatal projection medium spiny neurons (MSNs) that die in Huntington's Disease (HD). Authenticity is judged by the convergence of multiple features within individual cells. Our procedure lasts 80 days and couples neural induction via BMP/TGF-β inhibition with exposure to the developmental factors sonic hedgehog (SHH) and dickkopf1 (DKK-1) to drive ventral telencephalic specification, followed by terminal differentiation [1]. Authenticity of the resulting neuronal population is monitored by the appearance of FOXG1(+)/GSX2(+) progenitor cells of the lateral ganglionic eminence (LGE) at day 15-25 of differentiation, followed by appearance of CTIP2-, FOXP1- and FOXP2-positive cells at day 45. These precursor cells then mature into MAP2(+)/GABA(+) neurons with 20 % of them ultimately co-expressing the DARPP-32 and CTIP2 diagnostic markers and carrying electrophysiological properties expected for fully functional MSNs.The protocol is characterized by its replicability in at least three human pluripotent cell lines. Altogether this protocol defines a useful platform for in vitro developmental neurobiology studies, drug screening, and regenerative medicine approaches.

  14. Regulation of c-Myc Expression by Ahnak Promotes Induced Pluripotent Stem Cell Generation*

    PubMed Central

    Lim, Hee Jung; Kim, Jusong; Park, Chang-Hwan; Lee, Sang A.; Lee, Man Ryul; Kim, Kye-Seong; Kim, Jaesang; Bae, Yun Soo

    2016-01-01

    We have previously reported that Ahnak-mediated TGFβ signaling leads to down-regulation of c-Myc expression. Here, we show that inhibition of Ahnak can promote generation of induced pluripotent stem cells (iPSC) via up-regulation of endogenous c-Myc. Consistent with the c-Myc inhibitory role of Ahnak, mouse embryonic fibroblasts from Ahnak-deficient mouse (Ahnak−/− MEF) show an increased level of c-Myc expression compared with wild type MEF. Generation of iPSC with just three of the four Yamanaka factors, Oct4, Sox2, and Klf4 (hereafter 3F), was significantly enhanced in Ahnak−/− MEF. Similar results were obtained when Ahnak-specific shRNA was applied to wild type MEF. Of note, expressionof Ahnak was significantly induced during the formation of embryoid bodies from embryonic stem cells, suggesting that Ahnak-mediated c-Myc inhibition is involved in embryoid body formation and the initial differentiation of pluripotent stem cells. The iPSC from 3F-infected Ahnak−/− MEF cells (Ahnak−/−-iPSC-3F) showed expression of all stem cell markers examined and the capability to form three primary germ layers. Moreover, injection of Ahnak−/−-iPSC-3F into athymic nude mice led to development of teratoma containing tissues from all three primary germ layers, indicating that iPSC from Ahnak−/− MEF are bona fide pluripotent stem cells. Taken together, these data provide evidence for a new role for Ahnak in cell fate determination during development and suggest that manipulation of Ahnak and the associated signaling pathway may provide a means to regulate iPSC generation. PMID:26598518

  15. Oct4 and klf4 reprogram dermal papilla cells into induced pluripotent stem cells.

    PubMed

    Tsai, Su-Yi; Clavel, Carlos; Kim, Soo; Ang, Yen-Sin; Grisanti, Laura; Lee, Dung-Fang; Kelley, Kevin; Rendl, Michael

    2010-02-01

    Direct reprogramming of somatic cells into induced pluripotent stem (iPS) cells by only four transcription factors (Oct4, Sox2, Klf4, and c-Myc) has great potential for tissue-specific regenerative therapies, eliminating the ethical issues surrounding the use of embryonic stem cells and the rejection problems of using non-autologous cells. The reprogramming efficiency generally is very low, however, and the problems surrounding the introduction of viral genetic material are only partially investigated. Recent efforts to reduce the number of virally expressed transcription factors succeeded at reprogramming neural stem cells into iPS cells by overexpressing Oct4 alone. However, the relative inaccessibility and difficulty of obtaining neural cells in humans remains to be resolved. Here we report that dermal papilla (DP) cells, which are specialized skin fibroblasts thought to instruct hair follicle stem cells, endogenously express high levels of Sox2 and c-Myc, and that these cells can be reprogrammed into iPS cells with only Oct4 and Klf4. Moreover, we show that DP cells are reprogrammed more efficiently than skin and embryonic fibroblasts. iPS cells derived from DP cells expressed pluripotency genes and differentiated into cells from all germ layers in vitro and widely contributed to chimeric mice in vivo, including the germline. Our work establishes DP cells as an easily accessible source to generate iPS cells with efficiency and with less genetic material. This opens up the possibility of streamlined generation of skin-derived, patient-specific pluripotent stem cells and of ultimately replacing the remaining two factors with small molecules for safe generation of transplantable cells.

  16. Human induced pluripotent stem cell differentiation and direct transdifferentiation into corneal epithelial-like cells

    PubMed Central

    Cieślar-Pobuda, Artur; Rafat, Mehrdad; Knoflach, Viktoria; Skonieczna, Magdalena; Hudecki, Andrzej; Małecki, Andrzej; Urasińska, Elżbieta; Ghavami, Seaid; Łos, Marek J.

    2016-01-01

    The corneal epithelium is maintained by a small pool of tissue stem cells located at the limbus. Through certain injuries or diseases this pool of stem cells may get depleted. This leads to visual impairment. Standard treatment options include autologous or allogeneic limbal stem cell (LSC) transplantation, however graft rejection and chronic inflammation lowers the success rate over long time. Induced pluripotent stem (iPS) cells have opened new possibilities for treating various diseases with patient specific cells, eliminating the risk of immune rejection. In recent years, several protocols have been developed, aimed at the differentiation of iPS cells into the corneal epithelial lineage by mimicking the environmental niche of limbal stem cells. However, the risk of teratoma formation associated with the use of iPS cells hinders most applications from lab into clinics. Here we show that the differentiation of iPS cells into corneal epithelial cells results in the expression of corneal epithelial markers showing a successful differentiation, but the process is long and the level of gene expression for the pluripotency markers does not vanish completely. Therefore we set out to determine a direct transdifferentiation approach to circumvent the intermediate state of pluripotency (iPS-stage). The resulting cells, obtained by direct transdifferentiation of fibroblasts into limbal cells, exhibited corneal epithelial cell morphology and expressed corneal epithelial markers. Hence we shows for the first time a direct transdifferentiation of human dermal fibroblasts into the corneal epithelial lineage that may serve as source for corneal epithelial cells for transplantation approaches. PMID:27275539

  17. Clonal identification and characterization of self-renewing pluripotent stem cells in the developing liver

    PubMed Central

    Suzuki, Atsushi; Zheng, Yun-wen; Kaneko, Shin; Onodera, Masafumi; Fukao, Katashi; Nakauchi, Hiromitsu; Taniguchi, Hideki

    2002-01-01

    Using flow cytometry and single cell–based assays, we prospectively identified hepatic stem cells with multilineage differentiation potential and self-renewing capability. These cells could be clonally propagated in culture where they continuously produced hepatocytes and cholangiocytes as descendants while maintaining primitive stem cells. When cells that expanded in vitro were transplanted into recipient animals, they morphologically and functionally differentiated into hepatocytes and cholangiocytes with reconstitution of hepatocyte and bile duct structures. Furthermore, these cells differentiated into pancreatic ductal and acinar cells or intestinal epithelial cells when transplanted into pancreas or duodenal wall. These data indicate that self-renewing pluripotent stem cells persist in the developing mouse liver and that such cells can be induced to become cells of other organs of endodermal origin under appropriate microenvironment. Manipulation of hepatic stem cells may provide new insight into therapies for diseases of the digestive system. PMID:11781341

  18. Stem cell sources for clinical islet transplantation in type 1 diabetes: embryonic and adult stem cells.

    PubMed

    Miszta-Lane, Helena; Mirbolooki, Mohammadreza; James Shapiro, A M; Lakey, Jonathan R T

    2006-01-01

    Lifelong immunosuppressive therapy and inadequate sources of transplantable islets have led the islet transplantation benefits to less than 0.5% of type 1 diabetics. Whereas the potential risk of infection by animal endogenous viruses limits the uses of islet xeno-transplantation, deriving islets from stem cells seems to be able to overcome the current problems of islet shortages and immune compatibility. Both embryonic (derived from the inner cell mass of blastocysts) and adult stem cells (derived from adult tissues) have shown controversial results in secreting insulin in vitro and normalizing hyperglycemia in vivo. ESCs research is thought to have much greater developmental potential than adult stem cells; however it is still in the basic research phase. Existing ESC lines are not believed to be identical or ideal for generating islets or beta-cells and additional ESC lines have to be established. Research with ESCs derived from humans is controversial because it requires the destruction of a human embryo and/or therapeutic cloning, which some believe is a slippery slope to reproductive cloning. On the other hand, adult stem cells are already in some degree specialized, recipients may receive their own stem cells. They are flexible but they have shown mixed degree of availability. Adult stem cells are not pluripotent. They may not exist for all organs. They are difficult to purify and they cannot be maintained well outside the body. In order to draw the future avenues in this field, existent discrepancies between the results need to be clarified. In this study, we will review the different aspects and challenges of using embryonic or adult stem cells in clinical islet transplantation for the treatment of type 1 diabetes.

  19. Efficient derivation of human cardiac precursors and cardiomyocytes from pluripotent human embryonic stem cells with small molecule induction.

    PubMed

    Parsons, Xuejun H; Teng, Yang D; Parsons, James F; Snyder, Evan Y; Smotrich, David B; Moore, Dennis A

    2011-11-03

    To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic. To overcome these obstacles, we have resolved the elements of a defined culture

  20. Early maturation and distinct tau pathology in induced pluripotent stem cell-derived neurons from patients with MAPT mutations.

    PubMed

    Iovino, Mariangela; Agathou, Sylvia; González-Rueda, Ana; Del Castillo Velasco-Herrera, Martin; Borroni, Barbara; Alberici, Antonella; Lynch, Timothy; O'Dowd, Sean; Geti, Imbisaat; Gaffney, Daniel; Vallier, Ludovic; Paulsen, Ole; Káradóttir, Ragnhildur Thóra; Spillantini, Maria Grazia

    2015-11-01

    Tauopathies, such as Alzheimer's disease, some cases of frontotemporal dementia, corticobasal degeneration and progressive supranuclear palsy, are characterized by aggregates of the microtubule-associated protein tau, which are linked to neuronal death and disease development and can be caused by mutations in the MAPT gene. Six tau isoforms are present in the adult human brain and they differ by the presence of 3(3R) or 4(4R) C-terminal repeats. Only the shortest 3R isoform is present in foetal brain. MAPT mutations found in human disease affect tau binding to microtubules or the 3R:4R isoform ratio by altering exon 10 splicing. We have differentiated neurons from induced pluripotent stem cells derived from fibroblasts of controls and patients with N279K and P301L MAPT mutations. Induced pluripotent stem cell-derived neurons recapitulate developmental tau expression, showing the adult brain tau isoforms after several months in culture. Both N279K and P301L neurons exhibit earlier electrophysiological maturation and altered mitochondrial transport compared to controls. Specifically, the N279K neurons show abnormally premature developmental 4R tau expression, including changes in the 3R:4R isoform ratio and AT100-hyperphosphorylated tau aggregates, while P301L neurons are characterized by contorted processes with varicosity-like structures, some containing both alpha-synuclein and 4R tau. The previously unreported faster maturation of MAPT mutant human neurons, the developmental expression of 4R tau and the morphological alterations may contribute to disease development.

  1. Axolotl Nanog activity in mouse embryonic stem cells demonstrates that ground state pluripotency is conserved from urodele amphibians to mammals

    PubMed Central

    Dixon, James E.; Allegrucci, Cinzia; Redwood, Catherine; Kump, Kevin; Bian, Yuhong; Chatfield, Jodie; Chen, Yi-Hsien; Sottile, Virginie; Voss, S. Randal; Alberio, Ramiro; Johnson, Andrew D.

    2010-01-01

    Cells in the pluripotent ground state can give rise to somatic cells and germ cells, and the acquisition of pluripotency is dependent on the expression of Nanog. Pluripotency is conserved in the primitive ectoderm of embryos from mammals and urodele amphibians, and here we report the isolation of a Nanog ortholog from axolotls (axNanog). axNanog does not contain a tryptophan repeat domain and is expressed as a monomer in the axolotl animal cap. The monomeric form is sufficient to regulate pluripotency in mouse embryonic stem cells, but axNanog dimers are required to rescue LIF-independent self-renewal. Our results show that protein interactions mediated by Nanog dimerization promote proliferation. More importantly, they demonstrate that the mechanisms governing pluripotency are conserved from urodele amphibians to mammals. PMID:20736286

  2. Axolotl Nanog activity in mouse embryonic stem cells demonstrates that ground state pluripotency is conserved from urodele amphibians to mammals.

    PubMed

    Dixon, James E; Allegrucci, Cinzia; Redwood, Catherine; Kump, Kevin; Bian, Yuhong; Chatfield, Jodie; Chen, Yi-Hsien; Sottile, Virginie; Voss, S Randal; Alberio, Ramiro; Johnson, Andrew D

    2010-09-01

    Cells in the pluripotent ground state can give rise to somatic cells and germ cells, and the acquisition of pluripotency is dependent on the expression of Nanog. Pluripotency is conserved in the primitive ectoderm of embryos from mammals and urodele amphibians, and here we report the isolation of a Nanog ortholog from axolotls (axNanog). axNanog does not contain a tryptophan repeat domain and is expressed as a monomer in the axolotl animal cap. The monomeric form is sufficient to regulate pluripotency in mouse embryonic stem cells, but axNanog dimers are required to rescue LIF-independent self-renewal. Our results show that protein interactions mediated by Nanog dimerization promote proliferation. More importantly, they demonstrate that the mechanisms governing pluripotency are conserved from urodele amphibians to mammals.

  3. To clone or not to clone? Induced pluripotent stem cells can be generated in bulk culture.

    PubMed

    Willmann, Charlotte A; Hemeda, Hatim; Pieper, Lisa A; Lenz, Michael; Qin, Jie; Joussen, Sylvia; Sontag, Stephanie; Wanek, Paul; Denecke, Bernd; Schüler, Herdit M; Zenke, Martin; Wagner, Wolfgang

    2013-01-01

    Induced pluripotent stem cells (iPSCs) are usually clonally derived. The selection of fully reprogrammed cells generally involves picking of individual colonies with morphology similar to embryonic stem cells (ESCs). Given that fully reprogrammed cells are highly proliferative and escape from cellular senescence, it is conceivable that they outgrow non-pluripotent and partially reprogrammed cells during culture expansion without the need of clonal selection. In this study, we have reprogrammed human dermal fibroblasts (HDFs) with episomal plasmid vectors. Colony frequency was higher and size was larger when using murine embryonic fibroblasts (MEFs) as stromal support instead of HDFs or human mesenchymal stromal cells (MSCs). We have then compared iPSCs which were either clonally derived by manual selection of a single colony, or derived from bulk-cultures of all initial colonies. After few passages their morphology, expression of pluripotency markers, and gene expression profiles did not reveal any significant differences. Furthermore, clonally-derived and bulk-cultured iPSCs revealed similar in vitro differentiation potential towards the three germ layers. Therefore, manual selection of individual colonies does not appear to be necessary for the generation of iPSCs - this is of relevance for standardization and automation of cell culture procedures.

  4. FAS-Based Cell Depletion Facilitates the Selective Isolation of Mouse Induced Pluripotent Stem Cells

    PubMed Central

    Warlich, Eva; Schambach, Axel; Lock, Dominik; Wedekind, Dirk; Glage, Silke; Eckardt, Dominik; Bosio, Andreas; Knöbel, Sebastian

    2014-01-01

    Cellular reprogramming of somatic cells into induced pluripotent stem cells (iPSC) opens up new avenues for basic research and regenerative medicine. However, the low efficiency of the procedure remains a major limitation. To identify iPSC, many studies to date relied on the activation of pluripotency-associated transcription factors. Such strategies are either retrospective or depend on genetically modified reporter cells. We aimed at identifying naturally occurring surface proteins in a systematic approach, focusing on antibody-targeted markers to enable live-cell identification and selective isolation. We tested 170 antibodies for differential expression between mouse embryonic fibroblasts (MEF) and mouse pluripotent stem cells (PSC). Differentially expressed markers were evaluated for their ability to identify and isolate iPSC in reprogramming cultures. Epithelial cell adhesion molecule (EPCAM) and stage-specific embryonic antigen 1 (SSEA1) were upregulated early during reprogramming and enabled enrichment of OCT4 expressing cells by magnetic cell sorting. Downregulation of somatic marker FAS was equally suitable to enrich OCT4 expressing cells, which has not been described so far. Furthermore, FAS downregulation correlated with viral transgene silencing. Finally, using the marker SSEA-1 we exemplified that magnetic separation enables the establishment of bona fide iPSC and propose strategies to enrich iPSC from a variety of human source tissues. PMID:25029550

  5. Tetraploid Embryonic Stem Cells Maintain Pluripotency and Differentiation Potency into Three Germ Layers.

    PubMed

    Imai, Hiroyuki; Kano, Kiyoshi; Fujii, Wataru; Takasawa, Ken; Wakitani, Shoichi; Hiyama, Masato; Nishino, Koichiro; Kusakabe, Ken Takeshi; Kiso, Yasuo

    2015-01-01

    Polyploid amphibians and fishes occur naturally in nature, while polyploid mammals do not. For example, tetraploid mouse embryos normally develop into blastocysts, but exhibit abnormalities and die soon after implantation. Thus, polyploidization is thought to be harmful during early mammalian development. However, the mechanisms through which polyploidization disrupts development are still poorly understood. In this study, we aimed to elucidate how genome duplication affects early mammalian development. To this end, we established tetraploid embryonic stem cells (TESCs) produced from the inner cell masses of tetraploid blastocysts using electrofusion of two-cell embryos in mice and studied the developmental potential of TESCs. We demonstrated that TESCs possessed essential pluripotency and differentiation potency to form teratomas, which differentiated into the three germ layers, including diploid embryonic stem cells. TESCs also contributed to the inner cell masses in aggregated chimeric blastocysts, despite the observation that tetraploid embryos fail in normal development soon after implantation in mice. In TESCs, stability after several passages, colony morphology, and alkaline phosphatase activity were similar to those of diploid ESCs. TESCs also exhibited sufficient expression and localization of pluripotent markers and retained the normal epigenetic status of relevant reprogramming factors. TESCs proliferated at a slower rate than ESCs, indicating that the difference in genomic dosage was responsible for the different growth rates. Thus, our findings suggested that mouse ESCs maintained intrinsic pluripotency and differentiation potential despite tetraploidization, providing insights into our understanding of developmental elimination in polyploid mammals.

  6. A functionally characterized test set of human induced pluripotent stem cells

    PubMed Central

    Boulting, Gabriella L.; Kiskinis, Evangelos; Croft, Gist F.; Amoroso, Mackenzie W.; Oakley, Derek H.; Wainger, Brian J.; Williams, Damian J.; Kahler, David J.; Yamaki, Mariko; Davidow, Lance; Rodolfa, Christopher T.; Dimos, John T.; Mikkilineni, Shravani; MacDermott, Amy B.; Woolf, Clifford J.; Henderson, Christopher E.; Wichterle, Hynek; Eggan, Kevin

    2011-01-01

    Human embryonic (ESC) and induced pluripotent stem cells (iPSC) present exciting opportunities for studying development and in vitro disease modeling. However, reported variability in iPSC behavior has called their utility into question. We therefore constituted a test set of 16 iPSCs lines from 7 individuals of varying gender and health status, characterized them extensively for pluripotency, and evaluated their ability to terminally differentiate. Using standardized procedures in two independent laboratories, 13 of the iPSC lines gave rise to functional motor neurons with a range of efficiencies similar to ESCs. Although three iPSC lines were resistant to neural differentiation, early neuralization rescued their performance. Therefore, all lines in the test set passed a stringent test of differentiation capacity despite variations in expression of early pluripotency markers, transgenes and karyotype. This novel iPSC/ESC test set is a robust resource for those interested in the basic biology of stem cells and their applications. PMID:21293464

  7. BMP-SMAD signaling: From pluripotent stem cells to cardiovascular commitment.

    PubMed

    Orlova, Valeria V; Chuva de Sousa Lopes, Susana; Valdimarsdottir, Gudrun

    2016-02-01

    Human pluripotent stem cells (hPSCs) can form all somatic cells of the body. They thus offer opportunities for understanding (i) the basic steps of early human development, (ii) the pathophysiology in human degenerative diseases and (iii) approaches to regenerative medicine and drug development. Methods for improving their differentiation to defined mesodermal derivatives in particular will benefit their use in all of these areas but most particularly applications that require cardiac and vascular tissue. However, the molecular mechanisms that regulate mesodermal development in humans are still poorly understood. Gene ablation studies in mice have shown that the signaling pathways activated by the transforming growth factor beta (TGFβ) superfamily, including the bone morphogenetic proteins (BMP), play crucial roles in mesoderm differentiation and patterning the early embryo. Understanding their interplay and interaction with other signaling pathways, how they activate and inhibit transcription factors and epigenetic regulators during self-renewal, maintenance and exit from pluripotency and differentiation could provide vital information for a range of applications. This includes disease modeling when the hPSCs are derived from patients or drug screens for diseases of mesodermal organs. Here, we review the role of the BMP-SMAD signaling pathway in pluripotent stem cells and during mesoderm differentiation with focus on the cells that make up the cardiovascular system.

  8. [Establishment of hemophilia A patient-specific inducible pluripotent stem cells with urine cells].

    PubMed

    Hu, Zhiqing; Hu, Xuyun; Pang, Jialun; Wang, Xiaolin; Lin Peng, Siyuan; Li, Zhuo; Wu, Yong; Wu, Lingqian; Liang, Desheng

    2015-10-01

    OBJECTIVE To generate hemophilia A (HA) patient-specific inducible pluripotent stem cells (iPSCs) and induce endothelial differentiation. METHODS Tubular epithelial cells were isolated and cultured from the urine of HA patients. The iPSCs were generated by forced expression of Yamanaka factors (Oct4, Sox2, c-Myc and Klf4) using retroviruses and characterized by cell morphology, pluripotent marker staining and in vivo differentiation through teratoma formation. Induced endothelial differentiation of the iPSCs was achieved with the OP9 cell co-culture method. RESULTS Patient-specific iPSCs were generated from urine cells of the HA patients, which could be identified by cell morphology, pluripotent stem cell surface marker staining and in vivo differentiation of three germ layers. The teratoma experiment has confirmed that such cells could differentiate into endothelial cells expressing the endothelial-specific markers CD144, CD31 and vWF. CONCLUSION HA patient-specific iPSCs could be generated from urine cells and can differentiate into endothelial cells. This has provided a new HA disease modeling approach and may serve as an applicable autologous cell source for gene correction and cell therapy studies for HA.

  9. Transcriptional Signature and Memory Retention of Human-Induced Pluripotent Stem Cells

    PubMed Central

    Marchetto, Maria C. N.; Yeo, Gene W.; Kainohana, Osamu; Marsala, Martin; Gage, Fred H.; Muotri, Alysson R.

    2009-01-01

    Genetic reprogramming of somatic cells to a pluripotent state (induced pluripotent stem cells or iPSCs) by over-expression of specific genes has been accomplished using mouse and human cells. However, it is still unclear how similar human iPSCs are to human Embryonic Stem Cells (hESCs). Here, we describe the transcriptional profile of human iPSCs generated without viral vectors or genomic insertions, revealing that these cells are in general similar to hESCs but with significant differences. For the generation of human iPSCs without viral vectors or genomic insertions, pluripotent factors Oct4 and Nanog were cloned in episomal vectors and transfected into human fetal neural progenitor cells. The transient expression of these two factors, or from Oct4 alone, resulted in efficient generation of human iPSCs. The reprogramming strategy described here revealed a potential transcriptional signature for human iPSCs yet retaining the gene expression of donor cells in human reprogrammed cells free of viral and transgene interference. Moreover, the episomal reprogramming strategy represents a safe way to generate human iPSCs for clinical purposes and basic research. PMID:19763270

  10. Modeling human development and disease in pluripotent stem cell-derived gastric organoids

    PubMed Central

    McCracken, Kyle W.; Catá, Emily M.; Crawford, Calyn M.; Sinagoga, Katie L.; Schumacher, Michael; Rockich, Briana E.; Tsai, Yu-Hwai; Mayhew, Christopher N.; Spence, Jason R.; Zavros, Yana; Wells, James M.

    2014-01-01

    Gastric diseases, including peptic ulcer disease and gastric cancer, affect 10% of the world’s population and are largely due to chronic H. pylori infection1–3. Species differences in embryonic development and architecture of the adult stomach make animal models suboptimal for studying human stomach organogenesis and pathogenesis4, and there is no experimental model of normal human gastric mucosa. Here we report the de novo generation of three-dimensional human gastric tissue in vitro through the directed differentiation of human pluripotent stem cells (hPSCs). We identified that temporal manipulation of the FGF, WNT, BMP, retinoic acid and EGF signaling pathways and three-dimensional growth are sufficient to generate human gastric organoids (hGOs). Developing hGOs progressed through molecular and morphogenetic stages that were nearly identical to the developing antrum of the mouse stomach. Organoids formed primitive gastric gland- and pit-like domains, proliferative zones containing LGR5-expressing cells, surface and antral mucous cells, and a diversity of gastric endocrine cells. We used hGO cultures to identify novel signaling mechanisms that regulate early endoderm patterning and gastric endocrine cell differentiation upstream of the transcription factor NEUROG3. Using hGOs to model pathogenesis of human disease, we found that H. pylori infection resulted in rapid association of the virulence factor CagA with the c-Met receptor, activation of signaling and induction of epithelial proliferation. Together, these studies describe a novel and robust in vitro system for elucidating the mechanisms underlying human stomach development and disease. PMID:25363776

  11. In vitro Modeling of Ryanodine Receptor 2 Dysfunction Using Human Induced Pluripotent Stem Cells

    PubMed Central

    Fatima, Azra; Xu, Guoxing; Shao, Kaifeng; Papadopoulos, Symeon; Lehmann, Martin; Arnáiz-Cot, Juan J.; Rosa, Angelo O.; Nguemo, Filomain; Matzkies, Matthias; Dittmann, Sven; Stone, Susannah L.; Linke, Matthias; Zechner, Ulrich; Beyer, Vera; Hennies, Hans Christian; Rosenkranz, Stephan; Klauke, Baerbel; Parwani, Abdul S.; Haverkamp, Wilhelm; Pfitzer, Gabriele; Farr, Martin; Cleemann, Lars; Morad, Martin; Milting, Hendrik; Hescheler, Juergen; Šaric, Tomo

    2011-01-01

    Background/Aims: Induced pluripotent stem (iPS) cells generated from accessible adult cells of patients with genetic diseases open unprecedented opportunities for exploring the pathophysiology of human diseases in vitro. Catecholaminergic polymorphic ventricular tachycardia type 1 (CPVT1) is an inherited cardiac disorder that is caused by mutations in the cardiac ryanodine receptor type 2 gene (RYR2) and is characterized by stress-induced ventricular arrhythmia that can lead to sudden cardiac death in young individuals. The aim of this study was to generate iPS cells from a patient with CPVT1 and determine whether iPS cell-derived cardiomyocytes carrying patient specific RYR2 mutation recapitulate the disease phenotype in vitro. Methods: iPS cells were derived from dermal fibroblasts of healthy donors and a patient with CPVT1 carrying the novel heterozygous autosomal dominant mutation p.F2483I in the RYR2. Functional properties of iPS cell derived-cardiomyocytes were analyzed by using whole-cell current and voltage clamp and calcium imaging techniques. Results: Patch-clamp recordings revealed arrhythmias and delayed afterdepolarizations (DADs) after catecholaminergic stimulation of CPVT1-iPS cell-derived cardiomyocytes. Calcium imaging studies showed that, compared to healthy cardiomyocytes, CPVT1-cardiomyocytes exhibit higher amplitudes and longer durations of spontaneous Ca2+ release events at basal state. In addition, in CPVT1-cardiomyocytes the Ca2+-induced Ca2+-release events continued after repolarization and were abolished by increasing the cytosolic cAMP levels with forskolin. Conclusion: This study demonstrates the suitability of iPS cells in modeling RYR2-related cardiac disorders in vitro and opens new opportunities for investigating the disease mechanism in vitro, developing new drugs, predicting their toxicity, and optimizing current treatment strategies. PMID:22178870

  12. Reprogramming to pluripotency: from frogs to stem cells.

    PubMed

    Rossant, Janet

    2009-09-18

    This year's Albert Lasker Basic Medical Research Award goes to John Gurdon and Shinya Yamanaka for their contributions to our understanding of how to reprogram adult cells back to early embryonic states.

  13. Current state and perspectives in modeling and control of human pluripotent stem cell expansion processes in stirred-tank bioreactors.

    PubMed

    Galvanauskas, Vytautas; Grincas, Vykantas; Simutis, Rimvydas; Kagawa, Yuki; Kino-Oka, Masahiro

    2016-12-26

    Implementation of model-based practices for process development, control, automation, standardization, and validation are important factors for therapeutic and industrial applications of human pluripotent stem cells. As robust cultivation strategies for pluripotent stem cell expansion and differentiation have yet to be determined, process development could be enhanced by application of mathematical models and advanced control systems to optimize growth conditions. Therefore, it is important to understand both the potential of possible applications and the apparent limitations of existing mathematical models to improve pluripotent stem cell cultivation technologies. In the present review, the authors focus on these issues as they apply to stem cell expansion processes. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 2017.

  14. Differentiation of human pluripotent stem cells to cells similar to cord-blood endothelial colony–forming cells

    PubMed Central

    Vemula, Sasidhar; Meador, Jonathan Luke; Yoshimoto, Momoko; Ferkowicz, Michael J; Fett, Alexa; Gupta, Manav; Rapp, Brian M; Saadatzadeh, Mohammad Reza; Ginsberg, Michael; Elemento, Olivier; Lee, Younghee; Voytik-Harbin, Sherry L; Chung, Hyung Min; Hong, Ki Sung; Reid, Emma; O'Neill, Christina L; Medina, Reinhold J; Stitt, Alan W; Murphy, Michael P; Rafii, Shahin; Broxmeyer, Hal E; Yoder, Mervin C

    2015-01-01

    The ability to differentiate human pluripotent stem cells into endothelial cells with properties of cord-blood endothelial colony–forming cells (CB-ECFCs) may enable the derivation of clinically relevant numbers of highly proliferative blood vessel–forming cells to restore endothelial function in patients with vascular disease. We describe a protocol to convert human induced pluripotent stem cells (hiPSCs) or embryonic stem cells (hESCs) into cells similar to CB-ECFCs at an efficiency of >108 ECFCs produced from each starting pluripotent stem cell. The CB-ECFC-like cells display a stable endothelial phenotype with high clonal proliferative potential and the capacity to form human vessels in mice and to repair the ischemic mouse retina and limb, and they lack teratoma formation potential. We identify Neuropilin-1 (NRP-1)-mediated activation of KDR signaling through VEGF165 as a critical mechanism for the emergence and maintenance of CB-ECFC-like cells. PMID:25306246

  15. An in vivo model of human small intestine using pluripotent stem cells.

    PubMed

    Watson, Carey L; Mahe, Maxime M; Múnera, Jorge; Howell, Jonathan C; Sundaram, Nambirajan; Poling, Holly M; Schweitzer, Jamie I; Vallance, Jefferson E; Mayhew, Christopher N; Sun, Ying; Grabowski, Gregory; Finkbeiner, Stacy R; Spence, Jason R; Shroyer, Noah F; Wells, James M; Helmrath, Michael A

    2014-11-01

    Differentiation of human pluripotent stem cells (hPSCs) into organ-specific subtypes offers an exciting avenue for the study of embryonic development and disease processes, for pharmacologic studies and as a potential resource for therapeutic transplant. To date, limited in vivo models exist for human intestine, all of which are dependent upon primary epithelial cultures or digested tissue from surgical biopsies that include mesenchymal cells transplanted on biodegradable scaffolds. Here, we generated human intestinal organoids (HIOs) produced in vitro from human embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) that can engraft in vivo. These HIOs form mature human intestinal epithelium with intestinal stem cells contributing to the crypt-villus architecture and a laminated human mesenchyme, both supported by mouse vasculature ingrowth. In vivo transplantation resulted in marked expansion and maturation of the epithelium and mesenchyme, as demonstrated by differentiated intestinal cell lineages (enterocytes, goblet cells, Paneth cells, tuft cells and enteroendocrine cells), presence of functional brush-border enzymes (lactase, sucrase-isomaltase and dipeptidyl peptidase 4) and visible subepithelial and smooth muscle layers when compared with HIOs in vitro. Transplanted intestinal tissues demonstrated digestive functions as shown by permeability and peptide uptake studies. Furthermore, transplanted HIO-derived tissue was responsive to systemic signals from the host mouse following ileocecal resection, suggesting a role for circulating factors in the intestinal adaptive response. This model of the human small intestine may pave the way for studies of intestinal physiology, disease and translational studies.

  16. Two dimensional electrophysiological characterization of human pluripotent stem cell-derived cardiomyocyte system

    PubMed Central

    Zhu, Huanqi; Scharnhorst, Kelsey S.; Stieg, Adam Z.; Gimzewski, James K.; Minami, Itsunari; Nakatsuji, Norio; Nakano, Haruko; Nakano, Atsushi

    2017-01-01

    Stem cell-derived cardiomyocytes provide a promising tool for human developmental biology, regenerative therapies, disease modeling, and drug discovery. As human pluripotent stem cell-derived cardiomyocytes remain functionally fetal-type, close monitoring of electrophysiological maturation is critical for their further application to biology and translation. However, to date, electrophysiological analyses of stem cell-derived cardiomyocytes has largely been limited by biologically undefined factors including 3D nature of embryoid body, sera from animals, and the feeder cells isolated from mouse. Large variability in the aforementioned systems leads to uncontrollable and irreproducible results, making conclusive studies difficult. In this report, a chemically-defined differentiation regimen and a monolayer cell culture technique was combined with multielectrode arrays for accurate, real-time, and flexible measurement of electrophysiological parameters in translation-ready human cardiomyocytes. Consistent with their natural counterpart, amplitude and dV/dtmax of field potential progressively increased during the course of maturation. Monolayer culture allowed for the identification of pacemaking cells using the multielectrode array platform and thereby the estimation of conduction velocity, which gradually increased during the differentiation of cardiomyocytes. Thus, the electrophysiological maturation of the human pluripotent stem cell-derived cardiomyocytes in our system recapitulates in vivo development. This system provides a versatile biological tool to analyze human heart development, disease mechanisms, and the efficacy/toxicity of chemicals. PMID:28266620

  17. AKT/GSK3β signaling pathway is critically involved in human pluripotent stem cell survival

    PubMed Central

    Romorini, Leonardo; Garate, Ximena; Neiman, Gabriel; Luzzani, Carlos; Furmento, Verónica Alejandra; Guberman, Alejandra Sonia; Sevlever, Gustavo Emilio; Scassa, María Elida; Miriuka, Santiago Gabriel

    2016-01-01

    Human embryonic and induced pluripotent stem cells are self-renewing pluripotent stem cells (PSC) that can differentiate into a wide range of specialized cells. Basic fibroblast growth factor is essential for PSC survival, stemness and self-renewal. PI3K/AKT pathway regulates cell viability and apoptosis in many cell types. Although it has been demonstrated that PI3K/AKT activation by bFGF is relevant for PSC stemness maintenance its role on PSC survival remains elusive. In this study we explored the molecular mechanisms involved in the regulation of PSC survival by AKT. We found that inhibition of AKT with three non-structurally related inhibitors (GSK690693, AKT inhibitor VIII and AKT inhibitor IV) decreased cell viability and induced apoptosis. We observed a rapid increase in phosphatidylserine translocation and in the extent of DNA fragmentation after inhibitors addition. Moreover, abrogation of AKT activity led to Caspase-9, Caspase-3, and PARP cleavage. Importantly, we demonstrated by pharmacological inhibition and siRNA knockdown that GSK3β signaling is responsible, at least in part, of the apoptosis triggered by AKT inhibition. Moreover, GSK3β inhibition decreases basal apoptosis rate and promotes PSC proliferation. In conclusion, we demonstrated that AKT activation prevents apoptosis, partly through inhibition of GSK3β, and thus results relevant for PSC survival. PMID:27762303

  18. Modeling diseases of noncoding unstable repeat expansions using mutant pluripotent stem cells

    PubMed Central

    Yanovsky-Dagan, Shira; Mor-Shaked, Hagar; Eiges, Rachel

    2015-01-01

    Pathogenic mutations involving DNA repeat expansions are responsible for over 20 different neuronal and neuromuscular diseases. All result from expanded tracts of repetitive DNA sequences (mostly microsatellites) that become unstable beyond a critical length when transmitted across generations. Nearly all are inherited as autosomal dominant conditions and are typically associated with anticipation. Pathologic unstable repeat expansions can be classified according to their length, repeat sequence, gene location and underlying pathologic mechanisms. This review summarizes the current contribution of mutant pluripotent stem cells (diseased human embryonic stem cells and patient-derived induced pluripotent stem cells) to the research of unstable repeat pathologies by focusing on particularly large unstable noncoding expansions. Among this class of disorders are Fragile X syndrome and Fragile X-associated tremor/ataxia syndrome, myotonic dystrophy type 1 and myotonic dystrophy type 2, Friedreich ataxia and C9 related amyotrophic lateral sclerosis and/or frontotemporal dementia, Facioscapulohumeral Muscular Dystrophy and potentially more. Common features that are typical to this subclass of conditions are RNA toxic gain-of-function, epigenetic loss-of-function, toxic repeat-associated non-ATG translation and somatic instability. For each mechanism we summarize the currently available stem cell based models, highlight how they contributed to better understanding of the related mechanism, and discuss how they may be utilized in future investigations. PMID:26131313

  19. Molecular, phenotypic, and sample-associated data to describe pluripotent stem cell lines and derivatives

    PubMed Central

    Daily, Kenneth; Ho Sui, Shannan J.; Schriml, Lynn M.; Dexheimer, Phillip J.; Salomonis, Nathan; Schroll, Robin; Bush, Stacy; Keddache, Mehdi; Mayhew, Christopher; Lotia, Samad; Perumal, Thanneer M.; Dang, Kristen; Pantano, Lorena; Pico, Alexander R.; Grassman, Elke; Nordling, Diana; Hide, Winston; Hatzopoulos, Antonis K.; Malik, Punam; Cancelas, Jose A.; Lutzko, Carolyn; Aronow, Bruce J.; Omberg, Larsson

    2017-01-01

    The use of induced pluripotent stem cells (iPSC) derived from independent patients and sources holds considerable promise to improve the understanding of development and disease. However, optimized use of iPSC depends on our ability to develop methods to efficiently qualify cell lines and protocols, monitor genetic stability, and evaluate self-renewal and differentiation potential. To accomplish these goals, 57 stem cell lines from 10 laboratories were differentiated to 7 different states, resulting in 248 analyzed samples. Cell lines were differentiated and characterized at a central laboratory using standardized cell culture methodologies, protocols, and metadata descriptors. Stem cell and derived differentiated lines were characterized using RNA-seq, miRNA-seq, copy number arrays, DNA methylation arrays, flow cytometry, and molecular histology. All materials, including raw data, metadata, analysis and processing code, and methodological and provenance documentation are publicly available for re-use and interactive exploration at https://www.synapse.org/pcbc. The goal is to provide data that can improve our ability to robustly and reproducibly use human pluripotent stem cells to understand development and disease. PMID:28350385

  20. Stencil Micropatterning of Human Pluripotent Stem Cells for Probing Spatial Organization of Differentiation Fates.

    PubMed

    Sahni, Geetika; Yuan, Jun; Toh, Yi-Chin

    2016-06-17

    Human pluripotent stem cells (hPSCs), including embryonic stem cells and induced pluripotent stem cells, have the intrinsic ability to differentiate into all three germ layers. This makes them an attractive cell source for regenerative medicine and experimental modeling of normal and diseased organogenesis. However, the differentiation of hPSCs in vitro is heterogeneous and spatially disordered. Cell micropatterning technologies potentially offer the means to spatially control stem cell microenvironments and organize the resultant differentiation fates. Micropatterning hPSCs needs to take into account the stringent requirements for hPSC survival and maintenance. Here, we describe stencil micropatterning as a method that is highly compatible with hPSCs. hPSC micropatterns are specified by the geometries of the cell stencil through-holes, which physically confine the locations where hPSCs can access and attach to the underlying extracellular matrix-coated substrate. Due to this mode of operation, there is greater flexibility to use substrates that can adequately support hPSCs as compared to other cell micropatterning methods. We also highlight critical steps for the successful generation of hPSC micropatterns. As an example, we demonstrate that stencil micropatterning of hPSCs can be used to modulate spatial polarization of cell-cell and cell-matrix adhesions, which in turn determines mesoendoderm differentiation patterns. This simple and robust method to micropattern hPSCs widens the prospects of establishing experimental models to investigate tissue organization and patterning during early embryonic development.

  1. Pluripotent stem cells derived from mouse and human white mature adipocytes.

    PubMed

    Jumabay, Medet; Abdmaulen, Raushan; Ly, Albert; Cubberly, Mark R; Shahmirian, Laurine J; Heydarkhan-Hagvall, Sepideh; Dumesic, Daniel A; Yao, Yucheng; Boström, Kristina I

    2014-02-01

    White mature adipocytes give rise to so-called dedifferentiated fat (DFAT) cells that spontaneously undergo multilineage differentiation. In this study, we defined stem cell characteristics of DFAT cells as they are generated from adipocytes and the relationship between these characteristics and lineage differentiation. Both mouse and human DFAT cells, prepared from adipose tissue and lipoaspirate, respectively, showed evidence of pluripotency, with a maximum 5-7 days after adipocyte isolation. The DFAT cells spontaneously formed clusters in culture, which transiently expressed multiple stem cell markers, including stage-specific embryonic antigens, and Sca-1 (mouse) and CD105 (human), as determined by real-time polymerase chain reaction, fluorescence-activated cell sorting, and immunostaining. As the stem cell markers decreased, markers characteristic of the three germ layers and specific lineage differentiation, such as α-fetoprotein (endoderm, hepatic), Neurofilament-66 (ectoderm, neurogenic), and Troponin I (mesoderm, cardiomyogenic), increased. However, no teratoma formation was detected after injection in immunodeficient mice. A novel modification of the adipocyte isolation aimed at ensuring the initial purity of the adipocytes and avoiding ceiling culture allowed isolation of DFAT cells with pluripotent characteristics. Thus, the adipocyte-derived DFAT cells represent a plastic stem cell population that is highly responsive to changes in culture conditions and may benefit cell-based therapies.

  2. Pluripotent Stem Cells Derived From Mouse and Human White Mature Adipocytes

    PubMed Central

    Abdmaulen, Raushan; Ly, Albert; Cubberly, Mark R.; Shahmirian, Laurine J.; Heydarkhan-Hagvall, Sepideh; Dumesic, Daniel A.; Yao, Yucheng

    2014-01-01

    White mature adipocytes give rise to so-called dedifferentiated fat (DFAT) cells that spontaneously undergo multilineage differentiation. In this study, we defined stem cell characteristics of DFAT cells as they are generated from adipocytes and the relationship between these characteristics and lineage differentiation. Both mouse and human DFAT cells, prepared from adipose tissue and lipoaspirate, respectively, showed evidence of pluripotency, with a maximum 5–7 days after adipocyte isolation. The DFAT cells spontaneously formed clusters in culture, which transiently expressed multiple stem cell markers, including stage-specific embryonic antigens, and Sca-1 (mouse) and CD105 (human), as determined by real-time polymerase chain reaction, fluorescence-activated cell sorting, and immunostaining. As the stem cell markers decreased, markers characteristic of the three germ layers and specific lineage differentiation, such as α-fetoprotein (endoderm, hepatic), Neurofilament-66 (ectoderm, neurogenic), and Troponin I (mesoderm, cardiomyogenic), increased. However, no teratoma formation was detected after injection in immunodeficient mice. A novel modification of the adipocyte isolation aimed at ensuring the initial purity of the adipocytes and avoiding ceiling culture allowed isolation of DFAT cells with pluripotent characteristics. Thus, the adipocyte-derived DFAT cells represent a plastic stem cell population that is highly responsive to changes in culture conditions and may benefit cell-based therapies. PMID:24396033

  3. Concise Review: Pluripotent Stem Cell-Based Regenerative Applications for Failing β-Cell Function

    PubMed Central

    Holditch, Sara J.; Terzic, Andre

    2014-01-01

    Diabetes engenders the loss of pancreatic β-cell mass and/or function, resulting in insulin deficiency relative to the metabolic needs of the body. Diabetic care has traditionally relied on pharmacotherapy, exemplified by insulin replacement to target peripheral actions of the hormone. With growing understanding of the pathogenesis of diabetic disease, alternative approaches aiming at repair and restoration of failing β-cell function are increasingly considered as complements to current diabetes therapy regimens. To this end, emphasis is placed on transplantation of exogenous pancreas/islets or artificial islets, enhanced proliferation and maturation of endogenous β cells, prevention of β-cell loss, or fortified renewal of β-like-cell populations from stem cell pools and non-β-cell sources. In light of emerging clinical experiences with human embryonic stem cells and approval of the first in-human trial with induced pluripotent stem cells, in this study we highlight advances in β-cell regeneration strategies with a focus on pluripotent stem cell platforms in the context of translational applications. PMID:24646490

  4. Angiogenic activity mediates bone repair from human pluripotent stem cell-derived osteogenic cells

    PubMed Central

    Zou, Li; Chen, Qingshan; Quanbeck, Zachary; Bechtold, Joan E.; Kaufman, Dan S.

    2016-01-01

    Human pluripotent stem cells provide a standardized resource for bone repair. However, criteria to determine which exogenous cells best heal orthopedic injuries remain poorly defined. We evaluated osteogenic progenitor cells derived from both human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs). Phenotypic and genotypic analyses demonstrated that these hESCs/hiPSCs are similar in their osteogenic differentiation efficiency and they generate osteogenic cells comparable to osteogenic cells derived from mesenchymal stromal cells (BM-MSCs). However, expression of angiogenic factors, such as vascular endothelial growth factor and basic fibroblast growth factor in these osteogenic progenitor cells are markedly different, suggesting distinct pro-angiogenic potential of these stem cell derivatives. Studies to repair a femur non-union fracture demonstrate only osteogenic progenitor cells with higher pro-angiogenic potential significantly enhance bone repair in vivo. Together, these studies highlight a key role of pro-angiogenic potential of transplanted osteogenic cells for effective cell-mediated bone repair. PMID:26980556

  5. Expression of putative markers of pluripotency in equine embryonic and adult tissues.

    PubMed

    Esteves, Cristina L; Sharma, Ruchi; Dawson, Lucy; Taylor, Sarah E; Pearson, Gemma; Keen, John A; McDonald, Kieran; Aurich, Christine; Donadeu, F Xavier

    2014-12-01

    Expression of several putative markers of pluripotency (OCT4, SOX2, NANOG, LIN28A, REX1, DNMT3B and TERT) was examined in a range of equine tissues, including early embryos, induced pluripotent stem cells (iPSCs), testis, adipose- and bone marrow-derived mesenchymal stromal cells (MSCs), and keratinocytes. Transcript levels of all markers were highest in embryos and iPSCs and, except for SOX2, were very low or undetectable in keratinocytes. Mean expression levels of all markers were lower in testis than in embryos or iPSCs and, except for DNMT3B, were higher in testis than in MSCs. Expression of OCT4, NANOG and DNMT3B, but not the other markers, was detected in MSCs. Of all markers analysed, only LIN28A, REX1 and TERT were associated exclusively with pluripotent cells in the horse.

  6. Combining Induced Pluripotent Stem Cells and Genome Editing Technologies for Clinical Applications.

    PubMed

    Chang, Chia-Yu; Ting, Hsiao-Chien; Su, Hong-Lin; Jeng, Jing-Ren

    2017-02-17

    In this review, we introduce current developments in induced pluripotent stem cells (iPSCs), site-specific nuclease (SSN)-mediated genome editing tools, and the combined application of these two novel technologies in biomedical research and therapeutic trials. The sustainable pluripotent property of iPSCs in vitro not only provides unlimited cell sources for basic research but also benefits precision medicines for human diseases. In addition, rapidly evolving SSN tools efficiently tailor genetic manipulations for exploring gene functions and can be utilized to correct genetic defects of congenital diseases in the near future. Combining iPSC and SSN technologies will create new reliable human disease models with isogenic backgrounds in vitro and provide new solutions for cell replacement and precise therapies.

  7. Nono, a Bivalent Domain Factor, Regulates Erk Signaling and Mouse Embryonic Stem Cell Pluripotency.

    PubMed

    Ma, Chun; Karwacki-Neisius, Violetta; Tang, Haoran; Li, Wenjing; Shi, Zhennan; Hu, Haolin; Xu, Wenqi; Wang, Zhentian; Kong, Lingchun; Lv, Ruitu; Fan, Zheng; Zhou, Wenhao; Yang, Pengyuan; Wu, Feizhen; Diao, Jianbo; Tan, Li; Shi, Yujiang Geno; Lan, Fei; Shi, Yang

    2016-10-18

    Nono is a component of the para-speckle, which stores and processes RNA. Mouse embryonic stem cells (mESCs) lack para-speckles, leaving the function of Nono in mESCs unclear. Here, we find that Nono functions as a chromatin regulator cooperating with Erk to regulate mESC pluripotency. We report that Nono loss results in robust self-renewing mESCs with epigenomic and transcriptomic features resembling the 2i (GSK and Erk inhibitors)-induced "ground state." Erk interacts with and is required for Nono localization to a subset of bivalent genes that have high levels of poised RNA polymerase. Nono loss compromises Erk activation and RNA polymerase poising at its target bivalent genes in undifferentiated mESCs, thus disrupting target gene activation and differentiation. These findings argue that Nono collaborates with Erk signaling to regulate the integrity of bivalent domains and mESC pluripotency.

  8. Dissecting Transcriptional Heterogeneity in Pluripotency: Single Cell Analysis of Mouse Embryonic Stem Cells.

    PubMed

    Guedes, Ana M V; Henrique, Domingos; Abranches, Elsa

    2016-01-01

    Mouse Embryonic Stem cells (mESCs) show heterogeneous and dynamic expression of important pluripotency regulatory factors. Single-cell analysis has revealed the existence of cell-to-cell variability in the expression of individual genes in mESCs. Understanding how these heterogeneities are regulated and what their functional consequences are is crucial to obtain a more comprehensive view of the pluripotent state.In this chapter we describe how to analyze transcriptional heterogeneity by monitoring gene expression of Nanog, Oct4, and Sox2, using single-molecule RNA FISH in single mESCs grown in different cell culture medium. We describe in detail all the steps involved in the protocol, from RNA detection to image acquisition and processing, as well as exploratory data analysis.

  9. A new era of disease modeling and drug discovery using induced pluripotent stem cells.

    PubMed

    Suh, Wonhee

    2017-01-01

    In 2006, Shinya Yamanaka first reported that in vitro reprogramming of somatic cells toward pluripotency was achieved by simple induction of specific transcription factors. Induced pluripotent stem cell (iPSC) technology has since revolutionized the ways in which we explore the mechanisms of human diseases and develop therapeutics. Here, I describe the recent advances in human iPSC-based disease modeling and drug discovery and discuss the current challenges. Additionally, I outline potential future applications of human iPSCs in classifying patients based on their response to drugs in clinical trials and elucidating optimal patient-specific therapeutic strategies, which will contribute to reduced attrition rates and the development of precision medicine.

  10. Tumourigenicity and Immunogenicity of Induced Neural Stem Cell Grafts Versus Induced Pluripotent Stem Cell Grafts in Syngeneic Mouse Brain

    PubMed Central

    Gao, Mou; Yao, Hui; Dong, Qin; Zhang, Hongtian; Yang, Zhijun; Yang, Yang; Zhu, Jianwei; Xu, Minhui; Xu, Ruxiang

    2016-01-01

    Along with the development of stem cell-based therapies for central nervous system (CNS) disease, the safety of stem cell grafts in the CNS, such as induced pluripotent stem cells (iPSCs) and induced neural stem cells (iNSCs), should be of primary concern. To provide scientific basis for evaluating the safety of these stem cells, we determined their tumourigenicity and immunogenicity in syngeneic mouse brain. Both iPSCs and embryonic stem cells (ESCs) were able to form tumours in the mouse brain, leading to tissue destruction along with immune cell infiltration. In contrast, no evidence of tumour formation, brain injury or immune rejection was observed with iNSCs, neural stem cells (NSCs) or mesenchymal stem cells (MSCs). With the help of gene ontology (GO) enrichment analysis, we detected significantly elevated levels of chemokines in the brain tissue and serum of mice that developed tumours after ESC or iPSC transplantation. Moreover, we also investigated the interactions between chemokines and NF-κB signalling and found that NF-κB activation was positively correlated with the constantly rising levels of chemokines, and vice versa. In short, iNSC grafts, which lacked any resulting tumourigenicity or immunogenicity, are safer than iPSC grafts. PMID:27417157

  11. Disease modeling using human induced pluripotent stem cells: Lessons from the liver☆

    PubMed Central

    Gieseck, Richard L.; Colquhoun, Jennifer; Hannan, Nicholas R.F.

    2014-01-01

    Human pluripotent stem cells (hPSCs) have the capacity to differentiate into any of the hundreds of distinct cell types that comprise the human body. This unique characteristic has resulted in considerable interest in the field of regenerative medicine, given the potential for these cells to be used to protect, repair, or replace diseased, injured, and aged cells within the human body. In addition to their potential in therapeutics, hPSCs can be used to study the earliest stages of human development and to provide a platform for both drug screening and disease modeling using human cells. Recently, the description of human induced pluripotent stem cells (hIPSCs) has allowed the field of disease modeling to become far more accessible and physiologically relevant, as pluripotent cells can be generated from patients of any genetic background. Disease models derived from hIPSCs that manifest cellular disease phenotypes have been established to study several monogenic diseases; furthermore, hIPSCs can be used for phenotype-based drug screens to investigate complex diseases for which the underlying genetic mechanism is unknown. As a result, the use of stem cells as research tools has seen an unprecedented growth within the last decade as researchers look for in vitro disease models which closely mimic in vivo responses in humans. Here, we discuss the beginnings of hPSCs, starting with isolation of human embryonic stem cells, moving into the development and optimization of hIPSC technology, and ending with the application of hIPSCs towards disease modeling and drug screening applications, with specific examples highlighting the modeling of inherited metabolic disorders of the liver. This article is part of a Special Issue entitled Linking transcription to physiology in lipodomics. PMID:24943800

  12. Collagen-graft mixed cellulose esters membrane maintains undifferentiated morphology and markers of potential pluripotency in feeder-free culture of induced pluripotent stem cells.

    PubMed

    Lotfalah Moradi, Sadegh; Hajishafieeha, Zahra; Nojedehi, Shahrzad; Dinarvand, Vida; Hesami Tackallou, Saeed; Roy, Ram V; Ardeshirylajimi, Abdolreza; Soleimani, Masoud

    2016-09-01

    Induced pluripotent stem cells (iPSCs) are unique and unlimited clinical sources of stem cell therapy for the regenerative medicine. Feeder layer preparation is an important step for iPSCs production, which is expensive, time-consuming and requires conversance. In the present study, we investigated the maintenance of pluripotency, and stemness of the iPSCs through feeder-free culture on a collagen-grafted Mixed Cellulose Esters membrane (MCE-COL) after three passages during twelve days. Results have demonstrated that the iPSCs cultured on MCE-COL membrane had a fine, typical undifferentiated morphology, increased proliferation rate and significant multi-lineage differentiation potential. Alkaline phosphatase (ALP) staining and pluripotency associated gene markers expression further confirmed that iPSCs cultured on the surface of MCE-COL had more ALP positive colonies and enhanced expression of Oct-4, Nanog, Sox-2 and ALP in comparison with MCE and control groups. Since MCE-COL membrane has three dimensional structure and bioactivity, it has the potential for usage in the feeder-free culture of iPSCs, and could be a suitable candidate to use as a feeder layer in stem cells preparation.

  13. [Why do we need induced pluripotent stem cells in neurobiology?].

    PubMed

    Liszewska, Ewa; Jaworski, Jacek

    2013-01-01

    Reprogramming of somatic cells made possible to study in vitro inaccessible human cells, such as different types of neurons. Almost immediate consequence of the emergence of this technology was the development of a number of cellular models of the nervous system diseases. They are used both to explore the cellular mechanisms of these diseases and for the development of new pharmacological strategies. Reprogrammed cells are also a potential alternative to embryonic stem cells for transplantation. This article presents the most important achievements in the use of cell reprogramming technology in neurobiology and at the same time points out the limitations of the methodology and the expected directions of its development.

  14. Brown-like adipose progenitors derived from human induced pluripotent stem cells: Identification of critical pathways governing their adipogenic capacity.

    PubMed

    Hafner, Anne-Laure; Contet, Julian; Ravaud, Christophe; Yao, Xi; Villageois, Phi; Suknuntha, Kran; Annab, Karima; Peraldi, Pascal; Binetruy, Bernard; Slukvin, Igor I; Ladoux, Annie; Dani, Christian

    2016-08-31

    Human induced pluripotent stem cells (hiPSCs) show great promise for obesity treatment as they represent an unlimited source of brown/brite adipose progenitors (BAPs). However, hiPSC-BAPs display a low adipogenic capacity compared to adult-BAPs when maintained in a traditional adipogenic cocktail. The reasons of this feature are unknown and hamper their use both in cell-based therapy and basic research. Here we show that treatment with TGFβ pathway inhibitor SB431542 together with ascorbic acid and EGF were required to promote hiPSCs-BAP differentiation at a level similar to adult-BAP differentiation. hiPSC-BAPs expressed the molecular identity of adult-UCP1 expressing cells (PAX3, CIDEA, DIO2) with both brown (ZIC1) and brite (CD137) adipocyte markers. Altogether, these data highlighted the critical role of TGFβ pathway in switching off hiPSC-brown adipogenesis and revealed novel factors to unlock their differentiation. As hiPSC-BAPs display similarities with adult-BAPs, it opens new opportunities to develop alternative strategies to counteract obesity.

  15. Brown-like adipose progenitors derived from human induced pluripotent stem cells: Identification of critical pathways governing their adipogenic capacity

    PubMed Central

    Hafner, Anne-Laure; Contet, Julian; Ravaud, Christophe; Yao, Xi; Villageois, Phi; Suknuntha, Kran; Annab, Karima; Peraldi, Pascal; Binetruy, Bernard; Slukvin, Igor I.; Ladoux, Annie; Dani, Christian

    2016-01-01

    Human induced pluripotent stem cells (hiPSCs) show great promise for obesity treatment as they represent an unlimited source of brown/brite adipose progenitors (BAPs). However, hiPSC-BAPs display a low adipogenic capacity compared to adult-BAPs when maintained in a traditional adipogenic cocktail. The reasons of this feature are unknown and hamper their use both in cell-based therapy and basic research. Here we show that treatment with TGFβ pathway inhibitor SB431542 together with ascorbic acid and EGF were required to promote hiPSCs-BAP differentiation at a level similar to adult-BAP differentiation. hiPSC-BAPs expressed the molecular identity of adult-UCP1 expressing cells (PAX3, CIDEA, DIO2) with both brown (ZIC1) and brite (CD137) adipocyte markers. Altogether, these data highlighted the critical role of TGFβ pathway in switching off hiPSC-brown adipogenesis and revealed novel factors to unlock their differentiation. As hiPSC-BAPs display similarities with adult-BAPs, it opens new opportunities to develop alternative strategies to counteract obesity. PMID:27577850

  16. A bioengineered niche promotes in vivo engraftment and maturation of pluripotent stem cell derived human lung organoids

    PubMed Central

    Dye, Briana R; Dedhia, Priya H; Miller, Alyssa J; Nagy, Melinda S; White, Eric S; Shea, Lonnie D; Spence, Jason R

    2016-01-01

    Human pluripotent stem cell (hPSC) derived tissues often remain developmentally immature in vitro, and become more adult-like in their structure, cellular diversity and function following transplantation into immunocompromised mice. Previously we have demonstrated that hPSC-derived human lung organoids (HLOs) resembled human fetal lung tissue in vitro (Dye et al., 2015). Here we show that HLOs required a bioartificial microporous poly(lactide-co-glycolide) (PLG) scaffold niche for successful engraftment, long-term survival, and maturation of lung epithelium in vivo. Analysis of scaffold-grown transplanted tissue showed airway-like tissue with enhanced epithelial structure and organization compared to HLOs grown in vitro. By further comparing in vitro and in vivo grown HLOs with fetal and adult human lung tissue, we found that in vivo transplanted HLOs had improved cellular differentiation of secretory lineages that is reflective of differences between fetal and adult tissue, resulting in airway-like structures that were remarkably similar to the native adult human lung. DOI: http://dx.doi.org/10.7554/eLife.19732.001 PMID:27677847

  17. Induced Pluripotent Stem Cells for Traumatic Spinal Cord Injury

    PubMed Central

    Khazaei, Mohamad; Ahuja, Christopher S.; Fehlings, Michael G.

    2017-01-01

    Spinal cord injury (SCI) is a common cause of mortality and neurological morbidity. Although progress had been made in the last decades in medical, surgical, and rehabilitation treatments for SCI, the outcomes of these approaches are not yet ideal. The use of cell transplantation as a therapeutic strategy for the treatment of SCI is very promising. Cell therapies for the treatment of SCI are limited by several translational road blocks, including ethical concerns in relation to cell sources. The use of iPSCs is particularly attractive, given that they provide an autologous cell source and avoid the ethical and moral considerations of other stem cell sources. In addition, different cell types, that are applicable to SCI, can be created from iPSCs. Common cell sources used for reprogramming are skin fibroblasts, keratinocytes, melanocytes, CD34+ cells, cord blood cells and adipose stem cells. Different cell types have different genetic and epigenetic considerations that affect their reprogramming efficiencies. Furthermore, in SCI the iPSCs can be differentiated to neural precursor cells, neural crest cells, neurons, oligodendrocytes, astrocytes, and even mesenchymal stromal cells. These can produce functional recovery by replacing lost cells and/or modulating the lesion microenvironment. PMID:28154814

  18. [Research progress of induced pluripotent stem cells in treatment of muscle atrophy].

    PubMed

    Yao, Zhongkai; Yang, Chensong; Sun, Guixin

    2016-03-01

    Muscle atrophy caused by nerve injury is a common and difficult clinical problem. The development of stem cell researches has opened up a new way for the treatment of nerve injury-induced muscle atrophy. The induced pluripotent stem cells(iPSCs)can differentiate into various types of cells and have more advantages than embryonic stem cells (ESCs). After being transplanted into the damaged area, iPSCs are guided by neurogenic signals to the lesion sites, to repair the damaged nerve, promote generation of axon myelination, rebuild neural circuits and restore physiological function. Meanwhile, iPSCs can also differentiate into muscle cells and promote muscle tissue regeneration. Therefore, it would be possible to attenuate muscle atrophy caused by nerve injury with iPSCs treatment.

  19. Early embryonic development, assisted reproductive technologies, and pluripotent stem cell biology in domestic mammals.

    PubMed

    Hall, V; Hinrichs, K; Lazzari, G; Betts, D H; Hyttel, P

    2013-08-01

    Over many decades assisted reproductive technologies, including artificial insemination, embryo transfer, in vitro production (IVP) of embryos, cloning by somatic cell nuclear transfer (SCNT), and stem cell culture, have been developed with the aim of refining breeding strategies for improved production and health in animal husbandry. More recently, biomedical applications of these technologies, in particular, SCNT and stem cell culture, have been pursued in domestic mammals in order to create models for human disease and therapy. The following review focuses on presenting important aspects of pre-implantation development in cattle, pigs, horses, and dogs. Biological aspects and impact of assisted reproductive technologies including IVP, SCNT, and culture of pluripotent stem cells are also addressed.

  20. Induction of Germ Cell-like Cells from Porcine Induced Pluripotent Stem Cells

    PubMed Central

    Wang, Hanning; Xiang, Jinzhu; Zhang, Wei; Li, Junhong; Wei, Qingqing; Zhong, Liang; Ouyang, Hongsheng; Han, Jianyong

    2016-01-01

    The ability to generate germ cells from pluripotent stem cells (PSCs) is valuable for human regenerative medicine and animal breeding. Germ cell-like cells (GCLCs) have been differentiated from mouse and human PSCs, but not from porcine PSCs, which are considered an ideal model for stem cell applications. Here, we developed a defined culture system for the induction of primordial germ cell-like cells (PGCLCs) from porcine induced PSCs (piPSCs). The identity of the PGCLCs was characterized by observing cell morphology, detecting germ cell marker gene expression and evaluating epigenetic properties. PGCLCs could further differentiate into spermatogonial stem cell-like cells (SSCLCs) in vitro. Importantly, meiosis occurred during SSCLC induction. Xenotransplantation of GCLCs into seminiferous tubules of infertile immunodeficient mice resulted in immunohistochemically identifiable germ cells in vivo. Overall, our study provides a feasible strategy for directing piPSCs to the germ cell fate and lays a foundation for exploring germ cell development mechanisms. PMID:27264660

  1. High-Efficiency Serum-Free Feeder-Free Erythroid Differentiation of Human Pluripotent Stem Cells Using Small Molecules

    PubMed Central

    Marenah, Lamin; McCahill, Angela; Condie, Alison; Cowan, Scott

    2016-01-01

    This article describes a good manufacturing practice (GMP)-compatible, feeder-free and serum-free method to produce large numbers of erythroid cells from human pluripotent stem cells (hPSCs), either embryonic or induced. This multistep protocol combines cytokines and small molecules to mimic and surpass the early stages of development. It produces, without any selection or sorting step, a population of cells in which 91.8% ± 5.4% express CD34 at day 7, 98.6% ± 1.3% express CD43 at day 10, and 99.1% ± 0.95% of cells are CD235a positive by day 31 of the differentiation process. Moreover, this differentiation protocol supports extensive expansion, with a single hPSC producing up to 150 hematopoietic progenitor cells by day 10 and 50,000–200,000 erythroid cells by day 31. The erythroid cells produced exhibit a definitive fetal hematopoietic type, with 90%–95% fetal globin and variable proportion of embryonic and adult globin at the protein level. The presence of small molecules during the differentiation protocol has quantitative and qualitative effects; it increases the proportion of adult globin and decreases the proportion of embryonic globin. Given its level of definition, this system provides a powerful tool for investigation of the mechanisms governing early hematopoiesis and erythropoiesis, including globin switching and enucleation. The early stages of the differentiation protocol could also serve as a starting point for the production of endothelial cells and other hematopoietic cells, or to investigate the production of long-term reconstituting hematopoietic stem cells from hPSCs. Significance This differentiation protocol allows the production of a large amount of erythroid cells from pluripotent stem cells. Its efficiency is compatible with that of in vitro red blood cell production, and it can be a considerable asset for studying developmental erythropoiesis and red blood cell enucleation, thereby aiding both basic and translational research. In

  2. Porcine induced pluripotent stem cells analogous to naïve and primed embryonic stem cells of the mouse.

    PubMed

    Telugu, Bhanu Prakash V L; Ezashi, Toshihiko; Roberts, R Michael

    2010-01-01

    Authentic or naïve embryonic stem cells (ESC) have probably never been derived from the inner cell mass (ICM) of pig blastocysts, despite over 25 years of effort. Recently, several groups, including ours, have reported induced pluripotent stem cells (iPSC) from swine by reprogramming somatic cells with a combination of four factors, OCT4 (POU5F1)/SOX2/KLF4/c-MYC delivered by retroviral transduction. The porcine (p) iPSC resembled human (h) ESC and the mouse "Epiblast stem cells" (EpiSC) in their colony morphology and expression of pluripotent genes, and are likely dependent on FGF2/ACTIVIN/NODAL signaling, therefore representing a primed ESC state. These cells are likely to advance swine as a model in biomedical research, since grafts could potentially be matched to the animal that donated the cells for re-programming. The objective of the present work has been to develop naïve piPSC. Employing a combination of seven reprogramming factors assembled on episomal vectors, we successfully reprogrammed porcine embryonic fibroblasts on a modified LIF-medium supplemented with two kinase inhibitors; CHIR99021, which inhibits GSK-3beta, and PD0325901, a MEK inhibitor. The derived piPSC bear a striking resemblance to naïve mESC in colony morphology, are dependent on LIF to maintain an undifferentiated phenotype, and express markers consistent with pluripotency. They exhibit high telomerase activity, a short cell cycle interval, and a normal karyotype, and are able to generate teratomas. Currently, the competence of these lines for contributing to germ-line chimeras is being tested.

  3. Development of a rapid screen for the endodermal differentiation potential of human pluripotent stem cell lines

    PubMed Central

    Siller, Richard; Naumovska, Elena; Mathapati, Santosh; Lycke, Max; Greenhough, Sebastian; Sullivan, Gareth J.

    2016-01-01

    A challenge facing the human pluripotent stem cell (hPSC) field is the variability observed in differentiation potential of hPSCs. Variability can lead to time consuming and costly optimisation to yield the cell type of interest. This is especially relevant for the differentiation of hPSCs towards the endodermal lineages. Endodermal cells have the potential to yield promising new knowledge and therapies for diseases affecting multiple organ systems, including lung, thymus, intestine, pancreas and liver, as well as applications in regenerative medicine and toxicology. Providing a means to rapidly, cheaply and efficiently assess the differentiation potential of multiple hPSCs is of great interest. To this end, we have developed a rapid small molecule based screen to assess the endodermal potential (EP) of hPSCs, based solely on definitive endoderm (DE) morphology. This drastically reduces the cost and time to identify lines suitable for use in deriving endodermal lineages. We demonstrate the efficacy of this screen using 10 different hPSCs, including 4 human embryonic stem cell lines (hESCs) and 6 human induced pluripotent stem cell lines (hiPSCs). The screen clearly revealed lines amenable to endodermal differentiation, and only lines that passed our morphological assessment were capable of further differentiation to hepatocyte like cells (HLCs). PMID:27872482

  4. Efficient CRISPR/Cas9-Based Genome Engineering in Human Pluripotent Stem Cells.

    PubMed

    Kime, Cody; Mandegar, Mohammad A; Srivastava, Deepak; Yamanaka, Shinya; Conklin, Bruce R; Rand, Tim A

    2016-01-01

    Human pluripotent stem cells (hPS cells) are rapidly emerging as a powerful tool for biomedical discovery. The advent of human induced pluripotent stem cells (hiPS cells) with human embryonic stem (hES)-cell-like properties has led to hPS cells with disease-specific genetic backgrounds for in vitro disease modeling and drug discovery as well as mechanistic and developmental studies. To fully realize this potential, it will be necessary to modify the genome of hPS cells with precision and flexibility. Pioneering experiments utilizing site-specific double-strand break (DSB)-mediated genome engineering tools, including zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have paved the way to genome engineering in previously recalcitrant systems such as hPS cells. However, these methods are technically cumbersome and require significant expertise, which has limited adoption. A major recent advance involving the clustered regularly interspaced short palindromic repeats (CRISPR) endonuclease has dramatically simplified the effort required for genome engineering and will likely be adopted widely as the most rapid and flexible system for genome editing in hPS cells. In this unit, we describe commonly practiced methods for CRISPR endonuclease genomic editing of hPS cells into cell lines containing genomes altered by insertion/deletion (indel) mutagenesis or insertion of recombinant genomic DNA.

  5. PIWI Proteins Are Dispensable for Mouse Somatic Development and Reprogramming of Fibroblasts into Pluripotent Stem Cells

    PubMed Central

    Cheng, Ee-Chun; Kang, Dongwan; Wang, Zhong; Lin, Haifan

    2014-01-01

    PIWI proteins play essential and conserved roles in germline development, including germline stem cell maintenance and meiosis. Because germline regulators such as OCT4, NANOG, and SOX2 are known to be potent factors that reprogram differentiated somatic cells into induced pluripotent stem cells (iPSCs), we investigated whether the PIWI protein family is involved in iPSC production. We find that all three mouse Piwi genes, Miwi, Mili, and Miwi2, are expressed in embryonic stem cells (ESCs) at higher levels than in fibroblasts, with Mili being the highest. However, mice lacking all three Piwi genes are viable and female fertile, and are only male sterile. Furthermore, embryonic fibroblasts derived from Miwi/Mili/Miwi2 triple knockout embryos can be efficiently reprogrammed into iPS cells. These iPS cells expressed pluripotency markers and were capable of differentiating into all three germ layers in teratoma assays. Genome-wide expression profiling reveals that the triple knockout iPS cells are very similar to littermate control iPS cells. These results indicate that PIWI proteins are dispensable for direct reprogramming of mouse fibroblasts. PMID:25238487

  6. Reprogramming of Melanoma Tumor-Infiltrating Lymphocytes to Induced Pluripotent Stem Cells

    PubMed Central

    Saito, Hidehito; Okita, Keisuke; Fusaki, Noemi; Sabel, Michael S.; Chang, Alfred E.; Ito, Fumito

    2016-01-01

    Induced pluripotent stem cells (iPSCs) derived from somatic cells of patients hold great promise for autologous cell therapies. One of the possible applications of iPSCs is to use them as a cell source for producing autologous lymphocytes for cell-based therapy against cancer. Tumor-infiltrating lymphocytes (TILs) that express programmed cell death protein-1 (PD-1) are tumor-reactive T cells, and adoptive cell therapy with autologous TILs has been found to achieve durable complete response in selected patients with metastatic melanoma. Here, we describe the derivation of human iPSCs from melanoma TILs expressing high level of PD-1 by Sendai virus-mediated transduction of the four transcription factors, OCT3/4, SOX2, KLF4, and c-MYC. TIL-derived iPSCs display embryonic stem cell-like morphology, have normal karyotype, express stem cell-specific surface antigens and pluripotency-associated transcription factors, and have the capacity to differentiate in vitro and in vivo. A wide variety of T cell receptor gene rearrangement patterns in TIL-derived iPSCs confirmed the heterogeneity of T cells infiltrating melanomas. The ability to reprogram TILs containing patient-specific tumor-reactive repertoire might allow the generation of patient- and tumor-specific polyclonal T cells for cancer immunotherapy. PMID:27057178

  7. Engineering adolescence: maturation of human pluripotent stem cell-derived cardiomyocytes.

    PubMed

    Yang, Xiulan; Pabon, Lil; Murry, Charles E

    2014-01-31

    The discovery of human pluripotent stem cells (hPSCs), including both human embryonic stem cells and human-induced pluripotent stem cells, has opened up novel paths for a wide range of scientific studies. The capability to direct the differentiation of hPSCs into functional cardiomyocytes has provided a platform for regenerative medicine, development, tissue engineering, disease modeling, and drug toxicity testing. Despite exciting progress, achieving the optimal benefits has been hampered by the immature nature of these cardiomyocytes. Cardiac maturation has long been studied in vivo using animal models; however, finding ways to mature hPSC cardiomyocytes is only in its initial stages. In this review, we discuss progress in promoting the maturation of the hPSC cardiomyocytes, in the context of our current knowledge of developmental cardiac maturation and in relation to in vitro model systems such as rodent ventricular myocytes. Promising approaches that have begun to be examined in hPSC cardiomyocytes include long-term culturing, 3-dimensional tissue engineering, mechanical loading, electric stimulation, modulation of substrate stiffness, and treatment with neurohormonal factors. Future studies will benefit from the combinatorial use of different approaches that more closely mimic nature's diverse cues, which may result in broader changes in structure, function, and therapeutic applicability.

  8. Engineering the human pluripotent stem cell microenvironment to direct cell fate.

    PubMed

    Hazeltine, Laurie B; Selekman, Joshua A; Palecek, Sean P

    2013-11-15

    Human pluripotent stem cells (hPSCs), including both embryonic stem cells and induced pluripotent stem cells, offer a potential cell source for research, drug screening, and regenerative medicine applications due to their unique ability to self-renew or differentiate to any somatic cell type. Before the full potential of hPSCs can be realized, robust protocols must be developed to direct their fate. Cell fate decisions are based on components of the surrounding microenvironment, including soluble factors, substrate or extracellular matrix, cell-cell interactions, mechanical forces, and 2D or 3D architecture. Depending on their spatio-temporal context, these components can signal hPSCs to either self-renew or differentiate to cell types of the ectoderm, mesoderm, or endoderm. Researchers working at the interface of engineering and biology have identified various factors which can affect hPSC fate, often based on lessons from embryonic development, and they have utilized this information to design in vitro niches which can reproducibly direct hPSC fate. This review highlights culture systems that have been engineered to promote self-renewal or differentiation of hPSCs, with a focus on studies that have elucidated the contributions of specific microenvironmental cues in the context of those culture systems. We propose the use of microsystem technologies for high-throughput screening of spatial-temporal presentation of cues, as this has been demonstrated to be a powerful approach for differentiating hPSCs to desired cell types.

  9. Putative immunogeni