Science.gov

Sample records for adult pure erythroid

  1. Secondary pure erythroid leukaemia in relapsed acute lymphoblastic leukaemia: lineage switch or chemotherapy effect?

    PubMed

    Gupta, Sanjeev Kumar; Kumar, Rajive; Chharchhodawala, Taher; Kumar, Lalit

    2014-05-19

    Pure erythroid leukaemia is a rare subtype of acute myeloid leukaemia (AML) and its occurrence at acute lymphoblastic leukaemia (ALL) relapse has not been reported earlier. A 39-year-old man received chemotherapy for Philadelphia-negative B cell ALL. Subsequently, he developed pure erythroid leukaemia with >80% immature erythroid precursors in bone marrow showing block positivity on periodic acid-Schiff stain, expressing CD71, CD34 but lacking CD235a. The interval between exposure to multidrug chemotherapy including cyclophosphamide and AML diagnosis was 2 years and 9 months. No cytogenetic abnormality was detected at the time of relapse. The patient died 2 weeks after starting AML chemotherapy. The relatively narrow time interval (usually 5-10 years) between chemotherapy and AML development and normal karyotype at relapse raises a possibility of lineage switch besides therapy-related AML as the likely pathogenesis. Further exploration of such cases may unravel the pathways responsible for lineage assignment in pluripotent stem cells.

  2. The uniqueness of morphological features of pure erythroid leukemia in myeloid neoplasm with erythroid predominance: A reassessment using criteria revised in the 2016 World Health Organization classification

    PubMed Central

    Liu, Yao-Chung; Yeh, Chiu-Mei; Gau, Jyh-Pyng; Yu, Yuan-Bin; Hsiao, Liang-Tsai; Tzeng, Cheng-Hwai; Chen, Po-Min; Chiou, Tzeon-Jye

    2017-01-01

    We reviewed 97 consecutive cases of myeloid neoplasm with erythroid predominance (MN-EP) between 2000 and 2015. Following 2016 WHO classification, MN-EP patients were classified into four groups. Eight pure erythroid leukemia (PEL) (including t-MN and AML-MRC morphologically fulfilled criteria for PEL) patients had dismal outcomes (median OS: 1 month) and showed more bone marrow fibrosis, worse performance status (PS) and higher serum lactate dehydrogenase (LDH) at diagnosis than the other groups. In the univariate analysis, risks of death in MN-EP patients included the morphologic features of PEL, very poor cytogenetic risk by IPSS-R, bone marrow fibrosis, leukocytosis, anemia, hypoalbuminemia, high LDH, and poor PS. In the multivariate analysis, independent predictors of death were morphologic features of PEL (adjusted hazards ratio [HR] 3.48, 95% confidence interval [CI] 1.24–9.74, p = 0.018), very poor cytogenetic risk by IPSS-R (adjusted HR 2.73, 95% CI 1.22–6.10, p = 0.015), hypoalbuminemia (< 3.7 g/dl) (adjusted HR 2.33, 95% CI 1.10–4.91, p = 0.026) and high serum LDH (≥ 250 U/L) (adjusted HR 2.36, 95% CI 1.28–4.36, p = 0.006). Poor or unfavorable risk in different cytogenetic risk systems independently predicted death and UKMRC-R was the best model. PMID:28196090

  3. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    SciTech Connect

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-06-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes.

  4. Characterization of thrombopoietin (TPO)-responsive progenitor cells in adult mouse bone marrow with in vivo megakaryocyte and erythroid potential.

    PubMed

    Ng, Ashley P; Kauppi, Maria; Metcalf, Donald; Di Rago, Ladina; Hyland, Craig D; Alexander, Warren S

    2012-02-14

    Hematopoietic progenitor cells are the progeny of hematopoietic stem cells that coordinate the production of precise numbers of mature blood cells of diverse functional lineages. Identification of cell-surface antigen expression associated with hematopoietic lineage restriction has allowed prospective isolation of progenitor cells with defined hematopoietic potential. To clarify further the cellular origins of megakaryocyte commitment, we assessed the in vitro and in vivo megakaryocyte and platelet potential of defined progenitor populations in the adult mouse bone marrow. We show that megakaryocytes arise from CD150(+) bipotential progenitors that display both platelet- and erythrocyte-producing potential in vivo and that can develop from the Flt3(-) fraction of the pregranulocyte-macrophage population. We define a bipotential erythroid-megakaryocyte progenitor population, the CD150(+)CD9(lo)endoglin(lo) fraction of Lin(-)cKit(+)IL7 receptor alpha(-)FcγRII/III(lo)Sca1(-) cells, which contains the bulk of the megakaryocyte colony-forming capacity of the bone marrow, including bipotential megakaryocyte-erythroid colony-forming capacity, and can generate both erythrocytes and platelets efficiently in vivo. This fraction is distinct from the CD150(+)CD9(hi)endoglin(lo) fraction, which contains bipotential precursors with characteristics of increased megakaryocytic maturation, and the CD150(+)CD9(lo)endoglin(hi) fraction, which contains erythroid lineage-committed cells. Finally, we demonstrate that bipotential erythroid-megakaryocyte progenitor and CD150(+)CD9(hi)endoglin(lo) cells are TPO-responsive and that the latter population specifically expands in the recovery from thrombocytopenia induced by anti-platelet serum.

  5. The role of Ikaros in human erythroid differentiation.

    PubMed

    Dijon, Marilyne; Bardin, Florence; Murati, Anne; Batoz, Michèle; Chabannon, Christian; Tonnelle, Cécile

    2008-02-01

    Ikaros--a factor that positively or negatively controls gene transcription--is active in murine adult erythroid cells, and involved in fetal to adult globin switching. Mice with Ikaros mutations have defects in erythropoiesis and anemia. In this paper, we have studied the role of Ikaros in human erythroid development for the first time. Using a gene-transfer strategy, we expressed Ikaros 6 (Ik6)--a known dominant--negative protein that interferes with normal Ikaros activity-in cord blood or apheresis CD34(+) cells that were induced to differentiate along the erythroid pathway. Lentivirally induced Ik6-forced expression resulted in increased cell death, decreased cell proliferation, and decreased expression of erythroid-specific genes, including GATA1 and fetal and adult globins. In contrast, we observed the maintenance of a residual myeloid population that can be detected in this culture system, with a relative increase of myeloid gene expression, including PU1. In secondary cultures, expression of Ik6 favored reversion of sorted and phenotypically defined erythroid cells into myeloid cells, and prevented reversion of myeloid cells into erythroid cells. We conclude that Ikaros is involved in human adult or fetal erythroid differentiation as well as in the commitment between erythroid and myeloid cells.

  6. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    PubMed Central

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  7. Erythroid development in the mammalian embryo.

    PubMed

    Baron, Margaret H; Vacaru, Andrei; Nieves, Johnathan

    2013-12-01

    Erythropoiesis is the process by which progenitors for red blood cells are produced and terminally differentiate. In all vertebrates, two morphologically distinct erythroid lineages (primitive, embryonic, and definitive, fetal/adult) form successively within the yolk sac, fetal liver, and marrow and are essential for normal development. Red blood cells have evolved highly specialized functions in oxygen transport, defense against oxidation, and vascular remodeling. Here we review key features of the ontogeny of red blood cell development in mammals, highlight similarities and differences revealed by genetic and gene expression profiling studies, and discuss methods for identifying erythroid cells at different stages of development and differentiation.

  8. A Comparison of Pure Tone Auditory Thresholds in Human Infants and Adults.

    PubMed

    Sinnott, Joan M; Pisoni, David B; Aslin, Richard N

    1983-01-01

    Pure tone auditory thresholds for frequencies from .250 to 8.0 kHz were obtained from 277-to-11-month-old human infants and nine adults using a go-no-go operant head-turning technique combined with an adaptive staircase (tracking) discrimination procedure. New methods were devised for maintaining infants under stimulus control during threshold testing through the use of randomly interleaved "probe" and "catch" trials. Reliable threshold data were obtained from every infant studied, and identical threshold criteria were applied to infants and adults alike. Although infant thresholds were 17-27 dB higher than those of adults, infant inter-subject variability was no greater than that of adults. Adult audiograms were nearly flat between frequencies of .500 and 8.0 kHz with sensitivity ranging between 7 and 14 dB SPL. Infant audiograms were flat between frequencies of .500 and 4.0 kHz, with sensitivity ranging between 30 and 36 dB SPL. The most sensitive frequency for infants was 8.0 kHz (25 dB SPL).

  9. Erythroid expression and DNAaseI-hypersensitive sites of the carbonic anhydrase 1 gene.

    PubMed Central

    Sowden, J; Edwards, M; Morrison, K; Butterworth, P H; Edwards, Y H

    1992-01-01

    The carbonic anhydrase 1 gene is expressed in adult human and mouse erythroid cells and colon epithelia from two distinct promoters. We have explored the erythroid promoter for cis-acting sequences involved in transcription using DNAaseI as a probe. Two DNAaseI-hypersensitive sites (DHS-1 and DHS-2) have been identified in the distal erythroid promoter in CA1-expressing erythroleukaemic cells. These sites are present at low levels in K562 cells, which have a foetal/embryonic phenotype and do not express CA1. DHS-1 and DHS-2 are not present in non-erythroid cells, including colon cells, which express CA1 from the proximal colon promoter. DHS-1 and DHS-2 were also generated in an heterologous CA1 gene containing 5 kb of erythroid promoter sequence after transfection into erythroid cells, including K562 cells. These transfection studies showed that both this fragment, and an abbreviated 817 bp promoter fragment which contains only DHS-1, were sufficient to confer erythroid-specific expression to a reporter gene. These promoters were active in cell lines expressing CA1 and in K562 cells. This latter observation implies that a developmental repressor factor is both present in K562 cells and binds to a cis-acting sequence that is absent from the sequence 5 kb upstream of the erythroid transcription start site. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:1463458

  10. A simple method to obtain pure cultures of multiciliated ependymal cells from adult rodents.

    PubMed

    Grondona, J M; Granados-Durán, P; Fernández-Llebrez, P; López-Ávalos, M D

    2013-01-01

    Ependymal cells form an epithelium lining the ventricular cavities of the vertebrate brain. Numerous methods to obtain primary culture ependymal cells have been developed. Most of them use foetal or neonatal rat brain and the few that utilize adult brain hardly achieve purity. Here, we describe a simple and novel method to obtain a pure non-adherent ependymal cell culture from explants of the striatal and septal walls of the lateral ventricles. The combination of a low incubation temperature followed by a gentle enzymatic digestion allows the detachment of most of the ependymal cells from the ventricular wall in a period of 6 h. Along with ependymal cells, a low percentage (less than 6 %) of non-ependymal cells also detaches. However, they do not survive under two restrictive culture conditions: (1) a simple medium (alpha-MEM with glucose) without any supplement; and (2) a low density of 1 cell/µl. This purification method strategy does not require cell labelling with antibodies and cell sorting, which makes it a simpler and cheaper procedure than other methods previously described. After a period of 48 h, only ependymal cells survive such conditions, revealing the remarkable survival capacity of ependymal cells. Ependymal cells can be maintained in culture for up to 7-10 days, with the best survival rates obtained in Neurobasal supplemented with B27 among the tested media. After 7 days in culture, ependymal cells lose most of the cilia and therefore the mobility, while acquiring radial glial cell markers (GFAP, BLBP, GLAST). This interesting fact might indicate a reprogramming of the cell identity.

  11. Heme-bound iron activates placenta growth factor in erythroid cells via erythroid Krüppel-like factor.

    PubMed

    Wang, Xunde; Mendelsohn, Laurel; Rogers, Heather; Leitman, Susan; Raghavachari, Nalini; Yang, Yanqin; Yau, Yu Ying; Tallack, Michael; Perkins, Andrew; Taylor, James G; Noguchi, Constance Tom; Kato, Gregory J

    2014-08-07

    In adults with sickle cell disease (SCD), markers of iron burden are associated with excessive production of the angiogenic protein placenta growth factor (PlGF) and high estimated pulmonary artery pressure. Enforced PlGF expression in mice stimulates production of the potent vasoconstrictor endothelin-1, producing pulmonary hypertension. We now demonstrate heme-bound iron (hemin) induces PlGF mRNA >200-fold in a dose- and time-dependent fashion. In murine and human erythroid cells, expression of erythroid Krüppel-like factor (EKLF) precedes PlGF, and its enforced expression in human erythroid progenitor cells induces PlGF mRNA. Hemin-induced expression of PlGF is abolished in EKLF-deficient murine erythroid cells but rescued by conditional expression of EKLF. Chromatin immunoprecipitation reveals that EKLF binds to the PlGF promoter region. SCD patients show higher level expression of both EKLF and PlGF mRNA in circulating blood cells, and markers of iron overload are associated with high PlGF and early mortality. Finally, PlGF association with iron burden generalizes to other human diseases of iron overload. Our results demonstrate a specific mechanistic pathway induced by excess iron that is linked in humans with SCD and in mice to markers of vasculopathy and pulmonary hypertension. These trials were registered at www.clinicaltrials.gov as #NCT00007150, #NCT00023296, #NCT00081523, and #NCT00352430.

  12. Haemoglobin biosynthesis site in rabbit embryo erythroid cells.

    PubMed

    Cianciarullo, Aurora M; Bertho, Alvaro L; Soares, Maurilio J; Hosoda, Tânia M; Nogueira-Silva, Simone; Beçak, Willy

    2003-01-01

    Properly metabolized globin synthesis and iron uptake are indispensable for erythroid cell differentiation and maturation. Mitochondrial participation is crucial in the process of haeme synthesis for cytochromes and haemoglobin. We studied the final biosynthesis site of haemoglobin using an ultrastructural approach, with erythroid cells obtained from rabbit embryos, in order to compare these results with those of animals treated with saponine or phenylhydrazine. Our results are similar to those obtained in assays with adult mammals, birds, amphibians, reptiles and fish, after induction of haemolytic anaemia. Therefore, the treatment did not interfere with the process studied, confirming our previous findings. Immunoelectron microscopy showed no labelling of mitochondria or other cellular organelles supposedly involved in the final biosynthesis of haemoglobin molecules, suggesting instead that it occurs free in the cytoplasm immediately after the liberation of haeme from the mitochondria, by electrostatic attraction between haeme and globin chains.

  13. Setd1a and NURF mediate chromatin dynamics and gene regulation during erythroid lineage commitment and differentiation

    PubMed Central

    Li, Ying; Schulz, Vincent P.; Deng, Changwang; Li, Guangyao; Shen, Yong; Tusi, Betsabeh K.; Ma, Gina; Stees, Jared; Qiu, Yi; Steiner, Laurie A.; Zhou, Lei; Zhao, Keji; Bungert, Jörg; Gallagher, Patrick G.; Huang, Suming

    2016-01-01

    The modulation of chromatin structure is a key step in transcription regulation in mammalian cells and eventually determines lineage commitment and differentiation. USF1/2, Setd1a and NURF complexes interact to regulate chromatin architecture in erythropoiesis, but the mechanistic basis for this regulation is hitherto unknown. Here we showed that Setd1a and NURF complexes bind to promoters to control chromatin structural alterations and gene activation in a cell context dependent manner. In human primary erythroid cells USF1/2, H3K4me3 and the NURF complex were significantly co-enriched at transcription start sites of erythroid genes, and their binding was associated with promoter/enhancer accessibility that resulted from nucleosome repositioning. Mice deficient for Setd1a, an H3K4 trimethylase, in the erythroid compartment exhibited reduced Ter119/CD71 positive erythroblasts, peripheral blood RBCs and hemoglobin levels. Loss of Setd1a led to a reduction of promoter-associated H3K4 methylation, inhibition of gene transcription and blockade of erythroid differentiation. This was associated with alterations in NURF complex occupancy at erythroid gene promoters and reduced chromatin accessibility. Setd1a deficiency caused decreased associations between enhancer and promoter looped interactions as well as reduced expression of erythroid genes such as the adult β-globin gene. These data indicate that Setd1a and NURF complexes are specifically targeted to and coordinately regulate erythroid promoter chromatin dynamics during erythroid lineage differentiation. PMID:27141965

  14. High yield extraction of pure spinal motor neurons, astrocytes and microglia from single embryo and adult mouse spinal cord

    PubMed Central

    Beaudet, Marie-Josée; Yang, Qiurui; Cadau, Sébastien; Blais, Mathieu; Bellenfant, Sabrina; Gros-Louis, François; Berthod, François

    2015-01-01

    Extraction of mouse spinal motor neurons from transgenic mouse embryos recapitulating some aspects of neurodegenerative diseases like amyotrophic lateral sclerosis has met with limited success. Furthermore, extraction and long-term culture of adult mouse spinal motor neurons and glia remain also challenging. We present here a protocol designed to extract and purify high yields of motor neurons and glia from individual spinal cords collected on embryos and adult (5-month-old) normal or transgenic mice. This method is based on mild digestion of tissue followed by gradient density separation allowing to obtain two millions motor neurons over 92% pure from one E14.5 single embryo and more than 30,000 from an adult mouse. These cells can be cultured more than 14 days in vitro at a density of 100,000 cells/cm2 to maintain optimal viability. Functional astrocytes and microglia and small gamma motor neurons can be purified at the same time. This protocol will be a powerful and reliable method to obtain motor neurons and glia to better understand mechanisms underlying spinal cord diseases. PMID:26577180

  15. Neonatal CD71+ erythroid cells do not modify murine sepsis mortality

    PubMed Central

    Wynn, James L.; Scumpia, Philip O.; Stocks, Blair T.; Romano-Keeler, Joann; Alrifai, Mhd Wael; Liu, Jin-Hua; Kim, Annette S.; Alford, Catherine E.; Matta, Pranathi; Weitkamp, Jörn-Hendrik; Moore, Daniel J.

    2015-01-01

    Sepsis is a major cause of neonatal mortality and morbidity worldwide. A recent report suggested murine neonatal host defense against infection could be compromised by immunosuppressive CD71+ erythroid splenocytes. We examined the impact of CD71+ erythroid splenocytes on murine neonatal mortality to endotoxin challenge or polymicrobial sepsis and characterized circulating CD71+ erythroid (CD235a+) cells in human neonates. Adoptive transfer or antibody-mediated reduction of neonatal CD71+ erythroid splenocytes did not alter murine neonatal survival to endotoxin challenge or polymicrobial sepsis challenge. Ex vivo immunosuppression of stimulated adult CD11b+ cells was not limited to neonatal splenocytes as it also occurred with adult and neonatal bone marrow. Animals treated with anti-CD71 antibody showed reduced splenic bacterial load following bacterial challenge compared to isotype-treated mice. However, adoptive transfer of enriched CD71+ erythroid splenocytes to CD71+-reduced animals did not reduce bacterial clearance. Human CD71+CD235a+ cells were common among cord blood mononuclear cells and were shown to be reticulocytes. In summary, a lack of effect on murine survival to polymicrobial sepsis following adoptive transfer or diminution of CD71+ erythroid splenocytes under these experimental conditions suggests the impact of these cells on neonatal infection risk and progression may be limited. An unanticipated immune priming effect of anti-CD71 antibody treatment was likely responsible for the reported enhanced bacterial clearance, rather than a reduction of immunosuppressive CD71+ erythroid splenocytes. In humans, the well-described rapid decrease in circulating reticulocytes after birth suggests they may have a limited role in reducing inflammation secondary to microbial colonization. PMID:26101326

  16. A pilot study of the body weight of pure-bred client-owned adult cats.

    PubMed

    Kienzle, Ellen; Moik, Katja

    2011-10-01

    A total of 539 pure-bred and seventy-five cats without a pedigree were weighed and scored at cat shows or in veterinary surgeries. Data from normal-weight cats with a body condition score (BCS) of 5 (ideal) were only used. Breeds were grouped into five classes. For female cats, the mean weight for these groups were as follows: very light (2.8 kg); light (3.2 kg); medium (3.5 kg); large (4.0 kg); giant (4.9) kg. For male cats, the corresponding values were 3.6, 4.2, 4.3, 5.1 and 6.1 kg. Siamese/Oriental Shorthair were identified as a very light breed, the Norwegian Forest and the Siberian Cat as a large breed and the Maine Coon as a giant breed. Males and females of the same breed did not always belong to the same class. In some breeds, individuals of the same sex were found in two different classes. The percentage of intact overweight cats (BCS >5) was low (7 % of intact males, 3 % of intact females). Incidence of overweight in neutered cats was 50 % in males and 38 % in females. Among pedigreed cats, there were differences in the incidence of overweight in neutered cats: high in Norwegian Forest Cats (males 75 %, females 50 %) and low in Siamese/Oriental Shorthair Cats (males 25 %, females 1 %). Cats with a BCS of 6, 7 and 8 had on average 120, 154 and 214 % of the normal weight of their breed, respectively.

  17. Cytarabine With or Without SCH 900776 in Treating Adult Patients With Relapsed Acute Myeloid Leukemia

    ClinicalTrials.gov

    2016-07-20

    Adult Acute Megakaryoblastic Leukemia; Adult Acute Monoblastic Leukemia; Adult Acute Monocytic Leukemia; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With Maturation; Adult Acute Myeloid Leukemia With Minimal Differentiation; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Myeloid Leukemia Without Maturation; Adult Acute Myelomonocytic Leukemia; Adult Erythroleukemia; Adult Pure Erythroid Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Recurrent Adult Acute Myeloid Leukemia

  18. Calcium Signaling Is Required for Erythroid Enucleation

    PubMed Central

    Russell, Sarah M.; Humbert, Patrick O.

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation. PMID:26731108

  19. A novel role for nuclear factor-erythroid 2 in erythroid maturation by modulation of mitochondrial autophagy

    PubMed Central

    Gothwal, Monika; Wehrle, Julius; Aumann, Konrad; Zimmermann, Vanessa; Gründer, Albert; Pahl, Heike L.

    2016-01-01

    We have recently demonstrated that the transcription factor nuclear factor-erythroid 2, which is critical for erythroid maturation and globin gene expression, plays an important role in the pathophysiology of myeloproliferative neoplasms. Myeloproliferative neoplasm patients display elevated levels of nuclear factor-erythroid 2 and transgenic mice overexpressing the transcription factor develop myeloproliferative neoplasm, albeit, surprisingly without erythrocytosis. Nuclear factor-erythroid 2 transgenic mice show both a reticulocytosis and a concomitant increase in iron deposits in the spleen, suggesting both enhanced erythrocyte production and increased red blood cell destruction. We therefore hypothesized that elevated nuclear factor-erythroid 2 levels may lead to increased erythrocyte destruction by interfering with organelle clearance during erythroid maturation. We have previously shown that nuclear factor-erythroid 2 overexpression delays erythroid maturation of human hematopoietic stem cells. Here we report that increased nuclear factor-erythroid 2 levels also impede murine maturation by retarding mitochondrial depolarization and delaying mitochondrial elimination. In addition, ribosome autophagy is delayed in transgenics. We demonstrate that the autophagy genes NIX and ULK1 are direct novel nuclear factor-erythroid 2 target genes, as these loci are bound by nuclear factor-erythroid 2 in chromatin immunoprecipitation assays. Moreover, Nix and Ulk1 expression is increased in transgenic mice and in granulocytes from polycythemia vera patients. This is the first report implying a role for nuclear factor-erythroid 2 in erythroid maturation by affecting autophagy. PMID:27479815

  20. Study of clinical, haematological and cytogenetic profile of patients with acute erythroid leukaemia

    PubMed Central

    Linu, Jacob Abraham; Udupa, MS Namratha; Madhumathi, DS; Lakshmaiah, KC; Babu, K Govind; Lokanatha, D; Babu, MC Suresh; Lokesh, KN; Rajeev, LK; Rudresha, AH

    2017-01-01

    Background Acute erythroid leukaemia (AEL) is a rare subtype of acute myeloid leukaemia (AML), constituting <5% of all the cases of AML. The World Health Organization (WHO) in 2001 classified AEL into two types: (1) erythroid/myeloid leukaemia which required ≥50% erythroid precursors with ≥20% of the non-erythroid cells to be myeloid blasts and (2) pure erythroleukemia (pEL) with ≥80% erythroblasts. The WHO 2008 classification kept these subcategories, but made erythroleukemia a diagnosis of exclusion. There are very few studies on the clinico haematological and cytogenetic profile of this disease, considering the rarity of its occurrence and poor prognosis. Materials and methods This study was done by retrospective analysis of data from 32 case files of patients diagnosed with AEL. Clinical details noted down were the demographic profile, peripheral blood smear details and bone marrow examination details: (1) blasts-erythroblasts and myeloblasts, (2) dysplasia in the cell lineages and (3) cytogenetic abnormalities. Results The most common presenting symptom was fever. Pancytopenia at presentation was seen in 81.25% of patients. Dysplasia was observed in bone marrow in 100% of erythroblasts and in 40% of myeloblasts in erythroid/myeloid subtype. In pure myeloid subtype, myeloid and megakaryocytic dysplasias were not obvious. Complex karyotype was noticed only in patients of pEL. Conclusion AEL is a rare group of heterogeneous diseases with many neoplastic and non-neoplastic conditions mimicking the diagnosis. The clinical presentation and cytogenetics are also non-specific, presenting additional challenges to the diagnosis. PMID:28144286

  1. Isolation and transcriptome analyses of human erythroid progenitors: BFU-E and CFU-E.

    PubMed

    Li, Jie; Hale, John; Bhagia, Pooja; Xue, Fumin; Chen, Lixiang; Jaffray, Julie; Yan, Hongxia; Lane, Joseph; Gallagher, Patrick G; Mohandas, Narla; Liu, Jing; An, Xiuli

    2014-12-04

    Burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) cells are erythroid progenitors traditionally defined by colony assays. We developed a flow cytometry-based strategy for isolating human BFU-E and CFU-E cells based on the changes in expression of cell surface markers during in vitro erythroid cell culture. BFU-E and CFU-E are characterized by CD45(+)GPA(-)IL-3R(-)CD34(+)CD36(-)CD71(low) and CD45(+)GPA(-)IL-3R(-)CD34(-)CD36(+)CD71(high) phenotypes, respectively. Colony assays validated phenotypic assignment giving rise to BFU-E and CFU-E colonies, both at a purity of ∼90%. The BFU-E colony forming ability of CD45(+)GPA(-)IL-3R(-)CD34(+)CD36(-)CD71(low) cells required stem cell factor and erythropoietin, while the CFU-E colony forming ability of CD45(+)GPA(-)IL-3R(-)CD34(-)CD36(+)CD71(high) cells required only erythropoietin. Bioinformatic analysis of the RNA-sequencing data revealed unique transcriptomes at each differentiation stage. The sorting strategy was validated in uncultured primary cells isolated from bone marrow, cord blood, and peripheral blood, indicating that marker expression is not an artifact of in vitro cell culture, but represents an in vivo characteristic of erythroid progenitor populations. The ability to isolate highly pure human BFU-E and CFU-E progenitors will enable detailed cellular and molecular characterization of these distinct progenitor populations and define their contribution to disordered erythropoiesis in inherited and acquired hematologic disease. Our data provides an important resource for future studies of human erythropoiesis.

  2. Endogenous K-ras signaling in erythroid differentiation.

    PubMed

    Zhang, Jing; Lodish, Harvey F

    2007-08-15

    K-ras is one of the most frequently mutated genes in virtually all types of human cancers. Using mouse fetal liver erythroid progenitors as a model system, we studied the role of endogenous K-ras signaling in erythroid differentiation. When oncogenic K-ras is expressed from its endogenous promoter, it hyperactivates cytokine-dependent signaling pathways and results in a partial block in erythroid differentiation. In erythroid progenitors deficient in K-ras, cytokine-dependent Akt activation is greatly reduced, leading to delays in erythroid differentiation. Thus, both loss- and gain-of-Kras functions affect erythroid differentiation through modulation of cytokine signaling. These results support the notion that in human cancer patients oncogenic Ras signaling might be controlled by antagonizing essential cytokines.

  3. Development of Erythroid Progenitors under Erythropoietin Stimulation in Xenopus laevis Larval Liver.

    PubMed

    Okui, Takehito; Hosozawa, Sakiko; Kohama, Satoka; Fujiyama, Shingo; Maekawa, Shun; Muto, Hiroshi; Kato, Takashi

    2016-12-01

    Erythroid progenitors that respond to erythropoietin (Epo) are present in the liver of adult Xenopus laevis. However, cells responding to Epo in the larval liver and through the metamorphosis period under hepatic remodeling have not been characterized. In this study, tadpoles were staged using the tables of Nieuwkoop and Faber (NF). Liver cells from pre- (NF56) or post- (NF66) metamorphic stage were cultured in the presence of Epo. β2-globin mRNA expression peaked at day 7 after the start of culture. Larval β2-globin was highly expressed in NF56-derived cells, while adult β2-globinwas detected in those of NF66. In both NF56- and NF66-derived cells, mRNA expression of eporand gata2 peaked at day 5 and days 3-4, respectively. In contrast, gata1 expression peaked at day 6 in NF56 cells and at day 5 in NF66 cells. Half maximal proliferation of erythrocytic blast cells derived from the liver at NF66 was observed at day 3, which was earlier than that of NF56. These results indicate that erythroid progenitors that respond to Xenopus laevis Epo are maintained in pre- and post-metamorphic liver, although the tissue architecture changes dramatically during metamorphosis. Additionally, the globin switching occurred, and/or the erythroid progenitors for larval erythrocytes were replaced by those for adult erythrocytes in the metamorphic liver.

  4. Acute erythroid leukemia with multilineage dysplasia in a cat.

    PubMed

    Shirani, Dariush; Nassiri, Seyed Mahdi; Aldavood, Seyed Javid; Seddigh, Hamideh Salari; Fathi, Ezzatollah

    2011-04-01

    Dysplastic features of erythroid and megakaryocytic lineages were observed in a cat with acute erythroid leukemia. We demonstrated that flow cytometry analysis of the expression of glycophorin A and CD71 by neoplastic cells can be helpful in the diagnosis of this type of feline leukemia.

  5. Isocitrate ameliorates anemia by suppressing the erythroid iron restriction response.

    PubMed

    Richardson, Chanté L; Delehanty, Lorrie L; Bullock, Grant C; Rival, Claudia M; Tung, Kenneth S; Kimpel, Donald L; Gardenghi, Sara; Rivella, Stefano; Goldfarb, Adam N

    2013-08-01

    The unique sensitivity of early red cell progenitors to iron deprivation, known as the erythroid iron restriction response, serves as a basis for human anemias globally. This response impairs erythropoietin-driven erythropoiesis and underlies erythropoietic repression in iron deficiency anemia. Mechanistically, the erythroid iron restriction response results from inactivation of aconitase enzymes and can be suppressed by providing the aconitase product isocitrate. Recent studies have implicated the erythroid iron restriction response in anemia of chronic disease and inflammation (ACDI), offering new therapeutic avenues for a major clinical problem; however, inflammatory signals may also directly repress erythropoiesis in ACDI. Here, we show that suppression of the erythroid iron restriction response by isocitrate administration corrected anemia and erythropoietic defects in rats with ACDI. In vitro studies demonstrated that erythroid repression by inflammatory signaling is potently modulated by the erythroid iron restriction response in a kinase-dependent pathway involving induction of the erythroid-inhibitory transcription factor PU.1. These results reveal the integration of iron and inflammatory inputs in a therapeutically tractable erythropoietic regulatory circuit.

  6. Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker.

    PubMed

    Zangrossi, Stefano; Marabese, Mirko; Broggini, Massimo; Giordano, Rosaria; D'Erasmo, Marco; Montelatici, Elisa; Intini, Daniela; Neri, Antonino; Pesce, Maurizio; Rebulla, Paolo; Lazzari, Lorenza

    2007-07-01

    The Oct-4 transcription factor, a member of the POU family that is also known as Oct-3 and Oct3/4, is expressed in totipotent embryonic stem cells (ES) and germ cells, and it has a unique role in development and in the determination of pluripotency. ES may have their postnatal counterpart in the adult stem cells, recently described in various mammalian tissues, and Oct-4 expression in putative stem cells purified from adult tissues has been considered a real marker of stemness. In this context, normal mature adult cells would not be expected to show Oct-4 expression. On the contrary, we demonstrated, using reverse transcription-polymerase chain reaction (PCR) (total RNA, Poly A+), real-time PCR, immunoprecipitation, Western blotting, band shift, and immunofluorescence, that human peripheral blood mononuclear cells, genetically stable and mainly terminally differentiated cells with well defined functions and a limited lifespan, express Oct-4. These observations raise the question as to whether the role of Oct-4 as a marker of pluripotency should be challenged. Our findings suggest that the presence of Oct-4 is not sufficient to define a cell as pluripotent, and that additional measures should be used to avoid misleading results in the case of an embryonic-specific gene with a large number of pseudogenes that may contribute to false identification of Oct-4 in adult stem cells. These unexpected findings may provide new insights into the role of Oct-4 in fully differentiated cells. Disclosure of potential conflicts of interest is found at the end of this article.

  7. The exosome complex establishes a barricade to erythroid maturation

    PubMed Central

    McIver, Skye C.; Kang, Yoon-A; DeVilbiss, Andrew W.; O’Driscoll, Chelsea A.; Ouellette, Jonathan N.; Pope, Nathaniel J.; Camprecios, Genis; Chang, Chan-Jung; Yang, David; Bouhassira, Eric E.; Ghaffari, Saghi

    2014-01-01

    Complex genetic networks control hematopoietic stem cell differentiation into progenitors that give rise to billions of erythrocytes daily. Previously, we described a role for the master regulator of erythropoiesis, GATA-1, in inducing genes encoding components of the autophagy machinery. In this context, the Forkhead transcription factor, Foxo3, amplified GATA-1–mediated transcriptional activation. To determine the scope of the GATA-1/Foxo3 cooperativity, and to develop functional insights, we analyzed the GATA-1/Foxo3-dependent transcriptome in erythroid cells. GATA-1/Foxo3 repressed expression of Exosc8, a pivotal component of the exosome complex, which mediates RNA surveillance and epigenetic regulation. Strikingly, downregulating Exosc8, or additional exosome complex components, in primary erythroid precursor cells induced erythroid cell maturation. Our results demonstrate a new mode of controlling erythropoiesis in which multiple components of the exosome complex are endogenous suppressors of the erythroid developmental program. PMID:25115889

  8. The mechanism of expansion of late erythroid progenitors during erythroid regeneration: target cells and effects of erythropoietin and interleukin-3.

    PubMed

    Umemura, T; Papayannopoulou, T; Stamatoyannopoulos, G

    1989-05-15

    Through immunologic means we have been able to separate primate bone marrow cells into populations containing late erythroid progenitors (colony forming units [CFUe] and e-clusters) but depleted of early erythroid progenitors (burst-forming units [BFUe]) or populations enriched in BFUe in relation to late progenitors. We used these fractionated populations in a two stage liquid/semisolid culture system and have assessed the effect of erythropoietin (Epo) and interleukin-3 (IL-3) on the proliferation and differentiation of erythroid progenitors in the presence or absence of early progenitors. We found that populations that contained CFUe but were depleted of BFUe failed to show any amplification of CFUe or e-clusters in the presence of Epo (or Epo plus IL-3). In contrast, populations containing BFUe yielded a striking (sixfold for CFUe; 23-fold for e-clusters) expansion of late progenitors in the presence of Epo. Maximum amplification (15-fold for CFUe; 32-fold for e-clusters) was achieved when both IL-3 and Epo were present in culture. Our results imply that CFUe and e-clusters lack the capacity to amplify their numbers and suggests that the expansion of late erythroid progenitors during rapid erythroid regeneration is accomplished by influx of BFUe rather than amplification of CFUe. These data are of relevance to models of acute marrow expansion and to the mechanism of activation of fetal hemoglobin production during rapid erythroid regeneration.

  9. PPAR-α and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal.

    PubMed

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M Inmaculada; Li, Hu; Elmes, Russell R; Peters, Luanne L; Lodish, Harvey F

    2015-06-25

    Many acute and chronic anaemias, including haemolysis, sepsis and genetic bone marrow failure diseases such as Diamond-Blackfan anaemia, are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production. Treatment of these anaemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently, we showed that glucocorticoids specifically stimulate self-renewal of an early erythroid progenitor, burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells. Here we show that activation of the peroxisome proliferator-activated receptor α (PPAR-α) by the PPAR-α agonists GW7647 and fenofibrate synergizes with the glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures of both mouse fetal liver BFU-Es and mobilized human adult CD34(+) peripheral blood progenitors, with a new and effective culture system being used for the human cells that generates normal enucleated reticulocytes. Although Ppara(-/-) mice show no haematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPAR-α agonists facilitate recovery of wild-type but not Ppara(-/-) mice from PHZ-induced acute haemolytic anaemia. We also show that PPAR-α alleviates anaemia in a mouse model of chronic anaemia. Finally, both in control and corticosteroid-treated BFU-E cells, PPAR-α co-occupies many chromatin sites with GR; when activated by PPAR-α agonists, additional PPAR-α is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPAR-α agonists in stimulating self-renewal of early erythroid

  10. PPARα and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal

    PubMed Central

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M. Inmaculada; Li, Hu; Elmes, Russell R.; Peters, Luanne L.; Lodish, Harvey F.

    2015-01-01

    Summary Many acute and chronic anemias, including hemolysis, sepsis, and genetic bone marrow failure diseases such as Diamond-Blackfan Anemia (DBA), are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production 1,2,3–5,6,7,8,9. Treatment of these anemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently we showed that glucocorticoids specifically stimulate self-renewal of the early erythroid progenitor, the burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells 10,11. Here we demonstrate that activation of the peroxisome proliferator-activated receptor alpha (PPARα) by PPARα agonists, GW7647 and fenofibrate, synergizes with glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures both of mouse fetal liver BFU-Es and of mobilized human adult CD34+ peripheral blood progenitors, the latter employing a new and effective culture system that generates normal enucleated reticulocytes. While PPARα−/− mice show no hematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPARα agonists facilitate recovery of wild-type mice, but not PPARα−/− mice, from PHZ-induced acute hemolytic anemia. We also showed that PPARα alleviates anemia in a mouse model of chronic anemia. Finally, both in control and corticosteroid-treated BFU-E cells PPARα co-occupies many chromatin sites with GR; when activated by PPARα agonists, additional PPARα is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPARα agonists in stimulating self

  11. Regulation of erythroid cell-specific gene expression during erythropoiesis.

    PubMed Central

    Harrison, P. R.; Plumb, M.; Frampton, J.; Llewellyn, D.; Chester, J.; Chambers, I.; MacLeod, K.; Fleming, J.; O'Prey, J.; Walker, M.

    1988-01-01

    The aim of our group's work over the past few years has been to investigate the molecular mechanisms regulating erythroid cell-specific gene expression during erythroid cell differentiation. In addition to the alpha-globin gene, we have focussed on two non-globin genes of interest encoding the rabbit red cell-specific lipoxygenase (LOX) and the mouse glutathione peroxidase (GSHPX), an important seleno-enzyme responsible for protection against peroxide-damage. Characterisation of the GSHPX gene showed that the seleno-cysteine residue in the active site of the enzyme is encoded by UGA, which usually functions as a translation-termination codon. This novel finding has important implications regarding mRNA sequence context effects affecting codon recognition. The regulation of the GSHPX and red cell LOX genes has been investigated by functional transfection experiments. The 700 bp upstream of the GSHPX promoter seems to function equally well when linked to the bacterial chloramphenicol acetyl transferase (CAT) gene and transfected into mouse erythroid or fibroblast cell lines. However, the presence of tissue-specific DNase I hypersensitive sites (DHSS) in the 3' flanking region of the GSHPX gene suggests that such sites may be important in its regulation in the various cell types in which it is highly expressed, i.e., erythroid cells, liver and kidney. The transcription unit of the RBC LOX gene has also been defined and 5' and 3' flanking regions are being investigated for erythroid-specific regulatory elements: a region upstream of the LOX gene gives increased expression of a linked CAT gene when transfected into mouse erythroid cell lines compared to non-erythroid cell lines.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3151147

  12. Pathogenesis of the erythroid failure in Diamond Blackfan anaemia.

    PubMed

    Sieff, Colin A; Yang, Jing; Merida-Long, Lilia B; Lodish, Harvey F

    2010-02-01

    Diamond Blackfan anaemia (DBA) is a severe congenital failure of erythropoiesis. Despite mutations in one of several ribosome protein genes, including RPS19, the cause of the erythroid specificity is still a mystery. We hypothesized that, because the chromatin of late erythroid cells becomes condensed and transcriptionally inactive prior to enucleation, the rapidly proliferating immature cells require very high ribosome synthetic rates. RNA biogenesis was measured in primary mouse fetal liver erythroid progenitor cells; during the first 24 h, cell number increased three to fourfold while, remarkably, RNA content increased sixfold, suggesting an accumulation of an excess of ribosomes during early erythropoiesis. Retrovirus infected siRNA RPS19 knockdown cells showed reduced proliferation but normal differentiation, and cell cycle analysis showed a G1/S phase delay. p53 protein was increased in the knockdown cells, and the mRNA level for p21, a transcriptional target of p53, was increased. Furthermore, we show that RPS19 knockdown decreased MYB protein, and Kit mRNA was reduced, as was the amount of cell surface KIT protein. Thus, in this small hairpin RNA murine model of DBA, RPS19 insufficient erythroid cells may proliferate poorly because of p53-mediated cell cycle arrest, and also because of decreased expression of the key erythroid signalling protein KIT.

  13. Reference ranges of handgrip strength from 125,462 healthy adults in 21 countries: a prospective urban rural epidemiologic (PURE) study

    PubMed Central

    Teo, Koon K.; Rangarajan, Sumathy; Kutty, V. Raman; Lanas, Fernando; Hui, Chen; Quanyong, Xiang; Zhenzhen, Qian; Jinhua, Tang; Noorhassim, Ismail; AlHabib, Khalid F; Moss, Sarah J.; Rosengren, Annika; Akalin, Ayse Arzu; Rahman, Omar; Chifamba, Jephat; Orlandini, Andrés; Kumar, Rajesh; Yeates, Karen; Gupta, Rajeev; Yusufali, Afzalhussein; Dans, Antonio; Avezum, Álvaro; Lopez‐Jaramillo, Patricio; Poirier, Paul; Heidari, Hosein; Zatonska, Katarzyna; Iqbal, Romaina; Khatib, Rasha; Yusuf, Salim

    2016-01-01

    Abstract Background The measurement of handgrip strength (HGS) has prognostic value with respect to all‐cause mortality, cardiovascular mortality and cardiovascular disease, and is an important part of the evaluation of frailty. Published reference ranges for HGS are mostly derived from Caucasian populations in high‐income countries. There is a paucity of information on normative HGS values in non‐Caucasian populations from low‐ or middle‐income countries. The objective of this study was to develop reference HGS ranges for healthy adults from a broad range of ethnicities and socioeconomically diverse geographic regions. Methods HGS was measured using a Jamar dynamometer in 125,462 healthy adults aged 35‐70 years from 21 countries in the Prospective Urban Rural Epidemiology (PURE) study. Results HGS values differed among individuals from different geographic regions. HGS values were highest among those from Europe/North America, lowest among those from South Asia, South East Asia and Africa, and intermediate among those from China, South America, and the Middle East. Reference ranges stratified by geographic region, age, and sex are presented. These ranges varied from a median (25th–75th percentile) 50 kg (43–56 kg) in men <40 years from Europe/North America to 18 kg (14–20 kg) in women >60 years from South East Asia. Reference ranges by ethnicity and body‐mass index are also reported. Conclusions Individual HGS measurements should be interpreted using region/ethnic‐specific reference ranges. PMID:27104109

  14. Biology of Heme in Mammalian Erythroid Cells and Related Disorders

    PubMed Central

    Fujiwara, Tohru; Harigae, Hideo

    2015-01-01

    Heme is a prosthetic group comprising ferrous iron (Fe2+) and protoporphyrin IX and is an essential cofactor in various biological processes such as oxygen transport (hemoglobin) and storage (myoglobin) and electron transfer (respiratory cytochromes) in addition to its role as a structural component of hemoproteins. Heme biosynthesis is induced during erythroid differentiation and is coordinated with the expression of genes involved in globin formation and iron acquisition/transport. However, erythroid and nonerythroid cells exhibit distinct differences in the heme biosynthetic pathway regulation. Defects of heme biosynthesis in developing erythroblasts can have profound medical implications, as represented by sideroblastic anemia. This review will focus on the biology of heme in mammalian erythroid cells, including the heme biosynthetic pathway as well as the regulatory role of heme and human disorders that arise from defective heme synthesis. PMID:26557657

  15. Abnormal erythroid cell proliferation and myelofibrosis in a cat.

    PubMed

    Iwanaga, Tomoko; Miura, Naoki; Miyoshi, Noriaki; Endo, Yasuyuki; Momoi, Yasuyuki

    2012-07-01

    A cat was presented with severe progressive anemia despite marked erythroblastosis. The cat was negative for feline leukemia virus antigen and feline immunodeficiency virus antibody. Bone marrow cytology revealed an excess of erythroid cells with a predominance of prorubricytes and basophilic rubricytes. No response to immunosuppressive therapy was obtained, and a tentative diagnosis of myelodysplastic syndrome was made. The cat showed a partial response to low-dose cytarabine (20 mg/m(2) subcutaneously q24) but died 51 days after the 1st admission. Histopathological examination revealed fibrosis in the bone marrow and marked infiltration of erythroid cells into other organs.

  16. Evaluation of hematopoietic cells and myeloid/erythroid ratio in the bone marrow of the pheasant (Phasianus colchicus).

    PubMed

    Tadjalli, Mina; Nazifi, Saeed; Haghjoo, Rahil

    2013-01-01

    In order to study the normal hematopoiesis, cellular components and myeloid/erythroid (M/E) ratio in the bone marrow of the pheasant (Phasianus colchicus), bone marrow samples were collected from the proximal tibiotarsus bone of 16 clinically healthy adult pheasant. The bone marrow smears were stained using the Giemsa stain. The results indicated that the development and formation of blood cells in the bone marrow of pheasant were similar to other birds, whereas the morphology of the cells was similar to chickens, ducks, quail, and black-head gull. The mean M/E ratio was 1.24, the mean erythroid percentage was 42.24, the mean myeloid percentage was 52.62, and the mean percentage of all other cells percentage was 5.38. There was no significant difference in any of the cellular composition between male and female.

  17. Nitrogen excretion of adult sheep fed silages made of a mixed sward or of pure unfertilised grass alone and in combination with barley.

    PubMed

    Seip, Katharina; Breves, Gerhard; Isselstein, Johannes; Abel, Hansjörg

    2011-08-01

    Four adult rumen-fistulated wether sheep were fed silages combined with barley. The silages consisted of 48% grasses, 28% legumes and 24% other forbs (GCF) or of pure grass (G). The swards received no mineral fertiliser. The dry matter (DM) and fibre contents were lower in GCF than in G. Crude protein content of DM in GCF and G were 145 g/kg and 102 g/kg respectively. DM content as ash, lipids and non-fibrous carbohydrates were rather similar in both silages. About 40g DM were offered per kg BW0.75 and day either as silage alone or as a mixture of silage and barley (60:40). Faecal N excretion was greater with GCF than with G. The proportion of faecal bacterial and endogenous debris N reached 75 and 73% when GCF or G was fed, respectively. Undigested dietary N represented about 20%, and water soluble N accounted for 5-6% of faecal N. GCF caused more urinary N than G. Barley reduced urinary N excretion when supplemented to GCF. No dietary influence on urinary non-urea nitrogenous compounds was shown. GCF caused higher urinary urea N excretion than G and barley reduced this fraction when replacing part of GCF. Based on the urinary urea N proportions, it is concluded that N intake exceeded N requirement for any of the four diets fed. Dietary supplementation of ruminally fermentable carbohydrates can reduce urinary N excretion and this improves the efficiency of utilisation of N in N-unfertilised biodiverse grassland/ruminant farming systems.

  18. TMEM14C is required for erythroid mitochondrial heme metabolism

    PubMed Central

    Yien, Yvette Y.; Robledo, Raymond F.; Schultz, Iman J.; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E.; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J.; Cooney, Jeffrey D.; Pierce, Eric L.; Mohler, Kyla; Dailey, Tamara A.; Miyata, Non; Kingsley, Paul D.; Garone, Caterina; Hattangadi, Shilpa M.; Huang, Hui; Chen, Wen; Keenan, Ellen M.; Shah, Dhvanit I.; Schlaeger, Thorsten M.; DiMauro, Salvatore; Orkin, Stuart H.; Cantor, Alan B.; Palis, James; Koehler, Carla M.; Lodish, Harvey F.; Kaplan, Jerry; Ward, Diane M.; Dailey, Harry A.; Phillips, John D.; Peters, Luanne L.; Paw, Barry H.

    2014-01-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias. PMID:25157825

  19. Growth factor independence 1b (gfi1b) is important for the maturation of erythroid cells and the regulation of embryonic globin expression.

    PubMed

    Vassen, Lothar; Beauchemin, Hugues; Lemsaddek, Wafaa; Krongold, Joseph; Trudel, Marie; Möröy, Tarik

    2014-01-01

    Growth factor independence 1b (GFI1B) is a DNA binding repressor of transcription with vital functions in hematopoiesis. Gfi1b-null embryos die at midgestation very likely due to defects in erythro- and megakaryopoiesis. To analyze the full functionality of Gfi1b, we used conditionally deficient mice that harbor floxed Gfi1b alleles and inducible (Mx-Cre, Cre-ERT) or erythroid specific (EpoR-Cre) Cre expressing transgenes. In contrast to the germline knockout, EpoR-Cre mediated erythroid specific ablation of Gfi1b allows full gestation, but causes perinatal lethality with very few mice surviving to adulthood. Both the embryonic deletion of Gfi1b by EpoR-Cre and the deletion in adult mice by Mx-Cre or Cre-ERT leads to reduced numbers of erythroid precursors, perturbed and delayed erythroid maturation, anemia and extramedullary erythropoiesis. Global expression analyses showed that the Hba-x, Hbb-bh1 and Hbb-y embryonic globin genes were upregulated in Gfi1b deficient TER119+ fetal liver cells over the gestation period from day 12.5-17.5 p.c. and an increased level of Hbb-bh1 and Hbb-y embryonic globin gene expression was even maintained in adult Gfi1b deficient mice. While the expression of Bcl11a, a regulator of embryonic globin expression was not affected by Gfi1b deficiency, the expression of Gata1 was reduced and the expression of Sox6, also involved in globin switch, was almost entirely lost when Gfi1b was absent. These findings establish Gfi1b as a regulator of embryonic globin expression and embryonic and adult erythroid maturation.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    SciTech Connect

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. UFBP1, a Key Component of the Ufm1 Conjugation System, Is Essential for Ufmylation-Mediated Regulation of Erythroid Development

    PubMed Central

    Cai, Yafei; Pi, Wenhu; Sivaprakasam, Satish; Zhu, Xiaobin; Zhang, Mingsheng; Chen, Jijun; Makala, Levi; Lu, Chunwan; Wu, Jianchu; Teng, Yong; Pace, Betty; Tuan, Dorothy; Singh, Nagendra; Li, Honglin

    2015-01-01

    The Ufm1 conjugation system is an ubiquitin-like modification system that consists of Ufm1, Uba5 (E1), Ufc1 (E2), and less defined E3 ligase(s) and targets. The biological importance of this system is highlighted by its essential role in embryogenesis and erythroid development, but the underlying mechanism is poorly understood. UFBP1 (Ufm1 binding protein 1, also known as DDRGK1, Dashurin and C20orf116) is a putative Ufm1 target, yet its exact physiological function and impact of its ufmylation remain largely undefined. In this study, we report that UFBP1 is indispensable for embryonic development and hematopoiesis. While germ-line deletion of UFBP1 caused defective erythroid development and embryonic lethality, somatic ablation of UFBP1 impaired adult hematopoiesis, resulting in pancytopenia and animal death. At the cellular level, UFBP1 deficiency led to elevated ER (endoplasmic reticulum) stress and activation of unfolded protein response (UPR), and consequently cell death of hematopoietic stem/progenitor cells. In addition, loss of UFBP1 suppressed expression of erythroid transcription factors GATA-1 and KLF1 and blocked erythroid differentiation from CFU-Es (colony forming unit-erythroid) to proerythroblasts. Interestingly, depletion of Uba5, a Ufm1 E1 enzyme, also caused elevation of ER stress and under-expression of erythroid transcription factors in erythroleukemia K562 cells. By contrast, knockdown of ASC1, a newly identified Ufm1 target that functions as a transcriptional co-activator of hormone receptors, led to down-regulation of erythroid transcription factors, but did not elevate basal ER stress. Furthermore, we found that ASC1 was associated with the promoters of GATA-1 and Klf1 in a UFBP1-dependent manner. Taken together, our findings suggest that UFBP1, along with ASC1 and other ufmylation components, play pleiotropic roles in regulation of hematopoietic cell survival and differentiation via modulating ER homeostasis and erythroid lineage

  2. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation.

    PubMed

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F

    2014-09-29

    While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of posttranscriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid-important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3, Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus, transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation.

  3. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation

    PubMed Central

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F.

    2014-01-01

    SUMMARY While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of post-transcriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3 Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation. PMID:25220394

  4. Down-regulation of Myc is essential for terminal erythroid maturation.

    PubMed

    Jayapal, Senthil Raja; Lee, Kian Leong; Ji, Peng; Kaldis, Philipp; Lim, Bing; Lodish, Harvey F

    2010-12-17

    Terminal differentiation of mammalian erythroid progenitors involves 4-5 cell divisions and induction of many erythroid important genes followed by chromatin and nuclear condensation and enucleation. The protein levels of c-Myc (Myc) are reduced dramatically during late stage erythroid maturation, coinciding with cell cycle arrest in G(1) phase and enucleation, suggesting possible roles for c-Myc in either or both of these processes. Here we demonstrate that ectopic Myc expression affects terminal erythroid maturation in a dose-dependent manner. Expression of Myc at physiological levels did not affect erythroid differentiation or cell cycle shutdown but specifically blocked erythroid nuclear condensation and enucleation. Continued Myc expression prevented deacetylation of several lysine residues in histones H3 and H4 that are normally deacetylated during erythroid maturation. The histone acetyltransferase Gcn5 was up-regulated by Myc, and ectopic Gcn5 expression partially blocked enucleation and inhibited the late stage erythroid nuclear condensation and histone deacetylation. When overexpressed at levels higher than the physiological range, Myc blocked erythroid differentiation, and the cells continued to proliferate in cytokine-free, serum-containing culture medium with an early erythroblast morphology. Gene expression analysis demonstrated the dysregulation of erythropoietin signaling pathway and the up-regulation of several positive regulators of G(1)-S cell cycle checkpoint by supraphysiological levels of Myc. These results reveal an important dose-dependent function of Myc in regulating terminal maturation in mammalian erythroid cells.

  5. Pure red cell aplasia (PRCA): Response of three patients of cyclophosphamide and/or antilymphocyte globulin (ALG) and demonstration of two types of serum IgG inhibitors to erythropoiesis.

    PubMed

    Marmont, A; Peschle, C; Sanguineti, M; Condorelli, M

    1975-02-01

    Three cases of adult pure red cell aplasia (PRCA) ARE REPORTED. All patients proved refractory to various combinations of androgens and corticosteroids. The first case, harboring a thymoma, showed a complete clinical remission following cyclophosphamide therapy. The second and third responded similarly to either a combined cyclophosphamide + antilymphocyte globulin (ALG) treatment or to ALG administration preceded by a small dosage of cyclophosphamide, which had proved ineffective when administered alone. Serum IgG inhibitors to erythropoiesis were demonstrated in all cases by means of in vivo and/or in vitro techniques. The inhibitor(s), although directed against the erythroid marrow in both the first and third patients (PRCA type A), apparently functioned as an antibody to circulating erythropoientin (Ep) in the second case (PRCA type B). The inhibitor(s) was always absent in postremission samples. Additionally, experimental models for both types of human PRCA were established in normal rodents. The present studies support the contention that adult PRCA is an autoimmune disease. The therapeutic role of cytotoxic-immunodepressive agents in PRCA patients is confirmed. It is emphasized that ALG may represent an additional therapeutic tool in cases resistant to cyclophosphamide and/or steroids. In addition, cyclophosphamide proved effective in a patient harboring a thymoma not amenable to surgery. Finally, it is postulated that IgG serum autoantibodies, directed against either an early erythroid precursor (PRCA type A) or, more rarely, circulating Ep (PRCA type B), play a major role in the pathogenesis of the disease.

  6. Erythroid Krüppel-like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 5'HS3 of the beta-globin locus control region.

    PubMed

    Tewari, R; Gillemans, N; Wijgerde, M; Nuez, B; von Lindern, M; Grosveld, F; Philipsen, S

    1998-04-15

    Disruption of the gene for transcription factor EKLF (erythroid Krüppel-like factor) results in fatal anaemia caused by severely reduced expression of the adult beta-globin gene, while other erythroid-specific genes, including the embryonic epsilon- and fetal gamma-globin genes, are expressed normally. Thus, EKLF is thought to be a stage-specific factor acting through the CACC box in the beta-gene promoter, even though it is already present in embryonic red cells. Here, we show that a beta-globin gene linked directly to the locus control region (LCR) is expressed at embryonic stages, and that this is only modestly reduced in EKLF-/- embryos. Thus, embryonic beta-globin expression is not intrinsically dependent on EKLF. To investigate whether EKLF functions in the locus control region, we analysed the expression of LCR-driven lacZ reporters. This shows that EKLF is not required for reporter activation by the complete LCR. However, embryonic expression of reporters driven by 5'HS3 of the LCR requires EKLF. This suggests that EKLF interacts directly with the CACC motifs in 5'HS3 and demonstrates that EKLF is also a transcriptional activator in embryonic erythropoiesis. Finally, we show that overexpression of EKLF results in an earlier switch from gamma- to beta-globin expression. Adult mice with the EKLF transgene have reduced platelet counts, suggesting that EKLF levels affect the balance between the megakaryocytic and erythroid lineages. Interestingly, the EKLF transgene rescues the lethal phenotype of EKLF null mice, setting the stage for future studies aimed at the analysis of the EKLF protein and its role in beta-globin gene activation.

  7. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells.

    PubMed

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes.

  8. High-Efficiency Serum-Free Feeder-Free Erythroid Differentiation of Human Pluripotent Stem Cells Using Small Molecules.

    PubMed

    Olivier, Emmanuel N; Marenah, Lamin; McCahill, Angela; Condie, Alison; Cowan, Scott; Mountford, Joanne C

    2016-10-01

    : This article describes a good manufacturing practice (GMP)-compatible, feeder-free and serum-free method to produce large numbers of erythroid cells from human pluripotent stem cells (hPSCs), either embryonic or induced. This multistep protocol combines cytokines and small molecules to mimic and surpass the early stages of development. It produces, without any selection or sorting step, a population of cells in which 91.8% ± 5.4% express CD34 at day 7, 98.6% ± 1.3% express CD43 at day 10, and 99.1% ± 0.95% of cells are CD235a positive by day 31 of the differentiation process. Moreover, this differentiation protocol supports extensive expansion, with a single hPSC producing up to 150 hematopoietic progenitor cells by day 10 and 50,000-200,000 erythroid cells by day 31. The erythroid cells produced exhibit a definitive fetal hematopoietic type, with 90%-95% fetal globin and variable proportion of embryonic and adult globin at the protein level. The presence of small molecules during the differentiation protocol has quantitative and qualitative effects; it increases the proportion of adult globin and decreases the proportion of embryonic globin. Given its level of definition, this system provides a powerful tool for investigation of the mechanisms governing early hematopoiesis and erythropoiesis, including globin switching and enucleation. The early stages of the differentiation protocol could also serve as a starting point for the production of endothelial cells and other hematopoietic cells, or to investigate the production of long-term reconstituting hematopoietic stem cells from hPSCs.

  9. Human uroporphyrinogen-III synthase: genomic organization, alternative promoters, and erythroid-specific expression.

    PubMed

    Aizencang, G; Solis, C; Bishop, D F; Warner, C; Desnick, R J

    2000-12-01

    Uroporphyrinogen-III (URO) synthase is the heme biosynthetic enzyme defective in congenital erythropoietic porphyria. The approximately 34-kb human URO-synthase gene (UROS) was isolated, and its organization and tissue-specific expression were determined. The gene had two promoters that generated housekeeping and erythroid-specific transcripts with unique 5'-untranslated sequences (exons 1 and 2A) followed by nine common coding exons (2B to 10). Expression arrays revealed that the housekeeping transcript was present in all tissues, while the erythroid transcript was only in erythropoietic tissues. The housekeeping promoter lacked TATA and SP1 sites, consistent with the observed low level expression in most cells, whereas the erythroid promoter contained GATA1 and NF-E2 sites for erythroid specificity. Luciferase reporter assays demonstrated that the housekeeping promoter was active in both erythroid K562 and HeLa cells, while the erythroid promoter was active only in erythroid cells and its activity was increased during hemin-induced erythroid differentiation. Thus, human URO-synthase expression is regulated during erythropoiesis by an erythroid-specific alternative promoter.

  10. AKT induces erythroid-cell maturation of JAK2-deficient fetal liver progenitor cells and is required for Epo regulation of erythroid-cell differentiation.

    PubMed

    Ghaffari, Saghi; Kitidis, Claire; Zhao, Wei; Marinkovic, Dragan; Fleming, Mark D; Luo, Biao; Marszalek, Joseph; Lodish, Harvey F

    2006-03-01

    AKT serine threonine kinase of the protein kinase B (PKB) family plays essential roles in cell survival, growth, metabolism, and differentiation. In the erythroid system, AKT is known to be rapidly phosphorylated and activated in response to erythropoietin (Epo) engagement of Epo receptor (EpoR) and to sustain survival signals in cultured erythroid cells. Here we demonstrate that activated AKT complements EpoR signaling and supports erythroid-cell differentiation in wild-type and JAK2-deficient fetal liver cells. We show that erythroid maturation of AKT-transduced cells is not solely dependent on AKT-induced cell survival or proliferation signals, suggesting that AKT transduces also a differentiation-specific signal downstream of EpoR in erythroid cells. Down-regulation of expression of AKT kinase by RNA interference, or AKT activity by expression of dominant negative forms, inhibits significantly fetal liver-derived erythroid-cell colony formation and gene expression, demonstrating that AKT is required for Epo regulation of erythroid-cell maturation.

  11. Tolerance and autoimmunity to erythroid differentiation (B-G) major histocompatibility complex alloantigens of the chicken

    PubMed Central

    1982-01-01

    Hematopoietic chimeras were produced at four different stages of ontogeny between two allogeneic strains of chickens. All chimeras produced by parabiosis at day 12 of embryogenesis and the majority (83%) of the ones produced at day 15 by intravenous injection of allogeneic stem cells remained healthy, chimeric, and specifically tolerant at both the humoral and cell-mediated level throughout a long examination period. Chimeras generated at day 17 of embryogenesis demonstrated specific unresponsiveness at the cell-mediated level but produced specific anti-donor alloantibodies directed against erythrocyte-associated major histocompatibility complex (MHC) (B-G) antigens. These chimeras and a minority (17%) of the chimeras generated at day 15 of embryogenesis developed severe antibody-mediated autoimmune hemolytic anemia after the 5th mo of age and succumbed to massive bursal lymphomas and metastases by the 10th mo of age. The immunological and pathological characteristics of these birds appear to reflect an autoimmune state rather than one of tolerance. Erythroid chimeras generated at day 21 of ontogenic development displayed normal levels of GVH reactivity. These birds were eventually able to eliminate the chimeric state and remained healthy until deliberately killed. These results show that there is a critical period in embryogenesis during which the induction of allogeneic erythrocytic chimerism leads to the development, in adult life, of severe autoimmune anemia, B cell lymphomas, and death. B-G MHC antigens are erythroid differentiation antigens of the chicken. Polymorphic determinants on B-G antigens appear to be important cross-reactive determinants (with environmental bacteria), against which a high background immunity exists. Evidence is presented that the immune response to B-G antigens is responsible for the development of autoimmunity and other pathological events that follow and that tolerance to class I MHC antigens (B-F antigens) shared by lymphocytes

  12. High-Efficiency Serum-Free Feeder-Free Erythroid Differentiation of Human Pluripotent Stem Cells Using Small Molecules

    PubMed Central

    Marenah, Lamin; McCahill, Angela; Condie, Alison; Cowan, Scott

    2016-01-01

    This article describes a good manufacturing practice (GMP)-compatible, feeder-free and serum-free method to produce large numbers of erythroid cells from human pluripotent stem cells (hPSCs), either embryonic or induced. This multistep protocol combines cytokines and small molecules to mimic and surpass the early stages of development. It produces, without any selection or sorting step, a population of cells in which 91.8% ± 5.4% express CD34 at day 7, 98.6% ± 1.3% express CD43 at day 10, and 99.1% ± 0.95% of cells are CD235a positive by day 31 of the differentiation process. Moreover, this differentiation protocol supports extensive expansion, with a single hPSC producing up to 150 hematopoietic progenitor cells by day 10 and 50,000–200,000 erythroid cells by day 31. The erythroid cells produced exhibit a definitive fetal hematopoietic type, with 90%–95% fetal globin and variable proportion of embryonic and adult globin at the protein level. The presence of small molecules during the differentiation protocol has quantitative and qualitative effects; it increases the proportion of adult globin and decreases the proportion of embryonic globin. Given its level of definition, this system provides a powerful tool for investigation of the mechanisms governing early hematopoiesis and erythropoiesis, including globin switching and enucleation. The early stages of the differentiation protocol could also serve as a starting point for the production of endothelial cells and other hematopoietic cells, or to investigate the production of long-term reconstituting hematopoietic stem cells from hPSCs. Significance This differentiation protocol allows the production of a large amount of erythroid cells from pluripotent stem cells. Its efficiency is compatible with that of in vitro red blood cell production, and it can be a considerable asset for studying developmental erythropoiesis and red blood cell enucleation, thereby aiding both basic and translational research. In

  13. Functions of BET proteins in erythroid gene expression.

    PubMed

    Stonestrom, Aaron J; Hsu, Sarah C; Jahn, Kristen S; Huang, Peng; Keller, Cheryl A; Giardine, Belinda M; Kadauke, Stephan; Campbell, Amy E; Evans, Perry; Hardison, Ross C; Blobel, Gerd A

    2015-04-30

    Inhibitors of bromodomain and extraterminal motif proteins (BETs) are being evaluated for the treatment of cancer and other diseases, yet much remains to be learned about how BET proteins function during normal physiology. We used genomic and genetic approaches to examine BET function in a hematopoietic maturation system driven by GATA1, an acetylated transcription factor previously shown to interact with BETs. We found that BRD2, BRD3, and BRD4 were variably recruited to GATA1-regulated genes, with BRD3 binding the greatest number of GATA1-occupied sites. Pharmacologic BET inhibition impaired GATA1-mediated transcriptional activation, but not repression, genome-wide. Mechanistically, BETs promoted chromatin occupancy of GATA1 and subsequently supported transcriptional activation. Using a combination of CRISPR-Cas9-mediated genomic engineering and shRNA approaches, we observed that depletion of either BRD2 or BRD4 alone blunted erythroid gene activation. Surprisingly, depletion of BRD3 only affected erythroid transcription in the context of BRD2 deficiency. Consistent with functional overlap among BET proteins, forced BRD3 expression substantially rescued defects caused by BRD2 deficiency. These results suggest that pharmacologic BET inhibition should be interpreted in the context of distinct steps in transcriptional activation and overlapping functions among BET family members.

  14. Cdk6 contributes to cytoskeletal stability in erythroid cells.

    PubMed

    Uras, Iris Z; Scheicher, Ruth M; Kollmann, Karoline; Glösmann, Martin; Prchal-Murphy, Michaela; Tigan, Anca S; Fux, Daniela A; Altamura, Sandro; Neves, Joana; Muckenthaler, Martina; Bennett, Keiryn L; Kubicek, Stefan; Hinds, Philip W; von Lindern, Marieke; Sexl, Veronika

    2017-03-02

    Mice lacking Cdk6 kinase activity suffer from mild anemia accompanied by elevated numbers of Ter119+ cells in the bone marrow. The animals show hardly any alterations in erythroid development, indicating that Cdk6 is not required for proliferation and maturation of erythroid cells. There is also no difference in stress erythropoiesis following hemolysis in vivo. However, Cdk6-/- erythrocytes have a shortened lifespan and are more sensitive to mechanical stress in vitro, suggesting differences in the cytoskeletal architecture. Erythroblasts contain both Cdk4 and Cdk6, while mature erythrocytes apparently lack Cdk4 and their Cdk6 is partly associated with the cytoskeleton. We used mass spectrometry to show that Cdk6 interacts with a number of proteins involved in cytoskeletal organization. Cdk6-/- erythroblasts show impaired F-actin formation and lower levels of gelsolin, which interacts with Cdk6. We show further that Cdk6 regulates the transcription of a panel of genes involved in actin (de-) polymerization. Cdk6-deficient cells are sensitive to drugs that interfere with the cytoskeleton, suggesting that our findings are relevant to the treatment of patients with anemia and may be relevant to cancer patients treated with the new generation of CDK6 inhibitors.

  15. Monoclonal gammopathy-associated pure red cell aplasia.

    PubMed

    Korde, Neha; Zhang, Yong; Loeliger, Kelsey; Poon, Andrea; Simakova, Olga; Zingone, Adriana; Costello, Rene; Childs, Richard; Noel, Pierre; Silver, Samuel; Kwok, Mary; Mo, Clifton; Young, Neal; Landgren, Ola; Sloand, Elaine; Maric, Irina

    2016-06-01

    Pure red cell aplasia (PRCA) is a rare disorder characterized by inhibition of erythroid precursors in the bone marrow and normochromic, normocytic anaemia with reticulocytopenia. Among 51 PRCA patients, we identified 12 (24%) patients having monoclonal gammopathy, monoclonal gammopathy of undetermined significance or smouldering multiple myeloma, with presence of monoclonal protein or abnormal serum free light chains and atypical bone marrow features of clonal plasmacytosis, hypercellularity and fibrosis. Thus far, three patients treated with anti-myeloma based therapeutics have responded with reticulocyte recovery and clinical transfusion independence, suggesting plasma cells play a key role in the pathogenesis of this specific monoclonal gammopathy-associated PRCA.

  16. Pure red cell aplasia induced by epoetin zeta

    PubMed Central

    Panichi, Vincenzo; Ricchiuti, Guido; Scatena, Alessia; Del Vecchio, Lucia; Locatelli, Francesco

    2016-01-01

    Pure red cell aplasia (PRCA) may develop in patients with chronic kidney disease receiving erythropoiesis-stimulating agents (ESA). We report on a 72-year-old patient who developed hypo-proliferative anaemia unresponsive to ESA following the administration of epoetin zeta subcutaneously for 7 months. On the basis of severe isolated hypoplasia of the erythroid line in the bone marrow and high-titre neutralizing anti-erythropoietin antibodies (Ab), a diagnosis of Ab-mediated PRCA was made. Epoetin zeta was discontinued and the patient was given steroids. This was associated with anaemia recovery. To our knowledge this is the first PRCA case related to epoetin zeta. PMID:27478604

  17. Antibodies to human fetal erythroid cells from a nonimmune phage antibody library

    PubMed Central

    Huie, Michael A.; Cheung, Mei-Chi; Muench, Marcus O.; Becerril, Baltazar; Kan, Yuet W.; Marks, James D.

    2001-01-01

    The ability to isolate fetal nucleated red blood cells (NRBCs) from the maternal circulation makes possible prenatal genetic analysis without the need for diagnostic procedures that are invasive for the fetus. Such isolation requires antibodies specific to fetal NRBCs. To generate a panel of antibodies to antigens present on fetal NRBCs, a new type of nonimmune phage antibody library was generated in which multiple copies of antibody fragments are displayed on each phage. Antibody fragments specific for fetal NRBCs were isolated by extensive predepletion of the phage library on adult RBCs and white blood cells (WBCs) followed by positive selection and amplification on fetal liver erythroid cells. After two rounds of selection, 44% of the antibodies analyzed bound fetal NRBCs, with two-thirds of these showing no binding of WBCs. DNA fingerprint analysis revealed the presence of at least 16 unique antibodies. Antibody specificity was confirmed by flow cytometry, immunohistochemistry, and immunofluorescence of total fetal liver and adult RBCs and WBCs. Antibody profiling suggested the generation of antibodies to previously unknown fetal RBC antigens. We conclude that multivalent display of antibodies on phage leads to efficient selection of panels of specific antibodies to cell surface antigens. The antibodies generated to fetal RBC antigens may have clinical utility for isolating fetal NRBCs from maternal circulation for noninvasive prenatal genetic diagnosis. Some of the antibodies may also have possible therapeutic utility for erythroleukemia. PMID:11226299

  18. Twisted partially pure spinors

    NASA Astrophysics Data System (ADS)

    Herrera, Rafael; Tellez, Ivan

    2016-08-01

    Motivated by the relationship between orthogonal complex structures and pure spinors, we define twisted partially pure spinors in order to characterize spinorially subspaces of Euclidean space endowed with a complex structure.

  19. Glutathione peroxidase 4 prevents necroptosis in mouse erythroid precursors

    PubMed Central

    Canli, Özge; Alankuş, Yasemin B.; Grootjans, Sasker; Vegi, Naidu; Hültner, Lothar; Hoppe, Philipp S.; Schroeder, Timm; Vandenabeele, Peter; Bornkamm, Georg W.

    2016-01-01

    Maintaining cellular redox balance is vital for cell survival and tissue homoeostasis because imbalanced production of reactive oxygen species (ROS) may lead to oxidative stress and cell death. The antioxidant enzyme glutathione peroxidase 4 (Gpx4) is a key regulator of oxidative stress–induced cell death. We show that mice with deletion of Gpx4 in hematopoietic cells develop anemia and that Gpx4 is essential for preventing receptor-interacting protein 3 (RIP3)-dependent necroptosis in erythroid precursor cells. Absence of Gpx4 leads to functional inactivation of caspase 8 by glutathionylation, resulting in necroptosis, which occurs independently of tumor necrosis factor α activation. Although genetic ablation of Rip3 normalizes reticulocyte maturation and prevents anemia, ROS accumulation and lipid peroxidation in Gpx4-deficient cells remain high. Our results demonstrate that ROS and lipid hydroperoxides function as not-yet-recognized unconventional upstream signaling activators of RIP3-dependent necroptosis. PMID:26463424

  20. Gender-Specific Toxicological Effects of Chronic Exposure to Pure Microcystin-LR or Complex Microcystis aeruginosa Extracts on Adult Medaka Fish.

    PubMed

    Le Manach, Séverine; Khenfech, Nour; Huet, Hélène; Qiao, Qin; Duval, Charlotte; Marie, Arul; Bolbach, Gérard; Clodic, Gilles; Djediat, Chakib; Bernard, Cécile; Edery, Marc; Marie, Benjamin

    2016-08-02

    Cyanobacterial blooms often occur in freshwater lakes and constitute a potential health risk to human populations, as well as to other organisms. However, their overall and specific implications for the health of aquatic organisms that are chronically and environmentally exposed to cyanobacteria producing hepatotoxins, such as microcystins (MCs), together with other bioactive compounds have still not been clearly established and remain difficult to assess. The medaka fish was chosen as the experimental aquatic model for studying the cellular and molecular toxicological effects on the liver after chronic exposures (28 days) to environmentally relevant concentrations of pure MC-LR, complex extracts of MC producing or nonproducing cyanobacterial biomasses, and of a Microcystis aeruginosa natural bloom. Our results showed a higher susceptibility of females to the different treatments compared to males at both the cellular and the molecular levels. Although hepatocyte lysis increased with MC-containing treatments, lysis always appeared more severe in the liver of females compare to males, and the glycogen cellular reserves also appeared to decrease more in the liver of females compared to those in the males. Proteomic investigations reveal divergent responses between males and females exposed to all treatments, especially for proteins involved in metabolic and homeostasis processes. Our observations also highlighted the dysregulation of proteins involved in oogenesis in female livers. These results suggest that fish populations exposed to cyanobacteria blooms may potentially face several ecotoxicological issues.

  1. Dead regions in the cochlea at 4 kHz in elderly adults: relation to absolute threshold, steepness of audiogram, and pure-tone average.

    PubMed

    Aazh, Hashir; Moore, Brian C J

    2007-02-01

    The aims of this study were (1) to investigate the prevalence of dead regions (DRs) at 4 kHz in elderly people with hearing loss and (2) to determine the extent to which the presence/absence of a DR can be predicted from the absolute threshold, the slope of the audiogram, or the pure-tone average (PTA) hearing loss at 0.5, 1, and 2 kHz. DRs were assessed for 98 ears with absolute thresholds between 60 and 85 dB HL at 4 kHz using the threshold equalizing noise test. Thirty-six ears had a DR at 4 kHz. There was no statistically significant difference in the slope of the audiogram or PTA between ears with and without DRs. However, the mean absolute threshold at 4 kHz was significantly higher for the group with DRs than for the group without DRs. The prevalence of DRs exceeded 50% for hearing losses greater than 70 dB.

  2. Long noncoding RNA-mediated anti-apoptotic activity in murine erythroid terminal differentiation.

    PubMed

    Hu, Wenqian; Yuan, Bingbing; Flygare, Johan; Lodish, Harvey F

    2011-12-15

    Long noncoding RNAs (lncRNAs) are differentially expressed under both normal and pathological conditions, implying that they may play important biological functions. Here we examined the expression of lncRNAs during erythropoiesis and identified an erythroid-specific lncRNA with anti-apoptotic activity. Inhibition of this lncRNA blocks erythroid differentiation and promotes apoptosis. Conversely, ectopic expression of this lncRNA can inhibit apoptosis in mouse erythroid cells. This lncRNA represses expression of Pycard, a proapoptotic gene, explaining in part the inhibition of programmed cell death. These findings reveal a novel layer of regulation of cell differentiation and apoptosis by a lncRNA.

  3. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    SciTech Connect

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C. )

    1991-03-15

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase.

  4. When diagnostics meets translational research: detection of hemoglobin fractions in cellular lysates from in vitro erythroid cultures by Capillarys 2 Flex Piercing analyzer (Sebia).

    PubMed

    Aprile, Annamaria; Passerini, Gabriella; Cappellini, Maria Domenica; Marktel, Sarah; Ciceri, Fabio; Ferrari, Giuliana; Ceriotti, Ferruccio

    2016-03-01

    Detection of hemoglobin (Hb) variants represents an important issue for diagnosis and adequate treatment of hemoglobinopathies. The Capillarys 2 Flex Piercing analyzer (Capillarys) by Sebia is routinely used in our clinical laboratories to detect Hb variants in peripheral blood (PB). This automated method separates Hb fractions by capillary electrophoresis, giving a spectrophotometric measure of their relative proportion. The scientific research in the field of hemoglobinopathies needs robust procedures to evaluate the efficacy of experimental therapies, as gene therapy. We investigated for the first time the feasibility to use Capillarys on cellular lysates from in vitro erythroid cultures. Because total Hb concentration in erythroid lysates is up to 20-fold lower than in hemolysates from PB, we analyzed diluted blood samples, thanks to the manual mode included in the Capillarys setting. We compared analytical precision, accuracy, sensitivity, and specificity of this procedure to the automatic method, routinely used in diagnostics. For instance, adult Hb intra- and interassay precision were estimated as coefficient of variation 0.2% and 0.3%, respectively. The manual mode is less robust for detection of fractions <3% and the lower level of sensitivity is 2 g/L of total Hb. Specificity of manual and automatic settings was equivalent. We confirmed the performance of the method by analyzing erythroid lysates from thalassemic patients' cultures. Our study demonstrated that the Capillarys 2 Flex Piercing manual method is comparable to the automatic one. The analysis is very robust at low Hb concentrations, as in erythroid cultures from patients affected by hemoglobinopathies, representing a useful tool also in translational research.

  5. Holoprosencephaly and Pure Red Cell Aplasia in a Feline Leukaemia Virus-Positive Kitten.

    PubMed

    Southard, T L; Rodriguez-Ramos Fernandez, J; Priest, H; Stokol, T

    2016-01-01

    A 9-month-old, female, domestic longhair cat with severe anaemia tested positive for feline leukaemia virus (FeLV) and was humanely destroyed and submitted for necropsy examination. Gross findings included a non-divided rostral telencephalon, consistent with semilobar holoprosencephaly. Histological examination of the bone marrow revealed an almost complete absence of erythroid precursor cells, consistent with pure red cell aplasia, and mild to moderate myelofibrosis. This case demonstrates a very unusual central nervous system defect, as well as an atypical presentation of pure red cell aplasia, in a FeLV-positive kitten.

  6. Force Dependent Changes in Non-Erythroid Spectrin and Ankyrins

    NASA Astrophysics Data System (ADS)

    Degaga, Eleni; Forstner, Martin

    2012-02-01

    Mechanotransduction in cells describes the process by which external physical stimuli are converted into biochemical activity and plays an important role in many biological functions on both the cell and tissue level. However, the specific mechanisms by which mechanical forces lead to particular molecular and cellular responses are much less understood. We investigate the changes in non-erythroid spectrin and ankyrins as a result of equi-biaxial strain application to live cells in culture. Specifically, we focus on the spectrins' role in the ubiquitination process - a vital process in the regulation of protein degradation- of spectrin and ankyrins. We utilize immune-fluorescence staining and fluorescent fusion proteins for quantitative fluorescence imaging as well as biochemical methods to measure changes in of cell's spectrin and ankyrin content. Protein expression levels and localization between cells exposed to mechanical stimuli of different temporal and spatial profiles are compared. In addition, the threshold behavior of cell proliferation - as measured by number densities - of a variety of cell types as a function of mechano-stimulation is investigated.

  7. 7 CFR 916.16 - Pure grower or pure producer.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Pure grower or pure producer. 916.16 Section 916.16... Order Regulating Handling Definitions § 916.16 Pure grower or pure producer. (a) Pure grower means any...); or (2) Who produces and handles his or her own product; Provided, That a pure grower can pack...

  8. 7 CFR 917.8 - Pure grower or pure producer.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Pure grower or pure producer. 917.8 Section 917.8... CALIFORNIA Order Regulating Handling Definitions § 917.8 Pure grower or pure producer. (a) For peaches, pure... packing business); or (2) Who produces and handles his or her own product; Provided, That a pure...

  9. 7 CFR 916.16 - Pure grower or pure producer.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 8 2011-01-01 2011-01-01 false Pure grower or pure producer. 916.16 Section 916.16... Order Regulating Handling Definitions § 916.16 Pure grower or pure producer. (a) Pure grower means any...); or (2) Who produces and handles his or her own product; Provided, That a pure grower can pack...

  10. 7 CFR 917.8 - Pure grower or pure producer.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 8 2011-01-01 2011-01-01 false Pure grower or pure producer. 917.8 Section 917.8... CALIFORNIA Order Regulating Handling Definitions § 917.8 Pure grower or pure producer. (a) For peaches, pure... packing business); or (2) Who produces and handles his or her own product; Provided, That a pure...

  11. Caspase-3 Is Involved in the Signalling in Erythroid Differentiation by Targeting Late Progenitors

    PubMed Central

    Giarratana, Marie-Catherine; Darghouth, Dhouha; Faussat, Anne-Marie; Harmand, Laurence; Douay, Luc

    2013-01-01

    A role for caspase activation in erythroid differentiation has been established, yet its precise mode of action remains elusive. A drawback of all previous investigations on caspase activation in ex vivo erythroid differentiation is the lack of an in vitro model producing full enucleation of erythroid cells. Using a culture system which renders nearly 100% enucleated red cells from human CD34+ cells, we investigated the role of active caspase-3 in erythropoiesis. Profound effects of caspase-3 inhibition were found on erythroid cell growth and differentiation when inhibitors were added to CD34+ cells at the start of the culture and showed dose-response to the concentration of inhibitor employed. Enucleation was only reduced as a function of the reduced maturity of the culture and the increased cell death of mature cells while the majority of cells retained their ability to extrude their nuclei. Cell cycle analysis after caspase-3 inhibition showed caspase-3 to play a critical role in cell proliferation and highlighted a novel function of this protease in erythroid differentiation, i.e. its contribution to cell cycle regulation at the mitotic phase. While the effect of caspase-3 inhibitor treatment on CD34+ derived cells was not specific to the erythroid lineage, showing a similar reduction of cell expansion in myeloid cultures, the mechanism of action in both lineages appeared to be distinct with a strong induction of apoptosis causing the decreased yield of myeloid cells. Using a series of colony-forming assays we were able to pinpoint the stage at which cells were most sensitive to caspase-3 inhibition and found activated caspase-3 to play a signalling role in erythroid differentiation by targeting mature BFU-E and CFU-E but not early BFU-E. PMID:23658722

  12. Erythropoietin triggers a burst of GATA-1 in normal human erythroid cells differentiating in tissue culture.

    PubMed Central

    Dalyot, N; Fibach, E; Ronchi, A; Rachmilewitz, E A; Ottolenghi, S; Oppenheim, A

    1993-01-01

    GATA-1 is a central transcription-activator of erythroid differentiation. In the present work we have studied the kinetics of its expression and activity during development of normal human erythroid progenitors, grown in primary cultures. In response to the addition of erythropoietin (Epo), the cells undergo proliferation and differentiation in a synchronized fashion. This recently developed experimental system allows biochemical dissection of erythroid differentiation in a physiological meaningful environment. No DNA-binding activity of GATA-1 could be detected before the addition of Epo, although a very low level of mRNA was observed. Following Epo addition there was a sharp parallel rise in both mRNA and DNA-binding activity, consistent with positive autoregulation of the GATA-1 gene. After reaching a peak on day 7-9, both mRNA and protein activity decreased. The binding activity of the ubiquitous factor SP1 showed a biphasic pattern; its second peak usually coincided with the GATA-1 peak, suggesting that SP1 also plays a specific role in erythroid maturation. The highest activity of GATA-1 per erythroid cell was found on day 6-8, immediately preceding the major rise in globin gene mRNA and in the number of hemoglobinized cells. The results imply that a high level of GATA-1 activity is necessary for globin gene expression and erythroid maturation, suggesting that a requirement for a threshold concentration of GATA-1 is part of the mechanism that determines the final steps of erythroid maturation. Images PMID:8371977

  13. Characterization of Putative Erythroid Regulators of Hepcidin in Mouse Models of Anemia

    PubMed Central

    Mirciov, Cornel S. G.; Wilkins, Sarah J.; Dunn, Linda A.; Anderson, Gregory J.; Frazer, David M.

    2017-01-01

    Iron is crucial for many biological functions, but quantitatively the most important use of iron is in the production of hemoglobin in red blood cell precursors. The amount of iron in the plasma, and hence its availability for hemoglobin synthesis, is determined by the liver-derived iron regulatory hormone hepcidin. When the iron supply to erythroid precursors is limited, as often occurs during stimulated erythropoiesis, these cells produce signals to inhibit hepatic hepcidin production, thereby increasing the amount of iron that enters the plasma. How stimulated erythropoiesis suppresses hepcidin production is incompletely understood, but erythroferrone, Gdf15 and Twsg1 have emerged as candidate regulatory molecules. To further examine the relationship between erythropoiesis and the candidate erythroid regulators, we have studied five mouse models of anemia, including two models of β-thalassemia (Hbbth3/+ and RBC14), the hemoglobin deficit mouse (hbd), dietary iron deficient mice and mice treated with phenylhydrazine to induce acute hemolysis. Hematological parameters, iron status and the expression of Erfe (the gene encoding erythroferrone), Gdf15 and Twsg1 in the bone marrow and spleen were examined. Erfe expression was the most consistently upregulated of the candidate erythroid regulators in all of the mouse models examined. Gene expression was particularly high in the bone marrow and spleen of iron deficient animals, making erythroferrone an ideal candidate erythroid regulator, as its influence is strongest when iron supply to developing erythroid cells is limited. Gdf15 expression was also upregulated in most of the anemia models studied although the magnitude of the increase was generally less than that of Erfe. In contrast, very little regulation of Twsg1 was observed. These results support the prevailing hypothesis that erythroferrone is a promising erythroid regulator and demonstrate that Erfe expression is stimulated most strongly when the iron supply

  14. Mitochondrial Hspa9/Mortalin regulates erythroid differentiation via iron-sulfur cluster assembly.

    PubMed

    Shan, Yuxi; Cortopassi, Gino

    2016-01-01

    Mitochondrial iron-sulfur cluster (ISC) biogenesis provides iron-sulfur cofactors to several mitochondrial proteins, but the extent to which ISC biogenesis regulates hematopoiesis has been unclear. The blood disease Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis, and the disease overlaps with the gene Hspa9/Mortalin in multiple ways: the HSPA9 locus maps to 5q31.2 that is frequently deleted in human MDS; mutant Hspa9 causes zebrafish MDS; and Hspa9 knockdown mice have decreased hematopoiesis. We show here that HSPA9 functions in mitochondrial ISC biogenesis, and is required for erythroid differentiation. HSPA9 interacts with and stabilizes the mitochondrial ISC biogenesis proteins frataxin, Nfs1, ISCU, and Nfu. MDS-causing mutations in HSPA9 protein change its interactions with ISC biogenesis proteins. Depletion of HSPA9 decreases aconitase activity, which requires an ISC at its active site, but not that of the non-ISC requiring malate dehydrogenase, and increases IRP1 binding activity. In erythroid cell lines, Hspa9 depletion inhibited erythroid differentiation, post-transcriptionally regulating the expression of Alas2 and FeCH, as expected through known ISC control of the IRE response elements in these genes. By contrast, the Alas2 open reading frame rescued the Hspa9-dependent defect in erythroid differentiation, but not when uncoupled from its 5'-IRE sequence. Thus, Hspa9 depletion causes a mitochondrial ISC deficit, altering IRP1-IRE binding and FeCH stability, which consequently inhibits Alas2 translation, heme synthesis, and erythroid differentiation, i.e.: Hspa9->ISC->IRP/IRE->Alas2->heme synthesis->erythroid differentiation. Thus Hspa9 regulates erythroid differentiation through ISC cluster assembly, providing a pathophysiological mechanism for an MDS subtype characterized by HSPA9 haploinsufficiency, and suggests hemin and other pharmacological stimulators of ISC synthesis as potential routes to therapy.

  15. Vitamin K2 modulates differentiation and apoptosis of both myeloid and erythroid lineages.

    PubMed

    Sada, Eriko; Abe, Yasunobu; Ohba, Rie; Tachikawa, Yoshimichi; Nagasawa, Eriko; Shiratsuchi, Motoaki; Takayanagi, Ryoichi

    2010-12-01

    Vitamin K2 (VK2) can improve cytopenia in some patients with myelodysplastic syndrome (MDS). Although it is well known that VK2 induces differentiation and apoptosis in acute myeloid leukemia (AML) cell lines, little is known about its effect on normal hematopoietic progenitors. The effects of VK2 on primary myeloid and erythroid progenitors were examined. Mobilized CD34-positive cells from peripheral blood were used for the examination of myeloid lineage cells, and erythroid progenitors purified from peripheral blood were used for erythroid lineage cells. VK2 upregulated the expressions of myeloid markers CD11b and CD14, and increased the mRNA expression levels of CCAAT/enhancer binding protein-α (C/EBPα) and PU.1 in myeloid progenitors. In erythroid progenitors, VK2 did not show a significant effect on differentiation. However, VK2 exhibited an anti-apoptotic effect on erythroid progenitors under erythropoietin depletion. This anti-apoptotic effect was restricted to normal erythroid progenitors and was not shown in erythroleukemic cell line AS-E2. Steroid and xenobiotic receptor (SXR), which was recently identified as a receptor of VK2, was expressed on myeloid progenitors, and the SXR agonist rifampicin (RIF) also upregulated CD11b and CD14 expressions on myeloid progenitors. These results indicate that SXR is involved in the effect of VK2 on myeloid progenitors. The major effect of VK2 on myeloid progenitors was promoting differentiation, whereas its anti-apoptotic effect seemed to be dominant in erythroid progenitors. Although the detailed mechanism of VK2's effect on differentiation or apoptosis of hematopoietic progenitors remains unknown, the effect of VK2 therapy in patients with MDS could be partly explained by these mechanisms.

  16. Pure-quartic solitons

    PubMed Central

    Blanco-Redondo, Andrea; Martijn, de Sterke C.; Sipe, J.E.; Krauss, Thomas F.; Eggleton, Benjamin J.; Husko, Chad

    2016-01-01

    Temporal optical solitons have been the subject of intense research due to their intriguing physics and applications in ultrafast optics and supercontinuum generation. Conventional bright optical solitons result from the interaction of anomalous group-velocity dispersion and self-phase modulation. Here we experimentally demonstrate a class of bright soliton arising purely from the interaction of negative fourth-order dispersion and self-phase modulation, which can occur even for normal group-velocity dispersion. We provide experimental and numerical evidence of shape-preserving propagation and flat temporal phase for the fundamental pure-quartic soliton and periodically modulated propagation for the higher-order pure-quartic solitons. We derive the approximate shape of the fundamental pure-quartic soliton and discover that is surprisingly Gaussian, exhibiting excellent agreement with our experimental observations. Our discovery, enabled by precise dispersion engineering, could find applications in communications, frequency combs and ultrafast lasers. PMID:26822758

  17. Geomorphology: Pure and applied

    SciTech Connect

    Hart, M.G.

    1986-01-01

    The book summarizes the history of intellectual debate in geomorphology and describes modern developments both ''pure'' and ''applied.'' The history begins well before W.M. Davis and follows through to such debates as those concerned with the Pleistocene. Modern developments in pure geomorphology are cast in terms of chapters on form, process, materials, and methods analysis. The applied chapters concentrate on environmental hazards and resources, and their management.

  18. Erythropoiesis in the Absence of Adult Hemoglobin

    PubMed Central

    Liu, Shanrun; McConnell, Sean C.

    2013-01-01

    During erythropoiesis, hemoglobin (Hb) synthesis increases from early progenitors to mature enucleated erythrocytes. Although Hb is one of the most extensively studied proteins, the role of Hb in erythroid lineage commitment, differentiation, and maturation remains unclear. In this study, we generate mouse embryos and embryonic stem (ES) cells with all of the adult α and β globin genes deleted (Hb Null). While Hb Null embryos die in midgestation, adult globin genes are not required for primitive or definitive erythroid lineage commitment. In vitro differentiation of Hb Null ES cells generates viable definitive proerythroblasts that undergo apoptosis upon terminal differentiation. Surprisingly, all stages of Hb Null-derived definitive erythroblasts develop normally in vivo in chimeric mice, and Hb Null erythroid cells undergo enucleation to form reticulocytes. Free heme toxicity is not observed in Hb Null-derived erythroblasts. Transplantation of Hb Null-derived bone marrow cells provides short-term radioprotection of lethally irradiated recipients, whose progressive anemia results in an erythroid hyperplasia composed entirely of Hb Null-derived erythroblasts. This novel experimental model system enables the role played by Hb in erythroid cell enucleation, cytoskeleton maturation, and heme and iron regulation to be studied. PMID:23530053

  19. A highly conserved SOX6 double binding site mediates SOX6 gene downregulation in erythroid cells

    PubMed Central

    Cantu', Claudio; Grande, Vito; Alborelli, Ilaria; Cassinelli, Letizia; Cantu’, Ileana; Colzani, Maria Teresa; Ierardi, Rossella; Ronzoni, Luisa; Cappellini, Maria Domenica; Ferrari, Giuliana; Ottolenghi, Sergio; Ronchi, Antonella

    2011-01-01

    The Sox6 transcription factor plays critical roles in various cell types, including erythroid cells. Sox6-deficient mice are anemic due to impaired red cell maturation and show inappropriate globin gene expression in definitive erythrocytes. To identify new Sox6 target genes in erythroid cells, we used the known repressive double Sox6 consensus within the εy-globin promoter to perform a bioinformatic genome-wide search for similar, evolutionarily conserved motifs located within genes whose expression changes during erythropoiesis. We found a highly conserved Sox6 consensus within the Sox6 human gene promoter itself. This sequence is bound by Sox6 in vitro and in vivo, and mediates transcriptional repression in transient transfections in human erythroleukemic K562 cells and in primary erythroblasts. The binding of a lentiviral transduced Sox6FLAG protein to the endogenous Sox6 promoter is accompanied, in erythroid cells, by strong downregulation of the endogenous Sox6 transcript and by decreased in vivo chromatin accessibility of this region to the PstI restriction enzyme. These observations suggest that the negative Sox6 autoregulation, mediated by the double Sox6 binding site within its own promoter, may be relevant to control the Sox6 transcriptional downregulation that we observe in human erythroid cultures and in mouse bone marrow cells in late erythroid maturation. PMID:20852263

  20. Stress Granules contribute to α-globin homeostasis in differentiating erythroid cells

    PubMed Central

    Ghisolfi, Laura; Dutt, Shilpee; McConkey, Marie E.; Ebert, Benjamin L.; Anderson, Paul

    2012-01-01

    Hemoglobin is the major biosynthetic product of developing erythroid cells. Assembly of hemoglobin requires the balanced production of globin protein and the oxygen-carrying heme moiety. The heme-regulated inhibitor kinase (HRI) participates in this process by phosphorylating eIF2α and inhibiting the translation of globin protein when levels of free heme are limiting. HRI is also activated in erythroid cells subjected to oxidative stress. Phospho-eIF2α-mediated translational repression induces the assembly of stress granules (SG), cytoplasmic foci that harbor untranslated mRNAs and promote the survival of cells subjected to adverse environmental conditions. We have found that differentiating erythroid, but not myelomonocytic or megakaryocytic, murine and human progenitor cells assemble SGs, in vitro and in vivo. Targeted knockdown of HRI or G3BP, a protein required for SG assembly, inhibits spontaneous and arsenite-induced assembly of SGs in erythroid progenitor cells. This is accompanied by reduced globin production and increased apoptosis suggesting that G3BP+ SGs facilitate the survival of developing erythroid cells. PMID:22452989

  1. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands

    PubMed Central

    Belay, Eyayu; Hayes, Brian J.; Blau, C. Anthony; Torok-Storb, Beverly

    2017-01-01

    Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS) that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP), intercellular adhesion molecule 4 (ICAM-4), CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions. PMID:28135323

  2. In vitro culture of stress erythroid progenitors identifies distinct progenitor populations and analogous human progenitors

    PubMed Central

    Xiang, Jie; Wu, Dai-Chen; Chen, Yuanting

    2015-01-01

    Tissue hypoxia induces a systemic response designed to increase oxygen delivery to tissues. One component of this response is increased erythropoiesis. Steady-state erythropoiesis is primarily homeostatic, producing new erythrocytes to replace old erythrocytes removed from circulation by the spleen. In response to anemia, the situation is different. New erythrocytes must be rapidly made to increase hemoglobin levels. At these times, stress erythropoiesis predominates. Stress erythropoiesis is best characterized in the mouse, where it is extramedullary and utilizes progenitors and signals that are distinct from steady-state erythropoiesis. In this report, we use an in vitro culture system that recapitulates the in vivo development of stress erythroid progenitors. We identify cell-surface markers that delineate a series of stress erythroid progenitors with increasing maturity. In addition, we use this in vitro culture system to expand human stress erythroid progenitor cells that express analogous cell-surface markers. Consistent with previous suggestions that human stress erythropoiesis is similar to fetal erythropoiesis, we demonstrate that human stress erythroid progenitors express fetal hemoglobin upon differentiation. These data demonstrate that similar to murine bone marrow, human bone marrow contains cells that can generate BMP4-dependent stress erythroid burst-forming units when cultured under stress erythropoiesis conditions. PMID:25608563

  3. Inactivation of 3-hydroxybutyrate dehydrogenase 2 delays zebrafish erythroid maturation by conferring premature mitophagy

    PubMed Central

    Davuluri, Gangarao; Song, Ping; Liu, Zhuoming; Wald, David; Sakaguchi, Takuya F.; Devireddy, L.

    2016-01-01

    Mitochondria are the site of iron utilization, wherein imported iron is incorporated into heme or iron–sulfur clusters. Previously, we showed that a cytosolic siderophore, which resembles a bacterial siderophore, facilitates mitochondrial iron import in eukaryotes, including zebrafish. An evolutionarily conserved 3-hydroxy butyrate dehydrogenase, 3-hydroxy butyrate dehydrogenase 2 (Bdh2), catalyzes a rate-limiting step in the biogenesis of the eukaryotic siderophore. We found that inactivation of bdh2 in developing zebrafish embryo results in heme deficiency and delays erythroid maturation. The basis for this erythroid maturation defect is not known. Here we show that bdh2 inactivation results in mitochondrial dysfunction and triggers their degradation by mitophagy. Thus, mitochondria are prematurely lost in bdh2-inactivated erythrocytes. Interestingly, bdh2-inactivated erythroid cells also exhibit genomic alterations as indicated by transcriptome analysis. Reestablishment of bdh2 restores mitochondrial function, prevents premature mitochondrial degradation, promotes erythroid development, and reverses altered gene expression. Thus, mitochondrial communication with the nucleus is critical for erythroid development. PMID:26929344

  4. Decreased differentiation of erythroid cells exacerbates ineffective erythropoiesis in β-thalassemia

    PubMed Central

    Libani, Ilaria V.; Guy, Ella C.; Melchiori, Luca; Schiro, Raffaella; Ramos, Pedro; Breda, Laura; Scholzen, Thomas; Chadburn, Amy; Liu, YiFang; Kernbach, Margrit; Baron-Lühr, Bettina; Porotto, Matteo; de Sousa, Maria; Rachmilewitz, Eliezer A.; Hood, John D.; Cappellini, M. Domenica; Giardina, Patricia J.; Grady, Robert W.; Gerdes, Johannes

    2008-01-01

    In β-thalassemia, the mechanism driving ineffective erythropoiesis (IE) is insufficiently understood. We analyzed mice affected by β-thalassemia and observed, unexpectedly, a relatively small increase in apoptosis of their erythroid cells compared with healthy mice. Therefore, we sought to determine whether IE could also be characterized by limited erythroid cell differentiation. In thalassemic mice, we observed that a greater than normal percentage of erythroid cells was in S-phase, exhibiting an erythroblast-like morphology. Thalassemic cells were associated with expression of cell cycle–promoting genes such as EpoR, Jak2, Cyclin-A, Cdk2, and Ki-67 and the antiapoptotic protein Bcl-XL. The cells also differentiated less than normal erythroid ones in vitro. To investigate whether Jak2 could be responsible for the limited cell differentiation, we administered a Jak2 inhibitor, TG101209, to healthy and thalassemic mice. Exposure to TG101209 dramatically decreased the spleen size but also affected anemia. Although our data do not exclude a role for apoptosis in IE, we propose that expansion of the erythroid pool followed by limited cell differentiation exacerbates IE in thalassemia. In addition, these results suggest that use of Jak2 inhibitors has the potential to profoundly change the management of this disorder. PMID:18480424

  5. Implementation of erythroid lineage analysis by flow cytometry in diagnostic models for myelodysplastic syndromes

    PubMed Central

    Cremers, Eline M.P.; Westers, Theresia M.; Alhan, Canan; Cali, Claudia; Visser-Wisselaar, Heleen A.; Chitu, Dana A.; van der Velden, Vincent H.J.; te Marvelde, Jeroen G.; Klein, Saskia K.; Muus, Petra; Vellenga, Edo; de Greef, Georgina E.; Legdeur, Marie-Cecile C.J.C.; Wijermans, Pierre W.; Stevens-Kroef, Marian J.P.L.; da Silva-Coelho, Pedro; Jansen, Joop H.; Ossenkoppele, Gert J.; van de Loosdrecht, Arjan A.

    2017-01-01

    Flow cytometric analysis is a recommended tool in the diagnosis of myelodysplastic syndromes. Current flow cytometric approaches evaluate the (im)mature myelo-/monocytic lineage with a median sensitivity and specificity of ~71% and ~93%, respectively. We hypothesized that the addition of erythroid lineage analysis could increase the sensitivity of flow cytometry. Hereto, we validated the analysis of erythroid lineage parameters recommended by the International/European LeukemiaNet Working Group for Flow Cytometry in Myelodysplastic Syndromes, and incorporated this evaluation in currently applied flow cytometric models. One hundred and sixty-seven bone marrow aspirates were analyzed; 106 patients with myelodysplastic syndromes, and 61 cytopenic controls. There was a strong correlation between presence of erythroid aberrancies assessed by flow cytometry and the diagnosis of myelodysplastic syndromes when validating the previously described erythroid evaluation. Furthermore, addition of erythroid aberrancies to two different flow cytometric models led to an increased sensitivity in detecting myelodysplastic syndromes: from 74% to 86% for the addition to the diagnostic score designed by Ogata and colleagues, and from 69% to 80% for the addition to the integrated flow cytometric score for myelodysplastic syndromes, designed by our group. In both models the specificity was unaffected. The high sensitivity and specificity of flow cytometry in the detection of myelodysplastic syndromes illustrates the important value of flow cytometry in a standardized diagnostic approach. The trial is registered at www.trialregister.nl as NTR1825; EudraCT n.: 2008-002195-10 PMID:27658438

  6. Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

    PubMed

    Rath, A V; Schmahl, G E; Niemeyer, C M

    1997-01-01

    During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

  7. ETO-2 associates with SCL in erythroid cells and megakaryocytes and provides repressor functions in erythropoiesis.

    PubMed

    Schuh, Anna H; Tipping, Alex J; Clark, Allison J; Hamlett, Isla; Guyot, Boris; Iborra, Francesco J; Rodriguez, Patrick; Strouboulis, John; Enver, Tariq; Vyas, Paresh; Porcher, Catherine

    2005-12-01

    Lineage specification and cellular maturation require coordinated regulation of gene expression programs. In large part, this is dependent on the activator and repressor functions of protein complexes associated with tissue-specific transcriptional regulators. In this study, we have used a proteomic approach to characterize multiprotein complexes containing the key hematopoietic regulator SCL in erythroid and megakaryocytic cell lines. One of the novel SCL-interacting proteins identified in both cell types is the transcriptional corepressor ETO-2. Interaction between endogenous proteins was confirmed in primary cells. We then showed that SCL complexes are shared but also significantly differ in the two cell types. Importantly, SCL/ETO-2 interacts with another corepressor, Gfi-1b, in red cells but not megakaryocytes. The SCL/ETO-2/Gfi-1b association is lost during erythroid differentiation of primary fetal liver cells. Genetic studies of erythroid cells show that ETO-2 exerts a repressor effect on SCL target genes. We suggest that, through its association with SCL, ETO-2 represses gene expression in the early stages of erythroid differentiation and that alleviation/modulation of the repressive state is then required for expression of genes necessary for terminal erythroid maturation to proceed.

  8. Erythroid cell-specific alpha-globin gene regulation by the CP2 transcription factor family.

    PubMed

    Kang, Ho Chul; Chae, Ji Hyung; Lee, Yeon Ho; Park, Mi-Ae; Shin, June Ho; Kim, Sung-Hyun; Ye, Sang-Kyu; Cho, Yoon Shin; Fiering, Steven; Kim, Chul Geun

    2005-07-01

    We previously demonstrated that ubiquitously expressed CP2c exerts potent erythroid-specific transactivation of alpha-globin through an unknown mechanism. This mechanism is reported here to involve specific CP2 splice variants and protein inhibitor of activated STAT1 (PIAS1). We identify a novel murine splice isoform of CP2, CP2b, which is identical to CP2a except that it has an additional 36 amino acids encoded by an extra exon. CP2b has an erythroid cell-specific transcriptional activation domain, which requires the extra exon and can form heteromeric complexes with other CP2 isoforms, but lacks the DNA binding activity found in CP2a and CP2c. Transcriptional activation of alpha-globin occurred following dimerization between CP2b and CP2c in erythroid K562 and MEL cells, but this dimerization did not activate the alpha-globin promoter in nonerythroid 293T cells, indicating that an additional erythroid factor is missing in 293T cells. PIAS1 was confirmed as a CP2 binding protein by the yeast two-hybrid screen, and expression of CP2b, CP2c, and PIAS1 in 293T cell induced alpha-globin promoter activation. These results show that ubiquitously expressed CP2b exerts potent erythroid cell-specific alpha-globin gene expression by complexing with CP2c and PIAS1.

  9. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    NASA Astrophysics Data System (ADS)

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2013-12-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with L-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition. Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that these

  10. Resveratrol induces human K562 cell apoptosis, erythroid differentiation, and autophagy.

    PubMed

    Yan, Hui-Wen; Hu, Wei-Xin; Zhang, Jie-Ying; Wang, Ye; Xia, Kun; Peng, Min-Yuan; Liu, Jing

    2014-06-01

    Resveratrol (Res) is a naturally occurring phytoalexin with apoptotic and inducing-glob effects in leukemic cells, but the potential induction of erythroid differentiation in cells is not fully understood. Here, we investigated the effects of Res on human erythro-megakaryoblastic leukemia cell line K562. Among the treated cells, proliferation was inhibited and the occurrence of cell apoptosis and cell death were detected. Erythroid differentiation assay was explored, and we found that Res could increase the expression of glycophorin A (GPA), HBA1, HBB, and γ-globin genes and enforced the expression of GPA, CD71, and Band3 proteins. Res also induced K562 cell autophagy when the concentration of Res was increased up to 50 or 100 μM. Our findings suggested that Res possesses the potency not only inducing apoptosis but also inducing erythroid differentiation and autophagy in K562 cells. These results provide that Res may be a therapeutic candidate for chronic myelogenous leukemia treatment.

  11. Pure red cell aplasia following autoimmune hemolytic anemia: an enigma.

    PubMed

    Saha, M; Ray, S; Kundu, S; Chakrabarti, P

    2013-01-01

    A 26-year-old previously healthy female presented with a 6-month history of anemia. The laboratory findings revealed hemolytic anemia and direct antiglobulin test was positive. With a diagnosis of autoimmune hemolytic anemia (AIHA), prednisolone was started but was ineffective after 1 month of therapy. A bone marrow trephine biopsy revealed pure red cell aplasia (PRCA) showing severe erythroid hypoplasia. The case was considered PRCA following AIHA. This combination without clear underlying disease is rare. Human parvovirus B19 infection was not detected in the marrow aspirate during reticulocytopenia. The patient received azathioprine, and PRCA improved but significant hemolysis was once again documented with a high reticulocyte count. The short time interval between AIHA and PRCA phase suggested an increased possibility of the evolution of a single disease.

  12. Induction of erythroid differentiation and increased globin mRNA production with furocoumarins and their photoproducts

    PubMed Central

    Salvador, Alessia; Brognara, Eleonora; Vedaldi, Daniela; Castagliuolo, Ignazio; Brun, Paola; Zuccato, Cristina; Lampronti, Ilaria; Gambari, Roberto

    2013-01-01

    Differentiation-therapy is an important approach in the treatment of cancer, as in the case of erythroid induction in chronic myelogenous leukemia. Moreover, an important therapeutic strategy for treating beta-thalassemia and sickle-cell anemia could be the use of drugs able to induce erythroid differentiation and fetal hemoglobin (HbF) accumulation: in fact, the increased production of this type of hemoglobin can reduce the clinical symptoms and the frequency of transfusions. An important class of erythroid differentiating compounds and HbF inducers is composed by DNA-binding chemotherapeutics: however, they are not used in most instances considering their possible devastating side effects. In this contest, we approached the study of erythrodifferentiating properties of furocoumarins. In fact, upon UV-A irradiation, they are able to covalently bind DNA. Thus, the erythrodifferentiation activity of some linear and angular furocoumarins was evaluated in the experimental K562 cellular model system. Quantitative real-time reverse transcription polymerase-chain reaction assay was employed to evaluate the accumulation of different globin mRNAs. The results demonstrated that both linear and angular furocoumarins are strong inducers of erythroid differentiation of K562 cells. From a preliminary screening, we selected the most active compounds and investigated the role of DNA photodamage in their erythroid inducing activity and mechanism of action. Moreover, some cytofluorimetric experiments were carried out to better study cell cycle modifications and the mitochondrial involvement. A further development of the work was carried out studying the erythroid differentiation of photolysis products of these molecules. 5,5′-Dimethylpsoralen photoproducts induced an important increase in γ-globin gene transcription in K562 cells. PMID:23518160

  13. The VP1u Receptor Restricts Parvovirus B19 Uptake to Permissive Erythroid Cells

    PubMed Central

    Leisi, Remo; Von Nordheim, Marcus; Ros, Carlos; Kempf, Christoph

    2016-01-01

    Parvovirus B19 (B19V) is a small non-enveloped virus and known as the causative agent for the mild childhood disease erythema infectiosum. B19V has an extraordinary narrow tissue tropism, showing only productive infection in erythroid precursor cells in the bone marrow. We recently found that the viral protein 1 unique region (VP1u) contains an N-terminal receptor-binding domain (RBD), which mediates the uptake of the virus into cells of the erythroid lineage. To further investigate the role of the RBD in connection with a B19V-unrelated capsid, we chemically coupled the VP1u of B19V to the bacteriophage MS2 capsid and tested the internalization capacity of the bioconjugate on permissive cells. In comparison, we studied the cellular uptake and infection of B19V along the erythroid differentiation. The results showed that the MS2-VP1u bioconjugate mimicked the specific internalization of the native B19V into erythroid precursor cells, which further coincides with the restricted infection profile. The successful mimicry of B19V uptake demonstrates that the RBD in the VP1u is sufficient for the endocytosis of the viral capsid. Furthermore, the recombinant VP1u competed with B19V uptake into permissive cells, thus excluding a significant alternative uptake mechanism by other receptors. Strikingly, the VP1u receptor appeared to be expressed only on erythropoietin-dependent erythroid differentiation stages that also provide the necessary intracellular factors for a productive infection. Taken together, these findings suggest that the VP1u binds to a yet-unknown erythroid-specific cellular receptor and thus restricts the virus entry to permissive cells. PMID:27690083

  14. Is erythroferrone finally the long sought-after systemic erythroid regulator of iron?

    PubMed Central

    Lawen, Alfons

    2015-01-01

    Iron metabolism is regulated on the cellular and the systemic level. Over the last decade, the liver peptide “hepcidin” has emerged as the body’s key irons store regulator. The long postulated “erythroid regulator of iron”, however, remained elusive. Last year, evidence was provided, that a previously described myokine “myonectin” may also function as the long sought erythroid regulator of iron. Myonectin was therefore re-named “erythroferrone”. This editorial provides a brief discussion on the two functions of erythroferrone and also briefly considers the emerging potential role of transferrin receptor 2 in erythropoiesis. PMID:26322167

  15. Protein Arginine Methyltransferase 1 Interacts with and Activates p38α to Facilitate Erythroid Differentiation

    PubMed Central

    Hua, Wei-Kai; Chang, Yuan-I; Yao, Chao-Ling; Hwang, Shiaw-Min; Chang, Chung-Yi; Lin, Wey-Jinq

    2013-01-01

    Protein arginine methylation is emerging as a pivotal posttranslational modification involved in regulating various cellular processes; however, its role in erythropoiesis is still elusive. Erythropoiesis generates circulating red blood cells which are vital for body activity. Deficiency in erythroid differentiation causes anemia which compromises the quality of life. Despite extensive studies, the molecular events regulating erythropoiesis are not fully understood. This study showed that the increase in protein arginine methyltransferase 1 (PRMT1) levels, via transfection or protein transduction, significantly promoted erythroid differentiation in the bipotent human K562 cell line as well as in human primary hematopoietic progenitor CD34+ cells. PRMT1 expression enhanced the production of hemoglobin and the erythroid surface marker glycophorin A, and also up-regulated several key transcription factors, GATA1, NF-E2 and EKLF, which are critical for lineage-specific differentiation. The shRNA-mediated knockdown of PRMT1 suppressed erythroid differentiation. The methyltransferase activity-deficient PRMT1G80R mutant failed to stimulate differentiation, indicating the requirement of arginine methylation of target proteins. Our results further showed that a specific isoform of p38 MAPK, p38α, promoted erythroid differentiation, whereas p38β did not play a role. The stimulation of erythroid differentiation by PRMT1 was diminished in p38α- but not p38β-knockdown cells. PRMT1 appeared to act upstream of p38α, since expression of p38α still promoted erythroid differentiation in PRMT1-knockdown cells, and expression of PRMT1 enhanced the activation of p38 MAPK. Importantly, we showed for the first time that PRMT1 was associated with p38α in cells by co-immunoprecipitation and that PRMT1 directly methylated p38α in in vitro methylation assays. Taken together, our findings unveil a link between PRMT1 and p38α in regulating the erythroid differentiation program and

  16. Dysplastic changes in erythroid precursors as a manifestation of lead poisoning: report of a case and review of literature.

    PubMed

    Lv, Chenglan; Xu, Yueyi; Wang, Jing; Shao, Xiaoyan; Ouyang, Jian; Li, Juan

    2015-01-01

    Dysplastic changes in erythroid precursors occur not only in patients with hematologic diseases, but also those with other diseases. Here, we report on a patient that presented with dysplastic changes in erythroid precursors due to lead poisoning from the intake of Chinese folk remedies.

  17. Dysplastic changes in erythroid precursors as a manifestation of lead poisoning: report of a case and review of literature

    PubMed Central

    Lv, Chenglan; Xu, Yueyi; Wang, Jing; Shao, Xiaoyan; Ouyang, Jian; Li, Juan

    2015-01-01

    Dysplastic changes in erythroid precursors occur not only in patients with hematologic diseases, but also those with other diseases. Here, we report on a patient that presented with dysplastic changes in erythroid precursors due to lead poisoning from the intake of Chinese folk remedies. PMID:25755780

  18. Production of pure metals

    NASA Technical Reports Server (NTRS)

    Philipp, W. H.; Marsik, S. J.; May, C. E. (Inventor)

    1974-01-01

    A process for depositing elements by irradiating liquids is reported. Ultra pure elements are precipitated from aqueous solutions or suspensions of compounds. A solution of a salt of a metal to be prepared is irradiated, and the insoluble reaction product settles out. Some chemical compounds may also be prepared in this manner.

  19. Dahlbeck and Pure Ontology

    ERIC Educational Resources Information Center

    Mackenzie, Jim

    2016-01-01

    This article responds to Johan Dahlbeck's "Towards a pure ontology: Children's bodies and morality" ["Educational Philosophy and Theory," vol. 46 (1), 2014, pp. 8-23 (EJ1026561)]. His arguments from Nietzsche and Spinoza do not carry the weight he supposes, and the conclusions he draws from them about pedagogy would be…

  20. Language as Pure Potential

    ERIC Educational Resources Information Center

    Park, Joseph Sung-Yul

    2016-01-01

    Language occupies a crucial position in neoliberalism, due to the reimagination of language as commodified skill. This paper studies the role of language ideology in this transformation by identifying a particular ideology that facilitates this process, namely the ideology which views language as pure potential. Neoliberalism treats language as a…

  1. Cytotoxicity of quantum dots and graphene oxide to erythroid cells and macrophages

    NASA Astrophysics Data System (ADS)

    Qu, Guangbo; Wang, Xiaoyan; Wang, Zhe; Liu, Sijin; Jiang, Guibing

    2013-04-01

    Great concerns have been raised about the exposure and possible adverse influence of nanomaterials due to their wide applications in a variety of fields, such as biomedicine and daily lives. The blood circulation system and blood cells form an important barrier against invaders, including nanomaterials. However, studies of the biological effects of nanomaterials on blood cells have been limited and without clear conclusions thus far. In the current study, the biological influence of quantum dots (QDs) with various surface coating on erythroid cells and graphene oxide (GO) on macrophages was closely investigated. We found that QDs posed great damage to macrophages through intracellular accumulation of QDs coupled with reactive oxygen species generation, particularly for QDs coated with PEG-NH2. QD modified with polyethylene glycol-conjugated amine particles exerted robust inhibition on cell proliferation of J744A.1 macrophages, irrespective of apoptosis. Additionally, to the best of our knowledge, our study is the first to have demonstrated that GO could provoke apoptosis of erythroid cells through oxidative stress in E14.5 fetal liver erythroid cells and in vivo administration of GO-diminished erythroid population in spleen, associated with disordered erythropoiesis in mice.

  2. Notch1-promoted TRPA1 expression in erythroleukemic cells suppresses erythroid but enhances megakaryocyte differentiation.

    PubMed

    Chen, Ji-Lin; Ping, Yueh-Hsin; Tseng, Min-Jen; Chang, Yuan-I; Lee, Hsin-Chen; Hsieh, Rong-Hong; Yeh, Tien-Shun

    2017-02-21

    The Notch1 pathway plays important roles in modulating erythroid and megakaryocyte differentiation. To screen the Notch1-related genes that regulate differentiation fate of K562 and HEL cells, the expression of transient receptor potential ankyrin 1 (TRPA1) was induced by Notch1 receptor intracellular domain (N1IC), the activated form of Notch1 receptor. N1IC and v-ets erythroblastosis virus E26 oncogene homolog 1 (Ets-1) bound to TRPA1 promoter region to regulate transcription in K562 cells. Transactivation of TRPA1 promoter by N1IC depended on the methylation status of TRPA1 promoter. N1IC and Ets-1 suppressed the DNA methyltransferase 3B (DNMT3B) level in K562 cells. Inhibition of TRPA1 expression after Notch1 knockdown could be attenuated by nanaomycin A, an inhibitor of DNMT3B, in K562 and HEL cells. Functionally, hemin-induced erythroid differentiation could be suppressed by TRPA1, and the reduction of erythroid differentiation of both cells by N1IC and Ets-1 occurred via TRPA1. However, PMA-induced megakaryocyte differentiation could be enhanced by TRPA1, and the surface markers of megakaryocytes could be elevated by nanaomycin A. Megakaryocyte differentiation could be reduced by Notch1 or Ets-1 knockdown and relieved by TRPA1 overexpression. The results suggest that Notch1 and TRPA1 might be critical modulators that control the fate of erythroid and megakaryocyte differentiation.

  3. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders.

  4. BMP-mediated specification of the erythroid lineage suppresses endothelial development in blood island precursors

    PubMed Central

    Myers, Candace T.

    2013-01-01

    The developmental relationship between the blood and endothelial cell (EC) lineages remains unclear. In the extra-embryonic blood islands of birds and mammals, ECs and blood cells are closely intermixed, and blood island precursor cells in the primitive streak express many of the same molecular markers, leading to the suggestion that both lineages arise from a common precursor, called the hemangioblast. Cells within the blood island of Xenopus also coexpress predifferentiation markers of the blood and EC lineages. However, using multiple assays, we find that precursor cells in the Xenopus blood island do not normally differentiate into ECs, suggesting that classic hemangioblasts are rare or nonexistent in Xenopus. What prevents these precursor cells from developing into mature ECs? We have found that bone morphogenetic protein (BMP) signaling is essential for erythroid differentiation, and in the absence of BMP signaling, precursor cells adopt an EC fate. Furthermore, inhibition of the erythroid transcription pathway leads to endothelial differentiation. Our results indicate that bipotential endothelial/erythroid precursor cells do indeed exist in the Xenopus blood island, but BMP signaling normally acts to constrain EC fate. More generally, these results provide evidence that commitment to the erythroid lineage limits development of bipotential precursors toward an endothelial fate. PMID:24100450

  5. Establishment of Immortalized Human Erythroid Progenitor Cell Lines Able to Produce Enucleated Red Blood Cells

    PubMed Central

    Kurita, Ryo; Suda, Noriko; Sudo, Kazuhiro; Miharada, Kenichi; Hiroyama, Takashi; Miyoshi, Hiroyuki; Tani, Kenzaburo; Nakamura, Yukio

    2013-01-01

    Transfusion of red blood cells (RBCs) is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs. PMID:23533656

  6. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  7. Notch1-promoted TRPA1 expression in erythroleukemic cells suppresses erythroid but enhances megakaryocyte differentiation

    PubMed Central

    Chen, Ji-Lin; Ping, Yueh-Hsin; Tseng, Min-Jen; Chang, Yuan-I; Lee, Hsin-Chen; Hsieh, Rong-Hong; Yeh, Tien-Shun

    2017-01-01

    The Notch1 pathway plays important roles in modulating erythroid and megakaryocyte differentiation. To screen the Notch1-related genes that regulate differentiation fate of K562 and HEL cells, the expression of transient receptor potential ankyrin 1 (TRPA1) was induced by Notch1 receptor intracellular domain (N1IC), the activated form of Notch1 receptor. N1IC and v-ets erythroblastosis virus E26 oncogene homolog 1 (Ets-1) bound to TRPA1 promoter region to regulate transcription in K562 cells. Transactivation of TRPA1 promoter by N1IC depended on the methylation status of TRPA1 promoter. N1IC and Ets-1 suppressed the DNA methyltransferase 3B (DNMT3B) level in K562 cells. Inhibition of TRPA1 expression after Notch1 knockdown could be attenuated by nanaomycin A, an inhibitor of DNMT3B, in K562 and HEL cells. Functionally, hemin-induced erythroid differentiation could be suppressed by TRPA1, and the reduction of erythroid differentiation of both cells by N1IC and Ets-1 occurred via TRPA1. However, PMA-induced megakaryocyte differentiation could be enhanced by TRPA1, and the surface markers of megakaryocytes could be elevated by nanaomycin A. Megakaryocyte differentiation could be reduced by Notch1 or Ets-1 knockdown and relieved by TRPA1 overexpression. The results suggest that Notch1 and TRPA1 might be critical modulators that control the fate of erythroid and megakaryocyte differentiation. PMID:28220825

  8. Imaging Flow Cytometry for the Study of Erythroid Cell Biology and Pathology

    PubMed Central

    Samsel, Leigh; McCoy, J Philip

    2015-01-01

    Erythroid cell maturation and diseases affecting erythrocytes are frequently accompanied by morphologic and immunophenotypic changes to these cells. In the past, these changes have been assessed primarily through the use of manual microscopy, which substantially limits the statistical rigor, throughput, and objectivity of these studies. Imaging flow cytometry provides a technology to examine both the morphology of cells as well as to quantify the staining intensity and signal distribution of numerous fluorescent markers on a cell-by-cell basis with high throughput in a statistically robust manner, and thus is ideally suited to studying erythroid cell biology. To date imaging flow cytometry has been used to study erythrocytes in three areas: 1) erythroid cell maturation, 2) sickle cell disease, and 3) infectious diseases such as malaria. In the maturation studies, imaging flow cytometry can closely recapitulate known stages of maturation and has led to the identification of a new population of erythroid cell precursors. In sickle cell disease, imaging flow cytometry provides a robust method to quantify sickled erythrocytes and to identify cellular aggregates linked to morbidities, and in malaria, imaging flow cytometry has been used to screen for new chemotherapeutic agents. These studies have demonstrated the value of imaging flow cytometry for investigations of erythrocyte biology and pathology. PMID:25858229

  9. Probing conformational stability and dynamics of erythroid and nonerythroid spectrin: effects of urea and guanidine hydrochloride.

    PubMed

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from.

  10. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation.

    PubMed

    Hattangadi, Shilpa M; Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F

    2014-09-18

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly,many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7.

  11. Homeodomain-interacting protein kinase 2 plays an important role in normal terminal erythroid differentiation.

    PubMed

    Hattangadi, Shilpa M; Burke, Karly A; Lodish, Harvey F

    2010-06-10

    Gene-targeting experiments report that the homeodomain-interacting protein kinases 1 and 2, Hipk1 and Hipk2, are essential but redundant in hematopoietic development because Hipk1/Hipk2 double-deficient animals exhibit severe defects in hematopoiesis and vasculogenesis, whereas the single knockouts do not. These serine-threonine kinases phosphorylate and consequently modify the functions of several important hematopoietic transcription factors and cofactors. Here we show that Hipk2 knockdown alone plays a significant role in terminal fetal liver erythroid differentiation. Hipk1 and Hipk2 are highly induced during primary mouse fetal liver erythropoiesis. Specific knockdown of Hipk2 inhibits terminal erythroid cell proliferation (explained in part by impaired cell-cycle progression as well as increased apoptosis) and terminal enucleation as well as the accumulation of hemoglobin. Hipk2 knockdown also reduces the transcription of many genes involved in proliferation and apoptosis as well as important, erythroid-specific genes involved in hemoglobin biosynthesis, such as alpha-globin and mitoferrin 1, demonstrating that Hipk2 plays an important role in some but not all aspects of normal terminal erythroid differentiation.

  12. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation

    PubMed Central

    Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F.

    2014-01-01

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly, many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7. PMID:25092175

  13. Functional interaction of CP2 with GATA-1 in the regulation of erythroid promoters.

    PubMed

    Bosè, Francesca; Fugazza, Cristina; Casalgrandi, Maura; Capelli, Alessia; Cunningham, John M; Zhao, Quan; Jane, Stephen M; Ottolenghi, Sergio; Ronchi, Antonella

    2006-05-01

    We observed that binding sites for the ubiquitously expressed transcription factor CP2 were present in regulatory regions of multiple erythroid genes. In these regions, the CP2 binding site was adjacent to a site for the erythroid factor GATA-1. Using three such regulatory regions (from genes encoding the transcription factors GATA-1, EKLF, and p45 NF-E2), we demonstrated the functional importance of the adjacent CP2/GATA-1 sites. In particular, CP2 binds to the GATA-1 HS2 enhancer, generating a ternary complex with GATA-1 and DNA. Mutations in the CP2 consensus greatly impaired HS2 activity in transient transfection assays with K562 cells. Similar results were obtained by transfection of EKLF and p45 NF-E2 mutant constructs. Chromatin immunoprecipitation with K562 cells showed that CP2 binds in vivo to all three regulatory elements and that both GATA-1 and CP2 were present on the same GATA-1 and EKLF regulatory elements. Adjacent CP2/GATA-1 sites may represent a novel module for erythroid expression of a number of genes. Additionally, coimmunoprecipitation and glutathione S-transferase pull-down experiments demonstrated a physical interaction between GATA-1 and CP2. This may contribute to the functional cooperation between these factors and provide an explanation for the important role of ubiquitous CP2 in the regulation of erythroid genes.

  14. FOXO3-mTOR Metabolic Cooperation in the Regulation of Erythroid Cell Maturation and Homeostasis

    PubMed Central

    Zhang, Xin; Campreciós, Genís; Rimmelé, Pauline; Liang, Raymond; Yalcin, Safak; Mungamuri, Sathish Kumar; Barminko, Jeffrey; D’Escamard, Valentina; Baron, Margaret H.; Brugnara, Carlo; Papatsenko, Dmitri; Rivella, Stefano; Ghaffari, Saghi

    2014-01-01

    Ineffective erythropoiesis is observed in many erythroid disorders including β-thalassemia and anemia of chronic disease in which increased production of erythroblasts that fail to mature exacerbate the underlying anemias. As loss of the transcription factor FOXO3 results in erythroblast abnormalities similar to the ones observed in ineffective erythropoiesis, we investigated the underlying mechanisms of the defective Foxo3−/− erythroblast cell cycle and maturation. Here we show that loss of Foxo3 results in overactivation of the JAK2/AKT/mTOR signaling pathway in primary bone marrow erythroblasts partly mediated by redox modulation. We further show that hyperactivation of mTOR signaling interferes with cell cycle progression in Foxo3 mutant erythroblasts. Importantly, inhibition of mTOR signaling, in vivo or in vitro enhances significantly Foxo3 mutant erythroid cell maturation. Similarly, in vivo inhibition of mTOR remarkably improves erythroid cell maturation and anemia in a model of β-thalassemia. Finally we show that FOXO3 and mTOR are likely part of a larger metabolic network in erythroblasts as together they control the expression of an array of metabolic genes some of which are implicated in erythroid disorders. These combined findings indicate that a metabolism-mediated regulatory network centered by FOXO3 and mTOR control the balanced production and maturation of erythroid cells. They also highlight physiological interactions between these proteins in regulating erythroblast energy. Our results indicate that alteration in the function of this network might be implicated in the pathogenesis of ineffective erythropoiesis. PMID:24966026

  15. EPO-mediated expansion of late-stage erythroid progenitors in the bone marrow initiates recovery from sublethal radiation stress

    PubMed Central

    Peslak, Scott A.; Wenger, Jesse; Bemis, Jeffrey C.; Kingsley, Paul D.; Koniski, Anne D.; McGrath, Kathleen E.

    2012-01-01

    Erythropoiesis is a robust process of cellular expansion and maturation occurring in murine bone marrow and spleen. We previously determined that sublethal irradiation, unlike bleeding or hemolysis, depletes almost all marrow and splenic erythroblasts but leaves peripheral erythrocytes intact. To better understand the erythroid stress response, we analyzed progenitor, precursor, and peripheral blood compartments of mice post–4 Gy total body irradiation. Erythroid recovery initiates with rapid expansion of late-stage erythroid progenitors–day 3 burst-forming units and colony-forming units, associated with markedly increased plasma erythropoietin (EPO). Although initial expansion of late-stage erythroid progenitors is dependent on EPO, this cellular compartment becomes sharply down-regulated despite elevated EPO levels. Loss of EPO-responsive progenitors is associated temporally with a wave of maturing erythroid precursors in marrow and with emergence of circulating erythroid progenitors and subsequent reestablishment of splenic erythropoiesis. These circulating progenitors selectively engraft and mature in irradiated spleen after short-term transplantation, supporting the concept that bone marrow erythroid progenitors migrate to spleen. We conclude that sublethal radiation is a unique model of endogenous stress erythropoiesis, with specific injury to the extravascular erythron, expansion and maturation of EPO-responsive late-stage progenitors exclusively in marrow, and subsequent reseeding of extramedullary sites. PMID:22889760

  16. Comprehensive characterization of erythroid-specific enhancers in the genomic regions of human Krüppel-like factors

    PubMed Central

    2013-01-01

    Background Mapping of DNase I hypersensitive sites (DHSs) is a powerful tool to experimentally identify cis-regulatory elements (CREs). Among CREs, enhancers are abundant and predominantly act in driving cell-specific gene expression. Krüppel-like factors (KLFs) are a family of eukaryotic transcription factors. Several KLFs have been demonstrated to play important roles in hematopoiesis. However, transcriptional regulation of KLFs via CREs, particularly enhancers, in erythroid cells has been poorly understood. Results In this study, 23 erythroid-specific or putative erythroid-specific DHSs were identified by DNase-seq in the genomic regions of 17 human KLFs, and their enhancer activities were evaluated using dual-luciferase reporter (DLR) assay. Of the 23 erythroid-specific DHSs, the enhancer activities of 15 DHSs were comparable to that of the classical enhancer HS2 in driving minimal promoter (minP). Fifteen DHSs, some overlapping those that increased minP activities, acted as enhancers when driving the corresponding KLF promoters (KLF-Ps) in erythroid cells; of these, 10 DHSs were finally characterized as erythroid-specific KLF enhancers. These 10 erythroid-specific KLF enhancers were further confirmed using chromatin immunoprecipitation coupled to sequencing (ChIP-seq) data-based bioinformatic and biochemical analyses. Conclusion Our present findings provide a feasible strategy to extensively identify gene- and cell-specific enhancers from DHSs obtained by high-throughput sequencing, which will help reveal the transcriptional regulation and biological functions of genes in some specific cells. PMID:23985037

  17. C(5) modified uracil derivatives showing antiproliferative and erythroid differentiation inducing activities on human chronic myelogenous leukemia K562 cells

    PubMed Central

    Brognara, Eleonora; Lampronti, Ilaria; Breveglieri, Giulia; Accetta, Alessandro; Corradini, Roberto; Manicardi, Alex; Borgatti, Monica; Canella, Alessandro; Multineddu, Chiara; Marchelli, Rosangela; Gambari, Roberto

    2011-01-01

    The K562 cell line has been proposed as a useful experimental system to identify anti-tumor compounds acting by inducing terminal erythroid differentiation. K562 cells exhibit a low proportion of hemoglobin-synthesizing cells under standard cell growth conditions, but are able to undergo terminal erythroid differentiation when treated with a variety of anti-tumor compounds. In this paper we report a screening study on a set of different modified C(5) uracil derivatives for the evaluation of their antiproliferative effect in connection with erythroid differentiation pathways, and for defining a new class of drug candidates for the treatment of chronic myelogenous leukemia. Activity of the derivatives tested can be classified in two effect: an antiproliferative effect linked to a high level of erythroid differentiation activity and an antiproliferative effect without activation of gamma globin genes The highest antiproliferative effect and erythroid induction was shown by compound 9, a thymine derivative bearing a n-octyl chain on nitrogen N(1), whereas thymine did not show any effect, suggesting the importance of the linear alkyl chain in position N(1). To our knowledge this compound should be considered among the most efficient inducers of erythroid differentiation of K562 cells. This work is the starting point for the quest of more effective and specific drugs for the induction of terminal erythroid differentiation, for leading new insights in the treatment of neoplastic diseases with molecules acting by inducing differentiation rather than by simply exerting cytotoxic effects. PMID:21958870

  18. Spontaneous and Fas-induced apoptosis of low-grade MDS erythroid precursors involves the endoplasmic reticulum.

    PubMed

    Gyan, E; Frisan, E; Beyne-Rauzy, O; Deschemin, J-C; Pierre-Eugene, C; Randriamampita, C; Dubart-Kupperschmitt, A; Garrido, C; Dreyfus, F; Mayeux, P; Lacombe, C; Solary, E; Fontenay, M

    2008-10-01

    Spontaneous apoptosis of bone marrow erythroid precursors accounts for the anemia that characterizes most low-grade myelodysplastic syndromes (MDS). We have shown that death of these precursors involved the Fas-dependent activation of caspase-8. To explore the pathway leading from caspase-8 activation to apoptosis, we transduced MDS bone marrow CD34(+) cells with a lentivirus encoding wild-type (WT) or endoplasmic reticulum (ER)-targeted Bcl-2 protein before inducing their erythroid differentiation. Both WT-Bcl-2 and ER-targeted Bcl-2 prevented spontaneous and Fas-dependent apoptosis in MDS erythroid precursors. ER-targeted Bcl-2 inhibited mitochondrial membrane depolarization and cytochrome c release in MDS erythroid precursors undergoing apoptosis, indicating a role for the ER in the death pathway, upstream of the mitochondria. MDS erythroid precursors demonstrated elevated ER Ca(2+) stores and these stores remained unaffected by ER-targeted Bcl-2. The ER-associated protein Bcl-2-associated protein (BAP) 31 was cleaved by caspase-8 in MDS erythroid precursors undergoing apoptosis. The protective effect of ER-targeted Bcl-2 toward spontaneous and Fas-induced apoptosis correlated with inhibition of BAP31 cleavage. A protective effect of erythropoietin against Fas-induced BAP31 cleavage and apoptosis was observed. We propose that apoptosis of MDS erythroid precursors involves the ER, downstream of Fas and upstream of the mitochondria, through the cleavage of the ER-associated BAP31 protein.

  19. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    SciTech Connect

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  20. Parvovirus B 19 (PVB19) induced pure red cell aplasia (PRCA) in immunocompromised patient after liver transplantation.

    PubMed

    Mrzljak, Anna; Kardum-Skelin, Ika; Cvrlje, Vesna Colić; Kanizaj, Tajana Filipec; Sustercić, Dunja; Gustin, Denis; Kocman, Branislav

    2010-03-01

    Presented here is a case of human parvovirus B19 (PVB19) induced pure red-cell aplasia (PRCA) in immunocompromised patient after orthotopic liver transplantation (OLT). PVB19 is a small, single-stranded DNA whose target cell is the erythroid progenitor in bone marrow. Manifestations of PVB19 infection vary with the immunologic status of the patient, ranging from asymptomatic to severe infections and PRCA. Post-transplant PRCA is induced either by immunosuppressive agents or PVB19. In the presented case, bone marrow aspiration characterized by the absence of mature erythroid precursors and detection of PVB19 DNA in blood led to treatment with high-dose intravenous human immunoglobulins (IVIG) and subsequent recovery of erythropoiesis. Due to insufficient antibody response in immunocompromised patients, suppression of the PVB19 infection is delayed and repetitive treatments may be administrated in attempt of reversing PRCA.

  1. Pure right ventricular infarction.

    PubMed

    Inoue, Katsuji; Matsuoka, Hiroshi; Kawakami, Hideo; Koyama, Yasushi; Nishimura, Kazuhisa; Ito, Taketoshi

    2002-02-01

    A 76-year-old man with chest pain was admitted to hospital where electrocardiography (ECG) showed ST-segment elevation in leads V1-4, indicative of acute anterior myocardial infarction. ST-segment elevation was also present in the right precordial leads V4R-6R. Emergency coronary angiography revealed that the left coronary artery was dominant and did not have significant stenosis. Aortography showed ostial occlusion of the right coronary artery (RCA). Left ventriculography showed normal function and right ventriculography showed a dilated right ventricle and severe hypokinesis of the right ventricular free wall. Conservative treatment was selected because the patient's symptoms soon ameliorated and his hemodynamics was stable. 99mTc-pyrophosphate and 201Tl dual single-photon emission computed tomography showed uptake of 99mTc-pyrophosphate in only the right ventricular free wall, but no uptake of 99mTc-pyrophosphate and no perfusion defect of 201Tl in the left ventricle. The peak creatine kinase (CK) and CK-MB were 1,381 IU/L and 127 IU/L, respectively. His natural course was favorable and the chest pain disappeared under medication. Two months after the onset, the ECG showed poor R progression in leads V1-4 indicating an old anterior infarction. Coronary angiography confirmed the ostial stenosis of the hypoplastic RCA. This was a case of pure right ventricular free wall infarction because of the occlusion of the ostium of the hypoplastic RCA, but not of the right ventricular branch. Because the electrocardiographic findings resemble those of an acute anterior infarction, it is important to consider pure right ventricular infarction in the differential diagnosis.

  2. An erythroid enhancer of BCL11A subject to genetic variation determines fetal hemoglobin level

    PubMed Central

    Bauer, Daniel E.; Kamran, Sophia C.; Lessard, Samuel; Xu, Jian; Fujiwara, Yuko; Lin, Carrie; Shao, Zhen; Canver, Matthew C.; Smith, Elenoe C.; Pinello, Luca; Sabo, Peter J.; Vierstra, Jeff; Voit, Richard A.; Yuan, Guo-Cheng; Porteus, Matthew H.; Stamatoyannopoulos, John A.; Lettre, Guillaume; Orkin, Stuart H.

    2014-01-01

    Genome-wide association studies (GWAS) have ascertained numerous trait-associated common genetic variants, frequently localized to regulatory DNA. We find that common genetic variation at BCL11A associated with fetal hemoglobin (HbF) level lies in noncoding sequences decorated by an erythroid enhancer chromatin signature. Fine-mapping uncovers a motif-disrupting common variant associated with reduced transcription factor binding, modestly diminished BCL11A expression and elevated HbF. The surrounding sequences function in vivo as a developmental stage-specific lineage-restricted enhancer. Genome engineering reveals the enhancer is required in erythroid but not B-lymphoid cells for BCL11A expression. These findings illustrate how GWAS may expose functional variants of modest impact within causal elements essential for appropriate gene expression. We propose the GWAS-marked BCL11A enhancer represents an attractive target for therapeutic genome engineering for the β-hemoglobinopathies. PMID:24115442

  3. An erythroid enhancer of BCL11A subject to genetic variation determines fetal hemoglobin level.

    PubMed

    Bauer, Daniel E; Kamran, Sophia C; Lessard, Samuel; Xu, Jian; Fujiwara, Yuko; Lin, Carrie; Shao, Zhen; Canver, Matthew C; Smith, Elenoe C; Pinello, Luca; Sabo, Peter J; Vierstra, Jeff; Voit, Richard A; Yuan, Guo-Cheng; Porteus, Matthew H; Stamatoyannopoulos, John A; Lettre, Guillaume; Orkin, Stuart H

    2013-10-11

    Genome-wide association studies (GWASs) have ascertained numerous trait-associated common genetic variants, frequently localized to regulatory DNA. We found that common genetic variation at BCL11A associated with fetal hemoglobin (HbF) level lies in noncoding sequences decorated by an erythroid enhancer chromatin signature. Fine-mapping uncovers a motif-disrupting common variant associated with reduced transcription factor (TF) binding, modestly diminished BCL11A expression, and elevated HbF. The surrounding sequences function in vivo as a developmental stage-specific, lineage-restricted enhancer. Genome engineering reveals the enhancer is required in erythroid but not B-lymphoid cells for BCL11A expression. These findings illustrate how GWASs may expose functional variants of modest impact within causal elements essential for appropriate gene expression. We propose the GWAS-marked BCL11A enhancer represents an attractive target for therapeutic genome engineering for the β-hemoglobinopathies.

  4. A qualitative and quantitative cytochemical assay of dihydrofolate reductase in erythroid cells.

    PubMed

    Nano, R; Gerzeli, G; Invernizzi, R; Supino, R

    1989-01-01

    The distribution and intensity of dihydrofolate reductase (DHFR) cytochemically demonstrable was studied in erythroid cells. Cells of normal human bone marrow, of human erythroleukaemia (M6), and cells of the Friend (MEL) clone 745A murine erythroleukaemia (also after differentiation with dimethylsulphoxide, DMSO) were stained according to Gerzeli and de Piceis Polver (1969) technique; quantification of the reaction product was made using a Vickers M86 microdensitometer. The enzyme activity progressively decreased during the normal differentiation of the erythropoietic series while persisted at high levels in erythroleukaemia cells. It can be suggested that in the 1st case, the cytochemical pattern of dihydrofolate reductase may be a useful added tool for studying the erythroid differentiation. In the 2nd case, the increased level of this enzyme may be related to an amplification of the gene of DHFR in the malignant transformation.

  5. New insights into the mechanisms of mammalian erythroid chromatin condensation and enucleation.

    PubMed

    Ji, Peng

    2015-01-01

    A unique feature in mammalian erythropoiesis is the dramatic chromatin condensation followed by enucleation. This step-by-step process starts at the beginning of terminal erythropoiesis after the hematopoietic stem cells are committed to erythroid lineage. Although this phenomenon is known for decades, the mechanisms of chromatin condensation and enucleation remain elusive. Recent advances in cell and molecular biology have started to reveal the molecular pathways in the regulation of chromatin condensation, the establishment of nuclear polarity prior enucleation, and the rearrangement of actin cytoskeleton in enucleation. However, many challenging questions, especially whether and how the apoptotic mechanisms are involved in chromatin condensation and how to dissect the functions of many actin cytoskeleton proteins in cytokinesis and enucleation, remain to be answered. Here I review our current understanding of mammalian erythroid chromatin condensation and enucleation during terminal differentiation with a focus on more recent studies. I conclude with my perspective of future works in this rising topic in developmental and cell biology.

  6. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    PubMed

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation.

  7. Analysis of the erythroid differentiation effect of flavonoid apigenin on K562 human chronic leukemia cells.

    PubMed

    Isoda, Hiroko; Motojima, Hideko; Onaga, Shoko; Samet, Imen; Villareal, Myra O; Han, Junkyu

    2014-09-05

    The erythroid differentiation-inducing effect of apigenin and its derivatives on human chronic myeloid leukemia K562 has been reported but the functional group in its structure responsible for the effect has not yet been elucidated. Here, we determined the moiety responsible for the erythroid differentiation induction effect of apigenin by using different flavonoids to represent the functional groups in its structure. In addition, we compared apigenin and apigetrin, a flavonoid similar in structure to apigenin except for the glycoside in its structure. Morphological changes as well as expressions of specific markers in K562 cells treated with apigenin were compared with those treated with apigetrin, flavone, 7-hydroxyflavone, chrysin, luteolin, or naringenin. The anti-proliferative and erythroid differentiation-inducing effect of apigenin and the five flavonoids were then investigated and their effects on the α, β, and γ globin genes expressions were compared using real-time PCR. Results of the comparison between apigenin and apigetrin revealed that the glycoside part of apigetrin does not have a role in the induction of cell differentiation. Based on glycophorin A expression, the potency of the other flavonoids for induction of differentiation, was: apigenin>chrysin>flavone/7-hydroxyflavone>luteolin/naringenin. Results of the analysis of the relationship between the structure and function of the flavonoids suggest that the apigenin-induced K562 cell differentiation was due to the 2-3 double bond and hydroxyl groups in its structure. This is the first study that identified the specific functional group in apigenin that impact the erythroid differentiation effect in K562 cells.

  8. The Effect of Mir-451 Upregulation on Erythroid Lineage Differentiation of Murine Embryonic Stem Cells

    PubMed Central

    Obeidi, Narges; Pourfathollah, Ali Akbar; Soleimani, Masoud; Nikougoftar Zarif, Mahin; Kouhkan, Fatemeh

    2016-01-01

    Objective MicroRNAs (miRNAs) are small endogenous non-coding regulatory RNAs that control mRNAs post-transcriptionally. Several mouse stem cells miRNAs are cloned differentially regulated in different hematopoietic lineages, suggesting their possible role in hematopoietic lineage differentiation. Recent studies have shown that specific miRNAs such as Mir-451 have key roles in erythropoiesis. Materials and Methods In this experimental study, murine embryonic stem cells (mESCs) were infected with lentiviruses containing pCDH-Mir-451. Erythroid differentiation was assessed based on the expression level of transcriptional factors (Gata-1, Klf-1, Epor) and hemoglobin chains (α, β, γ , ε and ζ) genes using quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and presence of erythroid surface antigens (TER-119 and CD235a) using flow cytometery. Colony-forming unit (CFU) assay was also on days 14thand 21thafter transduction. Results Mature Mir-451 expression level increased by 3.434-fold relative to the untreated mESCs on day 4 after transduction (P<0.001). Mir-451 up-regulation correlated with the induction of transcriptional factor (Gata-1, Klf-1, Epor) and hemoglobin chain (α, β, γ, ε and ζ) genes in mESCs (P<0.001) and also showed a strong correlation with presence of CD235a and Ter- 119 markers in these cells (13.084and 13.327-fold increse, respectively) (P<0.05). Moreover, mESCs treated with pCDH-Mir-451 showed a significant raise in CFU-erythroid (CFU-E) colonies (5.2-fold) compared with untreated control group (P<0.05). Conclusion Our results showed that Mir-451 up-regulation strongly induces erythroid differentiation and maturation of mESCs. Overexpression of Mir-451 may have the potential to produce artificial red blood cells (RBCs) without the presence of any stimulatory cytokines. PMID:27540521

  9. Immunophenotypic analysis of erythroid dysplasia in myelodysplastic syndromes. A report from the IMDSFlow working group.

    PubMed

    Westers, Theresia M; Cremers, Eline M P; Oelschlaegel, Uta; Johansson, Ulrika; Bettelheim, Peter; Matarraz, Sergio; Orfao, Alberto; Moshaver, Bijan; Brodersen, Lisa Eidenschink; Loken, Michael R; Wells, Denise A; Subirá, Dolores; Cullen, Matthew; Te Marvelde, Jeroen G; van der Velden, Vincent H J; Preijers, Frank W M B; Chu, Sung-Chao; Feuillard, Jean; Guérin, Estelle; Psarra, Katherina; Porwit, Anna; Saft, Leonie; Ireland, Robin; Milne, Timothy; Béné, Marie C; Witte, Birgit I; Della Porta, Matteo G; Kern, Wolfgang; van de Loosdrecht, Arjan A

    2017-02-01

    Current recommendations for diagnosing myelodysplastic syndromes endorse flow cytometry as an informative tool. Most flow cytometry protocols focus on the analysis of progenitor cells and the evaluation of the maturing myelomonocytic lineage. However, one of the most frequently observed features of myelodysplastic syndromes is anemia, which may be associated with dyserythropoiesis. Therefore, analysis of changes in flow cytometry features of nucleated erythroid cells may complement current flow cytometry tools. The multicenter study within the IMDSFlow Working Group, reported herein, focused on defining flow cytometry parameters that enable discrimination of dyserythropoiesis associated with myelodysplastic syndromes from non-clonal cytopenias. Data from a learning cohort were compared between myelodysplasia and controls, and results were validated in a separate cohort. The learning cohort comprised 245 myelodysplasia cases, 290 pathological, and 142 normal controls; the validation cohort comprised 129 myelodysplasia cases, 153 pathological, and 49 normal controls. Multivariate logistic regression analysis performed in the learning cohort revealed that analysis of expression of CD36 and CD71 (expressed as coefficient of variation), in combination with CD71 fluorescence intensity and the percentage of CD117(+) erythroid progenitors provided the best discrimination between myelodysplastic syndromes and non-clonal cytopenias (specificity 90%; 95% confidence interval: 84-94%). The high specificity of this marker set was confirmed in the validation cohort (92%; 95% confidence interval: 86-97%). This erythroid flow cytometry marker combination may improve the evaluation of cytopenic cases with suspected myelodysplasia, particularly when combined with flow cytometry assessment of the myelomonocytic lineage.

  10. FOG-1 and GATA-1 act sequentially to specify definitive megakaryocytic and erythroid progenitors

    PubMed Central

    Mancini, Elena; Sanjuan-Pla, Alejandra; Luciani, Luisa; Moore, Susan; Grover, Amit; Zay, Agnes; Rasmussen, Kasper D; Luc, Sidinh; Bilbao, Daniel; O'Carroll, Donal; Jacobsen, Sten Eirik; Nerlov, Claus

    2012-01-01

    The transcription factors that control lineage specification of haematopoietic stem cells (HSCs) have been well described for the myeloid and lymphoid lineages, whereas transcriptional control of erythroid (E) and megakaryocytic (Mk) fate is less understood. We here use conditional removal of the GATA-1 and FOG-1 transcription factors to identify FOG-1 as required for the formation of all committed Mk- and E-lineage progenitors, whereas GATA-1 was observed to be specifically required for E-lineage commitment. FOG-1-deficient HSCs and preMegEs, the latter normally bipotent for the Mk and E lineages, underwent myeloid transcriptional reprogramming, and formed myeloid, but not erythroid and megakaryocytic cells in vitro. These results identify FOG-1 and GATA-1 as required for formation of bipotent Mk/E progenitors and their E-lineage commitment, respectively, and show that FOG-1 mediates transcriptional Mk/E programming of HSCs as well as their subsequent Mk/E-lineage commitment. Finally, C/EBPs and FOG-1 exhibited transcriptional cross-regulation in early myelo-erythroid progenitors making their functional antagonism a potential mechanism for separation of the myeloid and Mk/E lineages. PMID:22068055

  11. p73 Plays a Role in Erythroid Differentiation through GATA1 Induction*

    PubMed Central

    Marqués-García, Fernando; Ferrandiz, Nuria; Fernández-Alonso, Rosalía; González-Cano, Laura; Herreros-Villanueva, Marta; Rosa-Garrido, Manuel; Fernández-García, Belén; Vaque, José P.; Marqués, Margarita M.; Alonso, María Eugenia; Segovia, José Carlos; León, Javier; Marín, María C.

    2009-01-01

    The TP73 gene gives rise to transactivation domain-p73 isoforms (TAp73) as well as ΔNp73 variants with a truncated N terminus. Although TAp73α and -β proteins are capable of inducing cell cycle arrest, apoptosis, and differentiation, ΔNp73 acts in many cell types as a dominant-negative repressor of p53 and TAp73. It has been proposed that p73 is involved in myeloid differentiation, and its altered expression is involved in leukemic degeneration. However, there is little evidence as to which p73 variants (TA or ΔN) are expressed during differentiation and whether specific p73 isoforms have the capacity to induce, or hinder, this differentiation in leukemia cells. In this study we identify GATA1 as a direct transcriptional target of TAp73α. Furthermore, TAp73α induces GATA1 activity, and it is required for erythroid differentiation. Additionally, we describe a functional cooperation between TAp73 and ΔNp73 in the context of erythroid differentiation in human myeloid cells, K562 and UT-7. Moreover, the impaired expression of GATA1 and other erythroid genes in the liver of p73KO embryos, together with the moderated anemia observed in p73KO young mice, suggests a physiological role for TP73 in erythropoiesis. PMID:19509292

  12. Erythroid colony formation and effect of hemin in vitro in hereditary sideroblastic anemias.

    PubMed

    Partanen, S; Pasanen, A; Juvonen, E; Tenhunen, R; Ruutu, T

    1988-05-01

    Colony formation by erythroid burst-forming units (BFU-E) and erythroid colony-forming units (CFU-E) and the effect of hemin on colony growth was studied in vitro in three Finnish families with hereditary sideroblastic anemia (HSA). Defective activity of heme synthase has been demonstrated in family A and that of delta-aminolevulinic acid synthase in family B. No biochemical defect has been recognized so far in family C. CFU-E colony growth was defective in seven of the eight persons studied. The formation of BFU-E colonies was normal in family A and increased in family C, whereas of the two members of family B one showed normal and one decreased BFU-E colony growth. Hemin in 30-120 microM concentration increased significantly both BFU-E (p less than 0.01) and CFU-E (p less than 0.005) colony formation in family C. No effect was seen in family A, and in family B the only effect was normalization of the decreased BFU-E colony growth by the highest hemin concentration in one person. This study indicates that differences exist between families with HSA in erythroid colony formation and in response to hemin in vitro, but the low number of investigated members in each family does not permit a conclusive evaluation of the impact of the carrier versus patient status or of sex on the results.

  13. FOG-1 and GATA-1 act sequentially to specify definitive megakaryocytic and erythroid progenitors.

    PubMed

    Mancini, Elena; Sanjuan-Pla, Alejandra; Luciani, Luisa; Moore, Susan; Grover, Amit; Zay, Agnes; Rasmussen, Kasper D; Luc, Sidinh; Bilbao, Daniel; O'Carroll, Donal; Jacobsen, Sten Eirik; Nerlov, Claus

    2012-01-18

    The transcription factors that control lineage specification of haematopoietic stem cells (HSCs) have been well described for the myeloid and lymphoid lineages, whereas transcriptional control of erythroid (E) and megakaryocytic (Mk) fate is less understood. We here use conditional removal of the GATA-1 and FOG-1 transcription factors to identify FOG-1 as required for the formation of all committed Mk- and E-lineage progenitors, whereas GATA-1 was observed to be specifically required for E-lineage commitment. FOG-1-deficient HSCs and preMegEs, the latter normally bipotent for the Mk and E lineages, underwent myeloid transcriptional reprogramming, and formed myeloid, but not erythroid and megakaryocytic cells in vitro. These results identify FOG-1 and GATA-1 as required for formation of bipotent Mk/E progenitors and their E-lineage commitment, respectively, and show that FOG-1 mediates transcriptional Mk/E programming of HSCs as well as their subsequent Mk/E-lineage commitment. Finally, C/EBPs and FOG-1 exhibited transcriptional cross-regulation in early myelo-erythroid progenitors making their functional antagonism a potential mechanism for separation of the myeloid and Mk/E lineages.

  14. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  15. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

    PubMed Central

    Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  16. Immunophenotypic analysis of erythroid dysplasia in myelodysplastic syndromes. A report from the IMDSFlow working group

    PubMed Central

    Westers, Theresia M.; Cremers, Eline M.P.; Oelschlaegel, Uta; Johansson, Ulrika; Bettelheim, Peter; Matarraz, Sergio; Orfao, Alberto; Moshaver, Bijan; Brodersen, Lisa Eidenschink; Loken, Michael R.; Wells, Denise A.; Subirá, Dolores; Cullen, Matthew; te Marvelde, Jeroen G.; van der Velden, Vincent H.J.; Preijers, Frank W.M.B.; Chu, Sung-Chao; Feuillard, Jean; Guérin, Estelle; Psarra, Katherina; Porwit, Anna; Saft, Leonie; Ireland, Robin; Milne, Timothy; Béné, Marie C.; Witte, Birgit I.; Della Porta, Matteo G.; Kern, Wolfgang; van de Loosdrecht, Arjan A.

    2017-01-01

    Current recommendations for diagnosing myelodysplastic syndromes endorse flow cytometry as an informative tool. Most flow cytometry protocols focus on the analysis of progenitor cells and the evaluation of the maturing myelomonocytic lineage. However, one of the most frequently observed features of myelodysplastic syndromes is anemia, which may be associated with dyserythropoiesis. Therefore, analysis of changes in flow cytometry features of nucleated erythroid cells may complement current flow cytometry tools. The multicenter study within the IMDSFlow Working Group, reported herein, focused on defining flow cytometry parameters that enable discrimination of dyserythropoiesis associated with myelodysplastic syndromes from non-clonal cytopenias. Data from a learning cohort were compared between myelodysplasia and controls, and results were validated in a separate cohort. The learning cohort comprised 245 myelodysplasia cases, 290 pathological, and 142 normal controls; the validation cohort comprised 129 myelodysplasia cases, 153 pathological, and 49 normal controls. Multivariate logistic regression analysis performed in the learning cohort revealed that analysis of expression of CD36 and CD71 (expressed as coefficient of variation), in combination with CD71 fluorescence intensity and the percentage of CD117+ erythroid progenitors provided the best discrimination between myelodysplastic syndromes and non-clonal cytopenias (specificity 90%; 95% confidence interval: 84–94%). The high specificity of this marker set was confirmed in the validation cohort (92%; 95% confidence interval: 86–97%). This erythroid flow cytometry marker combination may improve the evaluation of cytopenic cases with suspected myelodysplasia, particularly when combined with flow cytometry assessment of the myelomonocytic lineage. PMID:27758818

  17. A core erythroid transcriptional network is repressed by a master regulator of myelo-lymphoid differentiation.

    PubMed

    Wontakal, Sandeep N; Guo, Xingyi; Smith, Cameron; MacCarthy, Thomas; Bresnick, Emery H; Bergman, Aviv; Snyder, Michael P; Weissman, Sherman M; Zheng, Deyou; Skoultchi, Arthur I

    2012-03-06

    Two mechanisms that play important roles in cell fate decisions are control of a "core transcriptional network" and repression of alternative transcriptional programs by antagonizing transcription factors. Whether these two mechanisms operate together is not known. Here we report that GATA-1, SCL, and Klf1 form an erythroid core transcriptional network by co-occupying >300 genes. Importantly, we find that PU.1, a negative regulator of terminal erythroid differentiation, is a highly integrated component of this network. GATA-1, SCL, and Klf1 act to promote, whereas PU.1 represses expression of many of the core network genes. PU.1 also represses the genes encoding GATA-1, SCL, Klf1, and important GATA-1 cofactors. Conversely, in addition to repressing PU.1 expression, GATA-1 also binds to and represses >100 PU.1 myelo-lymphoid gene targets in erythroid progenitors. Mathematical modeling further supports that this dual mechanism of repressing both the opposing upstream activator and its downstream targets provides a synergistic, robust mechanism for lineage specification. Taken together, these results amalgamate two key developmental principles, namely, regulation of a core transcriptional network and repression of an alternative transcriptional program, thereby enhancing our understanding of the mechanisms that establish cellular identity.

  18. Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation.

    PubMed

    Alvarez-Dominguez, Juan R; Hu, Wenqian; Yuan, Bingbing; Shi, Jiahai; Park, Staphany S; Gromatzky, Austin A; van Oudenaarden, Alexander; Lodish, Harvey F

    2014-01-23

    Erythropoiesis is regulated at multiple levels to ensure the proper generation of mature red cells under multiple physiological conditions. To probe the contribution of long noncoding RNAs (lncRNAs) to this process, we examined >1 billion RNA-seq reads of polyadenylated and nonpolyadenylated RNA from differentiating mouse fetal liver red blood cells and identified 655 lncRNA genes including not only intergenic, antisense, and intronic but also pseudogene and enhancer loci. More than 100 of these genes are previously unrecognized and highly erythroid specific. By integrating genome-wide surveys of chromatin states, transcription factor occupancy, and tissue expression patterns, we identify multiple lncRNAs that are dynamically expressed during erythropoiesis, show epigenetic regulation, and are targeted by key erythroid transcription factors GATA1, TAL1, or KLF1. We focus on 12 such candidates and find that they are nuclear-localized and exhibit complex developmental expression patterns. Depleting them severely impaired erythrocyte maturation, inhibiting cell size reduction and subsequent enucleation. One of them, alncRNA-EC7, is transcribed from an enhancer and is specifically needed for activation of the neighboring gene encoding BAND 3. Our study provides an annotated catalog of erythroid lncRNAs, readily available through an online resource, and shows that diverse types of lncRNAs participate in the regulatory circuitry underlying erythropoiesis.

  19. Biochemical measurements on single erythroid progenitor cells shed light on the combinatorial regulation of red blood cell production.

    PubMed

    Wang, Weijia; Akbarian, Vahe; Audet, Julie

    2013-02-02

    Adult bone marrow (BM) erythrocyte colony-forming units (CFU-Es) are important cellular targets for the treatment of anemia and also for the manufacture of red blood cells (RBCs) ex vivo. We obtained quantitative biochemical measurements from single and small numbers of CFU-Es by isolating and analyzing c-Kit(+)CD71(high)Ter119(-) cells from adult mouse BM and this allowed us to identify two mechanisms that can be manipulated to increase RBC production. As expected, maximum RBC output was obtained when CFU-Es were stimulated with a combination of Stem Cell Factor (SCF) and Erythropoietin (EPO) mainly because SCF supports a transient CFU-E expansion and EPO promotes the survival and terminal differentiation of erythroid progenitors. However, we found that one of the main factors limiting the output in RBCs was that EPO induces a downregulation of c-Kit expression which limits the transient expansion of CFU-Es. In the presence of SCF, the EPO-mediated downregulation of c-Kit on CFU-Es is delayed but still significant. Moreover, treatment of CFU-Es with 1-Naphthyl PP1 could partially inhibit the downregulation of c-Kit induced by EPO, suggesting that this process is dependent on a Src family kinase, v-Src and/or c-Fyn. We also found that CFU-E survival and proliferation was dependent on the level of time-integrated extracellular-regulated kinase (ERK) activation in these cells, all of which could be significantly increased when SCF and EPO were combined with mouse fetal liver-derived factors. Taken together, these results suggest two novel molecular strategies to increase RBC production and regeneration.

  20. Pure red cell aplasia caused by Parvo B19 virus in a kidney transplant recipient.

    PubMed

    Baral, A; Poudel, B; Agrawal, R K; Hada, R; Gurung, S

    2012-01-01

    Parvo B19 is a single stranded DNA virus, which typically has affinity for erythroid progenitor cells in the bone marrow and produces a severe form of anemia known as pure red cell aplasia. This condition is particularly worse in immunocompromised individuals. We herein report a young Nepali male who developed severe and persistent anaemia after kidney transplantation while being on immunosuppressive therapy. His bone marrow examination revealed morphological changes of pure red cell aplasia, caused by parvovirus B19. The IgM antibody against the virus was positive and the virus was detected by polymerase chain reaction in the blood. He was managed with intravenous immunoglobulin. He responded well to the treatment and has normal hemoglobin levels three months post treatment. To the best of our knowledge, this is the first such case report from Nepal.

  1. The Asymmetric Cell Division Regulators Par3, Scribble and Pins/Gpsm2 Are Not Essential for Erythroid Development or Enucleation

    PubMed Central

    Wölwer, Christina B.; Gödde, Nathan; Pase, Luke B.; Elsum, Imogen A.; Lim, Krystle Y. B.; Sacirbegovic, Faruk; Walkley, Carl R.; Ellis, Sarah; Ohno, Shigeo; Matsuzaki, Fumio; Russell, Sarah M.; Humbert, Patrick O.

    2017-01-01

    Erythroid enucleation is the process by which the future red blood cell disposes of its nucleus prior to entering the blood stream. This key event during red blood cell development has been likened to an asymmetric cell division (ACD), by which the enucleating erythroblast divides into two very different daughter cells of alternate molecular composition, a nucleated cell that will be removed by associated macrophages, and the reticulocyte that will mature to the definitive erythrocyte. Here we investigated gene expression of members of the Par, Scribble and Pins/Gpsm2 asymmetric cell division complexes in erythroid cells, and functionally tested their role in erythroid enucleation in vivo and ex vivo. Despite their roles in regulating ACD in other contexts, we found that these polarity regulators are not essential for erythroid enucleation, nor for erythroid development in vivo. Together our results put into question a role for cell polarity and asymmetric cell division in erythroid enucleation. PMID:28095473

  2. Reprogramming erythroid cells for lysosomal enzyme production leads to visceral and CNS cross-correction in mice with Hurler syndrome.

    PubMed

    Wang, Daren; Zhang, Wei; Kalfa, Theodosia A; Grabowski, Gregory; Davies, Stella; Malik, Punam; Pan, Dao

    2009-11-24

    Restricting transgene expression to maturing erythroid cells can reduce the risk for activating oncogenes in hematopoietic stem cells (HSCs) and their progeny, yet take advantage of their robust protein synthesis machinery for high-level protein production. This study sought to evaluate the feasibility and efficacy of reprogramming erythroid cells for production of a lysosomal enzyme, alpha-L-iduronidase (IDUA). An erythroid-specific hybrid promoter provided inducible IDUA expression and release during in vitro erythroid differentiation in murine erythroleukemia cells, resulting in phenotypical cross-correction in an enzyme-deficient lymphoblastoid cell line derived from patients with mucopolysaccharidosis type I (MPS I). Stable and higher than normal plasma IDUA levels were achieved in vivo in primary and secondary MPS I chimeras for at least 9 months after transplantation of HSCs transduced with the erythroid-specific IDUA-containing lentiviral vector (LV). Moreover, long-term metabolic correction was demonstrated by normalized urinary glycosaminoglycan accumulation in all treated MPS I mice. Complete normalization of tissue pathology was observed in heart, liver, and spleen. Notably, neurological function and brain pathology were significantly improved in MPS I mice by erythroid-derived, higher than normal peripheral IDUA protein. These data demonstrate that late-stage erythroid cells, transduced with a tissue-specific LV, can deliver a lysosomal enzyme continuously at supraphysiological levels to the bloodstream and can correct the disease phenotype in both viscera and CNS of MPS I mice. This approach provides a paradigm for the utilization of RBC precursors as a depot for efficient and potentially safer systemic delivery of nonsecreted proteins by ex vivo HSC gene transfer.

  3. ZFP36L2 is required for self-renewal of early burst-forming unit erythroid progenitors.

    PubMed

    Zhang, Lingbo; Prak, Lina; Rayon-Estrada, Violeta; Thiru, Prathapan; Flygare, Johan; Lim, Bing; Lodish, Harvey F

    2013-07-04

    Stem cells and progenitors in many lineages undergo self-renewing divisions, but the extracellular and intracellular proteins that regulate this process are largely unknown. Glucocorticoids stimulate red blood cell formation by promoting self-renewal of early burst-forming unit-erythroid (BFU-E) progenitors. Here we show that the RNA-binding protein ZFP36L2 is a transcriptional target of the glucocorticoid receptor (GR) in BFU-Es and is required for BFU-E self-renewal. ZFP36L2 is normally downregulated during erythroid differentiation from the BFU-E stage, but its expression is maintained by all tested GR agonists that stimulate BFU-E self-renewal, and the GR binds to several potential enhancer regions of ZFP36L2. Knockdown of ZFP36L2 in cultured BFU-E cells did not affect the rate of cell division but disrupted glucocorticoid-induced BFU-E self-renewal, and knockdown of ZFP36L2 in transplanted erythroid progenitors prevented expansion of erythroid lineage progenitors normally seen following induction of anaemia by phenylhydrazine treatment. ZFP36L2 preferentially binds to messenger RNAs that are induced or maintained at high expression levels during terminal erythroid differentiation and negatively regulates their expression levels. ZFP36L2 therefore functions as part of a molecular switch promoting BFU-E self-renewal and a subsequent increase in the total numbers of colony-forming unit-erythroid (CFU-E) progenitors and erythroid cells that are generated.

  4. Pure seminoma: A review and update

    PubMed Central

    2011-01-01

    Pure seminoma is a rare pathology of the young adult, often discovered in the early stages. Its prognosis is generally excellent and many therapeutic options are available, especially in stage I tumors. High cure rates can be achieved in several ways: standard treatment with radiotherapy is challenged by surveillance and chemotherapy. Toxicity issues and the patients' preferences should be considered when management decisions are made. This paper describes firstly the management of primary seminoma and its nodal involvement and, secondly, the various therapeutic options according to stage. PMID:21819630

  5. Large pure intracranial vagal schwannoma.

    PubMed

    Gazzeri, Roberto; Galarza, Marcelo; Costanzo, De Bonis; Carotenuto, Vincenzo; D'Angelo, Vincenzo

    2009-04-01

    We report a patient with a large, pure intracranial vagal schwannoma, compressing the medulla who presented with essential hypertension. Based on this and on previous cases, we suggest that a differentiation of pure intracranial schwannomas (subtype A1) from intracranial schwannomas with some extension in the jugular foramen (type A) should be used.

  6. Tissue-specific regulation of the rabbit 15-lipoxygenase gene in erythroid cells by a transcriptional silencer.

    PubMed Central

    O'Prey, J; Harrison, P R

    1995-01-01

    The 15-lipoxygenase (lox) gene is expressed in a tissue-specific manner, predominantly in erythroid cells but also in airway epithelial cells and eosinophils. We demonstrate in this report that the 5' flanking DNA of the 15-lox gene contains sequences which down-regulate its activity in a variety of non-erythroid cell lines but not in two erythroid cell lines. The element has characteristics of a transcriptional 'silencer' since it functions in both orientations. The main activity of the silencer has been mapped to the first 900 bp of 5' flanking DNA, which contains nine binding sites for a nuclear factor present in non-erythroid cells but not in erythroid cells. These binding sites have similar sequences and multiple copies of the binding sites confer tissue-specific down-regulation when attached to a minimal lox promoter fragment. The 5' flanking DNA also contains a cluster of three binding sites for the GATA family of transcription factors. Images PMID:7478994

  7. Induction of foetal haemoglobin synthesis in erythroid progenitor stem cells: mediated by water-soluble components of Terminalia catappa.

    PubMed

    Aimola, I A; Inuwa, H M; Nok, A J; Mamman, A I

    2014-06-01

    Current novel therapeutic agents for the treatment of sickle cell anaemia (SCA) focus on increasing foetal haemoglobin (HbF) levels in SCA patients. Unfortunately, the only approved HbF-inducing agent, hydroxyurea, has long-term unpredictable side effects. Studies have shown the potential of plant compounds to modulate HbF synthesis in primary erythroid progenitor stem cells. We isolated a novel HbF-inducing Terminalia catappa distilled water active fraction (TCDWF) from Terminalia catappa leaves that induced the commitment of erythroid progenitor stem cells to the erythroid lineage and relatively higher HbF synthesis of 9.2- and 6.8-fold increases in both erythropoietin (EPO)-independent and EPO-dependent progenitor stem cells respectively. TCDWF was differentially cytotoxic to EPO-dependent and EPO-independent erythroid progenitor stem cell cultures as revealed by lactate dehydrogenase release from the cells. TCDWF demonstrated a protective effect on EPO-dependent and not EPO-independent progenitor cells. TCDWF induced a modest increase in caspase 3 activity in EPO-independent erythroid progenitor stem cell cultures compared with a significantly higher (P˂0.05) caspase 3 activity in EPO-dependent ones. The results demonstrate that TCDWF may hold promising HbF-inducing compounds, which work synergistically, and suggest a dual modulatory effect on erythropoiesis inherent in this active fraction.

  8. Mathematical modeling reveals differential effects of erythropoietin on proliferation and lineage commitment of human hematopoietic progenitors in early erythroid culture

    PubMed Central

    Ward, Daniel; Carter, Deborah; Homer, Martin; Marucci, Lucia; Gampel, Alexandra

    2016-01-01

    Erythropoietin is essential for the production of mature erythroid cells, promoting both proliferation and survival. Whether erythropoietin and other cytokines can influence lineage commitment of hematopoietic stem and progenitor cells is of significant interest. To study lineage restriction of the common myeloid progenitor to the megakaryocyte/erythroid progenitor of peripheral blood CD34+ cells, we have shown that the cell surface protein CD36 identifies the earliest lineage restricted megakaryocyte/erythroid progenitor. Using this marker and carboxyfluorescein succinimidyl ester to track cell divisions in vitro, we have developed a mathematical model that accurately predicts population dynamics of erythroid culture. Parameters derived from the modeling of cultures without added erythropoietin indicate that the rate of lineage restriction is not affected by erythropoietin. By contrast, megakaryocyte/erythroid progenitor proliferation is sensitive to erythropoietin from the time that CD36 first appears at the cell surface. These results shed new light on the role of erythropoietin in erythropoiesis and provide a powerful tool for further study of hematopoietic progenitor lineage restriction and erythropoiesis. PMID:26589912

  9. CP2 binding to the promoter is essential for the enhanced transcription of globin genes in erythroid cells.

    PubMed

    Chae, Ji Hyung; Kim, Chul Geun

    2003-02-28

    We have previously reported that the reduced level of CP2 suppresses the mouse alpha- and beta-globin gene expression and hemoglobin synthesis during terminal differentiation of mouse erythroleukemia (MEL) cells in vitro [Chae et al. (1999)]. As an extension of this study, we demonstrated that human alpha-, epsilon-, and gamma- globin genes were also suppressed by the reduced expression of CP2 in K562 cells. To address how much CP2 contributes in the regulation of globin gene expression, we measured transcriptional activities of the wild type alpha-globin promoter and its various factor-binding sites mutants in erythroid and nonerythroid cells. Interestingly, CP2 site dependent transcriptional activation occurred in an erythroid-cell specific manner, even though CP2 is ubiquitously expressed. In addition, CP2 site mutation within the alpha-promoter severely suppressed promoter activity in differentiated, but not in undifferentiated MEL cells, suggesting that the CP2 binding site is needed for the enhanced transcription of globin genes during erythroid differentiation. When the human beta-globin locus control region was linked to the alpha-promoter, suppression was more severe in the CP2 site mutant in differentiated MEL cells. Overall data indicate that CP2 is a major factor in the regulation of globin expression in human and mouse erythroid cells, and CP2 binding to the globin gene promoter is essential for the enhanced transcription of globin genes in erythroid differentiation.

  10. Uroporphyrinogen III synthase erythroid promoter mutations in adjacent GATA1 and CP2 elements cause congenital erythropoietic porphyria.

    PubMed

    Solis, C; Aizencang, G I; Astrin, K H; Bishop, D F; Desnick, R J

    2001-03-01

    Congenital erythropoietic porphyria, an autosomal recessive inborn error of heme biosynthesis, results from the markedly deficient activity of uroporphyrinogen III synthase. Extensive mutation analyses of 40 unrelated patients only identified approximately 90% of mutant alleles. Sequencing the recently discovered erythroid-specific promoter in six patients with a single undefined allele identified four novel mutations clustered in a 20-bp region: (a) a -70T to C transition in a putative GATA-1 consensus binding element, (b) a -76G to A transition, (c) a -86C to A transversion in three unrelated patients, and (d) a -90C to A transversion in a putative CP2 binding motif. Also, a -224T to C polymorphism was present in approximately 4% of 200 unrelated Caucasian alleles. We inserted these mutant sequences into luciferase reporter constructs. When transfected into K562 erythroid cells, these constructs yielded 3 +/- 1, 54 +/- 3, 43 +/- 6, and 8 +/- 1%, respectively, of the reporter activity conferred by the wild-type promoter. Electrophoretic mobility shift assays indicated that the -70C mutation altered GATA1 binding, whereas the adjacent -76A mutation did not. Similarly, the -90C mutation altered CP2 binding, whereas the -86A mutation did not. Thus, these four pathogenic erythroid promoter mutations impaired erythroid-specific transcription, caused CEP, and identified functionally important GATA1 and CP2 transcriptional binding elements for erythroid-specific heme biosynthesis.

  11. Daughter Cells and Erythroid Cells Budding from PGCCs and Their Clinicopathological Significances in Colorectal Cancer

    PubMed Central

    Zhang, Dan; Yang, Xiaoyun; Yang, Zhengduo; Fei, Fei; Li, Shuyuan; Qu, Jie; Zhang, Mingqing; Li, Yuwei; Zhang, Xipeng; Zhang, Shiwu

    2017-01-01

    Purpose: We previously reported that polyploid giant cancer cells (PGCCs) induced by cobalt chloride (CoCl2) exhibit cancer stem cell properties. Daughter cells generated by PGCCs possess epithelial mesenchymal transition (EMT) phenotype changes and EMT plays an important role in cancer development and progression. This study investigated the characteristics of PGCCs from LoVo and HCT116 induced by CoCl2 and the clinicopathological significances of PGCCs in colorectal cancer (CRC). Materials and Methods: Western blotting and immunocytochemical staining were used to compare the expression levels of EMT-related proteins between PGCCs with budding daughter cells and the control cells. In addition, tissue samples were collected from 159 patients with CRC for analysis of PGCCs, vasculogenic mimicry (VM), and single stromal PGCCs with budding, as well as immunohistochemical staining for cathepsin B, vimentin, and hemoglobin A. Results: Single PGCCs induced by CoCl2 formed spheroids in vitro. Poorly differentiated CRCs showed the highest numbers of PGCCs and VM, and expression of cathepsin B. There was greater expression of EMT-related proteins in PGCCs with budding daughter cells than in control cells. The expression of vimentin located in PGCC nuclei. Single stomal PGCCs with budding were detected in 27.45% of well differentiated, 50% of moderately differentiated, and 90.20% of poorly differentiated CRC samples. PGCCs can generate erythroid cells that express delta-hemoglobin to form VM. Erythroid cells generated by PGCCs were positive for hemoglobin A immunocytochemical staining. Conclusion: PGCCs from LoVo and HCT116 treated by CoCl2 exhibited cancer stem cell properties. The number of PGCCs and VM were associated with CRC differentiation and daughter cells budded from PGCCs may promote the lymph node metastasis via expression of EMT-related proteins. PGCCs and their newly generated erythroid cells form VM structures. PMID:28261349

  12. Erythroid and megakaryocytic differentiation of K562 erythroleukemic cells by monochloramine.

    PubMed

    Ogino, T; Kobuchi, H; Fujita, H; Matsukawa, A; Utsumi, K

    2014-03-01

    The induction of leukemic cell differentiation is a hopeful therapeutic modality. We studied the effects of monochloramine (NH2Cl) on erythroleukemic K562 cell differentiation, and compared the effects observed with those of U0126 and staurosporine, which are known inducers of erythroid and megakaryocytic differentiation, respectively. CD235 (glycophorin) expression, a marker of erythroid differentiation, was significantly increased by NH2Cl and U0126, along with an increase in cd235 mRNA levels. Other erythroid markers such as γ-globin and CD71 (transferrin receptor) were also increased by NH2Cl and U0126. In contrast, CD61 (integrin β3) and CD42b (GP1bα) expression, markers of megakaryocytic differentiation, was increased by staurosporine, but did not change significantly by NH2Cl and U0126. NH2Cl retarded cell proliferation without a marked loss of viability. When ERK phosphorylation (T202/Y204) and CD235 expression were compared using various chemicals, a strong negative correlation was observed (r = -0.76). Paradoxically, NH2Cl and staurosporine, but not U0126, induced large cells with multiple or lobulated nuclei, which was characteristic to megakaryocytes. NH2Cl increased the mRNA levels of gata1 and scl, decreased that of gata2, and did not change those of pu.1 and klf1. The changes observed in mRNA expression were different from those of U0126 or staurosporine. These results suggest that NH2Cl induces the bidirectional differentiation of K562. Oxidative stress may be effective in inducing leukemic cell differentiation.

  13. A new molecular link between defective autophagy and erythroid abnormalities in chorea-acanthocytosis.

    PubMed

    Lupo, Francesca; Tibaldi, Elena; Matte, Alessandro; Sharma, Alok K; Brunati, Anna Maria; Alper, Seth L; Zancanaro, Carlo; Benati, Donatella; Siciliano, Angela; Bertoldi, Mariarita; Zonta, Francesca; Storch, Alexander; Walker, Ruth H; Danek, Adrian; Bader, Benedikt; Hermann, Andreas; De Franceschi, Lucia

    2016-12-22

    Chorea-acanthocytosis is one of the hereditary neurodegenerative disorders known as the neuroacanthocytoses. Chorea-acanthocytosis is characterized by circulating acanthocytes deficient in chorein, a protein of unknown function. We report here for the first time that chorea-acanthocytosis red cells are characterized by impaired autophagy, with cytoplasmic accumulation of active Lyn and of autophagy-related proteins Ulk1 and Atg7. In chorea-acanthocytosis erythrocytes, active Lyn is sequestered by HSP90-70 to form high-molecular-weight complexes that stabilize and protect Lyn from its proteasomal degradation, contributing to toxic Lyn accumulation. An interplay between accumulation of active Lyn and autophagy was found in chorea-acanthocytosis based on Lyn coimmunoprecipitation with Ulk1 and Atg7 and on the presence of Ulk1 in Lyn-containing high-molecular-weight complexes. In addition, chorein associated with Atg7 in healthy but not in chorea-acanthocytosis erythrocytes. Electron microscopy detected multivesicular bodies and membrane remnants only in circulating chorea-acanthocytosis red cells. In addition, reticulocyte-enriched chorea-acanthocytosis red cell fractions exhibited delayed clearance of mitochondria and lysosomes, further supporting the impairment of authophagic flux. Because autophagy is also important in erythropoiesis, we studied in vitro CD34(+)-derived erythroid precursors. In chorea-acanthocytosis, we found (1) dyserythropoiesis; (2) increased active Lyn; (3) accumulation of a marker of autophagic flux and autolysososme degradation; (4) accumlation of Lamp1, a lysosmal membrane protein, and LAMP1-positive aggregates; and (5) reduced clearance of lysosomes and mitochondria. Our results uncover in chorea-acanthocytosis erythroid cells an association between accumulation of active Lyn and impaired autophagy, suggesting a link between chorein and autophagic vesicle trafficking in erythroid maturation.

  14. Clinical utility of the IRF: assessment of erythroid regeneration following parvo B19 infection.

    PubMed

    Wyrick-Glatzel, Janis; Conway-Klaassen, Janice

    2002-01-01

    Parvo B19 (Fifth disease) is an erythrotropic virus which attaches through the 'P' globoside receptor on the surface of human red blood cells and precursors. This typically benign viral infection can cause a transient aplastic anemia in patients with underlying red cell disorders. In this case, a two-year-old child presents with severe aplastic anemia without evidence of underlying disease. Erythroid regeneration is monitored through the use of the immature reticulocyte fraction (IRF) and is demonstrated by the presence of high and medium fluorescence reticulocytes in the peripheral blood three to five days prior to the peak in absolute reticulocytes.

  15. Roles of Erythroid Differentiation Regulator 1 (Erdr1) on Inflammatory Skin Diseases

    PubMed Central

    Houh, Youn Kyung; Kim, Kyung Eun; Park, Hyun Jeong; Cho, Daeho

    2016-01-01

    Erythroid Differentiation Regulator 1 (Erdr1) is known as a hemoglobin synthesis factor which also regulates cell survival under conditions of stress. In addition, previous studies have revealed the effects of Erdr1 on cancer progression and its negative correlation with interleukin (IL)-18, a pro-inflammatory cytokine. Based on this evidence, the therapeutic effects of Erdr1 have been demonstrated in several inflammatory skin diseases such as malignant skin cancer, psoriasis, and rosacea. This article reviews the roles of Erdr1 in skin inflammation, suggesting that Erdr1 is a potential therapeutic molecule on inflammatory disorders. PMID:27941650

  16. Defense Mechanisms in "Pure" Anxiety and "Pure" Depressive Disorders.

    PubMed

    Colovic, Olga; Lecic Tosevski, Dusica; Perunicic Mladenovic, Ivana; Milosavljevic, Maja; Munjiza, Ana

    2016-10-01

    Our study was intended to test whether there are any differences in the way defense mechanisms are used by patients suffering from pure anxiety and those with pure depressive disorders. The sample size was as follows: depressive disorders without psychotic symptoms 30, anxiety disorders 30, and the healthy control group 30. The assessment of defense mechanisms was made using the DSQ-40 questionnaire. Our findings show that "pure" anxiety disorders differ from "pure" depressive disorders only in the use of immature defense mechanisms. The group with depressive disorders was significantly more prone to use immature defense mechanisms than the group with anxiety disorders (p = 0.005), primarily projection (p = 0.001) and devaluation (p = 0.003). These defense mechanisms may therefore be used both to differentiate between anxiety and depressive disorders and also to determine which symptoms (anxiety or depressive disorders) are dominant at any given stage of treatment.

  17. Invasive Thymoma with Pure Red Cell Aplasia and Amegakaryocytic Thrombocytopenia

    PubMed Central

    Kiyoki, Yusuke; Ueda, Sho; Yamaoka, Masatoshi; Shimizu, Seiich; Inagaki, Masaharu

    2016-01-01

    We here describe a case involving a 67-yearold female patient who was referred to our hospital due to severe anemia (hemoglobin, 5.0 g/dL), thrombocytopenia (platelet count, 0.6 × 104/μL), and a mediastinal shadow with calcification noted on X-ray. On admission, an anterior mediastinal tumor was detected, and bone marrow biopsy revealed few megakaryocytes and severely reduced numbers of erythroid cells. The diagnosis was thymoma with pure red cell aplasia (PRCA) and acquired amegakaryocytic thrombocytopenia (AAMT). On Day 8 of admission, the patient received immunosuppressive therapy together with cyclosporine for the 2 severe hematologic diseases, which were stabilized within 2 months. Subsequently, total thymectomy was performed. The diagnosis of the tumor invading the left lung was invasive thymoma, Masaokakoga stage III. The histological diagnosis was World Health Organization type AB. Thymoma accompanied with PRCA and AAMT is very rare, and, based on our case, immunotherapeutic therapy for the hematologic disorders should precede surgical intervention. PMID:28053696

  18. Pure red cell aplasia and lymphoproliferative disorders: an infrequent association.

    PubMed

    Vlachaki, Efthymia; Diamantidis, Michael D; Klonizakis, Philippos; Haralambidou-Vranitsa, Styliani; Ioannidou-Papagiannaki, Elizabeth; Klonizakis, Ioannis

    2012-01-01

    Pure red cell aplasia (PRCA) is a rare bone marrow failure syndrome defined by a progressive normocytic anaemia and reticulocytopenia without leukocytopenia and thrombocytopenia. Secondary PRCA can be associated with various haematological disorders, such as chronic lymphocytic leukaemia (CLL) or non-Hodgkin lymphoma (NHL). The aim of the present review is to investigate the infrequent association between PRCA and lymphoproliferative disorders. PRCA might precede the appearance of lymphoma, may present simultaneously with the lymphoid neoplastic disease, or might appear following the lymphomatic disorder. Possible pathophysiological molecular mechanisms to explain the rare association between PRCA and lymphoproliferative disorders are reported. Most cases of PRCA are presumed to be autoimmune mediated by antibodies against either erythroblasts or erythropoietin, by T-cells secreting factors selectively inhibiting erythroid colonies in the bone marrow or by NK cells directly lysing erythroblasts. Finally, focus is given to the therapeutical approach, as several treatment regimens have failed for PRCA. Immunosuppressive therapy and/or chemotherapy are effective for improving anaemia in the majority of patients with lymphoma-associated PRCA. Further investigation is required to define the pathophysiology of PRCA at a molecular level and to provide convincing evidence why it might appear as a rare complication of lymphoproliferative disorders.

  19. Hydroxycarbamide alters erythroid gene expression in children with sickle cell anaemia.

    PubMed

    Flanagan, Jonathan M; Steward, Shirley; Howard, Thad A; Mortier, Nicole A; Kimble, Amy C; Aygun, Banu; Hankins, Jane S; Neale, Geoffrey A; Ware, Russell E

    2012-04-01

    Sickle cell anaemia (SCA) is a severe debilitating haematological disorder associated with a high degree of morbidity and mortality. The level of fetal haemoglobin (HbF) is well-recognized as a critical laboratory parameter: lower HbF is associated with a higher risk of vaso-occlusive complications, organ damage, and early death. Hydroxycarbamide treatment can induce HbF, improve laboratory parameters, and ameliorate clinical complications of SCA but its mechanisms of action remain incompletely defined and the HbF response is highly variable. To identify pathways of hydroxycarbamide activity, we performed microarray expression analyses of early reticulocyte RNA obtained from children with SCA enrolled in the HydroxyUrea Study of Long-term Effects (NCT00305175) and examined the effects of hydroxycarbamide exposure in vivo. Hydroxycarbamide affected a large number of erythroid genes, with significant decreases in the expression of genes involved in translation, ribosome assembly and chromosome organization, presumably reflecting the daily cytotoxic pulses of hydroxycarbamide. Hydroxycarbamide also affected expression of numerous genes associated with HbF including BCL11A, a key regulator of baseline HbF levels. Together, these data indicate that hydroxycarbamide treatment for SCA leads to substantial changes in erythroid gene expression, including BCL11A and other potential signalling pathways associated with HbF induction.

  20. Interaction of the Macrophage and Primitive Erythroid Lineages in the Mammalian Embryo

    PubMed Central

    Palis, James

    2017-01-01

    Two distinct forms of erythropoiesis, primitive and definitive, are found in mammals. Definitive erythroid precursors in the bone marrow mature in the physical context of macrophage cells in “erythroblastic islands.” In the murine embryo, overlapping waves of primitive hematopoietic progenitors and definitive erythro-myeloid progenitors, each containing macrophage potential, arise in the yolk sac prior to the emergence of hematopoietic stem cells. Primitive erythroblasts mature in the bloodstream as a semi-synchronous cohort while macrophage cells derived from the yolk sac seed the fetal liver. Late-stage primitive erythroblasts associate with macrophage cells in erythroblastic islands in the fetal liver, indicating that primitive erythroblasts can interact with macrophage cells extravascularly. Like definitive erythroblasts, primitive erythroblasts physically associate with macrophages through α4 integrin–vascular adhesion molecule 1-mediated interactions and α4 integrin is redistributed onto the plasma membrane of primitive pyrenocytes. Both in vitro and in vivo studies indicate that fetal liver macrophage cells engulf primitive pyrenocytes. Taken together, these studies indicate that several aspects of the interplay between macrophage cells and maturing erythroid precursor cells are conserved during the ontogeny of mammalian organisms. PMID:28119687

  1. Canavanine inhibits vimentin assembly but not its synthesis in chicken embryo erythroid cells.

    PubMed

    Moon, R T; Lazarides, E

    1983-10-01

    In chicken embryo erythroid cells, newly synthesized vimentin first enters a Triton X-100 (TX-100)-soluble pool and subsequently assembles posttranslationally into TX-100-insoluble vimentin filaments (Blikstad I., and E. Lazarides, J. Cell Biol., 96:1803-1808). Here we show that incubation of chicken embryo erythroid cells in a medium in which arginine has been substituted by its amino acid analogue, canavanine, results in the inhibition of the posttranslational assembly of vimentin into the TX-100-insoluble filaments. Immunoprecipitation and subsequent SDS gel electrophoresis showed that the synthesis of canavanine-vimentin is not inhibited and that it accumulates in the TX-100-soluble compartment. Pulse-chase experiments with [35S]methionine demonstrated that while arginine-vimentin can be rapidly chased from the soluble to the cytoskeletal fraction, canavanine-vimentin remains in the soluble fraction, where it turns over. The effect of canavanine on the assembly of vimentin did not prevent the assembly of arginine-vimentin, as cells labeled with [35S]methionine first in the presence of canavanine and then in the presence of arginine contained labeled canavanine-vimentin only in the soluble fraction, and arginine-vimentin in both the soluble and cytoskeletal fractions. These results suggest that arginine residues play an essential role in the assembly of vimentin in vivo.

  2. Nanomechanical properties of composite protein networks of erythroid membranes at lipid surfaces.

    PubMed

    Encinar, Mario; Casado, Santiago; Calzado-Martín, Alicia; Natale, P; San Paulo, Álvaro; Calleja, Montserrat; Vélez, Marisela; Monroy, Francisco; López-Montero, Iván

    2017-01-01

    Erythrocyte membranes have been particularly useful as a model for studies of membrane structure and mechanics. Native erythroid membranes can be electroformed as giant unilamellar vesicles (eGUVs). In the presence of ATP, the erythroid membrane proteins of eGUVs rearrange into protein networks at the microscale. Here, we present a detailed nanomechanical study of individual protein microfilaments forming the protein networks of eGUVs when spread on supporting surfaces. Using Peak Force tapping Atomic Force Microscopy (PF-AFM) in liquid environment we have obtained the mechanical maps of the composite lipid-protein networks supported on solid surface. In the absence of ATP, the protein pool was characterized by a Young's Modulus Epool≈5-15MPa whereas the complex filaments were found softer after protein supramolecular rearrangement; Efil≈0.4MPa. The observed protein softening and reassembling could be relevant for understanding the mechanisms of cytoskeleton reorganization found in pathological erythrocytes or erythrocytes that are affected by biological agents.

  3. Transcription of the hypersensitive site HS2 enhancer in erythroid cells

    SciTech Connect

    Tuan, D.; Suming Kong; Hu, K. )

    1992-12-01

    In the human genome, the erythroid-specific hypersensitive site HS2 enhancer regulates the transcription of the downstream [beta]-like globin genes 10-50 kilobases away. The mechanism of HS2 enhancer function is not known. The present study employs RNA protection assays to analyze the transcriptional status of the HS2 enhancer in transfected recombinant chloramphenicol acetyltransferase (CAT) plasmids. In erythroid K562 cells in which the HS2 enhancer is active, the HS2 sequence directs the synthesis of long enhancer transcripts that are initiated apparently from within the enhancer and elongated through the intervening DNA into the cis-linked CAT gene. In nonerythroid HL-60 cells in which the HS2 enhancer is inactive, long enhancer transcripts are not detectable. Splitting the HS2 enhancer between two tandem Ap1 sites abolishes the synthesis of a group of long enhancer transcripts and results in loss of enhancer function and transcriptional silencing of the cis-linked CAT gene. In directing the synthesis of RNA through the intervening DNA and the gene by a tracking and transcription mechanism, the HS2 enhancer may (i) open up the chromatin structure of a gene domain and (ii) deliver enhancer binding proteins to the promoter sequence where they may stimulate the transcription of the gene at the cap site. 42 refs., 4 figs., 1 tab.

  4. Functional plasticity of the N-methyl-d-aspartate receptor in differentiating human erythroid precursor cells

    PubMed Central

    Hänggi, Pascal; Telezhkin, Vsevolod; Kemp, Paul J.; Schmugge, Markus; Gassmann, Max; Goede, Jeroen S.; Speer, Oliver

    2015-01-01

    Calcium signaling is essential to support erythroid proliferation and differentiation. Precise control of the intracellular Ca2+ levels in erythroid precursor cells (EPCs) is afforded by coordinated expression and function of several cation channels, including the recently identified N-methyl-d-aspartate receptor (NMDAR). Here, we characterized the changes in Ca2+ uptake and electric currents mediated by the NMDARs occurring during EPC differentiation using flow cytometry and patch clamp. During erythropoietic maturation, subunit composition and properties of the receptor changed; in proerythroblasts and basophilic erythroblasts, fast deactivating currents with high amplitudes were mediated by the GluN2A subunit-dominated receptors, while at the polychromatic and orthochromatic erythroblast stages, the GluN2C subunit was getting more abundant, overriding the expression of GluN2A. At these stages, the currents mediated by the NMDARs carried the features characteristic of the GluN2C-containing receptors, such as prolonged decay time and lower conductance. Kinetics of this switch in NMDAR properties and abundance varied markedly from donor to donor. Despite this variability, NMDARs were essential for survival of EPCs in any subject tested. Our findings indicate that NMDARs have a dual role during erythropoiesis, supporting survival of polychromatic erythroblasts and contributing to the Ca2+ homeostasis from the orthochromatic erythroblast stage to circulating red blood cells. PMID:25788577

  5. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    SciTech Connect

    Porter, P.N.; Ogawa, M.

    1982-06-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of /sup 59/Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture.

  6. BVL-1-like VL30 promoter sustains long-term expression in erythroid progenitor cells.

    PubMed

    Staplin, William R; Knezetic, Joseph A

    2003-03-01

    Congenital blood disorders are common and yet clinically challenging globin disorders. Gene therapy continues to serve as a potential therapeutic method to treat these disorders. While tremendous advances have been made in vivo, gene delivery protocols and vector prototypes still require optimization. Alternative cis-acting promoter elements derived from VL30 retroelements have been effective in expressing tissue-specific transgene expression in vivo in nonerythroid cells. VL30 promoter elements were isolated from ELM-I-1 erythroid progenitor cells upon erythropoietin (epo) treatment. These promoters were inserted into a VL30-derived expression vector and reintroduced into the ELM-I-1 cells. beta-Galactosidase reporter gene activity from the ELM 5 clone, a BVL-1-like VL30 promoter, was capable of expressing sustained levels of the transgene expression over a 16-week assay period. These findings delineate the potential utility of these retroelement promoters as transcriptionally active, erythroid-specific, long terminal repeat (LTR) components for current globin vector constructs.

  7. Pure red cell aplasia following major ABO-incompatible allogeneic hematopoietic stem cell transplantation.

    PubMed

    Zhu, Kang-Er; Xu, Yang; Wu, Dong; Zhong, Juan

    2002-02-01

    Six out of 20 patients undergoing a major ABO-incompatible allogeneic stem cell transplantation (allo-HSCT) developed pure red cell aplasia (PRCA), which did not show any effects on granulocyte and platelet engraftment, and incidence of grade II-IV aGVHD. All the 6 cases of PRCA were in blood group O recipients of grafts from blood group A donors (n = 5) or blood group B donor (n = 1), suggesting that donor/recipient pair (A/O) is associated with a high risk of PRCA after major ABO-incompatible allo-HSCT. Erythroid engraftment occurred spontaneously in four cases without specific intervention other than the RBC transfusion, which coincided with the decrease of isoagglutinin titers below 8, and the remaining 2 patients with prolonged erythroid aplasia( > 300 days) despite therapy with erythropoietin (EPO) were successfully treated by plasma exchange with donor-type plasma replacement. Cyclosporine did not appear to have played any role in causing PRCA in our patients, however, the occurrence of GVHD may facilitate the recovery of erythropoiesis.

  8. Pure autonomic failure without synucleinopathy.

    PubMed

    Isonaka, Risa; Holmes, Courtney; Cook, Glen A; Sullivan, Patti; Sharabi, Yehonatan; Goldstein, David S

    2017-04-01

    Pure autonomic failure is a rare form of chronic autonomic failure manifesting with neurogenic orthostatic hypotension and evidence of sympathetic noradrenergic denervation unaccompanied by signs of central neurodegeneration. It has been proposed that pure autonomic failure is a Lewy body disease characterized by intra-neuronal deposition of the protein alpha-synuclein in Lewy bodies and neurites. A middle-aged man with previously diagnosed pure autonomic failure experienced a sudden, fatal cardiac arrest. He was autopsied, and tissues were harvested for neurochemical and immunofluorescence studies. Post-mortem microscopic neuropathology showed no Lewy bodies, Lewy neurites, or alpha-synuclein deposition by immunohistochemistry anywhere in the brain. The patient had markedly decreased immunofluorescent tyrosine hydroxylase in sympathetic ganglion tissue without detectable alpha-synuclein even in rare residual nests of tyrosine hydroxylase-containing ganglionic fibers. In pure autonomic failure, sympathetic noradrenergic denervation can occur without concurrent Lewy bodies or alpha-synuclein deposition in the brain or sympathetic ganglion tissue.

  9. Rps14 haploinsufficiency causes a block in erythroid differentiation mediated by S100A8/S100A9

    PubMed Central

    Schneider, Rebekka K.; Schenone, Monica; Ferreira, Monica Ventura; Kramann, Rafael; Joyce, Cailin E.; Hartigan, Christina; Beier, Fabian; Brümmendorf, Tim H.; Gehrming, Ulrich; Platzbecker, Uwe; Büsche, Guntram; Knüchel, Ruth; Chen, Michelle C.; Waters, Christopher S.; Chen, Edwin; Chu, Lisa P.; Novina, Carl D.; Lindsley, R. Coleman; Carr, Steven A.; Ebert, Benjamin L.

    2016-01-01

    Heterozygous deletion of RPS14 occurs in del(5q) MDS and has been linked to impaired erythropoiesis, characteristic of this disease subtype. We generated a murine model with conditional inactivation of Rps14 and demonstrated a p53-dependent erythroid differentiation defect with apoptosis at the transition from polychromatic to orthochromatic erythroblasts resulting in age-dependent progressive anemia, megakaryocyte dysplasia, and loss of hematopoietic stem cell (HSC) quiescence. Using quantitative proteomics, we identified significantly increased expression of proteins involved in innate immune signaling, particularly the heterodimeric S100a8/S100a9 proteins in purified erythroblasts. S100a8 expression was significantly increased in erythroblasts, monocytes and macrophages and recombinant S100a8 was sufficient to induce an erythroid differentiation defect in wild-type cells. We rescued the erythroid differentiation defect in Rps14 haploinsufficient HSCs by genetic inactivation of S100a8 expression. Our data link Rps14 haploinsufficiency to activation of the innate immune system via induction of S100A8/A9 and the p53-dependant erythroid differentiation defect in del(5q) MDS. PMID:26878232

  10. VENTX induces expansion of primitive erythroid cells and contributes to the development of acute myeloid leukemia in mice

    PubMed Central

    Gentner, Eva; Vegi, Naidu M.; Mulaw, Medhanie A.; Mandal, Tamoghna; Bamezai, Shiva; Claus, Rainer; Tasdogan, Alpaslan; Quintanilla-Martinez, Leticia; Grunenberg, Alexander; Döhner, Konstanze; Döhner, Hartmut; Bullinger, Lars; Haferlach, Torsten; Buske, Christian

    2016-01-01

    Homeobox genes are key regulators in normal and malignant hematopoiesis. The human Vent-like homeobox gene VENTX, a putative homolog of the Xenopus laevis Xvent-2 gene, was shown to be highly expressed in normal myeloid cells and in patients with acute myeloid leukemia. We now demonstrate that constitutive expression of VENTX suppresses expression of genes responsible for terminal erythroid differentiation in normal CD34+ stem and progenitor cells. Transplantation of bone marrow progenitor cells retrovirally engineered to express VENTX caused massive expansion of primitive erythroid cells and partly acute erythroleukemia in transplanted mice. The leukemogenic potential of VENTX was confirmed in the AML1-ETO transplantation model, as in contrast to AML1-ETO alone co-expression of AML1-ETO and VENTX induced acute myeloid leukemia, partly expressing erythroid markers, in all transplanted mice. VENTX was highly expressed in patients with primary human erythroleukemias and knockdown of VENTX in the erythroleukemic HEL cell line significantly blocked cell growth. In summary, these data indicate that VENTX is able to perturb erythroid differentiation and to contribute to myeloid leukemogenesis when co-expressed with appropriate AML oncogenes and point to its potential significance as a novel therapeutic target in AML. PMID:27888632

  11. MicroRNA-486-5p is an erythroid oncomiR of the myeloid leukemias of Down syndrome.

    PubMed

    Shaham, Lital; Vendramini, Elena; Ge, Yubin; Goren, Yaron; Birger, Yehudit; Tijssen, Marloes R; McNulty, Maureen; Geron, Ifat; Schwartzman, Omer; Goldberg, Liat; Chou, Stella T; Pitman, Holly; Weiss, Mitchell J; Michaeli, Shulamit; Sredni, Benjamin; Göttgens, Berthold; Crispino, John D; Taub, Jeffrey W; Izraeli, Shai

    2015-02-19

    Children with Down syndrome (DS) are at increased risk for acute myeloid leukemias (ML-DS) characterized by mixed megakaryocytic and erythroid phenotype and by acquired mutations in the GATA1 gene resulting in a short GATA1s isoform. The chromosome 21 microRNA (miR)-125b cluster has been previously shown to cooperate with GATA1s in transformation of fetal hematopoietic progenitors. In this study, we report that the expression of miR-486-5p is increased in ML-DS compared with non-DS acute megakaryocytic leukemias (AMKLs). miR-486-5p is regulated by GATA1 and GATA1s that bind to the promoter of its host gene ANK1. miR-486-5p is highly expressed in mouse erythroid precursors and knockdown (KD) in ML-DS cells reduced their erythroid phenotype. Ectopic expression and KD of miR-486-5p in primary fetal liver hematopoietic progenitors demonstrated that miR-486-5p cooperates with Gata1s to enhance their self renewal. Consistent with its activation of AKT, overexpression and KD experiments showed its importance for growth and survival of human leukemic cells. Thus, miR-486-5p cooperates with GATA1s in supporting the growth and survival, and the aberrant erythroid phenotype of the megakaryocytic leukemias of DS.

  12. Erythroid cell growth and differentiation in vitro in the simulated microgravity environment of the NASA rotating wall vessel bioreactor

    NASA Technical Reports Server (NTRS)

    Sytkowski, A. J.; Davis, K. L.

    2001-01-01

    Prolonged exposure of humans and experimental animals to the altered gravitational conditions of space flight has adverse effects on the lymphoid and erythroid hematopoietic systems. Although some information is available regarding the cellular and molecular changes in lymphocytes exposed to microgravity, little is known about the erythroid cellular changes that may underlie the reduction in erythropoiesis and resultant anemia. We now report a reduction in erythroid growth and a profound inhibition of erythropoietin (Epo)-induced differentiation in a ground-based simulated microgravity model system. Rauscher murine erythroleukemia cells were grown either in tissue culture vessels at 1 x g or in the simulated microgravity environment of the NASA-designed rotating wall vessel (RWV) bioreactor. Logarithmic growth was observed under both conditions; however, the doubling time in simulated microgravity was only one-half of that seen at 1 x g. No difference in apoptosis was detected. Induction with Epo at the initiation of the culture resulted in differentiation of approximately 25% of the cells at 1 x g, consistent with our previous observations. In contrast, induction with Epo at the initiation of simulated microgravity resulted in only one-half of this degree of differentiation. Significantly, the growth of cells in simulated microgravity for 24 h prior to Epo induction inhibited the differentiation almost completely. The results suggest that the NASA RWV bioreactor may serve as a suitable ground-based microgravity simulator to model the cellular and molecular changes in erythroid cells observed in true microgravity.

  13. TGF-β inhibitors stimulate red blood cell production by enhancing self-renewal of BFU-E erythroid progenitors.

    PubMed

    Gao, Xiaofei; Lee, Hsiang-Ying; da Rocha, Edroaldo Lummertz; Zhang, Cheng; Lu, Yi-Fen; Li, Dandan; Feng, Yuxiong; Ezike, Jideofor; Elmes, Russell R; Barrasa, M Inmaculada; Cahan, Patrick; Li, Hu; Daley, George Q; Lodish, Harvey F

    2016-12-08

    Burst-forming unit erythroid progenitors (BFU-Es) are so named based on their ability to generate in methylcellulose culture large colonies of erythroid cells that consist of "bursts" of smaller erythroid colonies derived from the later colony-forming unit erythroid progenitor erythropoietin (Epo)-dependent progenitors. "Early" BFU-E cells forming large BFU-E colonies presumably have higher capacities for self-renewal than do "late" BFU-Es forming small colonies, but the mechanism underlying this heterogeneity remains unknown. We show that the type III transforming growth factor β (TGF-β) receptor (TβRIII) is a marker that distinguishes early and late BFU-Es. Transient elevation of TβRIII expression promotes TGF-β signaling during the early BFU-E to late BFU-E transition. Blocking TGF-β signaling using a receptor kinase inhibitor increases early BFU-E cell self-renewal and total erythroblast production, suggesting the usefulness of this type of drug in treating Epo-unresponsive anemias.

  14. [Pure red cell aplasia (PRCA) induced by anti-EPO antibodies: epidemiology, diagnosis and treatment].

    PubMed

    Janda, Katarzyna; Kraśniak, Andrzej; Krzanowski, Marcin; Sułowicz, Władysław

    2010-01-01

    Pure red-cell aplasia (PRCA) is a serious, life threatening rare condition of multifactorial causes manifested as severe anemia with absence of erythroid precursors in the bone marrow. PRCA may be a consequence of antibody production against applied recombinant human erythropoietin (EPO). The first description of PRCA in the course of EPO therapy was performed in a patient receiving subcutaneously Eprex and in the next years after therapy with other erythropoiesis stimulating agents like erythropoietin beta, omega or darbepoetin. In the paper we describe epidemiology and diagnostic criteria of PRCA. The current treatment possibilities of this complication were described with special attention dedicated to different immunosuppressive agents and effectiveness of kidney transplantation with subsequent immunosuppression.

  15. Strict in vivo specificity of the Bcl11a erythroid enhancer.

    PubMed

    Smith, Elenoe C; Luc, Sidinh; Croney, Donyell M; Woodworth, Mollie B; Greig, Luciano C; Fujiwara, Yuko; Nguyen, Minh; Sher, Falak; Macklis, Jeffrey D; Bauer, Daniel E; Orkin, Stuart H

    2016-10-05

    BCL11A, a repressor of human fetal (γ-)globin expression, is required for immune and hematopoietic stem cell functions and brain development. Regulatory sequences within the gene, which are subject to genetic variation affecting fetal globin expression, display hallmarks of an erythroid enhancer in cell lines and transgenic mice. As such this enhancer is a novel, attractive target for therapeutic gene editing. To explore the roles of such sequences in vivo, we generated mice in which the orthologous 10 kb intronic sequences were removed. Bcl11a-enhancer deleted mice (Bcl11a(Δenh)) phenocopy the BCL11A-null state with respect to alterations of globin expression, yet are viable and exhibit no observable blood, brain, or other abnormalities. These preclinical findings provide strong in vivo support for genetic modification of the enhancer for therapy of hemoglobin disorders.

  16. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders

    PubMed Central

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-01-01

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders. PMID:28165377

  17. Transcription factor CP2 is crucial in hemoglobin synthesis during erythroid terminal differentiation in vitro.

    PubMed

    Chae, J H; Lee, Y H; Kim, C G

    1999-09-24

    The transcription factor CP2 was initially identified to bind to the promoter region of the murine alpha-globin gene and known to stimulate the expression of alpha-globin by increasing CP2 transcripts 3- to 5-fold during induced differentiation of mouse erythroleukemic (MEL) cells in vitro. Here, we report that this increment of CP2 expression is crucial in erythroid-specific globin gene expression and hemoglobin synthesis. When antisense CP2 was overexpressed in MEL cells, production of endogenous CP2 protein was reduced 70-80%, and significant loss of its promoter binding activity was observed. During HMBA-induced terminal differentiation of antisense CP2 expressing MEL cells, the transcription of endogenous alpha-globin gene was suppressed as expected. Moreover, both beta-globin gene expression and hemoglobin synthesis were also severely impaired, without affecting the expression of key heme enzyme genes or HMBA-induced proliferation and viability.

  18. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells

    PubMed Central

    Steiner, Laurie A.; Schulz, Vincent; Makismova, Yelena; Lezon-Geyda, Kimberly; Gallagher, Patrick G.

    2016-01-01

    Background CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC) and primary human erythroid cells from single donors. Results Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner. Conclusion These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis. PMID:27219007

  19. Resveratrol accelerates erythroid maturation by activation of FoxO3 and ameliorates anemia in beta-thalassemic mice

    PubMed Central

    Franco, Sara Santos; De Falco, Luigia; Ghaffari, Saghi; Brugnara, Carlo; Sinclair, David A.; Matte’, Alessandro; Iolascon, Achille; Mohandas, Narla; Bertoldi, Mariarita; An, Xiuli; Siciliano, Angela; Rimmelé, Pauline; Cappellini, Maria Domenica; Michan, Shaday; Zoratti, Elisa; Anne, Janin; De Franceschi, Lucia

    2014-01-01

    Resveratrol, a polyphenolic-stilbene, has received increased attention in the last decade due to its wide range of biological activities. Beta(β)-thalassemias are inherited red cell disorders, found worldwide, characterized by ineffective erythropoiesis and red cell oxidative damage with reduced survival. We evaluated the effects of low-dose-resveratrol (5 μM) on in vitro human erythroid differentiation of CD34+ from normal and β-thalassemic subjects. We found that resveratrol induces accelerated erythroid-maturation, resulting in the reduction of colony-forming units of erythroid cells and increased intermediate and late erythroblasts. In sorted colony-forming units of erythroid cells resveratrol activates Forkhead-box-class-O3, decreases Akt activity and up-regulates anti-oxidant enzymes as catalase. In an in vivo murine model for β-thalassemia, resveratrol (2.4 mg/kg) reduces ineffective erythropoiesis, increases hemoglobin levels, reduces reticulocyte count and ameliorates red cell survival. In both wild-type and β-thalassemic mice, resveratrol up-regulates scavenging enzymes such as catalase and peroxiredoxin-2 through Forkhead-box-class-O3 activation. These data indicate that resveratrol inhibits Akt resulting in FoxO3 activation with upregulation of cytoprotective systems enabling the pathological erythroid precursors to resist the oxidative damage and continue to differentiate. Our data suggest that the dual effect of resveratrol on erythropoiesis through activation of FoxO3 transcriptional factor combined with the amelioration of oxidative stress in circulating red cells may be considered as a potential novel therapeutic strategy in treating β-thalassemia. PMID:23975182

  20. Induction of erythroid differentiadon in K562 cells by different butyrate regimens.

    PubMed

    Liu, Zhi-Jie; Qian, Xin-Hua; Li, Xi-Ping; Yao, Ying-Min

    2001-01-01

    OBJECTIVE: To investigate the hemoglobinization induced by butyrate and observe the effects of different butyrate regimens on erythroid differentiation of K562 cells. METHODS: K562 cells, used as an in vitro model system, were stained with benzidine to assess hemoglobin (Hb) production in response to different treatment regimens of butyrate at varied concentrations. Comparison of the percentage of benzidine-positive cells (BZ%)in untreated and butyrate-treated K562 cells was performed. Protein absorption at 414 nm using a spectrophotometer and cellulose acetate gel electrophoresis were employed to determine the changes of Hb production in K562 cells. RESULT: The BZ% increased by 4 to 6 fold and Hb production by 9 to 14 fold 3 d after the cells were incubated with butyrate which selectively promoted fetal hemoglobin(HbF) production in K562 cells. The BZ% increased gradually and reached the peak of l9% to 28% on day 3 or 4 in cells receiving pulse treatment with butyrate for only once, followed by a subsequent rapid fall and on day 7 to 9, it decreased to the level of untreated K562 cells. The length of time for incubation with butyrate was not related to in the increment or the maintenance of the increased level of BZ%. Continuous treatment with butyrate yielded a similar result to that of a single administration of pulse treatment. In contrast, in cells with intermittent pulse treatment the BZ% reached a peak after 72 h and was maintained between 20% and 30% till 3 cycles of treatment was completed. CONCLUSION: Butyrate can induce the expression of globin genes and augment Hb producfion especially that of HbF. A sustained erythroid differentiation of K562 cells can be achieved by intermittent pulse treatment with butyrate which can be an ideal regimen for children with beta globin diseases.

  1. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )

    1993-10-01

    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  2. Production of substantially pure fructose

    DOEpatents

    Hatcher, Herbert J.; Gallian, John J.; Leeper, Stephen A.

    1990-01-01

    A process is disclosed for the production of substantially pure fructose from sucrose-containing substrates. The process comprises converting the sucrose to levan and glucose, purifying the levan by membrane technology, hydrolyzing the levan to form fructose monomers, and recovering the fructose.

  3. What is antibody-mediated pure red cell aplasia (PRCA)?

    PubMed

    Casadevall, Nicole

    2005-05-01

    Antibody (Ab)-mediated pure red cell aplasia (PRCA) is an immunological pathology associated with the production of neutralizing Abs that inhibit the erythropoietic activity of endogenous erythropoietin (EPO) and recombinant erythropoiesis-stimulating agents (ESAs). Although this disorder occurs very rarely, the number of reported cases has increased dramatically in recent years, predominantly in patients with chronic kidney disease (CKD)-associated anaemia receiving subcutaneous (s.c.) injections of one particular formulation of recombinant epoetin-alpha. This disorder is differentiated from classic forms of PRCA that are caused by chemical toxaemia (i.e. erythroblastopenia induced by chemical compounds), lymphoproliferative neoplasms, thymoma, human parvovirus B19 and certain autoimmune disorders. Patients with Ab-mediated PRCA develop resistance to EPO and severe anaemia that follows a period of successful erythropoietic response, and exhibit characteristic decreases in blood haemoglobin (Hb) level and in the number of circulating reticulocytes. However, it is not yet possible to predict which patients will develop PRCA or when in the course of their treatments PRCA may develop. Laboratory confirmation of Ab-mediated PRCA requires bone marrow examination demonstrating few or no erythroid precursors and the presence of serum anti-EPO Abs using a validated assay. These neutralizing anti-EPO Abs recognize the protein core of the EPO molecule; carbohydrate groups on EPO can affect the binding of Abs but are themselves not immunological determinants. Animal models are being developed to increase further our understanding of the immunological mechanisms underlying the onset and progression of Ab-mediated PRCA.

  4. Changes in erythroid membrane proteins during erythropoietin-mediated terminal differentiation.

    PubMed

    Koury, M J; Bondurant, M C; Rana, S S

    1987-12-01

    Membrane and membrane skeleton proteins were examined in erythroid progenitor cells during terminal differentiation. The employed model system of erythroid differentiation was that in which proerythroblasts from mice infected with the anemia-inducing strain of Friend virus differentiate in vitro in response to erythropoietin (EP). With this system, developmentally homogeneous populations of cells can be examined morphologically and biochemically as they progress from proerythroblasts through enucleated reticulocytes. alpha and beta spectrins, the major proteins of the erythrocyte membrane skeleton, are synthesized in the erythroblasts both before and after EP exposure. At all times large portions of the newly synthesized spectrins exist in and are turned over in the cytoplasm. The remaining newly synthesized spectrin is found in a cellular fraction containing total membranes. Pulse-chase experiments show that little of the cytoplasmic spectrins become membrane associated, but that the proportion of newly synthesized spectrin which is membrane associated increases as maturation proceeds. A membrane fraction enriched in plasma membranes has significant differences in the stoichiometry of spectrin accumulation as compared to total cellular membranes. Synthesis of band 3 protein, the anion transporter, is induced only after EP addition to the erythroblasts. All of the newly synthesized band 3 is membrane associated. A two-dimensional gel survey was conducted of newly synthesized proteins in the plasma membrane enriched fraction of the erythroblasts as differentiation proceeded. A majority of the newly synthesized proteins remain in the same proportion to each other during maturation; however, a few newly synthesized proteins greatly increase following EP induction while others decrease markedly. Of the radiolabeled proteins observed in two dimensional gels, only the spectrins, band 3 and actin become major proteins of the mature erythrocyte membrane. Examination of

  5. The DEK Oncoprotein Is a Critical Component of the EKLF/KLF1 Enhancer in Erythroid Cells

    PubMed Central

    Lohmann, Felix; Dangeti, Mohan; Soni, Shefali; Chen, Xiaoyong; Planutis, Antanas; Baron, Margaret H.; Choi, Kyunghee

    2015-01-01

    Understanding how transcriptional regulators are themselves controlled is important in attaining a complete picture of the intracellular effects that follow signaling cascades during early development and cell-restricted differentiation. We have addressed this issue by focusing on the regulation of EKLF/KLF1, a zinc finger transcription factor that plays a necessary role in the global regulation of erythroid gene expression. Using biochemical affinity purification, we have identified the DEK oncoprotein as a critical factor that interacts with an essential upstream enhancer element of the EKLF promoter and exerts a positive effect on EKLF levels. This element also binds a core set of erythroid transcription factors, suggesting that DEK is part of a tissue-restricted enhanceosome that contains BMP4-dependent and -independent components. Together with local enrichment of properly coded histones and an open chromatin domain, optimal transcriptional activation of the EKLF locus can be established. PMID:26303528

  6. Hereditary sideroblastic anaemia due to a mutation in exon 10 of the erythroid 5-aminolaevulinate synthase gene.

    PubMed

    Edgar, A J; Wickramasinghe, S N

    1998-02-01

    DNA sequencing of the coding region of the erythroid 5-aminolaevulinate synthase (ALAS2) cDNA from a male with pyridoxine-responsive sideroblastic anaemia revealed a missense mutation C1622G and a closely linked polymorphism C1612A in exon 10 of the gene. Sequence analysis of the genomic DNA from other family members revealed that the proband's mother and daughter were heterozygous carriers of the mutation, consistent with the X-linked inheritance. The C1622G mutation results in a histidine to aspartic acid substitution at amino acid residue 524. The histidine residue is conserved in both the erythroid and housekeeping ALAS proteins in vertebrates, all other known ALAS proteins and other oxamine synthases that have pyridoxal 5'-phosphate as a co-factor. This histidine is located in a predicted loop, preceding a long alpha-helix region near the carboxy-terminus.

  7. Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

    PubMed

    Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

    2017-03-01

    Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596.

  8. Increase of microRNA-210, Decrease of Raptor Gene Expression and Alteration of Mammalian Target of Rapamycin Regulated Proteins following Mithramycin Treatment of Human Erythroid Cells

    PubMed Central

    Bianchi, Nicoletta; Finotti, Alessia; Ferracin, Manuela; Lampronti, Ilaria; Zuccato, Cristina; Breveglieri, Giulia; Brognara, Eleonora; Fabbri, Enrica; Borgatti, Monica; Negrini, Massimo; Gambari, Roberto

    2015-01-01

    Expression and regulation of microRNAs is an emerging issue in erythroid differentiation and globin gene expression in hemoglobin disorders. In the first part of this study microarray analysis was performed both in mithramycin-induced K562 cells and erythroid precursors from healthy subjects or β-thalassemia patients producing low or high levels of fetal hemoglobin. We demonstrated that: (a) microRNA-210 expression is higher in erythroid precursors from β-thalassemia patients with high production of fetal hemoglobin; (b) microRNA-210 increases as a consequence of mithramycin treatment of K562 cells and human erythroid progenitors both from healthy and β-thalassemia subjects; (c) this increase is associated with erythroid induction and elevated expression of γ-globin genes; (d) an anti-microRNA against microRNA-210 interferes with the mithramycin-induced changes of gene expression. In the second part of the study we have obtained convergent evidences suggesting raptor mRNA as a putative target of microRNA-210. Indeed, microRNA-210 binding sites of its 3’-UTR region were involved in expression and are targets of microRNA-210-mediated modulation in a luciferase reporter assays. Furthermore, (i) raptor mRNA and protein are down-regulated upon mithramycin-induction both in K562 cells and erythroid progenitors from healthy and β-thalassemia subjects. In addition, (ii) administration of anti-microRNA-210 to K562 cells decreased endogenous microRNA-210 and increased raptor mRNA and protein expression. Finally, (iii) treatment of K562 cells with premicroRNA-210 led to a decrease of raptor mRNA and protein. In conclusion, microRNA-210 and raptor are involved in mithramycin-mediated erythroid differentiation of K562 cells and participate to the fine-tuning and control of γ-globin gene expression in erythroid precursor cells. PMID:25849663

  9. CD14+ cells from peripheral blood positively regulate hematopoietic stem and progenitor cell survival resulting in increased erythroid yield.

    PubMed

    Heideveld, Esther; Masiello, Francesca; Marra, Manuela; Esteghamat, Fatemehsadat; Yağcı, Nurcan; von Lindern, Marieke; Migliaccio, Anna Rita F; van den Akker, Emile

    2015-11-01

    Expansion of erythroblasts from human peripheral blood mononuclear cells is 4- to 15-fold more efficient than that of CD34(+) cells purified from peripheral blood mononuclear cells. In addition, purified CD34(+) and CD34(-) populations from blood do not reconstitute this erythroid yield, suggesting a role for feeder cells present in blood mononuclear cells that increase hematopoietic output. Immunodepleting peripheral blood mononuclear cells for CD14(+) cells reduced hematopoietic stem and progenitor cell expansion. Conversely, the yield was increased upon co-culture of CD34(+) cells with CD14(+) cells (full contact or transwell assays) or CD34(+) cells re-constituted in conditioned medium from CD14(+) cells. In particular, CD14(++)CD16(+) intermediate monocytes/macrophages enhanced erythroblast outgrowth from CD34(+) cells. No effect of CD14(+) cells on erythroblasts themselves was observed. However, 2 days of co-culturing CD34(+) and CD14(+) cells increased CD34(+) cell numbers and colony-forming units 5-fold. Proliferation assays suggested that CD14(+) cells sustain CD34(+) cell survival but not proliferation. These data identify previously unrecognized erythroid and non-erythroid CD34(-) and CD34(+) populations in blood that contribute to the erythroid yield. A flow cytometry panel containing CD34/CD36 can be used to follow specific stages during CD34(+) differentiation to erythroblasts. We have shown modulation of hematopoietic stem and progenitor cell survival by CD14(+) cells present in peripheral blood mononuclear cells which can also be found near specific hematopoietic niches in the bone marrow.

  10. Nrf-2-driven long noncoding RNA ODRUL contributes to modulating silver nanoparticle-induced effects on erythroid cells.

    PubMed

    Gao, Ming; Zhao, Beibei; Chen, Minjun; Liu, Yun; Xu, Ming; Wang, Zhe; Liu, Sijin; Zhang, Chengdong

    2017-06-01

    The biosafety and biological effects of silver nanoparticles (AgNPs) on human health attract increasing concern. Although considerable studies have been performed to reveal the molecular mechanisms responsible for AgNP-induced effects, the current understanding mainly focuses on oxidative stress-associated signaling pathways activated by Ag particles and/or Ag ions. However, the molecular bases underlying the activation of these stress signaling pathways have not been thoroughly elucidated yet. In the current study, we aimed to shed light on the molecular bases of AgNP-induced effects on erythroid cells from the perspective of long noncoding RNAs. We identified a long-noncoding RNA molecule, ODRUL, which was substantially enhanced in K562 erythroid cells responding to AgNPs, coupled to accelerated cell death. Further, we uncovered oxidative stress-driven Nrf2 transcriptionally promoted ODRUL expression in K562 cells. Downstream of Nrf2-ODRUL activation by AgNPs, ODRUL was recognized to interact with PI4Kα protein to modulate the activities of its targets AKT and JNK. As a result, the Bcl-2 level was negatively regulated by PI4K-AKT/JNK signaling under AgNP-induced stress, leading to enhanced cell death. Together, our findings unearthed that Nrf2-mediated lncRNA ODRUL was indispensable for AgNP-induced toxicity in erythroid cells through regulation of AKT/JNK-Bcl-2 signaling dependent on a physical interaction with PI4Kα. Thus, this study would open a new path to depict the molecular bases of AgNP-induced effects on erythroid cells.

  11. A screen for Fli-1 transcriptional modulators identifies PKC agonists that induce erythroid to megakaryocytic differentiation and suppress leukemogenesis.

    PubMed

    Liu, Tangjingjun; Yao, Yao; Zhang, Gang; Wang, Ye; Deng, Bin; Song, Jialei; Li, Xiaogang; Han, Fei; Xiao, Xiao; Yang, Jue; Xia, Lei; Li, You-Jun; Plachynta, Maksym; Zhang, Mu; Yan, Chen; Mu, Shuzhen; Luo, Heng; Zacksenhaus, Eldad; Hao, Xiaojiang; Ben-David, Yaacov

    2016-12-30

    The ETS-related transcription factor Fli-1 affects many developmental programs including erythroid and megakaryocytic differentiation, and is frequently de-regulated in cancer. Fli-1 was initially isolated following retrovirus insertional mutagenesis screens for leukemic initiator genes, and accordingly, inhibition of this transcription factor can suppress leukemia through induction of erythroid differentiation. To search for modulators of Fli-1, we hereby performed repurposing drug screens with compounds isolated from Chinese medicinal plants. We identified agents that can transcriptionally activate or inhibit a Fli-1 reporter. Remarkably, agents that increased Fli-1 transcriptional activity conferred a strong anti-cancer activity upon Fli-1-expressing leukemic cells in culture. As opposed to drugs that suppress Fli1 activity and lead to erythroid differentiation, growth suppression by these new Fli-1 transactivating compounds involved erythroid to megakaryocytic conversion (EMC). The identified compounds are structurally related to diterpene family of small molecules, which are known agonists of protein kinase C (PKC). In accordance, these PKC agonists (PKCAs) induced PKC phosphorylation leading to activation of the mitogen-activated protein kinase (MAPK) pathway, increased cell attachment and EMC, whereas pharmacological inhibition of PKC or MAPK diminished the effect of our PKCAs. Moreover, in a mouse model of leukemia initiated by Fli-1 activation, the PKCA compounds exhibited strong anti-cancer activity, which was accompanied by increased presence of CD41/CD61 positive megakaryocytic cells in leukemic spleens. Thus, PKC agonists offer a novel approach to combat Fli-1-induced leukemia, and possibly other cancers,by inducing EMC in part through over-activation of the PKC-MAPK-Fli-1 pathway.

  12. Glucocorticoids improve erythroid progenitor maintenance and dampen Trp53 response in a mouse model of Diamond-Blackfan anaemia.

    PubMed

    Sjögren, Sara E; Siva, Kavitha; Soneji, Shamit; George, Amee J; Winkler, Marcus; Jaako, Pekka; Wlodarski, Marcin; Karlsson, Stefan; Hannan, Ross D; Flygare, Johan

    2015-11-01

    Diamond-Blackfan anaemia (DBA) is a rare congenital disease causing severe anaemia and progressive bone marrow failure. The majority of patients carry mutations in ribosomal proteins, which leads to depletion of erythroid progenitors in the bone marrow. As many as 40% of all DBA patients receive glucocorticoids to alleviate their anaemia. However, despite their use in DBA treatment for more than half a century, the therapeutic mechanisms of glucocorticoids remain largely unknown. Therefore we sought to study disease specific effects of glucocorticoid treatment using a ribosomal protein s19 (Rps19) deficient mouse model of DBA. This study determines for the first time that a mouse model of DBA can respond to glucocorticoid treatment, similar to DBA patients. Our results demonstrate that glucocorticoid treatment reduces apoptosis, rescues erythroid progenitor depletion and premature differentiation of erythroid cells. Furthermore, glucocorticoids prevent Trp53 activation in Rps19-deficient cells- in a disease-specific manner. Dissecting the therapeutic mechanisms behind glucocorticoid treatment of DBA provides indispensible insight into DBA pathogenesis. Identifying mechanisms important for DBA treatment also enables development of more disease-specific treatments of DBA.

  13. The glucocorticoid receptor is a key regulator of the decision between self-renewal and differentiation in erythroid progenitors.

    PubMed Central

    Wessely, O; Deiner, E M; Beug, H; von Lindern, M

    1997-01-01

    During development and in regenerating tissues such as the bone marrow, progenitor cells constantly need to make decisions between proliferation and differentiation. We have used a model system, normal erythroid progenitors of the chicken, to determine the molecular players involved in making this decision. The molecules identified comprised receptor tyrosine kinases (c-Kit and c-ErbB) and members of the nuclear hormone receptor superfamily (thyroid hormone receptor and estrogen receptor). Here we identify the glucocorticoid receptor (GR) as a key regulator of erythroid progenitor self-renewal (i.e. continuous proliferation in the absence of differentiation). In media lacking a GR ligand or containing a GR antagonist, erythroid progenitors failed to self-renew, even if c-Kit, c-ErbB and the estrogen receptor were activated simultaneously. To induce self-renewal, the GR required the continuous presence of an activated receptor tyrosine kinase and had to cooperate with the estrogen receptor for full activity. Mutant analysis showed that DNA binding and a functional AF-2 transactivation domain are required for proliferation stimulation and differentiation arrest. c-myb was identified as a potential target gene of the GR in erythroblasts. It could be demonstrated that delta c-Myb, an activated c-Myb protein, can functionally replace the GR. PMID:9029148

  14. The heme exporter Flvcr1 regulates expansion and differentiation of committed erythroid progenitors by controlling intracellular heme accumulation.

    PubMed

    Mercurio, Sonia; Petrillo, Sara; Chiabrando, Deborah; Bassi, Zuni Irma; Gays, Dafne; Camporeale, Annalisa; Vacaru, Andrei; Miniscalco, Barbara; Valperga, Giulio; Silengo, Lorenzo; Altruda, Fiorella; Baron, Margaret H; Santoro, Massimo Mattia; Tolosano, Emanuela

    2015-06-01

    Feline leukemia virus subgroup C receptor 1 (Flvcr1) encodes two heme exporters: FLVCR1a, which localizes to the plasma membrane, and FLVCR1b, which localizes to mitochondria. Here, we investigated the role of the two Flvcr1 isoforms during erythropoiesis. We showed that, in mice and zebrafish, Flvcr1a is required for the expansion of committed erythroid progenitors but cannot drive their terminal differentiation, while Flvcr1b contributes to the expansion phase and is required for differentiation. FLVCR1a-down-regulated K562 cells have defective proliferation, enhanced differentiation, and heme loading in the cytosol, while FLVCR1a/1b-deficient K562 cells show impairment in both proliferation and differentiation, and accumulate heme in mitochondria. These data support a model in which the coordinated expression of Flvcr1a and Flvcr1b contributes to control the size of the cytosolic heme pool required to sustain metabolic activity during the expansion of erythroid progenitors and to allow hemoglobinization during their terminal maturation. Consistently, reduction or increase of the cytosolic heme rescued the erythroid defects in zebrafish deficient in Flvcr1a or Flvcr1b, respectively. Thus, heme export represents a tightly regulated process that controls erythropoiesis.

  15. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria.

    PubMed

    Houwerzijl, E J; Pol, H-W D; Blom, N R; van der Want, J J L; de Wolf, J Th M; Vellenga, E

    2009-05-01

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired erythroid maturation are important characteristics of low-risk myelodysplasia. In this study we therefore questioned whether the autophagic clearance of mitochondria might be altered in erythroblasts from patients with refractory anemia (RA, n=3) and RA with ringed sideroblasts (RARS, n=6). Ultrastructurally, abnormal and iron-laden mitochondria were abundant, especially in RARS patients. A large proportion (52+/-16%) of immature and mature myelodysplastic syndrome (MDS) erythroblasts contained cytoplasmic vacuoles, partly double membraned and positive for lysosomal marker LAMP-2 and mitochondrial markers, findings compatible with autophagic removal of dysfunctional mitochondria. In healthy controls only mature erythroblasts comprised these vacuoles (12+/-3%). These findings were confirmed morphometrically showing an increased vacuolar surface in MDS erythroblasts compared to controls (P<0.0001). In summary, these data indicate that MDS erythroblasts show features of enhanced autophagy at an earlier stage of erythroid differentiation than in normal controls. The enhanced autophagy might be a cell protective mechanism to remove defective iron-laden mitochondria.

  16. In vivo erythropoietin requirements of regenerating erythroid progenitors (BFU-e, CFU-e) in bone marrow of mice.

    PubMed

    Udupa, K B; Reissmann, K R

    1979-06-01

    Erythroid progenitors (B-8, B-4, CFU-e) in the femoral marrow of polycythemic mice were measured by in vitro culture assays after a single administration of BCNU or Myleran. BCNU reduced pluripotent stem cells to 40% and erythroid progenitors to less than 5% of normal. B-8, the earliest erythroid progenitors, regenerated without erythropoietin (Epo) completely within 5 days. At 14 days after BCNU, intermediate progenitors (B-4) attained 60% of their normal numbers and CFU-e attained approximately 30%. Daily injections of Epo promptly restored normal B-4 numbers and near-normal CFU-e numbers in BCNU-treated mice. After Myleran, CFU-s remained below 2% of normal for 14 days, and no regeneration of the B-8 occurred with or without daily Epo injections. The findings suggest that regneration of B-8 was dependent on cell inflow from the pluripotent stem cell compartment but was independent of the presence of Epo. Intermediate progenitors (B-4) required Epo and the presence of B-8 for complete and permanent regeneration. CFU-e were the most Epo-dependent of the three progenitors. B-4, recruited by Epo, required after their formation a second exposure to the hormone in order to progress into the CFU-e stage.

  17. RNA Trans-Splicing Targeting Endogenous β-Globin Pre-Messenger RNA in Human Erythroid Cells.

    PubMed

    Uchida, Naoya; Washington, Kareem N; Mozer, Brian; Platner, Charlotte; Ballantine, Josiah; Skala, Luke P; Raines, Lydia; Shvygin, Anna; Hsieh, Matthew M; Mitchell, Lloyd G; Tisdale, John F

    2017-02-14

    Sickle cell disease results from a point mutation in exon 1 of the β-globin gene (total 3 exons). Replacing sickle β-globin exon 1 (and exon 2) with a normal sequence by trans-splicing is a potential therapeutic strategy. Therefore, this study sought to develop trans-splicing targeting β-globin pre-messenger RNA among human erythroid cells. Binding domains from random β-globin sequences were comprehensively screened. Six candidates had optimal binding, and all targeted intron 2. Next, lentiviral vectors encoding RNA trans-splicing molecules were constructed incorporating a unique binding domain from these candidates, artificial 5' splice site, and γ-globin cDNA, and trans-splicing was evaluated in CD34(+) cell-derived erythroid cells from healthy individuals. Lentiviral transduction was efficient, with vector copy numbers of 9.7 to 15.3. The intended trans-spliced RNA product, including exon 3 of endogenous β-globin and γ-globin, was detected at the molecular level. Trans-splicing efficiency was improved to 0.07-0.09% by longer binding domains, including the 5' splice site of intron 2. In summary, screening was performed to select efficient binding domains for trans-splicing. Detectable levels of trans-splicing were obtained for endogenous β-globin RNA in human erythroid cells. These methods provide the basis for future trans-splicing directed gene therapy.

  18. Genome-wide identification of TAL1's functional targets: insights into its mechanisms of action in primary erythroid cells.

    PubMed

    Kassouf, Mira T; Hughes, Jim R; Taylor, Stephen; McGowan, Simon J; Soneji, Shamit; Green, Angela L; Vyas, Paresh; Porcher, Catherine

    2010-08-01

    Coordination of cellular processes through the establishment of tissue-specific gene expression programs is essential for lineage maturation. The basic helix-loop-helix hemopoietic transcriptional regulator TAL1 (formerly SCL) is required for terminal differentiation of red blood cells. To gain insight into TAL1 function and mechanisms of action in erythropoiesis, we performed ChIP-sequencing and gene expression analyses from primary fetal liver erythroid cells. We show that TAL1 coordinates expression of genes in most known red cell-specific processes. The majority of TAL1's genomic targets require direct DNA-binding activity. However, one-fifth of TAL1's target sequences, mainly among those showing high affinity for TAL1, can recruit the factor independently of its DNA binding activity. An unbiased DNA motif search of sequences bound by TAL1 identified CAGNTG as TAL1-preferred E-box motif in erythroid cells. Novel motifs were also characterized that may help distinguish activated from repressed genes and suggest a new mechanism by which TAL1 may be recruited to DNA. Finally, analysis of recruitment of GATA1, a protein partner of TAL1, to sequences occupied by TAL1 suggests that TAL1's binding is necessary prior or simultaneous to that of GATA1. This work provides the framework to study regulatory networks leading to erythroid terminal maturation and to model mechanisms of action of tissue-specific transcription factors.

  19. Inactivation of Rb and E2f8 synergizes to trigger stressed DNA replication during erythroid terminal differentiation.

    PubMed

    Ghazaryan, Seda; Sy, Chandler; Hu, Tinghui; An, Xiuli; Mohandas, Narla; Fu, Haiqing; Aladjem, Mirit I; Chang, Victor T; Opavsky, Rene; Wu, Lizhao

    2014-08-01

    Rb is critical for promoting cell cycle exit in cells undergoing terminal differentiation. Here we show that during erythroid terminal differentiation, Rb plays a previously unappreciated and unorthodox role in promoting DNA replication and cell cycle progression. Specifically, inactivation of Rb in erythroid cells led to stressed DNA replication, increased DNA damage, and impaired cell cycle progression, culminating in defective terminal differentiation and anemia. Importantly, all of these defects associated with Rb loss were exacerbated by the concomitant inactivation of E2f8. Gene expression profiling and chromatin immunoprecipitation (ChIP) revealed that Rb and E2F8 cosuppressed a large array of E2F target genes that are critical for DNA replication and cell cycle progression. Remarkably, inactivation of E2f2 rescued the erythropoietic defects resulting from Rb and E2f8 deficiencies. Interestingly, real-time quantitative PCR (qPCR) on E2F2 ChIPs indicated that inactivation of Rb and E2f8 synergizes to increase E2F2 binding to its target gene promoters. Taken together, we propose that Rb and E2F8 collaborate to promote DNA replication and erythroid terminal differentiation by preventing E2F2-mediated aberrant transcriptional activation through the ability of Rb to bind and sequester E2F2 and the ability of E2F8 to compete with E2F2 for E2f-binding sites on target gene promoters.

  20. Inactivation of Rb and E2f8 Synergizes To Trigger Stressed DNA Replication during Erythroid Terminal Differentiation

    PubMed Central

    Ghazaryan, Seda; Sy, Chandler; Hu, Tinghui; An, Xiuli; Mohandas, Narla; Fu, Haiqing; Aladjem, Mirit I.; Chang, Victor T.; Opavsky, Rene

    2014-01-01

    Rb is critical for promoting cell cycle exit in cells undergoing terminal differentiation. Here we show that during erythroid terminal differentiation, Rb plays a previously unappreciated and unorthodox role in promoting DNA replication and cell cycle progression. Specifically, inactivation of Rb in erythroid cells led to stressed DNA replication, increased DNA damage, and impaired cell cycle progression, culminating in defective terminal differentiation and anemia. Importantly, all of these defects associated with Rb loss were exacerbated by the concomitant inactivation of E2f8. Gene expression profiling and chromatin immunoprecipitation (ChIP) revealed that Rb and E2F8 cosuppressed a large array of E2F target genes that are critical for DNA replication and cell cycle progression. Remarkably, inactivation of E2f2 rescued the erythropoietic defects resulting from Rb and E2f8 deficiencies. Interestingly, real-time quantitative PCR (qPCR) on E2F2 ChIPs indicated that inactivation of Rb and E2f8 synergizes to increase E2F2 binding to its target gene promoters. Taken together, we propose that Rb and E2F8 collaborate to promote DNA replication and erythroid terminal differentiation by preventing E2F2-mediated aberrant transcriptional activation through the ability of Rb to bind and sequester E2F2 and the ability of E2F8 to compete with E2F2 for E2f-binding sites on target gene promoters. PMID:24865965

  1. Synthesis of Enantiomerically Pure Anthracyclinones

    NASA Astrophysics Data System (ADS)

    Achmatowicz, Osman; Szechner, Barbara

    The anthracycline antibiotics are among the most important clinical drugs used in the treatment of human cancer. The search for new agents with improved therapeutic efficacy and reduced cardiotoxicity stimulated considerable efforts in the synthesis of new analogues. Since the biological activity of anthracyclines depends on their natural absolute configuration, various strategies for the synthesis of enantiomerically pure anthracyclinones (aglycones) have been developed. They comprise: resolution of racemic intermediate, incorporation of a chiral fragment derived from natural and non-natural chiral pools, asymmetric synthesis with the use of a chiral auxiliary or a chiral reagent, and enantioselective catalysis. Synthetic advances towards enantiopure anthracyclinones reported over the last 17 years are reviewed.

  2. Toxicological evaluation of pure hydroxytyrosol.

    PubMed

    Auñon-Calles, David; Canut, Lourdes; Visioli, Francesco

    2013-05-01

    Of all the phenolic constituents of olives and extra virgin olive oil, hydroxytyrosol is currently being actively exploited as a potential supplement or preservative to be employed in the nutraceutical, cosmeceutical, and food industry. In terms of safety profile, hydroxytyrosol has only been investigated as the predominant part of raw olive mill waste water extracts, due to the previous unavailability of appropriate quantities of the pure compound. We report the toxicological evaluation of hydroxytyrosol and, based on the results, propose a No Observed Adverse Effects Level (NOAEL) of 500mg/kg/d.

  3. Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer

    PubMed Central

    Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.

    2011-01-01

    β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846

  4. Study on Hydroxyurea Response in Hemoglobinopathies Patients Using Genetic Markers and Liquid Erythroid Cultures

    PubMed Central

    Sclafani, Serena; Agrigento, Veronica; Troia, Antonio; Di Maggio, Rosario; Sacco, Massimiliano; Maggio, Aurelio; D’Alcamo, Elena; Di Marzo, Rosalba

    2016-01-01

    Increased expression of fetal hemoglobin (HbF) may ameliorate the clinical course of hemoglobinopathies. Hydroxyurea (HU) is the only inducer approved for the treatment of these diseases able to stimulate HbF production but patients’ response is highly variable indicating the utility of the identification of pharmacogenomic biomarkers in order to predict pharmacological treatment efficacy. To date few studies to evaluate the role of genetic determinants in HU response have been conducted showing contradictory results. In this study we analyzed BCL11A, GATA-1, KLF-1 genes and γ-globin promoter in 60 alleles from 30 hemoglobinopathies patients under HU treatment to assess the role of these markers in HU response. We did not find any association between these genetic determinants and HU response. Before treatment started, the same patients were analyzed in vitro using liquid erythroid cultures in a test able to predict their response to HU. The results of our analysis confirm the absence of pharmacogenomic biomarker associated to HU response indicating that, the quantification of γ-globin mRNA fold increase remains the only method able to predict in vivo patients response to the drug. PMID:28053695

  5. Novel roles for erythroid Ankyrin-1 revealed through an ENU-induced null mouse mutant

    PubMed Central

    Rank, Gerhard; Sutton, Rosemary; Marshall, Vikki; Lundie, Rachel J.; Caddy, Jacinta; Romeo, Tony; Fernandez, Kate; McCormack, Matthew P.; Cooke, Brian M.; Foote, Simon J.; Crabb, Brendan S.; Curtis, David J.; Hilton, Douglas J.; Kile, Benjamin T.

    2009-01-01

    Insights into the role of ankyrin-1 (ANK-1) in the formation and stabilization of the red cell cytoskeleton have come from studies on the nb/nb mice, which carry hypomorphic alleles of Ank-1. Here, we revise several paradigms established in the nb/nb mice through analysis of an N-ethyl-N-nitrosourea (ENU)–induced Ank-1–null mouse. Mice homozygous for the Ank-1 mutation are profoundly anemic in utero and most die perinatally, indicating that Ank-1 plays a nonredundant role in erythroid development. The surviving pups exhibit features of severe hereditary spherocytosis (HS), with marked hemolysis, jaundice, compensatory extramedullary erythropoiesis, and tissue iron overload. Red cell membrane analysis reveals a complete loss of ANK-1 protein and a marked reduction in β-spectrin. As a consequence, the red cells exhibit total disruption of cytoskeletal architecture and severely altered hemorheologic properties. Heterozygous mutant mice, which have wild-type levels of ANK-1 and spectrin in their RBC membranes and normal red cell survival and ultrastructure, exhibit profound resistance to malaria, which is not due to impaired parasite entry into RBC. These findings provide novel insights into the role of Ank-1, and define an ideal model for the study of HS and malarial resistance. PMID:19179303

  6. Intron 1 GATA site enhances ALAS2 expression indispensably during erythroid differentiation

    PubMed Central

    Zhang, Yingchi; Zhang, Jingliao; An, Wenbin; Wan, Yang; Ma, Shihui; Yin, Jie; Li, Xichuan; Gao, Jie; Yuan, Weiping; Guo, Ye; Engel, James Douglas; Shi, Lihong; Cheng, Tao; Zhu, Xiaofan

    2017-01-01

    The first intronic mutations in the intron 1 GATA site (int-1-GATA) of 5-aminolevulinate synthase 2 (ALAS2) have been identified in X-linked sideroblastic anemia (XLSA) pedigrees, strongly suggesting it could be causal mutations of XLSA. However, the function of this int-1-GATA site during in vivo development remains largely unknown. Here, we generated mice lacking a 13 bp fragment, including this int-1-GATA site (TAGATAAAGCCCC) and found that hemizygous deletion led to an embryonic lethal phenotype due to severe anemia resulting from a lack of ALAS2 expression, indicating that this non-coding sequence is indispensable for ALAS2 expression in vivo. Further analyses revealed that this int-1-GATA site anchored the GATA site in intron 8 (int-8-GATA) and the proximal promoter, forming a long-range loop to enhance ALAS2 expression by an enhancer complex including GATA1, TAL1, LMO2, LDB1 and Pol II at least, in erythroid cells. However, compared with the int-8-GATA site, the int-1-GATA site is more essential for regulating ALAS2 expression through CRISPR/Cas9-mediated site-specific deletion. Therefore, the int-1-GATA site could serve as a valuable site for diagnosing XLSA in cases with unknown mutations. PMID:28123038

  7. Inhibition of human erythroid colony-forming units by tumor necrosis factor requires beta interferon.

    PubMed Central

    Means, R T; Krantz, S B

    1993-01-01

    We have previously reported that inhibition of human CFU-erythroid (E) colony formation by tumor necrosis factor (TNF) is an indirect effect mediated by a soluble factor released from a fraction of marrow accessory cells which are predominantly stromal elements (Means, R. T., Jr., E. N. Dessypris, and S. B. Krantz. 1990. J. Clin. Invest. 86:538-541). Further studies reported here identify a mediator of this effect. The inhibitory effect of recombinant TNF on marrow CFU-E is ablated by neutralizing antibodies to human beta IFN, but not by antibodies to gamma IFN or IL-1. Anti-beta IFN also neutralizes the inhibitory effect of conditioned medium prepared from marrow cells exposed to TNF. Human beta IFN inhibits colony formation by unpurified marrow CFU-E as well as highly purified CFU-E generated from peripheral blood progenitors, and limiting dilution analysis shows that this is a direct inhibitory effect. TNF has been implicated in the pathogenesis of the anemia of chronic diseases since blood TNF levels are elevated in many patients with this syndrome, and since exposure to TNF produces a similar anemia in either humans or mice. The present study demonstrates that beta IFN is a required mediator of this inhibitory effect on erythropoiesis. PMID:8432849

  8. Therapeutic Effects of Erythroid Differentiation Regulator 1 on Imiquimod-Induced Psoriasis-Like Skin Inflammation.

    PubMed

    Kim, Kyung Eun; Houh, Younkyung; Park, Hyun Jeong; Cho, Daeho

    2016-02-17

    Psoriasis is a common skin disease accompanied by chronic inflammation. In previous studies, erythroid differentiation regulator 1 (ERDR1) was shown to have a negative correlation with proinflammatory cytokine IL-18. However, the role of ERDR1 in the inflammatory skin disease psoriasis has not been evaluated. In this study, to investigate the role of ERDR1 in psoriasis, recombinant ERDR1 was injected intraperitoneally into a psoriasis mouse model. Recombinant ERDR1 (rERDR1) significantly alleviated the symptoms of psoriasis-like skin inflammation and reduced the mRNA of various psoriasis-related markers, including keratin 14, S100A8, and Th17-related cytokines IL-17 and IL-22, suggesting that rERDR1 exerts therapeutic effects on psoriasis via the regulation of Th17 functions. Additionally, the expression of CCL20, a well-known Th17 attracting chemokine, was determined. CCL20 expression significantly decreased in the rERDR1-injected group compared with the vehicle (PBS)-injected group. CCR6 expression in the psoriatic lesional skin was also decreased by rERDR1 administration, implying the inhibition of CCR6-expressing Th17 cell chemotaxis via the downregulation of CCL20. Taken together, this study provides the first evidence that ERDR1 may be a potential therapeutic target for psoriasis.

  9. The structure and organization of the human erythroid anion exchanger (AE1) gene

    SciTech Connect

    Sahr, K.E.; Taylor, W.M.; Daniels, B.P.

    1994-12-01

    The AE1 (anion exchanger, band 3) protein is expressed in erythrocytes and in the A-type intercalated cells of the kidney distal collecting tubule. In both cell types it mediates the electroneutral transport of chloride and bicarbonate ions across the lipid bilayer, and, in erythrocytes, it also serves as the critical attachment site of the peripheral membrane skeleton. We have characterized the human AE1 gene using overlapping clones isolated from a phage library of human genomic DNA. The gene spans {approximately}20 kb and consists of 20 exons separated by 19 introns. The structure of the human AE1 gene corresponds closely with that of the previously characterized mouse AE1 gene, with a high degree of conservation of exon/intron junctions, as well as exon and intron nucleotide sequences. The putative upstream and internal promoter sequences of the human AE1 gene used in erythroid and kidney cells, respectively, are described. We also report the nucleotide sequence of the entire 3{prime} noncoding region of exon 20, which was lacking in the published cDNA sequences. In addition, we have characterized 9 Alu repeat elements found within the body of the human AE1 gene that are members of 4 related subfamilies that appear to have entered the genome at different times during primate evolution. 59 refs., 5 figs., 2 tabs.

  10. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival.

    PubMed

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E; Natarajan, Viswanathan; Jacobson, Jeffrey R; Zhang, Donna D; Garcia, Joe G N; Wang, Ting

    2015-11-24

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer.

  11. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival

    PubMed Central

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I.; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E.; Natarajan, Viswanathan; Jacobson, Jeffrey R.; Zhang, Donna D.; Garcia, Joe G. N.; Wang, Ting

    2015-01-01

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer. PMID:26596768

  12. EWS/FLI-1 induces rapid onset of myeloid/erythroid leukemia in mice.

    PubMed

    Torchia, Enrique C; Boyd, Kelli; Rehg, Jerold E; Qu, Chunxu; Baker, Suzanne J

    2007-11-01

    EWS/FLI-1 is a chimeric oncogene generated by chromosomal translocation in Ewing tumors, a family of poorly differentiated pediatric tumors arising predominantly in bone but also in soft tissue. The fusion gene combines sequences encoding a strong transactivating domain from the EWS protein with the DNA binding domain of FLI-1, an ETS transcription factor. A related fusion, TLS/ERG, has been found in myeloid leukemia. To determine EWS/FLI-1 function in vivo, we engineered mice with Cre-inducible expression of EWS/FLI-1 from the ubiquitous Rosa26 locus. When crossed with Mx1-cre mice, Cre-mediated activation of EWS/FLI-1 resulted in the rapid development of myeloid/erythroid leukemia characterized by expansion of primitive mononuclear cells causing hepatomegaly, splenomegaly, severe anemia, and death. The disease could be transplanted serially into naïve recipients. Gene expression profiles of primary and transplanted animals were highly similar, suggesting that activation of EWS/FLI-1 was the primary event leading to disease in this model. The Cre-inducible EWS/FLI-1 mouse provides a novel model system to study the contribution of this oncogene to malignant disease in vivo.

  13. Genomic Structure and Variation of Nuclear Factor (Erythroid-Derived 2)-Like 2

    PubMed Central

    Cho, Hye-Youn

    2013-01-01

    High-density mapping of mammalian genomes has enabled a wide range of genetic investigations including the mapping of polygenic traits, determination of quantitative trait loci, and phylogenetic comparison. Genome sequencing analysis of inbred mouse strains has identified high-density single nucleotide polymorphisms (SNPs) for investigation of complex traits, which has become a useful tool for biomedical research of human disease to alleviate ethical and practical problems of experimentation in humans. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) encodes a key host defense transcription factor. This review describes genetic characteristics of human NRF2 and its homologs in other vertebrate species. NRF2 is evolutionally conserved and shares sequence homology among species. Compilation of publically available SNPs and other genetic mutations shows that human NRF2 is highly polymorphic with a mutagenic frequency of 1 per every 72 bp. Functional at-risk alleles and haplotypes have been demonstrated in various human disorders. In addition, other pathogenic alterations including somatic mutations and misregulated epigenetic processes in NRF2 have led to oncogenic cell survival. Comprehensive information from the current review addresses association of NRF2 variation and disease phenotypes and supports the new insights into therapeutic strategies. PMID:23936606

  14. Inducible Fli-1 gene deletion in adult mice modifies several myeloid lineage commitment decisions and accelerates proliferation arrest and terminal erythrocytic differentiation.

    PubMed

    Starck, Joëlle; Weiss-Gayet, Michèle; Gonnet, Colette; Guyot, Boris; Vicat, Jean-Michel; Morlé, François

    2010-12-02

    This study investigated the role of the ETS transcription factor Fli-1 in adult myelopoiesis using new transgenic mice allowing inducible Fli-1 gene deletion. Fli-1 deletion in adult induced mild thrombocytopenia associated with a drastic decrease in large mature megakaryocytes number. Bone marrow bipotent megakaryocytic-erythrocytic progenitors (MEPs) increased by 50% without increase in erythrocytic and megakaryocytic common myeloid progenitor progeny, suggesting increased production from upstream stem cells. These MEPs were almost unable to generate pure colonies containing large mature megakaryocytes, but generated the same total number of colonies mainly identifiable as erythroid colonies containing a reduced number of more differentiated cells. Cytological and fluorescence-activated cell sorting analyses of MEP progeny in semisolid and liquid cultures confirmed the drastic decrease in large mature megakaryocytes but revealed a surprisingly modest (50%) reduction of CD41-positive cells indicating the persistence of a megakaryocytic commitment potential. Symmetrical increase and decrease of monocytic and granulocytic progenitors were also observed in the progeny of purified granulocytic-monocytic progenitors and common myeloid progenitors. In summary, this study indicates that Fli-1 controls several lineages commitment decisions at the stem cell, MEP, and granulocytic-monocytic progenitor levels, stimulates the proliferation of committed erythrocytic progenitors at the expense of their differentiation, and is a major regulator of late stages of megakaryocytic differentiation.

  15. Pure dysarthria due to an insular infarction.

    PubMed

    Hiraga, Akiyuki; Tanaka, Saiko; Kamitsukasa, Ikuo

    2010-06-01

    Cortical infarction presenting with pure dysarthria is rarely reported. Previous studies have reported pure dysarthria due to cortical stroke at the precentral gyrus or middle frontal gyrus. We report a 72-year-old man who developed pure dysarthria caused by an acute cortical infarction in the insular cortex. The role of the insula in language has been difficult to assess clinically because of the rarity of pure insular strokes. Our patient showed pure dysarthria without aphasia, indicating that pure dysarthria can be the sole manifestation of insular infarctions.

  16. Multiple pure tone noise prediction

    NASA Astrophysics Data System (ADS)

    Han, Fei; Sharma, Anupam; Paliath, Umesh; Shieh, Chingwei

    2014-12-01

    This paper presents a fully numerical method for predicting multiple pure tones, also known as “Buzzsaw” noise. It consists of three steps that account for noise source generation, nonlinear acoustic propagation with hard as well as lined walls inside the nacelle, and linear acoustic propagation outside the engine. Noise generation is modeled by steady, part-annulus computational fluid dynamics (CFD) simulations. A linear superposition algorithm is used to construct full-annulus shock/pressure pattern just upstream of the fan from part-annulus CFD results. Nonlinear wave propagation is carried out inside the duct using a pseudo-two-dimensional solution of Burgers' equation. Scattering from nacelle lip as well as radiation to farfield is performed using the commercial solver ACTRAN/TM. The proposed prediction process is verified by comparing against full-annulus CFD simulations as well as against static engine test data for a typical high bypass ratio aircraft engine with hardwall as well as lined inlets. Comparisons are drawn against nacelle unsteady pressure transducer measurements at two axial locations as well as against near- and far-field microphone array measurements outside the duct. This is the first fully numerical approach (no experimental or empirical input is required) to predict multiple pure tone noise generation, in-duct propagation and far-field radiation. It uses measured blade coordinates to calculate MPT noise.

  17. Aclacinomycin A sensitizes K562 chronic myeloid leukemia cells to imatinib through p38MAPK-mediated erythroid differentiation.

    PubMed

    Lee, Yueh-Lun; Chen, Chih-Wei; Liu, Fu-Hwa; Huang, Yu-Wen; Huang, Huei-Mei

    2013-01-01

    Expression of oncogenic Bcr-Abl inhibits cell differentiation of hematopoietic stem/progenitor cells in chronic myeloid leukemia (CML). Differentiation therapy is considered to be a new strategy for treating this type of leukemia. Aclacinomycin A (ACM) is an antitumor antibiotic. Previous studies have shown that ACM induced erythroid differentiation of CML cells. In this study, we investigate the effect of ACM on the sensitivity of human CML cell line K562 to Bcr-Abl specific inhibitor imatinib (STI571, Gleevec). We first determined the optimal concentration of ACM for erythroid differentiation but not growth inhibition and apoptosis in K562 cells. Then, pretreatment with this optimal concentration of ACM followed by a minimally toxic concentration of imatinib strongly induced growth inhibition and apoptosis compared to that with simultaneous co-treatment, indicating that ACM-induced erythroid differentiation sensitizes K562 cells to imatinib. Sequential treatment with ACM and imatinib induced Bcr-Abl down-regulation, cytochrome c release into the cytosol, and caspase-3 activation, as well as decreased Mcl-1 and Bcl-xL expressions, but did not affect Fas ligand/Fas death receptor and procaspase-8 expressions. ACM/imatinib sequential treatment-induced apoptosis was suppressed by a caspase-9 inhibitor and a caspase-3 inhibitor, indicating that the caspase cascade is involved in this apoptosis. Furthermore, we demonstrated that ACM induced erythroid differentiation through the p38 mitogen-activated protein kinase (MAPK) pathway. The inhibition of erythroid differentiation by p38MAPK inhibitor SB202190, p38MAPK dominant negative mutant or p38MAPK shRNA knockdown, reduced the ACM/imatinib sequential treatment-mediated growth inhibition and apoptosis. These results suggest that differentiated K562 cells induced by ACM-mediated p38MAPK pathway become more sensitive to imatinib and result in down-regulations of Bcr-Abl and anti-apoptotic proteins, growth inhibition and

  18. Pure Immature Teratoma of the Ovary in Adults

    PubMed Central

    Alwazzan, Ahmad Bakr; Popowich, Shaundra; Dean, Erin; Robinson, Christine; Lotocki, Robert; Altman, Alon D.

    2015-01-01

    Objective The aim of this study was to evaluate clinicopathologic characteristics, treatment outcome, and reproductive function in women diagnosed with ovarian immature teratoma (IT). Our standard chemotherapy regime is currently etoposide/cisplatin (EP), creating a unique opportunity to evaluate this protocol in ovarian ITs. Materials and Methods This study is a retrospective analysis. Twenty-seven women older than 18 years with ovarian IT stages IA to IIIC were identified and included in this study. Patients were treated at 1 institution, Health Sciences Center, Women’s Hospital, Winnipeg, Manitoba, Canada, between 1983 and 2013. Results The median age at diagnosis was 27.0 years (range, 18–36 years). Twenty-two (82%) presented with an International Federation of Gynecology and Obstetrics stage I disease, 3 (11%) had stage II, and 2 patients (7%) had stage III disease. The histologic grade distribution was grade I in 9 patients (33%), grade II in 3 patients (11%), and grade III in 15 patients (56%). Initial management was surgical for all patients: 3 (11%) hysterectomy and bilateral salpingo-oophorectomy, 1 (4%) cystectomy only, and 23 (85%) unilateral salpingo-oophorectomy. Twenty-one patients (78%) received adjuvant therapy. The median follow-up was 60 months (range, 36–72 months). One patient recurred (histological grade III) 6 months after surgery and had a complete clinical response to 4 cycles of EP chemotherapy. Twelve patients reported an attempt to conceive resulting in 10 pregnancies (8 after chemotherapy). Conclusions Ovarian IT is a curable disease. Fertility-sparing surgery should be offered. Adjuvant treatment with cisplatinum-based chemotherapy, typically with bleomycin, etoposide, and cisplatin, is still considered the standard in stages greater than stage IA grade I. Etoposide/cisplatin as a primary chemotherapy regime for early- or advanced-stage disease is an effective treatment with minimal adverse effects and high tolerability. This is the first published study examining EP as a primary treatment modality for IT. Further studies are needed to strengthen these findings. PMID:26332392

  19. 76 FR 69284 - Pure Magnesium From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... COMMISSION Pure Magnesium From China Determination On the basis of the record \\1\\ developed in the subject... order on pure magnesium from China would be likely to lead to continuation or recurrence of material... USITC Publication 4274 (October 2011), entitled Pure Magnesium from China: Investigation No....

  20. A phase 1 study of ACE-536, a regulator of erythroid differentiation, in healthy volunteers.

    PubMed

    Attie, Kenneth M; Allison, Mark J; McClure, Ty; Boyd, Ingrid E; Wilson, Dawn M; Pearsall, Amelia E; Sherman, Matthew L

    2014-07-01

    ACE-536, a recombinant protein containing a modified activin receptor type IIB, is being developed for the treatment of anemias caused by ineffective erythropoiesis, such as thalassemias and myelodysplastic syndromes. ACE-536 acts through a mechanism distinct from erythropoiesis-stimulating agents to promote late-stage erythroid differentiation by binding to transforming growth factor-β superfamily ligands and inhibiting signaling through transcription factors Smad 2/3. The goal of this Phase 1 study was to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamic effects of ascending dose levels of ACE-536 in healthy volunteers. Thirty-two postmenopausal women were randomized in sequential cohorts of eight subjects each to receive up to two doses of either ACE-536 (0.0625-0.25 mg/kg) or placebo (3:1 randomization) given subcutaneously every 2 weeks. Mean baseline age was 59.4 years, and hemoglobin was 13.2 g/dL. ACE-536 was well tolerated at dose levels up to 0.25 mg/kg over the 1-month treatment period. There were no serious or severe adverse events, nor clinically meaningful changes in safety laboratory measures or vital signs. Mean ACE-536 AUC0-14d and Cmax increased proportionally after first dose; mean t½ was 15-16 days. Dose-dependent increases in hemoglobin concentration were observed, beginning 7 days after initiation of treatment and maintained for several weeks following treatment. The proportion of subjects with a hemoglobin increase ≥1.0 g/dL increased in a dose-dependent manner to 83.3% of subjects in the highest dose group, 0.25 mg/kg. ACE-536 was well tolerated and resulted in sustained increases in hemoglobin levels in healthy postmenopausal women.

  1. Rifampicin Attenuated Global Cerebral Ischemia Injury via Activating the Nuclear Factor Erythroid 2-Related Factor Pathway

    PubMed Central

    Chen, Beibei; Cao, Huimin; Chen, Lili; Yang, Xuemei; Tian, Xiaoyan; Li, Rong; Cheng, Oumei

    2016-01-01

    Background: Recent studies have found that rifampicin has neuroprotective properties in neurodegenerative diseases. However, the exact mechanisms of action remain unclear. The nuclear factor erythroid 2-related factor 2 (Nrf2) has been considered a potential target for neuroprotection. In this study, we examined whether rifampicin exhibits beneficial effects mediated by the Nrf2 pathway after global cerebral ischemia (GCI). Methods: Rats were randomly assigned to four groups that included a sham group and three treatment groups with global ischemia-reperfusion [control, rifampicin, and rifampicin plus brusatol (an inhibitor of Nrf2)]. Rats were subjected to transient GCI induced by bilateral common carotid artery occlusion for 20 min with systemic hypotension by blood withdrawal. The Morris water maze test was performed for neurobehavioral testing, whereas the pathological changes were investigated using HE and TUNEL staining. The protein expression of Nrf2, hemeoxygenase-1 (HO-1) and cyclooxygenase-2 (COX-2) in the hippocampus were analyzed by Western blotting. The immunofluorescence staining was used to determine the distribution of Nrf2. Results: Rifampicin treatment significantly improved spatial learning ability compared with the control group, which was consistent with the pathological changes. In addition, rifampicin significantly elevated the nuclear expression of Nrf2, Nrf2 downstream anti-oxidant protein, HO-1 compared with the control group, and it simultaneously downregulated the expression of COX-2 in the hippocampus on day 3 after ischemia-reperfusion. Interestingly, the forenamed effects of rifampicin were abolished by pretreatment with brusatol, a specific inhibitor of Nrf2 activation. Conclusions: Rifampicin exerts neuroprotective effects against global cerebral ischemia, which may be attributed to activation of the Nrf2 pathway. PMID:27965540

  2. Measurement of generation-dependent proliferation rates and death rates during mouse erythroid progenitor cell differentiation.

    PubMed

    Akbarian, Vahe; Wang, Weijia; Audet, Julie

    2012-05-01

    Herein, we describe an experimental and computational approach to perform quantitative carboxyfluorescein diacetate succinimidyl ester (CFSE) cell-division tracking in cultures of primary colony-forming unit-erythroid (CFU-E) cells, a hematopoietic progenitor cell type, which is an important target for the treatment of blood disorders and for the manufacture of red blood cells. CFSE labeling of CFU-Es isolated from mouse fetal livers was performed to examine the effects of stem cell factor (SCF) and erythropoietin (EPO) in culture. We used a dynamic model of proliferation based on the Smith-Martin representation of the cell cycle to extract proliferation rates and death rates from CFSE time-series. However, we found that to accurately represent the cell population dynamics in differentiation cultures of CFU-Es, it was necessary to develop a model with generation-specific rate parameters. The generation-specific rates of proliferation and death were extracted for six generations (G(0) -G(5) ) and they revealed that, although SCF alone or EPO alone supported similar total cell outputs in culture, stimulation with EPO resulted in significantly higher proliferation rates from G(2) to G(5) and higher death rates in G(2) , G(3) , and G(5) compared with SCF. In addition, proliferation rates tended to increase from G(1) to G(5) in cultures supplemented with EPO and EPO + SCF, while they remained lower and more constant across generations with SCF. The results are consistent with the notion that SCF promotes CFU-E self-renewal while EPO promotes CFU-E differentiation in culture.

  3. Recombinant erythroid differentiation regulator 1 inhibits both inflammation and angiogenesis in a mouse model of rosacea.

    PubMed

    Kim, Miri; Kim, Kyung-Eun; Jung, Haw Young; Jo, Hyunmu; Jeong, Seo-Won; Lee, Jahyung; Kim, Chang Han; Kim, Heejong; Cho, Daeho; Park, Hyun Jeong

    2015-09-01

    The erythroid differentiation regulator 1 (Erdr1), which is a novel and highly conserved factor, was recently reported to be negatively regulated by IL-18 and to play a crucial role as an antimetastatic factor. IL-18 is a proinflammatory cytokine that functions as an angiogenic mediator in inflammation. Rosacea is a chronic inflammatory skin disorder that is characterized by abnormal inflammation and vascular hyperactivity of the facial skin. To determine whether Erdr1 contributes to the regulation of the chronic inflammatory process in the development of rosacea, an immunohistochemical analysis was performed in healthy donors and patients with rosacea. In this study, we showed that Erdr1 was downregulated, whereas IL-18 was upregulated, in patients with rosacea, which led us to question the role of Erdr1 in this disorder. Moreover, a rosacea-like BALB/c mouse model was used to determine the role of Erdr1 in rosacea in vivo. LL-37 injection induced typical rosacea features, including erythema, telangiectasia and inflammation. Treatment with recombinant Erdr1 (rErdr1) resulted in a significant reduction of erythema, inflammatory cell infiltration (including CD4(+) and CD8(+) T cells), and microvessel density with vascular endothelial growth factor (VEGF). Taken together, our findings suggest that rErdr1 may be involved in attenuating the inflammation and angiogenesis associated with the pathogenesis of rosacea. Thus, these results provide new insight into the mechanism involved in this condition and indicate that rErdr1 could be a potential target for therapeutic intervention of rosacea.

  4. Expression of oncogenic K-ras from its endogenous promoter leads to a partial block of erythroid differentiation and hyperactivation of cytokine-dependent signaling pathways.

    PubMed

    Zhang, Jing; Liu, Yangang; Beard, Caroline; Tuveson, David A; Jaenisch, Rudolf; Jacks, Tyler E; Lodish, Harvey F

    2007-06-15

    When overexpressed in primary erythroid progenitors, oncogenic Ras leads to the constitutive activation of its downstream signaling pathways, severe block of terminal erythroid differentiation, and cytokine-independent growth of primary erythroid progenitors. However, whether high-level expression of oncogenic Ras is required for these phenotypes is unknown. To address this issue, we expressed oncogenic K-ras (K-ras(G12D)) from its endogenous promoter using a tetracycline-inducible system. We show that endogenous K-ras(G12D) leads to a partial block of terminal erythroid differentiation in vivo. In contrast to results obtained when oncogenic Ras was overexpressed from retroviral vectors, endogenous levels of K-ras(G12D) fail to constitutively activate but rather hyperactivate cytokine-dependent signaling pathways, including Stat5, Akt, and p44/42 MAPK, in primary erythroid progenitors. This explains previous observations that hematopoietic progenitors expressing endogenous K-ras(G12D) display hypersensitivity to cytokine stimulation in various colony assays. Our results support efforts to modulate Ras signaling for treating hematopoietic malignancies.

  5. Enhanced fetal hemoglobin production by phenylacetate and 4-phenylbutyrate in erythroid precursors derived from normal donors and patients with sickle cell anemia and beta-thalassemia.

    PubMed

    Fibach, E; Prasanna, P; Rodgers, G P; Samid, D

    1993-10-01

    In both sickle cell (SS) anemia and beta-thalassemia (beta-thal), an increase in fetal hemoglobin (HbF) ameliorates the clinical symptoms of the underlying disease. Several pharmacologic agents have been used to elevate HbF levels in adults; however, concerns regarding adverse effects of the prevailing drugs raise an urgent need for other agents capable of stimulating HbF production. We show here that sodium phenylacetate (NaPA) and its precursor, sodium 4-phenylbutyrate (NaPB), can enhance HbF production in cultured erythroid progenitor derived from normal donors and patients with SS anemia or beta-thal, when used at pharmacologic concentrations. Treatment resulted in (1) reduced cell proliferation, (2) elevated hemoglobin (Hb) content per cell (mean cellular Hb [MCH]), and (3) an increased proportion of HbF produced, associated with elevated levels of gamma-globin mRNA. Moreover, the active phenyl-fatty acids, with NaPA as a prototype, potentiated HbF induction by other drugs of clinical interest, including hydroxyurea (HU), sodium butyrate, and 5-azacytidine (5AzaC). Efficacy could be further enhanced by introducing chlorine substituents at the phenyl ring to increase drug lipophilicity. Our findings indicate that NaPA and NaPB, both already proven safe and effective in treatment of children with urea cycle disorders, might benefit also patients with severe hemoglobinopathies. The two-phase liquid culture procedure used in this study should prove valuable in further studies exploring the mechanisms of HbF induction by these agents, and might provide an assay to predict patient response in the clinical setting.

  6. Coxsackievirus B3 Infects the Bone Marrow and Diminishes the Restorative Capacity of Erythroid and Lymphoid Progenitors

    PubMed Central

    Althof, Nadine

    2013-01-01

    Coxsackievirus B3 (CVB3) is known to infect stem cells in the neonatal central nervous system. Here, we evaluated the effects of CVB3 infection on the major source and repository of stem cells, the bone marrow (BM). Viral genome was detectable in BM within 24 h of infection, and productive infection of BM cells was evident, peaking at 48 h postinfection (p.i.), when ∼1 to 2% of BM cells produced infectious virus particles. Beginning at 2 to 3 days p.i., a dramatic and persistent loss of immature erythroid cells, B and T lymphocytes, and neutrophils was observed in BM and, by day 3 to 4 p.i., the femoral BM stroma was largely destroyed. Analysis of peripheral blood revealed a modest neutrophilia, a loss of reticulocytes, and a massive lymphopenia. The abundance of multipotent progenitor cells (Lin−/c-kit+/Flt3+) in BM declined ∼10-fold during CVB3 infection and, consistent with a deficiency of primitive hematopoietic progenitors, serum levels of the hematopoietic growth factor Flt3 ligand were dramatically elevated. Therefore, we analyzed the regenerative capacity of BM from CVB3-infected mice. Granulocyte/macrophage progenitors displayed a relatively normal proliferative ability, consistent with the fact that the peripheral blood level of neutrophils—which are very short-lived cells—remained high throughout infection. However, erythroid and lymphoid hematopoietic progenitors in BM from CVB3-infected mice showed a markedly reduced colony-forming capacity, consonant with the observed loss of both lymphocytes and immature erythroid cells/reticulocytes from the BM and peripheral blood. In summary, CVB3 infects the BM and exerts differential effects on the various hematopoietic progenitor populations. PMID:23269810

  7. Activation of Stat 5b in erythroid progenitors correlates with the ability of ErbB to induce sustained cell proliferation.

    PubMed Central

    Mellitzer, G; Wessely, O; Decker, T; Meinke, A; Hayman, M J; Beug, H

    1996-01-01

    Self renewal of normal erythroid progenitors is induced by the receptor tyrosine kinase c-ErbB, whereas other receptors (c-Kit/Epo-R) regulate erythroid differentiation. To address possible mechanisms that could explain this selective activity of c-ErbB, we analyzed the ability of these receptors to activate the different members of the Stat transcription factor family. Ligand activation of c-ErbB induced the tyrosine phosphorylation, DNA-binding, and reporter gene transcription of Stat 5b in erythroblasts. In contrast, ligand activation of c-Kit was unable to induce any of these effects in the same cells. Activation of the erythropoietin receptor caused specific DNA-binding of Stat 5b, but failed to induce reporter gene transcription. These biochemical findings correlate perfectly with the selective ability of c-ErbB to cause sustained self renewal in erythroid progenitors. Images Fig. 1 Fig. 3 Fig. 4 PMID:8790376

  8. Immunophenotypic Profiling of Erythroid Progenitor-Derived Extracellular Vesicles in Diamond-Blackfan Anaemia: A New Diagnostic Strategy.

    PubMed

    Macrì, Serena; Pavesi, Elisa; Crescitelli, Rossella; Aspesi, Anna; Vizziello, Claudia; Botto, Carlotta; Corti, Paola; Quarello, Paola; Notari, Patrizia; Ramenghi, Ugo; Ellis, Steven Robert; Dianzani, Irma

    2015-01-01

    Diamond-Blackfan Anaemia (DBA) is a rare inherited anaemia caused by heterozygous mutations in one of 13 ribosomal protein genes. Erythroid progenitors (BFU-E and CFU-E) in bone marrow (BM) show a proapoptotic phenotype. Suspicion of DBA is reached after exclusion of other forms of BM failure syndromes. To improve DBA diagnosis, which is confirmed by mutation analysis, we tested a new approach based on the study of extracellular vesicles (EVs) isolated from plasma by differential centrifugations and analysed by flow cytometry. We chose CD34, CD71 and CD235a markers to study erythroid EVs. We characterised the EVs immunophentoypic profiles of 13 DBA patients, 22 healthy controls and 16 patients with other haematological diseases. Among the three EVs clusters we found, only the CD34+/CD71low population showed statistically significant differences between DBA patients and controls (p< 0.05). The absence of this cluster is in agreement with the low levels of BFU-E found in DBA patients. The assessment of ROC curves demonstrated the potential diagnostic value of this population. We suggest that this assay may be useful to improve DBA diagnosis as a quicker and less invasive alternative to BM BFU-E culture analysis.

  9. The Potential Role of Cell Penetrating Peptides in the Intracellular Delivery of Proteins for Therapy of Erythroid Related Disorders

    PubMed Central

    Papadopoulou, Lefkothea C.; Tsiftsoglou, Asterios S.

    2013-01-01

    The erythroid related disorders (ERDs) represent a large group of hematological diseases, which in most cases are attributed either to the deficiency or malfunction of biosynthetic enzymes or oxygen transport proteins. Current treatments for these disorders include histo-compatible erythrocyte transfusions or allogeneic hematopoietic stem cell (HSC) transplantation. Gene therapy delivered via suitable viral vectors or genetically modified HSCs have been under way. Protein Transduction Domain (PTD) technology has allowed the production and intracellular delivery of recombinant therapeutic proteins, bearing Cell Penetrating Peptides (CPPs), into a variety of mammalian cells. Remarkable progress in the field of protein transduction leads to the development of novel protein therapeutics (CPP-mediated PTs) for the treatment of monogenetic and/or metabolic disorders. The “concept” developed in this paper is the intracellular protein delivery made possible via the PTD technology as a novel therapeutic intervention for treatment of ERDs. This can be achieved via four stages including: (i) the production of genetically engineered human CPP-mediated PT of interest, since the corresponding native protein either is missing or is mutated in the erythroid progenitor cell (ErPCs) or mature erythrocytes of patients; (ii) isolation of target cells from the peripheral blood of the selected patients; (iii) ex vivo transduction of cells with the CPP-mediated PT of interest; and (iv) re-administration of the successfully transduced cells back into the same patients. PMID:24275786

  10. Development of phenotypic screening assays for γ-globin induction using primary human bone marrow day 7 erythroid progenitor cells.

    PubMed

    Li, Hu; Xie, Wensheng; Gore, Elizabeth R; Montoute, Monica N; Bee, Weilin Tiger; Zappacosta, Francesca; Zeng, Xin; Wu, Zining; Kallal, Lorena; Ames, Robert S; Pope, Andrew J; Benowitz, Andrew; Erickson-Miller, Connie L

    2013-12-01

    Sickle cell anemia (SCA) is a genetic disorder of the β-globin gene. SCA results in chronic ischemia with pain and tissue injury. The extent of SCA symptoms can be ameliorated by treatment with drugs, which result in increasing the levels of γ-globin in patient red blood cells. Hydroxyurea (HU) is a Food and Drug Administration-approved drug for SCA, but it has dose-limiting toxicity, and patients exhibit highly variable treatment responses. To identify compounds that may lead to the development of better and safer medicines, we have established a method using primary human bone marrow day 7 erythroid progenitor cells (EPCs) to screen for compounds that induce γ-globin production. First, human marrow CD34(+) cells were cultured and expanded for 7 days and characterized for the expression of erythroid differentiation markers (CD71, CD36, and CD235a). Second, fresh or cryopreserved EPCs were treated with compounds for 3 days in 384-well plates followed by γ-globin quantification by an enzyme-linked immunosorbent assay (ELISA), which was validated using HU and decitabine. From the 7408 compounds screened, we identified at least one new compound with confirmed γ-globin-inducing activity. Hits are undergoing analysis in secondary assays. In this article, we describe the method of generating fit-for-purpose EPCs; the development, optimization, and validation of the ELISA and secondary assays for γ-globin detection; and screening results.

  11. Increased oxidative metabolism is associated with erythroid precursor expansion in β0-thalassaemia/Hb E disease.

    PubMed

    Leecharoenkiat, Amporn; Wannatung, Tirawat; Lithanatudom, Pathrapol; Svasti, Saovaros; Fucharoen, Suthat; Chokchaichamnankit, Daranee; Srisomsap, Chantragan; Smith, Duncan R

    2011-10-15

    Erythropoiesis in β0-thalassaemia/Hb E patients, the most common variant form of β-thalassaemia in Southeast Asia, is characterized by accelerated differentiation and over-expansion of erythroid precursor cells. The mechanism driving this accelerated expansion and differentiation remain unknown. To address this issue a proteomic analysis was undertaken to firstly identify proteins differentially expressed during erythroblast differentiation and a second analysis was undertaken to identify proteins differentially expressed between β0-thalassaemia/Hb E erythroblasts and control erythroblasts. The majority of proteins identified as being differentially expressed between β0-thalassaemia/Hb E and control erythroblasts were constituents of the glycolysis/TCA pathway and levels of oxidative stress correlated with the degree of erythroid expansion. A model was constructed linking these observations with previous studies showing increased phosphorylation of ERK1/2 in thalassemic erythroblasts which predicted the increased activation of PKA, PKB and PKC which Western analysis confirmed. Inhibition of PKA or PKC reduced β0-thalassaemia/Hb E erythroblast differentiation and/or expansion. We propose that increased expansion and differentiation of β0-thalassaemia/Hb E erythroblasts occur as a result of feedback loops acting through increased oxidative metabolism.

  12. Erythroid Krüppel-like factor (EKLF) contains a multifunctional transcriptional activation domain important for inter- and intramolecular interactions.

    PubMed Central

    Chen, X; Bieker, J J

    1996-01-01

    Erythroid Krüppel-like factor (EKLF) is a red cell-restricted transcriptional activator that plays a dominant role in establishing high levels of beta-globin gene expression during erythroid ontogeny. Although its DNA binding domain belongs to the well-studied class of Krüppel-like zinc fingers, its proline-rich activation region has not been thoroughly examined. We have analyzed this region by monitoring the functional effects of its mutagenesis upon EKLF activity in vivo and in vitro. First, using co-transfection assays, we find that the transactivation region contains discrete stimulatory and inhibitory subdomains. Second, in vitro binding assays indicate that the inhibitory domain exerts its effect in cis by interfering with DNA binding. Third, in vivo competition assays demonstrate that EKLF interacts with a positive-acting cellular factor, and that the domain responsible for this trans interaction lies within a 40 amino acid sequence that is coincident with the EKLF minimal transactivation domain. Finally, site-directed mutagenesis of this domain implies that conformation and/or phosphorylation status of its central core may be critical for such interactions. These results point towards post-translational steric and/or allosteric control of EKLF function that may be important not just for its DNA binding ability, but also for its potential to interact with other proteins that fully establish the correct stereospecific array leading to efficient switching of beta-globin transcription during development. Images PMID:8918466

  13. Enforced expression of HOX11 is associated with an immature phenotype in J2E erythroid cells.

    PubMed

    Greene, Wayne K; Ford, Jette; Dixon, Darcelle; Tilbrook, Peta A; Watt, Paul M; Klinken, S Peter; Kees, Ursula R

    2002-09-01

    The HOX11 gene encodes a homeodomain transcription factor that is essential for spleen development during embryogenesis. HOX11 is also leukaemogenic, both through its clinical association with childhood T-cell acute lymphoblastic leukaemia, and its ability to immortalize other haematopoietic cell lineages experimentally. To examine the pathological role of HOX11 in tumorigenesis, we constitutively expressed HOX11 cDNA in J2E murine erythroleukaemic cells, which are capable of terminal differentiation. Enforced HOX11 expression was found to induce a profound alteration in J2E cellular morphology and differentiation status. Our analyses revealed that HOX11 produced clones with a preponderance of less differentiated cells that were highly adherent to plastic. Morphologically, the cells overexpressing HOX11 were larger and had decreased globin levels, as well as a reduction in haemoglobin synthesis in response to erythropoietin (EPO). Immunocytochemical analysis confirmed the immature erythroid phenotype imposed by HOX11, with clones transfected with HOX11 demonstrating expression of the c-Kit stem cell marker, while retaining EPO receptor expression. Taken together, these results show that HOX11 alters erythroid differentiation, favouring a less mature progenitor-like stage. This supports the notion that disrupted haematopoietic cell differentiation is responsible for pre-leukaemic immortalization by the HOX11 oncoprotein.

  14. Method of preparing pure fluorine gas

    DOEpatents

    Asprey, Larned B.

    1976-01-01

    A simple, inexpensive system for purifying and storing pure fluorine is described. The method utilizes alkali metal-nickel fluorides to absorb tank fluorine by forming nickel complex salts and leaving the gaseous impurities which are pumped away. The complex nickel fluoride is then heated to evolve back pure gaseous fluorine.

  15. Pure ovarian choriocarcinoma: report of two cases

    PubMed Central

    Mood, Narges Izadi; Samadi, Nasrin; Rahimi-Moghaddam, Parvaneh; Sarmadi, Soheila; Eftekhar, Zahra; Yarandi, Fariba

    2009-01-01

    Pure primary ovarian choriocarcinoma is an extremely rare condition of gestational or nongestational origin. The possibility of gestational origin can be suspected by the presence of a corpus luteum of pregnancy but definite diagnosis would be based on genetic analysis. Here, we present two cases of pure ovarian choriocarcinoma in the forth decade of life with the possibility of gestational origin. PMID:21772904

  16. Direct evidence for interaction between human erythroid progenitor cells and a hemoglobin switching activity present in fetal sheep serum.

    PubMed Central

    Stamatoyannopoulos, G; Nakamoto, B; Kurachi, S; Papayannopoulou, T

    1983-01-01

    An activity that induces Hb F to Hb A switching in human cells is present in fetal sheep serum. To test directly the role of cell-to-environment interactions in hemoglobin switching and to define the level of erythroid cell differentiation at which this activity operates, colony transfer experiments were done. Clones grown in the presence of switching activity-containing medium (fetal sheep serum) or control medium (fetal calf serum) were transferred, at the 16- to 30-cell stage, to either fetal sheep serum or fetal calf serum plates and Hb F synthesis was determined in the fully mature erythroid bursts. Fetal calf serum-to-fetal calf serum transfers produced colonies with the high Hb F levels characteristic of undisturbed fetal calf serum-grown clones. Fetal sheep serum-to-fetal calf serum transfers resulted in significant decrease in Hb F synthesis, revealing an interaction between hemoglobin switching activity and cells at an early stage of progenitor cell development. The reduction of Hb F synthesis in fetal calf serum-to-fetal sheep serum transfers indicated that hemoglobin switching activity interacts with cells at later stages of progenitor cell development. Maximal decrease in Hb F synthesis was observed in fetal sheep serum-to-fetal sheep serum transfers, indicating that optimal effects on Hb switching are obtained when the environment that induces Hb switching is present throughout the development of progenitor cells. By splitting single early clones into two parts and transferring them to either a fetal sheep serum or a fetal calf serum environment, these interactions were further demonstrated in the progeny of a single erythroid burst-forming unit. Since all clone transfers were done on cell-free plates, the results of fetal calf serum-to-fetal sheep serum and of fetal sheep serum-to-fetal sheep serum transfers indicated that the switching activity does not require helper cells for its action. These studies show directly that (i) Hb F synthesis is

  17. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells

    PubMed Central

    Salopiata, Florian; Depner, Sofia; Wäsch, Marvin; Böhm, Martin E.; Mücke, Oliver; Plass, Christoph; Lehmann, Wolf D.; Kreutz, Clemens; Timmer, Jens; Klingmüller, Ursula

    2016-01-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  18. Progressive inactivation of the expression of an erythroid transcriptional factor in GM- and G-CSF-dependent myeloid cell lines.

    PubMed Central

    Crotta, S; Nicolis, S; Ronchi, A; Ottolenghi, S; Ruzzi, L; Shimada, Y; Migliaccio, A R; Migliaccio, G

    1990-01-01

    The transcriptional binding protein NFE-1 (also called GF-1 and Ery-f1) is thought to play a necessary, but not sufficient, role in the regulation of differentiation-related gene expression in a subset of hematopoietic lineages (erythroid, megakaryocytic, and basophil-mast cell). In order to clarify the mechanism which underlies the lineage-specificity of the NFE-1 expression, as well as the relationship between the expression of this factor and growth factor responsiveness, we have evaluated the capacity of erythropoietin (Epo)-, granulomonocytic (GM)-colony stimulating factor (CSF)-, and granulocyte (G)-CSF-dependent subclones derived from the interleukin 3 (IL-3)-dependent cell line 32D, to express 1) NFE-1 mRNA, 2) NFE-1-related nuclear proteins, and 3) chloramphenicol acetyl transferase (CAT) activity when transfected with a CAT gene under the control of NFE-1 cognate sequences. NFE-1 mRNA was found to be expressed not only in cells with mast cell (IL-3-dependent 32D) and erythroid (Epo-dependent 32D Epo1) phenotypes, but also in cells with predominantly granulocyte/macrophage properties, such as the GM-CSF- (early myelomonocytic) and G-CSF- (myelocytic) dependent subclones of 32D. However, a gradient of expression, correlating with the lineage, the stage of differentiation, and the growth factor responsiveness of the cell lines, was found among the different subclones: Epo greater than or equal to IL-3 greater than GM-CSF greater than G-CSF. Binding experiments demonstrated NFE-1 activity in all cell lines except the G-CSF-dependent line. Function of the NFE-1 protein was assessed by the expression of the CAT gene linked to the SV40 promoter and a mutant (-175 T----C) HPFH gamma-globin promoter. High level CAT expression was seen only in the Epo1 cells although low level expression was also seen in the parent 32D. These results demonstrate that the specificity of the expression of NFE-1 for the erythroid--megakaryocytic--mast cell lineages is obtained by

  19. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    PubMed Central

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M.; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M.; Ribeiro, Maria L.; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A.; Davis, Brian R.; Segovia, Jose C.

    2015-01-01

    Summary Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses. PMID:26549847

  20. Association between Variants at BCL11A Erythroid-Specific Enhancer and Fetal Hemoglobin Levels among Sickle Cell Disease Patients in Cameroon: Implications for Future Therapeutic Interventions

    PubMed Central

    Pule, Gift Dineo; Ngo Bitoungui, Valentina Josiane; Chemegni, Bernard Chetcha; Kengne, Andre Pascal; Antonarakis, Stylianos

    2015-01-01

    Abstract Variants in BCL11A were previously associated with fetal hemoglobin (HbF) levels among Cameroonian sickle cell disease (SCD) patients, however explaining only ∼2% of the variance. In the same patients, we have investigated the relationship between HbF and two SNPs in a BCL11A erythroid-specific enhancer (N = 626). Minor allele frequencies in rs7606173 and rs1427407 were 0.42 and 0.24, respectively. Both variants were significantly associated with HbF levels (p = 3.11e-08 and p = 6.04e-06, respectively) and explained 8% and 6.2% variations, respectively. These data have confirmed a stronger effect on HbF of genomic variations at the BCL11A erythroid-specific enhancer among patients with SCD in Cameroon, the first report on a West African population. The relevance of these findings is of prime importance because the disruption of this enhancer would alter BCL11A expression in erythroid precursors and thus HbF expression, while sparing the induced functional challenges of any alterations on the expression of this transcription factor in non-erythroid lineages, thus providing an attractive approach for new treatment strategies of SCD. PMID:26393293

  1. Enhancement of erythroid colony growth by triiodothyronine in cell cultures from bone marrow of normal and anemic rats with chronic renal failure.

    PubMed

    Malgor, L A; Valsecia, M E; Verges, E G; de Markowsky, E E

    1995-01-01

    In order to make a contribution in clarifying the role of thyroid hormones on modulation of erythropoiesis and to gain a further insight on the effects of these hormones in the anemia of chronic renal failure (CRF), we studied the action of triiodo-1-thyronine (LT3) and DT3, a dextrorotary non-calorigenic isomer of T3 on late (CFU-E) and early (BFU-E) committed erythroid precursor cells from bone marrow of normal and anemic uremic rats. Cultures were prepared using the methylcellulose technique containing a standard dose (182 mU/ml) of erythropoietin (Ep), LT3 and DT3 in doses of 0.5 and 1.5 micrograms/ml. Thyroid hormones were added to cultures in the absence of Ep. Our results demonstrated that LT3 and DT3 produced a direct and significant stimulation of CFU-E formation and a moderate increase of BFU-E. A dose-correlation was apparent in cultures containing thyroid hormones. DT3 was somewhat less active than LT3. As expected, Ep also produced a significant increase in erythroid colony formation, mainly CFU-E. It is notheworthy that the effects of LT3, DT3 and Ep on erythroid colony growth were significantly higher in marrow cultures from anemic rats with CRF, indicating an increased proliferative cell kinetics of committed erythroid cells in response to these drugs.

  2. Spi-1/PU.1 but not Fli-1 inhibits erythroid-specific alternative splicing of 4.1R pre-mRNA in murine erythroleukemia cells.

    PubMed

    Théoleyre, Orianne; Deguillien, Mireille; Morinière, Madeleine; Starck, Joëlle; Moreau-Gachelin, Françoise; Morlé, François; Baklouti, Faouzi

    2004-01-29

    The inclusion of exon 16 in mature protein 4.1R mRNA arises from a stage-specific splicing event that occurs during late erythroid development. We have shown that mouse erythroleukemia (MEL) cells reproduce this erythroid-specific splicing event upon induction of differentiation. We here found that this splicing event is regulated specifically in erythroleukemic cells that have the potential to differentiate and produce hemoglobin, regardless of the nature of the differentiation inducer. Knowing that dysregulated expression of spi-1/pu.1 and fli-1 oncogenes is involved in MEL cell differentiation arrest, we looked at their effect on exon 16 erythroid splicing. We found that exon 16 inclusion requires Spi-1/PU.1 shutdown in MEL cells, and that enforced expression of Spi-1/PU.1 inhibits exon selection, regardless of the presence or absence of a chemical inducer. By contrast, endogenous overexpression or enforced expression of Fli-1 has no effect on exon selection. We further showed that Spi-1/PU.1 acts similarly on the endogenous and on a transfected exon 16, suggesting a promoter-independent effect of Spi-1/PU.1 on splicing regulation. This study provides the first evidence that Spi-1/PU.1 displays the unique property, not shared with Fli-1, to inhibit erythroid-specific pre-mRNA splicing in erythroleukemia cell context.

  3. In vitro generated Rh(null) red cells recapitulate the in vivo deficiency: a model for rare blood group phenotypes and erythroid membrane disorders.

    PubMed

    Cambot, Marie; Mazurier, Christelle; Canoui-Poitrine, Florence; Hebert, Nicolas; Picot, Julien; Clay, Denis; Picard, Véronique; Ripoche, Pierre; Douay, Luc; Dubart-Kupperschmitt, Anne; Cartron, Jean-Pierre

    2013-05-01

    Lentiviral modification combined with ex vivo erythroid differentiation was used to stably inhibit RhAG expression, a critical component of the Rh(rhesus) membrane complex defective in the Rh(null) syndrome. The cultured red cells generated recapitulate the major alterations of native Rh(null) cells regarding antigen expression, membrane deformability, and gas transport function, providing the proof of principle for their use as model of Rh(null) syndrome and to investigate Rh complex biogenesis in human primary erythroid cells. Using this model, we were able to reveal for the first time that RhAG extinction alone is sufficient to explain ICAM-4 and CD47 loss observed on native Rh(null) RBCs. Together with the effects of RhAG forced expression in Rh(null) progenitors, this strongly strengthens the hypothesis that RhAG is critical to Rh complex formation. The strategy is also promising for diagnosis purpose in order to overcome the supply from rare blood donors and is applicable to other erythroid defects and rare phenotypes, providing models to dissect membrane biogenesis of multicomplex proteins in erythroid cells, with potential clinical applications in transfusion medicine.

  4. Conformal pure radiation with parallel rays

    NASA Astrophysics Data System (ADS)

    Leistner, Thomas; Nurowski, Paweł

    2012-03-01

    We define pure radiation metrics with parallel rays to be n-dimensional pseudo-Riemannian metrics that admit a parallel null line bundle K and whose Ricci tensor vanishes on vectors that are orthogonal to K. We give necessary conditions in terms of the Weyl, Cotton and Bach tensors for a pseudo-Riemannian metric to be conformal to a pure radiation metric with parallel rays. Then, we derive conditions in terms of the tractor calculus that are equivalent to the existence of a pure radiation metric with parallel rays in a conformal class. We also give analogous results for n-dimensional pseudo-Riemannian pp-waves.

  5. Antioxidants for Healthy Skin: The Emerging Role of Aryl Hydrocarbon Receptors and Nuclear Factor-Erythroid 2-Related Factor-2

    PubMed Central

    Furue, Masutaka; Uchi, Hiroshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Chiba, Takahito; Ito, Takamichi; Nakahara, Takeshi; Tsuji, Gaku

    2017-01-01

    Skin is the outermost part of the body and is, thus, inevitably exposed to UV rays and environmental pollutants. Oxidative stress by these hazardous factors accelerates skin aging and induces skin inflammation and carcinogenesis. Aryl hydrocarbon receptors (AHRs) are chemical sensors that are abundantly expressed in epidermal keratinocytes and mediate the production of reactive oxygen species. To neutralize or minimize oxidative stress, the keratinocytes also express nuclear factor-erythroid 2-related factor-2 (NRF2), which is a master switch for antioxidant signaling. Notably, there is fine-tuned crosstalk between AHR and NRF2, which mutually increase or decrease their activation states. Many NRF2-mediated antioxidant phytochemicals are capable of up- and downmodulating AHR signaling. The precise mechanisms by which these phytochemicals differentially affect the AHR and NRF2 system remain largely unknown and warrant future investigation. PMID:28273792

  6. Defective erythroid differentiation in miR-451 mutant mice mediated by 14-3-3ζ

    PubMed Central

    Patrick, David M.; Zhang, Cheng C.; Tao, Ye; Yao, Huiyu; Qi, Xiaoxia; Schwartz, Robert J.; Jun-Shen Huang, Lily; Olson, Eric N.

    2010-01-01

    Erythrocyte formation occurs throughout life in response to cytokine signaling. We show that microRNA-451 (miR-451) regulates erythropoiesis in vivo. Mice lacking miR-451 display a reduction in hematrocrit, an erythroid differentiation defect, and ineffective erythropoiesis in response to oxidative stress. 14-3-3ζ, an intracellular regulator of cytokine signaling that is repressed by miR-451, is up-regulated in miR-451−/− erythroblasts, and inhibition of 14-3-3ζ rescues their differentiation defect. These findings reveal an essential role of 14-3-3ζ as a mediator of the proerythroid differentiation actions of miR-451, and highlight the therapeutic potential of miR-451 inhibitors. PMID:20679397

  7. Antioxidants for Healthy Skin: The Emerging Role of Aryl Hydrocarbon Receptors and Nuclear Factor-Erythroid 2-Related Factor-2.

    PubMed

    Furue, Masutaka; Uchi, Hiroshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Chiba, Takahito; Ito, Takamichi; Nakahara, Takeshi; Tsuji, Gaku

    2017-03-03

    Skin is the outermost part of the body and is, thus, inevitably exposed to UV rays and environmental pollutants. Oxidative stress by these hazardous factors accelerates skin aging and induces skin inflammation and carcinogenesis. Aryl hydrocarbon receptors (AHRs) are chemical sensors that are abundantly expressed in epidermal keratinocytes and mediate the production of reactive oxygen species. To neutralize or minimize oxidative stress, the keratinocytes also express nuclear factor-erythroid 2-related factor-2 (NRF2), which is a master switch for antioxidant signaling. Notably, there is fine-tuned crosstalk between AHR and NRF2, which mutually increase or decrease their activation states. Many NRF2-mediated antioxidant phytochemicals are capable of up- and downmodulating AHR signaling. The precise mechanisms by which these phytochemicals differentially affect the AHR and NRF2 system remain largely unknown and warrant future investigation.

  8. JAK2 V617F stimulates proliferation of erythropoietin-dependent erythroid progenitors and delays their differentiation by activating Stat1 and other nonerythroid signaling pathways.

    PubMed

    Shi, Jiahai; Yuan, Bingbing; Hu, Wenqian; Lodish, Harvey

    2016-11-01

    JAK2 V617F is a mutant-activated JAK2 kinase found in most polycythemia vera (PV) patients; it skews normal proliferation and differentiation of hematopoietic stem and progenitor cells and simulates aberrant expansion of erythroid progenitors. JAK2 V617F is known to activate some signaling pathways not normally activated in mature erythroblasts, but there has been no systematic study of signal transduction pathways or gene expression in erythroid cells expressing JAK2 V617F undergoing erythropoietin (Epo)-dependent terminal differentiation. Here we report that expression of JAK2 V617F in murine fetal liver Epo-dependent progenitors allows them to divide approximately six rather than the normal approximately four times in the presence of Epo, delaying their exit from the cell cycle. Over time, the number of red cells formed from each Epo-dependent progenitor increases fourfold, and these cells eventually differentiate into normal enucleated reticulocytes. We report that purified fetal liver Epo-dependent progenitors express many cytokine receptors additional to the EpoR. Expression of JAK2 V617F triggers activation of Stat5, the only STAT normally activated by Epo, as well as activation of Stat1 and Stat3. Expression of JAK2 V617F also leads to transient induction of many genes not normally activated in terminally differentiating erythroid cells and that are characteristic of other hematopoietic lineages. Inhibition of Stat1 activation blocks JAK2 V617F hyperproliferation of erythroid progenitors, and we conclude that Stat1-mediated activation of nonerythroid signaling pathways delays terminal erythroid differentiation and permits extended cell divisions.

  9. [Acquired pure red cell aplasia associated with relapsed non-Hodgkin's lymphoma: a case report-improvement of PRCA after acute hepatitis].

    PubMed

    Kuramoto, K; Oda, K; Katsutani, S; Fujii, T; Abe, K; Imamura, N; Kimura, A

    1998-04-01

    A 47-year-old male patient was admitted because of anemia. He had been diagnosed as non-Hodgkin's lymphoma (Follicular mixed, B cell type, stage ISA) by splenectomy two years before. Bone marrow examination on admission revealed lymphoma cell infiltration and marked decrease in erythroid cells. These findings confirmed relapsed lymphoma with acquired pure red cell aplasia. After several courses of combination chemotherapy, lymphoma cells disappeared from bone marrow, but PRCA was not improved. In this case there were two times remission of PRCA. At first time, acute B type hepatitis occurred during the chemotherapy, anemia improved transiently. At the second time, mild acute hepatitis associated with herpes zoster occurred. Twenty days after hepatic injury, PRCA was improved, and continued in remission state till present day. To disclose the mechanism of PRCA in this case, erythroid colony assay of marrow cells was performed. This showed the presence of inhibitory factor in patient's serum at PRCA state, that was considered to be related to the occurrence of PRCA. These findings suggest that the improvement of PRCA was associated with the changes on immunological condition after acute hepatitis in this case.

  10. Making Pure Fine-Grained Inorganic Powder

    NASA Technical Reports Server (NTRS)

    Wood, C.

    1985-01-01

    Sustained arc plasma chemical reactor fabricates very-fine-grained inorganic solids having low thermal conductivity. Powder fabrication method, based on plasma tube technique produces pure solids without contamination commonly produced by grinding.

  11. Quantifying the coherence of pure quantum states

    NASA Astrophysics Data System (ADS)

    Chen, Jianxin; Grogan, Shane; Johnston, Nathaniel; Li, Chi-Kwong; Plosker, Sarah

    2016-10-01

    In recent years, several measures have been proposed for characterizing the coherence of a given quantum state. We derive several results that illuminate how these measures behave when restricted to pure states. Notably, we present an explicit characterization of the closest incoherent state to a given pure state under the trace distance measure of coherence. We then use this result to show that the states maximizing the trace distance of coherence are exactly the maximally coherent states. We define the trace distance of entanglement and show that it coincides with the trace distance of coherence for pure states. Finally, we give an alternate proof to a recent result that the ℓ1 measure of coherence of a pure state is never smaller than its relative entropy of coherence.

  12. Human Erythroid 5-Aminolevulinate Synthase Mutations Associated with X-Linked Protoporphyria Disrupt Conformational Equilibrium and Enhance Product Release†

    PubMed Central

    Fratz, Erica J.; Clayton, Jerome; Hunter, Gregory A.; Ducamp, Sarah; Breydo, Leonid; Uversky, Vladimir N.; Deybach, Jean-Charles; Gouya, Laurent; Puy, Hervé; Ferreira, Gloria C.

    2015-01-01

    Regulation of 5-aminolevulinate synthase (ALAS) is at the origin of balanced heme production in mammals. Mutations in the C-terminal region of human erythroid-specific ALAS (hALAS2) are associated with X-linked protoporphyria (XLPP), a disease characterized by extreme photosensitivity, with elevated blood concentrations of free protoporphyrin IX and zinc protoporphyrin. To investigate the molecular basis for this disease, recombinant hALAS2 and variants of the enzyme harboring the gain-of-function XLPP mutations were constructed, purified, and analyzed kinetically, spectroscopically and thermodynamically. Enhanced activities of the XLPP variants resulted from accelerations in the rate at which the product 5-aminolevulinate (ALA) was released from the enzyme. Circular dichroism spectroscopy revealed that the XLPP mutations altered the microenvironment of the pyridoxal 5’-phosphate cofactor, which underwent further and specific alterations upon succinyl-CoA binding. Transient kinetic analyses of the variant-catalyzed reactions and protein fluorescence quenching upon ALA binding to the XLPP variants demonstrated that the protein conformational transition step associated with product release was predominantly affected. Of relevance, XLPP could also be modeled in cell culture. We propose that 1) the XLPP mutations destabilize the succinyl-CoA-induced hALAS2 closed conformation and thus accelerate ALA release, 2) the extended C-terminus of wild-type mammalian ALAS2 provides a regulatory role that allows for allosteric modulation of activity, thereby controlling the rate of erythroid heme biosynthesis, and 3) this control is disrupted in XLPP, resulting in porphyrin accumulation. PMID:26300302

  13. Cloning, expression, and characterization of a novel guanylate-binding protein, GBP3 in murine erythroid progenitor cells.

    PubMed

    Han, B H; Park, D J; Lim, R W; Im, J H; Kim, H D

    1998-05-19

    We report the molecular cloning of a novel guanylate-binding protein (GBP), termed mouse GBP3 (mGBP3) in Friend virus-induced mouse erythroid progenitor (FVA) cells. The 71-kDa mGBP3 belongs to a family of known GBPs that contain the first two consensus motifs, GXXXXGK(S/T) and DXXG, but lack the third element, (N/T)KXD, found in typical GTP-binding proteins. Recombinant mGBP3 protein, expressed using a baculovirus expression system, binds to agarose-immobilized guanine nucleotides (GTP, GDP and GMP). Moreover, mGBP3 has been found to have an intrinsic GTPase activity with K(m) and Vmax values of 77 +/- 4 microM and 21 +/- 0.5 pmol min-1 microgram-1 of protein, respectively. The mGBP3 is distinct from the other GBPs, in that it does not have an isoprenylation/methylation motif CAAX at the carboxyl terminus. The mGBP3 appears to be localized in the cytosol based on immunofluorescence staining. Although the mGBP3 transcript is expressed to a varying degree in numerous mouse tissues, the message is most abundant in FVA cells. The mGBP3 transcript increases in FVA cells undergoing differentiation to a maximum within a few hours and then decreases to an undetectable level by 24 h. These results, taken together, suggest that mGBP3 is a novel member of a family of guanylate-binding proteins, which plays a role in the erythroid differentiation. The nucleotide sequence reported in this paper has been submitted to the GenBank with accession number U44731.

  14. The thyroid hormone receptor functions as a ligand-operated developmental switch between proliferation and differentiation of erythroid progenitors.

    PubMed Central

    Bauer, A; Mikulits, W; Lagger, G; Stengl, G; Brosch, G; Beug, H

    1998-01-01

    The avian erythroblastosis virus (AEV) oncoprotein v-ErbA represents a mutated, oncogenic thyroid hormone receptor alpha (c-ErbA/ TRalpha). v-ErbA cooperates with the stem cell factor-activated, endogenous receptor tyrosine kinase c-Kit to induce self-renewal and to arrest differentiation of primary avian erythroblasts, the AEV transformation target cells. In this cooperation, v-ErbA substitutes for endogenous steroid hormone receptor function required for sustained proliferation of non-transformed erythroid progenitors. In this paper, we propose a novel concept of how v-ErbA transforms erythroblasts. Using culture media strictly depleted from thyroid hormone (T3) and retinoids, the ligands for c-ErbA/TRalpha and its co-receptor RXR, we show that overexpressed, unliganded c-ErbA/ TRalpha closely resembles v-ErbA in its activity on primary erythroblasts. In cooperation with ligand-activated c-Kit, c-ErbA/ TRalpha causes steroid-independent, long-term proliferation and tightly blocks differentiation. Activation of c-ErbA/ TRalpha by physiological T3 levels causes the loss of self-renewal capacity and induces synchronous, terminal differentiation under otherwise identical conditions. This T3-induced switch in erythroid progenitor development is correlated with a decrease of c-ErbA-associated histone deacetylase activity. Our results suggest that the crucial role of the mutations activating v-erbA as an oncogene is to 'freeze' c-ErbA/ TRalpha in its non-liganded, repressive conformation and to facilitate its overexpression. PMID:9687498

  15. Complete genomic organization of the human erythroid p55 gene (MPP1), a membrane-associated guanylate kinase homologue

    SciTech Connect

    Kim, A.C.; Metzenberg, A.B.; Sahr, K.E.

    1996-01-15

    Human p55 is an abundantly palmitoylated phosphoprotein of the erythroid membrane. It is the prototype of a newly discovered family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologues). The MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. Here, we report the complete intron-exon map of the human erythroid p55 gene (HGMW-approved symbol MPP1). The structure of the p55 gene was determined from cosmid clones isolated from a cosmid library specific for the human X chromosome. There is a single copy of the p55 gene, composed of 12 exons and spanning approximately 28 kb in the q28 region of the human X chromosome. The exon sizes range from 69 (exon 5) to 203 bp (intron 2) to {approximately}14 kb (intron 1). The intron-exon boundaries conform to the donor/acceptor consensus sequence, GT-AG, for splice junctions. Several of the exon boundaries correspond to the boundaries of functional domains in the p55 protein. These domains include a SH3 motif and a region that binds to cytoskeletal protein 4.1. In addition, a comparison of the genomic and the primary structures of p55 reveals a highly conserved phosphotyrosine domain located between the protein 4.1 binding domain and the guanylate kinase domain. Finally, promoter activity measurements of the region immediately upstream of the p55 gene, which contains several cis-elements commonly found in housekeeping genes, suggest that a CpG island may be associated with the p55 gene expression in vivo. 42 refs., 5 figs., 1 tab.

  16. H-Ferritin Is Preferentially Incorporated by Human Erythroid Cells through Transferrin Receptor 1 in a Threshold-Dependent Manner

    PubMed Central

    Sakamoto, Soichiro; Kawabata, Hiroshi; Masuda, Taro; Uchiyama, Tatsuki; Mizumoto, Chisaki; Ohmori, Katsuyuki; Koeffler, H. Phillip; Kadowaki, Norimitsu; Takaori-Kondo, Akifumi

    2015-01-01

    Ferritin is an iron-storage protein composed of different ratios of 24 light (L) and heavy (H) subunits. The serum level of ferritin is a clinical marker of the body’s iron level. Transferrin receptor (TFR)1 is the receptor not only for transferrin but also for H-ferritin, but how it binds two different ligands and the blood cell types that preferentially incorporate H-ferritin remain unknown. To address these questions, we investigated hematopoietic cell-specific ferritin uptake by flow cytometry. Alexa Fluor 488-labeled H-ferritin was preferentially incorporated by erythroid cells among various hematopoietic cell lines examined, and was almost exclusively incorporated by bone marrow erythroblasts among human primary hematopoietic cells of various lineages. H-ferritin uptake by erythroid cells was strongly inhibited by unlabeled H-ferritin but was only partially inhibited by a large excess of holo-transferrin. On the other hand, internalization of labeled holo-transferrin by these cells was not inhibited by H-ferritin. Chinese hamster ovary cells lacking functional endogenous TFR1 but expressing human TFR1 with a mutated RGD sequence, which is required for transferrin binding, efficiently incorporated H-ferritin, indicating that TFR1 has distinct binding sites for H-ferritin and holo-transferrin. H-ferritin uptake by these cells required a threshold level of cell surface TFR1 expression, whereas there was no threshold for holo-transferrin uptake. The requirement for a threshold level of TFR1 expression can explain why among primary human hematopoietic cells, only erythroblasts efficiently take up H-ferritin. PMID:26441243

  17. Dark fermentation on biohydrogen production: Pure culture.

    PubMed

    Lee, Duu-Jong; Show, Kuan-Yeow; Su, Ay

    2011-09-01

    Biohydrogen is regarded as an attractive future clean energy carrier due to its high energy content and environmental-friendly conversion. While biohydrogen production is still in the early stage of development, there have been a variety of laboratory- and pilot-scale systems developed with promising potential. This work presents a review of literature reports on the pure hydrogen-producers under anaerobic environment. Challenges and perspective of biohydrogen production with pure cultures are also outlined.

  18. Diphenylhydantoin-induced pure red cell aplasia.

    PubMed

    Rusia, Usha; Malhotra, Purnima; Joshi, Panul

    2006-01-01

    Pure red cell aplasia is an uncommon complication of diphenylhydantoin therapy. It has not been reported in Indian literature. Awareness of the entity helps in establishing the cause of anaemia in these patients and alerts the physicians to the need of comprehensive haematological monitoring in these patients. A case of 58-year-old male who developed pure red cell aplasia following three months of diphenylhydantoin therapy is reported here.

  19. Purely extradural spinal nerve root hemangioblastomas

    PubMed Central

    Aytar, Murat Hamit; Yener, Ulaş; Ekşi, Murat Şakir; Kaya, Behram; Özgen, Serdar; Sav, Aydin; Alanay, Ahmet

    2016-01-01

    Spinal nerve root hemangioblastomas present mostly as intradural-extradurally. Purely extradural spinal nerve root hemangioblastoma is a very rare entity. In this study, we aimed to analyze epidemiological perspectives of purely extradural spinal nerve root hemangioblastomas presented in English medical literature in addition to our own exemplary case. PubMed/MEDLINE was searched using the terms “hemangioblastoma,” “extradural,” “spinal,” and “nerve root.” Demographical variables of age, gender, concomitant presence of von Hippel–Lindau (VHL) disease; spinal imaging and/or intraoperative findings for tumor location were surveyed from retrieved articles. There are 38 patients with purely extradural spinal nerve root hemangioblastoma. The median age is 45 years (range = 24–72 years). Female:male ratio is 0.6. Spinal levels for purely extradural spinal nerve root hemangioblastomas, in order of decreasing frequency, are thoracic (48.6%), cervical (13.5%), lumbar (13.5%), lumbosacral (10.8%), sacral (8.1%), and thoracolumbar (5.4%). Concomitant presence of VHL disease is 45%. Purely extradural spinal nerve root hemangioblastomas are very rare and can be confused with other more common extradural spinal cord tumors. Concomitant presence of VHL disease is observed in less than half of the patients with purely extradural spinal nerve root hemangioblastomas. Surgery is the first-line treatment in these tumors. PMID:27891027

  20. Pure laparoscopic hepatectomy combined with a pure laparoscopic pringle maneuver in patients with severe cirrhosis.

    PubMed

    Miyagi, Shigehito; Nakanishi, Chikashi; Kawagishi, Naoki; Kamei, Takashi; Satomi, Susumu; Ohuchi, Noriaki

    2015-01-01

    Laparoscopic hepatectomy is a standard surgical procedure. However, it is difficult to perform in patients with severe cirrhosis because of fibrosis and a high risk of hemorrhage. We report our recent experience in five cases of pure laparoscopic hepatectomy combined with a pure laparoscopic Pringle maneuver in patients with severe cirrhosis. From 2012 to 2014, we performed pure laparoscopic partial hepatectomy in five patients with severe liver cirrhosis (indocyanine green retention rate at 15 min [ICG R15] >30% and fibrosis stage f4). A pure laparoscopic Pringle maneuver was employed in all patients. We investigated operative time, blood loss, duration of hospitalization and the days when discharge was possible, and compared these findings with those of patients with a normal liver (ICG R15 <10%, f0) who underwent pure laparoscopic partial hepatectomy during the same period (n = 7). As a result, operative time, blood loss, duration of hospitalization and the days when discharge was possible were similar in patients with cirrhosis undergoing pure laparoscopic hepatectomy combined with a pure laparoscopic Pringle maneuver to those in patients with a normal liver undergoing pure laparoscopic partial hepatectomy. In conclusion, pure laparoscopic hepatectomy combined with a pure laparoscopic Pringle maneuver appears to be safe in patients with severe cirrhosis.

  1. Nokia PureView oversampling technology

    NASA Astrophysics Data System (ADS)

    Vuori, Tero; Alakarhu, Juha; Salmelin, Eero; Partinen, Ari

    2013-03-01

    This paper describes Nokia's PureView oversampling imaging technology as well as the product, Nokia 808 PureView, featuring it. The Nokia PureView imaging technology is the combination of a large, super high resolution 41Mpix with high performance Carl Zeiss optics. Large sensor enables a pixel oversampling technique that reduces an image taken at full resolution into a lower resolution picture, thus achieving higher definition and light sensitivity. One oversampled super pixel in image file is formed by using many sensor pixels. A large sensor enables also a lossless zoom. If a user wants to use the lossless zoom, the sensor image is cropped. However, up-scaling is not needed as in traditional digital zooming usually used in mobile devices. Lossless zooming means image quality that does not have the digital zooming artifacts as well as no optical zooming artifacts like zoom lens system distortions. Zooming with PureView is also completely silent. PureView imaging technology is the result of many years of research and development and the tangible fruits of this work are exceptional image quality, lossless zoom, and superior low light performance.

  2. cAMP and in vivo hypoxia induce tob, ifr1, and fos expression in erythroid cells of the chick embryo.

    PubMed

    Dragon, Stefanie; Offenhäuser, Nina; Baumann, Rosemarie

    2002-04-01

    During avian embryonic development, terminal erythroid differentiation occurs in the circulation. Some of the key events, such as the induction of erythroid 2,3-bisphosphoglycerate (2,3-BPG), carbonic anhydrase (CAII), and pyrimidine 5'-nucleotidase (P5N) synthesis are oxygen dependent (Baumann R, Haller EA, Schöning U, and Weber M, Dev Biol 116: 548-551, 1986; Dragon S and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 280: R870-R878, 2001; Dragon S, Carey C, Martin K, and Baumann R, J Exp Biol 202: 2787-2795, 1999; Dragon S, Glombitza S, Götz R, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996; Dragon S, Hille R, Götz R, and Baumann R, Blood 91: 3052-3058, 1998; Million D, Zillner P, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 261: R1188-R1196, 1991) in an indirect way: hypoxia stimulates the release of norepinephrine (NE)/adenosine into the circulation (Dragon et al., J Exp Biol 202: 2787-2795, 1999; Dragon et al., Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996). This leads via erythroid beta-adrenergic/adenosine A(2) receptor activation to a cAMP signal inducing several proteins in a transcription-dependent manner (Dragon et al., Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996; Dragon et al., Blood 91: 3052-3058, 1998; Glombitza S, Dragon S, Berghammer M, Pannermayr M, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 271: R973-R981, 1996). To understand how the cAMP-dependent processes are initiated, we screened an erythroid cDNA library for cAMP-regulated genes. We detected three genes that were strongly upregulated (>5-fold) by cAMP in definitive and primitive red blood cells. They are homologous to the mammalian Tob, Ifr1, and Fos proteins. In addition, the genes are induced in the intact embryo during short-term hypoxia. Because the genes are regulators of proliferation and differentiation in other cell types, we suggest that c

  3. Primary Sjögren syndrome presenting with hemolytic anemia and pure red cell aplasia following delivery due to Coombs-negative autoimmune hemolytic anemia and hemophagocytosis.

    PubMed

    Komaru, Yohei; Higuchi, Takakazu; Koyamada, Ryosuke; Haji, Youichiro; Okada, Masato; Kamesaki, Toyomi; Okada, Sadamu

    2013-01-01

    A 36-year-old woman presented with hemolytic anemia without a reticulocyte response 38 days after delivery. A marked reduction in erythroid cells and an increase in macrophages with active hemophagocytosis were noted in the bone marrow. While conventional Coombs' tests were negative, the level of red blood cell (RBC)-bound immunoglobulin G (IgG) was increased. The patient was diagnosed with primary Sjögren syndrome (pSS) based on her symptoms, positive anti-SS-A antibodies, Coombs-negative autoimmune hemolytic anemia and pure red cell aplasia associated with RBC-bound IgG and hemophagocytosis. The unique presentation was considered to be a consequence of immunological derangement associated with pSS, pregnancy and delivery.

  4. Pure neuritic leprosy: Current status and relevance.

    PubMed

    Rao, P Narasimha; Suneetha, Sujai

    2016-01-01

    Pure neuritic leprosy has always been an enigma due to its clinical and management ambiguities. Although only the Indian Association of Leprologist's classification recognizes 'pure neuritic leprosy' as a distinct sub group of leprosy, cases nonetheless are reported from various countries of Asia, Africa, South America and Europe, indicating its global relevance. It is important to maintain pure neuritic leprosy as a subgroup as it constitutes a good percentage of leprosy cases reported from India, which contributes to more than half of global leprosy numbers. Unfortunately, a high proportion of these patients present with Grade 2 disability at the time of initial reporting itself due to the early nerve involvement. Although skin lesions are absent by definition, when skin biopsies were performed from the skin along the distribution of the affected nerve, a proportion of patients demonstrated leprosy pathology, revealing sub-clinical skin involvement. In addition on follow-up, skin lesions are noted to develop in up to 20% of pure neuritic leprosy cases, indicating its progression to manifest cutaneous disease. Over the decades, the confirmation of diagnosis of pure neuritic leprosy has been subjective, however, with the arrival and use of high-resolution ultrasonography (HRUS) for nerve imaging, we have a tool not only to objectively measure and record the nerve thickening but also to assess the morphological alterations in the nerve including echo texture, fascicular pattern and vascularity. Management of pure neuritic leprosy requires multidrug therapy along with appropriate dose of systemic corticosteroids, for both acute and silent neuritis. Measures for pain relief, self-care of limbs and physiotherapy are important to prevent as well as manage disabilities in this group of patients.

  5. BRST and the pure spinor formalism

    SciTech Connect

    Garcia, J. Antonio

    2008-03-06

    The aim of this talk is to show the relation between the standard BRST approach of the GS superstring with the quantization technics used in the pure spinor approach to superstring. To that end we will use the Batalin-Fradkin-Tyutin (BFT) conversion program of second class constraints to first class constraints in the GS superstring using light cone coordinates. By applying this systematic procedure we were able to obtain a gauge system that is equivalent to the recent model proposed in [1] to relate the GS superstring to the pure spinor formalism.

  6. Pure Apraxia of Speech - A Case Report -

    PubMed Central

    Kang, Young Ae; Yun, Sang Jin

    2011-01-01

    Apraxia of speech (AOS) is the impairment of motor programming. However, the exact nature of this deficit remains unclear. In particular, AOS without other speech-language deficit is called pure AOS, but it is very rare. When diagnosing AOS, the characteristic of articulation is considered a crucial criterion, which has been proposed for differentiating AOS from phonological and dysarthric disorders. The present study reports on pure AOS in a 37-year-old right-handed male after a left insular, front, temporal infarction. This report may be useful for further AOS study and diagnosis in the clinical setting. PMID:22506197

  7. Minimal covariant observables identifying all pure states

    NASA Astrophysics Data System (ADS)

    Carmeli, Claudio; Heinosaari, Teiko; Toigo, Alessandro

    2013-09-01

    It has been recently shown by Heinosaari, Mazzarella and Wolf (2013) [1] that an observable that identifies all pure states of a d-dimensional quantum system has minimally 4d-4 outcomes or slightly less (the exact number depending on d). However, no simple construction of this type of minimal observable is known. We investigate covariant observables that identify all pure states and have minimal number of outcomes. It is shown that the existence of this kind of observables depends on the dimension of the Hilbert space.

  8. Biogenesis of the avian erythroid membrane skeleton: receptor-mediated assembly and stabilization of ankyrin (goblin) and spectrin.

    PubMed

    Moon, R T; Lazarides, E

    1984-05-01

    Ankyrin is an extrinsic membrane protein in human erythrocytes that links the alpha beta-spectrin-based extrinsic membrane skeleton to the membrane by binding simultaneously to the beta-spectrin subunit and to the transmembrane anion transporter. To analyse the temporal and spatial regulation of assembly of this membrane skeleton, we investigated the kinetics of synthesis and assembly of ankyrin ( goblin ) with respect to those of spectrin in chicken embryo erythroid cells. Electrophoretic analysis of Triton X-100 soluble and cytoskeletal fractions show that at steady state both ankyrin and spectrin are detected exclusively in the cytoskeleton. In contrast, continuous labeling of erythroid cells with [35S]methionine, and immunoprecipitation of ankyrin and alpha- and beta-spectrin, reveals that newly synthesized ankyrin and spectrin are partitioned into both the cytoskeletal and Triton X-100 soluble fractions. The soluble pools of ankyrin and beta-spectrin reach a plateau of labeling within 1 h, whereas the soluble pool of alpha-spectrin is substantially larger and reaches a plateau more slowly, reflecting an approximately 3:1 ratio of synthesis of alpha- to beta-spectrin. Ankyrin and beta-spectrin enter the cytoskeletal fraction within 10 min of labeling, and the amount assembled into the cytoskeletal fraction exceeds the amount present in their respective soluble pools within 1 h of labeling. Although alpha-spectrin enters the cytoskeletal fraction with similar kinetics to beta-spectrin and ankyrin, and in amounts equimolar to beta-spectrin, the amount of cytoskeletal alpha-spectrin does not exceed the amount of soluble alpha-spectrin even after 3 h of labeling. Pulse-chase labeling experiments reveal that ankyrin and alpha- and beta-spectrin assembled into the cytoskeleton exhibit no detectable turnover, whereas the Triton X-100 soluble polypeptides are rapidly catabolized, suggesting that stable assembly of the three polypeptides is dependent upon their

  9. Pure word deafness and pure anarthria in a patient with frontotemporal dementia.

    PubMed

    Iizuka, O; Suzuki, K; Endo, K; Fujii, T; Mori, E

    2007-04-01

    A 66-year-old right-handed man developed pure anarthria following pure word deafness. In addition to language disorders, his behavior gradually changed and finally included violence against his wife. Brain magnetic resonance imagings revealed atrophy of the left perisylvian area, which included the inferior half of the precentral gyrus and the upper portion of the superior temporal gyrus, consistent with frontotemporal dementia (FTD). It has been documented as either a disorder of expressive language or as an impaired understanding of word meaning. Unlike with pure anarthria, pure word deafness is not included in the clinical diagnostic current criteria for FTD. However, a large variety of language symptoms can appear in FTD according to the distribution of pathological changes in the frontotemporal cortices. This case suggests that pure word deafness could be a prodomal symptom of FTD.

  10. Pediatric red cell disorders and pure red cell aplasia.

    PubMed

    Perkins, Sherrie L

    2004-12-01

    Anemia in children may arise from a wide variety of pathogenetic mechanisms that include congenital and acquired disorders. Often the diagnostic considerations include disorders that are not seen commonly in adults and lifelong disorders that arise in children and persist throughout life. Consideration of diverse causes of anemia such as red cell membrane disorders, red cell enzymopathies, congenital dyserythropoietic anemias, congenital sideroblastic anemias, and hereditary pure red cell aplasia (Diamond-Blackfan anemia), as well as infectious causes such as parvovirus B19 infection, often is required when diagnosing anemia in an infant or young child. Knowledge of these entities that are important causes of anemia in the pediatric population, including clinical manifestations and laboratory workup, will aid in recognition of the specific disease entities and effective workup of pediatric red cell disorders.

  11. Pure science and the problem of progress.

    PubMed

    Douglas, Heather

    2014-06-01

    How should we understand scientific progress? Kuhn famously discussed science as its own internally driven venture, structured by paradigms. He also famously had a problem describing progress in science, as problem-solving ability failed to provide a clear rubric across paradigm change--paradigm changes tossed out problems as well as solving them. I argue here that much of Kuhn's inability to articulate a clear view of scientific progress stems from his focus on pure science and a neglect of applied science. I trace the history of the distinction between pure and applied science, showing how the distinction came about, the rhetorical uses to which the distinction has been put, and how pure science came to be both more valued by scientists and philosophers. I argue that the distinction between pure and applied science does not stand up to philosophical scrutiny, and that once we relinquish it, we can provide Kuhn with a clear sense of scientific progress. It is not one, though, that will ultimately prove acceptable. For that, societal evaluations of scientific work are needed.

  12. Pure Dephasing of a Vibrational Adbond.

    DTIC Science & Technology

    1987-08-01

    that pure dephasing terms Involve only one (real) level of the adbond, and that sIngle-phonon proceses are Impossible. Figure 4. The logarithm of the...Crane, Indiana 47522-5050 China Lake, California 93555 Scientific Advisor Naval Civil Engineering Laboratory 1 Commandant of the Marine Corps Attn: Dr. R

  13. Primary pure choriocarcinoma of the liver.

    PubMed

    Fernández Alonso, J; Sáez, C; Pérez, P; Montaño, A; Japón, M A

    1992-04-01

    We report a pure choriocarcinoma of the liver studied at necropsy. The tumour was diagnosed ante-mortem and treated by chemotherapy with no satisfactory response. Previous cases of hepatic choriocarcinoma are reviewed and criteria to diagnose this extragonadal neoplasm are recommended.

  14. Yttria Nanoparticle Reinforced Commercially Pure (CP) Titanium

    DTIC Science & Technology

    2011-09-01

    nanoparticles as well as titanium boride (TiB) reinforcements were produced through gas atomization. After consolidation and extrusion, room temperature...pure FE iron O oxygen Ti titanium TiB titanium boride TYS tensile yield strength UTS ultimate tensile strength wt% weight percent Y2O3

  15. Purely competitive evolutionary dynamics for games.

    PubMed

    Veller, Carl; Rajpaul, Vinesh

    2012-10-01

    We introduce and analyze a purely competitive dynamics for the evolution of an infinite population subject to a three-strategy game. We argue that this dynamics represents a characterization of how certain systems, both natural and artificial, are governed. In each period, the population is randomly sorted into pairs, which engage in a once-off play of the game; the probability that a member propagates its type to its offspring is proportional only to its payoff within the pair. We show that if a type is dominant (obtains higher payoffs in games with both other types), its "pure" population state, comprising only members of that type, is globally attracting. If there is no dominant type, there is an unstable "mixed" fixed point; the population state eventually oscillates between the three near-pure states. We then allow for mutations, where offspring have a nonzero probability of randomly changing their type. In this case, the existence of a dominant type renders a point near its pure state globally attracting. If no dominant type exists, a supercritical Hopf bifurcation occurs at the unique mixed fixed point, and above a critical (typically low) mutation rate, this fixed point becomes globally attracting: the implication is that even very low mutation rates can stabilize a system that would, in the absence of mutations, be unstable.

  16. Implicit Reading in Chinese Pure Alexia

    ERIC Educational Resources Information Center

    Shan, Chunlei; Zhu, Renjing; Xu, Mingwei; Luo, Benyan; Weng, Xuchu

    2010-01-01

    A number of recent studies have shown that some patients with pure alexia display evidence of implicit access to lexical and semantic information about words that they cannot read explicitly. This phenomenon has not been investigated systematically in Chinese patients. We report here a case study of a Chinese patient who met the criteria for pure…

  17. Predict thermal conductivities of pure gases

    SciTech Connect

    Weber, J.H.

    1981-01-01

    The programs presented for the TI-59 programmable calculator can determine the thermal conductivity of pure gases and gases at low pressures as well as the effect of pressure on conductivity. They are based on correlations by Eucken, Stiel-Thodos, Misic-Thodos, Roy-Thodos, and Redlich-Kwong.

  18. Hydrogen Sulfide Levels and Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) Activity Are Attenuated in the Setting of Critical Limb Ischemia (CLI)

    PubMed Central

    Islam, Kazi N; Polhemus, David J; Donnarumma, Erminia; Brewster, Luke P; Lefer, David J

    2015-01-01

    Background Cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase are endogenous enzymatic sources of hydrogen sulfide (H2S). Functions of H2S are mediated by several targets including ion channels and signaling proteins. Nuclear factor-erythroid 2-related factor 2 is responsible for the expression of antioxidant response element–regulated genes and is known to be upregulated by H2S. We examined the levels of H2S, H2S-producing enzymes, and nuclear factor-erythroid 2-related factor 2 activation status in skeletal muscle obtained from critical limb ischemia (CLI) patients. Methods and Results Gastrocnemius tissues were attained postamputation from human CLI and healthy control patients. We found mRNA and protein levels of cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase were significantly decreased in skeletal muscle of CLI patients as compared to control. H2S and sulfane sulfur levels were significantly decreased in skeletal muscle of CLI patients. We also observed significant reductions in nuclear factor-erythroid 2-related factor 2 activation as well as antioxidant proteins, such as Cu, Zn-superoxide dismutase, catalase, and glutathione peroxidase in skeletal muscle of CLI patients. Biomarkers of oxidative stress, such as malondialdehyde and protein carbonyl formation, were significantly increased in skeletal muscle of CLI patients as compared to healthy controls. Conclusions The data demonstrate that H2S bioavailability and nuclear factor-erythroid 2-related factor 2 activation are both attenuated in CLI tissues concomitant with significantly increased oxidative stress. Reductions in the activity of H2S-producing enzymes may contribute to the pathogenesis of CLI. PMID:25977470

  19. Phorbol ester-treated human acute myeloid leukemia cells secrete G-CSF, GM-CSF and erythroid differentiation factor into serum-free media in primary culture.

    PubMed

    Scher, W; Eto, Y; Ejima, D; Den, T; Svet-Moldavsky, I A

    1990-12-10

    Upon treatment with the phorbol ester, tetradecanoylphorbol 13-acetate (PMA), peripheral mononuclear blood cells from patients with acute myeloid leukemia secrete into serum-free cell-conditioned media (PMA-CCM) at least three distinct nondialysable 'hematopoietic' factors: granulocyte-colony-stimulating factor (G-CSF), granulocyte/macrophage-colony-stimulating factor (GM-CSF) and erythroid differentiation factor (EDF, activin A). G-CSF was identified by its stimulation of [3H]thymidine incorporation into a G-CSF-responsive cell line, NSF-60, and the inhibition of its stimulation by a G-CSF-specific monoclonal antibody (MAB). GM-CSF was identified by its stimulation of [3H]thymidine incorporation into a GM-CSF-responsive line, TALL-101, and the inhibition of its stimulation by a GM-CSF-specific MAB. EDF was identified by its ability to stimulate erythroid differentiation in mouse erythroleukemia cell lines, its identical retention times to those of authentic EDF on three successive reverse-phase HPLC columns and characterization of its penultimate N-terminal residue as leucine which is the same as that of authentic EDF. Both authentic EDF and the erythroid-stimulating activity in PMA-CCM were found to act synergistically with a suboptimal inducing concentration of a well-studied inducing agent, dimethyl sulfoxide, in inducing erythroid differentiation. In addition, a fourth activity was observed in PMA-CCM: normal human fetal bone marrow cell-proliferation stimulating activity (FBMC-PSA). FBMC-PSA was identified by its ability to stimulate the growth of granulocytes and macrophages in FBMC suspension cultures, which neither recombinant G-CSF or GM-CSF were found to do.

  20. Transcription factors Fli1 and EKLF in the differentiation of megakaryocytic and erythroid progenitor in 5q- syndrome and in Diamond-Blackfan anemia.

    PubMed

    Neuwirtova, Radana; Fuchs, Ota; Holicka, Monika; Vostry, Martin; Kostecka, Arnost; Hajkova, Hana; Jonasova, Anna; Cermak, Jaroslav; Cmejla, Radek; Pospisilova, Dagmar; Belickova, Monika; Siskova, Magda; Hochova, Ivana; Vondrakova, Jana; Sponerova, Dana; Kadlckova, Eva; Novakova, Ludmila; Brezinova, Jana; Michalova, Kyra

    2013-01-01

    Friend leukemia virus integration 1 (Fli1) and erythroid Krüppel-like factor (EKLF) participate under experimental conditions in the differentiation of megakaryocytic and erythroid progenitor in cooperation with other transcription factors, cytokines, cytokine receptors, and microRNAs. Defective erythropoiesis with refractory anemia and effective megakaryopoiesis with normal or increased platelet count is typical for 5q- syndrome. We decided to evaluate the roles of EKLF and Fli1 in the pathogenesis of this syndrome and of another ribosomopathy, Diamond-Blackfan anemia (DBA). Fli1 and EKLF mRNA levels were examined in mononuclear blood and bone marrow cells from patients with 5q- syndrome, low-risk MDS patients with normal chromosome 5, DBA patients, and healthy controls. In 5q- syndrome, high Fli1 mRNA levels in the blood and bone marrow mononuclear cells were found. In DBA, Fli1 expression did not differ from the controls. EKLF mRNA level was significantly decreased in the blood and bone marrow of 5q- syndrome and in all DBA patients. We propose that the elevated Fli1 in 5q- syndrome protects megakaryocytic cells from ribosomal stress contrary to erythroid cells and contributes to effective though dysplastic megakaryopoiesis.

  1. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    PubMed

    Chatterjee, Sreoshi; Bhardwaj, Nitin; Saxena, Rajiv K

    2016-01-01

    Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA) in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB) technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS) were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71) monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline). Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  2. Accumulation of gamma-globin mRNA and induction of irreversible erythroid differentiation after treatment of CML cell line K562 with new doxorubicin derivatives.

    PubMed

    Szulawska, Agata; Arkusinska, Justyna; Czyz, Malgorzata

    2007-01-15

    Human chronic myelogenous leukemia (CML) cell line K562 can be chemically induced to differentiate and express embryonic and fetal globin genes. In this study, the effects of doxorubicin (DOX), an inducer of K562 cell erythroid differentiation, with those of epidoxorubicin (EDOX) as well as newly synthesized derivatives of both drugs (DOXM, DOXH, and EDOXM) on cell growth and differentiation were compared. Our results revealed that DOX, EDOX and their derivatives caused irreversible differentiation of K562 cells into more mature hemoglobin-containing cells. This phenomenon was linked to time-dependent inhibition of cell proliferation. Considering the impact of the structure of newly synthesized anthracyclines on their cellular activity, our data clearly indicated that among tested anthracyclines DOXM, a morpholine derivative of DOX exerted the highest antiproliferative and differentiating activity. An increase of gamma-globin mRNA level caused both by high transcription rate and by mRNA stabilization, as well as an enhancement of expression but not activity of erythroid transcription factor GATA-1 were observed. Therefore, a high level of hemoglobin-containing cells in the presence of DOXM resulted from transcriptional and post-transcriptional events on gamma-globin gene regulation. The same morpholine modification introduced to EDOX did not cause, however, similar effects on cellular level. Characterization of new powerful inducers of erythroid differentiation may contribute to the development of novel compounds for pharmacological approach by differentiation therapy to leukemia or to beta-globin disorder, beta-thalassemia.

  3. Structure of the Membrane Proximal Oxioreductase Domain of Human Steap3, the Dominant Ferrireductase of the Erythroid Transferrin Cycle

    SciTech Connect

    Sendamarai, A.K.; Ohgami, R.S.; Fleming, M.D.; Lawrence, C.M.

    2009-05-27

    The daily production of 200 billion erythrocytes requires 20 mg of iron, accounting for nearly 80% of the iron demand in humans. Thus, erythroid precursor cells possess an efficient mechanism for iron uptake in which iron loaded transferrin (Tf) binds to the transferrin receptor (TfR) at the cell surface. The Tf:TfR complex then enters the endosome via receptor-mediated endocytosis. Upon endosomal acidification, iron is released from Tf, reduced to Fe{sup 2+} by Steap3, and transported across the endosomal membrane by divalent metal iron transporter 1. Steap3, the major ferrireductase in erythrocyte endosomes, is a member of a unique family of reductases. Steap3 is comprised of an N-terminal cytosolic oxidoreductase domain and a C-terminal heme-containing transmembrane domain. Cytosolic NADPH and a flavin are predicted cofactors, but the NADPH/flavin binding domain differs significantly from those in other eukaryotic reductases. Instead, Steap3 shows remarkable, although limited homology to FNO, an archaeal oxidoreductase. We have determined the crystal structure of the human Steap3 oxidoreductase domain in the absence and presence of NADPH. The structure reveals an FNO-like domain with an unexpected dimer interface and substrate binding sites that are well positioned to direct electron transfer from the cytosol to a heme moiety predicted to be fixed within the transmembrane domain. Here, we discuss possible gating mechanisms for electron transfer across the endosomal membrane.

  4. The N-terminal zinc finger of the erythroid transcription factor GATA-1 binds GATC motifs in DNA.

    PubMed

    Newton, A; Mackay, J; Crossley, M

    2001-09-21

    The mammalian transcription factor GATA-1 is required for normal erythroid and megakaryocytic development. GATA-1 contains two zinc fingers, the C-terminal finger, which is known to bind (A/T)GATA(A/G) motifs in DNA and the N-finger, which is important for interacting with co-regulatory proteins such as Friend of GATA (FOG). We now show that, like the C-finger, the N-finger of GATA-1 is also capable of binding DNA but recognizes distinct sequences with the core GATC. We demonstrate that the GATA-1 N-finger can bind these sequences in vitro and that in cellular assays, GATA-1 can activate promoters containing GATC motifs. Experiments with mutant GATA-1 proteins confirm the importance of the N-finger, as the C-finger is not required for transactivation from GATC sites. Recently four naturally occurring mutations in GATA-1 have been shown to be associated with familial blood disorders. These mutations all map to the N-finger domain. We have investigated the effect of these mutations on the recognition of GATC sites by the N-finger and show that one mutation R216Q abolishes DNA binding, whereas the others have only minor effects.

  5. Application of high-performance liquid chromatographic methodology to the analysis of hemoglobins synthesized in erythroid progenitor cells.

    PubMed

    Bhaumik, K; Huisman, T H

    1989-11-10

    High-performance liquid chromatography (HPLC) has been successfully used in the quantitation of the relatively minute amounts of hemoglobin types recovered from in vitro cultures of hemoglobin-synthesizing erythroid progenitor (BFU-E) cells. This reversed-phase HPLC method uses the Vydac C4 column and water-acetonitrile-trifluoroacetic acid as mobile phases; it has been applied to the study of fetal hemoglobin synthesis patterns in ten homozygous sickle cell anemia patients and a similar number of their heterozygous relatives along with a few normal control subjects. A significant increase in the total gamma chain level was observed in the BFU-E lysate samples corresponding to the whole blood lysates of all the patients and their heterozygous relatives, except in one patient with the beta S haplotype Mor. On the other hand, the relative level of the G gamma chains appeared to be decreased in the BFU-E lysate samples of all except the individuals carrying the Mor haplotype, where it is reversed. The method has considerable advantages over other chromatographic and electrophoretic procedures; it is extremely sensitive and allows quantitation of all different globin chains in one single chromatogram.

  6. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression.

    PubMed

    Escartin, Carole; Won, Seok Joon; Malgorn, Carole; Auregan, Gwennaelle; Berman, Ari E; Chen, Pei-Chun; Déglon, Nicole; Johnson, Jeffrey A; Suh, Sang Won; Swanson, Raymond A

    2011-05-18

    Astrocytes support neuronal antioxidant capacity by releasing glutathione, which is cleaved to cysteine in brain extracellular space. Free cysteine is then taken up by neurons through excitatory amino acid transporter 3 [EAAT3; also termed Slc1a1 (solute carrier family 1 member 1)] to support de novo glutathione synthesis. Activation of the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant responsive element (ARE) pathway by oxidative stress promotes astrocyte release of glutathione, but it remains unknown how this release is coupled to neuronal glutathione synthesis. Here we evaluated transcriptional regulation of the neuronal cysteine transporter EAAT3 by the Nrf2-ARE pathway. Nrf2 activators and Nrf2 overexpression both produced EAAT3 transcriptional activation in C6 cells. A conserved ARE-related sequence was found in the EAAT3 promoter of several mammalian species. This ARE-related sequence was bound by Nrf2 in mouse neurons in vivo as observed by chromatin immunoprecipitation. Chemical activation of the Nrf2-ARE pathway in mouse brain increased both neuronal EAAT3 levels and neuronal glutathione content, and these effects were abrogated in mice genetically deficient in either Nrf2 or EAAT3. Selective overexpression of Nrf2 in brain neurons by lentiviral gene transfer was sufficient to upregulate both neuronal EAAT3 protein and glutathione content. These findings identify a mechanism whereby Nrf2 activation can coordinate astrocyte glutathione release with neuronal glutathione synthesis through transcriptional upregulation of neuronal EAAT3 expression.

  7. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    SciTech Connect

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  8. Human and Murine Hematopoietic Stem Cell Aging Is Associated with Functional Impairments and Intrinsic Megakaryocytic/Erythroid Bias

    PubMed Central

    Rundberg Nilsson, Alexandra; Soneji, Shamit; Adolfsson, Sofia; Bryder, David; Pronk, Cornelis Jan

    2016-01-01

    Aging within the human hematopoietic system associates with various deficiencies and disease states, including anemia, myeloid neoplasms and reduced adaptive immune responses. Similar phenotypes are observed in mice and have been linked to alterations arising at the hematopoietic stem cell (HSC) level. Such an association is, however, less established in human hematopoiesis and prompted us here to detail characteristics of the most primitive human hematopoietic compartments throughout ontogeny. In addition, we also attempted to interrogate similarities between aging human and murine hematopoiesis. Coupled to the transition from human cord blood (CB) to young and aged bone marrow (BM), we observed a gradual increase in frequency of candidate HSCs. This was accompanied by functional impairments, including decreased lymphoid output and reduced proliferative potential. Downstream of human HSCs, we observed decreasing levels of common lymphoid progenitors (CLPs), and increasing frequencies of megakaryocyte/erythrocyte progenitors (MEPs) with age, which could be linked to changes in lineage-affiliated gene expression patterns in aged human HSCs. These findings were paralleled in mice. Therefore, our data support the notion that age-related changes also in human hematopoiesis involve the HSC pool, with a prominent skewing towards the megakaryocytic/erythroid lineages, and suggests conserved mechanisms underlying aging of the blood cell system. PMID:27368054

  9. Extensive Ex Vivo Expansion of Functional Human Erythroid Precursors Established From Umbilical Cord Blood Cells by Defined Factors

    PubMed Central

    Huang, Xiaosong; Shah, Siddharth; Wang, Jing; Ye, Zhaohui; Dowey, Sarah N; Tsang, Kit Man; Mendelsohn, Laurel G; Kato, Gregory J; Kickler, Thomas S; Cheng, Linzhao

    2014-01-01

    There is a constant shortage of red blood cells (RBCs) from sufficiently matched donors for patients who need chronic transfusion. Ex vivo expansion and maturation of human erythroid precursors (erythroblasts) from the patients or optimally matched donors could represent a potential solution. Proliferating erythroblasts can be expanded from umbilical cord blood mononuclear cells (CB MNCs) ex vivo for 106–107-fold (in ~50 days) before proliferation arrest and reaching sufficient number for broad application. Here, we report that ectopic expression of three genetic factors (Sox2, c-Myc, and an shRNA against TP53 gene) associated with iPSC derivation enables CB-derived erythroblasts to undergo extended expansion (~1068-fold in ~12 months) in a serum-free culture condition without change of cell identity or function. These expanding erythroblasts maintain immature erythroblast phenotypes and morphology, a normal diploid karyotype and dependence on a specific combination of growth factors for proliferation throughout expansion period. When being switched to a terminal differentiation condition, these immortalized erythroblasts gradually exit cell cycle, decrease cell size, accumulate hemoglobin, condense nuclei and eventually give rise to enucleated hemoglobin-containing erythrocytes that can bind and release oxygen. Our result may ultimately lead to an alternative approach to generate unlimited numbers of RBCs for personalized transfusion medicine. PMID:24002691

  10. Reactive Oxygen Species and Nuclear Factor Erythroid 2-Related Factor 2 Activation in Diabetic Nephropathy: A Hidden Target

    PubMed Central

    Abdo, Shaaban; Zhang, Shao-Ling; Chan, John S.D.

    2015-01-01

    Hyperglycemia, oxidative stress and renin-angiotensin system (RAS) dysfunction have been implicated in diabetic nephropathy (DN) progression, but the underlying molecular mechanisms are far from being fully understood. In addition to the systemic RAS, the existence of a local intrarenal RAS in renal proximal tubular cells has been recognized. Angiotensinogen is the sole precursor of all angiotensins (Ang). Intrarenal reactive oxygen species (ROS) generation, Ang II level and RAS gene expression are up-regulated in diabetes, indicating that intrarenal ROS and RAS activation play an important role in DN. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is one of the major protective processes that occurs in response to intracellular oxidative stress. Nrf2 stimulates an array of antioxidant enzymes that convert excessive ROS to less reactive or less damaging forms. Recent studies have, however, revealed that Nrf2 activation might have other undesirable effects in diabetic animals and in diabetic patients with chronic kidney disease. This mini-review summarizes current knowledge of the relationship between ROS, Nrf2 and intra renal RAS activation in DN progression as well as possible novel target(s) for DN treatment. PMID:26213634

  11. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involve the nuclear erythroid 2-related factor 2 pathway

    PubMed Central

    Han, Jing; Xiao, Qing; Lin, Yan-hua; Zheng, Zhen-zhu; He, Zhao-dong; Hu, Juan; Chen, Li-dian

    2015-01-01

    Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg) reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke. PMID:26889188

  12. Therapeutic effect of erythroid differentiation regulator 1 (Erdr1) on collagen-induced arthritis in DBA/1J mouse

    PubMed Central

    Kim, Kyung Eun; Kim, Sungryung; Park, Sunyoung; Houh, Younkyung; Yang, Yoolhee; Park, Seung Beom; Kim, Sangyoon; Kim, Daejin; Hur, Dae Young; Kim, Seonghan

    2016-01-01

    Rheumatoid arthritis (RA) is a chronic inflammatory autoimmune disease, and multiple inflammatory cytokines are involved in RA pathogenesis. Interleukin (IL)-18, in particular, has a significant positive correlation with RA. In this study, we investigated the effect of erythroid differentiation regulator 1 (Erdr1), which is negatively regulated by IL-18, in an animal model of inflammatory arthritis, collagen-induced arthritis (CIA) in DBA/1J mice. Treatment of mice with recombinant (r)Erdr1 significantly suppressed the severity of arthritis, histologic features of arthritic tissue, and serum levels of anti-collagen autoantibodies (IgG, IgG1, IgG2a and IgM) in CIA. In addition, IL-18 expression was reduced in the affected synovium of rErdr1-treated mice. Interestingly, Erdr1 treatment suppressed migration in contrast to the pro-migratory effect of IL-18, indicating the therapeutic effects of Erdr1 on CIA through inhibiting synovial fibroblast migration. In addition, Erdr1 inhibited activation of ERK1/2, a key signaling pathway in migration of various cell types. Taken together, these data show that rErdr1 exerts therapeutic effects on RA by inhibiting synovial fibroblast migration, suggesting that rErdr1 treatment might be an effective therapeutic approach for RA. PMID:27823968

  13. Global Genetic Architecture of an Erythroid Quantitative Trait Locus, HMIP-2

    PubMed Central

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-01-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed “A” and “B.” These typically occurred together (“A–B”) on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for “A” and “B,” we interrogated public population datasets. Haplotypes carrying only “A” or “B” were typical for populations in Sub-Saharan Africa. The “A–B” combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene–environment interaction during human migration and adaptation. PMID:25069958

  14. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture... REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined by applying the respective tolerances to the germination plus the hard seed and the pure seed....

  15. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 3 2013-01-01 2013-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture... REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined by applying the respective tolerances to the germination plus the hard seed and the pure seed....

  16. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture... REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined by applying the respective tolerances to the germination plus the hard seed and the pure seed. [5 FR 35,...

  17. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 3 2014-01-01 2014-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture... REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined by applying the respective tolerances to the germination plus the hard seed and the pure seed....

  18. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture... REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined by applying the respective tolerances to the germination plus the hard seed and the pure seed. [5 FR 35,...

  19. How Pure Components Control Polymer Blend Miscibility

    NASA Astrophysics Data System (ADS)

    White, Ronald; Lipson, Jane; Higgins, Julia

    2012-02-01

    We present insight into some intriguing relationships revealed by our recent studies of polymer mixture miscibility. Applying our simple lattice-based equation of state, we discuss some of the patterns observed over a sample of experimental blends. We focus on the question of how much key information can one determine from a knowledge of just the pure components only, and further, on the role of separate enthalpic and entropic contributions to the miscibility behavior. One interesting correlation connects the value of the difference in pure component energetic parameters with that of the mixed segment interactions, suggesting new possibilities for predictive modeling. We also show how in some cases these two parameter groupings act as separate controls determining the entropy and enthalpy of mixing. Also discussed are the different patterns exhibited for UCST-type and LCST-type blends, these being revealed in some cases by simple examination of the underlying microscopic parameters.

  20. Pure field theories and MACSYMA algorithms

    NASA Technical Reports Server (NTRS)

    Ament, W. S.

    1977-01-01

    A pure field theory attempts to describe physical phenomena through singularity-free solutions of field equations resulting from an action principle. The physics goes into forming the action principle and interpreting specific results. Algorithms for the intervening mathematical steps are sketched. Vacuum general relativity is a pure field theory, serving as model and providing checks for generalizations. The fields of general relativity are the 10 components of a symmetric Riemannian metric tensor; those of the Einstein-Straus generalization are the 16 components of a nonsymmetric. Algebraic properties are exploited in top level MACSYMA commands toward performing some of the algorithms of that generalization. The light cone for the theory as left by Einstein and Straus is found and simplifications of that theory are discussed.

  1. Physics with chemically and isotopically pure semiconductors

    NASA Astrophysics Data System (ADS)

    Haller, E. E.

    1993-05-01

    Chemically and isotopically pure semiconductors offer a wealth of interesting physics. We review a number of impurity complexes which were discovered in ultrapure Germanium. They have led the way to the widely pursued studies of hydrogen in numerous semiconductors. Isotope related effects and processes include neutron transmutation doping, a technique used for a number of silicon and germanium devices. Isotopically pure and deliberately mixed crystals of germanium have been grown recently and have been used to study the dependence of the indirect bandgap and phonon properties on the mass and mass disorder of the nuclei. The large number of stable isotopes of the various semiconductors present a great potential for basic and applied studies. Semi-conductor isotope engineering may become a reality because of the new economic and political world order.

  2. Pure connection action principle for general relativity.

    PubMed

    Krasnov, Kirill

    2011-06-24

    It has already been known for two decades that general relativity can be reformulated as a certain gauge theory, so that the only dynamical field is an SO(3) connection and the spacetime metric appears as a derived object. However, no simple action principle realizing these ideas has been available. A new elegant action principle for such a "pure connection" formulation of GR is described.

  3. Computing Properties Of Pure And Mixed Fluids

    NASA Technical Reports Server (NTRS)

    Fowler, J. R.; Hendricks, Robert C.

    1993-01-01

    GASPLUS created as two-part code: first designed for use with pure fluids and second designed for use with mixtures of fluids and phases. Offers routines for mathematical modeling of conditions of fluids in pumps, turbines, compressors and other machines. Other routines for calculating performance of para/ortho-hydrogen reactor and heat of para/normal-hydrogen reaction as well as unique convergence routine demonstrates engineering flavor of GASPLUS. Written in FORTRAN 77.

  4. On constructing purely affine theories with matter

    NASA Astrophysics Data System (ADS)

    Cervantes-Cota, Jorge L.; Liebscher, D.-E.

    2016-08-01

    We explore ways to obtain the very existence of a space-time metric from an action principle that does not refer to it a priori. Although there are reasons to believe that only a non-local theory can viably achieve this goal, we investigate here local theories that start with Schrödinger's purely affine theory (Schrödinger in Space-time structure. Cambridge UP, Cambridge, 1950), where he gave reasons to set the metric proportional to the Ricci curvature aposteriori. When we leave the context of unified field theory, and we couple the non-gravitational matter using some weak equivalence principle, we can show that the propagation of shock waves does not define a lightcone when the purely affine theory is local and avoids the explicit use of the Ricci tensor in realizing the weak equivalence principle. When the Ricci tensor is substituted for the metric, the equations seem to have only a very limited set of solutions. This backs the conviction that viable purely affine theories have to be non-local.

  5. Graphical calculus for Gaussian pure states

    SciTech Connect

    Menicucci, Nicolas C.; Flammia, Steven T.; Loock, Peter van

    2011-04-15

    We provide a unified graphical calculus for all Gaussian pure states, including graph transformation rules for all local and semilocal Gaussian unitary operations, as well as local quadrature measurements. We then use this graphical calculus to analyze continuous-variable (CV) cluster states, the essential resource for one-way quantum computing with CV systems. Current graphical approaches to CV cluster states are only valid in the unphysical limit of infinite squeezing, and the associated graph transformation rules only apply when the initial and final states are of this form. Our formalism applies to all Gaussian pure states and subsumes these rules in a natural way. In addition, the term 'CV graph state' currently has several inequivalent definitions in use. Using this formalism we provide a single unifying definition that encompasses all of them. We provide many examples of how the formalism may be used in the context of CV cluster states: defining the 'closest' CV cluster state to a given Gaussian pure state and quantifying the error in the approximation due to finite squeezing; analyzing the optimality of certain methods of generating CV cluster states; drawing connections between this graphical formalism and bosonic Hamiltonians with Gaussian ground states, including those useful for CV one-way quantum computing; and deriving a graphical measure of bipartite entanglement for certain classes of CV cluster states. We mention other possible applications of this formalism and conclude with a brief note on fault tolerance in CV one-way quantum computing.

  6. Reflection on Teaching and Epistemological Structure: Reflective and Critically Reflective Processes in "Pure/Soft" and "Pure/Hard" Fields

    ERIC Educational Resources Information Center

    Kreber, Carolin; Castleden, Heather

    2009-01-01

    We empirically explored whether academics from pure/soft and pure/hard fields engage in reflective practice on teaching differently and, if so, whether these differences could be partially explained by the epistemological structure of their discipline. Interview data from academics in pure/hard (N = 30) and pure/soft fields (N = 10) were…

  7. Altered Turnover of Hypoxanthine Phosphoribosyltransferase in Erythroid Cells of Mice Expressing Hprt a and Hprt b Alleles

    PubMed Central

    Johnson, Gerald G.; Chapman, Verne M.

    1987-01-01

    We have previously shown that mice expressing Hprt a allele(s) have erythrocyte hypoxanthine phosphoribosyltransferase (HPRT) levels that are approximately 25-fold (Mus musculus castaneus) and 70-fold ( Mus spretus) higher than in mice that express the Hprt b allele (Mus musculus domesticus; C57BI/6J; C3H/HeHa), and that these differences in erythrocyte HPRT levels are due to differences in the turnover rates of the HPRT A and B proteins as reticulocytes mature to erythrocytes. We show here that: (1) the taxonomic subgroups of the genus Mus are essentially monomorphic for the occurrence of either the Hprt a or the Hprt b allele, with Hprt a being common in the aboriginal species (M. spretus, Mus hortulanus and Mus abbotti) and in several commensal species (Mus musculus musculus, M. m. castaneus, Mus musculus molossinus), while Hprt b is common in feral M. m. domesticus populations as well as in all inbred strains of mice tested; (2) in all these diverse Mus subgroups there is a strict association of Hprt a with high and Hprt b with low levels of erythrocyte HPRT; and, (3) the association between the occurrence of the Hprt a allele and elevated erythrocyte HPRT levels is retained following repeated backcrosses of wild-derived Hprt a allele(s) into the genetic background of inbred strains of mice with the Hprt b allele. Collectively, these observations indicate that the elevated and low levels of erythrocyte HPRT are specified by differences in the Hprt a and b structural genes. Since evidence indicates that Hprt a and b encode HPRT proteins which differ in primary structure, we infer that the structure of HPRT is an important factor in determining its sensitivity to turnover in mouse erythroid cells. Hprt a and b may provide a useful system of "normal" allelic gene products for identifying factors that participate in protein turnover during mouse reticulocyte maturation. PMID:3609725

  8. Co-operative signalling mechanisms required for erythroid precursor expansion in response to erythropoietin and stem cell factor.

    PubMed

    Arcasoy, Murat O; Jiang, Xiaohong

    2005-07-01

    The regeneration of circulating red blood cells in response to anaemia associated with blood loss or haemolysis involves an increased rate of erythropoiesis and expansion of proerythroblasts, the bone marrow precursor cells that terminally differentiate into mature erythrocytes. This study investigated the mechanisms by which erythropoietin (Epo) and stem cell factor (Scf) modulate the expansion of proerythroblasts. Homogenous populations of primary human proerythroblasts were generated in liquid cultures of CD34(+) cells. In serum-free cultures, proerythroblasts failed to survive in the presence of Epo or Scf alone, but exhibited synergistic proliferation in response to combined Epo and Scf treatment, exhibiting one-log expansion in 5 d. Intracellular signal transduction in response to Epo and Scf revealed that tyrosine phosphorylation of signal transducers and activators of transcription (Stat) 5, a downstream target for the non-receptor tyrosine kinase, Janus kinase 2 (Jak2), was mediated by Epo but not Scf. The mitogen-activated protein kinases (MAPKs) extracellular regulated kinase (Erk) 1-2 were phosphorylated in response to either Epo or Scf. Phosphorylation of Akt, a signalling molecule downstream of phosphatidylinositol 3-kinase (PI3K), was observed following Scf but not Epo treatment. To determine the contribution of specific signalling pathways to synergistic expansion of proerythroblasts in response to co-operative effects of Epo and Scf, cells were treated with kinase inhibitors targeting Jak2, PI3K and MAPK kinase. There was a significant, dose-dependent inhibition of proerythroblast expansion in response to all three kinase inhibitors. In conclusion, Epo- and Scf-mediated co-operative, synergistic expansion of primary erythroid precursors requires selective activation of multiple signalling pathways, including the Jak-Stat, PI3K and MAPK pathways.

  9. Pathophysiological processes in multiple sclerosis: focus on nuclear factor erythroid-2-related factor 2 and emerging pathways

    PubMed Central

    Arnold, Philipp; Mojumder, Deb; DeToledo, John; Lucius, Ralph; Wilms, Henrik

    2014-01-01

    Multiple sclerosis (MS) is a disease of the central nervous system that is characterized by the demyelination of neuronal axons. Four different patterns of demyelination have been described, showing the heterogeneity in the immunopathologic processes involved in the demyelination. This review will focus on reactive oxygen species (ROS)-related inflammation in MS. Special emphasis will be placed on the nuclear factor erythroid-2-related factor 2 (Nrf2) as it regulates the transcription of ROS-protective genes. In the cytosol, Nrf2 binds to Keap1 (Kelch-like ECH-associated protein 1), and together they are degraded by the 26S proteasome after ubiquitination. If challenged by ROS Nrf2, binding to Keap1 is abrogated, and it translocates into the nucleus. Here it binds to the antioxidant response element and to a small protein termed Maf (musculoaponeurotic fibrosarcoma oncogene homolog). This leads to an enhanced transcription of ROS protective genes and represents the physiological answer against ROS challenge. It has been shown that dimethyl fumarate (DMF) has the same effect and leads to an enhanced transcription of ROS-protective genes. This response is mediated through a reduced binding of Nrf2 to Keap1, thus resulting in a higher level of free Nrf2 in the cytosol. Consequently, more Nrf2 translocates to the nucleus, promoting transcription of its target genes. DMF has been used for the treatment of psoriasis for many years in Germany without the occurrence of major side effects. In psoriasis, DMF reduces ROS-related inflammation in skin. A DMF analog, BG-12, was recently approved for the treatment of relapsing-remitting MS by the European Union and the US Food and Drug Administration. As an oral formulation, it gives patients a convenient and effective alternative to the injectable immune modulators in the long-term treatment of MS. PMID:24591852

  10. CD45 tyrosine phosphatase inhibits erythroid differentiation of umbilical cord blood CD34+ cells associated with selective inactivation of Lyn.

    PubMed

    Harashima, Akira; Suzuki, Motoyuki; Okochi, Ayumi; Yamamoto, Mayuko; Matsuo, Yoshinobu; Motoda, Ryuichi; Yoshioka, Tamotsu; Orita, Kunzo

    2002-12-15

    CD45 is a membrane-associated tyrosine phosphatase that dephosphorylates Src family kinases and Janus kinases (JAKs). To clarify the role of CD45 in hematopoietic differentiation, we examined the effects of anti-CD45 monoclonal antibody NU-L(PAN) on the proliferation and differentiation of umbilical cord blood CD34(+) cells. NU-L(PAN) showed a prominent inhibition of the proliferation of CD34(+) cells induced by the mouse bone marrow stromal cell line MS-5 or erythropoietin (EPO). However, NU-L(PAN) did not affect the proliferation induced by interleukin 3. NU-L(PAN) also inhibited MS-5-induced or EPO-induced erythroid differentiation of CD34(+) cells. The cells stimulated with EPO in the presence of NU-L(PAN) morphologically showed differentiation arrest at the stage of basophilic erythroblasts after 11 days of culture, whereas the cells treated with EPO without NU-L(PAN) differentiated into mature red blood cells. The Src family kinase Lyn and JAK2 were phosphorylated when erythroblasts obtained after 4 days of culture of CD34(+) cells in the presence of EPO were restimulated with EPO. Overnight NU-L(PAN) treatment before addition of EPO reduced the phosphorylation of Lyn but not that of JAK2. Simultaneously, the enhancement of Lyn kinase activity after restimulation with EPO was reduced by NU-L(PAN) treatment. These results indicate selective inactivation of Lyn by CD45 activated with NU-L(PAN) and could partly explain the inhibitory mechanism on erythropoiesis exhibited by EPO. These findings suggest that CD45 may play a pivotal role in erythropoiesis.

  11. V-erbA generates ribosomes devoid of RPL11 and regulates translational activity in avian erythroid progenitors.

    PubMed

    Nguyen-Lefebvre, A T; Leprun, G; Morin, V; Viñuelas, J; Couté, Y; Madjar, J-J; Gandrillon, O; Gonin-Giraud, S

    2014-03-20

    The v-erbA oncogene transforms chicken erythrocytic progenitors (T2EC) by blocking their differentiation and freezing them in a state of self-renewal. Transcriptomes of T2EC, expressing either v-erbA or a non-transforming form of v-erbA (S61G), were compared using serial analysis of gene expression and some, but not all, mRNA-encoding ribosomal proteins were seen to be affected by v-erbA. These results suggest that this oncogene could modulate the composition of ribosomes. In the present study, we demonstrate, using two-dimensional difference in gel electrophoresis, that v-erbA-expressing cells have a lower amount of RPL11 associated with the ribosomes. The presence of ribosomes devoid of RPL11 in v-erbA-expressing cells was further confirmed by immunoprecipitation. In order to assess the possible impact of these specialized ribosomes on the translational activity, we analyzed proteomes of either v-erbA or S61G-expressing cells using 2D/mass spectrometry, and identified nine proteins present in differing amounts within these cells. Among these proteins, we focused on HSP70 because of its involvement in erythroid differentiation. Our results indicate that, in v-erbA-expressing cells, hsp70 is not only transcribed but also translated more efficiently, as shown by polyribosome fractionation experiments. We demonstrate here, for the first time, the existence of ribosomes with different protein components, notably ribosomes devoid of RPL11, and a regulation of mRNA translation depending on v-erbA oncogene expression.

  12. Hippocampal body changes in pure partial onset sleep and pure partial onset waking epileptic patients.

    PubMed

    Motamedi, Mahmood; Zandieh, Ali; Hajimirzabeigi, Alireza; Tahsini, Majid; Vakhshiteh, Fatemeh; Rahimian, Elham

    2013-09-01

    The aim of the current study was to evaluate for the first time the hippocampal changes in patients with pure sleep and pure waking epilepsy. A total of 35 patients with pure partial onset sleep epilepsy and 35 patients with pure partial onset waking epilepsy matched for age and sex ratio were enrolled. MR images were analyzed to determine hippocampal body changes. Rounding ratio of hippocampal body was defined as short axis divided by long axis and hippocampal bodies with ratios ≥ 0.70 were considered rounded. Hippocampal sclerosis and atrophy were found in nine (25.7 %) and seven (20.0 %) patients with pure sleep epilepsy, and in 12 (34.3 %) and 11 (31.4 %) patients with pure waking epilepsy, respectively (P > 0.05 for the comparison between sleep and waking epilepsy). However, proportion of subjects with rounded hippocampal bodies (15, 42.9 % vs. 3, 8.6 % for patients with sleep and waking epilepsy, respectively) and rounding ratios of both left and right hippocampal bodies (0.66 ± 0.13 and 0.61 ± 0.12, respectively for left and right hippocampal bodies in sleep epileptic patients vs. 0.57 ± 0.11 and 0.55 ± 0.11, respectively for left and right hippocampal bodies in waking epileptic patients) were increased in patients with sleep epilepsy (P < 0.05). Further, in sleep epileptic patients with left sided hippocampal body rounding, epileptiform discharges were more readily lateralized to the left temporal lobe (P < 0.05). In conclusion, hippocampal sclerosis and atrophy are not different between pure partial onset sleep and waking epileptic patients. However, rounding ratio and frequency of hippocampal body rounding are increased in sleep epileptic patients.

  13. The co-existence of pure red cell aplasia and autoimmune haemolytic anaemia in a child with malignant lymphoma.

    PubMed

    Ahmed, Suhair Abbas; Hassan, Rosline

    2005-07-01

    The association between pure red cell aplasia (PRCA) and autoimmune haemolytic anaemia (AIHA) has rarely been reported. PRCA represents an isolated process, characterized by normochromic, normocytic anaemia, reticulocytopenia and erythroid hypoplasia in the bone marrow, and may be attributable to infection with Parvo virus B19. AIHA is a condition in which peripheral red blood cell destruction is induced by the presence of autoantibodies. However, the co-existence of these conditions is very rare, since only few cases of PRCA and AIHA associated with malignant lymphoma (ML) were reported. A case of PRCA and AIHA was detected and described, for the first time in Malaysia, in a 10-year-old child suffering from non-Hodgkin lymphoma from the Department of Haematology, Universiti Sains Malaysia. Following the induction course of chemotherapy, the patient turned anaemic, with tendency for red cell clumping, reticulocytopenia and anisocytosis. AIHA was suspected in spite of the weak Coomb reaction obtained. The bone marrow aspirate revealed the presence of giant pronormoblasts, suggesting PRCA. Serological tests for Parvo virus and other viruses were negative.

  14. Assays for detecting and diagnosing antibody-mediated pure red cell aplasia (PRCA): an assessment of available procedures.

    PubMed

    Thorpe, Robin; Swanson, Steven J

    2005-05-01

    Antibody (Ab)-mediated pure red cell aplasia (PRCA) develops when patients mount a neutralizing Ab response to recombinant erythropoiesis-stimulating agents (ESAs) such as epoetin-alpha (EPO). These neutralizing Abs can also cross-neutralize endogenous EPO, leading to a state of absolute EPO resistance and transfusion dependence. The diagnosis of Ab-mediated PRCA in part relies on the sensitive and specific detection of serum anti-EPO Abs and a confirmatory examination of patients' bone marrow for lack of erythroid precursors. To date, a variety of assays have been used to detect anti-EPO Abs, including radioimmunoprecipitation (RIP) assay, enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance (SPR) and bioassays that measure neutralizing Abs. Each of these assays can yield informative results and possess characteristic benefits and limitations, so it is unclear whether or not a "superior" assay is required or possible. To date, a universal standardized assay has not yet been established that would facilitate the comparison of Ab data derived from different laboratories and retrospective analysis of stored sera. This review evaluates the results of studies measuring anti-EPO Abs with different assays and compares their relative advantages and disadvantages in terms of specificity, sensitivity, ease of use and ability to measure Ab-binding affinities and subclasses. These comparisons provide a basis for determining the optimal assay(s) for screening and/or analysis of patients' serum for anti-EPO Abs during treatment or after onset of Ab-mediated PRCA.

  15. [XX 'pure' gonadal dysgenesis and XYY syndrome].

    PubMed

    Itoh, Naoki; Tsukamoto, Taiji

    2004-02-01

    XX 'pure' gonadal dysgenesis is a disease related to Turner's syndrome. Patients of this disease are characterized by normal female external genitalia, bilateral streak gonads, amenorrhea and sexual infantilism. Recently, it has been reported that point mutations of the FSH receptor gene may be one of cause of this disease. The relationship between criminal behavior and XYY syndrome is still controversial. Increased incidence of disomic sperm in 47,XYY males has been reported by fluorescent in situ hybridization(FISH). Genetic counseling should be done when they undergo intracytoplasmic sperm injection.

  16. Electrostatic Precipitation in Nearly Pure Gaseous Nitrogen

    NASA Technical Reports Server (NTRS)

    Buhler, Charles; Calle, Carlos; Clements, Sid; Cox, Bobby; Ritz, Mindy

    2008-01-01

    Electrostatic precipitation was performed in a nearly pure gaseous nitrogen system as a possible remedy for black dust contaminant from high pressure 6000 psi lines at the NASA Kennedy Space Center. The results of a prototype electrostatic precipitator that was built and tested using nitrogen gas at standard atmospheric pressures is presented. High voltage pulsed waveforms are generated using a rotating spark gap system at 30 Hz. A unique dust delivery system utilizing the Venturi effect was devised that supplies a given amount of dust per unit time for testing purposes.

  17. Defective spatial imagery with pure Gerstmann's syndrome.

    PubMed

    Carota, Antonio; Di Pietro, Marie; Ptak, Radek; Poglia, Davide; Schnider, Armin

    2004-01-01

    Gerstmann's syndrome comprises finger agnosia, peripheral agraphia, anarithmetia, and right-left confusion. We here report a single-case study of an 85-year-old ambidextrous man who exhibited pure Gerstmann's syndrome (i.e., without aphasia) 10 weeks after a stroke involving the angular gyrus in the left parietal lobe. We hypothesize that, in this case, the main cognitive denominator of Gerstmann's tetrad was a severe dysfunction in mental rotation and translation. This report provides further evidence for the spatial nature of Gerstmann's syndrome.

  18. Synthesis of highly phase pure BSCCO superconductors

    DOEpatents

    Dorris, Stephen E.; Poeppel, Roger B.; Prorok, Barton C.; Lanagan, Michael T.; Maroni, Victor A.

    1995-01-01

    An article and method of manufacture of (Bi, Pb)-Sr-Ca-Cu-O superconductor. The superconductor is manufactured by preparing a first powdered mixture of bismuth oxide, lead oxide, strontium carbonate, calcium carbonate and copper oxide. A second powdered mixture is then prepared of strontium carbonate, calcium carbonate and copper oxide. The mixtures are calcined separately with the two mixtures then combined. The resulting combined mixture is then subjected to a powder in tube deformation and thermal processing to produce a substantially phase pure (Bi, Pb)-Sr-Ca-Cu-O superconductor.

  19. Synthesis of highly phase pure BSCCO superconductors

    DOEpatents

    Dorris, S.E.; Poeppel, R.B.; Prorok, B.C.; Lanagan, M.T.; Maroni, V.A.

    1995-11-21

    An article and method of manufacture (Bi, Pb)-Sr-Ca-Cu-O superconductor are disclosed. The superconductor is manufactured by preparing a first powdered mixture of bismuth oxide, lead oxide, strontium carbonate, calcium carbonate and copper oxide. A second powdered mixture is then prepared of strontium carbonate, calcium carbonate and copper oxide. The mixtures are calcined separately with the two mixtures then combined. The resulting combined mixture is then subjected to a powder in tube deformation and thermal processing to produce a substantially phase pure (Bi, Pb)-Sr-Ca-Cu-O superconductor. 5 figs.

  20. Pure phase decoherence in a ring geometry

    SciTech Connect

    Zhu, Z.; Aharony, A.; Entin-Wohlman, O.; Stamp, P. C. E.

    2010-06-15

    We study the dynamics of pure phase decoherence for a particle hopping around an N-site ring, coupled both to a spin bath and to an Aharonov-Bohm flux which threads the ring. Analytic results are found for the dynamics of the influence functional and of the reduced density matrix of the particle, both for initial single wave-packet states, and for states split initially into two separate wave packets moving at different velocities. We also give results for the dynamics of the current as a function of time.

  1. Purely cubic action for string field theory

    NASA Technical Reports Server (NTRS)

    Horowitz, G. T.; Lykken, J.; Rohm, R.; Strominger, A.

    1986-01-01

    It is shown that Witten's (1986) open-bosonic-string field-theory action and a closed-string analog can be written as a purely cubic interaction term. The conventional form of the action arises by expansion around particular solutions of the classical equations of motion. The explicit background dependence of the conventional action via the Becchi-Rouet-Stora-Tyutin operator is eliminated in the cubic formulation. A closed-form expression is found for the full nonlinear gauge-transformation law.

  2. Critical speeding up in pure fluids

    NASA Technical Reports Server (NTRS)

    Boukari, Hacene; Shaumeyer, J. N.; Briggs, Matthew E.; Gammon, Robert W.

    1990-01-01

    The extreme compressibility of a pure fluid near its critical point significantly affects its bulk dynamic response to temperature changes through adiabatic processes. Equations that describe the dynamics in the absence of gravity are developed, and the magnitude of the effect is illustrated with numerical solutions in one dimension. The results are remarkable: 5 mm of critical xenon, quenched from 20 to 10 mK above its critical temperature, cools by over 99 percent in less than 5 s. Moreover, adiabatic cooling is faster when the fluid is closer to the critical point.

  3. Hydroxyl X2Pi pure rotational transitions

    NASA Technical Reports Server (NTRS)

    Goorvitch, D.; Goldman, A.; Dothe, Hoang; Tipping, R. H.; Chackerian, C., Jr.

    1992-01-01

    We present a list of frequencies, term values, Einstein A values, and assignments for the pure rotational transitions of the X2Pi state of the OH molecule. This list includes transitions from 3 to 2015/cm for Delta-v = 0, v-double-prime = 0-4, and J-double-prime = 0.5-49.5. The A values were computed using recent advances in calculating wave functions for a coupled system and an experimentally derived electric dipole moment function (Nelson et al., 1990) which exhibits curvature.

  4. The role of mnemonic processes in pure-target and pure-foil recognition memory.

    PubMed

    Koop, Gregory J; Criss, Amy H; Malmberg, Kenneth J

    2015-04-01

    Surprisingly, response patterns in a recognition memory test are very similar regardless of whether the test list contains both targets and foils or just one class of items. To better understand these effects, we evaluate performance over the course of testing. Output interference (OI) is the decrease in performance across test trials due to an increase in noise caused by encoded test items. Critically, OI is predicted on pure lists if the mnemonic evidence for each test item is evaluated. In two experiments, participants received accurate feedback, no feedback, or random feedback that was unrelated to the response on each test trial and pure or standard test lists. When no feedback was provided, performance was nearly identical for standard and pure test lists, replicating previous findings. Only in the presence of accurate feedback were participants able to successfully adapt to pure list environments and improve their accuracy. Critically, OI was observed, demonstrating that participants continued to evaluate mnemonic evidence even in pure list conditions. We discuss the implication of these data for models of memory.

  5. Decitabine With or Without Bortezomib in Treating Older Patients With Acute Myeloid Leukemia

    ClinicalTrials.gov

    2016-08-30

    Acute Myeloid Leukemia Arising From Previous Myelodysplastic Syndrome; Adult Acute Megakaryoblastic Leukemia; Adult Acute Monoblastic Leukemia; Adult Acute Monocytic Leukemia; Adult Acute Myeloid Leukemia With Minimal Differentiation; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Myeloid Leukemia Without Maturation; Adult Erythroleukemia; Adult Pure Erythroid Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

  6. Pomalidomide reverses γ-globin silencing through the transcriptional reprogramming of adult hematopoietic progenitors.

    PubMed

    Dulmovits, Brian M; Appiah-Kubi, Abena O; Papoin, Julien; Hale, John; He, Mingzhu; Al-Abed, Yousef; Didier, Sebastien; Gould, Michael; Husain-Krautter, Sehba; Singh, Sharon A; Chan, Kyle W H; Vlachos, Adrianna; Allen, Steven L; Taylor, Naomi; Marambaud, Philippe; An, Xiuli; Gallagher, Patrick G; Mohandas, Narla; Lipton, Jeffrey M; Liu, Johnson M; Blanc, Lionel

    2016-03-17

    Current therapeutic strategies for sickle cell anemia are aimed at reactivating fetal hemoglobin. Pomalidomide, a third-generation immunomodulatory drug, was proposed to induce fetal hemoglobin production by an unknown mechanism. Here, we report that pomalidomide induced a fetal-like erythroid differentiation program, leading to a reversion of γ-globin silencing in adult human erythroblasts. Pomalidomide acted early by transiently delaying erythropoiesis at the burst-forming unit-erythroid/colony-forming unit-erythroid transition, but without affecting terminal differentiation. Further, the transcription networks involved in γ-globin repression were selectively and differentially affected by pomalidomide including BCL11A, SOX6, IKZF1, KLF1, and LSD1. IKAROS (IKZF1), a known target of pomalidomide, was degraded by the proteasome, but was not the key effector of this program, because genetic ablation of IKZF1 did not phenocopy pomalidomide treatment. Notably, the pomalidomide-induced reprogramming was conserved in hematopoietic progenitors from individuals with sickle cell anemia. Moreover, multiple myeloma patients treated with pomalidomide demonstrated increased in vivo γ-globin levels in their erythrocytes. Together, these data reveal the molecular mechanisms by which pomalidomide reactivates fetal hemoglobin, reinforcing its potential as a treatment for patients with β-hemoglobinopathies.

  7. Underwater loudness for pure tones: Duration effects

    NASA Astrophysics Data System (ADS)

    Cudahy, Edward A.; Schwaller, Derek; Fothergill, David; Wolgemuth, Keith

    2003-04-01

    The loudness of underwater pure tones was measured by loudness matching for pure tones from 100 to 16,000 Hz. The standard was a one second tone at 1000 Hz. The signal duration was varied from 20 milliseconds to 5 seconds. Subjects were instructed to match the loudness of the comparison tone at one of the test frequencies to the loudness of the standard tone. Loudness was measured at the threshold, the most comfortable loudness, and the maximum tolerable loudness. The intensity of the standard was varied randomly across the test series. The subjects were bareheaded U.S. Navy divers tested at a depth of 3 meters. All subjects had normal in-air hearing. Tones were presented to the right side of the subject from an array of underwater sound projectors. The sound pressure level was calibrated at the location of the subject's head with the subject absent. Loudness increased and threshold decreased as duration increased. The effect was greatest at the lowest and highest frequencies. The shape of the loudness contours across frequency and duration derived from these measurements are different from in-air measurements. [Research supported by ONR.

  8. Dead regions and noisiness of pure tones.

    PubMed

    Huss, Martina; Moore, Brian C J

    2005-10-01

    Some hearing-impaired subjects report pure tones as sounding highly distorted and noise-like. We assessed whether such reports indicate that the tone frequency falls inside a dead region (DR). Nine hearing-impaired and four normally hearing subjects rated pure tones on a scale from 1 to 7, where 1 indicates clear tone and 7 indicates noise. A white noise was presented as a reference for a sound that should be rated as 7. Stimuli covered the whole audible range of frequencies and levels. The noisiness ratings were, on average, higher for hearing-impaired subjects than for normally hearing subjects. For the former, the ratings were not markedly different for tones with frequencies just outside or inside a DR. However, ratings always exceeded 3 for tones falling more than 1.5 octaves inside a DR. The results indicate that judgement of a tone as sounding noise-like does not reliably indicate that the tone frequency falls in a DR. Both normally hearing and hearing-impaired subjects rated 0.125 kHz and 12 kHz tones as somewhat noise-like, independently of the existence of a DR.

  9. Light Higgsinos in pure gravity mediation

    NASA Astrophysics Data System (ADS)

    Evans, Jason L.; Ibe, Masahiro; Olive, Keith A.; Yanagida, Tsutomu T.

    2015-03-01

    Pure gravity mediation, with two free parameters, is a minimalistic approach to supergravity models, yet it is capable of incorporating radiative electroweak symmetry breaking, a Higgs mass in agreement with the experimental measurement, without violating any phenomenological constraints. The model may also contain a viable dark matter candidate in the form of a wino. Here, we extend the minimal model by allowing the μ term to be a free parameter equivalent to allowing the two Higgs soft masses, m1 and m2, to differ from other scalar masses, which are set by the gravitino mass. In particular, we examine the region of parameter space where μ ≪m3 /2, in which case the Higgsino becomes the lightest supersymmetric particle and a dark matter candidate. We also consider a generalization of pure gravity mediation that incorporates a Peccei-Quinn symmetry which determines the μ term dynamically. In this case we show that the dark matter may either be in the form of an axion and/or a neutralino and that the lightest supersymmetric particle may be either a wino, bino, or Higgsino.

  10. Time Evolution of Pure Gravitational Waves

    NASA Astrophysics Data System (ADS)

    Miyama, S. M.

    1981-03-01

    Numerical solutions to the Einstein equations in the case of pure gravitational waves are given. The system is assumed to be axially symmetric and non-rotating. The time symmetric initial data and the conformally flat initial data are obtained by solving the constraint equations at t=0. The time evolution of these initial data depends strongly on the initial amplitude of the gravitational waves. In the case of the low initial amplitude, waves only disperse to null infinity. By comparing the initial gravitational energy with the total energy loss through an r=constant surface, it is concluded that the Newman-Penrose method and the Gibbon-Hawking method are the most desirable for measuring the energy flux of gravitational radiation numerically. In the case that the initial ratio of the spatial extent of the gravitational waves to the Schwarzschild radius (M/2) is smaller than about 300, the waves collapse by themselves, leading to formation of a black hole. The analytic solutions of the linearized Einstein equations for the pure gravitational waves are also shown.

  11. Long-term follow-up of myelodysplastic syndrome patients with moderate/severe anaemia receiving human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3: independent positive impact of erythroid response on survival.

    PubMed

    Crisà, Elena; Foli, Cristina; Passera, Roberto; Darbesio, Antonella; Garvey, Kimberly B; Boccadoro, Mario; Ferrero, Dario

    2012-07-01

    We previously reported a 60% erythroid response rate with recombinant erythropoietin + 13-cis retinoic acid + dihydroxylated vitamin D3 in 63 elderly myelodysplastic patients (median age 75 years) with unfavourable features for response to erythropoietin alone [70% transfusion-dependent, 35% refractory anaemia with ring sideroblasts/refractory anaemia with excess of blasts type 1 (RAEB1), 70% with International Prognostic Scoring System (IPSS) Intermediate-1 or -2]. This report updates that case study at a 7-year follow-up, and compared the impact on overall survival of erythroid response to known prognostic factors. The erythroid response duration (median 17 months; 22 in non-RAEB patients, with 20% patients in response after 6 years of therapy) was longer than in most studies with erythropoietin alone. Overall survival (median 55 months in non-RAEB, 15 in RAEB1 patients) was negatively affected by RAEB1 diagnosis, IPSS and WPSS intermediate scores and transfusion-dependence. In the multivariate analysis, erythroid response maintained an independent positive impact on survival, particularly in non-RAEB patients in the first 3 years from diagnosis (90% survival compared to 50% of non-responders). In conclusion, the long-term follow-up confirmed the achievement, by our combined treatment, of fairly long-lasting erythroid response in the majority of MDS patients with unfavourable prognostic features for response to erythropoietin: this translated in a survival benefit that was independent from other prognostic features.

  12. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse

    PubMed Central

    Chatterjee, Sreoshi; Bhardwaj, Nitin; Saxena, Rajiv K.

    2016-01-01

    Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA) in C57BL/6 mice after 5–6 weeks. Using the double in vivo biotinylation (DIB) technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS) were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71) monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline). Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA. PMID:27870894

  13. Variation of erythroid and myeloid precursors in the marrow and peripheral blood of volunteer subjects infected with human parvovirus (B19).

    PubMed Central

    Potter, C G; Potter, A C; Hatton, C S; Chapel, H M; Anderson, M J; Pattison, J R; Tyrrell, D A; Higgins, P G; Willman, J S; Parry, H F

    1987-01-01

    Infection of normal individuals with human parvovirus (B19) results in a mild disease (erythema infectiosum) but gives rise to aplastic crises in patients with chronic hemolytic anemias. The effects of this disease on hemopoiesis were investigated following intranasal inoculation of the virus into three volunteers. A typical disease ensued with a viremia peaking at 9 d. Marrow morphology 6 d after inoculation appeared normal but at 10 d there was a severe loss of erythroid precursors followed by a 1-2-g drop in hemoglobin, and an increase in serum immunoreactive erythropoietin. Erythroid burst-forming units (BFU-E) from the peripheral blood were considerably reduced, starting at the time of viremia and persisting for 4-8 d depending on the individual. Granulocyte-macrophage colony-forming units (CFU-GM) were also affected but the loss started 2 d later. Both CFU-GM and BFU-E showed a sharp overshoot at recovery. In the marrow, BFU-E and CFU-E were reduced at 6 and 10 d in the individual having the longest period of peripheral progenitor loss. In contrast, there was an increase in BFU-E and CFU-E in the subject with least change in peripheral progenitors. In the third subject, with an intermediate picture, there was a loss at 6 d but an increase at 10 d of erythroid progenitors. It is suggested that the architecture of the marrow might partially isolate progenitors from high titers of virus in the serum and individual variation in this respect might give the results observed. PMID:3033026

  14. Computational models of adult neurogenesis

    NASA Astrophysics Data System (ADS)

    Cecchi, Guillermo A.; Magnasco, Marcelo O.

    2005-10-01

    Experimental results in recent years have shown that adult neurogenesis is a significant phenomenon in the mammalian brain. Little is known, however, about the functional role played by the generation and destruction of neurons in the context of an adult brain. Here, we propose two models where new projection neurons are incorporated. We show that in both models, using incorporation and removal of neurons as a computational tool, it is possible to achieve a higher computational efficiency that in purely static, synapse-learning-driven networks. We also discuss the implication for understanding the role of adult neurogenesis in specific brain areas like the olfactory bulb and the dentate gyrus.

  15. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    PubMed

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles.

  16. Beyond Sex Education: How Adults Relate to Children's Sensuality.

    ERIC Educational Resources Information Center

    Fogel, Alan

    Current cultural attitudes toward children's sexuality resemble attitudes toward adults' sexuality; there is an emphasis on purely genital and orgasmic pleasure. Adults and children need warmth, physical contact, and a sense of belonging for which genital stimulation may be unnecessary or inappropriate. Children's sexual advances to adults, as…

  17. Pure Rotational Spectroscopy of Vinyl Mercaptan

    NASA Astrophysics Data System (ADS)

    Martin-Drumel, Marie-Aline; Zingsheim, Oliver; Thorwirth, Sven; Müller, Holger S. P.; Lewen, Frank; Schlemmer, Stephan

    2014-06-01

    Vinyl mercaptan (ethenethiol, CH_2=CHSH) exists in the gas phase in two distinct rotameric forms, syn (planar) and anti (quasi-planar in the ground vibrational state). The microwave spectra of these two isomers were investigated previously, however not exceeding frequencies of about 65 GHz. In the present investigation, the pure rotational spectra of both species have been investigated at millimeter wavelengths. Vinyl mercaptan was produced in a radiofrequency discharge through a constant flow of ethanedithiol at low pressure. Both syn and anti rotamers were observed and new extensive sets of molecular parameters were obtained. Owing to its close structural relationship to vinyl alcohol and the astronomical abundance of complex sulfur-bearing molecules, vinyl mercaptan is a plausible candidate for future radio astronomical searches. M. Tanimoto et al. J. Mol. Spectrosc. 78, 95--105 & 106--119 (1979)

  18. Synaptic devices based on purely electronic memristors

    SciTech Connect

    Pan, Ruobing; Li, Jun; Zhuge, Fei E-mail: h-cao@nimte.ac.cn; Zhu, Liqiang; Liang, Lingyan; Zhang, Hongliang; Gao, Junhua; Cao, Hongtao E-mail: h-cao@nimte.ac.cn; Fu, Bing; Li, Kang

    2016-01-04

    Memristive devices have been widely employed to emulate biological synaptic behavior. In these cases, the memristive switching generally originates from electrical field induced ion migration or Joule heating induced phase change. In this letter, the Ti/ZnO/Pt structure was found to show memristive switching ascribed to a carrier trapping/detrapping of the trap sites (e.g., oxygen vacancies or zinc interstitials) in ZnO. The carrier trapping/detrapping level can be controllably adjusted by regulating the current compliance level or voltage amplitude. Multi-level conductance states can, therefore, be realized in such memristive device. The spike-timing-dependent plasticity, an important Hebbian learning rule, has been implemented in this type of synaptic device. Compared with filamentary-type memristive devices, purely electronic memristors have potential to reduce their energy consumption and work more stably and reliably, since no structural distortion occurs.

  19. Purely antiferromagnetic magnetoelectric random access memory.

    PubMed

    Kosub, Tobias; Kopte, Martin; Hühne, Ruben; Appel, Patrick; Shields, Brendan; Maletinsky, Patrick; Hübner, René; Liedke, Maciej Oskar; Fassbender, Jürgen; Schmidt, Oliver G; Makarov, Denys

    2017-01-03

    Magnetic random access memory schemes employing magnetoelectric coupling to write binary information promise outstanding energy efficiency. We propose and demonstrate a purely antiferromagnetic magnetoelectric random access memory (AF-MERAM) that offers a remarkable 50-fold reduction of the writing threshold compared with ferromagnet-based counterparts, is robust against magnetic disturbances and exhibits no ferromagnetic hysteresis losses. Using the magnetoelectric antiferromagnet Cr2O3, we demonstrate reliable isothermal switching via gate voltage pulses and all-electric readout at room temperature. As no ferromagnetic component is present in the system, the writing magnetic field does not need to be pulsed for readout, allowing permanent magnets to be used. Based on our prototypes, we construct a comprehensive model of the magnetoelectric selection mechanisms in thin films of magnetoelectric antiferromagnets, revealing misfit induced ferrimagnetism as an important factor. Beyond memory applications, the AF-MERAM concept introduces a general all-electric interface for antiferromagnets and should find wide applicability in antiferromagnetic spintronics.

  20. Purely antiferromagnetic magnetoelectric random access memory

    NASA Astrophysics Data System (ADS)

    Kosub, Tobias; Kopte, Martin; Hühne, Ruben; Appel, Patrick; Shields, Brendan; Maletinsky, Patrick; Hübner, René; Liedke, Maciej Oskar; Fassbender, Jürgen; Schmidt, Oliver G.; Makarov, Denys

    2017-01-01

    Magnetic random access memory schemes employing magnetoelectric coupling to write binary information promise outstanding energy efficiency. We propose and demonstrate a purely antiferromagnetic magnetoelectric random access memory (AF-MERAM) that offers a remarkable 50-fold reduction of the writing threshold compared with ferromagnet-based counterparts, is robust against magnetic disturbances and exhibits no ferromagnetic hysteresis losses. Using the magnetoelectric antiferromagnet Cr2O3, we demonstrate reliable isothermal switching via gate voltage pulses and all-electric readout at room temperature. As no ferromagnetic component is present in the system, the writing magnetic field does not need to be pulsed for readout, allowing permanent magnets to be used. Based on our prototypes, we construct a comprehensive model of the magnetoelectric selection mechanisms in thin films of magnetoelectric antiferromagnets, revealing misfit induced ferrimagnetism as an important factor. Beyond memory applications, the AF-MERAM concept introduces a general all-electric interface for antiferromagnets and should find wide applicability in antiferromagnetic spintronics.

  1. Fock expansion of multimode pure Gaussian states

    SciTech Connect

    Cariolaro, Gianfranco; Pierobon, Gianfranco

    2015-12-15

    The Fock expansion of multimode pure Gaussian states is derived starting from their representation as displaced and squeezed multimode vacuum states. The approach is new and appears to be simpler and more general than previous ones starting from the phase-space representation given by the characteristic or Wigner function. Fock expansion is performed in terms of easily evaluable two-variable Hermite–Kampé de Fériet polynomials. A relatively simple and compact expression for the joint statistical distribution of the photon numbers in the different modes is obtained. In particular, this result enables one to give a simple characterization of separable and entangled states, as shown for two-mode and three-mode Gaussian states.

  2. Hologram of a pure state black hole

    NASA Astrophysics Data System (ADS)

    Roy, Shubho R.; Sarkar, Debajyoti

    2015-12-01

    In this paper, we extend the Hamilton-Kabat-Lifschytz-Lowe (HKLL) holographic smearing function method to reconstruct (quasi)local anti-de Sitter bulk scalar observables in the background of a large anti-de Sitter black hole formed by null shell collapse (a "pure state" black hole), from the dual conformal field theory which is undergoing a sudden quench. In particular, we probe the near horizon and subhorizon bulk locality. First, we construct local bulk operators from the conformal field theory in the leading semiclassical limit, N →∞ . Then, we look at effects due to the finiteness of N , where we propose a suitable coarse-graining prescription involving early and late time cutoffs to define semiclassical bulk observables which are approximately local, their departure from locality being nonperturbatively small in N . Our results have important implications on the black hole information problem.

  3. Pure versus Co-Occurring Externalizing and Internalizing Symptoms in Children: The Potential Role of Socio-Developmental Milestones

    ERIC Educational Resources Information Center

    Oland, Alyssa A.; Shaw, Daniel S.

    2005-01-01

    Co-occurring internalizing and externalizing disorders are moderately prevalent in children, adolescents, and adults (Anderson, Williams, McGee, & Silva, 1987; McConaughy & Skiba, 1994), but much remains to be understood regarding why some children show "pure" versus co-occurring internalizing and externalizing symptoms. One possible influence…

  4. Reflections on Remaining Obstacles in a Primary-Care Oriented Pure PBL Curriculum after Twelve Years of Implementation

    ERIC Educational Resources Information Center

    D'Ottavio, Alberto Enrique; Bassan, Norberto David

    2014-01-01

    A pioneer primary-care oriented pure PBL curriculum, based on constructivism and adult learning theories combined with Morin's complex thinking, was implemented in our medical school since 2002. Regardless of warnings opportunely made because the basic requirements for its successful implementation could not be fully fulfilled in practice, the…

  5. 77 FR 59979 - Pure Magnesium (Granular) From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-01

    ... COMMISSION Pure Magnesium (Granular) From China Determination On the basis of the record \\1\\ developed in the... antidumping duty order on pure magnesium (granular) from China would be likely to lead to continuation or...), entitled Pure Magnesium (Granular) from China: Investigation No.731-TA- 895 (Second Review)....

  6. ThermoData Engine Database - Pure Compounds and Binary Mixtures

    National Institute of Standards and Technology Data Gateway

    SRD 103b NIST ThermoData Engine Version 6.0 - Pure CompoThermoData Engine Database - Pure Compounds and Binary Mixtures (PC database for purchase)   This database contains property data for more than 21,000 pure compounds, 37,500 binary mixtures, 10,000 ternary mixtures, and 6,000 chemical reactions.

  7. HMGA2 Moderately Increases Fetal Hemoglobin Expression in Human Adult Erythroblasts

    PubMed Central

    de Vasconcellos, Jaira F.; Lee, Y. Terry; Byrnes, Colleen; Tumburu, Laxminath; Rabel, Antoinette; Miller, Jeffery L.

    2016-01-01

    Induction of fetal hemoglobin (HbF) has therapeutic importance for patients with beta-hemoglobin disorders. Previous studies showed that let-7 microRNAs (miRNAs) are highly regulated in erythroid cells during the fetal-to-adult developmental transition, and that targeting let-7 mediated the up-regulation of HbF to greater than 30% of the total globin levels in human adult cultured erythroblasts. HMGA2 is a member of the high-mobility group A family of proteins and a validated target of the let-7 family of miRNAs. Here we investigate whether expression of HMGA2 directly regulates fetal hemoglobin in adult erythroblasts. Let-7 resistant HMGA2 expression was studied after lentiviral transduction of CD34(+) cells. The transgene was regulated by the erythroid-specific gene promoter region of the human SPTA1 gene (HMGA2-OE). HMGA2-OE caused significant increases in gamma-globin mRNA expression and HbF to around 16% of the total hemoglobin levels compared to matched control transductions. Interestingly, no significant changes in KLF1, SOX6, GATA1, ZBTB7A and BCL11A mRNA levels were observed. Overall, our data suggest that expression of HMGA2, a downstream target of let-7 miRNAs, causes moderately increased gamma-globin gene and protein expression in adult human erythroblasts. PMID:27861570

  8. Tipifarnib in Treating Older Patients With Previously Untreated Acute Myeloid Leukemia

    ClinicalTrials.gov

    2013-03-22

    Acute Myeloid Leukemia With Multilineage Dysplasia Following Myelodysplastic Syndrome; Adult Acute Basophilic Leukemia; Adult Acute Eosinophilic Leukemia; Adult Acute Erythroid Leukemia (M6); Adult Acute Megakaryoblastic Leukemia (M7); Adult Acute Minimally Differentiated Myeloid Leukemia (M0); Adult Acute Monoblastic Leukemia (M5a); Adult Acute Monoblastic Leukemia and Acute Monocytic Leukemia (M5); Adult Acute Monocytic Leukemia (M5b); Adult Acute Myeloblastic Leukemia With Maturation (M2); Adult Acute Myeloblastic Leukemia Without Maturation (M1); Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Acute Myelomonocytic Leukemia (M4); Adult Erythroleukemia (M6a); Adult Pure Erythroid Leukemia (M6b); Cellular Diagnosis, Adult Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

  9. In-house pureed food production in long-term care: perspectives of dietary staff and implications for improvement.

    PubMed

    Ilhamto, Nila; Anciado, Katrina; Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Texture modification of foods to a pureed consistency is a common management approach for older adults with dysphagia. Long-term care (LTC) facilities commonly produce some pureed food in-house. This study investigated challenges and preferred practices associated with the production of pureed food in LTC facilities. Nutrition Managers (n = 27) and cooks (n = 26) from 25 Ontario LTC facilities were recruited for one-on-one, semistructured interviews. Interviews were digitally recorded, transcribed, and analyzed using inductive thematic analysis. Four themes arose from the data to exemplify challenges in production, including (a) difficulty in using standardized recipes, (b) varied interpretation of governmental guidelines, (c) lack of consistency in terminology and texture, and (d) wanting to improve the visual appeal. These challenges were reported to reduce the quality of in-house produced pureed food. Preferred practices to overcome these challenges were also provided by participants, such as involving cooks in pureed recipe improvements and tailoring to the specific needs of residents. Incorporation of these practices into pureed food production may help to shape and improve future practice and pureed food products.

  10. Sequences responsible for erythroid and lymphoid leukemia in the long terminal repeats of Friend-mink cell focus-forming and Moloney murine leukemia viruses.

    PubMed Central

    Ishimoto, A; Takimoto, M; Adachi, A; Kakuyama, M; Kato, S; Kakimi, K; Fukuoka, K; Ogiu, T; Matsuyama, M

    1987-01-01

    Despite the high degree of homology (91%) between the nucleotide sequences of the Friend-mink cell focus-forming (MCF) and the Moloney murine leukemia virus (MuLV) genomic long terminal repeats (LTRs), the pathogenicities determined by the LTR sequences of the two viruses are quite different. Friend-MCF MuLV is an erythroid leukemia virus, and Moloney MuLV is a lymphoid leukemia virus. To map the LTR sequences responsible for the different disease specificities, we constructed nine viruses with LTRs recombinant between the Friend-MCF and Moloney MuLVs. Analysis of the leukemia induced with the recombinant viruses showed that a 195-base-pair nucleotide sequence, including a 75-base-pair nucleotide Moloney enhancer, is responsible for the tissue-specific leukemogenicity of Moloney MuLV. However, not only the enhancer but also its downstream sequences appear to be necessary. The Moloney virus enhancer and its downstream sequence exerted a dominant effect over that of the Friend-MCF virus, but the enhancer sequence alone did not. The results that three of the nine recombinant viruses induced both erythroid and lymphoid leukemias supported the hypothesis that multiple viral genetic determinants control both the ability to cause leukemia and the type of leukemia induced. PMID:3033317

  11. Cis-vaccenic acid induces differentiation and up-regulates gamma globin synthesis in K562, JK1 and transgenic mice erythroid progenitor stem cells.

    PubMed

    Aimola, Idowu A; Inuwa, Hajiya M; Nok, Andrew J; Mamman, Aisha I; Bieker, James J

    2016-04-05

    Gamma globin induction remains a promising pharmacological therapeutic treatment mode for sickle cell anemia and beta thalassemia, however Hydroxyurea remains the only FDA approved drug which works via this mechanism. In this regard, we assayed the γ-globin inducing capacity of Cis-vaccenic acid (CVA). CVA induced differentiation of K562, JK1 and transgenic mice primary bone marrow hematopoietic progenitor stem cells. CVA also significantly up-regulated γ-globin gene expression in JK-1 and transgenic mice bone marrow erythroid progenitor stem cells (TMbmEPSCs) but not K562 cells without altering cell viability. Increased γ-globin expression was accompanied by KLF1 suppression in CVA induced JK-1 cells. Erythropoietin induced differentiation of JK-1 cells 24h before CVA induction did not significantly alter CVA induced differentiation and γ-globin expression in JK-1 cells. Inhibition of JK-1 and Transgenic mice bone marrow erythroid progenitor stem cells Fatty acid elongase 5 (Elovl5) and Δ(9) desaturase suppressed the γ-globin inductive effects of CVA. CVA treatment failed to rescue γ-globin expression in Elovl5 and Δ(9)-desaturase inhibited cells 48 h post inhibition in JK-1 cells. The data suggests that CVA directly modulates differentiation of JK-1 and TMbmEPSCs, and indirectly modulates γ-globin gene expression in these cells. Our findings provide important clues for further evaluations of CVA as a potential fetal hemoglobin therapeutic inducer.

  12. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    PubMed

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  13. In utero and in vitro effects of benzene and its metabolites on erythroid differentiation and the role of reactive oxygen species

    SciTech Connect

    Badham, Helen J.; Winn, Louise M.

    2010-05-01

    Benzene is a ubiquitous occupational and environmental toxicant. Exposures to benzene both prenatally and during adulthood are associated with the development of disorders such as aplastic anemia and leukemia. Mechanisms of benzene toxicity are unknown; however, generation of reactive oxygen species (ROS) by benzene metabolites may play a role. Little is known regarding the effects of benzene metabolites on erythropoiesis. Therefore, to determine the effects of in utero exposure to benzene on the growth and differentiation of fetal erythroid progenitor cells (CFU-E), pregnant CD-1 mice were exposed to benzene and CFU-E numbers were assessed in fetal liver (hematopoietic) tissue. In addition, to determine the effect of benzene metabolite-induced ROS generation on erythropoiesis, HD3 chicken erythroblast cells were exposed to benzene, phenol, or hydroquinone followed by stimulation of erythrocyte differentiation. Our results show that in utero exposure to benzene caused significant alterations in female offspring CFU-E numbers. In addition, exposure to hydroquinone, but not benzene or phenol, significantly reduced the percentage of differentiated HD3 cells, which was associated with an increase in ROS. Pretreatment of HD3 cells with polyethylene glycol-conjugated superoxide dismutase (PEG-SOD) prevented hydroquinone-induced inhibition of erythropoiesis, supporting the hypothesis that ROS generation is involved in the development of benzene erythrotoxicity. In conclusion, this study provided evidence that ROS generated as a result of benzene metabolism may significantly alter erythroid differentiation, potentially leading to the development of Blood Disorders.

  14. Identification of an arginine452 to histidine substitution in the erythroid 5-aminolaevulinate synthetase gene in a large pedigree with X-linked hereditary sideroblastic anaemia.

    PubMed

    Edgar, A J; Losowsky, M S; Noble, J S; Wickramasinghe, S N

    1997-01-01

    The coding region of the erythroid 5-aminolaevulinate synthetase gene (ALAS2) from a large pedigree with pyridoxine-responsive X-linked hereditary sideroblastic anaemia was examined for mutations. In three affected males from this pedigree, single strand conformational polymorphism (SSCP) analysis showed anomalous migration of a PCR product spanning exon 9. Sequencing of amplified genomic DNA from one of these affected males revealed a guanine to adenine transition at nucleotide 1407 of the cDNA sequence in exon 9 of the gene. This mutation results in the loss of an HhaI restriction enzyme digest site. An HhaI digest assay demonstrated the presence of this mutation in other affected males but not in unaffected males and unrelated individuals. The point mutation results in an arginine to histidine substitution at amino acid residue 452. The arginine residue is conserved in both the erythroid and housekeeping ALAS genes in all known vertebrate sequences. This arginine is located in the middle of a predicted alpha-helix.

  15. Overactivation of the nuclear factor (erythroid-derived 2)-like 2-antioxidant response element pathway in hepatocytes decreases hepatic ischemia/reperfusion injury in mice.

    PubMed

    Lee, Lung-Yi; Harberg, Calvin; Matkowskyj, Kristina A; Cook, Shelly; Roenneburg, Drew; Werner, Sabine; Johnson, Jeffrey; Foley, David P

    2016-01-01

    Hepatic ischemia/reperfusion injury (IRI) is a critical component of hepatic surgery. Oxidative stress has long been implicated as a key player in IRI. In this study, we examine the cell-specific role of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-antioxidant response element pathway in warm hepatic IRI. Nrf2 knockout (KO) and wild-type (WT) animals and novel transgenic mice expressing a constitutively active nuclear factor (erythroid-derived 2)-like 2 (caNrf2) mutant in hepatocytes (AlbCre+/caNrf2+) and their littermate controls underwent partial hepatic ischemia or sham surgery. The animals were killed 6 hours after reperfusion, and their serum and tissue were collected for analysis. As compared to WT animals after ischemia/reperfusion (IR), Nrf2 KO mice had increased hepatocellular injury with increased serum alanine aminotransferase and aspartate aminotransferase, Suzuki score, apoptosis, an increased inflammatory infiltrate, and enhanced inflammatory cytokine expression. On the other hand, AlbCre+/caNrf2+ that underwent IR had significantly reduced serum transaminases, less necrosis on histology, and a less pronounced inflammatory infiltrate and inflammatory cytokine expression as compared to the littermate controls. However, there were no differences in apoptosis. Taken together, Nrf2 plays a critical role in our murine model of warm hepatic IRI, with Nrf2 deficiency exacerbating hepatic IRI and hepatocyte-specific Nrf2 overactivation providing protection against warm hepatic IRI.

  16. A dominant-negative mutant of C/EBPalpha, associated with acute myeloid leukemias, inhibits differentiation of myeloid and erythroid progenitors of man but not mouse.

    PubMed

    Schwieger, Maike; Löhler, Jürgen; Fischer, Meike; Herwig, Uwe; Tenen, Daniel G; Stocking, Carol

    2004-04-01

    The CCAAT/enhancer binding protein alpha (C/EBPalpha) is an essential transcription factor for granulocytic differentiation. C/EBPalpha mutations are found in approximately 8% of acute myeloid leukemia (AML) patients. Most of these mutations occur in the N-terminal coding region, resulting in a frame shift and the enhanced translation of a dominant-negative 30-kDa protein, which may be responsible for the differentiation block observed in AML. To test this hypothesis, we introduced a cDNA encoding an N-terminal mutated C/EBPalpha (mut10) into primary hematopoietic progenitors using a retroviral vector. Expression of mut10 in human CD34+ cord blood cells dramatically inhibited differentiation of both myeloid and erythroid lineages. Immunohistochemical analysis demonstrated coexpression of both myeloid and erythroid markers in the immature transformed cells. Surprisingly, mut10 did not block myelocytic differentiation in murine progenitors but did alter their differentiation kinetics and clonogenicity. Experiments were performed to confirm that the differential effect of mut10 on murine and human progenitors was not due to species-specific differences in C/EBPalpha protein sequences, expression levels, or inefficient targeting of relevant cells. Taken together, our results underline the intrinsic differences between hematopoietic controls in mouse and human and support the hypothesis that mutations in CEBPA are critical events in the disruption of myeloid differentiation in AMLs.

  17. p210(BCR-ABL) reprograms transformed and normal human megakaryocytic progenitor cells into erythroid cells and suppresses FLI-1 transcription.

    PubMed

    Buet, D; Raslova, H; Geay, J-F; Jarrier, P; Lazar, V; Turhan, A; Morlé, F; Vainchenker, W; Louache, F

    2007-05-01

    The BCR-ABL oncoprotein exhibits deregulated protein tyrosine kinase activity and is implicated in the pathogenesis of Philadelphia chromosome (Ph)-positive human leukemias. Here, we report that ectopic expression of p210(BCR-ABL) in the megakaryoblastic Mo7e cell line and in primary human CD34(+) progenitors trigger erythroid differentiation at the expense of megakaryocyte (MK) differentiation. Clonal culture of purified CD41(+)CD42(-) cells, a population highly enriched in MK progenitors, combined with the conditional expression of p210(BCR-ABL) tyrosine kinase activity by imatinib identified a true lineage reprogramming. In both Mo7e or CD41(+)CD42(-) cells transduced with p210(BCR-ABL), lineage switching was associated with a downregulation of the friend leukemia Integration 1 (FLI-1) transcription factor. Re-expression of FLI-1 in p210(BCR-ABL)-transduced Mo7e cells rescued the megakaryoblastic phenotype. Altogether, these results demonstrate that alteration of signal transduction via p210(BCR-ABL) reprograms MK cells into erythroid cells by a downregulation of FLI-1. In addition, our findings underscore the role of kinases in lineage choice and infidelity in pathology and suggest that downregulation of FLI-1 may have important implications in CML pathogenesis.

  18. PLC-beta 1 regulates the expression of miR-210 during mithramycin-mediated erythroid differentiation in K562 cells

    PubMed Central

    Fiume, Roberta; Blalock, William; Matteucci, Alessandro; Ramazzotti, Giulia; McCubrey, James A.; Cocco, Lucio; Faenza, Irene

    2014-01-01

    PLC-beta 1 (PLCβ1) inhibits in human K562 cells erythroid differentiation induced by mithramycin (MTH) by targeting miR-210 expression. Inhibition of miR-210 affects the erythroid differentiation pathway and it occurs to a greater extent in MTH-treated cells. Overexpression of PLCβ1 suppresses the differentiation of K562 elicited by MTH as demonstrated by the absence of γ-globin expression. Inhibition of PLCβ1 expression is capable to promote the differentiation process leading to a recovery of γ-globin gene even in the absence of MTH. Our experimental evidences suggest that PLCβ1 signaling regulates erythropoiesis through miR-210. Indeed overexpression of PLCβ1 leads to a decrease of miR-210 expression after MTH treatment. Moreover miR-210 is up-regulated when PLCβ1 expression is down-regulated. When we silenced PKCα by RNAi technique, we found a decrease in miR-210 and γ-globin expression levels, which led to a severe slowdown of cell differentiation in K562 cells and these effects were the same encountered in cells overexpressing PLCβ1. Therefore we suggest a novel role for PLCβ1 in regulating miR-210 and our data hint at the fact that, in human K562 erythroleukemia cells, the modulation of PLCβ1 expression is able to exert an impairment of normal erythropoiesis as assessed by γ-globin expression. PMID:24962066

  19. Cis-vaccenic acid induces differentiation and up-regulates gamma globin synthesis in K562, JK1 and transgenic mice erythroid progenitor stem cells

    PubMed Central

    Aimola, Idowu A.; Inuwa, Hajiya M.; Nok, Andrew J.; Mamman, Aisha I.; Bieker, James J.

    2017-01-01

    Gamma globin induction remains a promising pharmacological therapeutic treatment mode for sickle cell anemia and beta thalassemia, however Hydroxyurea remains the only FDA approved drug which works via this mechanism. In this regard, we assayed the γ-globin inducing capacity of Cis-vaccenic acid (CVA). CVA induced differentiation of K562, JK1 and transgenic mice primary bone marrow hematopoietic progenitor stem cells. CVA also significantly up-regulated γ-globin gene expression in JK-1 and transgenic mice bone marrow erythroid progenitor stem cells (TMbmEPSCs) but not K562 cells without altering cell viability. Increased γ-globin expression was accompanied by KLF1 suppression in CVA induced JK-1 cells. Erythropoietin induced differentiation of JK-1 cells 24 h before CVA induction did not significantly alter CVA induced differentiation and γ-globin expression in JK-1 cells. Inhibition of JK-1 and Transgenic mice bone marrow erythroid progenitor stem cells Fatty acid elongase 5 (Elovl5) and Δ9 desaturase suppressed the γ-globin inductive effects of CVA. CVA treatment failed to rescue γ-globin expression in Elovl5 and Δ9-desaturase inhibited cells 48 h post inhibition in JK-1 cells. The data suggests that CVA directly modulates differentiation of JK-1 and TMbmEPSCs, and indirectly modulates γ-globin gene expression in these cells. Our findings provide important clues for further evaluations of CVA as a potential fetal hemoglobin therapeutic inducer PMID:26879870

  20. Erythroid differentiation of mouse erythroleukemia cells results in reorganization of protein-DNA complexes in the mouse beta maj globin promoter but not its distal enhancer.

    PubMed Central

    Reddy, P M; Shen, C K

    1993-01-01

    Dimethyl sulfoxide (DMSO) induction of mouse erythroleukemia (MEL) cells represents a well-defined in vitro system of terminal erythroid differentiation. We have studied the molecular mechanisms of transcriptional activation of the mouse beta maj globin gene during MEL cell differentiation by analyzing nuclear factor-DNA interactions in vivo at the gene's upstream promoter and a distal enhancer, 5'HS-2. Genomic footprinting data indicate that three motifs, CAC, NF-E2/AP1, and GATA-1, of the 5'HS-2 enhancer are bound with nuclear factors in MEL cells both prior to and after DMSO induction. No obvious conformational change of these nuclear factor-DNA complexes could be detected upon terminal differentiation of MEL cells. On the other hand, DMSO induction of MEL cells leads to the formation of specific nuclear factor-DNA complexes at several transcriptional regulatory elements of the mouse beta maj globin upstream promoter. Our genomic footprinting data have interesting implications with respect to the molecular mechanisms of transcriptional regulation and chromatin change of the mouse beta maj globin gene during erythroid differentiation. Images PMID:8423777

  1. Accelerating degradation rate of pure iron by zinc ion implantation

    PubMed Central

    Huang, Tao; Zheng, Yufeng; Han, Yong

    2016-01-01

    Pure iron has been considered as a promising candidate for biodegradable implant applications. However, a faster degradation rate of pure iron is needed to meet the clinical requirement. In this work, metal vapor vacuum arc technology was adopted to implant zinc ions into the surface of pure iron. Results showed that the implantation depth of zinc ions was about 60 nm. The degradation rate of pure iron was found to be accelerated after zinc ion implantation. The cytotoxicity tests revealed that the implanted zinc ions brought a slight increase on cytotoxicity of the tested cells. In terms of hemocompatibility, the hemolysis of zinc ion implanted pure iron was lower than 2%. However, zinc ions might induce more adhered and activated platelets on the surface of pure iron. Overall, zinc ion implantation can be a feasible way to accelerate the degradation rate of pure iron for biodegradable applications. PMID:27482462

  2. Stable pure state quantum tomography from five orthonormal bases

    NASA Astrophysics Data System (ADS)

    Carmeli, Claudio; Heinosaari, Teiko; Kech, Michael; Schultz, Jussi; Toigo, Alessandro

    2016-08-01

    For any finite-dimensional Hilbert space, we construct explicitly five orthonormal bases such that the corresponding measurements allow for efficient tomography of an arbitrary pure quantum state. This means that such measurements can be used to distinguish an arbitrary pure state from any other state, pure or mixed, and the pure state can be reconstructed from the outcome distribution in a feasible way. The set of measurements we construct is independent of the unknown state, and therefore our results provide a fixed scheme for pure state tomography, as opposed to the adaptive (state-dependent) scheme proposed by Goyeneche et al. (Phys. Rev. Lett., 115 (2015) 090401). We show that our scheme is robust with respect to noise, in the sense that any measurement scheme which approximates these measurements well enough is equally suitable for pure state tomography. Finally, we present two convex programs which can be used to reconstruct the unknown pure state from the measurement outcome distributions.

  3. Accelerating degradation rate of pure iron by zinc ion implantation.

    PubMed

    Huang, Tao; Zheng, Yufeng; Han, Yong

    2016-12-01

    Pure iron has been considered as a promising candidate for biodegradable implant applications. However, a faster degradation rate of pure iron is needed to meet the clinical requirement. In this work, metal vapor vacuum arc technology was adopted to implant zinc ions into the surface of pure iron. Results showed that the implantation depth of zinc ions was about 60 nm. The degradation rate of pure iron was found to be accelerated after zinc ion implantation. The cytotoxicity tests revealed that the implanted zinc ions brought a slight increase on cytotoxicity of the tested cells. In terms of hemocompatibility, the hemolysis of zinc ion implanted pure iron was lower than 2%. However, zinc ions might induce more adhered and activated platelets on the surface of pure iron. Overall, zinc ion implantation can be a feasible way to accelerate the degradation rate of pure iron for biodegradable applications.

  4. AgraPure Mississippi Biomass Project

    SciTech Connect

    Blackwell,D.A; Broadhead, L.W.; Harrell, W.J.

    2006-03-31

    The AgraPure Mississippi Biomass project was a congressionally directed project, initiated to study the utilization of Mississippi agricultural byproducts and waste products in the production of bio-energy and to determine the feasibility of commercialization of these agricultural byproducts and waste products as feedstocks in the production of energy. The final products from this project were two business plans; one for a Thermal plant, and one for a Biodiesel/Ethanol plant. Agricultural waste fired steam and electrical generating plants and biodiesel plants were deemed the best prospects for developing commercially viable industries. Additionally, oil extraction methods were studied, both traditional and two novel techniques, and incorporated into the development plans. Mississippi produced crop and animal waste biomasses were analyzed for use as raw materials for both industries. The relevant factors, availability, costs, transportation, storage, location, and energetic value criteria were considered. Since feedstock accounts for more than 70 percent of the total cost of producing biodiesel, any local advantages are considered extremely important in developing this particular industry. The same factors must be evaluated in assessing the prospects of commercial operation of a steam and electrical generation plant. Additionally, the access to the markets for electricity is more limited, regulated and tightly controlled than the liquid fuel markets. Domestically produced biofuels, both biodiesel and ethanol, are gaining more attention and popularity with the consuming public as prices rise and supplies of foreign crude become less secure. Biodiesel requires no major modifications to existing diesel engines or supply chain and offers significant environmental benefits. Currently the biodiesel industry requires Federal and State incentives to allow the industry to develop and become self-sustaining. Mississippi has available the necessary feedstocks and is

  5. Pure Culture Fermentation of Brined Cucumbers1

    PubMed Central

    Etchells, J. L.; Costilow, R. N.; Anderson, T. E.; Bell, T. A.

    1964-01-01

    The relative abilities of Pediococcus cerevisiae, Lactobacillus plantarum, L. brevis, and several other species of lactic acid bacteria to grow and produce acid in brined cucumbers were evaluated in pure culture fermentations. Such fermentations were made possibly by the use of two techniques, gamma radiation (0.83 to 1.00 Mrad) and hot-water blanching (66 to 80 C for 5 min), designed first to rid the cucumbers of naturally occurring, interfering, and competitive microbial groups prior to brining, followed by inoculation with the desired lactic acid bacteria. Of the nine species tested, strains of the three common to cucumber fermentations, P. cerevisiae, L. plantarum, and L. brevis, grew to the highest populations, and produced the highest levels of brine acidity and the lowest pH values in fermentations at 5.4 to 5.6% NaCl by weight; also, their sequence of active development in fermentations, with the use of a three-species mixture for inoculation, was in the species order just named. This sequence of occurrence was similar to that estimated by others for natural fermentations. The rates of growth and acid production in fermentations with a mixture of P. cerevisiae, L. plantarum, and L. brevis increased as the incubation temperature was increased from 21 to 27 to 32 C; however, the maximal populations and acidities attained were essentially the same for fermentations at each temperature. Further, these same three species were found to be the most salt tolerant of those tested; their upper limit for appreciable growth and measurable acid production was about 8% salt, whereas thermophilic species such as L. thermophilus, L. lactis, L. helveticus, L. fermenti, and L. delbrueckii exhibited a much lower salt tolerance, ranging from about 2.5 to 4.0%. However, certain strains of L. delbrueckii grew very rapidly in cucumbers brined at 2.5 to 3.0% salt, and produced sufficient acid in about 30 hr at 48 C to reduce the brine pH from above 7.0 to below 4.0. An inexpensive

  6. Pure Culture Fermentation of Brined Cucumbers.

    PubMed

    Etchells, J L; Costilow, R N; Anderson, T E; Bell, T A

    1964-11-01

    The relative abilities of Pediococcus cerevisiae, Lactobacillus plantarum, L. brevis, and several other species of lactic acid bacteria to grow and produce acid in brined cucumbers were evaluated in pure culture fermentations. Such fermentations were made possibly by the use of two techniques, gamma radiation (0.83 to 1.00 Mrad) and hot-water blanching (66 to 80 C for 5 min), designed first to rid the cucumbers of naturally occurring, interfering, and competitive microbial groups prior to brining, followed by inoculation with the desired lactic acid bacteria. Of the nine species tested, strains of the three common to cucumber fermentations, P. cerevisiae, L. plantarum, and L. brevis, grew to the highest populations, and produced the highest levels of brine acidity and the lowest pH values in fermentations at 5.4 to 5.6% NaCl by weight; also, their sequence of active development in fermentations, with the use of a three-species mixture for inoculation, was in the species order just named. This sequence of occurrence was similar to that estimated by others for natural fermentations. The rates of growth and acid production in fermentations with a mixture of P. cerevisiae, L. plantarum, and L. brevis increased as the incubation temperature was increased from 21 to 27 to 32 C; however, the maximal populations and acidities attained were essentially the same for fermentations at each temperature. Further, these same three species were found to be the most salt tolerant of those tested; their upper limit for appreciable growth and measurable acid production was about 8% salt, whereas thermophilic species such as L. thermophilus, L. lactis, L. helveticus, L. fermenti, and L. delbrueckii exhibited a much lower salt tolerance, ranging from about 2.5 to 4.0%. However, certain strains of L. delbrueckii grew very rapidly in cucumbers brined at 2.5 to 3.0% salt, and produced sufficient acid in about 30 hr at 48 C to reduce the brine pH from above 7.0 to below 4.0. An inexpensive

  7. Reexamination of pure qubit work extraction.

    PubMed

    Frenzel, Max F; Jennings, David; Rudolph, Terry

    2014-11-01

    Many work extraction or information erasure processes in the literature involve the raising and lowering of energy levels via external fields. But even if the actual system is treated quantum mechanically, the field is assumed to be classical and of infinite strength, hence not developing any correlations with the system or experiencing back-actions. We extend these considerations to a fully quantum mechanical treatment by studying a spin-1/2 particle coupled to a finite-sized directional quantum reference frame, a spin-l system, which models an external field. With this concrete model together with a bosonic thermal bath, we analyze the back-action a finite-size field suffers during a quantum-mechanical work extraction process and the effect this has on the extractable work and highlight a range of assumptions commonly made when considering such processes. The well-known semiclassical treatment of work extraction from a pure qubit predicts a maximum extractable work W=kTlog2 for a quasistatic process, which holds as a strict upper bound in the fully quantum mechanical case and is attained only in the classical limit. We also address the problem of emergent local time dependence in a joint system with a globally fixed Hamiltonian.

  8. Localization of aerial pure tones by pinnipeds

    NASA Astrophysics Data System (ADS)

    Holt, Marla M.; Schusterman, Ronald J.; Kastak, David; Southall, Brandon L.

    2005-12-01

    In this study, minimum audible angles (MAAs) of aerial pure tones were measured in and compared between a northern elephant seal (Mirounga angustirostris), a harbor seal (Phoca vitulina), and a California sea lion (Zalophus californianus). Testing was conducted between 0.8 and 16 kHz in the elephant seal and 0.8 and 20 kHz in the harbor seal and sea lion in a hemi-anechoic chamber using a left/right psychophysical procedure. Performance for the same frequencies was also quantified for discrete speaker separation of 5° from the mid-line. For all subjects, MAAs ranged from approximately 3° to 15° and were generally equal to or larger than those previously measured in the same subjects with a broadband signal. Performance at 5° ranged from chance to 97% correct, depending on frequency and subject. Poorest performance in the sea lion and harbor seal occurred at intermediate frequencies, which is consistent with the duplex theory of sound localization. In contrast, the elephant seal's poorest performance occurred at higher frequencies. The elephant seal's result suggests an inferior ability to utilize interaural level differences and is perhaps related to best hearing sensitivity shifted toward lower frequencies in this species relative to other pinnipeds.

  9. Foaming of mixtures of pure hydrocarbons

    NASA Technical Reports Server (NTRS)

    Robinson, J. V.; Woods, W. W.

    1950-01-01

    Mixtures of pure liquid hydrocarbons are capable of foaming. Nine hydrocarbons were mixed in pairs, in all possible combinations, and four proportions of each combination. These mixtures were sealed in glass tubes, and the foaming was tested by shaking. Mixtures of aliphatic with other aliphatic hydrocarbons, or of alkyl benzenes with other alkyl benzenes, did not foam. Mixtures of aliphatic hydrocarbons with alkyl benzenes did foam. The proportions of the mixtures greatly affected the foaming, the maximum foaming of 12 of 20 pairs being at the composition 20 percent aliphatic hydrocarbon, 80 percent alkyl benzene. Six seconds was the maximum foam lifetime of any of these mixtures. Aeroshell 120 lubricating oil was fractionated into 52 fractions and a residue by extraction with acetone in a fractionating extractor. The index of refraction, foam lifetime, color, and viscosity of these fractions were measured. Low viscosity and high index fractions were extracted first. The viscosity of the fractions extracted rose and the index decreased as fractionation proceeded. Foam lifetimes and color were lowest in the middle fractions. Significance is attached to the observation that none of the foam lifetimes of the fractions or residue is as high as the foam lifetime of the original Aeroshell, indicating that the foaming is not due to a particular foaming constituent, but rather to the entire mixture.

  10. Calibration of sound velocimeter in pure water

    NASA Astrophysics Data System (ADS)

    Li, Zhiwei; Zhang, Baofeng; Li, Tao; Zhu, Junchao; Xie, Ziming

    2016-01-01

    Accurate measurement of sound speed is important to calibrate a sound velocity profiler which provides real-time sound velocity to the sonar equipment in oceanographic survey. The sound velocity profiler calculates the sound speed by measuring the time-of-flight of a 1 MHz single acoustic pulse to travel over about 300 mm path. A standard sound velocimeter instrument was invited to calibrate the sound velocity profiler in pure water at temperatures of 278,283, 288, 293, 298, 303 and 308K in a thermostatic vessel at one atmosphere. The sound velocity profiler was deployed in the thermostatic vessel alongside the standard sound velocimeter instrument and two platinum resistance thermometers (PRT) which were calibrated to 0.002k by comparison with a standard PRT. Time of flight circuit board was used to measure the time-of-flight to 22 picosecond precision. The sound speed which was measured by the sound velocity profiler was compared to the standard sound speed calculated by UNESCO to give the laboratory calibration coefficients and was demonstrated agreement with CTD-derived sound speed using Del Grosso's seawater equation after removing a bias.

  11. Ponytail headache: a pure extracranial headache.

    PubMed

    Blau, J N

    2004-05-01

    Fifty of 93 females experienced headache from wearing a ponytail. Pain was experienced only at the site of the hair tie in 10 subjects, extending in others, forwards to the vertex (n = 5) or forehead (n = 7), laterally to the parietal region (n = 8) or temples (n = 3), downwards to the neck (n = 5), or to other areas (n = 12). Loosening the hair relieved pain immediately in 4 subjects, within half an hour in 32, and within an hour in 5 subjects; the remaining 9 subjects were uncertain of pain duration. This headache was preventable by wearing the ponytail more loosely tied. Ponytail headache, well known to females, is not described in the medical literature because the remedy is obvious, therefore those affected do not seek medical advice. This seemingly common headache provides an example of a pure extracranial headache arising from pericranial muscle fascia and tendon traction. Males almost certainly have similar experiences, but were not questioned in this study. Distinguishing intracranial from extracranial headache is essential in diagnosis and treatment. Further research on ponytail and other extracranial headaches could shed light on the mechanism of tension-type headache.

  12. Twofold symmetries of the pure gravity action

    NASA Astrophysics Data System (ADS)

    Cheung, Clifford; Remmen, Grant N.

    2017-01-01

    We recast the action of pure gravity into a form that is invariant under a twofold Lorentz symmetry. To derive this representation, we construct a general parameterization of all theories equivalent to the Einstein-Hilbert action up to a local field redefinition and gauge fixing. We then exploit this freedom to eliminate all interactions except those exhibiting two sets of independently contracted Lorentz indices. The resulting action is local, remarkably simple, and naturally expressed in a field basis analogous to the exponential parameterization of the nonlinear sigma model. The space of twofold Lorentz invariant field redefinitions then generates an infinite class of equivalent representations. By construction, all off-shell Feynman diagrams are twofold Lorentz invariant while all on-shell tree amplitudes are automatically twofold gauge invariant. We extend our results to curved spacetime and calculate the analogue of the Einstein equations. While these twofold invariances are hidden in the canonical approach of graviton perturbation theory, they are naturally expected given the double copy relations for scattering amplitudes in gauge theory and gravity.

  13. Localization of aerial pure tones by pinnipeds.

    PubMed

    Holt, Marla M; Schusterman, Ronald J; Kastak, David; Southall, Brandon L

    2005-12-01

    In this study, minimum audible angles (MAAs) of aerial pure tones were measured in and compared between a northern elephant seal (Mirounga angustirostris), a harbor seal (Phoca vitulina), and a California sea lion (Zalophus californianus). Testing was conducted between 0.8 and 16 kHz in the elephant seal and 0.8 and 20 kHz in the harbor seal and sea lion in a hemi-anechoic chamber using a left/right psychophysical procedure. Performance for the same frequencies was also quantified for discrete speaker separation of 5 degrees from the mid-line. For all subjects, MAAs ranged from approximately 3 degrees to 15 degrees and were generally equal to or larger than those previously measured in the same subjects with a broadband signal. Performance at 5 degrees ranged from chance to 97% correct, depending on frequency and subject. Poorest performance in the sea lion and harbor seal occurred at intermediate frequencies, which is consistent with the duplex theory of sound localization. In contrast, the elephant seal's poorest performance occurred at higher frequencies. The elephant seal's result suggests an inferior ability to utilize interaural level differences and is perhaps related to best hearing sensitivity shifted toward lower frequencies in this species relative to other pinnipeds.

  14. Triplet pairing in pure neutron matter

    NASA Astrophysics Data System (ADS)

    Srinivas, Sarath; Ramanan, S.

    2016-12-01

    We study the zero-temperature BCS gaps for the triplet channel in pure neutron matter using similarity renormalization group (SRG) evolved interactions. We use the dependence of the results on the SRG resolution scale as a tool to analyze medium and many-body corrections. In particular, we study the effects of including the three-body interactions at leading order, which appear at next-to-next-to leading order (N2LO) in the chiral effective field theory (EFT), as well as that of the first-order self-energy corrections on the zero-temperature gap. In addition we also extract the transition temperature as a function of densities and verify the BCS scaling of the zero-temperature gaps to the transition temperature. We observe that the self-energy effects are very crucial in order to reduce the SRG resolution scale dependence of the results, while the three-body effects at the leading order do not change the two-body resolution scale dependence. On the other hand, the results depend strongly on the three-body cutoff, emphasizing the importance of the missing higher-order three-body effects. We also observe that self-energy effects reduce the overall gap as well as shift the gap closure to lower densities.

  15. Triplet pairing in pure neutron matter

    NASA Astrophysics Data System (ADS)

    Srinivas, Sarath; Ramanan, Sunethra

    2016-09-01

    We study the zero temperature BCS gaps for the triplet channel in pure neutron matter using Similarity Renormalization Group (SRG) evolved interactions. We use the dependence of the results on the SRG resolution scale, as a tool to analyze medium and many-body corrections. In particular, we study the effects of including the three-body interactions at leading order, which appear at N2LO in the Chiral EFT, as well as that of the first-order self-energy corrections on the zero temperature gap. In addition we also extract the transition temperature as a function of densities and verify the BCS scaling of the zero temperature gaps to the transition temperature. We observe that the self-energy effects are very crucial in order to reduce the resolution scale dependence of the results, while the three-body effects at the leading order do not change the two-body resolution scale depdendence. On the other hand, the results depend strongly on the three-body cut-off, emphasizing the importance of the missing higher-order three-body effects. We also observe that self-energy effects reduce the overall gap as well as shift the gap closure to lower densities.

  16. Reduction of hydrogen content in pure Ti

    NASA Astrophysics Data System (ADS)

    Ogiwara, N.; Suganuma, K.; Hikichi, Y.; Kamiya, J.; Kinsho, M.; Sukenobu, S.

    2008-03-01

    Pure Ti is adopted as a material for ducts and bellows at the proton accelerator 3 GeV-RCS in J-PARC project, because of its small residual radioactivity. In the particle accelerator, the H2 outgassing due to ion impact is often the dominant source of gas release. As the reduction of hydrogen content will probably suppress ion induced desorption, we attempted to reduce the hydrogen content in the Ti by in-situ vacuum baking. First, thermal desorption behavior and the change in hydrogen content after the heat treatment were investigated. Vacuum firing at temperatures higher than 550°C was effective in reducing the hydrogen content in the Ti. At the same time, the mechanical properties were monitored because grain growth leads to decrease in mechanical strength. Even after treatment at 750°C for 12 hr, the decreases in tensile and yield strength were so small (~10%) that we have no anxiety about the reduction of mechanical strength. Based upon the results of this study, vacuum firing has been applied to reduce the hydrogen content in the Ti bellows and ducts of the RCS machine.

  17. Purely antiferromagnetic magnetoelectric random access memory

    PubMed Central

    Kosub, Tobias; Kopte, Martin; Hühne, Ruben; Appel, Patrick; Shields, Brendan; Maletinsky, Patrick; Hübner, René; Liedke, Maciej Oskar; Fassbender, Jürgen; Schmidt, Oliver G.; Makarov, Denys

    2017-01-01

    Magnetic random access memory schemes employing magnetoelectric coupling to write binary information promise outstanding energy efficiency. We propose and demonstrate a purely antiferromagnetic magnetoelectric random access memory (AF-MERAM) that offers a remarkable 50-fold reduction of the writing threshold compared with ferromagnet-based counterparts, is robust against magnetic disturbances and exhibits no ferromagnetic hysteresis losses. Using the magnetoelectric antiferromagnet Cr2O3, we demonstrate reliable isothermal switching via gate voltage pulses and all-electric readout at room temperature. As no ferromagnetic component is present in the system, the writing magnetic field does not need to be pulsed for readout, allowing permanent magnets to be used. Based on our prototypes, we construct a comprehensive model of the magnetoelectric selection mechanisms in thin films of magnetoelectric antiferromagnets, revealing misfit induced ferrimagnetism as an important factor. Beyond memory applications, the AF-MERAM concept introduces a general all-electric interface for antiferromagnets and should find wide applicability in antiferromagnetic spintronics. PMID:28045029

  18. Pure gauge spin-orbit couplings

    NASA Astrophysics Data System (ADS)

    Shikakhwa, M. S.

    2017-01-01

    Planar systems with a general linear spin-orbit interaction (SOI) that can be cast in the form of a non-Abelian pure gauge field are investigated using the language of non-Abelian gauge field theory. A special class of these fields that, though a 2×2 matrix, are Abelian are seen to emerge and their general form is given. It is shown that the unitary transformation that gauges away these fields induces at the same time a rotation on the wave function about a fixed axis but with a space-dependent angle, both of which being characteristics of the SOI involved. The experimentally important case of equal-strength Rashba and Dresselhaus SOI (R+D SOI) is shown to fall within this special class of Abelian gauge fields, and the phenomenon of persistent spin helix (PSH) that emerges in the presence of this latter SOI in a plane is shown to fit naturally within the general formalism developed. The general formalism is also extended to the case of a particle confined to a ring. It is shown that the Hamiltonian on a ring in the presence of equal-strength R+D SOI is unitarily equivalent to that of a particle subject to only a spin-independent but θ-dependent potential with the unitary transformation relating the two being again the space-dependent rotation operator characteristic of R+D SOI.

  19. Three new enantiomerically pure ferrocenylphosphole compounds.

    PubMed

    López Cortés, José Guadalupe; Vincendeau, Sandrine; Daran, Jean Claude; Manoury, Eric; Gouygou, Maryse

    2006-05-01

    The absolute configurations of three new enantiomerically pure ferrocenylphosphole compounds, namely (2S,4S,S(Fc))-4-methoxymethyl-2-[2-(9-thioxo-9lambda5-phosphafluoren-9-yl)ferrocenyl]-1,3-dioxane, [Fe(C5H5)(C23H22O3PS)], (III), (S(Fc))-[2-(9-thioxo-9lambda5-phosphafluoren-9-yl)ferrocenyl]methanol, [Fe(C5H5)(C18H14OPS)], (V), and (S(Fc))-diphenyl[2-(9-thioxo-9lambda5-phosphafluoren-9-yl]ferrocenylmethyl]phosphine, [Fe(C5H5)(C30H23P2)], (VIII), have been unambiguously established. All three ligands contain a planar chiral ferrocene group, bearing a dibenzophosphole and either a dioxane, a methanol or a diphenylphosphinomethane group on the same cyclopentadienyl. In compound (V), the occurrence of O-H...S and C-H...S hydrogen bonds results in the formation of a two-dimensional network parallel to (001). The geometry of the ferrocene frameworks agrees with related reported structures.

  20. Degradable quantum channels using pure-state to product-of-pure-state isometries

    NASA Astrophysics Data System (ADS)

    Siddhu, Vikesh; Griffiths, Robert B.

    2016-11-01

    We consider a family of quantum channels characterized by the fact that certain (in general nonorthogonal) pure states at the channel entrance are mapped to (tensor) products of pure states (PPP; hence "pcubed") at the complementary outputs (the main output and the "environment") of the channel. The pcubed construction, a reformulation of the twisted-diagonal procedure by M. M. Wolf and D. Pérez-García [Phys. Rev. A 75, 012303 (2007)], 10.1103/PhysRevA.75.012303, can be used to produce a large class of degradable quantum channels; degradable channels are of interest because their quantum capacities are easy to calculate. Several known types of degradable channels are either pcubed channels, or subchannels (employing a subspace of the channel entrance), or continuous limits of pcubed channels. The pcubed construction also yields channels which are neither degradable nor antidegradable (i.e., the complement of a degradable channel); a particular example of a qutrit channel of this type is studied in some detail. Determining whether a pcubed channel is degradable or antidegradable or neither is quite straightforward given the pure input and output states that characterize the channel. Conjugate degradable pcubed channels are always degradable.

  1. Characterizing commercial pureed foods: sensory, nutritional, and textural analysis.

    PubMed

    Ettinger, Laurel; Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Dysphagia (swallowing impairment) is a common consequence of stroke and degenerative diseases such as Parkinson's and Alzheimer's. Limited research is available on pureed foods, specifically the qualities of commercial products. Because research has linked pureed foods, specifically in-house pureed products, to malnutrition due to inferior sensory and nutritional qualities, commercial purees also need to be investigated. Proprietary research on sensory attributes of commercial foods is available; however direct comparisons of commercial pureed foods have never been reported. Descriptive sensory analysis as well as nutritional and texture analysis of commercially pureed prepared products was performed using a trained descriptive analysis panel. The pureed foods tested included four brands of carrots, of turkey, and two of bread. Each commercial puree was analyzed for fat (Soxhlet), protein (Dumas), carbohydrate (proximate analysis), fiber (total fiber), and sodium content (Quantab titrator strips). The purees were also texturally compared with a line spread test and a back extrusion test. Differences were found in the purees for sensory attributes as well as nutritional and textural properties. Findings suggest that implementation of standards is required to reduce variability between products, specifically regarding the textural components of the products. This would ensure all commercial products available in Canada meet standards established as being considered safe for swallowing.

  2. Pure-phase and pure-amplitude hologram design using the method of generalized projections

    NASA Astrophysics Data System (ADS)

    Catino, William Charles

    The overall contribution of the research presented in this dissertation is a systematic procedure for designing computer-generated holograms subject to far-field image constraints. The method of generalized projections is used to design pure-phase and pure-amplitude diffraction holograms that generate prescribed gray-scale images in the Fourier frequency plane. Performance is demonstrated with objective measures (error, efficiency, and variance), as well as with subjective comparison of images. Test images include a photographic quality image of Lena, a uniform intensity spot array, and a binary amplitude block text image. Projection algorithms are derived for pure-phase holograms with both continuous and quantized phase characteristics from a prescribed far-field magnitude constraint. The performance of the pure-phase hologram designs, as measured in the far-field image, is always very good for the continuous phase case and for the quantized phase case with a large number of phase quantization levels. However, as the number of quantization levels decreases, the performance typically degrades. Performance is significantly improved by constraining the energy in mutually exclusive cliques, that is, groups of image plane (far-field) pixels, instead of constraining the intensity of each individual pixel. Even for the binary phase case, acceptable images are generated with the clique energy algorithm. The method of generalized projections is also used to design pure-amplitude diffraction holograms using a prescribed image intensity constraint. Two algorithms are derived: the direct method, which nonlinearly constrains the hologram transmittance to the range of real values in (0,1); and the indirect method, which constrains the transmittance values to the real axis, and linearly transforms the resulting values to the range (0,1). Digital amplitude holograms are simulated by quantizing the amplitude holograms resulting from the indirect method. The indirect method

  3. Pure Obsessive Compulsive Disorder in Three Generations

    PubMed Central

    Rahimi, Alireza; Haghighi, Mohammad; Shamsaei, Farshid

    2015-01-01

    Introduction: Obsessive-compulsive disorder (OCD) is a psychiatric disorder, which has been shown to affect 2 - 3.5% of people, during their lifetimes. Identification of familial more homogenous characteristics of OCD may help to define relevant subtypes and increase the power of genetic and neurobiological studies of OCD. Case Presentation; This case report describes an adult woman suffering from symptoms of energy loss, insomnia, lack of appetite, and depressed mood. The patient history was positive for counting coercion. The patient’s genogram revealed counting coercion in three generations of her family. Conclusions: This case highlights the issue whether counting can be a distinctive feature among inflicted and not inflicted individuals, such as hoarding. Also, it is still unclear what is it really transferred; the vulnerability to disease, which is transferred among three generations, or the symptoms of counting itself, by genes. Further studies are required to answer the debates on this issue. PMID:26288641

  4. Predictions of pure liquid shock Hugoniots

    SciTech Connect

    Hobbs, M.L.; Baer, M.R.

    1998-06-01

    Determination of product species and associated equations-of-state (EOS) for energetic materials such as pyrotechnics with complex elemental compositions remains a major unsolved problem. Although, empirical EOS models may be calibrated to replicate detonation conditions within experimental variability (5--10%), different states, e.g. expansion, may produce significant discrepancy with data if the basic form of the EOS model is incorrect. A more physically realistic EOS model based on intermolecular potentials, such as the Jacobs Cowperthwaite Zwisler (JCZ3) EOS, is needed to predict detonation states as well as expanded states. Predictive capability for any EOS requires a large species data base composed of a wide variety of elements. Unfortunately, only 20 species have known exponential 6 (EXP 6) molecular force constants which are used in the JCZ3-EOS. Of these 20 species, only 10 have been adequately compared to experimental data such as molecular scattering or shock Hugoniot data. Since data in the strongly repulsive region of the molecular potential is limited, alternative methods must be found to deduce force constants for a larger number of species. The objective of the present study is to determine JCZ3 product species force constants using corresponding state theory. Intermolecular potential parameters were obtained for a variety of gas species using a simple corresponding states technique with critical volume and critical temperature. A more complex, four parameter corresponding state method with shape and polarity corrections was also used to obtain intermolecular potential parameters. Both corresponding state methods were used to predict shock Hugoniot data obtained from pure liquids. The simple corresponding state method is shown to give adequate agreement with shock Hugoniot data.

  5. Nonhematopoietic Nrf2 dominantly impedes adult progression of sickle cell anemia in mice

    PubMed Central

    Ghosh, Samit; Ihunnah, Chibueze A.; Hazra, Rimi; Walker, Aisha L.; Hansen, Jason M.; Archer, David R.; Owusu-Ansah, Amma T.; Ofori-Acquah, Solomon F.

    2016-01-01

    The prevention of organ damage and early death in young adults is a major clinical concern in sickle cell disease (SCD). However, mechanisms that control adult progression of SCD during the transition from adolescence are poorly defined with no cognate prophylaxis. Here, we demonstrate in a longitudinal cohort of homozygous SCD (SS) mice a link between intravascular hemolysis, vascular inflammation, lung injury, and early death. Prophylactic Nrf2 activation in young SS mice stabilized intravascular hemolysis, reversed vascular inflammation, and attenuated lung edema in adulthood. Enhanced Nrf2 activation in endothelial cells in vitro concurred with the dramatic effect on vascular inflammation in the mice. BM chimeric SS mice lacking Nrf2 expression in nonhematopoietic tissues were created to dissect the role of nonerythroid Nrf2 in SCD progression. The SS chimeras developed severe intravascular hemolysis despite having erythroid Nrf2. In addition, they developed premature vascular inflammation and pulmonary edema and died younger than donor littermates with intact nonhematopoietic Nrf2. Our results reveal a dominant protective role for nonhematopoietic Nrf2 against tissue damage in both erythroid and nonerythroid tissues in SCD. Furthermore, we show that prophylactic augmentation of Nrf2-coordinated cytoprotection effectively impedes onset of the severe adult phenotype of SCD in mice. PMID:27158670

  6. The erythroid function of transferrin receptor 2 revealed by Tmprss6 inactivation in different models of transferrin receptor 2 knockout mice

    PubMed Central

    Nai, Antonella; Pellegrino, Rosa M.; Rausa, Marco; Pagani, Alessia; Boero, Martina; Silvestri, Laura; Saglio, Giuseppe; Roetto, Antonella; Camaschella, Clara

    2014-01-01

    Transferrin receptor 2 (TFR2) is a transmembrane glycoprotein expressed in the liver and in the erythroid compartment, mutated in a form of hereditary hemochromatosis. Hepatic TFR2, together with HFE, activates the transcription of the iron-regulator hepcidin, while erythroid TFR2 is a member of the erythropoietin receptor complex. The TMPRSS6 gene, encoding the liver-expressed serine protease matriptase-2, is the main inhibitor of hepcidin and inactivation of TMPRSS6 leads to iron deficiency with high hepcidin levels. Here we evaluate the phenotype resulting from the genetic loss of Tmprss6 in Tfr2 total (Tfr2−/−) and liver-specific (Tfr2LCKO) knockout mice. Tmprss6−/−Tfr2−/− and Tmprss6−/−Tfr2LCKO mice have increased hepcidin levels and show iron-deficiency anemia like Tmprss6−/−mice. However, while Tmprss6−/−Tfr2LCKO are phenotypically identical to Tmprss6−/− mice, Tmprss6−/−Tfr2−/− mice have increased red blood cell count and more severe microcytosis than Tmprss6−/− mice. In addition hepcidin expression in Tmprss6−/−Tfr2−/− mice is higher than in the wild-type animals, but lower than in Tmprss6−/− mice, suggesting partial inhibition of the hepcidin activating pathway. Our results prove that hepatic TFR2 acts upstream of TMPRSS6. In addition Tfr2 deletion causes a relative erythrocytosis in iron-deficient mice, which likely attenuates the effect of over-expression of hepcidin in Tmprss6−/− mice. Since liver-specific deletion of Tfr2 in Tmprss6−/− mice does not modify the erythrocyte count, we speculate that loss of Tfr2 in the erythroid compartment accounts for the hematologic phenotype of Tmprss6−/−Tfr2−/− mice. We propose that TFR2 is a limiting factor for erythropoiesis, particularly in conditions of iron restriction. PMID:24658816

  7. Typical pure nonequilibrium steady states and irreversibility for quantum transport.

    PubMed

    Monnai, Takaaki; Yuasa, Kazuya

    2016-07-01

    It is known that each single typical pure state in an energy shell of a large isolated quantum system well represents a thermal equilibrium state of the system. We show that such typicality holds also for nonequilibrium steady states (NESS's). We consider a small quantum system coupled to multiple infinite reservoirs. In the long run, the total system reaches a unique NESS. We identify a large Hilbert space from which pure states of the system are to be sampled randomly and show that the typical pure states well describe the NESS. We also point out that the irreversible relaxation to the unique NESS is important to the typicality of the pure NESS's.

  8. Pure endoscopic management of epileptogenic hypothalamic hamartomas.

    PubMed

    Chibbaro, S; Cebula, H; Scholly, J; Todeschi, J; Ollivier, I; Timofeev, A; Ganau, M; Di Emidio, P; Valenti, M P; Staack, A M; Bast, T; Steinhoff, B J; Hirsch, E; Kehrli, P; Proust, F

    2017-02-07

    Hypothalamic hamartomas (HH) are rare congenital malformations located in the region of the tuber cinereum and third ventricle. Their usual clinical presentation is characterized by gelastic/dacrystic seizures which often become pharmaco-resistant and progress to secondary focal/generalized intractable epilepsy causing mostly in children cognitive and behavioral problems (particularly in cases of progressive epileptic encephalopathy) and precocious puberty. Whereas gelastic seizures can be surgically controlled either by resection of the lesion or disconnection (tissue-destructive) procedures, aimed at functionally prevent the spreading of the epileptic burst; generalized seizures tend to respond better to HH excision rather than isolated neocortical resections, which generally fail to control them. Prospective analysis of 14 consecutive patients harboring HH treated in an 8-year period; 12 patients had unilateral and two bilateral HH. All patients were managed by pure endoscopic excision of the HH. The mean operative time was 48 min and mean hospital stay was 2 days; perioperative blood loss was negligible in all cases. Two patients showed a transient diabetes insipidus (DI); no transient or permanent postoperative neurological deficit or memory impairment was recorded. Complete HH excision was achieved in 10/14 patients. At a mean follow-up of 48 months, no wound infection, meningitis, postoperative hydrocephalus, and/or mortality were recorded in this series of patients. Eight patients became seizure free (Engel class I), 2 other experienced worthwhile improvement of disabling seizures (Engel class II); 2 patients were cured from gelastic attacks while still experiencing focal dyscognitive seizures; and 2, having bilateral HH (both undergoing unilateral HH excision), did not experience significant improvement and required later on a temporal lobectomy coupled to amygdalohyppocampectomy. Overall, the followings resulted to be predictive factors for better

  9. Pure Culture Fermentation of Green Olives1

    PubMed Central

    Etchells, J. L.; Borg, A. F.; Kittel, I. D.; Bell, T. A.; Fleming, H. P.

    1966-01-01

    The method previously developed by us for the pure-culture fermentation of brined cucumbers and other vegetables has been applied successfully to Manzanillo variety olives. Field-run grade fruit was processed first by conventional procedures to remove most of the bitterness. Then the relative abilities of Lactobacillus plantarum, L. brevis, Pediococcus cerevisiae, and Leuconostoc mesenteroides to become established and produce acid in both heat-shocked (74 C for 3 min) and unheated olives, brined at 4.7 to 5.9% NaCl (w/v basis), were evaluated. The heat-shock treatment not only proved effective in ridding the fruit of naturally occurring, interfering, and competitive microbial groups prior to brining and inoculation, but also made the olives highly fermentable with respect to growth and acid production by the introduced culture, particularly L. plantarum. Of the four species used as inocula, L. plantarum was by far the most vigorous in fermentation ability. It consistently produced the highest levels of brine acidity (1.0 to 1.2% calculated as lactic acid) and the lowest pH values (3.8 to 3.9) during the fermentation of heat-shocked olives. Also, L. plantarum completely dominated fermentations when used in two-species (with P. cerevisiae) and three-species (with P. cerevisiae and L. brevis) combinations as inocula. In contrast, when L. plantarum was inoculated into the brines of unheated olives it failed to become properly established; the same was true for the other species tested, but even to a more pronounced degree. L. brevis was the only species used that failed to develop in brines of both heat-shocked and unheated olives. Modification of the curing brine by the addition of lactic acid at the outset, either with or without dextrose, led to a much earlier onset of fermentation with accompanying acid development, as compared to treatments with dextrose alone or nonadditive controls. Reasons for the marked improvement of the fermentability of Manzanillo olives

  10. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    PubMed

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  11. Efficacy of Rapamycin as Inducer of Hb F in Primary Erythroid Cultures from Sickle Cell Disease and β-Thalassemia Patients.

    PubMed

    Pecoraro, Alice; Troia, Antonio; Calzolari, Roberta; Scazzone, Concetta; Rigano, Paolo; Martorana, Adriana; Sacco, Massimiliano; Maggio, Aurelio; Di Marzo, Rosalba

    2015-01-01

    Phenotypic improvement of hemoglobinopathies such as sickle cell disease and β-thalassemia (β-thal) has been shown in patients with high levels of Hb F. Among the drugs proposed to increase Hb F production, hydroxyurea (HU) is currently the only one proven to improve the clinical course of these diseases. However, Hb F increase and patient's response are highly variable, indicating that new pharmacological agents could be useful for patients not responding to HU or showing a reduction of response during long-term therapy. In this study we evaluated the efficacy of rapamycin, a lypophilic macrolide used for the prevention of acute rejection in renal transplant recipients, as an inducer of Hb F production. The analyses were performed in cultured erythroid progenitors from 25 sickle cell disease and 25 β-thal intermedia (β-TI) patients. The use of a quantitative Real-Time-polymerase chain reaction ReTi-PCR technique and high performance liquid chromatography (HPLC) allowed us to determine the increase in γ-globin mRNA expression and Hb F production in human erythroid cells treated with rapamycin. The results of our study demonstrated an increase in vitro of γ-globin mRNA expression in 15 sickle cell disease and 14 β-TI patients and a corresponding Hb F increase. The induction by rapamycin, even if lower or similar in most of samples analyzed, in some cases was higher than HU. These data suggest that rapamycin could be a good candidate to be used in vivo for the treatment of hemoglobinopathies.

  12. Erythroid progenitor cells (CFU-E*) from Friend virus-infected mice undergo VVFe suicide in vitro in the absence of added erythropoietin

    SciTech Connect

    Del Rizzo, D.F.; Axelrad, A.A.

    1985-11-01

    The authors have investigated the effect of VVFe on the survival in suspension of erythropoietin (epo)-independent erythroid progenitor cells (CFU-E*) induced by Friend polycythemia virus (FV). Spleen cells from C3Hf/Bi mice previously infected with FV were exposed to carrier-free VVFe, and the survival of CFU-E* as a function of time in liquid medium was determined from the number of erythroid colonies that developed from these cells seeded in plasma cultures without added epo. The results showed that spleen CFU-E* were highly vulnerable to VVFe. Marrow CFU-E* behaved in a similar manner. The VVFe responsible for their suicide had been presented to the progenitor cells only during the 4-h period of incubation, after which they were washed and plated in excess nonradioactive iron. They therefore conclude that CFU-E* themselves, and not only their progeny, are capable of actively incorporating iron. Under the same conditions in the absence of added epo, the effect of VVFe on the survival of normal spleen or marrow CFU-E could not be assessed because two few normal CFU-E survived the incubation period. Normal bone marrow cells incubated in complete medium containing epo retained their capacity for erythrocytic colony formation, and CFU-E could then be shown to be vulnerable to VVFe. Thus, either the iron-incorporating system of normal CFU-E was inducible by epo, or else epo permitted survival of the CFU-E so that the activity of a constitutive iron-incorporating system could be recognized.

  13. Response to erythropoietin in erythroid subclones of the factor-dependent cell line 32D is determined by translocation of the erythropoietin receptor to the cell surface.

    PubMed Central

    Migliaccio, A R; Migliaccio, G; D'Andrea, A; Baiocchi, M; Crotta, S; Nicolis, S; Ottolenghi, S; Adamson, J W

    1991-01-01

    Regulation of the expression of the erythropoietin (Epo) receptor (EpoR) gene is under the control of transcriptional regulatory factor GATA-1. GATA-1 is expressed widely among the nonerythroid, factor-dependent subclones of the interleukin 3-dependent mouse cell line 32D. Consequently, to determine whether GATA-1 and EpoR gene expression are linked even in nonerythroid cells, we have studied the correlation of GATA-1 expression with expression and function of EpoR in these cell lines. EpoR mRNA (by RNase protection analysis) and EpoR protein (by specific antibody immunoprecipitation of metabolically labeled EpoR protein) were detectable not only in 32D and 32D Epo (an Epo-dependent subclone) but also in 32D GM, a subclone dependent for growth on granulocyte/macrophage colony-stimulating factor. EpoR mRNA also was detectable by PCR in 32D G, a subclone dependent for growth on granulocyte colony-stimulating factor. However, only 32D Epo cells bound 125I-labeled Epo and expressed EpoR protein on the cell surface, as determined by immunoprecipitation of surface-labeled proteins. These results indicate that, in these factor-dependent cell lines, the major regulatory step determining the erythroid-specific response to Epo is the efficiency of EpoR protein translocation to the cell surface. Mechanisms that could affect lineage-specific translocation are the presence of a chaperone protein, erythroid-specific editing of EpoR mRNA, or altered processing of the EpoR protein to the cell surface. In this model, lineage-restricted responses to growth factors such as Epo are determined not by expression of the genes for growth factor receptors but, rather, by appropriate processing of the receptor protein. Images PMID:1722318

  14. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    SciTech Connect

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  15. Forced FOG1 expression in erythroleukemia cells: Induction of erythroid genes and repression of myelo-lymphoid transcription factor PU.1.

    PubMed

    Fujiwara, Tohru; Sasaki, Katsuyuki; Saito, Kei; Hatta, Shunsuke; Ichikawa, Satoshi; Kobayashi, Masahiro; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Harigae, Hideo

    2017-02-16

    The transcription factor GATA-1-interacting protein Friend of GATA-1 (FOG1) is essential for proper transcriptional activation and repression of GATA-1 target genes; yet, the mechanisms by which FOG1 exerts its activating and repressing functions remain unknown. Forced FOG1 expression in human K562 erythroleukemia cells induced the expression of erythroid genes (SLC4A1, globins) but repressed that of GATA-2 and PU.1. A quantitative chromatin immunoprecipitation (ChIP) analysis demonstrated increased GATA-1 chromatin occupancy at both FOG1-activated as well as FOG1-repressed gene loci. However, while TAL1 chromatin occupancy was significantly increased at FOG1-activated gene loci, it was significantly decreased at FOG1-repressed gene loci. When FOG1 was overexpressed in TAL1-knocked down K562 cells, FOG1-mediated activation of HBA, HBG, and SLC4A1 was significantly compromised by TAL1 knockdown, suggesting that FOG1 may require TAL1 to activate GATA-1 target genes. Promoter analysis and quantitative ChIP analysis demonstrated that FOG1-mediated transcriptional repression of PU.1 would be mediated through a GATA-binding element located at its promoter, accompanied by significantly decreased H3 acetylation at lysine 4 and 9 (K4 and K9) as well as H3K4 trimethylation. Our results provide important mechanistic insight into the role of FOG1 in the regulation of GATA-1-regulated genes and suggest that FOG1 has an important role in inducing cells to differentiate toward the erythroid lineage rather than the myelo-lymphoid one by repressing the expression of PU.1.

  16. Recombinant adeno-associated virus (rAAV)-mediated expression of a human gamma-globin gene in human progenitor-derived erythroid cells.

    PubMed Central

    Miller, J L; Donahue, R E; Sellers, S E; Samulski, R J; Young, N S; Nienhuis, A W

    1994-01-01

    Effective gene therapy for the severe hemoglobin (Hb) disorders, sickle-cell anemia and thalassemia, will require an efficient method to transfer, integrate, and express a globin gene in primary erythroid cells. To evaluate recombinant adeno-associated virus (rAAV) for this purpose, we constructed a rAAV vector encoding a human gamma-globin gene (pJM24/vHS432A gamma). Its 4725-nucleotide genome consists of two 180-bp AAV inverted terminal repeats flanking the core elements of hypersensitive sites 2, 3, and 4 from the locus control region of the beta-globin gene cluster, linked to a mutationally marked A gamma-globin gene (A gamma) containing native promoter and RNA processing signals. CD34+ human hematopoietic cells were exposed to rAAV particles at a multiplicity of infection of 500-1000 and cultured in semisolid medium containing several cytokines. A reverse transcriptase polymerase chain reaction assay distinguished mRNA signals derived from transduced and endogenous human gamma-globin genes. Twenty to 40% of human erythroid burst-forming unit-derived colonies expressed the rAAV-transduced A gamma-globin gene at levels 4-71% that of the endogenous gamma-globin genes. The HbF content of pooled control colonies was 26%, whereas HbF was 40% of the total in pooled colonies derived from rAAV transduced progenitors. These data establish that rAAV containing elements from the locus control region linked to a gamma-globin gene are capable of transferring and expressing that gene in primary human hematopoietic cells resulting in a substantial increase in HbF content. Images PMID:7524085

  17. Cell-specific overactivation of nuclear erythroid 2 p45-related factor 2-mediated gene expression in myeloid cells decreases hepatic ischemia/reperfusion injury.

    PubMed

    Lee, Lung-Yi; Harberg, Calvin; Matkowskyj, Kristina A; Cook, Shelly; Roenneburg, Drew; Werner, Sabine; Johnson, Delinda A; Johnson, Jeffrey A; Foley, David P

    2016-08-01

    Hepatic ischemia/reperfusion injury (IRI) is an unavoidable consequence of liver transplantation that can lead to postoperative hepatic dysfunction. Myeloid cells that include Kupffer cells, monocytes, and neutrophils contribute to the inflammatory response and cellular injury observed during hepatic IRI. We hypothesize that overactivation of the nuclear erythroid 2 p45-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway in myeloid cells leads to decreased cellular damage after hepatic IRI. We constructed transgenic mice with constitutively active nuclear erythroid 2 p45-related factor 2 (caNrf2) that over activates the Nrf2-ARE pathway in myeloid cells (lysozyme M cre recombinase [LysMcre]+/caNrf2+, n = 9), and their littermate controls lacking transgene expression (LysMcre+/caNrf2-, n = 11). The mice underwent either sham or partial hepatic ischemia surgery, with 60 minutes of ischemia followed by 6 hours of reperfusion. After IRI, LysMcre+/caNrf2+ mice demonstrated significantly decreased serum alanine aminotransferase and decreased areas of necrosis. Immunohistochemistry and immunoblot of caspase 3 showed a significantly decreased cleaved to full-length caspase 3 ratio in LysMcre+/caNrf2+ animals. Lymphocyte antigen 6 complex locus G and CD68 staining demonstrated reduced inflammatory cell infiltration. LysMcre+/caNrf2+ animals also had significantly decreased gene expression of proinflammatory cytokines, including interleukin (IL) 1β, IL6, tumor necrosis factor α, chemokine (C-C motif) ligand 2, and chemokine (C-X-C motif) ligand 10, and significantly decreased levels of 8-isoprostanes. In our model, Nrf2 overactivation in myeloid cells leads to decreased hepatocellular damage, necrosis, apoptosis, inflammation, and oxidative stress. Pharmacologic targeting of the Nrf2-ARE pathway in myeloid cells may be a novel strategy to mitigate hepatic IRI. Liver Transplantation 22 1115-1128 2016 AASLD.

  18. Structural and dynamic study of the tetramerization region of non-erythroid alpha-spectrin: a frayed helix revealed by site-directed spin labeling electron paramagnetic resonance.

    PubMed

    Li, Qufei; Fung, L W-M

    2009-01-13

    The N-terminal region of alpha-spectrin is responsible for its association with beta-spectrin in a heterodimer, forming functional tetramers. Non-erythroid alpha-spectrin (alphaII-spectrin) has a significantly higher association affinity for beta-spectrin than the homologous erythroid alpha-spectrin (alphaI-spectrin). We have previously determined the solution structure of the N-terminal region of alphaI-spectrin by NMR methods, but currently no structural information is available for alphaII-spectrin. We have used cysteine scanning, spin labeling electron paramagnetic resonance (EPR), and isothermal titration calorimetry (ITC) methods to study the tetramerization region of alphaII-spectrin. EPR data clearly show that, in alphaII-spectrin, the first nine N-terminal residues were unstructured, followed by an irregular helix (helix C'), frayed at the N-terminal end, but rigid at the C-terminal end, which merges into the putative triple-helical structural domain. The region corresponding to the important unstructured junction region linking helix C' to the first structural domain in alphaI-spectrin was clearly structured. On the basis of the published model for aligning helices A', B', and C', important interactions among residues in helix C' of alphaI- and alphaII-spectrin and helices A' and B' of betaI- and betaII-spectrin are identified, suggesting similar coiled coil helical bundling for spectrin I and II in forming tetramers. The differences in affinity are likely due to the differences in the conformation of the junction regions. Equilibrium dissociation constants of spin-labeled alphaII and betaI complexes from ITC measurements indicate that residues 15, 19, 37, and 40 are functionally important residues in alphaII-spectrin. Interestingly, all four corresponding homologous residues in alphaI-spectrin (residues 24, 28, 46, and 49) have been reported to be clinically significant residues involved in hematological diseases.

  19. Proteasome-Mediated Proteolysis of SRSF5 Splicing Factor Intriguingly Co-occurs with SRSF5 mRNA Upregulation during Late Erythroid Differentiation

    PubMed Central

    Breig, Osman; Baklouti, Faouzi

    2013-01-01

    SR proteins exhibit diverse functions ranging from their role in constitutive and alternative splicing, to virtually all aspects of mRNA metabolism. These findings have attracted growing interest in deciphering the regulatory mechanisms that control the tissue-specific expression of these SR proteins. In this study, we show that SRSF5 protein decreases drastically during erythroid cell differentiation, contrasting with a concomitant upregulation of SRSF5 mRNA level. Proteasome chemical inhibition provided strong evidence that endogenous SRSF5 protein, as well as protein deriving from stably transfected SRSF5 cDNA, are both targeted to proteolysis as the cells undergo terminal differentiation. Consistently, functional experiments show that overexpression of SRSF5 enhances a specific endogenous pre-mRNA splicing event in proliferating cells, but not in differentiating cells, due to proteasome-mediated targeting of both endogenous and transfection-derived SRSF5. Further investigation of the relationship between SRSF5 structure and its post-translation regulation and function, suggested that the RNA recognition motifs of SRSF5 are sufficient to activate pre-mRNA splicing, whereas proteasome-mediated proteolysis of SRSF5 requires the presence of the C-terminal RS domain of the protein. Phosphorylation of SR proteins is a key post-translation regulation that promotes their activity and subcellular availability. We here show that inhibition of the CDC2-like kinase (CLK) family and mutation of the AKT phosphorylation site Ser86 on SRSF5, have no effect on SRSF5 stability. We reasoned that at least AKT and CLK signaling pathways are not involved in proteasome-induced turnover of SRSF5 during late erythroid development. PMID:23536862

  20. Polymyositis - adult

    MedlinePlus

    ... rash is a sign of a similar condition, dermatomyositis . Common symptoms include: Muscle weakness in the shoulders ... in the treatment of refractory adult and juvenile dermatomyositis and adult polymyositis: a randomized, placebo-phase trial. ...

  1. 1. SOUTH AND WEST ELEVATION OF ILLINOIS PURE ALUMINUM (IPA) ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. SOUTH AND WEST ELEVATION OF ILLINOIS PURE ALUMINUM (IPA) COMPANY FACTORY; SOUTH ELEVATION FACING ILLINOIS CENTRAL GULF RAILROAD TRACKS AND MAIN STREET. THE ONE-STORY BRICK BUILDING TO THE LEFT IS AN ABANDONED COMMONWEALTH EDISON COMPANY ELECTRICAL SUBSTATION. - Illinois Pure Aluminum Company, 109 Holmes Street, Lemont, Cook County, IL

  2. Physical and Spiritual Education within the Framework of Pure Life

    ERIC Educational Resources Information Center

    Bagheri Noaparast, Khosrow

    2013-01-01

    This paper aims at showing the dimensions of spirituality in childhood education by suggesting a new analysis of the concept of "pure life" used in the Qur'an. Putting spirituality in the framework of the pure life provides us with a rich framework in dealing with spirituality as the latter will be extended to all dimensions of a life. In the…

  3. Keeping consumers safe: food providers' perspectives on pureed food.

    PubMed

    Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Twelve focus groups were conducted in five sites with 80 allied health providers to identify their perspectives on providing pureed food to consumers. Thematic care analysis was completed to summarize and interpret these data. Providers' greatest concern was keeping consumers safe, and the right texture was prioritized over sensory appeal and acceptance. Providers recognized that these foods impacted the quality of life of consumers and worked to rationalize these diets with residents/patients and their families. In addition, offering foods they knew to be poorly accepted affected their self-concept as providers. As a result of these challenges, they did whatever they could in the kitchen and tableside to promote intake of pureed foods. Those in the "food chain" of pureed food provision suggested several ways to further improve these products. Greater communication between those who assist consumers with eating and those who produce the pureed food they consume is needed to promote acceptable pureed products.

  4. [The left central gyral lesion and pure anarthria].

    PubMed

    Tabuchi, M; Odashima, K; Fujii, T; Suzuki, K; Saitou, J; Yamadori, A

    2000-05-01

    We report a very rare case of pure anarthria with lesion analysis. A 44-year-old right-handed man suffered from a cerebral infarction with a mild right hemiparesis and speech disturbance. An MRI of the brain 1.5 months post onset revealed a lesion confined to the left central gyrus. One month after the onset, his spontaneous speech was dysprosodic and laborious. It was contaminated with dysarthria and phonological paraphasias. However, language comprehension, repetition and naming abilities were normal. Most remarkably he showed no impairment in writing with his left hand. Over the following months, his difficulties in verbal output showed general amelioration, but the isolated impairment in the domain of articulation characterized by dysprosody, dysarthria, and phonological paraphasia persisted. As for the symptomatology of pure anarthria resulting from precentral gyral lesions, there have been controversies about its pureness. Some argue that the so called pure anarthria always shows some degree of writing disturbances, albeit mild in degree. Others maintain there certainly exists the pure type without any signs of agraphia. In the present case lesions were limited to the central gyrus but spared the lowest opercular portion. The previous reports of pure anarthria that had mild agraphia all had lesions involving the opercular portion. We conclude the sparing of this area is most likely related with sparing of writing capacity in pure anarthria.

  5. [The role of fetus decalcified bone matrix (FDBM) in inducing pure titanium-bone implant integration].

    PubMed

    Zou, L; Zhang, D; Wang, W

    1998-05-01

    Because of its high biological compatibility, titanium has been a good biomaterial. The implanted artificial bone made from titanium can contact with the vital and mature osseous tissue directly within 3-6 months, the so-called osteointergration. In order to promote the process of osteointergration, FDBM of rabbit was prepared and was combined with pure titanium so as to speed up osteointergration. The study focused on bone density, bone intergration rate, new bone growth rate around the pure titanium, and the Ca2+ and PO(4)3- density of titanium-bone interface. A control group of pure titanium inplant without FDBM was set up. The results showed FDBM had no antigenicity. It could induce and speed up the new bone formation at titanium-bone interface. The titanium-bone intergration time was within 2 months. It was suggested that there were more bone morphogenesis protein (BMP) or other bone induction and bone formation factors in brephobone than that in child and adult bone. As a kind of bone induction material, FDBM was easy prepared, cheap in price, easy to storage, no antigenicity and obvious bone-inductive function.

  6. Inhibition of erythroid differentiation and induction of megakaryocytic differentiation by thrombopoietin are regulated by two different mechanisms in TPO-dependent UT-7/c-mpl and TF-1/c-mpl cell lines.

    PubMed

    Goncalves, F; Lacout, C; Féger, F; Cohen-Solal, K; Guichard, J; Cramer, E; Vainchenker, W; Duménil, D

    1998-09-01

    Thrombopoietin (TPO) regulates megakaryocytic (MK) maturation and platelet production. Molecular and cellular mechanisms of the TPO-induced MK differentiation are not totally understood. In order to develop cellular models to study these mechanisms, we introduced c-mpl into UT-7 and TF-1 cells by means of a retroviral vector and compared the effects of TPO on these two cell lines. UT-7 and TF-1 cell lines are two factor-dependent leukemic cell lines with an erythroid and MK phenotype. They proliferate in response to IL-3, GM-CSF and EPO, but not to TPO. The erythroid differentiation of both cell lines can be markedly increased by EPO. Several UT-7/c-mpl and TF-1/c-mpl cell clones which express different levels of the c-mpl protein (Mpl) were obtained and all became TPO-dependent for their proliferation. The UT-7/c-mpl clones, but not the TF-1/c-mpl clones, were capable of undergoing MK differentiation in response to TPO. This was demonstrated by the increase in MK markers (GPIIb, GPIIIa, GPIb alpha, GPIX and vWF), the appearance of cytoplasmic alpha-granules, intracellular membranes resembling demarcation membranes which were immunologically labeled with an GPIIb/IIIa anti-antibody, and a small percentage of polyploid cells (8N and 16N). In contrast, TPO inhibited the erythroid program of differentiation (glycophorin A, beta-globin and EPO receptor) as well as the differentiative activity of EPO in both UT-7/c-mpl and TF-1/c-mpl clones. It is noteworthy that the differentiative effect of EPO in TF-1/c-mpl cells was associated with an increase in GATA-1 transcripts which was totally suppressed by TPO. Overall the effects of TPO are the same as those of phorbol myristate acetate (PMA) which also induces MK differentiation and inhibits erythroid differentiation. These results suggest that: (1) Mpl expression is necessary but not sufficient for induction of MK differentiation; and (2) induction of Mk differentiation and inhibition of erythroid differentiation by TPO

  7. Shunting arc plasma source for pure carbon ion beama)

    NASA Astrophysics Data System (ADS)

    Koguchi, H.; Sakakita, H.; Kiyama, S.; Shimada, T.; Sato, Y.; Hirano, Y.

    2012-02-01

    A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA/mm2 at the peak of the pulse.

  8. Shunting arc plasma source for pure carbon ion beam.

    PubMed

    Koguchi, H; Sakakita, H; Kiyama, S; Shimada, T; Sato, Y; Hirano, Y

    2012-02-01

    A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA∕mm(2) at the peak of the pulse.

  9. Effect of humidity on fretting wear of several pure metals

    NASA Technical Reports Server (NTRS)

    Goto, H.; Buckley, D. H.

    1984-01-01

    Fretting wear experiments with several pure metals were conducted in air at various relative humidity levels. The materials used were iron, aluminum, copper, silver, chromium, titanium, and nickel. Each pure metal had a maximum fretting wear volume at a specific humidity level RH sub max that was not dependent on mechanical factors such as contact load, fretting amplitude, and frequency in the ranges studied. The weight loss due to fretting wear at RH sub max for each pure metal decreased with increasing heat of oxygen adsorption on the metal, indicating that adhesive wear dominated at RH sub max.

  10. Correction of deep overbite in adults.

    PubMed

    Nanda, R

    1997-01-01

    Deep overbite is one of the most common features of adult malocclusions. Treatment of deep overbites involves a careful diagnosis, treatment plan, and mechanics plan. Pure intrusion of upper or lower incisors alone or in combination with flaring and extrusion of posterior teeth are common methods to correct deep overbites. This article describes appliance systems and biomechanical considerations necessary for intrusion of incisors.

  11. Differential effect of pure isoflavones and soymilk on estrogen receptor activity in mice

    SciTech Connect

    Rando, Gianpaolo; Ramachandran, Balaji; Rebecchi, Monica; Ciana, Paolo; Maggi, Adriana

    2009-06-15

    Background: Because of the complexity of estrogen receptor (ER) physiological activity, the interaction of pure isoflavones or soy-based diets on ER needs to be clearly demonstrated. Objectives: To investigate the effects of the administration of isoflavones as a pure compound or as a component of diet on the ER transcriptional activity in adult mice. Methods: Effects of acute (6 h) and chronic (21 days) oral administration of soy milk, pure genistein and a mix of genistein and daidzein was studied in living ERE-Luc mice. In this animal model, the synthesis of luciferase is under the state of ER transcriptional activity. Luciferase activity was measured in living mice by daily bioluminescence imaging sessions and in tissue extracts by enzymatic assay. Results: Acute, oral administration of genistein or soymilk caused a significant increase of ER activity in liver. In a 20 day long treatment, soymilk was more potent than genistein in liver and appeared to extend its influence on ER transcriptional activity in other tissues, such as the digestive tract. A mixture of pure genistein and daidzein at the same concentration as in soymilk failed to induce significant changes during acute and chronic studies suggesting an important, uncharacterized role of the soymilk matrix. Consistent with this observation, synergistic effects of the matrix plus isoflavones were observed in MCF-7 cells stably transfected with the ERE-luc construct. Conclusions: This study underlines the limitations of the analysis of single food components in the evaluation of their effects on estrogen receptor activity and advocates the necessity to use complex organisms for the full comprehension of the effects of compounds altering the endocrine balance.

  12. Production of fermented chestnut purees by lactic acid bacteria.

    PubMed

    Blaiotta, G; Di Capua, M; Coppola, R; Aponte, M

    2012-09-03

    The objective of this study was to develop a new chestnut-based puree, in order to seasonally adjust the offer and use the surplus of undersized production, providing, at the same time, a response to the growing demand for healthy and environmentally friendly products. Broken dried chestnuts have been employed to prepare purees to be fermented with six different strains of Lactobacillus (Lb.) rhamnosus and Lactobacillus casei. The fermented purees were characterized by a technological and sensorial point of view, while the employed strains were tested for their probiotic potential. Conventional in vitro tests have indicated the six lactobacilli strains as promising probiotic candidates; moreover, being the strains able to grow and to survive in chestnut puree at a population level higher than 8 log₁₀ CFU/mL along 40 days of storage at 4 °C, the bases for the production of a new food, lactose-free and with reduced fat content, have been laid.

  13. Faster and cleaner real-time pure shift NMR experiments.

    PubMed

    Mauhart, Johannes; Glanzer, Simon; Sakhaii, Peyman; Bermel, Wolfgang; Zangger, Klaus

    2015-10-01

    Real-time pure shift experiments provide highly resolved proton NMR spectra which do not require any special processing. Although being more sensitive than their pseudo 2D counterparts, their signal intensities per unit time are still far below regular NMR spectra. In addition, scalar coupling evolution during the individual data chunks produces decoupling sidebands. Here we show that faster and cleaner real-time pure shift spectra can be obtained through the implementation of two parameter alterations. Variation of the FID chunk lengths between individual transients significantly suppresses decoupling sidebands for any kind of real-time pure shift spectra and thus allows for example the analysis of minor components in compound mixtures. Shifting the excitation frequency between individual scans of real-time slice-selective pure shift spectra increases their sensitivity obtainable in unit time by allowing faster repetitions of acquisitions.

  14. The theoretical polarization of pure scattering axisymmetric circumstellar envelopes

    NASA Technical Reports Server (NTRS)

    Fox, G. K.

    1994-01-01

    The Sobolev approach to the scattering of starlight through a pure scattering circumstellar envelope is developed. The theoretical polarization due to electron scattering in Be star envelopes is calculated for two geometries (an equatorially enhanced envelope and a spheroidal envelope). Only the disk-type envelope is found to yield a maximum polarization consistent with the observed range for Be stars. A lower limit, analytical approximation to the theoretical polarization from a pure scattering envelope is obtained.

  15. Adult-onset mitochondrial myopathy.

    PubMed Central

    Fernandez-Sola, J.; Casademont, J.; Grau, J. M.; Graus, F.; Cardellach, F.; Pedrol, E.; Urbano-Marquez, A.

    1992-01-01

    Mitochondrial diseases are polymorphic entities which may affect many organs and systems. Skeletal muscle involvement is frequent in the context of systemic mitochondrial disease, but adult-onset pure mitochondrial myopathy appears to be rare. We report 3 patients with progressive skeletal mitochondrial myopathy starting in adult age. In all cases, the proximal myopathy was the only clinical feature. Mitochondrial pathology was confirmed by evidence of ragged-red fibres in muscle histochemistry, an abnormal mitochondrial morphology in electron microscopy and by exclusion of other underlying diseases. No deletions of mitochondrial DNA were found. We emphasize the need to look for a mitochondrial disorder in some non-specific myopathies starting in adult life. Images Figure 1 Figure 2 PMID:1589382

  16. Fracture behaviors under pure shear loading in bulk metallic glasses

    PubMed Central

    Chen, Cen; Gao, Meng; Wang, Chao; Wang, Wei-Hua; Wang, Tzu-Chiang

    2016-01-01

    Pure shear fracture test, as a special mechanical means, had been carried out extensively to obtain the critical information for traditional metallic crystalline materials and rocks, such as the intrinsic deformation behavior and fracture mechanism. However, for bulk metallic glasses (BMGs), the pure shear fracture behaviors have not been investigated systematically due to the lack of a suitable test method. Here, we specially introduce a unique antisymmetrical four-point bend shear test method to realize a uniform pure shear stress field and study the pure shear fracture behaviors of two kinds of BMGs, Zr-based and La-based BMGs. All kinds of fracture behaviors, the pure shear fracture strength, fracture angle and fracture surface morphology, are systematically analyzed and compared with those of the conventional compressive and tensile fracture. Our results indicate that both the Zr-based and La-based BMGs follow the same fracture mechanism under pure shear loading, which is significantly different from the situation of some previous research results. Our results might offer new enlightenment on the intrinsic deformation and fracture mechanism of BMGs and other amorphous materials. PMID:28008956

  17. Pure-tone birdsong by resonance filtering of harmonic overtones.

    PubMed

    Beckers, Gabriël J L; Suthers, Roderick A; ten Cate, Carel

    2003-06-10

    Pure-tone song is a common and widespread phenomenon in birds. The mechanistic origin of this type of phonation has been the subject of long-standing discussion. Currently, there are three hypotheses. (i) A vibrating valve in the avian vocal organ, the syrinx, generates a multifrequency harmonic source sound, which is filtered to a pure tone by a vocal tract filter ("source-filter" model, analogous to human speech production). (ii) Vocal tract resonances couple with a vibrating valve source, suppressing the normal production of harmonic overtones at this source ("soprano" model, analogous to human soprano singing). (iii) Pure-tone sound is produced as such by a sound-generating mechanism that is fundamentally different from a vibrating valve. Here we present direct evidence of a source-filter mechanism in the production of pure-tone birdsong. Using tracheal thermistors and air sac pressure cannulae, we recorded sound signals close to the syringeal sound source during spontaneous, pure-tone vocalizations of two species of turtledove. The results show that pure-tone dove vocalizations originate through filtering of a multifrequency harmonic sound source.

  18. Fracture behaviors under pure shear loading in bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Chen, Cen; Gao, Meng; Wang, Chao; Wang, Wei-Hua; Wang, Tzu-Chiang

    2016-12-01

    Pure shear fracture test, as a special mechanical means, had been carried out extensively to obtain the critical information for traditional metallic crystalline materials and rocks, such as the intrinsic deformation behavior and fracture mechanism. However, for bulk metallic glasses (BMGs), the pure shear fracture behaviors have not been investigated systematically due to the lack of a suitable test method. Here, we specially introduce a unique antisymmetrical four-point bend shear test method to realize a uniform pure shear stress field and study the pure shear fracture behaviors of two kinds of BMGs, Zr-based and La-based BMGs. All kinds of fracture behaviors, the pure shear fracture strength, fracture angle and fracture surface morphology, are systematically analyzed and compared with those of the conventional compressive and tensile fracture. Our results indicate that both the Zr-based and La-based BMGs follow the same fracture mechanism under pure shear loading, which is significantly different from the situation of some previous research results. Our results might offer new enlightenment on the intrinsic deformation and fracture mechanism of BMGs and other amorphous materials.

  19. Testing effects in mixed- versus pure-list designs.

    PubMed

    Rowland, Christopher A; Littrell-Baez, Megan K; Sensenig, Amanda E; DeLosh, Edward L

    2014-08-01

    In the present study, we investigated the role of list composition in the testing effect. Across three experiments, participants learned items through study and initial testing or study and restudy. List composition was manipulated, such that tested and restudied items appeared either intermixed in the same lists (mixed lists) or in separate lists (pure lists). In Experiment 1, half of the participants received mixed lists and half received pure lists. In Experiment 2, all participants were given both mixed and pure lists. Experiment 3 followed Erlebacher's (Psychological Bulletin, 84, 212-219, 1977) method, such that mixed lists, pure tested lists, and pure restudied lists were given to independent groups. Across all three experiments, the final recall results revealed significant testing effects for both mixed and pure lists, with no reliable difference in the magnitude of the testing advantage across list designs. This finding suggests that the testing effect is not subject to a key boundary condition-list design-that impacts other memory phenomena, including the generation effect.

  20. A Simple Protein Synthesis Model for the PURE System Operation.

    PubMed

    Mavelli, Fabio; Marangoni, Roberto; Stano, Pasquale

    2015-06-01

    The encapsulation of transcription-translation (TX-TL) cell-free machinery inside lipid vesicles (liposomes) is a key element in synthetic cell technology. The PURE system is a TX-TL kit composed of well-characterized parts, whose concentrations are fine tunable, which works according to a modular architecture. For these reasons, the PURE system perfectly fulfils the requirements of synthetic biology and is widely used for constructing synthetic cells. In this work, we present a simplified mathematical model to simulate the PURE system operations. Based on Michaelis-Menten kinetics and differential equations, the model describes protein synthesis dynamics by using 9 chemical species, 6 reactions and 16 kinetic parameters. The model correctly predicts the time course for messenger RNA and protein production and allows quantitative predictions. By means of this model, it is possible to foresee how the PURE system species affect the mechanism of proteins synthesis and therefore help in understanding scenarios where the concentration of the PURE system components has been modified purposely or as a result of stochastic fluctuations (for example after random encapsulation inside vesicles). The model also makes the determination of response coefficients for all species involved in the TX-TL mechanism possible and allows for scrutiny on how chemical energy is consumed by the three PURE system modules (transcription, translation and aminoacylation).

  1. Fracture behaviors under pure shear loading in bulk metallic glasses.

    PubMed

    Chen, Cen; Gao, Meng; Wang, Chao; Wang, Wei-Hua; Wang, Tzu-Chiang

    2016-12-23

    Pure shear fracture test, as a special mechanical means, had been carried out extensively to obtain the critical information for traditional metallic crystalline materials and rocks, such as the intrinsic deformation behavior and fracture mechanism. However, for bulk metallic glasses (BMGs), the pure shear fracture behaviors have not been investigated systematically due to the lack of a suitable test method. Here, we specially introduce a unique antisymmetrical four-point bend shear test method to realize a uniform pure shear stress field and study the pure shear fracture behaviors of two kinds of BMGs, Zr-based and La-based BMGs. All kinds of fracture behaviors, the pure shear fracture strength, fracture angle and fracture surface morphology, are systematically analyzed and compared with those of the conventional compressive and tensile fracture. Our results indicate that both the Zr-based and La-based BMGs follow the same fracture mechanism under pure shear loading, which is significantly different from the situation of some previous research results. Our results might offer new enlightenment on the intrinsic deformation and fracture mechanism of BMGs and other amorphous materials.

  2. PURE ribosome display and its application in antibody technology.

    PubMed

    Kanamori, Takashi; Fujino, Yasuhiro; Ueda, Takuya

    2014-11-01

    Ribosome display utilizes formation of the mRNA-ribosome-polypeptide ternary complex in a cell-free protein synthesis system to link genotype (mRNA) to phenotype (polypeptide). However, the presence of intrinsic components, such as nucleases in the cell-extract-based cell-free protein synthesis system, reduces the stability of the ternary complex, which would prevent attainment of reliable results. We have developed an efficient and highly controllable ribosome display system using the PURE (Protein synthesis Using Recombinant Elements) system. The mRNA-ribosome-polypeptide ternary complex is highly stable in the PURE system, and the selected mRNA can be easily recovered because activities of nucleases and other inhibitory factors are very low in the PURE system. We have applied the PURE ribosome display to antibody engineering approaches, such as epitope mapping and affinity maturation of antibodies, and obtained results showing that the PURE ribosome display is more efficient than the conventional method. We believe that the PURE ribosome display can contribute to the development of useful antibodies. This article is part of a Special Issue entitled: Recent advances in molecular engineering of antibody.

  3. Transcriptional regulation of Elf-1: locus-wide analysis reveals four distinct promoters, a tissue-specific enhancer, control by PU.1 and the importance of Elf-1 downregulation for erythroid maturation.

    PubMed

    Calero-Nieto, Fernando J; Wood, Andrew D; Wilson, Nicola K; Kinston, Sarah; Landry, Josette-Renée; Göttgens, Berthold

    2010-10-01

    Ets transcription factors play important roles during the development and maintenance of the haematopoietic system. One such factor, Elf-1 (E74-like factor 1) controls the expression of multiple essential haematopoietic regulators including Scl/Tal1, Lmo2 and PU.1. However, to integrate Elf-1 into the wider regulatory hierarchies controlling haematopoietic development and differentiation, regulatory elements as well as upstream regulators of Elf-1 need to be identified. Here, we have used locus-wide comparative genomic analysis coupled with chromatin immunoprecipitation (ChIP-chip) assays which resulted in the identification of five distinct regulatory regions directing expression of Elf-1. Further, ChIP-chip assays followed by functional validation demonstrated that the key haematopoietic transcription factor PU.1 is a major upstream regulator of Elf-1. Finally, overexpression studies in a well-characterized erythroid differentiation assay from primary murine fetal liver cells demonstrated that Elf-1 downregulation is necessary for terminal erythroid differentiation. Given the known activation of PU.1 by Elf-1 and our newly identified reciprocal activation of Elf-1 by PU.1, identification of an inhibitory role for Elf-1 has significant implications for our understanding of how PU.1 controls myeloid-erythroid differentiation. Our findings therefore not only represent the first report of Elf-1 regulation but also enhance our understanding of the wider regulatory networks that control haematopoiesis.

  4. Acute intermittent porphyria: identification and expression of exonic mutations in the hydroxymethylbilane synthase gene. An initiation codon missense mutation in the housekeeping transcript causes "variant acute intermittent porphyria" with normal expression of the erythroid-specific enzyme.

    PubMed Central

    Chen, C H; Astrin, K H; Lee, G; Anderson, K E; Desnick, R J

    1994-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error, results from the half-normal activity of the heme biosynthetic enzyme, hydroxymethylbilane synthase (EC 4.3.1.8). Diagnosis of AIP heterozygotes is essential to prevent acute, life-threatening neurologic attacks by avoiding various precipitating factors. Since biochemical diagnosis is problematic, the identification of hydroxymethylbilane synthase mutations has facilitated the detection of AIP heterozygotes. Molecular analyses of unrelated AIP patients revealed six exonic mutations: an initiating methionine to isoleucine substitution (M1I) in a patient with variant AIP, which precluded translation of the housekeeping, but not the erythroid-specific isozyme; four missense mutations in classical AIP patients, V93F, R116W, R201W, C247F; and a nonsense mutation W283X in a classical AIP patient, which truncated the housekeeping and erythroid-specific isozymes. Each mutation was confirmed in genomic DNA from family members. The W283X lesion was found in another unrelated AIP family. Expression of each mutation in Escherichia coli revealed that R201W, C247F, and W283X had residual activity. In vitro transcription/translation studies indicated that the M1I allele produced only the erythroid-specific enzyme, while the other mutant alleles encoded both isozymes. These mutations provide insight into the molecular pathology of classic and variant AIP and facilitate molecular diagnosis in AIP families. Images PMID:7962538

  5. The β-globin locus control region in combination with the EF1α short promoter allows enhanced lentiviral vector-mediated erythroid gene expression with conserved multilineage activity.

    PubMed

    Montiel-Equihua, Claudia A; Zhang, Lin; Knight, Sean; Saadeh, Heba; Scholz, Simone; Carmo, Marlene; Alonso-Ferrero, Maria E; Blundell, Michael P; Monkeviciute, Aiste; Schulz, Reiner; Collins, Mary; Takeuchi, Yasuhiro; Schmidt, Manfred; Fairbanks, Lynette; Antoniou, Michael; Thrasher, Adrian J; Gaspar, H Bobby

    2012-07-01

    Some gene therapy strategies are compromised by the levels of gene expression required for therapeutic benefit, and also by the breadth of cell types that require correction. We designed a lentiviral vector system in which a transgene is under the transcriptional control of the short form of constitutively acting elongation factor 1α promoter (EFS) combined with essential elements of the locus control region of the β-globin gene (β-LCR). We show that the β-LCR can upregulate EFS activity specifically in erythroid cells but does not alter EFS activity in myeloid or lymphoid cells. Experiments using the green fluorescent protein (GFP) reporter or the human adenosine deaminase (ADA) gene demonstrate 3-7 times upregulation in vitro but >20 times erythroid-specific upregulation in vivo, the effects of which were sustained for 1 year. The addition of the β-LCR did not alter the mutagenic potential of the vector in in vitro mutagenesis (IM) assays although microarray analysis showed that the β-LCR upregulates ~9% of neighboring genes. This vector design therefore combines the benefits of multilineage gene expression with high-level erythroid expression, and has considerable potential for correction of multisystem diseases including certain lysosomal storage diseases through a hematopoietic stem cell (HSC) gene therapy approach.

  6. NADPH Oxidase 4 (Nox4) Suppresses Mitochondrial Biogenesis and Bioenergetics in Lung Fibroblasts via a Nuclear Factor Erythroid-derived 2-like 2 (Nrf2)-dependent Pathway.

    PubMed

    Bernard, Karen; Logsdon, Naomi J; Miguel, Veronica; Benavides, Gloria A; Zhang, Jianhua; Carter, A Brent; Darley-Usmar, Victor M; Thannickal, Victor J

    2017-02-17

    Mitochondrial bioenergetics are critical for cellular homeostasis and stress responses. The reactive oxygen species-generating enzyme, NADPH oxidase 4 (Nox4), regulates a number of physiological and pathological processes, including cellular differentiation, host defense, and tissue fibrosis. In this study we explored the role of constitutive Nox4 activity in regulating mitochondrial function. An increase in mitochondrial oxygen consumption and reserve capacity was observed in murine and human lung fibroblasts with genetic deficiency (or silencing) of Nox4. Inhibition of Nox4 expression/activity by genetic or pharmacological approaches resulted in stimulation of mitochondrial biogenesis, as evidenced by elevated mitochondrial-to-nuclear DNA ratio and increased expression of the mitochondrial markers transcription factor A (TFAM), citrate synthase, voltage-dependent anion channel (VDAC), and cytochrome c oxidase subunit 4 (COX IV). Induction of mitochondrial biogenesis was dependent on TFAM up-regulation but was independent of the activation of the peroxisome proliferator-activated receptor γ coactivator 1-α (PGC-1α). The enhancement of mitochondrial bioenergetics as well as the increase in mitochondrial proteins in Nox4-deficient lung fibroblasts is inhibited by silencing of nuclear factor erythroid-derived 2-like 2 (Nrf2), supporting a key role for Nrf2 in control of mitochondrial biogenesis. Together, these results indicate a critical role for both Nox4 and Nrf2 in counter-regulation of mitochondrial biogenesis and metabolism.

  7. Integrative genomic analysis in K562 chronic myelogenous leukemia cells reveals that proximal NCOR1 binding positively regulates genes that govern erythroid differentiation and Imatinib sensitivity.

    PubMed

    Long, Mark D; van den Berg, Patrick R; Russell, James L; Singh, Prashant K; Battaglia, Sebastiano; Campbell, Moray J

    2015-09-03

    To define the functions of NCOR1 we developed an integrative analysis that combined ENCODE and NCI-60 data, followed by in vitro validation. NCOR1 and H3K9me3 ChIP-Seq, FAIRE-seq and DNA CpG methylation interactions were related to gene expression using bootstrapping approaches. Most NCOR1 combinations (24/44) were associated with significantly elevated level expression of protein coding genes and only very few combinations related to gene repression. DAVID's biological process annotation revealed that elevated gene expression was uniquely associated with acetylation and ETS binding. A matrix of gene and drug interactions built on NCI-60 data identified that Imatinib significantly targeted the NCOR1 governed transcriptome. Stable knockdown of NCOR1 in K562 cells slowed growth and significantly repressed genes associated with NCOR1 cistrome, again, with the GO terms acetylation and ETS binding, and significantly dampened sensitivity to Imatinib-induced erythroid differentiation. Mining public microarray data revealed that NCOR1-targeted genes were significantly enriched in Imatinib response gene signatures in cell lines and chronic myelogenous leukemia (CML) patients. These approaches integrated cistrome, transcriptome and drug sensitivity relationships to reveal that NCOR1 function is surprisingly most associated with elevated gene expression, and that these targets, both in CML cell lines and patients, associate with sensitivity to Imatinib.

  8. Nuclear Factor (Erythroid-Derived)-Related Factor 2-Associated Retinal Pigment Epithelial Cell Protection under Blue Light-Induced Oxidative Stress

    PubMed Central

    Kataoka, Keiko; Kimoto, Reona; Hwang, Shiang-Jyi; Nagasaka, Yosuke; Tsunekawa, Taichi; Nonobe, Norie; Ito, Yasuki; Terasaki, Hiroko

    2016-01-01

    Purpose. It is a matter of increasing concern that exposure to light-emitting diodes (LED), particularly blue light (BL), damages retinal cells. This study aimed to investigate the retinal pigment epithelium (RPE) damage caused by BL and to elucidate the role of nuclear factor (erythroid-derived)-related factor 2 (Nrf2) in the pathogenesis of BL-induced RPE damage. Methods. ARPE-19, a human RPE cell line, and mouse primary RPE cells from wild-type and Nrf2 knockout (Nrf2−/−) mice were cultured under blue LED exposure (intermediate wavelength, 450 nm). Cell death rate and reactive oxygen species (ROS) generation were measured. TUNEL staining was performed to detect apoptosis. Real-time polymerase chain reaction was performed on NRF2 mRNA, and western blotting was performed to detect Nrf2 proteins in the nucleus or cytoplasm of RPE cells. Results. BL exposure increased cell death rate and ROS generation in ARPE-19 cells in a time-dependent manner; cell death was caused by apoptosis. Moreover, BL exposure induced NRF2 mRNA upregulation and Nrf2 nuclear translocation in RPE. Cell death rate was significantly higher in RPE cells from Nrf2−/− mice than from wild-type mice. Conclusions. The Nrf2 pathway plays an important role in protecting RPE cells against BL-induced oxidative stress. PMID:27774118

  9. Integration of Elf-4 into stem/progenitor and erythroid regulatory networks through locus-wide chromatin studies coupled with in vivo functional validation.

    PubMed

    Smith, Aileen M; Calero-Nieto, Fernando J; Schütte, Judith; Kinston, Sarah; Timms, Richard T; Wilson, Nicola K; Hannah, Rebecca L; Landry, Josette-Renee; Göttgens, Berthold

    2012-02-01

    The ETS transcription factor Elf-4 is an important regulator of hematopoietic stem cell (HSC) and T cell homeostasis. To gain insights into the transcriptional circuitry within which Elf-4 operates, we used comparative sequence analysis coupled with chromatin immunoprecipitation (ChIP) with microarray technology (ChIP-chip) assays for specific chromatin marks to identify three promoters and two enhancers active in hematopoietic and endothelial cell lines. Comprehensive functional validation of each of these regulatory regions in transgenic mouse embryos identified a tissue-specific enhancer (-10E) that displayed activity in fetal liver, dorsal aorta, vitelline vessels, yolk sac, and heart. Integration of a ChIP-sequencing (ChIP-Seq) data set for 10 key stem cell transcription factors showed Pu.1, Fli-1, and Erg were bound to the -10E element, and mutation of three highly conserved ETS sites within the enhancer abolished its activity. Finally, the transcriptional repressor Gfi1b was found to bind to and repress one of the Elf-4 promoters (-30P), and we show that this repression of Elf-4 is important for the maturation of primary fetal liver erythroid cells. Taken together, our results provide a comprehensive overview of the transcriptional control of Elf-4 within the hematopoietic system and, thus, integrate Elf-4 into the wider transcriptional regulatory networks that govern hematopoietic development.

  10. Synthesis and post-translational assembly of intermediate filaments in avian erythroid cells: vimentin assembly limits the rate of synemin assembly.

    PubMed

    Moon, R T; Lazarides, E

    1983-09-01

    The assembly of vimentin intermediate filaments and the high molecular weight filament crosslinking protein, synemin, was studied in erythroid cells from 10-day chicken embryos. Pulse labeling studies show that newly synthesized vimentin is present both in a Triton X-100-insoluble form and in a soluble form. The incorporation of labeled vimentin into the insoluble fraction increases linearly with time, while the soluble pool of labeled vimentin saturates quickly. In contrast, synemin accumulates rapidly in the Triton X-100-soluble fraction and begins to accumulate in the insoluble fraction only after a considerable lag of time. Pulse-chase studies reveal that the detergent-soluble pools of both vimentin and synemin contain precursors for their post-translational assembly into detergent-insoluble filaments and that the half-life of soluble synemin is about twice as long as that of soluble vimentin. Immunoprecipitation of solubilized filaments with synemin antiserum precipitates vimentin with synemin. On the other hand, soluble vimentin does not coimmunoprecipitate with soluble synemin. These results suggest that, in the assembly of vimentin and synemin into intermediate filaments, vimentin filament elongation generates synemin binding sites, and thus the rate of vimentin filament elongation limits the rate of synemin assembly.

  11. Possible involvement of nuclear factor erythroid 2-related factor 2 in the gene expression of Cyp2b10 and Cyp2a5.

    PubMed

    Ashino, Takashi; Ohkubo-Morita, Haruyo; Yamamoto, Masayuki; Yoshida, Takemi; Numazawa, Satoshi

    2014-01-01

    Cytochrome P450 gene expression is altered by various chemical compounds. In this study, we used nuclear factor erythroid 2-related factor 2 (Nrf2)-deficient (Nrf2(-⧸-)) mice to investigate the involvement of Nrf2 in Cyp2b10 and Cyp2a5 gene expression. Phorone, an Nrf2 activator, strongly increased Cyp2b10 and Cyp2a5 mRNA as well as Nrf2 target genes, including NAD(P)H-quinone oxidoreductase-1 and heme oxygenase-1, in wild-type mouse livers 8 h after treatment. The phorone-induced mRNA levels in Nrf2(-⧸-) mouse livers were lower than that in wild-type mouse livers. Nrf2(-⧸-) mice showed attenuated Cyp2b10 and Cyp2a5 induction by phenobarbital, a classical Cyp2b inducer. These findings suggest that the Nrf2 pathway is involved in Cyp2b10 and Cyp2a5 gene expression.

  12. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    PubMed Central

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients. PMID:27274779

  13. Nuclear Factor Erythroid 2-Related Factor 2 Drives Podocyte-Specific Expression of Peroxisome Proliferator-Activated Receptor γ Essential for Resistance to Crescentic GN

    PubMed Central

    Bollee, Guillaume; Lenoir, Olivia; Dhaun, Neeraj; Camus, Marine; Chipont, Anna; Flosseau, Kathleen; Mandet, Chantal; Yamamoto, Masayuki; Karras, Alexandre; Thervet, Eric; Bruneval, Patrick; Nochy, Dominique; Mesnard, Laurent

    2016-01-01

    Necrotizing and crescentic rapidly progressive GN (RPGN) is a life-threatening syndrome characterized by a rapid loss of renal function. Evidence suggests that podocyte expression of the transcription factor peroxisome proliferator-activated receptor γ (PPARγ) may prevent podocyte injury, but the function of glomerular PPARγ in acute, severe inflammatory GN is unknown. Here, we observed marked loss of PPARγ abundance and transcriptional activity in glomerular podocytes in experimental RPGN. Blunted expression of PPARγ in podocyte nuclei was also found in kidneys from patients diagnosed with crescentic GN. Podocyte-specific Pparγ gene targeting accentuated glomerular damage, with increased urinary loss of albumin and severe kidney failure. Furthermore, a PPARγ gain-of-function approach achieved by systemic administration of thiazolidinedione (TZD) failed to prevent severe RPGN in mice with podocyte-specific Pparγ gene deficiency. In nuclear factor erythroid 2-related factor 2 (NRF2)–deficient mice, loss of podocyte PPARγ was observed at baseline. NRF2 deficiency markedly aggravated the course of RPGN, an effect that was partially prevented by TZD administration. Furthermore, delayed administration of TZD, initiated after the onset of RPGN, still alleviated the severity of experimental RPGN. These findings establish a requirement for the NRF2–PPARγ cascade in podocytes, and we suggest that these transcription factors have a role in augmenting the tolerance of glomeruli to severe immune-complex mediated injury. The NRF2–PPARγ pathway may be a therapeutic target for RPGN. PMID:25999406

  14. Umbelliferone and daphnetin ameliorate carbon tetrachloride-induced hepatotoxicity in rats via nuclear factor erythroid 2-related factor 2-mediated heme oxygenase-1 expression.

    PubMed

    Mohamed, Mohamed R; Emam, Manal A; Hassan, Nahla S; Mogadem, Abeer I

    2014-09-01

    Among various phytochemicals, coumarins comprise a very large class of plant phenolic compounds that have good nutritive value, in addition to their antioxidant effects. The purpose of the present study was to investigate the protective effects of two coumarin derivatives, umbelliferone and daphnetin, against carbon tetrachloride (CCl4)-induced hepatotoxicity in rats and elucidate the underlying mechanism. Treatment of rats with either umbelliferone or daphnetin significantly improved the CCl4-induced biochemical alterations. In addition, both compounds alleviated the induced-lipid peroxidation and boosted the antioxidant defense system. Moreover, the investigated compounds attenuated CCl4-induced histopathological alterations of the liver. Finally, umbelliferone and daphnetin induced the nuclear translocation of the nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), thereby inducing the expression and activity of the cytoprotective heme oxygenase-1 (HO-1). These results suggest that umbelliferone and daphnetin ameliorate oxidative stress-related hepatotoxicity via their ability to augment cellular antioxidant defenses by activating Nrf2-mediated HO-1 expression.

  15. Steroids and hematopoiesis. II. The effect of steroids on in vitro erythroid colony growth: evidence for different target cells for different classes of steroids.

    PubMed

    Singer, J W; Adamson, J W

    1976-06-01

    Androgenic steroids and their non-androgenic 5beta-H metabolites enhance the number of colonies of hemoglobin synthesizing cells grown from rat bone marrow in response to a standard (0.25 unit/ml) concentration of erythropoietin. The target cells for two steroids were found to be different. Cells influenced by the androgen, fluoxymesterone (fluoxy), resembled cells responding to erythropoietin in their cycle characteristics, as measured by tritiated thymidine suicide, and in their physical characteristics, as determined by velocity sedimentation gradient separation. Cells responding to etiocholanolone (etio) had a much lower tritiated thymidine suicide rate and different sedimentation velocities. Preincubation of marrow cells with etio for two hours was sufficient to enhance erythroid colony growth by 84%, whereas a similar incubation with fluoxy produced no increment. These studies demonstrate that different classes of steroids may influence in vitro erythropoiesis by acting on distinct populations of marrow cells. Fluoxymesterone appears to act through cells already committed to respond to erythropoietin, while etiocholanolone appears to act on a separate, perhaps more primitive population of marrow cells.

  16. Nuclear Factor Erythroid 2-related Factor 2 Deficiency Exacerbates Lupus Nephritis in B6/lpr mice by Regulating Th17 Cell Function

    PubMed Central

    Zhao, Mei; Chen, Huanpeng; Ding, Qingfeng; Xu, Xiaoxie; Yu, Bolan; Huang, Zhaofeng

    2016-01-01

    Lupus nephritis (LN) is the major clinical manifestation of systemic lupus erythematosus. LN is promoted by T helper 17 (Th17) cells, which are the major pro-inflammatory T cell subset contributing to autoimmunity regulation. Nuclear factor erythroid 2-related factor 2 (NRF2) is critical for suppressing reactive oxygen species (ROS) and relieving oxidant stress by regulating antioxidant gene expression. Previous studies have demonstrated that Nrf2 deficiency promotes drug-induced or spontaneous LN. However, whether NRF2 regulates Th17 function during LN development is still unclear. In this study, we introduced Nrf2 deficiency into a well-known LN model, the B6/lpr mouse strain, and found that it promoted early-stage LN with altered Th17 activation. Th17 cells and their relevant cytokines were dramatically increased in these double-mutant mice. We also demonstrated that naïve T cells from the double-mutant mice showed significantly increased differentiation into Th17 cells in vitro, with decreased expression of the Th17 differentiation suppressor Socs3 and increased phosphorylation of STAT3. Our results demonstrated that Nrf2 deficiency promoted Th17 differentiation and function during LN development. Moreover, our results suggested that the regulation of Th17 differentiation via NRF2 could be a therapeutic target for the treatment of subclinical LN patients. PMID:27941837

  17. Nuclear factor erythroid 2-related factor 2 signaling in Parkinson disease: a promising multi therapeutic target against oxidative stress, neuroinflammation and cell death.

    PubMed

    Kumar, Hemant; Koppula, Sushruta; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug

    2012-12-01

    Parkinson's disease (PD) is the second most common progressive neurodegenerative disorder with increased oxidative stress as central component. Till date, treatments related to PD are based on restoring dopamine either by targeting neurotransmitter and/or at receptor levels. These therapeutic approaches try to repair damage but do not address the underlying processes such as oxidative stress and neuroinflammation that contribute to cell death. The central nervous system maintains a robust antioxidant defense mechanism consisting of several cytoprotective genes and enzymes whose expression is controlled by antioxidant response element (ARE) which further depends on activation of nuclear factor erythroid 2-related factor 2 (Nrf2). In response to oxidative or electrophilic stress transcription factor Nrf2 binds to ARE and rescues the cells from oxidative stress and neuroinflammation. Recently, Nrf2 has been utilized as a drug target and some agents are currently under clinical trial. Owing to the potential role of Nrf2 in counteracting oxidative stress and neuroinflammation seen in PD, here we have focused on the molecular mechanism of the Nrf2/ARE antioxidant defense pathway in PD. Further, we also summarize published reports on the potential inducers of Nrf2 that demonstrate neuroprotective effects in experimental models of PD with possible future strategies to increase the transcriptional level of Nrf2 as a therapeutic strategy to provide neuroprotection of damaged dopaminergic neurons in PD.

  18. Strange Bedfellows: Nuclear Factor, Erythroid 2-Like 2 (Nrf2) and Hypoxia-Inducible Factor 1 (HIF-1) in Tumor Hypoxia.

    PubMed

    Toth, Rachel K; Warfel, Noel A

    2017-04-06

    The importance of the tumor microenvironment for cancer progression and therapeutic resistance is an emerging focus of cancer biology. Hypoxia, or low oxygen, is a hallmark of solid tumors that promotes metastasis and represents a significant obstacle to successful cancer therapy. In response to hypoxia, cancer cells activate a transcriptional program that allows them to survive and thrive in this harsh microenvironment. Hypoxia-inducible factor 1 (HIF-1) is considered the main effector of the cellular response to hypoxia, stimulating the transcription of genes involved in promoting angiogenesis and altering cellular metabolism. However, growing evidence suggests that the cellular response to hypoxia is much more complex, involving coordinated signaling through stress response pathways. One key signaling molecule that is activated in response to hypoxia is nuclear factor, erythroid 2 like-2 (Nrf2). Nrf2 is a transcription factor that controls the expression of antioxidant-response genes, allowing the cell to regulate reactive oxygen species. Nrf2 is also activated in various cancer types due to genetic and epigenetic alterations, and is associated with poor survival and resistance to therapy. Emerging evidence suggests that coordinated signaling through Nrf2 and HIF-1 is critical for tumor survival and progression. In this review, we discuss the distinct and overlapping roles of HIF-1 and Nrf2 in the cellular response to hypoxia, with a focus on how targeting Nrf2 could provide novel chemotherapeutic modalities for treating solid tumors.

  19. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  20. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds.

    PubMed

    Denzer, Isabel; Münch, Gerald; Friedland, Kristina

    2016-01-01

    Oxidative stress and mitochondrial dysfunction are early events in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Mitochondria are important key players in cellular function based on mitochondrial energy production and their major role in cell physiology. Since neurons are highly depending on mitochondrial energy production due to their high energy demand and their reduced glycolytic capacity mitochondrial dysfunction has fatal consequences for neuronal function and survival. The transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2) is the major regulator of cellular response to oxidative stress. Activation of Nrf2 induces the transcriptional regulation of antioxidant response element (ARE)-dependent expression of a battery of cytoprotective and antioxidant enzymes and proteins. Moreover, activation of Nrf2 protects mitochondria from dysfunction and promotes mitochondrial biogenesis. Therefore, the Nrf2/ARE pathway has become an attractive target for the prevention and treatment of oxidative stress-related neurodegenerative diseases. Small food-derived inducers of the Nrf2/ARE pathway including l-sulforaphane from broccoli and isoliquiritigenin from licorice displayed promising protection of mitochondrial function in models of oxidative stress and neurodegenerative diseases and represent a novel approach to prevent and treat aging-associated neurodegenerative diseases.

  1. Chromosome 12p abnormalities and IMP3 expression in prepubertal pure testicular teratomas.

    PubMed

    Cornejo, Kristine M; Cheng, Liang; Church, Alanna; Wang, Mingsheng; Jiang, Zhong

    2016-03-01

    Although the histologic appearance of pure testicular teratomas (PTTs) is similar in children and adults, the prognosis is dramatically different. Prepubertal PTTs are rare, with a benign clinical course, whereas the adult cases typically have malignant outcomes. Chromosome 12p abnormalities are seen in most adult testicular germ cell tumors but have not been found in prepubertal PTTs. IMP3 is an oncofetal protein that is highly expressed in many malignancies. Recently, we demonstrated IMP3 is expressed in adult mature testicular teratomas but not in mature ovarian teratomas. The aim of this study was to evaluate prepubertal PTTs for chromosome 12p abnormalities and expression of IMP3. A total of 11 cases (excision, n=1; orchiectomy, n=10) were obtained from the surgical pathology archives of 2 large medical centers (1957-2013). All 11 cases were investigated for isochromosome 12p and 12p copy number gain using interphase fluorescence in situ hybridization analysis and were examined by immunohistochemistry for IMP3 expression. Patients ranged in age from 0.9 to 7.0 (mean, 2.4) years. A positive immunohistochemical stain for IMP3 (cytoplasmic staining) was identified in 5 (46%) of 11 cases. Isochromosome 12p was detected in 2 cases (18%) that also expressed IMP3. Somatic copy number alterations of 12p were not observed (0%). We are the first to describe 12p abnormalities and IMP3 expression in prepubertal PTTs. Our data demonstrate a small subset of PTTs harbor typical molecular alterations observed in adult testicular germ cell tumors. Although prepubertal PTTs are considered to be benign neoplasms, it may be a heterogeneous group.

  2. Presence of tadpole and adult globin RNA sequences in oocytes of Xenopus laevis

    PubMed Central

    Perlman, S. M.; Ford, P. J.; Rosbash, M. M.

    1977-01-01

    Complementary DNA transcribed from adult Xenopus laevis globin mRNA was used to assay ovary RNA from Xenopus for the presence of globin sequences by RNA·cDNA hybridization. These sequences are present at approximately the same concentration as the majority of poly(A)-containing ovary sequences. The sequences are also found at approximately 200,000 copies per cell in poly(A)-containing RNA extracted from mature oocytes. To rule out contamination of the oocytes with somatic cells, two additional experiments were performed. First, RNA isolated from ovulated unfertilized eggs, which are devoid of somatic cells, was also shown to contain the globin sequences. Second, globin mRNA was isolated from Xenopus tadpoles. Adult globin mRNA is free of the tadpole sequence and no homology was detected between adult and tadpoles globin RNA. The ovary was shown to contain tadpole globin RNA at nearly the same concentration as the adult sequences. Thus, the results cannot be explained by contamination with erythroid cells which should contain only the adult sequence. The swimming tadpole, which possesses an active circulatory system, was also assayed for the tadpole and adult globin sequences. Whereas the adult sequences are present at approximately the same concentration as in the mature oocyte, the concentration of the tadpole sequences increases at least 300-fold in the first 3 days following fertilization. PMID:269434

  3. Extraction of distance restraints from pure shift NOE experiments.

    PubMed

    Kaltschnee, Lukas; Knoll, Kevin; Schmidts, Volker; Adams, Ralph W; Nilsson, Mathias; Morris, Gareth A; Thiele, Christina M

    2016-10-01

    NMR techniques incorporating pure shift methods to improve signal resolution have recently attracted much attention, owing to their potential use in studies of increasingly complex molecular systems. Extraction of frequencies from these simplified spectra enables easier structure determination, but only a few of the methods presented provide structural parameters derived from signal integral measurements. In particular, for quantification of the nuclear Overhauser effect (NOE) it is highly desirable to utilize pure shift techniques where signal overlap normally prevents accurate signal integration, to enable measurement of a larger number of interatomic distances. However, robust methods for the measurement of interatomic distances using the recently developed pure shift techniques have not been reported to date. In this work we discuss some of the factors determining the accuracy of measurements of signal integrals in interferogram-based Zangger-Sterk (ZS) pure shift NMR experiments. The ZS broadband homodecoupling technique is used in different experiments designed for quantitative NOE determination from pure shift spectra. It is shown that the techniques studied can be used for quantitative extraction of NOE-derived distance restraints, as exemplified for the test case of strychnine.

  4. Extraction of distance restraints from pure shift NOE experiments

    NASA Astrophysics Data System (ADS)

    Kaltschnee, Lukas; Knoll, Kevin; Schmidts, Volker; Adams, Ralph W.; Nilsson, Mathias; Morris, Gareth A.; Thiele, Christina M.

    2016-10-01

    NMR techniques incorporating pure shift methods to improve signal resolution have recently attracted much attention, owing to their potential use in studies of increasingly complex molecular systems. Extraction of frequencies from these simplified spectra enables easier structure determination, but only a few of the methods presented provide structural parameters derived from signal integral measurements. In particular, for quantification of the nuclear Overhauser effect (NOE) it is highly desirable to utilize pure shift techniques where signal overlap normally prevents accurate signal integration, to enable measurement of a larger number of interatomic distances. However, robust methods for the measurement of interatomic distances using the recently developed pure shift techniques have not been reported to date. In this work we discuss some of the factors determining the accuracy of measurements of signal integrals in interferogram-based Zangger-Sterk (ZS) pure shift NMR experiments. The ZS broadband homodecoupling technique is used in different experiments designed for quantitative NOE determination from pure shift spectra. It is shown that the techniques studied can be used for quantitative extraction of NOE-derived distance restraints, as exemplified for the test case of strychnine.

  5. Redefining dermatomyositis: a description of new diagnostic criteria that differentiate pure dermatomyositis from overlap myositis with dermatomyositis features.

    PubMed

    Troyanov, Yves; Targoff, Ira N; Payette, Marie-Pier; Raynauld, Jean-Pierre; Chartier, Suzanne; Goulet, Jean-Richard; Bourré-Tessier, Josiane; Rich, Eric; Grodzicky, Tamara; Fritzler, Marvin J; Joyal, France; Koenig, Martial; Senécal, Jean-Luc

    2014-11-01

    Dermatomyositis (DM) is a major clinical subset of autoimmune myositis (AIM). The characteristic DM rash (Gottron papules, heliotrope rash) and perifascicular atrophy at skeletal muscle biopsy are regarded as specific features for this diagnosis. However, new concepts are challenging the current definition of DM. A modified Bohan and Peter classification of AIM was proposed in which the core concept was the inclusion of the diagnostic significance of overlap connective tissue disease features. In this clinical classification, a DM rash in association with myositis in the absence of overlap features indicates a diagnosis of pure DM. However, overlap features in association with myositis allow a diagnosis of overlap myositis (OM), irrespective of the presence or absence of the DM rash. Perifascicular atrophy may be present in both pure DM and OM. Recently, the presence of perifascicular atrophy in myositis without a DM rash was proposed as diagnostic of a novel entity, adermatopathic DM. We conducted the present study to evaluate these new concepts to further differentiate pure DM from OM.Using the modified Bohan and Peter classification, we performed a follow-up study of a longitudinal cohort of 100 consecutive adult French Canadian patients with AIM, including 44 patients with a DM phenotype, defined as a DM rash, and/or DM-type calcinosis, and/or the presence of perifascicular atrophy on muscle biopsy. A detailed evaluation was performed for overlap features, the extent and natural history of the DM rash, adermatopathic DM, DM-specific and overlap autoantibodies by protein A immunoprecipitation on coded serum samples, and associations with cancer and survival.Two distinct subsets were identified in patients with a DM phenotype: pure DM (n = 24) and OM with DM features, or OMDM (n = 20). In pure DM, the DM rash was a dominant finding. It was the first disease manifestation, was always present at the time of myositis diagnosis, and was associated with a high

  6. Excitation of coherent propagating spin waves by pure spin currents

    PubMed Central

    Demidov, Vladislav E.; Urazhdin, Sergei; Liu, Ronghua; Divinskiy, Boris; Telegin, Andrey; Demokritov, Sergej O.

    2016-01-01

    Utilization of pure spin currents not accompanied by the flow of electrical charge provides unprecedented opportunities for the emerging technologies based on the electron's spin degree of freedom, such as spintronics and magnonics. It was recently shown that pure spin currents can be used to excite coherent magnetization dynamics in magnetic nanostructures. However, because of the intrinsic nonlinear self-localization effects, magnetic auto-oscillations in the demonstrated devices were spatially confined, preventing their applications as sources of propagating spin waves in magnonic circuits using these waves as signal carriers. Here, we experimentally demonstrate efficient excitation and directional propagation of coherent spin waves generated by pure spin current. We show that this can be achieved by using the nonlocal spin injection mechanism, which enables flexible design of magnetic nanosystems and allows one to efficiently control their dynamic characteristics. PMID:26818232

  7. Fine Needle Aspiration Cytology in Diagnosis of Pure Neuritic Leprosy

    PubMed Central

    Kumar, Bipin; Pradhan, Anju

    2011-01-01

    Leprosy is a chronic infection affecting mainly the skin and peripheral nerve. Pure neuritic form of this disease manifests by involvement of the nerve in the absence of skin lesions. Therefore, it can sometimes create a diagnostic problem. It often requires a nerve biopsy for diagnosis, which is an invasive procedure and may lead to neural deficit. Fine needle aspiration cytology (FNAC) of an affected nerve can be a valuable and less invasive procedure for the diagnosis of such cases. We report five suspected cases of pure neuritic Hansen's disease involving the common and superficial peroneal, ulnar, and median nerve, who underwent FNAC. Smears revealed nerve fibers infiltrated by chronic inflammatory cells in all cases, presence of epithelioid cells granulomas, and Langhans giant cells in three cases, and acid fast bacilli in two cases. In conclusion, FNAC is a safe, less invasive, and time saving procedure for the diagnosis of pure neuritic leprosy. PMID:21660285

  8. The neuroanatomy of pure apraxia of speech in stroke

    PubMed Central

    Graff-Radford, Jonathan; Jones, David T.; Strand, Edythe A.; Rabinstein, Alejandro A.; Duffy, Joseph R.; Josephs, Keith A.

    2014-01-01

    The left insula or Broca’s area have been proposed as the neuroanatomical correlate for apraxia of speech (AOS) based on studies of patients with both AOS and aphasia due to stroke. Studies of neurodegenerative AOS suggest the premotor area and the supplementary motor areas as the anatomical correlates. The study objective was to determine the common infarction area in patients with pure AOS due to stroke. Patients with AOS and no or equivocal aphasia due to ischemic stroke were identified through a pre-existing database. Seven subjects were identified. Five had pure AOS, and two had equivocal aphasia. MRI lesion analysis revealed maximal overlap spanning the left premotor and motor cortices. While both neurodegenerative AOS and stroke induced pure AOS involve the premotor cortex, further studies are needed to establish whether stroke-induced AOS and neurodegenerative AOS share a common anatomic substrate. PMID:24556336

  9. Single biphoton ququarts as either pure or mixed states

    SciTech Connect

    Fedorov, M. V.; Volkov, P. A.; Mikhailova, J. M.

    2011-09-15

    We analyze features of mixed biphoton polarization states, which arise from pure states of polarization-frequency biphoton ququarts after averaging over frequencies of photons. For mixed states, we find their concurrence C, Schmidt parameter K, degree of polarization P, as well as the von Neumann mutual information I. In some simple cases, we also find the relative entropy S{sub rel} and the degree of classical correlations C{sub cl}. In mixed states, the Schmidt parameter does not characterize the degree of entanglement anymore, as it does in pure states. Nevertheless, the Schmidt parameter remains useful even in the case of mixed states because it remains directly related to the degree of polarization. We compare results occurring in the cases of full pure polarization-frequency states of ququarts and mixed states (averaged over frequencies). Differences between these results can be seen in experiments with and without frequency filters in front of a detector.

  10. The neuroanatomy of pure apraxia of speech in stroke.

    PubMed

    Graff-Radford, Jonathan; Jones, David T; Strand, Edythe A; Rabinstein, Alejandro A; Duffy, Joseph R; Josephs, Keith A

    2014-02-01

    The left insula or Broca's area have been proposed as the neuroanatomical correlate for apraxia of speech (AOS) based on studies of patients with both AOS and aphasia due to stroke. Studies of neurodegenerative AOS suggest the premotor area and the supplementary motor areas as the anatomical correlates. The study objective was to determine the common infarction area in patients with pure AOS due to stroke. Patients with AOS and no or equivocal aphasia due to ischemic stroke were identified through a pre-existing database. Seven subjects were identified. Five had pure AOS, and two had equivocal aphasia. MRI lesion analysis revealed maximal overlap spanning the left premotor and motor cortices. While both neurodegenerative AOS and stroke induced pure AOS involve the premotor cortex, further studies are needed to establish whether stroke-induced AOS and neurodegenerative AOS share a common anatomic substrate.

  11. Fast word reading in pure alexia: "fast, yet serial".

    PubMed

    Bormann, Tobias; Wolfer, Sascha; Hachmann, Wibke; Neubauer, Claudia; Konieczny, Lars

    2015-01-01

    Pure alexia is a severe impairment of word reading in which individuals process letters serially with a pronounced length effect. Yet, there is considerable variation in the performance of alexic readers with generally very slow, but also occasionally fast responses, an observation addressed rarely in previous reports. It has been suggested that "fast" responses in pure alexia reflect residual parallel letter processing or that they may even be subserved by an independent reading system. Four experiments assessed fast and slow reading in a participant (DN) with pure alexia. Two behavioral experiments investigated frequency, neighborhood, and length effects in forced fast reading. Two further experiments measured eye movements when DN was forced to read quickly, or could respond faster because words were easier to process. Taken together, there was little support for the proposal that "qualitatively different" mechanisms or reading strategies underlie both types of responses in DN. Instead, fast responses are argued to be generated by the same serial-reading strategy.

  12. CPR: Adult

    MedlinePlus

    Refresher Center Home FIRST AID, CPR and AED LIFEGUARDING Refresher Putting It All Together: CPR—Adult (2:03) Refresher videos only utilize this player QUICK LINKS Home RedCross.org Purchase Course ...

  13. Spectrofluorimetric determination of famciclovir in pure and pharmaceutical preparations

    NASA Astrophysics Data System (ADS)

    Karasakal, A.; ULU, S. Tatar; Unal, D. Ozer

    2015-08-01

    A sensitive spectrofluorimetric method was developed for the determination of famciclovir in pure and pharmaceutical preparations. The method is based on the derivatization reaction of famciclovir with fluorescamine. The different experimental parameters that affect the fluorescence intensity were carefully studied, at once. The method was validated for linearity, limit of detection, limit of quantification, precision, accuracy, recovery, robustness. The assay was linear over the concentration range of 100 and 1000 ng/mL. The limits of detection and limit of quantification were calculated to be 51.13 and 153.39 ng/mL. The proposed method was applied to study of famciclovir in pure and in pharmaceutical preparations.

  14. Hierarchy of Stochastic Pure States for Open Quantum System Dynamics

    NASA Astrophysics Data System (ADS)

    Suess, D.; Eisfeld, A.; Strunz, W. T.

    2014-10-01

    We derive a hierarchy of stochastic evolution equations for pure states (quantum trajectories) for open quantum system dynamics with non-Markovian structured environments. This hierarchy of pure states (HOPS) is generally applicable and provides the exact reduced density operator as an ensemble average over normalized states. The corresponding nonlinear equations are presented. We demonstrate that HOPS provides an efficient theoretical tool and apply it to the spin-boson model, the calculation of absorption spectra of molecular aggregates, and energy transfer in a photosynthetic pigment-protein complex.

  15. Actuating dielectric elastomers in pure shear deformation by elastomeric conductors

    SciTech Connect

    Wang, Yin; Chen, Baohong; Zhou, Jinxiong; Bai, Yuanyuan; Wang, Hong

    2014-02-10

    Pure shear experiments are commonly used to characterize dielectric elastomer (DE) material properties and to evaluate DE actuator/generator performance. It is increasingly important for many applications to replace conventional carbon grease electrodes with stretchable elastomeric conductors. We formulate a theory for DE with elastomeric conductors, synthesize transparent hydrogel as ionic conductors, and measure actuation of DE in pure shear deformation. Maximum 67% actuation strain is demonstrated. The theory agrees well with our measurement and also correlates well with reported experiments on DE with electronic conductors.

  16. Spectroscopic characterization of pure and cation-stabilized sodium phosphate

    NASA Astrophysics Data System (ADS)

    Cole, R. S.; Frech, Roger

    2000-03-01

    A systematic study was conducted of pure Na3PO4 and solid solutions of Na3PO4 doped with Mg2+ and Zn2+. Na3PO4 has two solid phases: a low-temperature tetragonal phase and a high-temperature cubic phase. A factor group analysis of the two phases yielded the expected number of modes and their symmetry-based assignments. A temperature-dependent Raman spectroscopic study was then performed for the pure compound. Analysis of the doped Na3PO4 has also provided another description of the local structural distortions present in the cubic structure.

  17. Clinical study of 222 patients with pure motor stroke

    PubMed Central

    Arboix, A; Padilla, I; Massons, J; Garcia-Eroles, L; Comes, E; Targa, C

    2001-01-01

    The objective was to assess the frequency of pure motor stroke caused by different stroke subtypes and to compare demographic, clinical, neuroimaging, and outcome data of pure motor stroke with those of patients with other lacunar stroke as well as with those of patients with non-lacunar stroke.
Data from 2000 patients with acute stroke (n=1761) or transient ischaemic attack (n=239) admitted consecutively to the department of neurology of an acute care 350 bed teaching hospital were prospectively collected in the Sagrat Cor Hospital of Barcelona stroke registry over a 10 year period. For the purpose of the study 222 (12.7%) patients with pure motor stroke were selected. The other study groups included 218 (12.3%) patients with other lacunar strokes and 1321 (75%) patients with non-lacunar stroke.
In relation to stroke subtype, lacunar infarcts were found in 189 (85%) patients, whereas ischaemic lacunar syndromes not due to lacunar infarcts occurred in 23 (10.4%) patients (atherothrombotic stroke in 12, cardioembolic stroke in seven, infarction of undetermined origin in three, and infarction of unusual aetiology in one) and haemorrhagic lacunar syndromes in 10 (4.5%). Patients with pure motor stroke showed a better outcome than patients with non-lacunar stroke with a significantly lower number of complications and in hospital mortality rate, shorter duration of hospital stay, and a higher number of symptom free patients at hospital discharge. After multivariate analysis, hypertension, diabetes, obesity, hyperlipidaemia, non-sudden stroke onset, internal capsule involvement, and pons topography seemed to be independent factors of pure motor stroke in patients with acute stroke.
In conclusion, about one of every 10 patients with acute stroke had a pure motor stroke. Pure motor stroke was caused by a lacunar infarct in 85% of patients and by other stroke subtypes in 15%. Several clinical features are more frequent in patients with pure motor stroke than in

  18. Pure Oats as Part of the Canadian Gluten-Free Diet in Celiac Disease: The Need to Revisit the Issue.

    PubMed

    de Souza, M Cristina P; Deschênes, Marie-Eve; Laurencelle, Suzanne; Godet, Patrick; Roy, Claude C; Djilali-Saiah, Idriss

    2016-01-01

    The question about recommending pure, noncontaminated oats as part of the gluten-free diet of patients with celiac disease remains controversial. This might be due to gluten cross contamination and to the possible immunogenicity of some oat cultivars. In view of this controversy, a review of the scientific literature was conducted to highlight the latest findings published between 2008 and 2014 to examine the current knowledge on oats safety and celiac disease in Europe and North America. Results showed that regular oats consumed in Canada are largely contaminated. Overall, the consumption of pure oats has been generally considered to be safe for adults and children. However, it appears that some oat cultivars may trigger an immune response in sensitive individuals. Therefore, further long-term studies on the impact of consumption of oats identifying the cultivar(s) constitute an important step forward for drawing final recommendations. Furthermore, a closer and more accurate monitoring of the dietary intake of noncontaminated oats would be paramount to better determine what its actual contribution in the gluten-free diet of adults and children with celiac disease are in order to draw sound recommendations on the safety of pure oats as part of the gluten-free diet.

  19. Similarities and differences between learning abilities, "pure" learning disabilities, "pure" ADHD and comorbid ADHD with learning disabilities.

    PubMed

    Mangina, Constantine A; Beuzeron-Mangina, Helen

    2009-08-01

    This research pursues the crucial question of the differentiation of preadolescents with "Pure" ADHD, comorbid ADHD with learning disabilities, "Pure" learning disabilities and age-matched normal controls. For this purpose, Topographic Mapping of Event-Related Brain Potentials (ERPs) to a Memory Workload Paradigm with visually presented words, Bilateral Electrodermal Activity during cognitive workload and Mangina-Test performance were used. The analysis of Topographic distribution of amplitudes revealed that normal preadolescents were significantly different from "Pure" ADHD (P<0.0001), "Pure" learning disabilities (P<0.0001), and comorbid ADHD with learning disabilities (P<0.0009), by displaying enhanced prefrontal and frontal negativities (N450). In contrast, preadolescents with "Pure" ADHD and comorbid ADHD with learning disabilities have shown a marked reduction of prefrontal and frontal negativities (N450). As for the "Pure" Learning Disabled preadolescents, very small positivities (P450) in prefrontal and frontal regions were obtained as compared to the other pathological groups. Bilateral Electrodermal Activity during cognitive workload revealed a significant main effect for groups (P<0.00001), Left versus Right (P=0.0029) and sessions (P=0.0136). A significant main effect for the Mangina-Test performance which separated the four groups was found (P<0.000001). Overall, these data support the existence of clear differences and similarities between the pathological preadolescent groups as opposed to age-matched normal controls. The psychophysiological differentiation of these groups, provides distinct biological markers which integrate central, autonomic and neuropsychometric variables by targeting the key features of these pathologies for diagnosis and intervention strategies and by providing knowledge for the understanding of normal neurocognitive processes and functions.

  20. 'Pure' spindle cell variant of angiomatoid fibrous histiocytoma, lacking classic histologic features.

    PubMed

    Thway, Khin; Strauss, Dirk C; Wren, Dorte; Fisher, Cyril

    2016-11-01

    Angiomatoid fibrous histiocytoma (AFH) is a soft tissue tumor of intermediate biologic potential and uncertain differentiation that most frequently occurs in the superficial extremities of children and young adults. It is histologically typified by nodules of ovoid to spindle cells with pseudoangiomatoid spaces and a surrounding dense lymphoplasmacytic infiltrate, desmin expression in about 50%, and association with EWSR1-CREB1, EWSR1-ATF1 or FUS-ATF1 gene fusions. The diagnosis still poses a challenge because AFH may not display all classic features, can show a variety of unusual histologic findings and lacks a specific immunoprofile. We describe a case of 'pure' spindle cell AFH arising in the forearm musculature of a 19 year-old female, which harbored EWSR1-CREB1 fusion transcripts by reverse transcription-polymerase chain reaction. The neoplasm was composed entirely of highly cellular fascicles of spindled cells architecturally resembling spindle cell sarcoma, and lacked obvious pseudoangiomatoid spaces or a lymphoid cuff. This purely spindle cell variant adds to the significant morphologic spectrum of AFH, and emphasizes that even when occuring at a typical site, AFH may be difficult to recognize when showing non-classical morphology. This is of clinical relevance, as AFH with this morphology could be potentially misdiagnosed as a high-grade sarcoma, with the patient subject to more radical therapeutic approaches.

  1. Scintillation properties of pure CaF 2

    NASA Astrophysics Data System (ADS)

    Mikhailik, V. B.; Kraus, H.; Imber, J.; Wahl, D.

    2006-10-01

    The temperature dependence of the decay time and scintillation light yield of pure CaF 2 crystal was measured over the temperature range 8-305 K using the multiphoton coincidence counting technique. Pure CaF 2 exhibits emission of triplet self-trapped excitons at 280 nm with a slow decay, the time constant of which changes significantly with temperature. The main decay time constant increases by three orders of magnitude when cooled, from 0.96±0.06 μs at 295 K to 930±40 μs at 8 K. The results obtained demonstrate that the scintillation light yield of pure CaF 2 increases with decreasing temperature down to 20 K below which it is roughly constant. At low temperatures the light yield of CaF 2 is estimated to be 60% relative to that of pure CaWO 4. It is concluded that undoped calcium fluoride is a very attractive target material for experimental searches for rare events based on the detection of phonon and scintillation signals.

  2. Extracting pure endmembers using symmetric sparse representation for hyperspectral imagery

    NASA Astrophysics Data System (ADS)

    Sun, Weiwei; Liu, Chun; Sun, Yanwei; Li, Weiyue; Li, Jialin

    2016-10-01

    This article proposes a symmetric sparse representation (SSR) method to extract pure endmembers from hyperspectral imagery (HSI). The SSR combines the features of the linear unmixing model and the sparse subspace clustering model of endmembers, and it assumes that the desired endmembers and all the HSI pixel points can be sparsely represented by each other. It formulates the endmember extraction problem into a famous program of archetypal analysis, and accordingly, extracting pure endmembers can be transformed as finding the archetypes in the minimal convex hull containing all the HSI pixel points. The vector quantization scheme is adopted to help in carefully choosing the initial pure endmembers, and the archetypal analysis program is solved using the simple projected gradient algorithm. Seven state-of-the-art methods are implemented to make comparisons with the SSR on both synthetic and real hyperspectral images. Experimental results show that the SSR outperforms all the seven methods in spectral angle distance and root-mean-square error, and it can be a good alternative choice for extracting pure endmembers from HSI data.

  3. A pure-sampling quantum Monte Carlo algorithm.

    PubMed

    Ospadov, Egor; Rothstein, Stuart M

    2015-01-14

    The objective of pure-sampling quantum Monte Carlo is to calculate physical properties that are independent of the importance sampling function being employed in the calculation, save for the mismatch of its nodal hypersurface with that of the exact wave function. To achieve this objective, we report a pure-sampling algorithm that combines features of forward walking methods of pure-sampling and reptation quantum Monte Carlo (RQMC). The new algorithm accurately samples properties from the mixed and pure distributions simultaneously in runs performed at a single set of time-steps, over which extrapolation to zero time-step is performed. In a detailed comparison, we found RQMC to be less efficient. It requires different sets of time-steps to accurately determine the energy and other properties, such as the dipole moment. We implement our algorithm by systematically increasing an algorithmic parameter until the properties converge to statistically equivalent values. As a proof in principle, we calculated the fixed-node energy, static α polarizability, and other one-electron expectation values for the ground-states of LiH and water molecules. These quantities are free from importance sampling bias, population control bias, time-step bias, extrapolation-model bias, and the finite-field approximation. We found excellent agreement with the accepted values for the energy and a variety of other properties for those systems.

  4. Pure esophageal atresia with normal outer appearance: case report.

    PubMed

    Sanal, Murat; Haeussler, Beatrice; Tabarelli, Walther; Maurer, Kathrin; Sergi, Consolato; Hager, Josef

    2007-08-01

    Isolated esophageal atresia is characterized by a long segment between the 2 esophageal pouches. This article presents a case of pure esophageal atresia with a 1-cm-long segment at the midportion without discontinuity that resembled the subtype II3 according to the Kluth atlas. Resection of the atretic segment and primary anastomosis were performed successfully.

  5. Rare or unusual causes of chronic, isolated, pure aortic regurgitation

    SciTech Connect

    Waller, B.F.; Taliercio, C.P.; Dickos, D.K.; Howard, J.; Adlam, J.H.; Jolly, W. )

    1990-08-01

    Six patients undergoing aortic valve replacement had rare or unusual causes of isolated, pure aortic regurgitation. Two patients had congenitally bicuspid aortic valves with a false commissure (raphe) displaced to the aortic wall (tethered bicuspid aortic valve), two had floppy aortic valves, one had a congenital quadricuspid valve, and one had radiation-induced valve damage.

  6. A Hybrid Sensing Approach for Pure and Adulterated Honey Classification

    PubMed Central

    Subari, Norazian; Saleh, Junita Mohamad; Shakaff, Ali Yeon Md; Zakaria, Ammar

    2012-01-01

    This paper presents a comparison between data from single modality and fusion methods to classify Tualang honey as pure or adulterated using Linear Discriminant Analysis (LDA) and Principal Component Analysis (PCA) statistical classification approaches. Ten different brands of certified pure Tualang honey were obtained throughout peninsular Malaysia and Sumatera, Indonesia. Various concentrations of two types of sugar solution (beet and cane sugar) were used in this investigation to create honey samples of 20%, 40%, 60% and 80% adulteration concentrations. Honey data extracted from an electronic nose (e-nose) and Fourier Transform Infrared Spectroscopy (FTIR) were gathered, analyzed and compared based on fusion methods. Visual observation of classification plots revealed that the PCA approach able to distinct pure and adulterated honey samples better than the LDA technique. Overall, the validated classification results based on FTIR data (88.0%) gave higher classification accuracy than e-nose data (76.5%) using the LDA technique. Honey classification based on normalized low-level and intermediate-level FTIR and e-nose fusion data scored classification accuracies of 92.2% and 88.7%, respectively using the Stepwise LDA method. The results suggested that pure and adulterated honey samples were better classified using FTIR and e-nose fusion data than single modality data. PMID:23202033

  7. Information balance in quantum teleportation with an arbitrary pure state

    SciTech Connect

    Li Li; Chen Zengbing

    2005-07-15

    We study a general teleportation scheme with an arbitrary two-party pure state and derive a tight bound of the teleportation fidelity with a predesigned estimation of the unknown state to be teleported. This bound shows a piecewise balance between information gain and state disturbance. We also explain possible physical significance of the balance.

  8. Entropy for quantum pure states and quantum H theorem

    NASA Astrophysics Data System (ADS)

    Han, Xizhi; Wu, Biao

    2015-06-01

    We construct a complete set of Wannier functions that are localized at both given positions and momenta. This allows us to introduce the quantum phase space, onto which a quantum pure state can be mapped unitarily. Using its probability distribution in quantum phase space, we define an entropy for a quantum pure state. We prove an inequality regarding the long-time behavior of our entropy's fluctuation. For a typical initial state, this inequality indicates that our entropy can relax dynamically to a maximized value and stay there most of time with small fluctuations. This result echoes the quantum H theorem proved by von Neumann [Zeitschrift für Physik 57, 30 (1929), 10.1007/BF01339852]. Our entropy is different from the standard von Neumann entropy, which is always zero for quantum pure states. According to our definition, a system always has bigger entropy than its subsystem even when the system is described by a pure state. As the construction of the Wannier basis can be implemented numerically, the dynamical evolution of our entropy is illustrated with an example.

  9. In vitro degradation of pure Mg in response to glucose

    NASA Astrophysics Data System (ADS)

    Zeng, Rong-Chang; Li, Xiao-Ting; Li, Shuo-Qi; Zhang, Fen; Han, En-Hou

    2015-08-01

    Magnesium and its alloys are promising biodegradable biomaterials but are still challenging to be used in person with high levels of blood glucose or diabetes. To date, the influence of glucose on magnesium degradation has not yet been elucidated, this issue requires more attention. Herein, we present pure Mg exhibiting different corrosion responses to saline and Hank’s solutions with different glucose contents, and the degradation mechanism of pure Mg in the saline solution with glucose in comparison with mannitol as a control. On one hand, the corrosion rate of pure Mg increases with the glucose concentration in saline solutions. Glucose rapidly transforms into gluconic acid, which attacks the oxides of the metal and decreases the pH of the solution; it also promotes the absorption of chloride ions on the Mg surface and consequently accelerates corrosion. On the other hand, better corrosion resistance is obtained with increasing glucose content in Hank’s solution due to the fact that glucose coordinates Ca2+ ions in Hank’s solution and thus improves the formation of Ca-P compounds on the pure Mg surface. This finding will open up new avenues for research on the biodegradation of bio-Mg materials in general, which could yield many new and interesting results.

  10. In vitro degradation of pure Mg in response to glucose

    PubMed Central

    Zeng, Rong-Chang; Li, Xiao-Ting; Li, Shuo-Qi; Zhang, Fen; Han, En-Hou

    2015-01-01

    Magnesium and its alloys are promising biodegradable biomaterials but are still challenging to be used in person with high levels of blood glucose or diabetes. To date, the influence of glucose on magnesium degradation has not yet been elucidated, this issue requires more attention. Herein, we present pure Mg exhibiting different corrosion responses to saline and Hank’s solutions with different glucose contents, and the degradation mechanism of pure Mg in the saline solution with glucose in comparison with mannitol as a control. On one hand, the corrosion rate of pure Mg increases with the glucose concentration in saline solutions. Glucose rapidly transforms into gluconic acid, which attacks the oxides of the metal and decreases the pH of the solution; it also promotes the absorption of chloride ions on the Mg surface and consequently accelerates corrosion. On the other hand, better corrosion resistance is obtained with increasing glucose content in Hank’s solution due to the fact that glucose coordinates Ca2+ ions in Hank’s solution and thus improves the formation of Ca-P compounds on the pure Mg surface. This finding will open up new avenues for research on the biodegradation of bio-Mg materials in general, which could yield many new and interesting results. PMID:26264413

  11. Hyponatremia due to hypothyroidism: a pure renal mechanism.

    PubMed

    Schmitz, P H; de Meijer, P H; Meinders, A E

    2001-03-01

    Hyponatremia is a common disorder. When hyponatremia is the result of hypothyroidism it can be successfully treated with thyroid hormone substitution. We followed cumulative sodium- and fluid balances of a patient with hyponatremia, resulting from hypothyroidism. We concluded that hyponatremia in hypothyroidism is due to a pure renal mechanism, and cannot be ascribed to inappropriate secretion of antidiuretic hormone.

  12. Pure Mediated Priming: A Retrospective Semantic Matching Model

    ERIC Educational Resources Information Center

    Jones, Lara L.

    2010-01-01

    Mediated priming refers to the activation of a target (e.g., "stripes") by a prime (e.g., "lion") that is related indirectly via a connecting mediator (e.g., tiger). In previous mediated priming studies (e.g., McNamara & Altarriba, 1988), the mediator was associatively related to the prime. In contrast, pure mediated…

  13. A Graphical Representation for the Fugacity of a Pure Substance

    ERIC Educational Resources Information Center

    Book, Neil L.; Sitton, Oliver C.

    2010-01-01

    The thermodynamic equations used to define and compute the fugacity of a pure substance are depicted as processes on a semi-logarithmic plot of pressure vs. molar Gibbs energy (PG diagram) with isotherms for the substance behaving as an ideal gas superimposed. The PG diagram clearly demonstrates the physical basis for the definitions and the…

  14. About the Role of Visual Field Defects in Pure Alexia

    ERIC Educational Resources Information Center

    Pflugshaupt, Tobias; Gutbrod, Klemens; Wurtz, Pascal; von Wartburg, Roman; Nyffeler, Thomas; de Haan, Bianca; Karnath, Hans-Otto; Mueri, Rene M.

    2009-01-01

    Pure alexia is an acquired reading disorder characterized by a disproportionate prolongation of reading time as a function of word length. Although the vast majority of cases reported in the literature show a right-sided visual defect, little is known about the contribution of this low-level visual impairment to their reading difficulties. The…

  15. Idealization in Chemistry: Pure Substance and Laboratory Product

    ERIC Educational Resources Information Center

    Fernández-González, Manuel

    2013-01-01

    This article analyzes the concept of idealization in chemistry and the role played by pure substance and laboratory product. This topic has evident repercussions in the educational contexts that are applied to the science classroom, which are highlighted throughout the text. A common structure for knowledge construction is proposed for both…

  16. Number Reading in Pure Alexia--A Review

    ERIC Educational Resources Information Center

    Starrfelt, Randi; Behrmann, Marlene

    2011-01-01

    It is commonly assumed that number reading can be intact in patients with pure alexia, and that this dissociation between letter/word recognition and number reading strongly constrains theories of visual word processing. A truly selective deficit in letter/word processing would strongly support the hypothesis that there is a specialized system or…

  17. A pure-sampling quantum Monte Carlo algorithm

    SciTech Connect

    Ospadov, Egor; Rothstein, Stuart M.

    2015-01-14

    The objective of pure-sampling quantum Monte Carlo is to calculate physical properties that are independent of the importance sampling function being employed in the calculation, save for the mismatch of its nodal hypersurface with that of the exact wave function. To achieve this objective, we report a pure-sampling algorithm that combines features of forward walking methods of pure-sampling and reptation quantum Monte Carlo (RQMC). The new algorithm accurately samples properties from the mixed and pure distributions simultaneously in runs performed at a single set of time-steps, over which extrapolation to zero time-step is performed. In a detailed comparison, we found RQMC to be less efficient. It requires different sets of time-steps to accurately determine the energy and other properties, such as the dipole moment. We implement our algorithm by systematically increasing an algorithmic parameter until the properties converge to statistically equivalent values. As a proof in principle, we calculated the fixed-node energy, static α polarizability, and other one-electron expectation values for the ground-states of LiH and water molecules. These quantities are free from importance sampling bias, population control bias, time-step bias, extrapolation-model bias, and the finite-field approximation. We found excellent agreement with the accepted values for the energy and a variety of other properties for those systems.

  18. Molarity (Aromic Density) of the Elements as Pure Crystals.

    ERIC Educational Resources Information Center

    Pauling, Linus; Herman, Zelek S.

    1985-01-01

    Provides background information for teachers on the atomic density of the elements as pure crystals. Atomic density is defined as the reciprocal of the atomic volume. Includes atomic-density diagrams which were prepared using the atomic-volume values given by Singman, supplemented by additional values for some allotropes. (JN)

  19. Generalized Pure Density Matrices and the Standard Model

    NASA Astrophysics Data System (ADS)

    Brannen, Carl

    2015-04-01

    We consider generalizations of pure density matrices that have ρρ = ρ , but give up the trace=1 requirement. Given a representation of a quantum algebra in N × N complex matrices, the elements that satisfy ρρ = ρ can be taken to be pure density matrix states. In the Standard Model, particles from different ``superselection sectors'' cannot form linear superpositions. For example, it is impossible to form a linear superposition between an electron and a neutrino. We report that some quantum algebras give symmetry, particle and generation content, gauge freedom, and superselection sectors that are similar to those of the Standard Model. Our lecture will consider as an example the 4 × 4 complex matrices. There are 16 that are diagonal with ρρ = ρ . The 4 with trace=1 give the usual pure density matrices. We will show that the 6 with trace=2 form an SU(3) triplet of three superselection sectors, with each sector consisting of an SU(2) doublet. Considering one of these sectors, the mapping to SU(2) is not unique; there is an SU(2) gauge freedom. This gauge freedom is an analogy to the U(1) gauge freedom that arises when converting a pure density matrix to a state vector.

  20. Computer Pure-Tone and Operator Stress: Report III.

    ERIC Educational Resources Information Center

    Dow, Caroline; Covert, Douglas C.

    Pure-tone sound at 15,750 Herz generated by flyback transformers in many computer and video display terminal (VDT) monitors has stress-related productivity effects in some operators, especially women. College-age women in a controlled experiment simulating half a normal work day showed responses within the first half hour of exposure to a tone…

  1. Antioxidative effects of the spice cardamom against non-melanoma skin cancer by modulating nuclear factor erythroid-2-related factor 2 and NF-κB signalling pathways.

    PubMed

    Das, Ila; Acharya, Asha; Berry, Deborah L; Sen, Supti; Williams, Elizabeth; Permaul, Eva; Sengupta, Archana; Bhattacharya, Sudin; Saha, Tapas

    2012-09-28

    The role of dietary factors in inhibiting or delaying the development of non-melanoma skin cancer (NMSC) has been investigated for many years. Cardamom, which is a dietary phytoproduct, has been commonly used in cuisines for flavour and has numerous health benefits, such as improving digestion and stimulating metabolism and having antitumorigenic effects. We have investigated the efficacy of dietary cardamom against 7,12-dimethylbenz[a]anthracene (DMBA)-induced skin papillomatogenesis in Swiss albino mice that closely resembles human NMSC. Mice were grouped into normal wild type (untreated), vehicle-treated (acetone), carcinogen-treated (DMBA), and DMBA and cardamom-treated (DMBA+CARD) to delineate the role of cardamom against DMBA-induced papillomatogenesis. Oral administration of cardamom to DMBA-treated mice up-regulated the phase II detoxification enzymes, such as glutathione-S-transferase and glutathione peroxidase, probably via activation of nuclear factor erythroid-2-related factor 2 transcription factor in 'DMBA+CARD' mice. Furthermore, reduced glutathione, glutathione reductase, superoxide dismutase and catalase were also up-regulated by cardamom in the same 'DMBA+CARD' group of mice compared with DMBA-treated mice. Cardamom ingestion in DMBA-treated mice blocked NF-κB activation and down-regulated cyclo-oxygenase-2 expression. As a consequence, both the size and the number of skin papillomas generated on the skin due to the DMBA treatment were reduced in the 'DMBA+CARD' group. Thus, the results from the present study suggest that cardamom has a potential to become a pivotal chemopreventive agent to prevent papillomagenesis on the skin.

  2. Melatonin downregulates nuclear erythroid 2-related factor 2 and nuclear factor-kappaB during prevention of oxidative liver injury in a dimethylnitrosamine model.

    PubMed

    Jung, Kyung Hee; Hong, Sang-Won; Zheng, Hong-Mei; Lee, Don-Haeng; Hong, Soon-Sun

    2009-09-01

    Melatonin has potent hepatoprotective effects as an antioxidant. However, the signaling pathway of melatonin in the induction of antioxidant enzymes against acute liver injury is not fully understood. The study aimed to determine whether melatonin could prevent dimethylnitrosamine (DMN)-induced liver injury through nuclear erythroid 2-related factor 2 (Nrf2) and inflammation. Liver injury was induced in rats by a single injection of DMN (30 mg/kg, i.p.). Melatonin treatment (50 mg/kg/daily, i.p.) was initiated 24 hr after DMN injection for 14 days, after which the rats were killed and samples were collected. Serum and antioxidant enzyme activities improved in melatonin-treated rats, compared with DMN-induced liver injury group (P < 0.01). Melatonin reduced the infiltration of inflammatory cells and necrosis in the liver, and increased the expression of NADPH: quinone oxidoreductase-1, heme oxygenase-1, and superoxide dismutase-2, which were decreased by DMN. Melatonin increased expression of novel transcription factor, Nrf2, and decreased expression of inflammatory mediators including tumor necrosis factor-alpha, interleukin (IL)-1beta, IL-6, and inducible nitric oxide synthase. The increased nuclear binding of nuclear factor-kappa B (NF-kappaB) in the DMN-induced liver injury group was inhibited by melatonin. Our results show that melatonin increases antioxidant enzymes and Nrf2 expression in parallel with the decrease of inflammatory mediators in DMN-induced liver injury, suggesting that melatonin may play a role of antioxidant defense via the Nrf2 pathway, by reducing inflammation by NF-kappaB inhibition.

  3. The Microglial α7-Acetylcholine Nicotinic Receptor Is a Key Element in Promoting Neuroprotection by Inducing Heme Oxygenase-1 via Nuclear Factor Erythroid-2-Related Factor 2

    PubMed Central

    Parada, Esther; Egea, Javier; Buendia, Izaskun; Negredo, Pilar; Cunha, Ana C.; Cardoso, Silvia; Soares, Miguel P.

    2013-01-01

    Abstract Aims: We asked whether the neuroprotective effect of cholinergic microglial stimulation during an ischemic event acts via a mechanism involving the activation of nuclear factor erythroid-2-related factor 2 (Nrf2) and/or the expression of its target cytoprotective gene, heme oxygenase-1 (HO-1). Specifically, the protective effect of the pharmacologic alpha-7 nicotinic acetylcholine receptor (α7 nAChR) agonist PNU282987 was analyzed in organotypic hippocampal cultures (OHCs) subjected to oxygen and glucose deprivation (OGD) in vitro as well as in photothrombotic stroke in vivo. Results: OHCs exposed to OGD followed by reoxygenation elicited cell death, measured by propidium iodide and 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide staining. Activation of α7 nAChR by PNU282987, after OGD, reduced cell death, reactive oxygen species production, and tumor necrosis factor release. This was associated with induction of HO-1 expression, an effect reversed by α-bungarotoxin and by tin–protoporphyrin IX. The protective effect of PNU282987 was lost in microglial-depleted OHCs as well as in OHCs from Nrf2-deficient-versus-wild-type mice, an effect associated with suppression of HO-1 expression in microglia. Administration of PNU282987 1 h after induction of photothrombotic stroke in vivo reduced the infarct size and improved motor skills in Hmox1lox/lox mice that express normal levels of HO-1, but not in LysMCreHmox1Δ/Δ in which HO-1 expression is inhibited in myeloid cells, including the microglia. Innovation: This study suggests the participation of the microglial α7 nAChR in the brain cholinergic anti-inflammatory pathway. Conclusion: Activation of the α7 nAChR/Nrf2/HO-1 axis in microglia regulates neuroinflammation and oxidative stress, affording neuroprotection under brain ischemic conditions. Antioxid. Redox Signal. 19, 1135–1148. PMID:23311871

  4. Plant Extracts of the Family Lauraceae: A Potential Resource for Chemopreventive Agents that Activate the Nuclear Factor-Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway

    PubMed Central

    Shen, Tao; Chen, Xue-Mei; Harder, Bryan; Long, Min; Wang, Xiao-Ning; Lou, Hong-Xiang; Wondrak, Georg T.; Ren, Dong-Mei; Zhang, Donna D.

    2015-01-01

    Cells and tissues counteract insults from exogenous or endogenous carcinogens through the expression of genes encoding antioxidants and phase II detoxifying enzymes regulated by antioxidant response element promoter regions. Nuclear factor-erythroid 2-related factor 2 plays a key role in regulating the antioxidant response elements-target gene expression. Hence, the Nrf2/ARE pathway represents a vital cellular defense mechanism against damage caused by oxidative stress and xenobiotics, and is recognized as a potential molecular target for discovering chemo-preventive agents. Using a stable antioxidant response element luciferase reporter cell line derived from human breast cancer MDA-MB-231 cells combined with a 96-well high-throughput screening system, we have identified a series of plant extracts from the family Lauraceae that harbor Nrf2-inducing effects. These extracts, including Litsea garrettii (ZK-08), Cinnamomum chartophyllum (ZK-02), C. mollifolium (ZK-04), C. camphora var. linaloolifera (ZK-05), and C. burmannii (ZK-10), promoted nuclear translocation of Nrf2, enhanced protein expression of Nrf2 and its target genes, and augmented intracellular glutathione levels. Cytoprotective activity of these extracts against two electrophilic toxicants, sodium arsenite and H2O2, was investigated. Treatment of human bronchial epithelial cells with extracts of ZK-02, ZK-05, and ZK-10 significantly improved cell survival in response to sodium arsenite and H2O2, while ZK-08 showed a protective effect against only H2O2. Importantly, their protective effects against insults from both sodium arsenite and H2O2 were Nrf2-dependent. Therefore, our data provide evidence that the selected plants from the family Lauraceae are potential sources for chemopreventive agents targeting the Nrf2/ARE pathway. PMID:24585092

  5. Alcohol Causes Alveolar Epithelial Oxidative Stress by Inhibiting the Nuclear Factor (Erythroid-Derived 2)–Like 2–Antioxidant Response Element Signaling Pathway

    PubMed Central

    Jensen, J. Spencer; Fan, Xian

    2013-01-01

    Excessive alcohol use increases the risk of acute lung injury and pneumonia. Chronic alcohol ingestion causes oxidative stress within the alveolar space, including near depletion of glutathione (GSH), which impairs alveolar epithelial and macrophage function, in experimental animals and human subjects. However, the fundamental mechanism(s) by which alcohol induces such profound lung oxidative stress is unknown. Nuclear factor (erythroid-derived 2)–like 2 (Nrf2) is a redox-sensitive master transcription factor that regulates activation of the antioxidant response element (ARE). As the alveolar epithelium controls GSH levels within the alveolar space, we hypothesized that alcohol also decreases Nrf2 expression and/or activation within the alveolar epithelium. In this study, we determined that alcohol ingestion in vivo or direct alcohol exposure in vitro down-regulated the Nrf2–ARE pathway in lung epithelial cells, decreased the expression of antioxidant genes, and lowered intracellular GSH levels. RNA silencing of Nrf2 gene expression in alveolar epithelial cells in vitro decreased expression of these same antioxidant genes, and likewise lowered intracellular GSH levels, findings that mirrored the effects of alcohol. In contrast, treating alcohol-exposed alveolar epithelial cells in vitro with the Nrf2 activator, sulforaphane, preserved Nrf2 expression, ARE activation, intracellular GSH levels, and epithelial barrier function. These new experimental findings implicate down-regulation of the Nrf2–ARE signaling pathway as a fundamental mechanism by which alcohol causes profound oxidative stress and alveolar epithelial dysfunction, and suggest that treatments, such as sulforaphane, that activate this pathway could mitigate the pathophysiological consequences of alcohol on the lung and other organs. PMID:23306837

  6. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  7. Nuclear Factor Erythroid 2-Related Factor 2 Deletion Impairs Glucose Tolerance and Exacerbates Hyperglycemia in Type 1 Diabetic MiceS⃞

    PubMed Central

    Aleksunes, Lauren M.; Reisman, Scott A.; Yeager, Ronnie L.; Goedken, Michael J.

    2010-01-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic β-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum β-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels. PMID:20086057

  8. Morris Water Maze Training in Mice Elevates Hippocampal Levels of Transcription Factors Nuclear Factor (Erythroid-derived 2)-like 2 and Nuclear Factor Kappa B p65

    PubMed Central

    Snow, Wanda M.; Pahlavan, Payam S.; Djordjevic, Jelena; McAllister, Danielle; Platt, Eric E.; Alashmali, Shoug; Bernstein, Michael J.; Suh, Miyoung; Albensi, Benedict C.

    2015-01-01

    Research has identified several transcription factors that regulate activity-dependent plasticity and memory, with cAMP-response element binding protein (CREB) being the most well-studied. In neurons, CREB activation is influenced by the transcription factor nuclear factor kappa B (NF-κB), considered central to immunity but more recently implicated in memory. The transcription factor early growth response-2 (Egr-2), an NF-κB gene target, is also associated with learning and memory. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), an antioxidant transcription factor linked to NF-κB in pathological conditions, has not been studied in normal memory. Given that numerous transcription factors implicated in activity-dependent plasticity demonstrate connections to NF-κB, this study simultaneously evaluated protein levels of NF-κB, CREB, Egr-2, Nrf2, and actin in hippocampi from young (1 month-old) weanling CD1 mice after training in the Morris water maze, a hippocampal-dependent spatial memory task. After a 6-day acquisition period, time to locate the hidden platform decreased in the Morris water maze. Mice spent more time in the target vs. non-target quadrants of the maze, suggestive of recall of the platform location. Western blot data revealed a decrease in NF-κB p50 protein after training relative to controls, whereas NF-κB p65, Nrf2 and actin increased. Nrf2 levels were correlated with platform crosses in nearly all tested animals. These data demonstrate that training in a spatial memory task results in alterations in and associations with particular transcription factors in the hippocampus, including upregulation of NF-κB p65 and Nrf2. Training-induced increases in actin protein levels caution against its use as a loading control in immunoblot studies examining activity-dependent plasticity, learning, and memory. PMID:26635523

  9. Competition of nuclear factor-erythroid 2 factors related transcription factor isoforms, Nrf1 and Nrf2, in antioxidant enzyme induction.

    PubMed

    Chepelev, Nikolai L; Zhang, Hongqiao; Liu, Honglei; McBride, Skye; Seal, Andrew J; Morgan, Todd E; Finch, Caleb E; Willmore, William G; Davies, Kelvin J A; Forman, Henry Jay

    2013-01-01

    Although the Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2) regulated expression of multiple antioxidant and cytoprotective genes through the electrophile responsive element (EpRE) is well established, interaction of Nrf2/EpRE with Nrf1, a closely-related transcription factor, is less well understood. Due to either proteolysis or alternative translation, Nrf1 has been found as proteins of varying size, p120, p95, and p65, which have been described as either activators of EpRE or competitive inhibitors of Nrf2. We investigated the effect of Nrf1 on EpRE-regulated gene expression using the catalytic and modifier subunits of glutamate cysteine ligase (GCLC and GCLM) as models and explored the potential role of Nrf1 in altering their expression in aging and upon chronic exposure to airborne nano-sized particulate matter (nPM). Nrf1 knockout resulted in the increased expression of GCLC and GCLM in human bronchial epithelial (HBE1) cells. Overexpression Nrf2 in combination with either p120 or p65 diminished or failed to further increase the GCLC- and GLCM-EpRE luciferase activity. All known forms of Nrf1 protein, remained unchanged in the lungs of mice with age or in response to nPM. Our study shows that Nrf1 could inhibit EpRE activity in vitro, whereas the precise role of Nrf1 in vivo requires further investigations. We conclude that Nrf1 may not be directly responsible for the loss of Nrf2-dependent inducibility of antioxidant and cytoprotective genes observed in aged animals.

  10. Mesenchymal stromal cells (MSCs) induce ex vivo proliferation and erythroid commitment of cord blood haematopoietic stem cells (CB-CD34+ cells)

    PubMed Central

    Perucca, Simone; Di Palma, Andrea; Piccaluga, Pier Paolo; Gemelli, Claudia; Zoratti, Elisa; Bassi, Giulio; Giacopuzzi, Edoardo; Lojacono, Andrea; Borsani, Giuseppe; Tagliafico, Enrico; Scupoli, Maria Teresa; Bernardi, Simona; Zanaglio, Camilla; Cattina, Federica; Cancelli, Valeria; Malagola, Michele; Krampera, Mauro; Marini, Mirella; Almici, Camillo; Ferrari, Sergio; Russo, Domenico

    2017-01-01

    A human bone marrow-derived mesenchymal stromal cell (MSCs) and cord blood-derived CD34+ stem cell co-culture system was set up in order to evaluate the proliferative and differentiative effects induced by MSCs on CD34+ stem cells, and the reciprocal influences on gene expression profiles. After 10 days of co-culture, non-adherent (SN-fraction) and adherent (AD-fraction) CD34+ stem cells were collected and analysed separately. In the presence of MSCs, a significant increase in CD34+ cell number was observed (fold increase = 14.68), mostly in the SN-fraction (fold increase = 13.20). This was combined with a significant increase in CD34+ cell differentiation towards the BFU-E colonies and with a decrease in the CFU-GM. These observations were confirmed by microarray analysis. Through gene set enrichment analysis (GSEA), we noted a significant enrichment in genes involved in heme metabolism (e.g. LAMP2, CLCN3, BMP2K), mitotic spindle formation and proliferation (e.g. PALLD, SOS1, CCNA1) and TGF-beta signalling (e.g. ID1) and a down-modulation of genes participating in myeloid and lymphoid differentiation (e.g. PCGF2) in the co-cultured CD34+ stem cells. On the other hand, a significant enrichment in genes involved in oxygen-level response (e.g. TNFAIP3, SLC2A3, KLF6) and angiogenesis (e.g. VEGFA, IGF1, ID1) was found in the co-cultured MSCs. Taken together, our results suggest that MSCs can exert a priming effect on CD34+ stem cells, regulating their proliferation and erythroid differentiation. In turn, CD34+ stem cells seem to be able to polarise the BM-niche towards the vascular compartment by modulating molecular pathways related to hypoxia and angiogenesis. PMID:28231331

  11. Pterostilbene attenuates high glucose-induced oxidative injury in hippocampal neuronal cells by activating nuclear factor erythroid 2-related factor 2.

    PubMed

    Yang, Yang; Fan, Chongxi; Wang, Bodong; Ma, Zhiqiang; Wang, Dongjin; Gong, Bing; Di, Shouyin; Jiang, Shuai; Li, Yue; Li, Tian; Yang, Zhi; Luo, Erping

    2017-04-01

    In the present study, neuroblastoma (SH-SY5Y) cells were used to investigate the mechanisms mediating the potential protective effects of pterostilbene (PTE) against mitochondrial metabolic impairment and oxidative stress induced by hyperglycemia for mimicking the diabetic encephalopathy. High glucose medium (100mM) decreased cellular viability after 24h incubation which was evidenced by: (i) reduced mitochondrial complex I and III activities; (ii) reduced mitochondrial cytochrome C; (iii) increased reactive oxygen species (ROS) generation; (iv) decreased mitochondrial membrane potential (ΔΨm); and (v) increased lactate dehydrogenase (LDH) levels. PTE (2.5, 5, and 10μM for 24h) was nontoxic and induced the nuclear transition of Nrf2. Pretreatment of PTE (2.5, 5, and 10μM for 2h) displayed a dose-dependently neuroprotective effect, as indicated by significantly prevented high glucose-induced loss of cellular viability, generation of ROS, reduced mitochondrial complex I and III activities, reduced mitochondrial cytochrome C, decreased ΔΨm, and increased LDH levels. Moreover, the levels of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1) and glutathione S-transferase (GST) were elevated after PTE treatment. In addition, the elevation of nuclear Nrf2 by PTE treatment (10μM for 2h) was abolished by Nrf2 siRNA. Importantly, Nrf2 siRNA induced the opposite changes in mitochondrial complex I and III activities, mitochondrial cytochrome C, reactive species generation, ΔΨm, and LDH. Overall, the present findings were the first to show that pterostilbene attenuated high glucose-induced central nervous system injury in vitro through the activation of Nrf2 signaling, displaying protective effects against mitochondrial dysfunction-derived oxidative stress.

  12. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae)

    PubMed Central

    Liu, Di; Irwin, David M.; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the re