Science.gov

Sample records for adult pure erythroid

  1. Secondary pure erythroid leukaemia in relapsed acute lymphoblastic leukaemia: lineage switch or chemotherapy effect?

    PubMed

    Gupta, Sanjeev Kumar; Kumar, Rajive; Chharchhodawala, Taher; Kumar, Lalit

    2014-05-19

    Pure erythroid leukaemia is a rare subtype of acute myeloid leukaemia (AML) and its occurrence at acute lymphoblastic leukaemia (ALL) relapse has not been reported earlier. A 39-year-old man received chemotherapy for Philadelphia-negative B cell ALL. Subsequently, he developed pure erythroid leukaemia with >80% immature erythroid precursors in bone marrow showing block positivity on periodic acid-Schiff stain, expressing CD71, CD34 but lacking CD235a. The interval between exposure to multidrug chemotherapy including cyclophosphamide and AML diagnosis was 2 years and 9 months. No cytogenetic abnormality was detected at the time of relapse. The patient died 2 weeks after starting AML chemotherapy. The relatively narrow time interval (usually 5-10 years) between chemotherapy and AML development and normal karyotype at relapse raises a possibility of lineage switch besides therapy-related AML as the likely pathogenesis. Further exploration of such cases may unravel the pathways responsible for lineage assignment in pluripotent stem cells.

  2. Qualitative and quantitative comparison of the proteome of erythroid cells differentiated from human iPSCs and adult erythroid cells by multiplex TMT labelling and nanoLC-MS/MS.

    PubMed

    Trakarnsanga, Kongtana; Wilson, Marieangela C; Griffiths, Rebecca E; Toye, Ashley M; Carpenter, Lee; Heesom, Kate J; Parsons, Steve F; Anstee, David J; Frayne, Jan

    2014-01-01

    Induced pluripotent stem cells (iPSC) are an attractive progenitor source for the generation of in vitro blood products. However, before iPSC-derived erythroid cells can be considered for therapeutic use their similarity to adult erythroid cells must be confirmed. We have analysed the proteome of erythroid cells differentiated from the iPSC fibroblast derived line (C19) and showed they express hallmark RBC proteins, including all those of the ankyrin and 4.1R complex. We next compared the proteome of erythroid cells differentiated from three iPSC lines (C19, OCE1, OPM2) with that of adult and cord blood progenitors. Of the 1989 proteins quantified <3% differed in level by 2-fold or more between the different iPSC-derived erythroid cells. When compared to adult cells, 11% of proteins differed in level by 2-fold or more, falling to 1.9% if a 5-fold threshold was imposed to accommodate slight inter-cell line erythropoietic developmental variation. Notably, the level of >30 hallmark erythroid proteins was consistent between the iPSC lines and adult cells. In addition, a sub-population (10-15%) of iPSC erythroid cells in each of the iPSC lines completed enucleation. Aberrant expression of some cytoskeleton proteins may contribute to the failure of the majority of the cells to enucleate since we detected some alterations in cytoskeletal protein abundance. In conclusion, the proteome of erythroid cells differentiated from iPSC lines is very similar to that of normal adult erythroid cells, but further work to improve the induction of erythroid cells in existing iPSC lines or to generate novel erythroid cell lines is required before iPSC-derived red cells can be considered suitable for transfusion therapy.

  3. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    SciTech Connect

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-06-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes.

  4. RUNX1B Expression Is Highly Heterogeneous and Distinguishes Megakaryocytic and Erythroid Lineage Fate in Adult Mouse Hematopoiesis

    PubMed Central

    Draper, Julia E.; Sroczynska, Patrycja; Tsoulaki, Olga; Leong, Hui Sun; Fadlullah, Muhammad Z. H.; Miller, Crispin; Kouskoff, Valerie; Lacaud, Georges

    2016-01-01

    The Core Binding Factor (CBF) protein RUNX1 is a master regulator of definitive hematopoiesis, crucial for hematopoietic stem cell (HSC) emergence during ontogeny. RUNX1 also plays vital roles in adult mice, in regulating the correct specification of numerous blood lineages. Akin to the other mammalian Runx genes, Runx1 has two promoters P1 (distal) and P2 (proximal) which generate distinct protein isoforms. The activities and specific relevance of these two promoters in adult hematopoiesis remain to be fully elucidated. Utilizing a dual reporter mouse model we demonstrate that the distal P1 promoter is broadly active in adult hematopoietic stem and progenitor cell (HSPC) populations. By contrast the activity of the proximal P2 promoter is more restricted and its upregulation, in both the immature Lineage- Sca1high cKithigh (LSK) and bipotential Pre-Megakaryocytic/Erythroid Progenitor (PreMegE) populations, coincides with a loss of erythroid (Ery) specification. Accordingly the PreMegE population can be prospectively separated into “pro-erythroid” and “pro-megakaryocyte” populations based on Runx1 P2 activity. Comparative gene expression analyses between Runx1 P2+ and P2- populations indicated that levels of CD34 expression could substitute for P2 activity to distinguish these two cell populations in wild type (WT) bone marrow (BM). Prospective isolation of these two populations will enable the further investigation of molecular mechanisms involved in megakaryocytic/erythroid (Mk/Ery) cell fate decisions. Having characterized the extensive activity of P1, we utilized a P1-GFP homozygous mouse model to analyze the impact of the complete absence of Runx1 P1 expression in adult mice and observed strong defects in the T cell lineage. Finally, we investigated how the leukemic fusion protein AML1-ETO9a might influence Runx1 promoter usage. Short-term AML1-ETO9a induction in BM resulted in preferential P2 upregulation, suggesting its expression may be important to

  5. Erythroid-Specific Expression of LIN28A Is Sufficient for Robust Gamma-Globin Gene and Protein Expression in Adult Erythroblasts

    PubMed Central

    Byrnes, Colleen; Kaushal, Megha; Rabel, Antoinette; Tumburu, Laxminath; Allwardt, Joshua M.; Miller, Jeffery L.

    2015-01-01

    Increasing fetal hemoglobin (HbF) levels in adult humans remains an active area in hematologic research. Here we explored erythroid-specific LIN28A expression for its effect in regulating gamma-globin gene expression and HbF levels in cultured adult erythroblasts. For this purpose, lentiviral transduction vectors were produced with LIN28A expression driven by erythroid-specific gene promoter regions of the human KLF1 or SPTA1 genes. Transgene expression of LIN28A with a linked puromycin resistance marker was restricted to the erythroid lineage as demonstrated by selective survival of erythroid colonies (greater than 95% of all colonies). Erythroblast LIN28A over-expression (LIN28A-OE) did not significantly affect proliferation or inhibit differentiation. Greater than 70% suppression of total let-7 microRNA levels was confirmed in LIN28A-OE cells. Increases in gamma-globin mRNA and protein expression with HbF levels reaching 30–40% were achieved. These data suggest that erythroblast targeting of LIN28A expression is sufficient for increasing fetal hemoglobin expression in adult human erythroblasts. PMID:26675483

  6. Transcriptional activation of human adult alpha-globin genes by hypersensitive site-40 enhancer: function of nuclear factor-binding motifs occupied in erythroid cells.

    PubMed Central

    Rombel, I; Hu, K Y; Zhang, Q; Papayannopoulou, T; Stamatoyannopoulos, G; Shen, C K

    1995-01-01

    The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element. Images Fig. 2 Fig. 3 Fig. 5 Fig. 6 PMID:7604012

  7. A comparison of liking of pureed food between two groups of older adults.

    PubMed

    Ettinger, Laurel; Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Cognitive difficulties make consumer testing with older adults who have dysphagia extremely difficult. Using a healthier older adult population to predict liking scores of this subgroup of older adults could provide a reliable method of determining liking in this population. Forty-five adults older than 65 years who had not been diagnosed with dysphagia participated in a taste test at a local seniors' center. Twelve puree consumers were recruited from five long-term care homes in Ontario. All participants rated three commercial carrot purees and turkey purees for their liking of the appearance and flavor using a 5-point modified Cued Facial Scale. Significant differences between the groups indicate that a healthy group of older adults cannot replicate liking of puree consumers.

  8. Transcriptome dynamics during human erythroid differentiation and development.

    PubMed

    Yang, Yadong; Wang, Hai; Chang, Kai-Hsin; Qu, Hongzhu; Zhang, Zhaojun; Xiong, Qian; Qi, Heyuan; Cui, Peng; Lin, Qiang; Ruan, Xiuyan; Yang, Yaran; Li, Yajuan; Shu, Chang; Li, Quanzhen; Wakeland, Edward K; Yan, Jiangwei; Hu, Songnian; Fang, Xiangdong

    2013-01-01

    To explore the mechanisms controlling erythroid differentiation and development, we analyzed the genome-wide transcription dynamics occurring during the differentiation of human embryonic stem cells (HESCs) into the erythroid lineage and development of embryonic to adult erythropoiesis using high throughput sequencing technology. HESCs and erythroid cells at three developmental stages: ESER (embryonic), FLER (fetal), and PBER (adult) were analyzed. Our findings revealed that the number of expressed genes decreased during differentiation, whereas the total expression intensity increased. At each of the three transitions (HESCs-ESERs, ESERs-FLERs, and FLERs-PBERs), many differentially expressed genes were observed, which were involved in maintaining pluripotency, early erythroid specification, rapid cell growth, and cell-cell adhesion and interaction. We also discovered dynamic networks and their central nodes in each transition. Our study provides a fundamental basis for further investigation of erythroid differentiation and development, and has implications in using ESERs for transfusion product in clinical settings.

  9. Erythropoietin-induced acute erythroid leukemia-like picture: a potential pitfall.

    PubMed

    Moharram, Laila; Kamal, Nazmi; Al Sukhun, Sana; Sughayer, Maher A

    2014-03-01

    A 31-year-old male patient presented with fever and pancytopenia. He was diagnosed as a case of chronic anemia since early childhood. The etiology of the anemia was not known. The patient was transfusion dependent, and he had been maintained on erythropoietin for three years prior to admission. A bone marrow examination revealed prominent proliferation of immature and dysplastic erythroid precursors. Acute erythroid leukemia of the pure erythroid subtype was suspected. However, because of the history of erythropoietin therapy a definite diagnosis was not made. On follow-up one month later, the marrow changes had reversed to normal.

  10. Hypoxia Alters Progression of the Erythroid Program

    PubMed Central

    Rogers, Heather M.; Yu, Xiaobing; Wen, Jie; Smith, Reginald; Fibach, Eitan; Noguchi, Constance Tom

    2008-01-01

    Hypoxia can induce erythropoiesis through regulated increase of erythropoietin (Epo) production. We investigated the direct influence of oxygen tension (pO2) in the physiologic range (2–8%) on erythroid progenitor cell differentiation using cultures of adult human hematopoietic progenitor cells exposed to decreasing (20 – 2%) pO2 and independent of variation in Epo levels. Decreases in Hb-containing cells were observed at the end of the culture period with decreasing pO2. This is due in part to a reduction in cell growth, and at 2% O2 a marked increase in cell toxicity. Analysis of the kinetics of cell differentiation showed an increase in the proportion of cells with glycophorin A expression and Hb accumulation at physiologic pO2. The cells were characterized by an early induction of γ-globin expression and a delay and reduction in peak levels of β-globin expression. Overall, fetal Hb and γ-globin expression were increased at physiologic pO2 but the increases were reduced at 2% O2 as cultures become cytotoxic. At reduced pO2, induction of EPO-receptor (EPO-R) by Epo was decreased and delayed, analogous to the delay in β-globin induction. The oxygen dependent reduction of EPO-R can account for the associated cytotoxicity at 2% O2. Epo induction of erythroid transcription factors, EKLF, GATA-1 and SCL/Tal-1, was also delayed and decreased at reduced pO2, consistent with lower levels of EPO-R and resultant Epo signaling. These changes in EPO-R and globin gene expression raise the possibility that the early increase of γ-globin is a consequence of reduced Epo signaling and a delay in induction of erythroid transcription factors. PMID:17936496

  11. Functional erythroid promoters created by interaction of the transcription factor GATA-1 with CACCC and AP-1/NFE-2 elements.

    PubMed Central

    Walters, M; Martin, D I

    1992-01-01

    We have investigated interactions between the erythroid transcription factor GATA-1 and factors binding two cis-acting elements commonly linked to GATA sites in erythroid control elements. GATA-1 is present at all stages of erythroid differentiation, is necessary for erythropoiesis, and binds sites in all erythroid control elements. However, minimal promoters containing GATA-1 sites are inactive when tested in erythroid cells. Based on this observation, two erythroid cis elements, here termed CACCC and AP-1/NFE-2, were linked to GATA sites in minimal promoters. None of the elements linked only to a TATA box created an active promoter, but GATA sites linked to either CACCC or AP-1/NFE-2 elements formed strong erythroid promoters. A mutation of T to C at position -175 in the gamma-globin promoter GATA site, associated with hereditary persistence of fetal hemoglobin (HPFH), increased expression of these promoters in both fetal and adult cells. A construct bearing the beta-globin CACCC element was more active in adult and less active in fetal erythroid cells, when compared with the gamma-globin CACCC element. These studies suggest that erythroid control elements are formed by the interactions of at least three transcription factors, none of which functions alone. Images PMID:1438231

  12. ERYTHROPOIETIN EFFECTS ON FETAL MOUSE ERYTHROID CELLS

    PubMed Central

    Chui, David H. K.; Djaldetti, Meir; Marks, Paul A.; Rifkind, Richard A.

    1971-01-01

    The effect of the hormone, erythropoietin, on cultures of erythroblasts derived from the livers of fetal C57BL/6J mice was examined. An increase both in the content and in the rate of synthesis of normal adult mouse globin chains was detected in hormone-treated cultures. The rate of protein synthesis by individual erythroblasts does not increase in response to the hormone, whereas the absolute number of hemoglobin-synthesizing cells does increase and accounts for the observed stimulation of hemoglobin synthesis. The principal effect of erythropoietin appears to be upon the population of immature erythroid precursor cells which persists in the presence of the hormone, the cells maintaining their ability to replicate, and their capacity to differentiate into hemoglobinizing erythroblasts. In the absence of hormone, already committed erythroblasts continue their development, but erythropoiesis is not sustained. PMID:5128349

  13. A simple method to obtain pure cultures of multiciliated ependymal cells from adult rodents.

    PubMed

    Grondona, J M; Granados-Durán, P; Fernández-Llebrez, P; López-Ávalos, M D

    2013-01-01

    Ependymal cells form an epithelium lining the ventricular cavities of the vertebrate brain. Numerous methods to obtain primary culture ependymal cells have been developed. Most of them use foetal or neonatal rat brain and the few that utilize adult brain hardly achieve purity. Here, we describe a simple and novel method to obtain a pure non-adherent ependymal cell culture from explants of the striatal and septal walls of the lateral ventricles. The combination of a low incubation temperature followed by a gentle enzymatic digestion allows the detachment of most of the ependymal cells from the ventricular wall in a period of 6 h. Along with ependymal cells, a low percentage (less than 6 %) of non-ependymal cells also detaches. However, they do not survive under two restrictive culture conditions: (1) a simple medium (alpha-MEM with glucose) without any supplement; and (2) a low density of 1 cell/µl. This purification method strategy does not require cell labelling with antibodies and cell sorting, which makes it a simpler and cheaper procedure than other methods previously described. After a period of 48 h, only ependymal cells survive such conditions, revealing the remarkable survival capacity of ependymal cells. Ependymal cells can be maintained in culture for up to 7-10 days, with the best survival rates obtained in Neurobasal supplemented with B27 among the tested media. After 7 days in culture, ependymal cells lose most of the cilia and therefore the mobility, while acquiring radial glial cell markers (GFAP, BLBP, GLAST). This interesting fact might indicate a reprogramming of the cell identity.

  14. β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

    PubMed

    Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

    2016-06-01

    Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552.

  15. Haemoglobin biosynthesis site in rabbit embryo erythroid cells.

    PubMed

    Cianciarullo, Aurora M; Bertho, Alvaro L; Soares, Maurilio J; Hosoda, Tânia M; Nogueira-Silva, Simone; Beçak, Willy

    2003-01-01

    Properly metabolized globin synthesis and iron uptake are indispensable for erythroid cell differentiation and maturation. Mitochondrial participation is crucial in the process of haeme synthesis for cytochromes and haemoglobin. We studied the final biosynthesis site of haemoglobin using an ultrastructural approach, with erythroid cells obtained from rabbit embryos, in order to compare these results with those of animals treated with saponine or phenylhydrazine. Our results are similar to those obtained in assays with adult mammals, birds, amphibians, reptiles and fish, after induction of haemolytic anaemia. Therefore, the treatment did not interfere with the process studied, confirming our previous findings. Immunoelectron microscopy showed no labelling of mitochondria or other cellular organelles supposedly involved in the final biosynthesis of haemoglobin molecules, suggesting instead that it occurs free in the cytoplasm immediately after the liberation of haeme from the mitochondria, by electrostatic attraction between haeme and globin chains. PMID:12972280

  16. Setd1a and NURF mediate chromatin dynamics and gene regulation during erythroid lineage commitment and differentiation.

    PubMed

    Li, Ying; Schulz, Vincent P; Deng, Changwang; Li, Guangyao; Shen, Yong; Tusi, Betsabeh K; Ma, Gina; Stees, Jared; Qiu, Yi; Steiner, Laurie A; Zhou, Lei; Zhao, Keji; Bungert, Jörg; Gallagher, Patrick G; Huang, Suming

    2016-09-01

    The modulation of chromatin structure is a key step in transcription regulation in mammalian cells and eventually determines lineage commitment and differentiation. USF1/2, Setd1a and NURF complexes interact to regulate chromatin architecture in erythropoiesis, but the mechanistic basis for this regulation is hitherto unknown. Here we showed that Setd1a and NURF complexes bind to promoters to control chromatin structural alterations and gene activation in a cell context dependent manner. In human primary erythroid cells USF1/2, H3K4me3 and the NURF complex were significantly co-enriched at transcription start sites of erythroid genes, and their binding was associated with promoter/enhancer accessibility that resulted from nucleosome repositioning. Mice deficient for Setd1a, an H3K4 trimethylase, in the erythroid compartment exhibited reduced Ter119/CD71 positive erythroblasts, peripheral blood RBCs and hemoglobin levels. Loss of Setd1a led to a reduction of promoter-associated H3K4 methylation, inhibition of gene transcription and blockade of erythroid differentiation. This was associated with alterations in NURF complex occupancy at erythroid gene promoters and reduced chromatin accessibility. Setd1a deficiency caused decreased associations between enhancer and promoter looped interactions as well as reduced expression of erythroid genes such as the adult β-globin gene. These data indicate that Setd1a and NURF complexes are specifically targeted to and coordinately regulate erythroid promoter chromatin dynamics during erythroid lineage differentiation. PMID:27141965

  17. Setd1a and NURF mediate chromatin dynamics and gene regulation during erythroid lineage commitment and differentiation

    PubMed Central

    Li, Ying; Schulz, Vincent P.; Deng, Changwang; Li, Guangyao; Shen, Yong; Tusi, Betsabeh K.; Ma, Gina; Stees, Jared; Qiu, Yi; Steiner, Laurie A.; Zhou, Lei; Zhao, Keji; Bungert, Jörg; Gallagher, Patrick G.; Huang, Suming

    2016-01-01

    The modulation of chromatin structure is a key step in transcription regulation in mammalian cells and eventually determines lineage commitment and differentiation. USF1/2, Setd1a and NURF complexes interact to regulate chromatin architecture in erythropoiesis, but the mechanistic basis for this regulation is hitherto unknown. Here we showed that Setd1a and NURF complexes bind to promoters to control chromatin structural alterations and gene activation in a cell context dependent manner. In human primary erythroid cells USF1/2, H3K4me3 and the NURF complex were significantly co-enriched at transcription start sites of erythroid genes, and their binding was associated with promoter/enhancer accessibility that resulted from nucleosome repositioning. Mice deficient for Setd1a, an H3K4 trimethylase, in the erythroid compartment exhibited reduced Ter119/CD71 positive erythroblasts, peripheral blood RBCs and hemoglobin levels. Loss of Setd1a led to a reduction of promoter-associated H3K4 methylation, inhibition of gene transcription and blockade of erythroid differentiation. This was associated with alterations in NURF complex occupancy at erythroid gene promoters and reduced chromatin accessibility. Setd1a deficiency caused decreased associations between enhancer and promoter looped interactions as well as reduced expression of erythroid genes such as the adult β-globin gene. These data indicate that Setd1a and NURF complexes are specifically targeted to and coordinately regulate erythroid promoter chromatin dynamics during erythroid lineage differentiation. PMID:27141965

  18. Direct demonstration of the human parvovirus in erythroid progenitor cells infected in vitro.

    PubMed Central

    Young, N; Harrison, M; Moore, J; Mortimer, P; Humphries, R K

    1984-01-01

    The human parvovirus (HPV), the cause of transient aplastic crisis of hereditary hemolytic anemia, has been shown to be cytotoxic for erythroid progenitor cells and its presence in these cells demonstrated by morphologic techniques. A relatively pure population of progenitors, isolated by removal of immature erythroid bursts from primary culture, was the target of the virus infection. Infected cells failed to proliferate in secondary culture. Using a monoclonal antibody to HPV, specific fluorescence was demonstrated in a minority of cells 24-48 h after infection with virus. Infected cells examined by electron microscopy showed marked toxic ultrastructural alterations and parvovirus-like particles in crystalline arrays in the nucleus. Images PMID:6392340

  19. Comparison of adult age differences in verbal and visuo-spatial memory: the importance of 'pure', parallel and validated measures.

    PubMed

    Kemps, Eva; Newson, Rachel

    2006-04-01

    The study compared age-related decrements in verbal and visuo-spatial memory across a broad elderly adult age range. Twenty-four young (18-25 years), 24 young-old (65-74 years), 24 middle-old (75-84 years) and 24 old-old (85-93 years) adults completed parallel recall and recognition measures of verbal and visuo-spatial memory from the Doors and People Test (Baddeley, Emslie & Nimmo-Smith, 1994). These constituted 'pure' and validated indices of either verbal or visuo-spatial memory. Verbal and visuo-spatial memory declined similarly with age, with a steeper decline in recall than recognition. Unlike recognition memory, recall performance also showed a heightened decline after the age of 85. Age-associated memory loss in both modalities was largely due to working memory and executive function. Processing speed and sensory functioning (vision, hearing) made minor contributions to memory performance and age differences in it. Together, these findings demonstrate common, rather than differential, age-related effects on verbal and visuo-spatial memory. They also emphasize the importance of using 'pure', parallel and validated measures of verbal and visuo-spatial memory in memory ageing research.

  20. In vitro apoptotic cell death during erythroid differentiation.

    PubMed

    Zamai, L; Burattini, S; Luchetti, F; Canonico, B; Ferri, P; Melloni, E; Gonelli, A; Guidotti, L; Papa, S; Falcieri, E

    2004-03-01

    Erythropoiesis occurs in bone marrow and it has been shown that during in vivo erythroid differentiation some immature erythroblasts undergo apoptosis. In this regard, it is known that immature erythroblasts are FasL- and TRAIL-sensitive and can be killed by cells expressing these ligand molecules. In the present study, we have investigated the cell death phenomenon that occurs during a common unilineage model of erythroid development. Purified CD34+ human haemopoietic progenitors were cultured in vitro in the presence of SCF, IL-3 and erythropoietin. Their differentiation stages and apoptosis were followed by multiple technical approaches. Flow cytometric evaluation of surface and intracellular molecules revealed that glycophorin A appeared at day 3-4 of incubation and about 75% of viable cells co-expressed high density glycophorin A (Gly(bright)) and adult haemoglobin at day 14 of culture, indicating that this system reasonably recapitulates in vivo normal erythropoiesis. Interestingly, when mature (Gly(bright)) erythroid cells reached their higher percentages (day 14) almost half of cultured cells were apoptotic. Morphological studies indicated that the majority of dead cells contained cytoplasmic granular material typical of basophilic stage, and DNA analysis by flow cytometry and TUNEL reaction revealed nuclear fragmentation. These observations indicate that in vitro unilineage erythroid differentiation, as in vivo, is associated with apoptotic cell death of cells with characteristics of basophilic erythroblasts. We suggest that the interactions between different death receptors on immature basophilic erythroblasts with their ligands on more mature erythroblasts may contribute to induce apoptosis in vitro. PMID:15004520

  1. Neonatal CD71+ erythroid cells do not modify murine sepsis mortality

    PubMed Central

    Wynn, James L.; Scumpia, Philip O.; Stocks, Blair T.; Romano-Keeler, Joann; Alrifai, Mhd Wael; Liu, Jin-Hua; Kim, Annette S.; Alford, Catherine E.; Matta, Pranathi; Weitkamp, Jörn-Hendrik; Moore, Daniel J.

    2015-01-01

    Sepsis is a major cause of neonatal mortality and morbidity worldwide. A recent report suggested murine neonatal host defense against infection could be compromised by immunosuppressive CD71+ erythroid splenocytes. We examined the impact of CD71+ erythroid splenocytes on murine neonatal mortality to endotoxin challenge or polymicrobial sepsis and characterized circulating CD71+ erythroid (CD235a+) cells in human neonates. Adoptive transfer or antibody-mediated reduction of neonatal CD71+ erythroid splenocytes did not alter murine neonatal survival to endotoxin challenge or polymicrobial sepsis challenge. Ex vivo immunosuppression of stimulated adult CD11b+ cells was not limited to neonatal splenocytes as it also occurred with adult and neonatal bone marrow. Animals treated with anti-CD71 antibody showed reduced splenic bacterial load following bacterial challenge compared to isotype-treated mice. However, adoptive transfer of enriched CD71+ erythroid splenocytes to CD71+-reduced animals did not reduce bacterial clearance. Human CD71+CD235a+ cells were common among cord blood mononuclear cells and were shown to be reticulocytes. In summary, a lack of effect on murine survival to polymicrobial sepsis following adoptive transfer or diminution of CD71+ erythroid splenocytes under these experimental conditions suggests the impact of these cells on neonatal infection risk and progression may be limited. An unanticipated immune priming effect of anti-CD71 antibody treatment was likely responsible for the reported enhanced bacterial clearance, rather than a reduction of immunosuppressive CD71+ erythroid splenocytes. In humans, the well-described rapid decrease in circulating reticulocytes after birth suggests they may have a limited role in reducing inflammation secondary to microbial colonization. PMID:26101326

  2. High yield extraction of pure spinal motor neurons, astrocytes and microglia from single embryo and adult mouse spinal cord

    PubMed Central

    Beaudet, Marie-Josée; Yang, Qiurui; Cadau, Sébastien; Blais, Mathieu; Bellenfant, Sabrina; Gros-Louis, François; Berthod, François

    2015-01-01

    Extraction of mouse spinal motor neurons from transgenic mouse embryos recapitulating some aspects of neurodegenerative diseases like amyotrophic lateral sclerosis has met with limited success. Furthermore, extraction and long-term culture of adult mouse spinal motor neurons and glia remain also challenging. We present here a protocol designed to extract and purify high yields of motor neurons and glia from individual spinal cords collected on embryos and adult (5-month-old) normal or transgenic mice. This method is based on mild digestion of tissue followed by gradient density separation allowing to obtain two millions motor neurons over 92% pure from one E14.5 single embryo and more than 30,000 from an adult mouse. These cells can be cultured more than 14 days in vitro at a density of 100,000 cells/cm2 to maintain optimal viability. Functional astrocytes and microglia and small gamma motor neurons can be purified at the same time. This protocol will be a powerful and reliable method to obtain motor neurons and glia to better understand mechanisms underlying spinal cord diseases. PMID:26577180

  3. Cytarabine With or Without SCH 900776 in Treating Adult Patients With Relapsed Acute Myeloid Leukemia

    ClinicalTrials.gov

    2016-07-20

    Adult Acute Megakaryoblastic Leukemia; Adult Acute Monoblastic Leukemia; Adult Acute Monocytic Leukemia; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With Maturation; Adult Acute Myeloid Leukemia With Minimal Differentiation; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Myeloid Leukemia Without Maturation; Adult Acute Myelomonocytic Leukemia; Adult Erythroleukemia; Adult Pure Erythroid Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Recurrent Adult Acute Myeloid Leukemia

  4. A pilot study of the body weight of pure-bred client-owned adult cats.

    PubMed

    Kienzle, Ellen; Moik, Katja

    2011-10-01

    A total of 539 pure-bred and seventy-five cats without a pedigree were weighed and scored at cat shows or in veterinary surgeries. Data from normal-weight cats with a body condition score (BCS) of 5 (ideal) were only used. Breeds were grouped into five classes. For female cats, the mean weight for these groups were as follows: very light (2.8 kg); light (3.2 kg); medium (3.5 kg); large (4.0 kg); giant (4.9) kg. For male cats, the corresponding values were 3.6, 4.2, 4.3, 5.1 and 6.1 kg. Siamese/Oriental Shorthair were identified as a very light breed, the Norwegian Forest and the Siberian Cat as a large breed and the Maine Coon as a giant breed. Males and females of the same breed did not always belong to the same class. In some breeds, individuals of the same sex were found in two different classes. The percentage of intact overweight cats (BCS >5) was low (7 % of intact males, 3 % of intact females). Incidence of overweight in neutered cats was 50 % in males and 38 % in females. Among pedigreed cats, there were differences in the incidence of overweight in neutered cats: high in Norwegian Forest Cats (males 75 %, females 50 %) and low in Siamese/Oriental Shorthair Cats (males 25 %, females 1 %). Cats with a BCS of 6, 7 and 8 had on average 120, 154 and 214 % of the normal weight of their breed, respectively.

  5. The CACCC-Binding Protein KLF3/BKLF Represses a Subset of KLF1/EKLF Target Genes and Is Required for Proper Erythroid Maturation In Vivo

    PubMed Central

    Funnell, Alister P. W.; Norton, Laura J.; Mak, Ka Sin; Burdach, Jon; Artuz, Crisbel M.; Twine, Natalie A.; Wilkins, Marc R.; Power, Carl A.; Hung, Tzong-Tyng; Perdomo, José; Koh, Philip; Bell-Anderson, Kim S.; Orkin, Stuart H.; Fraser, Stuart T.; Perkins, Andrew C.; Pearson, Richard C. M.

    2012-01-01

    The CACCC-box binding protein erythroid Krüppel-like factor (EKLF/KLF1) is a master regulator that directs the expression of many important erythroid genes. We have previously shown that EKLF drives transcription of the gene for a second KLF, basic Krüppel-like factor, or KLF3. We have now tested the in vivo role of KLF3 in erythroid cells by examining Klf3 knockout mice. KLF3-deficient adults exhibit a mild compensated anemia, including enlarged spleens, increased red pulp, and a higher percentage of erythroid progenitors, together with elevated reticulocytes and abnormal erythrocytes in the peripheral blood. Impaired erythroid maturation is also observed in the fetal liver. We have found that KLF3 levels rise as erythroid cells mature to become TER119+. Consistent with this, microarray analysis of both TER119− and TER119+ erythroid populations revealed that KLF3 is most critical at the later stages of erythroid maturation and is indeed primarily a transcriptional repressor. Notably, many of the genes repressed by KLF3 are also known to be activated by EKLF. However, the majority of these are not currently recognized as erythroid-cell-specific genes. These results reveal the molecular and physiological function of KLF3, defining it as a feedback repressor that counters the activity of EKLF at selected target genes to achieve normal erythropoiesis. PMID:22711990

  6. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation

    PubMed Central

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5mC) and 5hmC at a CCGG site within the 5′ γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5mC and 5hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5hmC and negatively correlated with 5mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  7. JAK-STAT and AKT pathway-coupled genes in erythroid progenitor cells through ontogeny

    PubMed Central

    2012-01-01

    Background It has been reported that the phosphatidylinositol 3-kinase (PI3K)-AKT signaling pathway regulates erythropoietin (EPO)-induced survival, proliferation, and maturation of early erythroid progenitors. Erythroid cell proliferation and survival have also been related to activation of the JAK-STAT pathway. The goal of this study was to observe the function of EPO activation of JAK-STAT and PI3K/AKT pathways in the development of erythroid progenitors from hematopoietic CD34+ progenitor cells, as well as to distinguish early EPO target genes in human erythroid progenitors during ontogeny. Methods Hematopoietic CD34+ progenitor cells, isolated from fetal and adult hematopoietic tissues, were differentiated into erythroid progenitor cells. We have used microarray analysis to examine JAK-STAT and PI3K/AKT related genes, as well as broad gene expression modulation in these human erythroid progenitor cells. Results In microarray studies, a total of 1755 genes were expressed in fetal liver, 3844 in cord blood, 1770 in adult bone marrow, and 1325 genes in peripheral blood-derived erythroid progenitor cells. The erythroid progenitor cells shared 1011 common genes. Using the Ingenuity Pathways Analysis software, we evaluated the network pathways of genes linked to hematological system development, cellular growth and proliferation. The KITLG, EPO, GATA1, PIM1 and STAT3 genes represent the major connection points in the hematological system development linked genes. Some JAK-STAT signaling pathway-linked genes were steadily upregulated throughout ontogeny (PIM1, SOCS2, MYC, PTPN11), while others were downregulated (PTPN6, PIAS, SPRED2). In addition, some JAK-STAT pathway related genes are differentially expressed only in some stages of ontogeny (STATs, GRB2, CREBB). Beside the continuously upregulated (AKT1, PPP2CA, CHUK, NFKB1) and downregulated (FOXO1, PDPK1, PIK3CG) genes in the PI3K-AKT signaling pathway, we also observed intermittently regulated gene expression

  8. Iron targeting to mitochondria in erythroid cells.

    PubMed

    Ponka, P; Sheftel, A D; Zhang, A-S

    2002-08-01

    Immature erythroid cells have an exceptionally high capacity to synthesize haem that is, at least in part, the result of the unique control of iron metabolism in these cells. In erythroid cells the vast majority of Fe released from endosomes must cross both the outer and the inner mitochondrial membranes to reach ferrochelatase, which inserts Fe into protoporphyrin IX. Based on the fact that Fe is specifically targeted into erythroid mitochondria, we have proposed that a transient mitochondria-endosome interaction is involved in Fe transfer to ferrochelatase [Ponka (1997) Blood 89, 1-25]. In this study, we examined whether the inhibition of endosome mobility within erythroid cells would decrease the rate of (59)Fe incorporation into haem. We found that, in reticulocytes, the myosin light-chain kinase inhibitor, wortmannin, and the calmodulin antagonist, W-7, caused significant inhibition of (59)Fe incorporation from (59)Fe-transferrin-labelled endosomes into haem. These results, together with confocal microscopy studies using transferrin and mitochondria labelled by distinct fluorescent markers, suggest that, in erythroid cells, endosome mobility, and perhaps their contact with mitochondria, plays an important role in a highly efficient utilization of iron for haem synthesis.

  9. A novel role for nuclear factor-erythroid 2 in erythroid maturation by modulation of mitochondrial autophagy.

    PubMed

    Gothwal, Monika; Wehrle, Julius; Aumann, Konrad; Zimmermann, Vanessa; Gründer, Albert; Pahl, Heike L

    2016-09-01

    We have recently demonstrated that the transcription factor nuclear factor-erythroid 2, which is critical for erythroid maturation and globin gene expression, plays an important role in the pathophysiology of myeloproliferative neoplasms. Myeloproliferative neoplasm patients display elevated levels of nuclear factor-erythroid 2 and transgenic mice overexpressing the transcription factor develop myeloproliferative neoplasm, albeit, surprisingly without erythrocytosis. Nuclear factor-erythroid 2 transgenic mice show both a reticulocytosis and a concomitant increase in iron deposits in the spleen, suggesting both enhanced erythrocyte production and increased red blood cell destruction. We therefore hypothesized that elevated nuclear factor-erythroid 2 levels may lead to increased erythrocyte destruction by interfering with organelle clearance during erythroid maturation. We have previously shown that nuclear factor-erythroid 2 overexpression delays erythroid maturation of human hematopoietic stem cells. Here we report that increased nuclear factor-erythroid 2 levels also impede murine maturation by retarding mitochondrial depolarization and delaying mitochondrial elimination. In addition, ribosome autophagy is delayed in transgenics. We demonstrate that the autophagy genes NIX and ULK1 are direct novel nuclear factor-erythroid 2 target genes, as these loci are bound by nuclear factor-erythroid 2 in chromatin immunoprecipitation assays. Moreover, Nix and Ulk1 expression is increased in transgenic mice and in granulocytes from polycythemia vera patients. This is the first report implying a role for nuclear factor-erythroid 2 in erythroid maturation by affecting autophagy. PMID:27479815

  10. A novel role for nuclear factor-erythroid 2 in erythroid maturation by modulation of mitochondrial autophagy.

    PubMed

    Gothwal, Monika; Wehrle, Julius; Aumann, Konrad; Zimmermann, Vanessa; Gründer, Albert; Pahl, Heike L

    2016-09-01

    We have recently demonstrated that the transcription factor nuclear factor-erythroid 2, which is critical for erythroid maturation and globin gene expression, plays an important role in the pathophysiology of myeloproliferative neoplasms. Myeloproliferative neoplasm patients display elevated levels of nuclear factor-erythroid 2 and transgenic mice overexpressing the transcription factor develop myeloproliferative neoplasm, albeit, surprisingly without erythrocytosis. Nuclear factor-erythroid 2 transgenic mice show both a reticulocytosis and a concomitant increase in iron deposits in the spleen, suggesting both enhanced erythrocyte production and increased red blood cell destruction. We therefore hypothesized that elevated nuclear factor-erythroid 2 levels may lead to increased erythrocyte destruction by interfering with organelle clearance during erythroid maturation. We have previously shown that nuclear factor-erythroid 2 overexpression delays erythroid maturation of human hematopoietic stem cells. Here we report that increased nuclear factor-erythroid 2 levels also impede murine maturation by retarding mitochondrial depolarization and delaying mitochondrial elimination. In addition, ribosome autophagy is delayed in transgenics. We demonstrate that the autophagy genes NIX and ULK1 are direct novel nuclear factor-erythroid 2 target genes, as these loci are bound by nuclear factor-erythroid 2 in chromatin immunoprecipitation assays. Moreover, Nix and Ulk1 expression is increased in transgenic mice and in granulocytes from polycythemia vera patients. This is the first report implying a role for nuclear factor-erythroid 2 in erythroid maturation by affecting autophagy.

  11. A novel role for nuclear factor-erythroid 2 in erythroid maturation by modulation of mitochondrial autophagy

    PubMed Central

    Gothwal, Monika; Wehrle, Julius; Aumann, Konrad; Zimmermann, Vanessa; Gründer, Albert; Pahl, Heike L.

    2016-01-01

    We have recently demonstrated that the transcription factor nuclear factor-erythroid 2, which is critical for erythroid maturation and globin gene expression, plays an important role in the pathophysiology of myeloproliferative neoplasms. Myeloproliferative neoplasm patients display elevated levels of nuclear factor-erythroid 2 and transgenic mice overexpressing the transcription factor develop myeloproliferative neoplasm, albeit, surprisingly without erythrocytosis. Nuclear factor-erythroid 2 transgenic mice show both a reticulocytosis and a concomitant increase in iron deposits in the spleen, suggesting both enhanced erythrocyte production and increased red blood cell destruction. We therefore hypothesized that elevated nuclear factor-erythroid 2 levels may lead to increased erythrocyte destruction by interfering with organelle clearance during erythroid maturation. We have previously shown that nuclear factor-erythroid 2 overexpression delays erythroid maturation of human hematopoietic stem cells. Here we report that increased nuclear factor-erythroid 2 levels also impede murine maturation by retarding mitochondrial depolarization and delaying mitochondrial elimination. In addition, ribosome autophagy is delayed in transgenics. We demonstrate that the autophagy genes NIX and ULK1 are direct novel nuclear factor-erythroid 2 target genes, as these loci are bound by nuclear factor-erythroid 2 in chromatin immunoprecipitation assays. Moreover, Nix and Ulk1 expression is increased in transgenic mice and in granulocytes from polycythemia vera patients. This is the first report implying a role for nuclear factor-erythroid 2 in erythroid maturation by affecting autophagy. PMID:27479815

  12. Calcium Signaling Is Required for Erythroid Enucleation.

    PubMed

    Wölwer, Christina B; Pase, Luke B; Russell, Sarah M; Humbert, Patrick O

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation.

  13. Chronic erythroid hyperplasia and accelerated bone turnover.

    PubMed

    Weinstein, R S; Lutcher, C L

    Bone atrophy is generally thought to be the etiology of the decreased skeletal mass and fractures found in patients with ineffective hematopoiesis and associated erythroid hyperplasia. A bone biopsy from a patient with chronic erythroid hyperplasia and diffuse cortical osteopenia revealed a normal trabecular bone volume, excess osteoid, numerous osteoblasts, and increased osteoclastic resorptive surface. The increased fractional labeled surfaces and widely spaced double tetracycline labels indicated accelerated bone turnover, despite demonstrable iron deposits at the calcification front and cement lines and a low serum level of 25-hydroxyvitamin D. The relationship between the expanded marrow space and trabecular bone suggests that local marrow factors may be responsible for the rapid bone remodeling.

  14. Calcium Signaling Is Required for Erythroid Enucleation

    PubMed Central

    Russell, Sarah M.; Humbert, Patrick O.

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation. PMID:26731108

  15. Endogenous K-ras signaling in erythroid differentiation.

    PubMed

    Zhang, Jing; Lodish, Harvey F

    2007-08-15

    K-ras is one of the most frequently mutated genes in virtually all types of human cancers. Using mouse fetal liver erythroid progenitors as a model system, we studied the role of endogenous K-ras signaling in erythroid differentiation. When oncogenic K-ras is expressed from its endogenous promoter, it hyperactivates cytokine-dependent signaling pathways and results in a partial block in erythroid differentiation. In erythroid progenitors deficient in K-ras, cytokine-dependent Akt activation is greatly reduced, leading to delays in erythroid differentiation. Thus, both loss- and gain-of-Kras functions affect erythroid differentiation through modulation of cytokine signaling. These results support the notion that in human cancer patients oncogenic Ras signaling might be controlled by antagonizing essential cytokines.

  16. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  17. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  18. Sublethal radiation injury uncovers a functional transition during erythroid maturation

    PubMed Central

    Peslak, Scott A.; Wenger, Jesse; Bemis, Jeffrey C.; Kingsley, Paul D.; Frame, Jenna M.; Koniski, Anne D.; Chen, Yuhchyau; Williams, Jacqueline P.; McGrath, Kathleen E.; Dertinger, Stephen D.; Palis, James

    2012-01-01

    Objective Clastogenic injury of the erythroid lineage results in anemia, reticulocytopenia, and transient appearance of micronucleated reticulocytes (MN-RET). However, the MN-RET dose-response in murine models is only linear to 2 Gy total body irradiation (TBI) and paradoxically decreases at higher exposures, suggesting complex radiation effects on erythroid intermediates. To better understand this phenomenon, we investigated the kinetics and apoptotic response of the erythron to sublethal radiation injury. Materials and Methods We analyzed the response to 1 and 4 Gy TBI of erythroid progenitors and precursors using colony assays and imaging flow cytometry (IFC), respectively. We also investigated cell cycling and apoptotic gene expression of the steady-state erythron. Results Following 1 Gy TBI, erythroid progenitors and precursors were partially depleted. In contrast, essentially all bone marrow erythroid progenitors and precursors were lost within two days following 4 Gy irradiation. IFC analysis revealed preferential loss of phenotypic erythroid colony-forming units (CFU-E) and proerythroblasts immediately following sublethal irradiation. Furthermore, these populations underwent radiation-induced apoptosis, without changes in steady-state cellular proliferation, at much higher frequencies than later-stage erythroid precursors. Primary erythroid precursor maturation is associated with marked Bcl-xL upregulation and Bax and Bid down-regulation. Conclusions MN-RET loss following higher sublethal radiation exposures results from rapid depletion of erythroid progenitors and precursors. This injury reveals that CFU-E and proerythroblasts constitute a particularly proapoptotic compartment within the erythron. We conclude that the functional transition of primary proerythroblasts to later-stage erythroid precursors is characterized by a shift from a pro-apoptotic to an anti-apoptotic phenotype. PMID:21291953

  19. The ASSR: clinical application in normal-hearing and hearing-impaired infants and adults, comparison with the click-evoked ABR and pure-tone audiometry.

    PubMed

    Scherf, Fanny; Brokx, Jan; Wuyts, Floris L; Van de Heyning, Paul H

    2006-05-01

    The objective of this study was to investigate the clinical application of the ASSR (GSI Audera). It was completed in two parts: Study 1. Correlation between the ASSR-based threshold estimations and the conventional pure-tone thresholds in adults; and Study 2. Correlation between the average of the 2-4 kHz ASSR-based threshold estimations and c-ABR thresholds in children. The ASSRs were recorded in awake adults and sleeping infants with a range of hearing loss at CFs of 0.5 to 4 kHz and MFs between 46 and 95 Hz. The results show that in hearing-impaired adults (thresholds > 40 dBHL) good correlations can be observed between the behavioural thresholds and the ASSR-based threshold estimations. For the normal- to near-normal-hearing adults, a significant correspondence exists between the ASSR-based threshold estimations and FPTA. In children, strong correlations were found between the c-ABR and the 2-4 kHz ASSR-based threshold estimation average. These studies illustrate that the GSI Audera ASSR can accurately predict the behavioural audiogram in hearing-impaired subjects. In subjects with normal hearing the individual ASSR-based threshold estimations scatter too much. Instead the average of the ASSR-based threshold estimations corresponds well with the FPTA. PMID:16717018

  20. Transcription factor networks in erythroid cell and megakaryocyte development

    PubMed Central

    Doré, Louis C.

    2011-01-01

    Erythroid cells and megakaryocytes are derived from a common precursor, the megakaryocyte-erythroid progenitor. Although these 2 closely related hematopoietic cell types share many transcription factors, there are several key differences in their regulatory networks that lead to differential gene expression downstream of the megakaryocyte-erythroid progenitor. With the advent of next-generation sequencing and our ability to precisely define transcription factor chromatin occupancy in vivo on a global scale, we are much closer to understanding how these 2 lineages are specified and in general how transcription factor complexes govern hematopoiesis. PMID:21622645

  1. Erythroid Kruppel like factor: from fishing expedition to gourmet meal.

    PubMed

    Perkins, A

    1999-10-01

    Erythroid Kruppel like factor (EKLF) is the founding member of a family of transcription factors which are defined by the presence of three C-terminal C2H2-type zinc fingers. Since its discovery 6 years ago, the study of EKLF has been intense. In this review I will revisit the discovery of EKLF, and highlight recent advances in our understanding of how it interacts with other proteins to regulate erythroid gene transcription. The current knowledge of the biological role/s of EKLF in erythroid cell differentiation and globin gene switching are summarized.

  2. CBFβ-SMMHC creates aberrant megakaryocyte-erythroid progenitors prone to leukemia initiation in mice.

    PubMed

    Cai, Qi; Jeannet, Robin; Hua, Wei-Kai; Cook, Guerry J; Zhang, Bin; Qi, Jing; Liu, Hongjun; Li, Ling; Chen, Ching-Cheng; Marcucci, Guido; Kuo, Ya-Huei

    2016-09-15

    Acute myeloid leukemia (AML) arises through multistep clonal evolution characterized by stepwise accumulation of successive alterations affecting the homeostasis of differentiation, proliferation, self-renewal, and survival programs. The persistence and dynamic clonal evolution of leukemia-initiating cells and preleukemic stem cells during disease progression and treatment are thought to contribute to disease relapse and poor outcome. Inv(16)(p13q22) or t(16;16)(p13.1;q22), one of the most common cytogenetic abnormalities in AML, leads to expression of a fusion protein CBFβ-SMMHC (CM) known to disrupt myeloid and lymphoid differentiation. Anemia is often observed in AML but is presumed to be a secondary consequence of leukemic clonal expansion. Here, we show that CM expression induces marked deficiencies in erythroid lineage differentiation and early preleukemic expansion of a phenotypic pre-megakaryocyte/erythrocyte (Pre-Meg/E) progenitor population. Using dual-fluorescence reporter mice in lineage tracking and repopulation assays, we show that CM expression cell autonomously causes expansion of abnormal Pre-Meg/E progenitors with compromised erythroid specification and differentiation capacity. The preleukemic Pre-Meg/Es display dysregulated erythroid and megakaryocytic fate-determining factors including increased Spi-1, Gata2, and Gfi1b and reduced Zfpm1, Pf4, Vwf, and Mpl expression. Furthermore, these abnormal preleukemic Pre-Meg/Es have enhanced stress resistance and are prone to leukemia initiation upon acquiring cooperative signals. This study reveals that the leukemogenic CM fusion protein disrupts adult erythropoiesis and creates stress-resistant preleukemic Pre-Meg/E progenitors predisposed to malignant transformation. Abnormality in Meg/E or erythroid progenitors could potentially be considered an early predictive risk factor for leukemia evolution.

  3. CBFβ-SMMHC creates aberrant megakaryocyte-erythroid progenitors prone to leukemia initiation in mice.

    PubMed

    Cai, Qi; Jeannet, Robin; Hua, Wei-Kai; Cook, Guerry J; Zhang, Bin; Qi, Jing; Liu, Hongjun; Li, Ling; Chen, Ching-Cheng; Marcucci, Guido; Kuo, Ya-Huei

    2016-09-15

    Acute myeloid leukemia (AML) arises through multistep clonal evolution characterized by stepwise accumulation of successive alterations affecting the homeostasis of differentiation, proliferation, self-renewal, and survival programs. The persistence and dynamic clonal evolution of leukemia-initiating cells and preleukemic stem cells during disease progression and treatment are thought to contribute to disease relapse and poor outcome. Inv(16)(p13q22) or t(16;16)(p13.1;q22), one of the most common cytogenetic abnormalities in AML, leads to expression of a fusion protein CBFβ-SMMHC (CM) known to disrupt myeloid and lymphoid differentiation. Anemia is often observed in AML but is presumed to be a secondary consequence of leukemic clonal expansion. Here, we show that CM expression induces marked deficiencies in erythroid lineage differentiation and early preleukemic expansion of a phenotypic pre-megakaryocyte/erythrocyte (Pre-Meg/E) progenitor population. Using dual-fluorescence reporter mice in lineage tracking and repopulation assays, we show that CM expression cell autonomously causes expansion of abnormal Pre-Meg/E progenitors with compromised erythroid specification and differentiation capacity. The preleukemic Pre-Meg/Es display dysregulated erythroid and megakaryocytic fate-determining factors including increased Spi-1, Gata2, and Gfi1b and reduced Zfpm1, Pf4, Vwf, and Mpl expression. Furthermore, these abnormal preleukemic Pre-Meg/Es have enhanced stress resistance and are prone to leukemia initiation upon acquiring cooperative signals. This study reveals that the leukemogenic CM fusion protein disrupts adult erythropoiesis and creates stress-resistant preleukemic Pre-Meg/E progenitors predisposed to malignant transformation. Abnormality in Meg/E or erythroid progenitors could potentially be considered an early predictive risk factor for leukemia evolution. PMID:27443289

  4. Randomized Effectiveness Trial of an Internet, Pure Self-Help, Cognitive Behavioral Intervention for Depressive Symptoms in Young Adults

    PubMed Central

    Clarke, Greg; Kelleher, Chris; Hornbrook, Matt; DeBar, Lynn; Dickerson, John; Gullion, Christina

    2008-01-01

    This study evaluated an Internet-delivered, cognitive behavioral skills training program versus a treatment-as-usual (TAU) control condition targeting depression symptoms in youth ages 18 to 24. Potential participants were mailed a recruitment brochure; if interested they accessed the study website to complete an online consent and baseline assessment. Intervention participants could access the website at their own pace and at any time. Reminder postcards were mailed periodically to encourage return use of the intervention. The pure self-help intervention was delivered without contact with a live therapist. The primary depression outcome measure was the Patient Health Questionnaire (PHQ-8), administered at 0, 5, 10, 16, and 32 weeks after enrollment. A small but significant between-group effect was found from week 0 to week 32 for the entire sample (n=160; d=.20, 95% CI=0.00-0.50), with a moderate effect among females (n=128; d=.42, 95% CI=0.09-0.77). Greater depression reduction was associated with two measures of lower website usage, total minutes and total number of page hits. While intervention effects were modest, they were observed against a background of substantial TAU depression pharmacotherapy and psychosocial services. Highly disseminable, low-cost, and self-help interventions such as this have the potential to deliver a significant public health benefit. PMID:19440896

  5. CACCC and GATA-1 sequences make the constitutively expressed alpha-globin gene erythroid-responsive in mouse erythroleukemia cells.

    PubMed Central

    Ren, S; Li, J; Atweh, G F

    1996-01-01

    Although the human alpha-globin and beta-globin genes are co-regulated in adult life, they achieve the same end by very different mechanisms. For example, a transfected beta-globin gene is expressed in an inducible manner in mouse erythroleukemia (MEL) cells while a transfected alpha-globin gene is constitutively expressed at a high level in induced and uninduced MEL cells. Interestingly, when the alpha-globin gene is transferred into MEL cells as part of human chromosome 16, it is appropriately expressed in an inducible manner. We explored the basis for the lack of erythroid-responsiveness of the proximal regulatory elements of the human alpha-globin gene. Since the alpha-globin gene is the only functional human globin gene that lacks CACCC and GATA-1 motifs, we asked whether their addition to the alpha-globin promoter would make the gene erythroid-responsive in MEL cells. The addition of each of these binding sites to the alpha-globin promoter separately did not result in inducibility in MEL cells. However, when both sites were added together, the alpha-globin gene became inducible in MEL cells. This suggests that erythroid non-responsiveness of the alpha-globin gene results from the lack of erythroid binding sites and is not necessarily a function of the constitutively active, GC rich promoter. PMID:8628660

  6. PPAR-α and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal.

    PubMed

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M Inmaculada; Li, Hu; Elmes, Russell R; Peters, Luanne L; Lodish, Harvey F

    2015-06-25

    Many acute and chronic anaemias, including haemolysis, sepsis and genetic bone marrow failure diseases such as Diamond-Blackfan anaemia, are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production. Treatment of these anaemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently, we showed that glucocorticoids specifically stimulate self-renewal of an early erythroid progenitor, burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells. Here we show that activation of the peroxisome proliferator-activated receptor α (PPAR-α) by the PPAR-α agonists GW7647 and fenofibrate synergizes with the glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures of both mouse fetal liver BFU-Es and mobilized human adult CD34(+) peripheral blood progenitors, with a new and effective culture system being used for the human cells that generates normal enucleated reticulocytes. Although Ppara(-/-) mice show no haematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPAR-α agonists facilitate recovery of wild-type but not Ppara(-/-) mice from PHZ-induced acute haemolytic anaemia. We also show that PPAR-α alleviates anaemia in a mouse model of chronic anaemia. Finally, both in control and corticosteroid-treated BFU-E cells, PPAR-α co-occupies many chromatin sites with GR; when activated by PPAR-α agonists, additional PPAR-α is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPAR-α agonists in stimulating self-renewal of early erythroid

  7. PPARα and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal

    PubMed Central

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M. Inmaculada; Li, Hu; Elmes, Russell R.; Peters, Luanne L.; Lodish, Harvey F.

    2015-01-01

    Summary Many acute and chronic anemias, including hemolysis, sepsis, and genetic bone marrow failure diseases such as Diamond-Blackfan Anemia (DBA), are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production 1,2,3–5,6,7,8,9. Treatment of these anemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently we showed that glucocorticoids specifically stimulate self-renewal of the early erythroid progenitor, the burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells 10,11. Here we demonstrate that activation of the peroxisome proliferator-activated receptor alpha (PPARα) by PPARα agonists, GW7647 and fenofibrate, synergizes with glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures both of mouse fetal liver BFU-Es and of mobilized human adult CD34+ peripheral blood progenitors, the latter employing a new and effective culture system that generates normal enucleated reticulocytes. While PPARα−/− mice show no hematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPARα agonists facilitate recovery of wild-type mice, but not PPARα−/− mice, from PHZ-induced acute hemolytic anemia. We also showed that PPARα alleviates anemia in a mouse model of chronic anemia. Finally, both in control and corticosteroid-treated BFU-E cells PPARα co-occupies many chromatin sites with GR; when activated by PPARα agonists, additional PPARα is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPARα agonists in stimulating self

  8. PPAR-α and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal.

    PubMed

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M Inmaculada; Li, Hu; Elmes, Russell R; Peters, Luanne L; Lodish, Harvey F

    2015-06-25

    Many acute and chronic anaemias, including haemolysis, sepsis and genetic bone marrow failure diseases such as Diamond-Blackfan anaemia, are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production. Treatment of these anaemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently, we showed that glucocorticoids specifically stimulate self-renewal of an early erythroid progenitor, burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells. Here we show that activation of the peroxisome proliferator-activated receptor α (PPAR-α) by the PPAR-α agonists GW7647 and fenofibrate synergizes with the glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures of both mouse fetal liver BFU-Es and mobilized human adult CD34(+) peripheral blood progenitors, with a new and effective culture system being used for the human cells that generates normal enucleated reticulocytes. Although Ppara(-/-) mice show no haematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPAR-α agonists facilitate recovery of wild-type but not Ppara(-/-) mice from PHZ-induced acute haemolytic anaemia. We also show that PPAR-α alleviates anaemia in a mouse model of chronic anaemia. Finally, both in control and corticosteroid-treated BFU-E cells, PPAR-α co-occupies many chromatin sites with GR; when activated by PPAR-α agonists, additional PPAR-α is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPAR-α agonists in stimulating self-renewal of early erythroid

  9. The SCL gene product: a positive regulator of erythroid differentiation.

    PubMed Central

    Aplan, P D; Nakahara, K; Orkin, S H; Kirsch, I R

    1992-01-01

    The SCL (tal-1, TCL5) gene is a member of the basic domain, helix-loop-helix (bHLH) class of putative transcription factors. We found that (i) the SCL promoter for exon Ia contains a potential recognition site for GATA-binding transcription factors, (ii) SCL mRNA is expressed in all erythroid tissues and cell lines examined, and (iii) SCL mRNA increases upon induced differentiation of murine erythroleukemia (MEL) cells, and inferred that SCL may play a physiologic role in erythroid differentiation. We used gel shift and transfection assays to demonstrate that the GATA motif in the SCL promoter binds GATA-1 (and GATA-2), and also mediates transcriptional transactivation. To identify a role for SCL in erythroid differentiation, we generated stable transfectants of MEL and K562 (a human chronic myelogenous leukemia cell line that can differentiate along the erythroid pathway) cells overexpressing wild-type, antisense or mutant SCL cDNA. Increasing the level of SCL expression in two independent MEL lines (F4-6 and C19, a 745 derivative) and K562 cells increased the rate of spontaneous (i.e. in the absence of inducer) erythroid differentiation. Conversely, induced differentiation was inhibited in MEL transfectants expressing either antisense SCL cDNA or a mutant SCL lacking the basic domain. Our experiments suggest that the SCL gene can be a target for the erythroid transcription factor GATA-1 and that the SCL gene product serves as a positive regulator of erythroid differentiation. Images PMID:1396592

  10. Hemozoin (malarial pigment) directly promotes apoptosis of erythroid precursors.

    PubMed

    Lamikanra, Abigail A; Theron, Michel; Kooij, Taco W A; Roberts, David J

    2009-12-24

    Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis) and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that have adequate

  11. Pathogenesis of the erythroid failure in Diamond Blackfan anaemia.

    PubMed

    Sieff, Colin A; Yang, Jing; Merida-Long, Lilia B; Lodish, Harvey F

    2010-02-01

    Diamond Blackfan anaemia (DBA) is a severe congenital failure of erythropoiesis. Despite mutations in one of several ribosome protein genes, including RPS19, the cause of the erythroid specificity is still a mystery. We hypothesized that, because the chromatin of late erythroid cells becomes condensed and transcriptionally inactive prior to enucleation, the rapidly proliferating immature cells require very high ribosome synthetic rates. RNA biogenesis was measured in primary mouse fetal liver erythroid progenitor cells; during the first 24 h, cell number increased three to fourfold while, remarkably, RNA content increased sixfold, suggesting an accumulation of an excess of ribosomes during early erythropoiesis. Retrovirus infected siRNA RPS19 knockdown cells showed reduced proliferation but normal differentiation, and cell cycle analysis showed a G1/S phase delay. p53 protein was increased in the knockdown cells, and the mRNA level for p21, a transcriptional target of p53, was increased. Furthermore, we show that RPS19 knockdown decreased MYB protein, and Kit mRNA was reduced, as was the amount of cell surface KIT protein. Thus, in this small hairpin RNA murine model of DBA, RPS19 insufficient erythroid cells may proliferate poorly because of p53-mediated cell cycle arrest, and also because of decreased expression of the key erythroid signalling protein KIT.

  12. Reference ranges of handgrip strength from 125,462 healthy adults in 21 countries: a prospective urban rural epidemiologic (PURE) study

    PubMed Central

    Teo, Koon K.; Rangarajan, Sumathy; Kutty, V. Raman; Lanas, Fernando; Hui, Chen; Quanyong, Xiang; Zhenzhen, Qian; Jinhua, Tang; Noorhassim, Ismail; AlHabib, Khalid F; Moss, Sarah J.; Rosengren, Annika; Akalin, Ayse Arzu; Rahman, Omar; Chifamba, Jephat; Orlandini, Andrés; Kumar, Rajesh; Yeates, Karen; Gupta, Rajeev; Yusufali, Afzalhussein; Dans, Antonio; Avezum, Álvaro; Lopez‐Jaramillo, Patricio; Poirier, Paul; Heidari, Hosein; Zatonska, Katarzyna; Iqbal, Romaina; Khatib, Rasha; Yusuf, Salim

    2016-01-01

    Abstract Background The measurement of handgrip strength (HGS) has prognostic value with respect to all‐cause mortality, cardiovascular mortality and cardiovascular disease, and is an important part of the evaluation of frailty. Published reference ranges for HGS are mostly derived from Caucasian populations in high‐income countries. There is a paucity of information on normative HGS values in non‐Caucasian populations from low‐ or middle‐income countries. The objective of this study was to develop reference HGS ranges for healthy adults from a broad range of ethnicities and socioeconomically diverse geographic regions. Methods HGS was measured using a Jamar dynamometer in 125,462 healthy adults aged 35‐70 years from 21 countries in the Prospective Urban Rural Epidemiology (PURE) study. Results HGS values differed among individuals from different geographic regions. HGS values were highest among those from Europe/North America, lowest among those from South Asia, South East Asia and Africa, and intermediate among those from China, South America, and the Middle East. Reference ranges stratified by geographic region, age, and sex are presented. These ranges varied from a median (25th–75th percentile) 50 kg (43–56 kg) in men <40 years from Europe/North America to 18 kg (14–20 kg) in women >60 years from South East Asia. Reference ranges by ethnicity and body‐mass index are also reported. Conclusions Individual HGS measurements should be interpreted using region/ethnic‐specific reference ranges. PMID:27104109

  13. Erythroid differentiation is augmented in Reelin-deficient K562 cells and homozygous reeler mice.

    PubMed

    Chu, Hui-Chun; Lee, Hsing-Ying; Huang, Yen-Shu; Tseng, Wei-Lien; Yen, Ching-Ju; Cheng, Ju-Chien; Tseng, Ching-Ping

    2014-01-01

    Reelin is an extracellular glycoprotein that is highly conserved in mammals. In addition to its expression in the nervous system, Reelin is present in erythroid cells but its function there is unknown. We report in this study that Reelin is up-regulated during erythroid differentiation of human erythroleukemic K562 cells and is expressed in the erythroid progenitors of murine bone marrow. Reelin deficiency promotes erythroid differentiation of K562 cells and augments erythroid production in murine bone marrow. In accordance with these findings, Reelin deficiency attenuates AKT phosphorylation of the Ter119(+)CD71(+) erythroid progenitors and alters the cell number and frequency of the progenitors at different erythroid differentiation stages. A regulatory role of Reelin in erythroid differentiation is thus defined. PMID:24239537

  14. Racial and gender effects on pure-tone thresholds and distortion-product otoacoustic emissions (DPOAEs) in normal-hearing young adults.

    PubMed

    Dreisbach, Laura E; Kramer, Steven J; Cobos, Sandra; Cowart, Kristin

    2007-08-01

    This study examined racial and gender effects on behavioral thresholds and distortion-product otoacoustic emissions (DPOAEs) in the same subjects. Pure-tone behavioral thresholds and DPOAEs were measured in 60 young normal-hearing adult subjects (20 Caucasian, 20 Asian, 20 African-American, with ten females and ten males in each group). Behavioral thresholds were measured from 1000 through 16,000 Hz using Békèsy tracking. A DPOAE frequency sweep was measured with primary stimulus levels of L(1)/L(2)=60/45 dB SPL, and an f(2)/f(1) of 1.2 at discrete f(2) frequencies between 2000 through 12,000 Hz for each subject. Significant racial and gender differences in behavioral thresholds were found at 14,000 and 16,000 Hz, with the African Americans and females having the best hearing sensitivity. Based on the current results, similar findings for DPOAE frequency sweeps can be expected amongst different racial groups given that no significant differences were identified between the groups. To further define the effects of race and gender on auditory measures, future studies should include larger numbers of subjects, measurement of body size and middle ear reflectance, and examine emission generators. PMID:17654083

  15. Evaluation of hematopoietic cells and myeloid/erythroid ratio in the bone marrow of the pheasant (Phasianus colchicus).

    PubMed

    Tadjalli, Mina; Nazifi, Saeed; Haghjoo, Rahil

    2013-01-01

    In order to study the normal hematopoiesis, cellular components and myeloid/erythroid (M/E) ratio in the bone marrow of the pheasant (Phasianus colchicus), bone marrow samples were collected from the proximal tibiotarsus bone of 16 clinically healthy adult pheasant. The bone marrow smears were stained using the Giemsa stain. The results indicated that the development and formation of blood cells in the bone marrow of pheasant were similar to other birds, whereas the morphology of the cells was similar to chickens, ducks, quail, and black-head gull. The mean M/E ratio was 1.24, the mean erythroid percentage was 42.24, the mean myeloid percentage was 52.62, and the mean percentage of all other cells percentage was 5.38. There was no significant difference in any of the cellular composition between male and female.

  16. Binding of HMG 17 to mononucleosomes of the avian beta-globin gene cluster in erythroid and non-erythroid cells.

    PubMed Central

    Brotherton, T W; Reneker, J; Ginder, G D

    1990-01-01

    The binding of HMG 17 to stripped core mononucleosomes containing DNA from the avian beta-globin gene cluster was examined to determine whether binding in vitro in this developmentally-regulated gene domain was associated with transcriptional activity or DNaseI-sensitivity in intact nuclei. Mononucleosomes were prepared from primitive and definitive stage embryonic red blood cells of chick embryos, adult reticulocytes, adult reticulocytes in which embryonic rho-globin transcription was induced, and adult thymus cells. Preferential binding by HMG 17 to mononucleosomes containing the beta-globin gene cluster was confined to erythroid-derived mononucleosomes that contain the embryonic rho-globin gene, the adult beta-globin gene, and DNA sequences located between these two genes, but not to those that contain the embryonic epsilon-globin gene. Comparison of these results to the known patterns of transcription and DNaseI-sensitivity within the beta-globin gene cluster shows that HMG 17 binding, although tissue-specific, does not correlate directly with either DNaseI-sensitivity or active gene transcription, but is dependent on other factors present in core mononucleosomes from this active gene domain. Images PMID:1692412

  17. The effect of mild agitation on in vitro erythroid development.

    PubMed

    Boehm, Daniela; Murphy, William G; Al-Rubeai, Mohamed

    2010-08-31

    The cultivation of erythroid cells at large scale would have to be performed in suitable bioreactors which would most likely employ some mode of agitation to ensure optimal mass and gas transfer and prevent culture inhomogeneity. The effect of low agitation at 15-20 rpm on ex vivo erythropoiesis of PB CD34+ derived cultures was investigated and found to have significant impact on erythroid development. Agitated cultures showed a reduced lag phase and increased cell expansion during the early stages of culture. Additionally, agitation accelerated erythroid differentiation as seen by the loss of early development markers, acquisition of late erythroid markers and premature cell cycle arrest, although not yielding higher fractions of terminally differentiated cells in comparison to stationary culture. However, agitation at 20 rpm led to significantly increased loss of cell viability after day 15 in culture, an effect that could be reduced by decreasing the agitation rate to 15 rpm. On the one hand these results imply that agitation may improve cell yields and reduce expensive cytokine-dependent early culture stages but on the other hand it might introduce the risk of increased cell death in large scale culture.

  18. TMEM14C is required for erythroid mitochondrial heme metabolism.

    PubMed

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  19. TMEM14C is required for erythroid mitochondrial heme metabolism

    PubMed Central

    Yien, Yvette Y.; Robledo, Raymond F.; Schultz, Iman J.; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E.; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J.; Cooney, Jeffrey D.; Pierce, Eric L.; Mohler, Kyla; Dailey, Tamara A.; Miyata, Non; Kingsley, Paul D.; Garone, Caterina; Hattangadi, Shilpa M.; Huang, Hui; Chen, Wen; Keenan, Ellen M.; Shah, Dhvanit I.; Schlaeger, Thorsten M.; DiMauro, Salvatore; Orkin, Stuart H.; Cantor, Alan B.; Palis, James; Koehler, Carla M.; Lodish, Harvey F.; Kaplan, Jerry; Ward, Diane M.; Dailey, Harry A.; Phillips, John D.; Peters, Luanne L.; Paw, Barry H.

    2014-01-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias. PMID:25157825

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    SciTech Connect

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. UFBP1, a Key Component of the Ufm1 Conjugation System, Is Essential for Ufmylation-Mediated Regulation of Erythroid Development

    PubMed Central

    Cai, Yafei; Pi, Wenhu; Sivaprakasam, Satish; Zhu, Xiaobin; Zhang, Mingsheng; Chen, Jijun; Makala, Levi; Lu, Chunwan; Wu, Jianchu; Teng, Yong; Pace, Betty; Tuan, Dorothy; Singh, Nagendra; Li, Honglin

    2015-01-01

    The Ufm1 conjugation system is an ubiquitin-like modification system that consists of Ufm1, Uba5 (E1), Ufc1 (E2), and less defined E3 ligase(s) and targets. The biological importance of this system is highlighted by its essential role in embryogenesis and erythroid development, but the underlying mechanism is poorly understood. UFBP1 (Ufm1 binding protein 1, also known as DDRGK1, Dashurin and C20orf116) is a putative Ufm1 target, yet its exact physiological function and impact of its ufmylation remain largely undefined. In this study, we report that UFBP1 is indispensable for embryonic development and hematopoiesis. While germ-line deletion of UFBP1 caused defective erythroid development and embryonic lethality, somatic ablation of UFBP1 impaired adult hematopoiesis, resulting in pancytopenia and animal death. At the cellular level, UFBP1 deficiency led to elevated ER (endoplasmic reticulum) stress and activation of unfolded protein response (UPR), and consequently cell death of hematopoietic stem/progenitor cells. In addition, loss of UFBP1 suppressed expression of erythroid transcription factors GATA-1 and KLF1 and blocked erythroid differentiation from CFU-Es (colony forming unit-erythroid) to proerythroblasts. Interestingly, depletion of Uba5, a Ufm1 E1 enzyme, also caused elevation of ER stress and under-expression of erythroid transcription factors in erythroleukemia K562 cells. By contrast, knockdown of ASC1, a newly identified Ufm1 target that functions as a transcriptional co-activator of hormone receptors, led to down-regulation of erythroid transcription factors, but did not elevate basal ER stress. Furthermore, we found that ASC1 was associated with the promoters of GATA-1 and Klf1 in a UFBP1-dependent manner. Taken together, our findings suggest that UFBP1, along with ASC1 and other ufmylation components, play pleiotropic roles in regulation of hematopoietic cell survival and differentiation via modulating ER homeostasis and erythroid lineage

  2. UFBP1, a Key Component of the Ufm1 Conjugation System, Is Essential for Ufmylation-Mediated Regulation of Erythroid Development.

    PubMed

    Cai, Yafei; Pi, Wenhu; Sivaprakasam, Satish; Zhu, Xiaobin; Zhang, Mingsheng; Chen, Jijun; Makala, Levi; Lu, Chunwan; Wu, Jianchu; Teng, Yong; Pace, Betty; Tuan, Dorothy; Singh, Nagendra; Li, Honglin

    2015-11-01

    The Ufm1 conjugation system is an ubiquitin-like modification system that consists of Ufm1, Uba5 (E1), Ufc1 (E2), and less defined E3 ligase(s) and targets. The biological importance of this system is highlighted by its essential role in embryogenesis and erythroid development, but the underlying mechanism is poorly understood. UFBP1 (Ufm1 binding protein 1, also known as DDRGK1, Dashurin and C20orf116) is a putative Ufm1 target, yet its exact physiological function and impact of its ufmylation remain largely undefined. In this study, we report that UFBP1 is indispensable for embryonic development and hematopoiesis. While germ-line deletion of UFBP1 caused defective erythroid development and embryonic lethality, somatic ablation of UFBP1 impaired adult hematopoiesis, resulting in pancytopenia and animal death. At the cellular level, UFBP1 deficiency led to elevated ER (endoplasmic reticulum) stress and activation of unfolded protein response (UPR), and consequently cell death of hematopoietic stem/progenitor cells. In addition, loss of UFBP1 suppressed expression of erythroid transcription factors GATA-1 and KLF1 and blocked erythroid differentiation from CFU-Es (colony forming unit-erythroid) to proerythroblasts. Interestingly, depletion of Uba5, a Ufm1 E1 enzyme, also caused elevation of ER stress and under-expression of erythroid transcription factors in erythroleukemia K562 cells. By contrast, knockdown of ASC1, a newly identified Ufm1 target that functions as a transcriptional co-activator of hormone receptors, led to down-regulation of erythroid transcription factors, but did not elevate basal ER stress. Furthermore, we found that ASC1 was associated with the promoters of GATA-1 and Klf1 in a UFBP1-dependent manner. Taken together, our findings suggest that UFBP1, along with ASC1 and other ufmylation components, play pleiotropic roles in regulation of hematopoietic cell survival and differentiation via modulating ER homeostasis and erythroid lineage

  3. Survival and proliferative roles of erythropoietin beyond the erythroid lineage

    PubMed Central

    Noguchi, Constance Tom; Wang, Li; Rogers, Heather M.; Teng, Ruifeng; Jia, Yi

    2011-01-01

    Since the isolation and purification of erythropoietin (EPO) in 1977, the essential role of EPO for mature red blood cell production has been well established. The cloning and production of recombinant human EPO led to its widespread use in treating patients with anaemia. However, the biological activity of EPO is not restricted to regulation of erythropoiesis. EPO receptor (EPOR) expression is also found in endothelial, brain, cardiovascular and other tissues, although at levels considerably lower than that of erythroid progenitor cells. This review discusses the survival and proliferative activity of EPO that extends beyond erythroid progenitor cells. Loss of EpoR expression in mouse models provides evidence for the role of endogenous EPO signalling in nonhaematopoietic tissue during development or for tissue maintenance and/or repair. Determining the extent and distribution of receptor expression provides insights into the potential protective activity of erythropoietin in brain, heart and other nonhaematopoietic tissues. PMID:19040789

  4. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation

    PubMed Central

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F.

    2014-01-01

    SUMMARY While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of post-transcriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3 Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation. PMID:25220394

  5. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation.

    PubMed

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F

    2014-09-29

    While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of posttranscriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid-important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3, Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus, transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation.

  6. Down-regulation of Myc is essential for terminal erythroid maturation.

    PubMed

    Jayapal, Senthil Raja; Lee, Kian Leong; Ji, Peng; Kaldis, Philipp; Lim, Bing; Lodish, Harvey F

    2010-12-17

    Terminal differentiation of mammalian erythroid progenitors involves 4-5 cell divisions and induction of many erythroid important genes followed by chromatin and nuclear condensation and enucleation. The protein levels of c-Myc (Myc) are reduced dramatically during late stage erythroid maturation, coinciding with cell cycle arrest in G(1) phase and enucleation, suggesting possible roles for c-Myc in either or both of these processes. Here we demonstrate that ectopic Myc expression affects terminal erythroid maturation in a dose-dependent manner. Expression of Myc at physiological levels did not affect erythroid differentiation or cell cycle shutdown but specifically blocked erythroid nuclear condensation and enucleation. Continued Myc expression prevented deacetylation of several lysine residues in histones H3 and H4 that are normally deacetylated during erythroid maturation. The histone acetyltransferase Gcn5 was up-regulated by Myc, and ectopic Gcn5 expression partially blocked enucleation and inhibited the late stage erythroid nuclear condensation and histone deacetylation. When overexpressed at levels higher than the physiological range, Myc blocked erythroid differentiation, and the cells continued to proliferate in cytokine-free, serum-containing culture medium with an early erythroblast morphology. Gene expression analysis demonstrated the dysregulation of erythropoietin signaling pathway and the up-regulation of several positive regulators of G(1)-S cell cycle checkpoint by supraphysiological levels of Myc. These results reveal an important dose-dependent function of Myc in regulating terminal maturation in mammalian erythroid cells.

  7. Neuraminidase enhances in vitro expansion of human erythroid progenitors.

    PubMed

    Bodivit, Gwellaouen; Chadebech, Philippe; Vigon, Isabelle; Yacia, Azzedine; Roziers, Nicolas Burin des; Pirenne, France; Fichelson, Serge

    2016-06-01

    In spite of recent key improvements, in vitro mass production of erythrocytes from human stem cells is still limited by difficulties in obtaining sufficient numbers of erythroid progenitors. In fact, such progenitors are as scarce in the bone marrow as in peripheral blood. We used a two-step culture model of human cord blood-derived erythroid progenitors in the presence or absence of high-purity neuraminidase, in a serum-free, defined culture medium. Granulocytic and megakaryocytic progenitor cell expansions were also studied. We show that significant enhancement of erythroid cell generation is obtained when CD34(+) human hematopoietic progenitors are cultured in the presence of neuraminidase. Interestingly, in so doing, expanded red cell progenitors remained erythropoietin-dependent for further expansion and survival, and cells thus generated displayed a normal phenotype. Moreover, the activity of neuraminidase on these cells can be reversed by simple cell washing. Finally, growth of cells of the other myeloid lineages (granulocytes and megakaryocytes) is either decreased or unchanged in the presence of neuraminidase. This specific feature of neuraminidase, that of stimulation of human red cell progenitor proliferation, provides a safe technique for producing greater numbers of in vitro-generated red blood cells for both basic research and transfusion use. PMID:27478075

  8. Murine erythroid short-term radioprotection requires a BMP4-dependent, self-renewing population of stress erythroid progenitors.

    PubMed

    Harandi, Omid F; Hedge, Shailaja; Wu, Dai-Chen; McKeone, Daniel; Paulson, Robert F

    2010-12-01

    Acute anemic stress induces a systemic response designed to increase oxygen delivery to hypoxic tissues. Increased erythropoiesis is a key component of this response. Recovery from acute anemia relies on stress erythropoiesis, which is distinct from steady-state erythropoiesis. In this study we found that the bone morphogenetic protein 4-dependent (BMP4-dependent) stress erythropoiesis pathway was required and specific for erythroid short-term radioprotection following bone marrow transplantation. BMP4 signaling promoted the development of three populations of stress erythroid progenitors, which expanded in the spleen subsequent to bone marrow transplantation in mice. These progenitors did not correspond to previously identified bone marrow steady-state progenitors. The most immature population of stress progenitors was capable of self renewal while maintaining erythropoiesis without contribution to other lineages when serially transplanted into irradiated secondary and tertiary recipients. These data suggest that during the immediate post-transplant period, the microenvironment of the spleen is altered, which allows donor bone marrow cells to adopt a stress erythropoietic fate and promotes the rapid expansion and differentiation of stress erythroid progenitors. Our results also suggest that stress erythropoiesis may be manipulated through targeting the BMP4 signaling pathway to improve survival after injury. PMID:21060151

  9. Erythroid Krüppel-like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 5'HS3 of the beta-globin locus control region.

    PubMed

    Tewari, R; Gillemans, N; Wijgerde, M; Nuez, B; von Lindern, M; Grosveld, F; Philipsen, S

    1998-04-15

    Disruption of the gene for transcription factor EKLF (erythroid Krüppel-like factor) results in fatal anaemia caused by severely reduced expression of the adult beta-globin gene, while other erythroid-specific genes, including the embryonic epsilon- and fetal gamma-globin genes, are expressed normally. Thus, EKLF is thought to be a stage-specific factor acting through the CACC box in the beta-gene promoter, even though it is already present in embryonic red cells. Here, we show that a beta-globin gene linked directly to the locus control region (LCR) is expressed at embryonic stages, and that this is only modestly reduced in EKLF-/- embryos. Thus, embryonic beta-globin expression is not intrinsically dependent on EKLF. To investigate whether EKLF functions in the locus control region, we analysed the expression of LCR-driven lacZ reporters. This shows that EKLF is not required for reporter activation by the complete LCR. However, embryonic expression of reporters driven by 5'HS3 of the LCR requires EKLF. This suggests that EKLF interacts directly with the CACC motifs in 5'HS3 and demonstrates that EKLF is also a transcriptional activator in embryonic erythropoiesis. Finally, we show that overexpression of EKLF results in an earlier switch from gamma- to beta-globin expression. Adult mice with the EKLF transgene have reduced platelet counts, suggesting that EKLF levels affect the balance between the megakaryocytic and erythroid lineages. Interestingly, the EKLF transgene rescues the lethal phenotype of EKLF null mice, setting the stage for future studies aimed at the analysis of the EKLF protein and its role in beta-globin gene activation.

  10. AKT induces erythroid-cell maturation of JAK2-deficient fetal liver progenitor cells and is required for Epo regulation of erythroid-cell differentiation.

    PubMed

    Ghaffari, Saghi; Kitidis, Claire; Zhao, Wei; Marinkovic, Dragan; Fleming, Mark D; Luo, Biao; Marszalek, Joseph; Lodish, Harvey F

    2006-03-01

    AKT serine threonine kinase of the protein kinase B (PKB) family plays essential roles in cell survival, growth, metabolism, and differentiation. In the erythroid system, AKT is known to be rapidly phosphorylated and activated in response to erythropoietin (Epo) engagement of Epo receptor (EpoR) and to sustain survival signals in cultured erythroid cells. Here we demonstrate that activated AKT complements EpoR signaling and supports erythroid-cell differentiation in wild-type and JAK2-deficient fetal liver cells. We show that erythroid maturation of AKT-transduced cells is not solely dependent on AKT-induced cell survival or proliferation signals, suggesting that AKT transduces also a differentiation-specific signal downstream of EpoR in erythroid cells. Down-regulation of expression of AKT kinase by RNA interference, or AKT activity by expression of dominant negative forms, inhibits significantly fetal liver-derived erythroid-cell colony formation and gene expression, demonstrating that AKT is required for Epo regulation of erythroid-cell maturation.

  11. miR-150 inhibits terminal erythroid proliferation and differentiation

    PubMed Central

    Sun, Zhiwei; Wang, Ye; Han, Xu; Zhao, Xielan; Peng, Yuanliang; Li, Yusheng; Peng, Minyuan; Song, Jianhui; Wu, Kunlu; Sun, Shumin; Zhou, Weihua; Qi, Biwei; Zhou, Chufan; Chen, Huiyong; An, Xiuli; Liu, Jing

    2015-01-01

    MicroRNAs (miRNAs), a class of small non-coding linear RNAs, have been shown to play a crucial role in erythropoiesis. To evaluate the indispensable role of constant suppression of miR-150 during terminal erythropoiesis, we performed miR-150 gain- and loss-of-function experiments on hemin-induced K562 cells and EPO-induced human CD34+ cells. We found that forced expression of miR-150 suppresses commitment of hemoglobinization and CD235a labeling in both cell types. Erythroid proliferation is also inhibited via inducing apoptosis and blocking the cell cycle when miR-150 is overexpressed. In contrast, miR-150 inhibition promotes terminal erythropoiesis. 4.1 R gene is a new target of miR-150 during terminal erythropoiesis, and its abundance ensures the mechanical stability and deformability of the membrane. However, knockdown of 4.1 R did not affect terminal erythropoiesis. Transcriptional profiling identified more molecules involved in terminal erythroid dysregulation derived from miR-150 overexpression. These results shed light on the role of miR-150 during human terminal erythropoiesis. This is the first report highlighting the relationship between miRNA and membrane protein and enhancing our understanding of how miRNA works in the hematopoietic system. PMID:26543232

  12. Monoclonal gammopathy-associated pure red cell aplasia.

    PubMed

    Korde, Neha; Zhang, Yong; Loeliger, Kelsey; Poon, Andrea; Simakova, Olga; Zingone, Adriana; Costello, Rene; Childs, Richard; Noel, Pierre; Silver, Samuel; Kwok, Mary; Mo, Clifton; Young, Neal; Landgren, Ola; Sloand, Elaine; Maric, Irina

    2016-06-01

    Pure red cell aplasia (PRCA) is a rare disorder characterized by inhibition of erythroid precursors in the bone marrow and normochromic, normocytic anaemia with reticulocytopenia. Among 51 PRCA patients, we identified 12 (24%) patients having monoclonal gammopathy, monoclonal gammopathy of undetermined significance or smouldering multiple myeloma, with presence of monoclonal protein or abnormal serum free light chains and atypical bone marrow features of clonal plasmacytosis, hypercellularity and fibrosis. Thus far, three patients treated with anti-myeloma based therapeutics have responded with reticulocyte recovery and clinical transfusion independence, suggesting plasma cells play a key role in the pathogenesis of this specific monoclonal gammopathy-associated PRCA. PMID:26999424

  13. Glutathione peroxidase 4 prevents necroptosis in mouse erythroid precursors

    PubMed Central

    Canli, Özge; Alankuş, Yasemin B.; Grootjans, Sasker; Vegi, Naidu; Hültner, Lothar; Hoppe, Philipp S.; Schroeder, Timm; Vandenabeele, Peter; Bornkamm, Georg W.

    2016-01-01

    Maintaining cellular redox balance is vital for cell survival and tissue homoeostasis because imbalanced production of reactive oxygen species (ROS) may lead to oxidative stress and cell death. The antioxidant enzyme glutathione peroxidase 4 (Gpx4) is a key regulator of oxidative stress–induced cell death. We show that mice with deletion of Gpx4 in hematopoietic cells develop anemia and that Gpx4 is essential for preventing receptor-interacting protein 3 (RIP3)-dependent necroptosis in erythroid precursor cells. Absence of Gpx4 leads to functional inactivation of caspase 8 by glutathionylation, resulting in necroptosis, which occurs independently of tumor necrosis factor α activation. Although genetic ablation of Rip3 normalizes reticulocyte maturation and prevents anemia, ROS accumulation and lipid peroxidation in Gpx4-deficient cells remain high. Our results demonstrate that ROS and lipid hydroperoxides function as not-yet-recognized unconventional upstream signaling activators of RIP3-dependent necroptosis. PMID:26463424

  14. Reduction of erythroid progenitors in protein-energy malnutrition.

    PubMed

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  15. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    SciTech Connect

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C. )

    1991-03-15

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase.

  16. Gender-Specific Toxicological Effects of Chronic Exposure to Pure Microcystin-LR or Complex Microcystis aeruginosa Extracts on Adult Medaka Fish.

    PubMed

    Le Manach, Séverine; Khenfech, Nour; Huet, Hélène; Qiao, Qin; Duval, Charlotte; Marie, Arul; Bolbach, Gérard; Clodic, Gilles; Djediat, Chakib; Bernard, Cécile; Edery, Marc; Marie, Benjamin

    2016-08-01

    Cyanobacterial blooms often occur in freshwater lakes and constitute a potential health risk to human populations, as well as to other organisms. However, their overall and specific implications for the health of aquatic organisms that are chronically and environmentally exposed to cyanobacteria producing hepatotoxins, such as microcystins (MCs), together with other bioactive compounds have still not been clearly established and remain difficult to assess. The medaka fish was chosen as the experimental aquatic model for studying the cellular and molecular toxicological effects on the liver after chronic exposures (28 days) to environmentally relevant concentrations of pure MC-LR, complex extracts of MC producing or nonproducing cyanobacterial biomasses, and of a Microcystis aeruginosa natural bloom. Our results showed a higher susceptibility of females to the different treatments compared to males at both the cellular and the molecular levels. Although hepatocyte lysis increased with MC-containing treatments, lysis always appeared more severe in the liver of females compare to males, and the glycogen cellular reserves also appeared to decrease more in the liver of females compared to those in the males. Proteomic investigations reveal divergent responses between males and females exposed to all treatments, especially for proteins involved in metabolic and homeostasis processes. Our observations also highlighted the dysregulation of proteins involved in oogenesis in female livers. These results suggest that fish populations exposed to cyanobacteria blooms may potentially face several ecotoxicological issues.

  17. Long noncoding RNA-mediated anti-apoptotic activity in murine erythroid terminal differentiation.

    PubMed

    Hu, Wenqian; Yuan, Bingbing; Flygare, Johan; Lodish, Harvey F

    2011-12-15

    Long noncoding RNAs (lncRNAs) are differentially expressed under both normal and pathological conditions, implying that they may play important biological functions. Here we examined the expression of lncRNAs during erythropoiesis and identified an erythroid-specific lncRNA with anti-apoptotic activity. Inhibition of this lncRNA blocks erythroid differentiation and promotes apoptosis. Conversely, ectopic expression of this lncRNA can inhibit apoptosis in mouse erythroid cells. This lncRNA represses expression of Pycard, a proapoptotic gene, explaining in part the inhibition of programmed cell death. These findings reveal a novel layer of regulation of cell differentiation and apoptosis by a lncRNA.

  18. Twisted partially pure spinors

    NASA Astrophysics Data System (ADS)

    Herrera, Rafael; Tellez, Ivan

    2016-08-01

    Motivated by the relationship between orthogonal complex structures and pure spinors, we define twisted partially pure spinors in order to characterize spinorially subspaces of Euclidean space endowed with a complex structure.

  19. Bone marrow pathology in dogs and cats with non-regenerative immune-mediated haemolytic anaemia and pure red cell aplasia.

    PubMed

    Weiss, D J

    2008-01-01

    Many dogs and cats with immune-mediated haemolytic anaemia (IMHA) lack a bone marrow erythroid regenerative response. To better understand the failure of the bone marrow to respond to the anaemia, bone marrow pathology associated with non-regenerative IMHA and pure red cell aplasia (PRCA) was reviewed. Eighty-two affected dogs and 57 affected cats were identified from a population presenting to a referral hospital over a 10-year period. Fifty-five dogs had non-regenerative IMHA (38 had bone marrow erythroid hyperplasia and 17 had erythroid maturation arrest) and 27 had pure red cell aplasia (PRCA). Twenty-eight cats had non-regenerative IMHA (24 had erythroid hyperplasia and 4 had erythroid maturation arrest) and 29 had PRCA. A variety of pathological changes were observed in bone marrow aspirates and core biopsy specimens taken from these animals. These changes included dysmyelopoiesis, myelonecrosis, myelofibrosis, interstitial oedema, haemorrhage, acute inflammation, haemophagocytic syndrome, lymphocyte aggregation, and lymphocyte or plasma cell hyperplasia. In both dogs and cats, dysmyelopoiesis, myelonecrosis, myelofibrosis, interstitial oedema, haemorrhage, acute inflammation and haemophagocytic syndrome were primarily noted in bone marrow specimens where there was evidence of erythroid hyperplasia. These animals were also more often neutropenic and thrombocytopenic, and had decreased 60 day survival when compared with dogs or cats with non-regenerative anaemia associated with erythroid maturation arrest or PRCA. Therefore, the pathogenesis of the non-regenerative anaemia in non-regenerative IMHA may involve both antibody-mediated destruction of bone marrow precursor cells and pathological events within the bone marrow that result in ineffective erythropoiesis.

  20. Gene expression profiling of human erythroid progenitors by micro-serial analysis of gene expression.

    PubMed

    Fujishima, Naohito; Hirokawa, Makoto; Aiba, Namiko; Ichikawa, Yoshikazu; Fujishima, Masumi; Komatsuda, Atsushi; Suzuki, Yoshiko; Kawabata, Yoshinari; Miura, Ikuo; Sawada, Ken-ichi

    2004-10-01

    We compared the expression profiles of highly purified human CD34+ cells and erythroid progenitor cells by micro-serial analysis of gene expression (microSAGE). Human CD34+ cells were purified from granulocyte colony-stimulating factor-mobilized blood stem cells, and erythroid progenitors were obtained by cultivating these cells in the presence of stem cell factor, interleukin 3, and erythropoietin. Our 10,202 SAGE tags allowed us to identify 1354 different transcripts appearing more than once. Erythroid progenitor cells showed increased expression of LRBA, EEF1A1, HSPCA, PILRB, RANBP1, NACA, and SMURF. Overexpression of HSPCA was confirmed by real-time polymerase chain reaction analysis. MicroSAGE revealed an unexpected preferential expression of several genes in erythroid progenitor cells in addition to the known functional genes, including hemoglobins. Our results provide reference data for future studies of gene expression in various hematopoietic disorders, including myelodysplastic syndrome and leukemia.

  1. Particle-induced erythropoietin-independent effects of erythroid precursor cells in murine bone marrow.

    PubMed

    Ploemacher, R E; van Soest, P L; Wagemaker, G; van 't Hull, E

    1979-09-01

    A possible regulatory action of phagocytic cells on erythropoiesis was investigated by infusion of inert polystyrene latex particles (LAT). LAT appeared to induce changes in the femoral content of erythroid progenitor cells. These changes were most pronounced in primitive erythroid progenitor cells (BFUe) and appeared to be gradually damped in more differentiated populations (CFUe and erythroblasts). LAT did not influence granulocyte/macrophage progenitor cells (CFUc). The effects of LAT could not be attributed to changes in the systemic erythropoietin (EP) concentration. Administration of dexamethason nullified the effect of low doses of LAT, suggesting that phagocytosis of the particles is essential to the observed effects. Erythroid burst formation was previously found to be dependent on a bone marrow associated activity, termed BFA (burst feeder activity). BFA acts as an in vitro inducer of EP-responsiveness in BFUe. In this study it was found that LAT-induced changes in femoral erythroid progenitor cell content were characteristically preceded by corresponding changes in BFA. It was concluded that BFA-associated cells probably play a role in vivo in the early differentiation of erythroid progenitor cells. The present data are interpreted as direct in vivo evidence supporting a two-step regulatory model operating in erythropoiesis and provide evidence that phagocytic cells are a component of the erythroid haemopoietic inductive micro-environment. PMID:519701

  2. Repression by RB1 characterizes genes involved in the penultimate stage of erythroid development.

    PubMed

    Zhang, Ji; Loyd, Melanie R; Randall, Mindy S; Morris, John J; Shah, Jayesh G; Ney, Paul A

    2015-01-01

    Retinoblastoma-1 (RB1), and the RB1-related proteins p107 and p130, are key regulators of the cell cycle. Although RB1 is required for normal erythroid development in vitro, it is largely dispensable for erythropoiesis in vivo. The modest phenotype caused by RB1 deficiency in mice raises questions about redundancy within the RB1 family, and the role of RB1 in erythroid differentiation. Here we show that RB1 is the major pocket protein that regulates terminal erythroid differentiation. Erythroid cells lacking all pocket proteins exhibit the same cell cycle defects as those deficient for RB1 alone. RB1 has broad repressive effects on gene transcription in erythroid cells. As a group, RB1-repressed genes are generally well expressed but downregulated at the final stage of erythroid development. Repression correlates with E2F binding, implicating E2Fs in the recruitment of RB1 to repressed genes. Merging differential and time-dependent changes in expression, we define a group of approximately 800 RB1-repressed genes. Bioinformatics analysis shows that this list is enriched for terms related to the cell cycle, but also for terms related to terminal differentiation. Some of these have not been previously linked to RB1. These results expand the range of processes potentially regulated by RB1, and suggest that a principal role of RB1 in development is coordinating the events required for terminal differentiation. PMID:26397180

  3. Force Dependent Changes in Non-Erythroid Spectrin and Ankyrins

    NASA Astrophysics Data System (ADS)

    Degaga, Eleni; Forstner, Martin

    2012-02-01

    Mechanotransduction in cells describes the process by which external physical stimuli are converted into biochemical activity and plays an important role in many biological functions on both the cell and tissue level. However, the specific mechanisms by which mechanical forces lead to particular molecular and cellular responses are much less understood. We investigate the changes in non-erythroid spectrin and ankyrins as a result of equi-biaxial strain application to live cells in culture. Specifically, we focus on the spectrins' role in the ubiquitination process - a vital process in the regulation of protein degradation- of spectrin and ankyrins. We utilize immune-fluorescence staining and fluorescent fusion proteins for quantitative fluorescence imaging as well as biochemical methods to measure changes in of cell's spectrin and ankyrin content. Protein expression levels and localization between cells exposed to mechanical stimuli of different temporal and spatial profiles are compared. In addition, the threshold behavior of cell proliferation - as measured by number densities - of a variety of cell types as a function of mechano-stimulation is investigated.

  4. Myc Inhibits p27-Induced Erythroid Differentiation of Leukemia Cells by Repressing Erythroid Master Genes without Reversing p27-Mediated Cell Cycle Arrest▿ ‡

    PubMed Central

    Acosta, Juan C.; Ferrándiz, Nuria; Bretones, Gabriel; Torrano, Verónica; Blanco, Rosa; Richard, Carlos; O'Connell, Brenda; Sedivy, John; Delgado, M. Dolores; León, Javier

    2008-01-01

    Inhibition of differentiation has been proposed as an important mechanism for Myc-induced tumorigenesis, but the mechanisms involved are unclear. We have established a genetically defined differentiation model in human leukemia K562 cells by conditional expression of the cyclin-dependent kinase (Cdk) inhibitor p27 (inducible by Zn2+) and Myc (activatable by 4-hydroxy-tamoxifen). Induction of p27 resulted in erythroid differentiation, accompanied by Cdk inhibition and G1 arrest. Interestingly, activation of Myc inhibited p27-mediated erythroid differentiation without affecting p27-mediated proliferation arrest. Microarray-based gene expression indicated that, in the presence of p27, Myc blocked the upregulation of several erythroid-cell-specific genes, including NFE2, JUNB, and GATA1 (transcription factors with a pivotal role in erythropoiesis). Moreover, Myc also blocked the upregulation of Mad1, a transcriptional antagonist of Myc that is able to induce erythroid differentiation. Cotransfection experiments demonstrated that Myc-mediated inhibition of differentiation is partly dependent on the repression of Mad1 and GATA1. In conclusion, this model demonstrates that Myc-mediated inhibition of differentiation depends on the regulation of a specific gene program, whereas it is independent of p27-mediated cell cycle arrest. Our results support the hypothesis that differentiation inhibition is an important Myc tumorigenic mechanism that is independent of cell proliferation. PMID:18838534

  5. Mitochondrial Hspa9/Mortalin regulates erythroid differentiation via iron-sulfur cluster assembly.

    PubMed

    Shan, Yuxi; Cortopassi, Gino

    2016-01-01

    Mitochondrial iron-sulfur cluster (ISC) biogenesis provides iron-sulfur cofactors to several mitochondrial proteins, but the extent to which ISC biogenesis regulates hematopoiesis has been unclear. The blood disease Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis, and the disease overlaps with the gene Hspa9/Mortalin in multiple ways: the HSPA9 locus maps to 5q31.2 that is frequently deleted in human MDS; mutant Hspa9 causes zebrafish MDS; and Hspa9 knockdown mice have decreased hematopoiesis. We show here that HSPA9 functions in mitochondrial ISC biogenesis, and is required for erythroid differentiation. HSPA9 interacts with and stabilizes the mitochondrial ISC biogenesis proteins frataxin, Nfs1, ISCU, and Nfu. MDS-causing mutations in HSPA9 protein change its interactions with ISC biogenesis proteins. Depletion of HSPA9 decreases aconitase activity, which requires an ISC at its active site, but not that of the non-ISC requiring malate dehydrogenase, and increases IRP1 binding activity. In erythroid cell lines, Hspa9 depletion inhibited erythroid differentiation, post-transcriptionally regulating the expression of Alas2 and FeCH, as expected through known ISC control of the IRE response elements in these genes. By contrast, the Alas2 open reading frame rescued the Hspa9-dependent defect in erythroid differentiation, but not when uncoupled from its 5'-IRE sequence. Thus, Hspa9 depletion causes a mitochondrial ISC deficit, altering IRP1-IRE binding and FeCH stability, which consequently inhibits Alas2 translation, heme synthesis, and erythroid differentiation, i.e.: Hspa9->ISC->IRP/IRE->Alas2->heme synthesis->erythroid differentiation. Thus Hspa9 regulates erythroid differentiation through ISC cluster assembly, providing a pathophysiological mechanism for an MDS subtype characterized by HSPA9 haploinsufficiency, and suggests hemin and other pharmacological stimulators of ISC synthesis as potential routes to therapy.

  6. Candidate ligand for the c-kit transmembrane kinase receptor: KL, a fibroblast derived growth factor stimulates mast cells and erythroid progenitors.

    PubMed Central

    Nocka, K; Buck, J; Levi, E; Besmer, P

    1990-01-01

    The c-kit proto-oncogene encodes a transmembrane tyrosine kinase receptor for an unidentified ligand and is allelic with the murine white-spotting locus (W). W mutations affect melanogenesis, gametogenesis and hematopoiesis during development and in adult life. Cellular targets of W mutations in hematopoiesis include distinct cell populations in the erythroid and mast cell lineages as well as stem cells. In the absence of interleukin-3 (IL-3) mast cells derived from normal mice but not from W mutant mice can be maintained by co-culture with 3T3 fibroblasts. Based on the defective proliferative response of W mast cells in the 3T3 fibroblast co-culture system it had been proposed that fibroblasts produce the c-kit ligand. We have used a mast cell proliferation assay to purify a 30 kd protein, designated KL, from conditioned medium of Balb/3T3 fibroblasts to apparent homogeneity. KL stimulates the proliferation of normal bone marrow derived mast cells but not mast cells from W mice, although both normal and mutant mast cells respond similarly to IL-3. Connective tissue-type mast cells derived from the peritoneal cavity of normal mice were found to express a high level of c-kit protein on their surface and to proliferate in response to KL. The effect of KL on erythroid progenitor cells was investigated as well. In combination with erythropoietin, KL was found to stimulate early erythroid progenitors (BFU-E) from fetal liver and spleen cells but not from bone marrow cells of adult mice and from fetal liver cells of W/W mice.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 3. Fig. 5. Fig. 7. PMID:1698611

  7. Human parvovirus B19 causes cell cycle arrest of human erythroid progenitors via deregulation of the E2F family of transcription factors

    PubMed Central

    Wan, Zhihong; Zhi, Ning; Wong, Susan; Keyvanfar, Keyvan; Liu, Delong; Raghavachari, Nalini; Munson, Peter J.; Su, Su; Malide, Daniela; Kajigaya, Sachiko; Young, Neal S.

    2010-01-01

    Human parvovirus B19 (B19V) is the only human pathogenic parvovirus. It causes a wide spectrum of human diseases, including fifth disease (erythema infectiosum) in children and pure red cell aplasia in immunocompromised patients. B19V is highly erythrotropic and preferentially replicates in erythroid progenitor cells (EPCs). Current understanding of how B19V interacts with cellular factors to regulate disease progression is limited, due to a lack of permissive cell lines and animal models. Here, we employed a recently developed primary human CD36+ EPC culture system that is highly permissive for B19V infection to identify cellular factors that lead to cell cycle arrest after B19V infection. We found that B19V exploited the E2F family of transcription factors by downregulating activating E2Fs (E2F1 to E2F3a) and upregulating repressive E2Fs (E2F4 to E2F8) in the primary CD36+ EPCs. B19V nonstructural protein 1 (NS1) was a key viral factor responsible for altering E2F1–E2F5 expression, but not E2F6–E2F8 expression. Interaction between NS1 and E2F4 or E2F5 enhanced the nuclear import of these repressive E2Fs and induced stable G2 arrest. NS1-induced G2 arrest was independent of p53 activation and increased viral replication. Downstream E2F4/E2F5 targets, which are potentially involved in the progression from G2 into M phase and erythroid differentiation, were identified by microarray analysis. These findings provide new insight into the molecular pathogenesis of B19V in highly permissive erythroid progenitors. PMID:20890043

  8. The SOD1 transgene expressed in erythroid cells alleviates fatal phenotype in congenic NZB/NZW-F1 mice.

    PubMed

    Otsuki, Noriyuki; Konno, Tasuku; Kurahashi, Toshihiro; Suzuki, Saori; Lee, Jaeyong; Okada, Futoshi; Iuchi, Yoshihito; Homma, Takujiro; Fujii, Junichi

    2016-07-01

    Oxidative stress due to a superoxide dismutase 1 (SOD1) deficiency causes anemia and autoimmune responses, which are phenotypically similar to autoimmune hemolytic anemia (AIHA) and systemic lupus erythematosus (SLE) in C57BL/6 mice and aggravates AIHA pathogenesis in New Zealand black (NZB) mice. We report herein on an evaluation of the role of reactive oxygen species (ROS) in a model mouse with inherited SLE, that is, F1 mice of the NZB × New Zealand white (NZW) strain. The ROS levels within red blood cells (RBCs) of the F1 mice were similar to the NZW mice but lower compared to the NZB mice throughout adult period. Regarding SLE pathogenesis, we examined the effects of an SOD1 deficiency or the overexpression of human SOD1 in erythroid cells by establishing corresponding congenic F1 mice. A SOD1 deficiency caused an elevation in ROS production, methemoglobin content, and hyperoxidation of peroxiredoxin in RBC of the F1 mice, which were all consistent with elevated oxidative stress. However, while the overexpression of human SOD1 in erythroid cells extended the life span of the congenic F1 mice, the SOD1 deficiency had no effect on life span compared to wild-type F1 mice. It is generally recognized that NZW mice possess a larval defect in the immune system and that NZB mice trigger an autoimmune reaction in the F1 mice. Our results suggest that the oxidative insult originated from the NZB mouse background has a functional role in triggering an aberrant immune reaction, leading to fatal responses in F1 mice. PMID:27080108

  9. The fibronectin receptor on mammalian erythroid precursor cells: characterization and developmental regulation

    PubMed Central

    1986-01-01

    The plasma membrane of murine erythro-leukemia (MEL) cells contains a 140-kD protein that binds specifically to fibronectin. A 125I-labeled 140-kD protein from surface-labeled uninduced MEL cells was specifically bound by an affinity matrix that contained the 115-kD cell binding fragment of fibronectin, and specifically eluted by a synthetic peptide that has cell attachment-promoting activity. The loss of this protein during erythroid differentiation was correlated with loss of cellular adhesion to fibronectin. Both MEL cells and reticulocytes attached to the same site on fibronectin as do fibroblasts since adhesion of erythroid cells to fibronectin was specifically blocked by a monoclonal antibody directed against the cell-binding fragment of fibronectin and by a synthetic peptide containing the Arg-Gly-Asp-Ser sequence found in the cell-binding fragment of fibronectin. Erythroid cells attached specifically to surfaces coated either with the 115-kD cell-binding fragment of fibronectin or with the synthetic peptide- albumin complex. Thus, the erythroid 140-kD protein exhibits several properties in common with those described for the fibronectin receptor of fibroblasts. We propose that loss or modification of this protein at the cell surface is responsible for the loss of cellular adhesion to fibronectin during erythroid differentiation. PMID:2935541

  10. Stress Granules contribute to α-globin homeostasis in differentiating erythroid cells

    PubMed Central

    Ghisolfi, Laura; Dutt, Shilpee; McConkey, Marie E.; Ebert, Benjamin L.; Anderson, Paul

    2012-01-01

    Hemoglobin is the major biosynthetic product of developing erythroid cells. Assembly of hemoglobin requires the balanced production of globin protein and the oxygen-carrying heme moiety. The heme-regulated inhibitor kinase (HRI) participates in this process by phosphorylating eIF2α and inhibiting the translation of globin protein when levels of free heme are limiting. HRI is also activated in erythroid cells subjected to oxidative stress. Phospho-eIF2α-mediated translational repression induces the assembly of stress granules (SG), cytoplasmic foci that harbor untranslated mRNAs and promote the survival of cells subjected to adverse environmental conditions. We have found that differentiating erythroid, but not myelomonocytic or megakaryocytic, murine and human progenitor cells assemble SGs, in vitro and in vivo. Targeted knockdown of HRI or G3BP, a protein required for SG assembly, inhibits spontaneous and arsenite-induced assembly of SGs in erythroid progenitor cells. This is accompanied by reduced globin production and increased apoptosis suggesting that G3BP+ SGs facilitate the survival of developing erythroid cells. PMID:22452989

  11. Inactivation of 3-hydroxybutyrate dehydrogenase 2 delays zebrafish erythroid maturation by conferring premature mitophagy

    PubMed Central

    Davuluri, Gangarao; Song, Ping; Liu, Zhuoming; Wald, David; Sakaguchi, Takuya F.; Devireddy, L.

    2016-01-01

    Mitochondria are the site of iron utilization, wherein imported iron is incorporated into heme or iron–sulfur clusters. Previously, we showed that a cytosolic siderophore, which resembles a bacterial siderophore, facilitates mitochondrial iron import in eukaryotes, including zebrafish. An evolutionarily conserved 3-hydroxy butyrate dehydrogenase, 3-hydroxy butyrate dehydrogenase 2 (Bdh2), catalyzes a rate-limiting step in the biogenesis of the eukaryotic siderophore. We found that inactivation of bdh2 in developing zebrafish embryo results in heme deficiency and delays erythroid maturation. The basis for this erythroid maturation defect is not known. Here we show that bdh2 inactivation results in mitochondrial dysfunction and triggers their degradation by mitophagy. Thus, mitochondria are prematurely lost in bdh2-inactivated erythrocytes. Interestingly, bdh2-inactivated erythroid cells also exhibit genomic alterations as indicated by transcriptome analysis. Reestablishment of bdh2 restores mitochondrial function, prevents premature mitochondrial degradation, promotes erythroid development, and reverses altered gene expression. Thus, mitochondrial communication with the nucleus is critical for erythroid development. PMID:26929344

  12. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    PubMed Central

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2014-01-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions1–7. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with l-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli8,9. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition10,11.Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that

  13. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    NASA Astrophysics Data System (ADS)

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2013-12-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with L-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition. Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that these

  14. Purely lytic osteosarcoma

    SciTech Connect

    De Santos, L.A.; Eideken, B.

    1982-11-01

    The radiographic features of 42 purely lytic osteosarcomas are presented. Purely lytic osteosarcoma is identified as a lytic lesion of bone with no demonstrable osteoid matrix by conventional radiographic modalities. Purely lytic osteosarcoma represented 13.7% of a group of 305 osteosarcomas. The most common presentation was that of a lytic illdefined lesion with a moderate to large extraosseous mass component. Nine lesions presented with benign radiographic features. The differential diagnosis is outlined. The need for awareness of this type of presentation of osteosarcoma is stressed.

  15. Identification of CD13+CD36+ cells as a common progenitor for erythroid and myeloid lineages in human bone marrow

    PubMed Central

    Chen, Ling; Gao, Zhigang; Zhu, Jianqiong; Rodgers, Griffin P.

    2008-01-01

    Objective To identify bi-potential precursor cells of erythroid and myeloid development in human bone marrow. Materials and Methods Cells co-expressing CD13 and CD36 (CD13+CD36+) were investigated by analyzing cell surface marker expression during erythroid development (induced with a combination of cytokines plus erythropoietin [EPO]), or myeloid development (induced with the same cocktail of cytokines plus granulocyte-colony stimulating factor [G-CSF]) of bone marrow derived CD133 cells in liquid cultures. CD13+CD36+ subsets were also isolated on the 14th day of cultures and further evaluated for their hematopoietic clonogenic capacity in methylcellulose. Results Colony-forming analysis of sorted CD13+CD36+ cells of committed erythroid and myeloid lineages demonstrated that these cells were able to generate erythroid, granulocyte, and mixed erythroid –granulocyte colonies. In contrast, CD13+CD36− or CD13−CD36+ cells exclusively committed to granulocyte/monocyte or erythroid colonies, respectively, but failed to form mixed erythroid –granulocyte colonies; no colonies were detected in CD13−CD36− cells with lineage-supporting cytokines. In addition, our data confirmed that EPO induced both erythroid and myeloid commitment, while G-CSF only supported the differentiation of the myeloid lineage. Conclusions The present data identify some CD13+CD36+ cells as bi-potential precursors of erythroid and myeloid commitment in normal hematopoiesis. They provide a physiological explanation for the cell identification of myeloid and erythroid lineages observed in hematopoietic diseases. This unique fraction of CD13+CD36+ cells may be useful for further studies on regulating erythroid and myeloid differentiation during normal and malignant hematopoiesis. PMID:17588473

  16. Pure-quartic solitons

    PubMed Central

    Blanco-Redondo, Andrea; Martijn, de Sterke C.; Sipe, J.E.; Krauss, Thomas F.; Eggleton, Benjamin J.; Husko, Chad

    2016-01-01

    Temporal optical solitons have been the subject of intense research due to their intriguing physics and applications in ultrafast optics and supercontinuum generation. Conventional bright optical solitons result from the interaction of anomalous group-velocity dispersion and self-phase modulation. Here we experimentally demonstrate a class of bright soliton arising purely from the interaction of negative fourth-order dispersion and self-phase modulation, which can occur even for normal group-velocity dispersion. We provide experimental and numerical evidence of shape-preserving propagation and flat temporal phase for the fundamental pure-quartic soliton and periodically modulated propagation for the higher-order pure-quartic solitons. We derive the approximate shape of the fundamental pure-quartic soliton and discover that is surprisingly Gaussian, exhibiting excellent agreement with our experimental observations. Our discovery, enabled by precise dispersion engineering, could find applications in communications, frequency combs and ultrafast lasers. PMID:26822758

  17. Pure-quartic solitons.

    PubMed

    Blanco-Redondo, Andrea; de Sterke, C Martijn; Martijn, de Sterke C; Sipe, J E; Krauss, Thomas F; Eggleton, Benjamin J; Husko, Chad

    2016-01-01

    Temporal optical solitons have been the subject of intense research due to their intriguing physics and applications in ultrafast optics and supercontinuum generation. Conventional bright optical solitons result from the interaction of anomalous group-velocity dispersion and self-phase modulation. Here we experimentally demonstrate a class of bright soliton arising purely from the interaction of negative fourth-order dispersion and self-phase modulation, which can occur even for normal group-velocity dispersion. We provide experimental and numerical evidence of shape-preserving propagation and flat temporal phase for the fundamental pure-quartic soliton and periodically modulated propagation for the higher-order pure-quartic solitons. We derive the approximate shape of the fundamental pure-quartic soliton and discover that is surprisingly Gaussian, exhibiting excellent agreement with our experimental observations. Our discovery, enabled by precise dispersion engineering, could find applications in communications, frequency combs and ultrafast lasers. PMID:26822758

  18. Geomorphology: Pure and applied

    SciTech Connect

    Hart, M.G.

    1986-01-01

    The book summarizes the history of intellectual debate in geomorphology and describes modern developments both ''pure'' and ''applied.'' The history begins well before W.M. Davis and follows through to such debates as those concerned with the Pleistocene. Modern developments in pure geomorphology are cast in terms of chapters on form, process, materials, and methods analysis. The applied chapters concentrate on environmental hazards and resources, and their management.

  19. Non-random subcellular distribution of variant EKLF in erythroid cells

    PubMed Central

    Quadrini, Karen J.; Gruzglin, Eugenia; Bieker, James J.

    2008-01-01

    EKLF protein plays a prominent role during erythroid development as a nuclear transcription factor. Not surprisingly, exogenous EKLF quickly localizes to the nucleus. However, using two different assays we have unexpectedly found that a substantial proportion of endogenous EKLF resides in the cytoplasm at steady state in all erythroid cells examined. While EKLF localization does not appear to change during either erythroid development or terminal differentiation, we find that the protein displays subtle yet distinct biochemical and functional differences depending on which subcellular compartment it is isolated from, with PEST sequences possibly playing a role in these differences. Localization is unaffected by inhibition of CRM1 activity and the two populations are not differentiated by stability. Heterokaryon assays demonstrate that EKLF is able to shuttle out of the nucleus although its nuclear re-entry is rapid. These studies suggest there is an unexplored role for EKLF in the cytoplasm that is separate from its well-characterized nuclear function. PMID:18329016

  20. A Chemical Screening Approach to Identify Novel Key Mediators of Erythroid Enucleation

    PubMed Central

    Wölwer, Christina B.; Pase, Luke B.; Pearson, Helen B.; Gödde, Nathan J.; Lackovic, Kurt; Huang, David C. S.; Russell, Sarah M.; Humbert, Patrick O.

    2015-01-01

    Erythroid enucleation is critical for terminal differentiation of red blood cells, and involves extrusion of the nucleus by orthochromatic erythroblasts to produce reticulocytes. Due to the difficulty of synchronizing erythroblasts, the molecular mechanisms underlying the enucleation process remain poorly understood. To elucidate the cellular program governing enucleation, we utilized a novel chemical screening approach whereby orthochromatic cells primed for enucleation were enriched ex vivo and subjected to a functional drug screen using a 324 compound library consisting of structurally diverse, medicinally active and cell permeable drugs. Using this approach, we have confirmed the role of HDACs, proteasomal regulators and MAPK in erythroid enucleation and introduce a new role for Cyclin-dependent kinases, in particular CDK9, in this process. Importantly, we demonstrate that when coupled with imaging analysis, this approach provides a powerful means to identify and characterize rate limiting steps involved in the erythroid enucleation process. PMID:26569102

  1. Non-random subcellular distribution of variant EKLF in erythroid cells

    SciTech Connect

    Quadrini, Karen J.; Gruzglin, Eugenia; Bieker, James J.

    2008-04-15

    EKLF protein plays a prominent role during erythroid development as a nuclear transcription factor. Not surprisingly, exogenous EKLF quickly localizes to the nucleus. However, using two different assays we have unexpectedly found that a substantial proportion of endogenous EKLF resides in the cytoplasm at steady state in all erythroid cells examined. While EKLF localization does not appear to change during either erythroid development or terminal differentiation, we find that the protein displays subtle yet distinct biochemical and functional differences depending on which subcellular compartment it is isolated from, with PEST sequences possibly playing a role in these differences. Localization is unaffected by inhibition of CRM1 activity and the two populations are not differentiated by stability. Heterokaryon assays demonstrate that EKLF is able to shuttle out of the nucleus although its nuclear re-entry is rapid. These studies suggest there is an unexplored role for EKLF in the cytoplasm that is separate from its well-characterized nuclear function.

  2. The VP1u Receptor Restricts Parvovirus B19 Uptake to Permissive Erythroid Cells

    PubMed Central

    Leisi, Remo; Von Nordheim, Marcus; Ros, Carlos; Kempf, Christoph

    2016-01-01

    Parvovirus B19 (B19V) is a small non-enveloped virus and known as the causative agent for the mild childhood disease erythema infectiosum. B19V has an extraordinary narrow tissue tropism, showing only productive infection in erythroid precursor cells in the bone marrow. We recently found that the viral protein 1 unique region (VP1u) contains an N-terminal receptor-binding domain (RBD), which mediates the uptake of the virus into cells of the erythroid lineage. To further investigate the role of the RBD in connection with a B19V-unrelated capsid, we chemically coupled the VP1u of B19V to the bacteriophage MS2 capsid and tested the internalization capacity of the bioconjugate on permissive cells. In comparison, we studied the cellular uptake and infection of B19V along the erythroid differentiation. The results showed that the MS2-VP1u bioconjugate mimicked the specific internalization of the native B19V into erythroid precursor cells, which further coincides with the restricted infection profile. The successful mimicry of B19V uptake demonstrates that the RBD in the VP1u is sufficient for the endocytosis of the viral capsid. Furthermore, the recombinant VP1u competed with B19V uptake into permissive cells, thus excluding a significant alternative uptake mechanism by other receptors. Strikingly, the VP1u receptor appeared to be expressed only on erythropoietin-dependent erythroid differentiation stages that also provide the necessary intracellular factors for a productive infection. Taken together, these findings suggest that the VP1u binds to a yet-unknown erythroid-specific cellular receptor and thus restricts the virus entry to permissive cells. PMID:27690083

  3. Upstream Distal Regulatory Elements Contact the Lmo2 Promoter in Mouse Erythroid Cells

    PubMed Central

    Bhattacharya, Anandi; Chen, Chih-Yu; Ho, Sara; Mitchell, Jennifer A.

    2012-01-01

    The Lim domain only 2 (Lmo2) gene encodes a transcriptional cofactor critical for the development of hematopoietic stem cells. Several distal regulatory elements have been identified upstream of the Lmo2 gene in the human and mouse genomes that are capable of enhancing reporter gene expression in erythroid cells and may be responsible for the high level transcription of Lmo2 in the erythroid lineage. In this study we investigate how these elements regulate transcription of Lmo2 and whether or not they function cooperatively in the endogenous context. Chromosome conformation capture (3C) experiments show that chromatin-chromatin interactions exist between upstream regulatory elements and the Lmo2 promoter in erythroid cells but that these interactions are absent from kidney where Lmo2 is transcribed at twelve fold lower levels. Specifically, long range chromatin-chromatin interactions occur between the Lmo2 proximal promoter and two broad regions, 3–31 and 66–105 kb upstream of Lmo2, which we term the proximal and distal control regions for Lmo2 (pCR and dCR respectively). Each of these regions is bound by several transcription factors suggesting that multiple regulatory elements cooperate in regulating high level transcription of Lmo2 in erythroid cells. Binding of CTCF and cohesin which support chromatin loops at other loci were also found within the dCR and at the Lmo2 proximal promoter. Intergenic transcription occurs throughout the dCR in erythroid cells but not in kidney suggesting a role for these intergenic transcripts in regulating Lmo2, similar to the broad domain of intergenic transcription observed at the human β-globin locus control region. Our data supports a model in which the dCR functions through a chromatin looping mechanism to contact and enhance Lmo2 transcription specifically in erythroid cells. Furthermore, these chromatin loops are supported by the cohesin complex recruited to both CTCF and transcription factor bound regions. PMID

  4. Stimulated stromal cells induce gamma-globin gene expression in erythroid cells via nitric oxide production

    PubMed Central

    Čokić, Vladan P.; Beleslin-Čokić, Bojana B.; Smith, Reginald D.; Economou, Antaeus P.; Wahl, Larry M.; Noguchi, Constance T.; Schechter, Alan N.

    2009-01-01

    Objective We have previously shown that nitric oxide (NO) is involved in the hydroxyurea-induced increase of gamma-globin gene expression in cultured human erythroid progenitor cells and that hydroxyurea increases NO production in endothelial cells via endothelial NO synthase (NOS). We have now expanded those studies to demonstrate that the stimulation of gamma-globin gene expression is also mediated by NOS induction in stromal cells within the bone marrow microenvironment. Materials and Methods Using NO analyzer, we measured NO production in endothelial and macrophage cell cultures. In co-culture studies of erythroid and stromal cells we measured globin gene expression during stimulation by NO inducers. Results Hydroxyurea (30–100 μM) induced NOS-dependent production of NO in human macrophages (up to 1.2 μM). Co-culture studies of human macrophages with erythroid progenitor cells also resulted in induction of gamma-globin mRNA expression (up to 3 fold) in the presence of hydroxyurea. NOS-dependent stimulation of NO by lipopolysaccharide (up to 0.6 μM) has been observed in human macrophages. We found that lipopolysaccharide and interferon-gamma together increased gamma-globin gene expression (up to 2 fold) in human macrophage/erythroid cell co-cultures. Co-culture of human bone marrow endothelial cells with erythroid progenitor cells also induced gamma-globin mRNA expression (2.4 fold) in the presence of hydroxyurea (40 μM). Conclusion These results demonstrate an arrangement by which NO and fetal hemoglobin inducers may stimulate globin genes in erythroid cells via the common paracrine effect of bone marrow stromal cells. PMID:19576950

  5. Ligand-dependent repression of the erythroid transcription factor GATA-1 by the estrogen receptor.

    PubMed Central

    Blobel, G A; Sieff, C A; Orkin, S H

    1995-01-01

    High-dose estrogen administration induces anemia in mammals. In chickens, estrogens stimulate outgrowth of bone marrow-derived erythroid progenitor cells and delay their maturation. This delay is associated with down-regulation of many erythroid cell-specific genes, including alpha- and beta-globin, band 3, band 4.1, and the erythroid cell-specific histone H5. We show here that estrogens also reduce the number of erythroid progenitor cells in primary human bone marrow cultures. To address potential mechanisms by which estrogens suppress erythropoiesis, we have examined their effects on GATA-1, an erythroid transcription factor that participates in the regulation of the majority of erythroid cell-specific genes and is necessary for full maturation of erythrocytes. We demonstrate that the transcriptional activity of GATA-1 is strongly repressed by the estrogen receptor (ER) in a ligand-dependent manner and that this repression is reversible in the presence of 4-hydroxytamoxifen. ER-mediated repression of GATA-1 activity occurs on an artificial promoter containing a single GATA-binding site, as well as in the context of an intact promoter which is normally regulated by GATA-1. GATA-1 and ER bind to each other in vitro in the absence of DNA. In coimmunoprecipitation experiments using transfected COS cells, GATA-1 and ER associate in a ligand-dependent manner. Mapping experiments indicate that GATA-1 and the ER form at least two contacts, which involve the finger region and the N-terminal activation domain of GATA-1. We speculate that estrogens exert effects on erythropoiesis by modulating GATA-1 activity through protein-protein interaction with the ER. Interference with GATA-binding proteins may be one mechanism by which steroid hormones modulate cellular differentiation. PMID:7760810

  6. Dysplastic changes in erythroid precursors as a manifestation of lead poisoning: report of a case and review of literature.

    PubMed

    Lv, Chenglan; Xu, Yueyi; Wang, Jing; Shao, Xiaoyan; Ouyang, Jian; Li, Juan

    2015-01-01

    Dysplastic changes in erythroid precursors occur not only in patients with hematologic diseases, but also those with other diseases. Here, we report on a patient that presented with dysplastic changes in erythroid precursors due to lead poisoning from the intake of Chinese folk remedies.

  7. Dysplastic changes in erythroid precursors as a manifestation of lead poisoning: report of a case and review of literature

    PubMed Central

    Lv, Chenglan; Xu, Yueyi; Wang, Jing; Shao, Xiaoyan; Ouyang, Jian; Li, Juan

    2015-01-01

    Dysplastic changes in erythroid precursors occur not only in patients with hematologic diseases, but also those with other diseases. Here, we report on a patient that presented with dysplastic changes in erythroid precursors due to lead poisoning from the intake of Chinese folk remedies. PMID:25755780

  8. Pure red cell aplasia following autoimmune hemolytic anemia: an enigma.

    PubMed

    Saha, M; Ray, S; Kundu, S; Chakrabarti, P

    2013-01-01

    A 26-year-old previously healthy female presented with a 6-month history of anemia. The laboratory findings revealed hemolytic anemia and direct antiglobulin test was positive. With a diagnosis of autoimmune hemolytic anemia (AIHA), prednisolone was started but was ineffective after 1 month of therapy. A bone marrow trephine biopsy revealed pure red cell aplasia (PRCA) showing severe erythroid hypoplasia. The case was considered PRCA following AIHA. This combination without clear underlying disease is rare. Human parvovirus B19 infection was not detected in the marrow aspirate during reticulocytopenia. The patient received azathioprine, and PRCA improved but significant hemolysis was once again documented with a high reticulocyte count. The short time interval between AIHA and PRCA phase suggested an increased possibility of the evolution of a single disease.

  9. Pure shift NMR.

    PubMed

    Zangger, Klaus

    2015-04-01

    Although scalar-coupling provides important structural information, the resulting signal splittings significantly reduce the resolution of NMR spectra. Limited resolution is a particular problem in proton NMR experiments, resulting in part from the limited proton chemical shift range (∼10 ppm) but even more from the splittings due to scalar coupling to nearby protons. "Pure shift" NMR spectroscopy (also known as broadband homonuclear decoupling) has been developed for disentangling overlapped proton NMR spectra. The resulting spectra are considerably simplified as they consist of single lines, reminiscent of proton-decoupled C-13 spectra at natural abundance, with no multiplet structure. The different approaches to obtaining pure shift spectra are reviewed here and several applications presented. Pure shift spectra are especially useful for highly overlapped proton spectra, as found for example in reaction mixtures, natural products and biomacromolecules.

  10. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders.

  11. Erythropoietin-independent regeneration of erythroid progenitor cells following multiple injections of hydroxyurea.

    PubMed

    Wagemaker, G; Visser, T P

    1980-09-01

    It wa shown previously that colony formation in vitro by early erythroid progenitor cells (BFUe) requires sequential stimulation with a specific glycoprotein termed BFA and erythropoietin (EP). The action exerted by BFA was characterized as induction of proliferation in BFUe resulting after several cell divisions in EP-responsive progeny. The present study is directed at detection of EP-independent regulation of erythroid progenitor cells in vivo. Haemopoietic regeneration was induced by multiple administrations of hydroxyurea (HU). The femoral regeneration patterns of haemopoietic stem cells (CFUs), granulocyte/macrophage progenitor cells (CFUgm) and erythroid progenitor cells (BFUe, day 3 BFUe and CFUe) were studied in hypertransfused mice in comparison to nontransfused controls. The results show that (1) the phase of exponential regeneration of none of the cell populations studied is affected by hypertransfusion; (2) each of these cell populations exhibit a distinct regeneration pattern, indicating that they behave as separate functional entities; and (3) the three erythroid cell populations are suppressed by hypertransfusion in the post-exponential phase of regeneration in contrast to CFUs and CFUgm. The results support a two-regulator model of erythropoiesis. PMID:7459981

  12. Establishment of Immortalized Human Erythroid Progenitor Cell Lines Able to Produce Enucleated Red Blood Cells

    PubMed Central

    Kurita, Ryo; Suda, Noriko; Sudo, Kazuhiro; Miharada, Kenichi; Hiroyama, Takashi; Miyoshi, Hiroyuki; Tani, Kenzaburo; Nakamura, Yukio

    2013-01-01

    Transfusion of red blood cells (RBCs) is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs. PMID:23533656

  13. Imaging Flow Cytometry for the Study of Erythroid Cell Biology and Pathology

    PubMed Central

    Samsel, Leigh; McCoy, J Philip

    2015-01-01

    Erythroid cell maturation and diseases affecting erythrocytes are frequently accompanied by morphologic and immunophenotypic changes to these cells. In the past, these changes have been assessed primarily through the use of manual microscopy, which substantially limits the statistical rigor, throughput, and objectivity of these studies. Imaging flow cytometry provides a technology to examine both the morphology of cells as well as to quantify the staining intensity and signal distribution of numerous fluorescent markers on a cell-by-cell basis with high throughput in a statistically robust manner, and thus is ideally suited to studying erythroid cell biology. To date imaging flow cytometry has been used to study erythrocytes in three areas: 1) erythroid cell maturation, 2) sickle cell disease, and 3) infectious diseases such as malaria. In the maturation studies, imaging flow cytometry can closely recapitulate known stages of maturation and has led to the identification of a new population of erythroid cell precursors. In sickle cell disease, imaging flow cytometry provides a robust method to quantify sickled erythrocytes and to identify cellular aggregates linked to morbidities, and in malaria, imaging flow cytometry has been used to screen for new chemotherapeutic agents. These studies have demonstrated the value of imaging flow cytometry for investigations of erythrocyte biology and pathology. PMID:25858229

  14. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation.

    PubMed

    Hattangadi, Shilpa M; Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F

    2014-09-18

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly,many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7.

  15. Homeodomain-interacting protein kinase 2 plays an important role in normal terminal erythroid differentiation.

    PubMed

    Hattangadi, Shilpa M; Burke, Karly A; Lodish, Harvey F

    2010-06-10

    Gene-targeting experiments report that the homeodomain-interacting protein kinases 1 and 2, Hipk1 and Hipk2, are essential but redundant in hematopoietic development because Hipk1/Hipk2 double-deficient animals exhibit severe defects in hematopoiesis and vasculogenesis, whereas the single knockouts do not. These serine-threonine kinases phosphorylate and consequently modify the functions of several important hematopoietic transcription factors and cofactors. Here we show that Hipk2 knockdown alone plays a significant role in terminal fetal liver erythroid differentiation. Hipk1 and Hipk2 are highly induced during primary mouse fetal liver erythropoiesis. Specific knockdown of Hipk2 inhibits terminal erythroid cell proliferation (explained in part by impaired cell-cycle progression as well as increased apoptosis) and terminal enucleation as well as the accumulation of hemoglobin. Hipk2 knockdown also reduces the transcription of many genes involved in proliferation and apoptosis as well as important, erythroid-specific genes involved in hemoglobin biosynthesis, such as alpha-globin and mitoferrin 1, demonstrating that Hipk2 plays an important role in some but not all aspects of normal terminal erythroid differentiation.

  16. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation

    PubMed Central

    Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F.

    2014-01-01

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly, many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7. PMID:25092175

  17. Hepatocyte growth factor induces proliferation and differentiation of multipotent and erythroid hemopoietic progenitors

    PubMed Central

    1994-01-01

    Hepatocyte growth factor (HGF) is a mesenchymal derived growth factor known to induce proliferation and "scattering" of epithelial and endothelial cells. Its receptor is the tyrosine kinase encoded by the c- MET protooncogene. Here we show that highly purified recombinant HGF stimulates hemopoietic progenitors to form colonies in vitro. In the presence of erythropoietin, picomolar concentrations of HGF induced the formation of erythroid burst-forming unit colonies from CD34-positive cells purified from human bone marrow, peripheral blood, or umbilical cord blood. The growth stimulatory activity was restricted to the erythroid lineage. HGF also stimulated the formation of multipotent CFU- GEMM colonies. This effect is synergized by stem cell factor, the ligand of the tyrosine kinase receptor encoded by the c-KIT protooncogene, which is active on early hemopoietic progenitors. By flow cytometry analysis, the receptor for HGF was found to be expressed on the cell surface in a fraction of CD34+ progenitors. Moreover, in situ hybridization experiments showed that HGF receptor mRNA is highly expressed in embryonic erythroid cells (megaloblasts). HGF mRNA was also found to be produced in the embryonal liver. These data show that HGF plays a direct role in the control of proliferation and differentiation of erythroid progenitors, and they suggest that it may be one of the long-sought mediators of paracrine interactions between stromal and hemopoietic cells within the hemopoietic microenvironment. PMID:7528222

  18. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  19. Pluripotent stem cells reveal erythroid-specific activities of the GATA1 N-terminus

    PubMed Central

    Byrska-Bishop, Marta; VanDorn, Daniel; Campbell, Amy E.; Betensky, Marisol; Arca, Philip R.; Yao, Yu; Gadue, Paul; Costa, Fernando F.; Nemiroff, Richard L.; Blobel, Gerd A.; French, Deborah L.; Hardison, Ross C.; Weiss, Mitchell J.; Chou, Stella T.

    2015-01-01

    Germline GATA1 mutations that result in the production of an amino-truncated protein termed GATA1s (where s indicates short) cause congenital hypoplastic anemia. In patients with trisomy 21, similar somatic GATA1s-producing mutations promote transient myeloproliferative disease and acute megakaryoblastic leukemia. Here, we demonstrate that induced pluripotent stem cells (iPSCs) from patients with GATA1-truncating mutations exhibit impaired erythroid potential, but enhanced megakaryopoiesis and myelopoiesis, recapitulating the major phenotypes of the associated diseases. Similarly, in developmentally arrested GATA1-deficient murine megakaryocyte-erythroid progenitors derived from murine embryonic stem cells (ESCs), expression of GATA1s promoted megakaryopoiesis, but not erythropoiesis. Transcriptome analysis revealed a selective deficiency in the ability of GATA1s to activate erythroid-specific genes within populations of hematopoietic progenitors. Although its DNA-binding domain was intact, chromatin immunoprecipitation studies showed that GATA1s binding at specific erythroid regulatory regions was impaired, while binding at many nonerythroid sites, including megakaryocytic and myeloid target genes, was normal. Together, these observations indicate that lineage-specific GATA1 cofactor associations are essential for normal chromatin occupancy and provide mechanistic insights into how GATA1s mutations cause human disease. More broadly, our studies underscore the value of ESCs and iPSCs to recapitulate and study disease phenotypes. PMID:25621499

  20. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  1. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    PubMed Central

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  2. Mito-protective autophagy is impaired in erythroid cells of aged mtDNA-mutator mice.

    PubMed

    Li-Harms, XiuJie; Milasta, Sandra; Lynch, John; Wright, Christopher; Joshi, Aashish; Iyengar, Rekha; Neale, Geoffrey; Wang, Xi; Wang, Yong-Dong; Prolla, Tomas A; Thompson, James E; Opferman, Joseph T; Green, Douglas R; Schuetz, John; Kundu, Mondira

    2015-01-01

    Somatic mitochondrial DNA (mtDNA) mutations contribute to the pathogenesis of age-related disorders, including myelodysplastic syndromes (MDS). The accumulation of mitochondria harboring mtDNA mutations in patients with these disorders suggests a failure of normal mitochondrial quality-control systems. The mtDNA-mutator mice acquire somatic mtDNA mutations via a targeted defect in the proofreading function of the mtDNA polymerase, PolgA, and develop macrocytic anemia similar to that of patients with MDS. We observed an unexpected defect in clearance of dysfunctional mitochondria at specific stages during erythroid maturation in hematopoietic cells from aged mtDNA-mutator mice. Mechanistically, aberrant activation of mechanistic target of rapamycin signaling and phosphorylation of uncoordinated 51-like kinase (ULK) 1 in mtDNA-mutator mice resulted in proteasome-mediated degradation of ULK1 and inhibition of autophagy in erythroid cells. To directly evaluate the consequence of inhibiting autophagy on mitochondrial function in erythroid cells harboring mtDNA mutations in vivo, we deleted Atg7 from erythroid progenitors of wild-type and mtDNA-mutator mice. Genetic disruption of autophagy did not cause anemia in wild-type mice but accelerated the decline in mitochondrial respiration and development of macrocytic anemia in mtDNA-mutator mice. These findings highlight a pathological feedback loop that explains how dysfunctional mitochondria can escape autophagy-mediated degradation and propagate in cells predisposed to somatic mtDNA mutations, leading to disease.

  3. Eafs Control Erythroid Cell Fate by Regulating c-myb Expression through Wnt Signaling

    PubMed Central

    Ma, Xufa; Liu, Jing-Xia

    2013-01-01

    ELL associated factor 1 and ELL associated factor 2 (EAF1/2 factors) are reported to play important roles in tumor suppression and embryogenesis. Our previous studies showed that eaf factors mediated effective convergence and extension (C&E) movements and modulated mesoderm and neural patterning by regulating both non-canonical and canonical Wnt signaling in the early embryonic process. In this study, through knockdown of both eaf1 and eaf2 in embryos, we found that differentiation of primary erythroid cells was blocked, but hematopoietic precursor cells maintained in eafs morphants. Co-injection of c-myb-MO rescued the erythroid differentiation in eafs morphants, as indicated by the restored expression of the erythroid-specific gene, βe3 globin. In addition, low dosage of c-myb effectively blocked the βe3 globin expression in embryos, and did not affect the expression of markers of hematopoietic progenitor cells and other mesoderm, which was similar to the phenotypes we observed in eafs morphants. We also revealed that knockdown Wnt signaling by transiently inducing dn-Tcf in embryos at the bud stage down-regulated the increased c-myb to normal level and also restored βe3 globin expression in eafs morphants. Our evidence points to a novel role for eaf factors in controlling erythroid cell fate by regulating c-Myb expression through canonic Wnt signaling. PMID:23717633

  4. Depletion of glutamine enhances sodium butyrate-induced erythroid differentiation of K562 cells.

    PubMed

    Canh Hiep, Nguyen; Kinohira, Seiko; Furuyama, Kazumichi; Taketani, Shigeru

    2012-12-01

    Human erytholeukemia K562 cells are induced to differentiate along the erythroid lineage by a variety of chemical compounds, including hemin, sodium butyrate and 1-β-d-arabinofuranosylcytosine. We have investigated the induction of erythroid differentiation of K562 cells by glutamine depletion. When K562 cells were cultured in glutamine-minus medium, the induction of hemoglobin synthesis, accompanied by those of heme-biosynthetic enzymes and erythroid transcriptional factors, was observed. This induction was dependent on the temporally marked decrease of intracellular level of glutathione, followed by the marked activation of p38MAPK and SAPK/JNK, but not ERK. Under glutamine-deficient conditions, the treatment of K562 cells with sodium butyrate resulted in the marked enhancement of the induction of heme biosynthesis. Glutamine depletion also accelerated the expressions of erythroid-related factors including α-globin and heme-biosynthetic enzymes, GATA-1 and NF-E2, in sodium butyrate-induced K562 cells. The transcriptional activity of β-globin gene promoter-reporter was markedly enhanced by these treatments, indicating that glutamine deficiency in combination with sodium butyrate treatment gives high efficiency of chemical-induced differentiation in the hematopoiesis process.

  5. Cytoplasmic Poly(A) Binding Protein C4 Serves a Critical Role in Erythroid Differentiation

    PubMed Central

    Kini, Hemant K.; Kong, Jian

    2014-01-01

    The expression of an mRNA is strongly impacted by its 3′ poly(A) tail and associated poly(A)-binding proteins (PABPs). Vertebrates encode six PABP isoforms that vary in abundance, distribution, developmental control, and subcellular localization. Here we demonstrate that the minor PABP isoform PABPC4 is expressed in erythroid cells and impacts the steady-state expression of a subset of erythroid mRNAs. Motif analyses reveal a high-value AU-rich motif in the 3′ untranslated regions (UTRs) of PABPC4-impacted mRNAs. This motif enhances the association of PABPC4 with mRNAs containing critically shortened poly(A) tails. This association may serve to protect a subset of mRNAs from accelerated decay. Finally, we demonstrate that selective depletion of PABPC4 in an erythroblast cell line inhibits terminal erythroid maturation with corresponding alterations in the erythroid gene expression. These observations lead us to conclude that PABPC4 plays an essential role in posttranscriptional control of a major developmental pathway. PMID:24469397

  6. Translational control mediated by hnRNP K links NMHC IIA to erythroid enucleation.

    PubMed

    Naarmann-de Vries, Isabel S; Brendle, Annika; Bähr-Ivacevic, Tomi; Benes, Vladimir; Ostareck, Dirk H; Ostareck-Lederer, Antje

    2016-03-15

    Post-transcriptional regulation is crucial for structural and functional alterations in erythropoiesis. Enucleation of erythroid progenitors precedes reticulocyte release into circulation. In enucleated cells, reticulocyte 15-lipoxygenase (r15-LOX, also known as ALOX15) initiates mitochondria degradation. Regulation of r15-LOX mRNA translation by hnRNP K determines timely r15-LOX synthesis in terminal maturation. K562 cells induced for erythroid maturation recapitulate enucleation and mitochondria degradation. HnRNP K depletion from maturing K562 cells results in enhanced enucleation, which even occurs independently of maturation. We performed RIP-Chip analysis to identify hnRNP K-interacting RNAs comprehensively. Non-muscle myosin heavy chain (NMHC) IIA (also known as MYH9) mRNA co-purified with hnRNP K from non-induced K562 cells, but not from mature cells. NMHC IIA protein increase in erythroid maturation at constant NMHC IIA mRNA levels indicates post-transcriptional regulation. We demonstrate that binding of hnRNP K KH domain 3 to a specific sequence element in the NMHC IIA mRNA 3'UTR mediates translation regulation in vitro Importantly, elevated NMHC IIA expression results in erythroid-maturation-independent enucleation as shown for hnRNP K depletion. Our data provide evidence that hnRNP-K-mediated regulation of NMHC IIA mRNA translation contributes to the control of enucleation in erythropoiesis. PMID:26823606

  7. Ldb1-nucleated transcription complexes function as primary mediators of global erythroid gene activation

    PubMed Central

    Li, LiQi; Freudenberg, Johannes; Cui, Kairong; Dale, Ryan; Song, Sang-Hyun; Dean, Ann; Zhao, Keji

    2013-01-01

    Erythropoiesis is dependent on the lineage-specific transcription factors Gata1, Tal1, and Klf1. Several erythroid genes have been shown to require all 3 factors for their expression, suggesting that they function synergistically; however, there is little direct evidence for widespread cooperation. Gata1 and Tal1 can assemble within higher-order protein complexes (Ldb1 complexes) that include the adapter molecules Lmo2 and Ldb1. Ldb1 proteins are capable of coassociation, and long-range Ldb1-mediated oligomerization of enhancer- and promoter-bound Ldb1 complexes has been shown to be required for β-globin gene expression. In this study, we generated a genomewide map of Ldb1 complex binding sites that revealed widespread binding at erythroid genes and at known erythroid enhancer elements. Ldb1 complex binding sites frequently colocalized with Klf1 binding sites and with consensus binding motifs for other erythroid transcription factors. Transcriptomic analysis demonstrated a strong correlation between Ldb1 complex binding and Ldb1 dependency for gene expression and identified a large cohort of genes coregulated by Ldb1 complexes and Klf1. Together, these results provide a foundation for defining the mechanism and scope of Ldb1 complex activity during erythropoiesis. PMID:23610375

  8. Transgene Insertion in Proximity to thec-myb Gene Disrupts Erythroid-Megakaryocytic Lineage Bifurcation▿

    PubMed Central

    Mukai, Harumi Y.; Motohashi, Hozumi; Ohneda, Osamu; Suzuki, Norio; Nagano, Masumi; Yamamoto, Masayuki

    2006-01-01

    The nuclear proto-oncogene c-myb plays crucial roles in the growth, survival, and differentiation of hematopoietic cells. We established three lines of erythropoietin receptor-transgenic mice and found that one of them exhibited anemia, thrombocythemia, and splenomegaly. These abnormalities were independent of the function of the transgenic erythropoietin receptor and were observed exclusively in mice harboring the transgene homozygously, suggesting transgenic disruption of a certain gene. The transgene was inserted 77 kb upstream of the c-myb gene, and c-Myb expression was markedly decreased in megakaryocyte/erythrocyte lineage-restricted progenitors (MEPs) of the homozygous mutant mice. In the bone marrows and spleens of the mutant mice, numbers of megakaryocytes were increased and numbers of erythroid progenitors were decreased. These abnormalities were reproducible in vitro in a coculture assay of MEPs with OP9 cells but eliminated by the retroviral expression of c-Myb in MEPs. The erythroid/megakaryocytic abnormalities were reconstituted in mice in vivo by transplantation of mutant mouse bone marrow cells. These results demonstrate that the transgene insertion into the c-myb gene far upstream regulatory region affects the gene expression at the stage of MEPs, leading to an imbalance between erythroid and megakaryocytic cells, and suggest that c-Myb is an essential regulator of the erythroid-megakaryocytic lineage bifurcation. PMID:16940183

  9. Effects of THAP11 on Erythroid Differentiation and Megakaryocytic Differentiation of K562 Cells

    PubMed Central

    Kong, Xiang-Zhen; Yin, Rong-Hua; Ning, Hong-Mei; Zheng, Wei-Wei; Dong, Xiao-Ming; Yang, Yang; Xu, Fei-Fei; Li, Jian-Jie; Zhan, Yi-Qun; Yu, Miao; Ge, Chang-Hui; Zhang, Jian-Hong; Chen, Hui; Li, Chang-Yan; Yang, Xiao-Ming

    2014-01-01

    Hematopoiesis is a complex process regulated by sets of transcription factors in a stage-specific and context-dependent manner. THAP11 is a transcription factor involved in cell growth, ES cell pluripotency, and embryogenesis. Here we showed that THAP11 was down-regulated during erythroid differentiation but up-regulated during megakaryocytic differentiation of cord blood CD34+ cells. Overexpression of THAP11 in K562 cells inhibited the erythroid differentiation induced by hemin with decreased numbers of benzidine-positive cells and decreased mRNA levels of α-globin (HBA) and glycophorin A (GPA), and knockdown of THAP11 enhanced the erythroid differentiation. Conversely, THAP11 overexpression accelerated the megakaryocytic differentiation induced by phorbol myristate acetate (PMA) with increased percentage of CD41+ cells, increased numbers of 4N cells, and elevated CD61 mRNA levels, and THAP11 knockdown attenuated the megakaryocytic differentiation. The expression levels of transcription factors such as c-Myc, c-Myb, GATA-2, and Fli1 were changed by THAP11 overexpression. In this way, our results suggested that THAP11 reversibly regulated erythroid and megakaryocytic differentiation. PMID:24637716

  10. Production of pure metals

    NASA Technical Reports Server (NTRS)

    Philipp, W. H.; Marsik, S. J.; May, C. E. (Inventor)

    1974-01-01

    A process for depositing elements by irradiating liquids is reported. Ultra pure elements are precipitated from aqueous solutions or suspensions of compounds. A solution of a salt of a metal to be prepared is irradiated, and the insoluble reaction product settles out. Some chemical compounds may also be prepared in this manner.

  11. Dahlbeck and Pure Ontology

    ERIC Educational Resources Information Center

    Mackenzie, Jim

    2016-01-01

    This article responds to Johan Dahlbeck's "Towards a pure ontology: Children's bodies and morality" ["Educational Philosophy and Theory," vol. 46 (1), 2014, pp. 8-23 (EJ1026561)]. His arguments from Nietzsche and Spinoza do not carry the weight he supposes, and the conclusions he draws from them about pedagogy would be…

  12. Selective erythroid replacement in murine beta-thalassemia using fetal hematopoietic stem cells.

    PubMed Central

    Bethel, C. A.; Murugesh, D.; Harrison, M. R.; Mohandas, N.; Rubin, E. M.

    1993-01-01

    We have explored the application of fetal hematopoietic stem cell (HSC) transplants for cellular replacement in a murine model of beta-thalassemia. Liver-derived HSCs from nonthalassemic syngeneic murine fetal donors were transplanted into nonirradiated neonatal beta-thalassemic recipients. Significant erythrocyte chimerism (9-27%) was demonstrated in the majority of recipients at 1 month and remained stable or increased (up to 55%) during long-term follow-up in almost all cases. Chimeras had improved phenotypes, as evidenced by decreased reticulocyte counts, increased mean erythrocyte deformability, and decreased iron deposits in comparison to controls. To investigate whether the high degree of peripheral blood chimerism was predominantly a feature of erythroid elements or was a general feature of all hematopoietic elements, chimeras were created using donor HSCs "tagged" with a DNA transgene. Whereas donor hemoglobin comprised > 30% of total hemoglobin, nucleated tagged nonerythroid donor cells comprised < 1% of peripheral blood elements. Explanations for the observed selective increase in erythroid chimerism include longer survival of normal donor red cells compared to that of thalassemic red cells and the effective maturation of the donor erythroid elements in the bone marrow in chimeric animals. The latter explanation bears consideration because it is consistent with the process of ineffective erythropoiesis, well documented to occur in thalassemia, in which the majority of thalassemic erythroid cells are destroyed during erythropoiesis prior to release from the bone marrow. Overall, these data demonstrate the potential for significant erythroid chimerism and suggest that fetal HSC transplantation may play a significant role in future treatment. Images Fig. 1 Fig. 4 Fig. 7 PMID:7980734

  13. Selective erythroid replacement in murine beta-thalassemia using fetal hematopoietic stem cells.

    PubMed

    Bethel, C A; Murugesh, D; Harrison, M R; Mohandas, N; Rubin, E M

    1993-11-01

    We have explored the application of fetal hematopoietic stem cell (HSC) transplants for cellular replacement in a murine model of beta-thalassemia. Liver-derived HSCs from nonthalassemic syngeneic murine fetal donors were transplanted into nonirradiated neonatal beta-thalassemic recipients. Significant erythrocyte chimerism (9-27%) was demonstrated in the majority of recipients at 1 month and remained stable or increased (up to 55%) during long-term follow-up in almost all cases. Chimeras had improved phenotypes, as evidenced by decreased reticulocyte counts, increased mean erythrocyte deformability, and decreased iron deposits in comparison to controls. To investigate whether the high degree of peripheral blood chimerism was predominantly a feature of erythroid elements or was a general feature of all hematopoietic elements, chimeras were created using donor HSCs "tagged" with a DNA transgene. Whereas donor hemoglobin comprised > 30% of total hemoglobin, nucleated tagged nonerythroid donor cells comprised < 1% of peripheral blood elements. Explanations for the observed selective increase in erythroid chimerism include longer survival of normal donor red cells compared to that of thalassemic red cells and the effective maturation of the donor erythroid elements in the bone marrow in chimeric animals. The latter explanation bears consideration because it is consistent with the process of ineffective erythropoiesis, well documented to occur in thalassemia, in which the majority of thalassemic erythroid cells are destroyed during erythropoiesis prior to release from the bone marrow. Overall, these data demonstrate the potential for significant erythroid chimerism and suggest that fetal HSC transplantation may play a significant role in future treatment.

  14. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin

    PubMed Central

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J.; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F.; Psathaki, Olympia E.; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R.; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34+ hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34+ hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34+ hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34+ cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. PMID:25326431

  15. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    SciTech Connect

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  16. Purely Cortical Anaplastic Ependymoma

    PubMed Central

    Romero, Flávio Ramalho; Zanini, Marco Antônio; Ducati, Luis Gustavo; Vital, Roberto Bezerra; de Lima Neto, Newton Moreira; Gabarra, Roberto Colichio

    2012-01-01

    Ependymomas are glial tumors derived from ependymal cells lining the ventricles and the central canal of the spinal cord. It may occur outside the ventricular structures, representing the extraventicular form, or without any relationship of ventricular system, called ectopic ependymona. Less than fifteen cases of ectopic ependymomas were reported and less than five were anaplastic. We report a rare case of pure cortical ectopic anaplastic ependymoma. PMID:23119204

  17. Purely cortical anaplastic ependymoma.

    PubMed

    Romero, Flávio Ramalho; Zanini, Marco Antônio; Ducati, Luis Gustavo; Vital, Roberto Bezerra; de Lima Neto, Newton Moreira; Gabarra, Roberto Colichio

    2012-01-01

    Ependymomas are glial tumors derived from ependymal cells lining the ventricles and the central canal of the spinal cord. It may occur outside the ventricular structures, representing the extraventicular form, or without any relationship of ventricular system, called ectopic ependymona. Less than fifteen cases of ectopic ependymomas were reported and less than five were anaplastic. We report a rare case of pure cortical ectopic anaplastic ependymoma.

  18. Pure Lovelock Kasner metrics

    NASA Astrophysics Data System (ADS)

    Camanho, Xián O.; Dadhich, Naresh; Molina, Alfred

    2015-09-01

    We study pure Lovelock vacuum and perfect fluid equations for Kasner-type metrics. These equations correspond to a single Nth order Lovelock term in the action in d=2N+1,2N+2 dimensions, and they capture the relevant gravitational dynamics when aproaching the big-bang singularity within the Lovelock family of theories. Pure Lovelock gravity also bears out the general feature that vacuum in the critical odd dimension, d=2N+1, is kinematic, i.e. we may define an analogue Lovelock-Riemann tensor that vanishes in vacuum for d=2N+1, yet the Riemann curvature is non-zero. We completely classify isotropic and vacuum Kasner metrics for this class of theories in several isotropy types. The different families can be characterized by means of certain higher order 4th rank tensors. We also analyze in detail the space of vacuum solutions for five- and six dimensional pure Gauss-Bonnet theory. It possesses an interesting and illuminating geometric structure and symmetries that carry over to the general case. We also comment on a closely related family of exponential solutions and on the possibility of solutions with complex Kasner exponents. We show that the latter imply the existence of closed timelike curves in the geometry.

  19. Effect of fetal hemoglobin-stimulating medicines on the interaction of DNA and protein of important erythroid regulatory elements.

    PubMed

    Ji, Xin-Jun; Liu, De-pei; Xu, Dong-Dong; Li, Lei; Liang, Chih-chuan

    2003-08-01

    Beta-Thalassemia is the most common single gene disorder in the world, which is caused by the imbalance between alpha-globin chain and beta-globin chain synthesis. Several medicines, such as 5-azacytidine, hydroxyurea, cytarabine, vinblatine, butyrate, and myleran, have been shown to be able to reactivate gamma-globin chain synthesis during the adult stage, and some of them (5-azacytidine, hydroxyurea, myleran, and butyrate) have been used clinically to treat thalassemia and sickle cell disease. Much research efforts are focusing on the determination of the underlying mechanisms of medicine action. In this experiment, as an effort to probe the underlying mechanism of medicine action, we used ligation-mediated polymerase chain reaction and in vivo footprinting methods to study the DNA-protein interaction at critical erythroid regulatory elements after hydroxyurea or myleran administration to mice. Our results showed that the patterns of in vivo footprints at both the hypersensitive site 2 of the locus control region and the beta-globin gene promoter were changed after medicine treatment. We proposed based on these results that the medicines' administration might result in a change in the interaction between trans-acting factors and cis-acting elements at these regions. These changes might influence the assembly of the transcription complex and, lastly, influence the expression of the beta-globin gene.

  20. 7 CFR 917.8 - Pure grower or pure producer.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE FRESH PEARS AND PEACHES GROWN IN CALIFORNIA Order Regulating Handling Definitions § 917.8 Pure grower or pure producer. (a) For peaches,...

  1. 7 CFR 917.8 - Pure grower or pure producer.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE FRESH PEARS AND PEACHES GROWN IN CALIFORNIA Order Regulating Handling Definitions § 917.8 Pure grower or pure producer. (a) For peaches,...

  2. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    PubMed

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation.

  3. New insights into the mechanisms of mammalian erythroid chromatin condensation and enucleation.

    PubMed

    Ji, Peng

    2015-01-01

    A unique feature in mammalian erythropoiesis is the dramatic chromatin condensation followed by enucleation. This step-by-step process starts at the beginning of terminal erythropoiesis after the hematopoietic stem cells are committed to erythroid lineage. Although this phenomenon is known for decades, the mechanisms of chromatin condensation and enucleation remain elusive. Recent advances in cell and molecular biology have started to reveal the molecular pathways in the regulation of chromatin condensation, the establishment of nuclear polarity prior enucleation, and the rearrangement of actin cytoskeleton in enucleation. However, many challenging questions, especially whether and how the apoptotic mechanisms are involved in chromatin condensation and how to dissect the functions of many actin cytoskeleton proteins in cytokinesis and enucleation, remain to be answered. Here I review our current understanding of mammalian erythroid chromatin condensation and enucleation during terminal differentiation with a focus on more recent studies. I conclude with my perspective of future works in this rising topic in developmental and cell biology.

  4. Dynamic long-range chromatin interactions control Myb proto-oncogene transcription during erythroid development

    PubMed Central

    Stadhouders, Ralph; Thongjuea, Supat; Andrieu-Soler, Charlotte; Palstra, Robert-Jan; Bryne, Jan Christian; van den Heuvel, Anita; Stevens, Mary; de Boer, Ernie; Kockx, Christel; van der Sloot, Antoine; van den Hout, Mirjam; van IJcken, Wilfred; Eick, Dirk; Lenhard, Boris; Grosveld, Frank; Soler, Eric

    2012-01-01

    The key haematopoietic regulator Myb is essential for coordinating proliferation and differentiation. ChIP-Sequencing and Chromosome Conformation Capture (3C)-Sequencing were used to characterize the structural and protein-binding dynamics of the Myb locus during erythroid differentiation. In proliferating cells expressing Myb, enhancers within the Myb-Hbs1l intergenic region were shown to form an active chromatin hub (ACH) containing the Myb promoter and first intron. This first intron was found to harbour the transition site from transcription initiation to elongation, which takes place around a conserved CTCF site. Upon erythroid differentiation, Myb expression is downregulated and the ACH destabilized. We propose a model for Myb activation by distal enhancers dynamically bound by KLF1 and the GATA1/TAL1/LDB1 complex, which primarily function as a transcription elongation element through chromatin looping. PMID:22157820

  5. Dynamic long-range chromatin interactions control Myb proto-oncogene transcription during erythroid development.

    PubMed

    Stadhouders, Ralph; Thongjuea, Supat; Andrieu-Soler, Charlotte; Palstra, Robert-Jan; Bryne, Jan Christian; van den Heuvel, Anita; Stevens, Mary; de Boer, Ernie; Kockx, Christel; van der Sloot, Antoine; van den Hout, Mirjam; van Ijcken, Wilfred; Eick, Dirk; Lenhard, Boris; Grosveld, Frank; Soler, Eric

    2012-02-15

    The key haematopoietic regulator Myb is essential for coordinating proliferation and differentiation. ChIP-Sequencing and Chromosome Conformation Capture (3C)-Sequencing were used to characterize the structural and protein-binding dynamics of the Myb locus during erythroid differentiation. In proliferating cells expressing Myb, enhancers within the Myb-Hbs1l intergenic region were shown to form an active chromatin hub (ACH) containing the Myb promoter and first intron. This first intron was found to harbour the transition site from transcription initiation to elongation, which takes place around a conserved CTCF site. Upon erythroid differentiation, Myb expression is downregulated and the ACH destabilized. We propose a model for Myb activation by distal enhancers dynamically bound by KLF1 and the GATA1/TAL1/LDB1 complex, which primarily function as a transcription elongation element through chromatin looping. PMID:22157820

  6. Structural Insights into the Stability and Flexibility of Unusual Erythroid Spectrin Repeats

    SciTech Connect

    Kusunoki, H.; Macdonald, R.I.; Mondragon, A.

    2010-03-08

    Erythroid spectrin, a major component of the cytoskeletal network of the red cell which contributes to both the stability and the elasticity of the red cell membrane, is composed of two subunits, {alpha} and {beta}, each formed by 16-20 tandem repeats. The properties of the repeats and their relative arrangement are thought to be key determinants of spectrin flexibility. Here we report a 2.4 {angstrom} resolution crystal structure of human erythroid {beta}-spectrin repeats 8 and 9. This two-repeat fragment is unusual as it exhibits low stability of folding and one of its repeats lacks two tryptophans highly conserved among spectrin repeats. Two key factors responsible for the lower stability and, possibly, its flexibility, are revealed by the structure. A third novel feature of the structure is the relative orientation of the two repeats, which increases the range of possible conformations and provides new insights into atomic models of spectrin flexibility.

  7. TRAIL regulates normal erythroid maturation through an ERK-dependent pathway.

    PubMed

    Secchiero, Paola; Melloni, Elisabetta; Heikinheimo, Markku; Mannisto, Susanna; Di Pietro, Roberta; Iacone, Antonio; Zauli, Giorgio

    2004-01-15

    In order to investigate the biologic activity of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) on human erythropoiesis, glycophorin A (GPA)+ erythroid cells were generated in serum-free liquid phase from human cord blood (CB) CD34+ progenitor cells. The surface expression of TRAIL-R1 was weakly detectable in the early-intermediate phase of erythroid differentiation (days 4-6; dim-intermediate GPA expression), whereas a clear-cut expression of TRAIL-R2 was observed through the entire course of erythroid differentiation (up to days 12-14; bright GPA expression). On the other hand, surface TRAIL-R3 and -R4 were not detected at any culture time. Besides inducing a rapid but small increase of apoptotic cell death, which was abrogated by the pan-caspase inhibitor z-VAD-fmk, the addition of recombinant TRAIL at day 6 of culture inhibited the generation of morphologically mature erythroblasts. Among the intracellular pathways investigated, TRAIL significantly stimulated the extracellular signal-regulated kinase 1/2 (ERK1/2) but not the p38/mitogen-activated protein kinase (MAPK) or the c-Jun NH2-terminal kinase (JNK) pathway. Consistently with a key role of ERK1/2 in mediating the negative effects of TRAIL on erythroid maturation, PD98059, a pharmacologic inhibitor of the ERK pathway, but not z-VAD-fmk or SB203580, a pharmacologic inhibitor of p38/MAPK, reverted the antidifferentiative effect of TRAIL on CB-derived erythroblasts. PMID:12969966

  8. RHEX, a novel regulator of human erythroid progenitor cell expansion and erythroblast development.

    PubMed

    Verma, Rakesh; Su, Su; McCrann, Donald J; Green, Jennifer M; Leu, Karen; Young, Peter R; Schatz, Peter J; Silva, Jeffrey C; Stokes, Matthew P; Wojchowski, Don M

    2014-08-25

    Ligation of erythropoietin (EPO) receptor (EPOR) JAK2 kinase complexes propagates signals within erythroid progenitor cells (EPCs) that are essential for red blood cell production. To reveal hypothesized novel EPOR/JAK2 targets, a phosphotyrosine (PY) phosphoproteomics approach was applied. Beyond known signal transduction factors, 32 new targets of EPO-modulated tyrosine phosphorylation were defined. Molecular adaptors comprised one major set including growth factor receptor-bound protein 2 (GRB2)-associated binding proteins 1-3 (GAB1-3), insulin receptor substrate 2 (IRS2), docking protein 1 (DOK1), Src homology 2 domain containing transforming protein 1 (SHC1), and sprouty homologue 1 (SPRY1) as validating targets, and SPRY2, SH2 domain containing 2A (SH2D2A), and signal transducing adaptor molecule 2 (STAM2) as novel candidate adaptors together with an ORF factor designated as regulator of human erythroid cell expansion (RHEX). RHEX is well conserved in Homo sapiens and primates but absent from mouse, rat, and lower vertebrate genomes. Among tissues and lineages, RHEX was elevated in EPCs, occurred as a plasma membrane protein, was rapidly PY-phosphorylated >20-fold upon EPO exposure, and coimmunoprecipitated with the EPOR. In UT7epo cells, knockdown of RHEX inhibited EPO-dependent growth. This was associated with extracellular signal-regulated kinase 1,2 (ERK1,2) modulation, and RHEX coupling to GRB2. In primary human EPCs, shRNA knockdown studies confirmed RHEX regulation of erythroid progenitor expansion and further revealed roles in promoting the formation of hemoglobinizing erythroblasts. RHEX therefore comprises a new EPO/EPOR target and regulator of human erythroid cell expansion that additionally acts to support late-stage erythroblast development.

  9. Late stage erythroid precursor production is impaired in mice with chronic inflammation

    PubMed Central

    Prince, Olivier D.; Langdon, Jacqueline M.; Layman, Andrew J.; Prince, Ian C.; Sabogal, Miguel; Mak, Howard H.; Berger, Alan E.; Cheadle, Chris; Chrest, Francis J.; Yu, Qilu; Andrews, Nancy C.; Xue, Qian-Li; Civin, Curt I.; Walston, Jeremy D.; Roy, Cindy N.

    2012-01-01

    Background We and others have shown previously that over-expression of hepcidin antimicrobial peptide, independently of inflammation, induces several features of anemia of inflammation and chronic disease, including hypoferremia, sequestration of iron stores and iron-restricted erythropoiesis. Because the iron-restricted erythropoiesis evident in hepcidin transgenic mice differs from the normocytic, normochromic anemia most often observed in anemia of inflammation, we tested the hypothesis that chronic inflammation may contribute additional features to anemia of inflammation which continue to impair erythropoiesis following the acute phase of inflammation in which hepcidin is active. Design and Methods We compared erythropoiesis and iron handling in mice with turpentine-induced sterile abscesses with erythropoiesis and iron handling in hepcidin transgenic mice. We compared erythrocyte indices, expression of genes in the hepcidin regulatory pathway, tissue iron distribution, expression of heme and iron transport genes in splenic macrophages, the phenotype of erythroid maturation and chloromethyl dichlorodihydrofluorescein diacetate, acetyl ester fluorescence. Results Mice with sterile abscesses exhibited an intense, acute inflammatory phase followed by a mild to moderate chronic inflammatory phase. We found that erythrocytes in mice with sterile abscesses were normocytic and normochromic in contrast to those in hepcidin transgenic mice. We also observed that although hypoferremia resolved in the late phases of inflammation, erythropoiesis remained suppressed, with evidence of inefficient maturation of erythroid precursors in the bone marrow of mice with sterile abscesses. Finally, we observed increased oxidative stress in erythroid progenitors and circulating erythrocytes of mice with sterile abscesses which was not evident in hepcidin transgenic mice. Conclusions Our results suggest that chronic inflammation inhibits late stages of erythroid production in the

  10. Histone demethylase LSD1-mediated repression of GATA-2 is critical for erythroid differentiation

    PubMed Central

    Guo, Yidi; Fu, Xueqi; Jin, Yue; Sun, Jing; Liu, Ye; Huo, Bo; Li, Xiang; Hu, Xin

    2015-01-01

    Background The transcription factor GATA-2 is predominantly expressed in hematopoietic stem and progenitor cells and counteracts the erythroid-specific transcription factor GATA-1, to modulate the proliferation and differentiation of hematopoietic cells. During hematopoietic cell differentiation, GATA-2 exhibits dynamic expression patterns, which are regulated by multiple transcription factors. Methods Stable LSD1-knockdown cell lines were established by growing murine erythroleukemia (MEL) or mouse embryonic stem cells together with virus particles, in the presence of Polybrene® at 4 μg/mL, for 24–48 hours followed by puromycin selection (1 μg/mL) for 2 weeks. Real-time polymerase chain reaction (PCR)-based quantitative chromatin immunoprecipitation (ChIP) analysis was used to test whether the TAL1 transcription factor is bound to 1S promoter in the GATA-2 locus or whether LSD1 colocalizes with TAL1 at the 1S promoter. The sequential ChIP assay was utilized to confirm the role of LSD1 in the regulation of H3K4me2 at the GATA-2 locus during erythroid differentiation. Western blot analysis was employed to detect the protein expression. The alamarBlue® assay was used to examine the proliferation of the cells, and the absorbance was monitored at optical density (OD) 570 nm and OD 600 nm. Results In this study, we showed that LSD1 regulates the expression of GATA-2 during erythroid differentiation. Knockdown of LSD1 results in increased GATA-2 expression and inhibits the differentiation of MEL and embryonic stem cells. Furthermore, we demonstrated that LSD1 binds to the 1S promoter of the GATA-2 locus and suppresses GATA-2 expression, via histone demethylation. Conclusion Our data revealed that LSD1 mediates erythroid differentiation, via epigenetic modification of the GATA-2 locus. PMID:26124638

  11. RHEX, a novel regulator of human erythroid progenitor cell expansion and erythroblast development.

    PubMed

    Verma, Rakesh; Su, Su; McCrann, Donald J; Green, Jennifer M; Leu, Karen; Young, Peter R; Schatz, Peter J; Silva, Jeffrey C; Stokes, Matthew P; Wojchowski, Don M

    2014-08-25

    Ligation of erythropoietin (EPO) receptor (EPOR) JAK2 kinase complexes propagates signals within erythroid progenitor cells (EPCs) that are essential for red blood cell production. To reveal hypothesized novel EPOR/JAK2 targets, a phosphotyrosine (PY) phosphoproteomics approach was applied. Beyond known signal transduction factors, 32 new targets of EPO-modulated tyrosine phosphorylation were defined. Molecular adaptors comprised one major set including growth factor receptor-bound protein 2 (GRB2)-associated binding proteins 1-3 (GAB1-3), insulin receptor substrate 2 (IRS2), docking protein 1 (DOK1), Src homology 2 domain containing transforming protein 1 (SHC1), and sprouty homologue 1 (SPRY1) as validating targets, and SPRY2, SH2 domain containing 2A (SH2D2A), and signal transducing adaptor molecule 2 (STAM2) as novel candidate adaptors together with an ORF factor designated as regulator of human erythroid cell expansion (RHEX). RHEX is well conserved in Homo sapiens and primates but absent from mouse, rat, and lower vertebrate genomes. Among tissues and lineages, RHEX was elevated in EPCs, occurred as a plasma membrane protein, was rapidly PY-phosphorylated >20-fold upon EPO exposure, and coimmunoprecipitated with the EPOR. In UT7epo cells, knockdown of RHEX inhibited EPO-dependent growth. This was associated with extracellular signal-regulated kinase 1,2 (ERK1,2) modulation, and RHEX coupling to GRB2. In primary human EPCs, shRNA knockdown studies confirmed RHEX regulation of erythroid progenitor expansion and further revealed roles in promoting the formation of hemoglobinizing erythroblasts. RHEX therefore comprises a new EPO/EPOR target and regulator of human erythroid cell expansion that additionally acts to support late-stage erythroblast development. PMID:25092874

  12. The Effect of Mir-451 Upregulation on Erythroid Lineage Differentiation of Murine Embryonic Stem Cells

    PubMed Central

    Obeidi, Narges; Pourfathollah, Ali Akbar; Soleimani, Masoud; Nikougoftar Zarif, Mahin; Kouhkan, Fatemeh

    2016-01-01

    Objective MicroRNAs (miRNAs) are small endogenous non-coding regulatory RNAs that control mRNAs post-transcriptionally. Several mouse stem cells miRNAs are cloned differentially regulated in different hematopoietic lineages, suggesting their possible role in hematopoietic lineage differentiation. Recent studies have shown that specific miRNAs such as Mir-451 have key roles in erythropoiesis. Materials and Methods In this experimental study, murine embryonic stem cells (mESCs) were infected with lentiviruses containing pCDH-Mir-451. Erythroid differentiation was assessed based on the expression level of transcriptional factors (Gata-1, Klf-1, Epor) and hemoglobin chains (α, β, γ , ε and ζ) genes using quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and presence of erythroid surface antigens (TER-119 and CD235a) using flow cytometery. Colony-forming unit (CFU) assay was also on days 14thand 21thafter transduction. Results Mature Mir-451 expression level increased by 3.434-fold relative to the untreated mESCs on day 4 after transduction (P<0.001). Mir-451 up-regulation correlated with the induction of transcriptional factor (Gata-1, Klf-1, Epor) and hemoglobin chain (α, β, γ, ε and ζ) genes in mESCs (P<0.001) and also showed a strong correlation with presence of CD235a and Ter- 119 markers in these cells (13.084and 13.327-fold increse, respectively) (P<0.05). Moreover, mESCs treated with pCDH-Mir-451 showed a significant raise in CFU-erythroid (CFU-E) colonies (5.2-fold) compared with untreated control group (P<0.05). Conclusion Our results showed that Mir-451 up-regulation strongly induces erythroid differentiation and maturation of mESCs. Overexpression of Mir-451 may have the potential to produce artificial red blood cells (RBCs) without the presence of any stimulatory cytokines. PMID:27540521

  13. A novel complex, RUNX1-MYEF2, represses hematopoietic genes in erythroid cells.

    PubMed

    van Riel, Boet; Pakozdi, Tibor; Brouwer, Rutger; Monteiro, Rui; Tuladhar, Kapil; Franke, Vedran; Bryne, Jan Christian; Jorna, Ruud; Rijkers, Erik-Jan; van Ijcken, Wilfred; Andrieu-Soler, Charlotte; Demmers, Jeroen; Patient, Roger; Soler, Eric; Lenhard, Boris; Grosveld, Frank

    2012-10-01

    RUNX1 is known to be an essential transcription factor for generating hematopoietic stem cells (HSC), but much less is known about its role in the downstream process of hematopoietic differentiation. RUNX1 has been shown to be part of a large transcription factor complex, together with LDB1, GATA1, TAL1, and ETO2 (N. Meier et al., Development 133:4913-4923, 2006) in erythroid cells. We used a tagging strategy to show that RUNX1 interacts with two novel protein partners, LSD1 and MYEF2, in erythroid cells. MYEF2 is bound in undifferentiated cells and is lost upon differentiation, whereas LSD1 is bound in differentiated cells. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) and microarray expression analysis were used to show that RUNX1 binds approximately 9,000 target sites in erythroid cells and is primarily active in the undifferentiated state. Functional analysis shows that a subset of the target genes is suppressed by RUNX1 via the newly identified partner MYEF2. Knockdown of Myef2 expression in developing zebrafish results in a reduced number of HSC. PMID:22801375

  14. A Novel Complex, RUNX1-MYEF2, Represses Hematopoietic Genes in Erythroid Cells

    PubMed Central

    van Riel, Boet; Pakozdi, Tibor; Brouwer, Rutger; Monteiro, Rui; Tuladhar, Kapil; Franke, Vedran; Bryne, Jan Christian; Jorna, Ruud; Rijkers, Erik-Jan; van Ijcken, Wilfred; Andrieu-Soler, Charlotte; Demmers, Jeroen; Patient, Roger; Soler, Eric

    2012-01-01

    RUNX1 is known to be an essential transcription factor for generating hematopoietic stem cells (HSC), but much less is known about its role in the downstream process of hematopoietic differentiation. RUNX1 has been shown to be part of a large transcription factor complex, together with LDB1, GATA1, TAL1, and ETO2 (N. Meier et al., Development 133:4913–4923, 2006) in erythroid cells. We used a tagging strategy to show that RUNX1 interacts with two novel protein partners, LSD1 and MYEF2, in erythroid cells. MYEF2 is bound in undifferentiated cells and is lost upon differentiation, whereas LSD1 is bound in differentiated cells. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) and microarray expression analysis were used to show that RUNX1 binds approximately 9,000 target sites in erythroid cells and is primarily active in the undifferentiated state. Functional analysis shows that a subset of the target genes is suppressed by RUNX1 via the newly identified partner MYEF2. Knockdown of Myef2 expression in developing zebrafish results in a reduced number of HSC. PMID:22801375

  15. Thioredoxin-interacting protein regulates the differentiation of murine erythroid precursors.

    PubMed

    Gasiorek, Jadwiga J; Mikhael, Marc; Garcia-Santos, Daniel; Hui, Simon T; Ponka, Prem; Blank, Volker

    2015-05-01

    Thioredoxin-interacting protein (TXNIP) is involved in various cellular processes including redox control, metabolism, differentiation, growth, and apoptosis. With respect to hematopoiesis, TXNIP has been shown to play roles in natural killer cells, dendritic cells, and hematopoietic stem cells. Our study investigates the role of TXNIP in erythropoiesis. We observed a rapid and significant increase of TXNIP transcript and protein levels in mouse erythroleukemia cells treated with dimethyl sulfoxide or hexamethylene bisacetamide, inducers of erythroid differentiation. The upregulation of TXNIP was not abrogated by addition of the antioxidant N-acetylcysteine. The increase of TXNIP expression was confirmed in another model of erythroid differentiation, G1E-ER cells, which undergo differentiation upon activation of the GATA1 transcription factor. In addition, we showed that TXNIP levels are induced following inhibition of p38 or c-Jun N-terminal kinase (JNK) mitogen-activated protein kinases. We also observed an increase in iron uptake and a decrease in transferrin receptor protein upon TXNIP overexpression, suggesting a role in iron homeostasis. In vivo, flow cytometry analysis of cells from Txnip(-/-) mice revealed a new phenotype of impaired terminal erythropoiesis in the spleen, characterized by a partial block between basophilic and late basophilic/polychromatic erythroblasts. Based on our data, TXNIP emerges as a novel regulator of terminal erythroid differentiation.

  16. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  17. Regulation of GATA Factor Expression Is Distinct between Erythroid and Mast Cell Lineages

    PubMed Central

    Ohmori, Shin'ya; Takai, Jun; Ishijima, Yasushi; Suzuki, Mikiko; Moriguchi, Takashi; Philipsen, Sjaak; Yamamoto, Masayuki

    2012-01-01

    The zinc finger transcription factors GATA1 and GATA2 participate in mast cell development. Although the expression of these factors is regulated in a cell lineage-specific and differentiation stage-specific manner, their regulation during mast cell development has not been clarified. Here, we show that the GATA2 mRNA level was significantly increased while GATA1 was maintained at low levels during the differentiation of mast cells derived from mouse bone marrow (BMMCs). Unlike in erythroid cells, forced expression or small interfering RNA (siRNA)-mediated knockdown of GATA1 rarely affected GATA2 expression, and vice versa, in mast cells, indicating the absence of cross-regulation between Gata1 and Gata2 genes. Chromatin immunoprecipitation assays revealed that both GATA factors bound to most of the conserved GATA sites of Gata1 and Gata2 loci in BMMCs. However, the GATA1 hematopoietic enhancer (G1HE) of the Gata1 gene, which is essential for GATA1 expression in erythroid and megakaryocytic lineages, was bound only weakly by both GATA factors in BMMCs. Furthermore, transgenic-mouse reporter assays revealed that the G1HE is not essential for reporter expression in BMMCs and peritoneal mast cells. Collectively, these results demonstrate that the expression of GATA factors in mast cells is regulated in a manner quite distinct from that in erythroid cells. PMID:22988301

  18. Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation.

    PubMed

    Alvarez-Dominguez, Juan R; Hu, Wenqian; Yuan, Bingbing; Shi, Jiahai; Park, Staphany S; Gromatzky, Austin A; van Oudenaarden, Alexander; Lodish, Harvey F

    2014-01-23

    Erythropoiesis is regulated at multiple levels to ensure the proper generation of mature red cells under multiple physiological conditions. To probe the contribution of long noncoding RNAs (lncRNAs) to this process, we examined >1 billion RNA-seq reads of polyadenylated and nonpolyadenylated RNA from differentiating mouse fetal liver red blood cells and identified 655 lncRNA genes including not only intergenic, antisense, and intronic but also pseudogene and enhancer loci. More than 100 of these genes are previously unrecognized and highly erythroid specific. By integrating genome-wide surveys of chromatin states, transcription factor occupancy, and tissue expression patterns, we identify multiple lncRNAs that are dynamically expressed during erythropoiesis, show epigenetic regulation, and are targeted by key erythroid transcription factors GATA1, TAL1, or KLF1. We focus on 12 such candidates and find that they are nuclear-localized and exhibit complex developmental expression patterns. Depleting them severely impaired erythrocyte maturation, inhibiting cell size reduction and subsequent enucleation. One of them, alncRNA-EC7, is transcribed from an enhancer and is specifically needed for activation of the neighboring gene encoding BAND 3. Our study provides an annotated catalog of erythroid lncRNAs, readily available through an online resource, and shows that diverse types of lncRNAs participate in the regulatory circuitry underlying erythropoiesis.

  19. Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation

    PubMed Central

    Alvarez-Dominguez, Juan R.; Yuan, Bingbing; Shi, Jiahai; Park, Staphany S.; Gromatzky, Austin A.; van Oudenaarden, Alexander

    2014-01-01

    Erythropoiesis is regulated at multiple levels to ensure the proper generation of mature red cells under multiple physiological conditions. To probe the contribution of long noncoding RNAs (lncRNAs) to this process, we examined >1 billion RNA-seq reads of polyadenylated and nonpolyadenylated RNA from differentiating mouse fetal liver red blood cells and identified 655 lncRNA genes including not only intergenic, antisense, and intronic but also pseudogene and enhancer loci. More than 100 of these genes are previously unrecognized and highly erythroid specific. By integrating genome-wide surveys of chromatin states, transcription factor occupancy, and tissue expression patterns, we identify multiple lncRNAs that are dynamically expressed during erythropoiesis, show epigenetic regulation, and are targeted by key erythroid transcription factors GATA1, TAL1, or KLF1. We focus on 12 such candidates and find that they are nuclear-localized and exhibit complex developmental expression patterns. Depleting them severely impaired erythrocyte maturation, inhibiting cell size reduction and subsequent enucleation. One of them, alncRNA-EC7, is transcribed from an enhancer and is specifically needed for activation of the neighboring gene encoding BAND 3. Our study provides an annotated catalog of erythroid lncRNAs, readily available through an online resource, and shows that diverse types of lncRNAs participate in the regulatory circuitry underlying erythropoiesis. PMID:24200680

  20. Control of developmentally primed erythroid genes by combinatorial co-repressor actions

    PubMed Central

    Stadhouders, Ralph; Cico, Alba; Stephen, Tharshana; Thongjuea, Supat; Kolovos, Petros; Baymaz, H. Irem; Yu, Xiao; Demmers, Jeroen; Bezstarosti, Karel; Maas, Alex; Barroca, Vilma; Kockx, Christel; Ozgur, Zeliha; van Ijcken, Wilfred; Arcangeli, Marie-Laure; Andrieu-Soler, Charlotte; Lenhard, Boris; Grosveld, Frank; Soler, Eric

    2015-01-01

    How transcription factors (TFs) cooperate within large protein complexes to allow rapid modulation of gene expression during development is still largely unknown. Here we show that the key haematopoietic LIM-domain-binding protein-1 (LDB1) TF complex contains several activator and repressor components that together maintain an erythroid-specific gene expression programme primed for rapid activation until differentiation is induced. A combination of proteomics, functional genomics and in vivo studies presented here identifies known and novel co-repressors, most notably the ETO2 and IRF2BP2 proteins, involved in maintaining this primed state. The ETO2–IRF2BP2 axis, interacting with the NCOR1/SMRT co-repressor complex, suppresses the expression of the vast majority of archetypical erythroid genes and pathways until its decommissioning at the onset of terminal erythroid differentiation. Our experiments demonstrate that multimeric regulatory complexes feature a dynamic interplay between activating and repressing components that determines lineage-specific gene expression and cellular differentiation. PMID:26593974

  1. Control of developmentally primed erythroid genes by combinatorial co-repressor actions.

    PubMed

    Stadhouders, Ralph; Cico, Alba; Stephen, Tharshana; Thongjuea, Supat; Kolovos, Petros; Baymaz, H Irem; Yu, Xiao; Demmers, Jeroen; Bezstarosti, Karel; Maas, Alex; Barroca, Vilma; Kockx, Christel; Ozgur, Zeliha; van Ijcken, Wilfred; Arcangeli, Marie-Laure; Andrieu-Soler, Charlotte; Lenhard, Boris; Grosveld, Frank; Soler, Eric

    2015-01-01

    How transcription factors (TFs) cooperate within large protein complexes to allow rapid modulation of gene expression during development is still largely unknown. Here we show that the key haematopoietic LIM-domain-binding protein-1 (LDB1) TF complex contains several activator and repressor components that together maintain an erythroid-specific gene expression programme primed for rapid activation until differentiation is induced. A combination of proteomics, functional genomics and in vivo studies presented here identifies known and novel co-repressors, most notably the ETO2 and IRF2BP2 proteins, involved in maintaining this primed state. The ETO2-IRF2BP2 axis, interacting with the NCOR1/SMRT co-repressor complex, suppresses the expression of the vast majority of archetypical erythroid genes and pathways until its decommissioning at the onset of terminal erythroid differentiation. Our experiments demonstrate that multimeric regulatory complexes feature a dynamic interplay between activating and repressing components that determines lineage-specific gene expression and cellular differentiation. PMID:26593974

  2. FOG-1 and GATA-1 act sequentially to specify definitive megakaryocytic and erythroid progenitors.

    PubMed

    Mancini, Elena; Sanjuan-Pla, Alejandra; Luciani, Luisa; Moore, Susan; Grover, Amit; Zay, Agnes; Rasmussen, Kasper D; Luc, Sidinh; Bilbao, Daniel; O'Carroll, Donal; Jacobsen, Sten Eirik; Nerlov, Claus

    2012-01-18

    The transcription factors that control lineage specification of haematopoietic stem cells (HSCs) have been well described for the myeloid and lymphoid lineages, whereas transcriptional control of erythroid (E) and megakaryocytic (Mk) fate is less understood. We here use conditional removal of the GATA-1 and FOG-1 transcription factors to identify FOG-1 as required for the formation of all committed Mk- and E-lineage progenitors, whereas GATA-1 was observed to be specifically required for E-lineage commitment. FOG-1-deficient HSCs and preMegEs, the latter normally bipotent for the Mk and E lineages, underwent myeloid transcriptional reprogramming, and formed myeloid, but not erythroid and megakaryocytic cells in vitro. These results identify FOG-1 and GATA-1 as required for formation of bipotent Mk/E progenitors and their E-lineage commitment, respectively, and show that FOG-1 mediates transcriptional Mk/E programming of HSCs as well as their subsequent Mk/E-lineage commitment. Finally, C/EBPs and FOG-1 exhibited transcriptional cross-regulation in early myelo-erythroid progenitors making their functional antagonism a potential mechanism for separation of the myeloid and Mk/E lineages.

  3. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

    PubMed Central

    Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  4. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies.

    PubMed

    Amanatiadou, Elsa P; Papadopoulos, Giorgio L; Strouboulis, John; Vizirianakis, Ioannis S

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  5. Estrogen-induced apoptosis by inhibition of the erythroid transcription factor GATA-1.

    PubMed Central

    Blobel, G A; Orkin, S H

    1996-01-01

    Steroid hormones regulate diverse biological functions, including programmed cell death (apoptosis). Although steroid receptors have been studied extensively, relatively little is known regarding the cellular targets through which apoptosis is triggered. We show here that the ligand-activated estrogen receptor (ER) induces apoptosis in an erythroid cell line by binding to, and consequently inhibiting the activity of, GATA-1, an erythroid transcription factor essential for the survival and maturation of erythroid precursor cells. GATA-1 inhibition is reflected in the downregulation of presumptive GATA-1 target genes. Constitutive overexpression of a GATA-binding protein resistant to the effects of the ER partially rescues ER-induced apoptosis. Induction of apoptosis by a mutant ER defective in binding to the estrogen response element but active in GATA-1 inhibition suggests that ER-mediated inhibition of GATA-1 is direct and does not require estrogen response element-dependent transcriptional activation. Thus, a lineage-restricted transcription factor, such as GATA-1, constitutes one cellular target through which steroid hormones may control apoptosis. As GATA-binding proteins are evolutionarily conserved, we speculate that members of the steroid receptor family may exert some of their diverse biological functions in different cellular contexts through interference with the function of GATA-binding proteins. PMID:8657144

  6. Genetic regulatory networks programming hematopoietic stem cells and erythroid lineage specification.

    PubMed

    Swiers, Gemma; Patient, Roger; Loose, Matthew

    2006-06-15

    Erythroid cell production results from passage through cellular hierarchies dependent on differential gene expression under the control of transcription factors responsive to changing niches. We have constructed Genetic Regulatory Networks (GRNs) describing this process, based predominantly on mouse data. Regulatory network motifs identified in E. coli and yeast GRNs are found in combination in these GRNs. Feed-forward motifs with autoregulation generate forward momentum and also control its rate, which is at its lowest in hematopoietic stem cells (HSCs). The simultaneous requirement for multiple regulators in multi-input motifs (MIMs) provides tight control over expression of target genes. Combinations of MIMs, exemplified by the SCL/LMO2 complexes, which have variable content and binding sites, explain how individual regulators can have different targets in HSCs and erythroid cells and possibly also how HSCs maintain stem cell functions while expressing lineage-affiliated genes at low level, so-called multi-lineage priming. MIMs combined with cross-antagonism describe the relationship between PU.1 and GATA-1 and between two of their target genes, Fli-1 and EKLF, with victory for GATA-1 and EKLF leading to erythroid lineage specification. These GRNs are useful repositories for current regulatory information, are accessible in interactive form via the internet, enable the consequences of perturbation to be predicted, and can act as seed networks to organize the rapidly accumulating microarray data.

  7. Reduced DOCK4 expression leads to erythroid dysplasia in myelodysplastic syndromes

    PubMed Central

    Sundaravel, Sriram; Duggan, Ryan; Bhagat, Tushar; Ebenezer, David L.; Liu, Hui; Yu, Yiting; Bartenstein, Matthias; Unnikrishnan, Madhu; Karmakar, Subhradip; Liu, Ting-Chun; Torregroza, Ingrid; Quenon, Thomas; Anastasi, John; McGraw, Kathy L.; Pellagatti, Andrea; Boultwood, Jacqueline; Yajnik, Vijay; Artz, Andrew; Le Beau, Michelle M.; Steidl, Ulrich; List, Alan F.; Evans, Todd; Verma, Amit; Wickrema, Amittha

    2015-01-01

    Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator of cytokinesis 4 (DOCK4) is a GTPase exchange factor, and its gene maps to the commonly deleted 7q region. We demonstrate that DOCK4 is underexpressed in MDS bone marrow samples and that the reduced expression is associated with decreased overall survival in patients. We show that depletion of DOCK4 levels leads to erythroid cells with dysplastic morphology both in vivo and in vitro. We established a novel single-cell assay to quantify disrupted F-actin filament network in erythroblasts and demonstrate that reduced expression of DOCK4 leads to disruption of the actin filaments, resulting in erythroid dysplasia that phenocopies the red blood cell (RBC) defects seen in samples from MDS patients. Reexpression of DOCK4 in −7q MDS patient erythroblasts resulted in significant erythropoietic improvements. Mechanisms underlying F-actin disruption revealed that DOCK4 knockdown reduces ras-related C3 botulinum toxin substrate 1 (RAC1) GTPase activation, leading to increased phosphorylation of the actin-stabilizing protein ADDUCIN in MDS samples. These data identify DOCK4 as a putative 7q gene whose reduced expression can lead to erythroid dysplasia. PMID:26578796

  8. Biochemical measurements on single erythroid progenitor cells shed light on the combinatorial regulation of red blood cell production.

    PubMed

    Wang, Weijia; Akbarian, Vahe; Audet, Julie

    2013-02-01

    Adult bone marrow (BM) erythrocyte colony-forming units (CFU-Es) are important cellular targets for the treatment of anemia and also for the manufacture of red blood cells (RBCs) ex vivo. We obtained quantitative biochemical measurements from single and small numbers of CFU-Es by isolating and analyzing c-Kit(+)CD71(high)Ter119(-) cells from adult mouse BM and this allowed us to identify two mechanisms that can be manipulated to increase RBC production. As expected, maximum RBC output was obtained when CFU-Es were stimulated with a combination of Stem Cell Factor (SCF) and Erythropoietin (EPO) mainly because SCF supports a transient CFU-E expansion and EPO promotes the survival and terminal differentiation of erythroid progenitors. However, we found that one of the main factors limiting the output in RBCs was that EPO induces a downregulation of c-Kit expression which limits the transient expansion of CFU-Es. In the presence of SCF, the EPO-mediated downregulation of c-Kit on CFU-Es is delayed but still significant. Moreover, treatment of CFU-Es with 1-Naphthyl PP1 could partially inhibit the downregulation of c-Kit induced by EPO, suggesting that this process is dependent on a Src family kinase, v-Src and/or c-Fyn. We also found that CFU-E survival and proliferation was dependent on the level of time-integrated extracellular-regulated kinase (ERK) activation in these cells, all of which could be significantly increased when SCF and EPO were combined with mouse fetal liver-derived factors. Taken together, these results suggest two novel molecular strategies to increase RBC production and regeneration. PMID:23168618

  9. Viscosity of pure hydrocarbons

    SciTech Connect

    Knapstad, B.; Skjolsvik, P.A.; Oye, H.A.

    1989-01-01

    Accurate viscosity measurements have been performed on eight pure hydrocarbons at atmospheric pressure in the temperature range 20-150/sup 0/C, or up to approximately 20/sup 0/C below the boiling point of the hydrocarbon, by use of an absolute oscillating viscometer. The hydrocarbons are cyclohexane and benzene and the n-alkanes of hexane, heptane, octane, decane, dodecane, and tetradecane. The viscosities are described with a modified Arrhenius equation, and the deviation in fit is 0.12% or less. The accuracy is estimated to be 0.33-0.56%. The lowest viscosities are assumed to have the highest deviation. Literature data reported by Dymond and Young normally fit our viscosities within our estimated accuracy. Other literature viscosities tend to be higher than our results, especially for the n-alkanes.

  10. Helper virus is not required for in vitro erythroid transformation of hematopoietic cells by Friend virus.

    PubMed

    Hankins, W D; Krantz, S B

    1980-09-01

    The Friend polycythemia virus complex (FVP), consisting of the replication-defective spleen focus-forming virus (SFFV) and a helper Friend murine leukemia virus (MuLV-F), produces erythroleukemia within 2-3 weeks in vivo. We have recently reported in vitro transformation of bone marrow cells by FVP, producing clusters of erythroid colonies (erythroid bursts) 4-6 days after infection. In contrast to uninfected bone marrow cells, FVP-treated cells proliferated and differentiated (synthesized hemoglobin) in the absence of added erythropoietin, the physiologic regulator of erythropoiesis. The relative roles of helper murine leukemia virus (MuLV) and SFFV in the in vitro erythroid transformation have now been examined. Pseudotype studies and the finding that cloned MuLV-F (free of SFFV) did not induce burst formation indicated that SFFV was essential for this in vitro effect of FVP. Because SFFV could not be obtained free of helper MuLV, we assessed the requirement of MuLV in the transformation by kinetic analyses of helper-deficient and helper-excess FVP preparations. Whereas helper-excess FVP gave single-hit kinetics both in vivo and in vitro, the helper-deficient FVP followed multiple-hit kinetics when titrated for spleen focus formation in vivo. Addition of MuLV-F to helper-deficient FVP prior to injection resulted in a marked enhancement of spleen focus formation and a conversion from multiple-hit to single-hit kinetics. In contrast, titration of this same preparation for erythroid burst transformation in vitro yielded single-hit kinetics, and the addition of helper MuLV-F had no effect. The time course of burst development was similar with or without added MuLV-F. Unlike burst transformation, SFFV production by these infected cultures followed multiple-hit kinetics. Addition of MuLV-F at the time of infection led to an enhancement of SFFV production and conversion of the titration curve from multiple-hit to single-hit. These data are consistent with the idea that

  11. ZFP36L2 is required for self-renewal of early burst-forming unit erythroid progenitors.

    PubMed

    Zhang, Lingbo; Prak, Lina; Rayon-Estrada, Violeta; Thiru, Prathapan; Flygare, Johan; Lim, Bing; Lodish, Harvey F

    2013-07-01

    Stem cells and progenitors in many lineages undergo self-renewing divisions, but the extracellular and intracellular proteins that regulate this process are largely unknown. Glucocorticoids stimulate red blood cell formation by promoting self-renewal of early burst-forming unit-erythroid (BFU-E) progenitors. Here we show that the RNA-binding protein ZFP36L2 is a transcriptional target of the glucocorticoid receptor (GR) in BFU-Es and is required for BFU-E self-renewal. ZFP36L2 is normally downregulated during erythroid differentiation from the BFU-E stage, but its expression is maintained by all tested GR agonists that stimulate BFU-E self-renewal, and the GR binds to several potential enhancer regions of ZFP36L2. Knockdown of ZFP36L2 in cultured BFU-E cells did not affect the rate of cell division but disrupted glucocorticoid-induced BFU-E self-renewal, and knockdown of ZFP36L2 in transplanted erythroid progenitors prevented expansion of erythroid lineage progenitors normally seen following induction of anaemia by phenylhydrazine treatment. ZFP36L2 preferentially binds to messenger RNAs that are induced or maintained at high expression levels during terminal erythroid differentiation and negatively regulates their expression levels. ZFP36L2 therefore functions as part of a molecular switch promoting BFU-E self-renewal and a subsequent increase in the total numbers of colony-forming unit-erythroid (CFU-E) progenitors and erythroid cells that are generated.

  12. Role of PI3K, MAPK/ERK1/2, and p38 in implementation of the proliferative and differentiation potential of erythroid progenitors after blood loss.

    PubMed

    Dygai, A M; Zhdanov, V V; Miroshnichenko, L A; Udut, E V; Zyuz'kov, G N; Simanina, E V; Sherstoboev, E Yu; Chaikovskii, A V; Stavrova, L A; Burmina, Ya V; Khrichkova, T Yu; Reichart, D V; Goldberg, V E

    2015-02-01

    The involvement of PI3K, ERK and p38-dependent signaling system in the regulation of functional activity of erythroid precursors after blood loss (30% of circulating volume) was studied. We demonstrated the important role of PI3K and p38 in the suppression of differentiation of erythroid precursors the contribution of p38 to stimulation of mitotic activity of erythroid CFU, which maintains the growth potential of the precursors at the optimal physiological level. The classical MAPK/ERK-kinase pathway does not determine the proliferative and differentiation status of erythroid CFU. PMID:25711660

  13. Mathematical modeling reveals differential effects of erythropoietin on proliferation and lineage commitment of human hematopoietic progenitors in early erythroid culture

    PubMed Central

    Ward, Daniel; Carter, Deborah; Homer, Martin; Marucci, Lucia; Gampel, Alexandra

    2016-01-01

    Erythropoietin is essential for the production of mature erythroid cells, promoting both proliferation and survival. Whether erythropoietin and other cytokines can influence lineage commitment of hematopoietic stem and progenitor cells is of significant interest. To study lineage restriction of the common myeloid progenitor to the megakaryocyte/erythroid progenitor of peripheral blood CD34+ cells, we have shown that the cell surface protein CD36 identifies the earliest lineage restricted megakaryocyte/erythroid progenitor. Using this marker and carboxyfluorescein succinimidyl ester to track cell divisions in vitro, we have developed a mathematical model that accurately predicts population dynamics of erythroid culture. Parameters derived from the modeling of cultures without added erythropoietin indicate that the rate of lineage restriction is not affected by erythropoietin. By contrast, megakaryocyte/erythroid progenitor proliferation is sensitive to erythropoietin from the time that CD36 first appears at the cell surface. These results shed new light on the role of erythropoietin in erythropoiesis and provide a powerful tool for further study of hematopoietic progenitor lineage restriction and erythropoiesis. PMID:26589912

  14. Mutant N-RAS Induces Erythroid Lineage Dysplasia in Human CD34+ Cells

    PubMed Central

    Darley, Richard L.; Hoy, Terence G.; Baines, Paul; Padua, Rose Ann; Burnett, Alan K.

    1997-01-01

    RAS mutations arise at high frequency (20–40%) in both acute myeloid leukemia and myelodysplastic syndrome (which is considered to be a manifestation of preleukemic disease). In each case, mutations arise predominantly at the N-RAS locus. These observations suggest a fundamental role for this oncogene in leukemogenesis. However, despite its obvious significance, little is known of how this key oncogene may subvert the process of hematopoiesis in human cells. Using CD34+ progenitor cells, we have modeled the preleukemic state by infecting these cells with amphotropic retrovirus expressing mutant N-RAS together with the selectable marker gene lacZ. Expression of the lacZ gene product, β-galactosidase, allows direct identification and study of N-RAS–expressing cells by incubating infected cultures with a fluorogenic substrate for β-galactosidase, which gives rise to a fluorescent signal within the infected cells. By using multiparameter flow cytometry, we have studied the ability of CD34+ cells expressing mutant N-RAS to undergo erythroid differentiation induced by erythropoietin. By this means, we have found that erythroid progenitor cells expressing mutant N-RAS exhibit a proliferative defect resulting in an increased cell doubling time and a decrease in the proportion of cells in S + G2M phase of the cell cycle. This is linked to a slowing in the rate of differentiation as determined by comparative cell-surface marker analysis and ultimate failure of the differentiation program at the late-erythroblast stage of development. The dyserythropoiesis was also linked to an increased tendency of the RAS-expressing cells to undergo programmed cell death during their differentiation program. This erythroid lineage dysplasia recapitulates one of the most common features of myelodysplastic syndrome, and for the first time provides a causative link between mutational activation of N-RAS and the pathogenesis of preleukemia. PMID:9104820

  15. Altered Chromatin Occupancy of Master Regulators Underlies Evolutionary Divergence in the Transcriptional Landscape of Erythroid Differentiation

    PubMed Central

    Ulirsch, Jacob C.; Lacy, Jessica N.; An, Xiuli; Mohandas, Narla; Mikkelsen, Tarjei S.; Sankaran, Vijay G.

    2014-01-01

    Erythropoiesis is one of the best understood examples of cellular differentiation. Morphologically, erythroid differentiation proceeds in a nearly identical fashion between humans and mice, but recent evidence has shown that networks of gene expression governing this process are divergent between species. We undertook a systematic comparative analysis of six histone modifications and four transcriptional master regulators in primary proerythroblasts and erythroid cell lines to better understand the underlying basis of these transcriptional differences. Our analyses suggest that while chromatin structure across orthologous promoters is strongly conserved, subtle differences are associated with transcriptional divergence between species. Many transcription factor (TF) occupancy sites were poorly conserved across species (∼25% for GATA1, TAL1, and NFE2) but were more conserved between proerythroblasts and cell lines derived from the same species. We found that certain cis-regulatory modules co-occupied by GATA1, TAL1, and KLF1 are under strict evolutionary constraint and localize to genes necessary for erythroid cell identity. More generally, we show that conserved TF occupancy sites are indicative of active regulatory regions and strong gene expression that is sustained during maturation. Our results suggest that evolutionary turnover of TF binding sites associates with changes in the underlying chromatin structure, driving transcriptional divergence. We provide examples of how this framework can be applied to understand epigenomic variation in specific regulatory regions, such as the β-globin gene locus. Our findings have important implications for understanding epigenomic changes that mediate variation in cellular differentiation across species, while also providing a valuable resource for studies of hematopoiesis. PMID:25521328

  16. Externalization and binding of galectin-1 on cell surface of K562 cells upon erythroid differentiation.

    PubMed

    Lutomski, D; Fouillit, M; Bourin, P; Mellottée, D; Denize, N; Pontet, M; Bladier, D; Caron, M; Joubert-Caron, R

    1997-12-01

    Galectin 1 (GAL1) is a beta-galactoside-binding lectin involved in cell cycle progression. GAL1 overexpression is associated with neoplastic transformation and loss of differentiation. The gene encoding for human GAL1 resides on chromosome 22(q12; q13), and its expression is developmentally regulated. Although devoid of signal peptide GAL1 can be externalized from cells by a mechanism independent of the normal secretory process. We report here on a study of the effects of erythroid differentiation of the human leukemia cell line K562 on GAL1 protein expression. In undifferentiated K562 cells, GAL1 was expressed into the cytosol. However, the amount of GAL1 was surprisingly weaker in K562 cells than in other leukemia cell lines such as TF-1 or KG1a. Treatment of K562 cells with erythropoietin (EPO) or with aphidicolin (APH), an inhibitor for DNA polymerase alpha, induced an erythroid phenotype and led to the externalization of cytosolic GAL1 which was then bound to ligands on cell surface in a galactoside-inhibitable fashion. Our results demonstrate that acquisition of an erythroid phenotype is associated with an externalization of GAL1. The autocrine binding of GAL1 to cell surface ligands of non adherent cells such as K562 suggest that GAL1 is implicated rather in signal transduction than in cell-cell or cell-matrix interaction. Moreover, the reciprocal translocation involving chromosomes 9 and 22 t(9;22) present in K562 cells might explain the weak expression of GAL1 in K562 leukemia cells.

  17. PLACENTAL GROWTH FACTOR ATTENUATES SUPPRESSION OF ERYTHROID COLONY FORMATION BY INTERFERON

    PubMed Central

    Dallalio, Gail; Means, Robert T.

    2008-01-01

    Placental growth factor (PlGF) is a member of the vascular endothelial growth factor family and is associated with inflammation and with pathologic angiogenesis. PlGF is released from marrow erythroid cells and serum PlGF concentrations have been reported to distinguish sickle cell patients from healthy controls. We observed that CFU-E from homozygous sickle cell (SS) patients are less sensitive to inhibition by recombinant human (rh) γ interferon (IFN) than those from healthy controls, and the contribution of PlGF to this process was evaluated. At concentrations 10 – 1000 pg/mL, PlGF neither inhibits nor enhances CFU-E colony formation, and there were no differences between the responses of SS patients or healthy controls. rhPlGF 100 pg/mL reversed the inhibitory effects of rhγIFN on CFU-E colony formation. rhPlGF significantly attenuated rhγIFN induction of Fas ligandin an erythroid cell line (HCD57). Both HCD57 cells and CD36+ human marrow cells express Flt-1, a receptor for PlGF. Neutralizing antibody against Flt-1 partially attenuated the IFN-protective effect of rhPlGF, although this effect was not statistically significant. In conclusion, increased PlGF concentrations in the marrow of SS patients may protect erythroid progenitors from cytokine-induced inhibition of colony formation, and may be a mechanism by which erythropoiesis in sickle cell disease is preserved despite concurrent inflammation. PMID:19010294

  18. Pure seminoma: A review and update

    PubMed Central

    2011-01-01

    Pure seminoma is a rare pathology of the young adult, often discovered in the early stages. Its prognosis is generally excellent and many therapeutic options are available, especially in stage I tumors. High cure rates can be achieved in several ways: standard treatment with radiotherapy is challenged by surveillance and chemotherapy. Toxicity issues and the patients' preferences should be considered when management decisions are made. This paper describes firstly the management of primary seminoma and its nodal involvement and, secondly, the various therapeutic options according to stage. PMID:21819630

  19. Identification and purification of human erythroid progenitor cells by monoclonal antibody to the transferrin receptor (TU 67).

    PubMed

    Herrmann, F; Griffin, J D; Sabbath, K D; Oster, W; Wernet, P; Mertelsmann, R

    1988-04-01

    Anti-TU 67 is a murine monoclonal antibody that recognizes the transferrin receptor. With respect to hematopoietic cells TU 67 is expressed by human multipotent colony-forming cells (CFU-Mix), erythroid progenitor cells (BFU-E and CFU-E) and a fraction of granulocyte/monocyte colony forming cells, but is not expressed by mature hematopoietic cells including erythrocytes, platelets, lymphocytes, and peripheral blood myeloid cells. The TU 67-positive fraction of normal bone marrow, separated by fluorescence-activated cell sorting (FACS) or immune rosettes, contained 87% of the erythroid progenitor cells. Erythroid progenitor cells were enriched up to 50-fold by using a combination of monoclonal antibodies to deplete mature hematopoietic cells, followed by positive selection of BFU-E and CFU-E by TU 67 antibody.

  20. Olive leaf components apigenin 7-glucoside and luteolin 7-glucoside direct human hematopoietic stem cell differentiation towards erythroid lineage.

    PubMed

    Samet, Imen; Villareal, Myra O; Motojima, Hideko; Han, Junkyu; Sayadi, Sami; Isoda, Hiroko

    2015-06-01

    The generation of blood cellular components from hematopoietic stem cells is important for the therapy of a broad spectrum of hematological disorders. In recent years, several lines of evidence suggested that certain nutrients, vitamins and flavonoids may have important roles in controlling the stem cell fate decision by maintaining their self-renewal or stimulating the lineage-specific differentiation. In this study, main olive leaf phytochemicals oleuropein (Olp), apigenin 7-glucoside (Api7G) and luteolin 7-glucoside (Lut7G) were investigated for their potential effects on hematopoietic stem cell differentiation using both phenotypic and molecular analysis. Oleuropein and the combination of the three compounds enhanced the differentiation of CD34+ cells into myelomonocytic cells and lymphocytes progenitors and inhibited the commitment to megakaryocytic and erythroid lineages. Treatment with Lut7G stimulated both the erythroid and the myeloid differentiation, while treatment with Api7G specifically induced the differentiation of CD34+ cells towards the erythroid lineage and inhibited the myeloid differentiation. Erythroid differentiation induced by Api7G and Lut7G treatments was confirmed by the increase in hemoglobin genes expressions (α-hemoglobin, β-hemoglobin and γ-hemoglobin) and erythroid transcription factor GATA1 expression. As revealed by microarray analysis, the mechanisms underlying the erythroid differentiation-inducing effect of Api7G on hematopoietic stem cells involves the activation of JAK/STAT signaling pathway. These findings prove the differentiation-inducing effects of olive leaf compounds on hematopoietic stem cells and highlight their potential use in the ex vivo generation of blood cells.

  1. Olive leaf components apigenin 7-glucoside and luteolin 7-glucoside direct human hematopoietic stem cell differentiation towards erythroid lineage.

    PubMed

    Samet, Imen; Villareal, Myra O; Motojima, Hideko; Han, Junkyu; Sayadi, Sami; Isoda, Hiroko

    2015-06-01

    The generation of blood cellular components from hematopoietic stem cells is important for the therapy of a broad spectrum of hematological disorders. In recent years, several lines of evidence suggested that certain nutrients, vitamins and flavonoids may have important roles in controlling the stem cell fate decision by maintaining their self-renewal or stimulating the lineage-specific differentiation. In this study, main olive leaf phytochemicals oleuropein (Olp), apigenin 7-glucoside (Api7G) and luteolin 7-glucoside (Lut7G) were investigated for their potential effects on hematopoietic stem cell differentiation using both phenotypic and molecular analysis. Oleuropein and the combination of the three compounds enhanced the differentiation of CD34+ cells into myelomonocytic cells and lymphocytes progenitors and inhibited the commitment to megakaryocytic and erythroid lineages. Treatment with Lut7G stimulated both the erythroid and the myeloid differentiation, while treatment with Api7G specifically induced the differentiation of CD34+ cells towards the erythroid lineage and inhibited the myeloid differentiation. Erythroid differentiation induced by Api7G and Lut7G treatments was confirmed by the increase in hemoglobin genes expressions (α-hemoglobin, β-hemoglobin and γ-hemoglobin) and erythroid transcription factor GATA1 expression. As revealed by microarray analysis, the mechanisms underlying the erythroid differentiation-inducing effect of Api7G on hematopoietic stem cells involves the activation of JAK/STAT signaling pathway. These findings prove the differentiation-inducing effects of olive leaf compounds on hematopoietic stem cells and highlight their potential use in the ex vivo generation of blood cells. PMID:26299581

  2. Murine tribbles homolog 2 deficiency affects erythroid progenitor development and confers macrocytic anemia on mice.

    PubMed

    Lin, Kou-Ray; Yang-Yen, Hsin-Fang; Lien, Huang-Wei; Liao, Wei-Hao; Huang, Chang-Jen; Lin, Liang-In; Li, Chung-Leung; Yen, Jeffrey Jong-Young

    2016-01-01

    Tribbles homolog 2 (Trib2) is a member of Tribbles protein pseudokinases and involves in apoptosis, autoimmunity, cancer, leukemia and erythropoiesis, however, the physiological function of Trib2 in hematopoietic system remains to be elucidated. Here, we report that Trib2 knockout (KO) mice manifest macrocytic anemia and increase of T lymphocytes. Although Trib2 deficient RBCs have similar half-life as the control RBCs, Trib2 KO mice are highly vulnerable to oxidant-induced hemolysis. Endogenous Trib2 mRNA is expressed in early hematopoietic progenitors, erythroid precursors, and lymphoid lineages, but not in mature RBCs, myeloid progenitors and granulocytes. Consistently, flow cytometric analysis and in vitro colony forming assay revealed that deletion of Trib2 mainly affected erythroid lineage development, and had no effect on either granulocyte or megakaryocyte lineages in bone marrow. Furthermore, a genetic approach using double knockout of Trib2 and C/ebpα genes in mice suggested that Trib2 promotes erythropoiesis independent of C/ebpα proteins in vivo. Finally, ectopic expression of human Trib2 in zebrafish embryos resulted in increased expression of erythropoiesis-related genes and of hemoglobin. Taking all data together, our results suggest that Trib2 positively promotes early erythrocyte differentiation and is essential for tolerance to hemolysis. PMID:27550848

  3. The genome-wide dynamics of the binding of Ldb1 complexes during erythroid differentiation.

    PubMed

    Soler, Eric; Andrieu-Soler, Charlotte; de Boer, Ernie; Bryne, Jan Christian; Thongjuea, Supat; Stadhouders, Ralph; Palstra, Robert-Jan; Stevens, Mary; Kockx, Christel; van Ijcken, Wilfred; Hou, Jun; Steinhoff, Christine; Rijkers, Erikjan; Lenhard, Boris; Grosveld, Frank

    2010-02-01

    One of the complexes formed by the hematopoietic transcription factor Gata1 is a complex with the Ldb1 (LIM domain-binding protein 1) and Tal1 proteins. It is known to be important for the development and differentiation of the erythroid cell lineage and is thought to be implicated in long-range interactions. Here, the dynamics of the composition of the complex-in particular, the binding of the negative regulators Eto2 and Mtgr1-are studied, in the context of their genome-wide targets. This shows that the complex acts almost exclusively as an activator, binding a very specific combination of sequences, with a positioning relative to transcription start site, depending on the type of the core promoter. The activation is accompanied by a net decrease in the relative binding of Eto2 and Mtgr1. A Chromosome Conformation Capture sequencing (3C-seq) assay also shows that the binding of the Ldb1 complex marks genomic interaction sites in vivo. This establishes the Ldb1 complex as a positive regulator of the final steps of erythroid differentiation that acts through the shedding of negative regulators and the active interaction between regulatory sequences. PMID:20123907

  4. Transcription of the hypersensitive site HS2 enhancer in erythroid cells.

    PubMed Central

    Tuan, D; Kong, S; Hu, K

    1992-01-01

    In the human genome, the erythroid-specific hypersensitive site HS2 enhancer regulates the transcription of the downstream beta-like globin genes 10-50 kilobases away. The mechanism of HS2 enhancer function is not known. The present study employs RNA protection assays to analyze the transcriptional status of the HS2 enhancer in transfected recombinant chloramphenicol acetyltransferase (CAT) plasmids. In erythroid K562 cells in which the HS2 enhancer is active, the HS2 sequence directs the synthesis of long enhancer transcripts that are initiated apparently from within the enhancer and elongated through the intervening DNA into the cis-linked CAT gene. In nonerythroid HL-60 cells in which the HS2 enhancer is inactive, long enhancer transcripts are not detectable. Splitting the HS2 enhancer between two tandem Ap1 sites abolishes the synthesis of a group of long enhancer transcripts and results in loss of enhancer function and transcriptional silencing of the cis-linked CAT gene. In directing the synthesis of RNA through the intervening DNA and the gene by a tracking and transcription mechanism, the HS2 enhancer may (i) open up the chromatin structure of a gene domain and (ii) deliver enhancer binding proteins to the promoter sequence where they may stimulate the transcription of the gene at the cap site. Images PMID:1454801

  5. Protein 4.1R–deficient mice are viable but have erythroid membrane skeleton abnormalities

    PubMed Central

    Shi, Zheng-Tao; Afzal, Veena; Coller, Barry; Patel, Dipti; Chasis, Joel A.; Parra, Marilyn; Lee, Gloria; Paszty, Chris; Stevens, Mary; Walensky, Loren; Peters, Luanne L.; Mohandas, Narla; Rubin, Edward; Conboy, John G.

    1999-01-01

    A diverse family of protein 4.1R isoforms is encoded by a complex gene on human chromosome 1. Although the prototypical 80-kDa 4.1R in mature erythrocytes is a key component of the erythroid membrane skeleton that regulates erythrocyte morphology and mechanical stability, little is known about 4.1R function in nucleated cells. Using gene knockout technology, we have generated mice with complete deficiency of all 4.1R protein isoforms. These 4.1R-null mice were viable, with moderate hemolytic anemia but no gross abnormalities. Erythrocytes from these mice exhibited abnormal morphology, lowered membrane stability, and reduced expression of other skeletal proteins including spectrin and ankyrin, suggesting that loss of 4.1R compromises membrane skeleton assembly in erythroid progenitors. Platelet morphology and function were essentially normal, indicating that 4.1R deficiency may have less impact on other hematopoietic lineages. Nonerythroid 4.1R expression patterns, viewed using histochemical staining for lacZ reporter activity incorporated into the targeted gene, revealed focal expression in specific neurons in the brain and in select cells of other major organs, challenging the view that 4.1R expression is widespread among nonerythroid cells. The 4.1R knockout mice represent a valuable animal model for exploring 4.1R function in nonerythroid cells and for determining pathophysiological sequelae to 4.1R deficiency. PMID:9927493

  6. During EPO or anemia challenge, erythroid progenitor cells transit through a selectively expandable proerythroblast pool.

    PubMed

    Dev, Arvind; Fang, Jing; Sathyanarayana, Pradeep; Pradeep, Anamika; Emerson, Christine; Wojchowski, Don M

    2010-12-01

    Investigations of bone marrow (BM) erythroblast development are important for clinical concerns but are hindered by progenitor cell and tissue availability. We therefore sought to more specifically define dynamics, and key regulators, of the formation of developing BM erythroid cell cohorts. A unique Kit(-)CD71(high)Ter119(-) "stage E2" proerythroblast pool first is described, which (unlike its Kit(+) "stage E1" progenitors, or maturing Ter119(+) "stage E3" progeny) proved to selectively expand ∼ 7-fold on erythropoietin challenge. During short-term BM transplantation, stage E2 proerythroblasts additionally proved to be a predominantly expanded progenitor pool within spleen. This E1→E2→E3 erythroid series reproducibly formed ex vivo, enabling further characterizations. Expansion, in part, involved E1 cell hyperproliferation together with rapid E2 conversion plus E2 stage restricted BCL2 expression. Possible erythropoietin/erythropoietin receptor proerythroblast stage specific events were further investigated in mice expressing minimal erythropoietin receptor alleles. For a hypomorphic erythropoietin receptor-HM allele, major defects in erythroblast development occurred selectively at stage E2. In addition, stage E2 cells proved to interact productively with primary BM stromal cells in ways that enhanced both survival and late-stage development. Overall, findings reveal a novel transitional proerythroblast compartment that deploys unique expansion devices.

  7. Murine tribbles homolog 2 deficiency affects erythroid progenitor development and confers macrocytic anemia on mice

    PubMed Central

    Lin, Kou-Ray; Yang-Yen, Hsin-Fang; Lien, Huang-Wei; Liao, Wei-Hao; Huang, Chang-Jen; Lin, Liang-In; Li, Chung-Leung; Yen, Jeffrey Jong-Young

    2016-01-01

    Tribbles homolog 2 (Trib2) is a member of Tribbles protein pseudokinases and involves in apoptosis, autoimmunity, cancer, leukemia and erythropoiesis, however, the physiological function of Trib2 in hematopoietic system remains to be elucidated. Here, we report that Trib2 knockout (KO) mice manifest macrocytic anemia and increase of T lymphocytes. Although Trib2 deficient RBCs have similar half-life as the control RBCs, Trib2 KO mice are highly vulnerable to oxidant-induced hemolysis. Endogenous Trib2 mRNA is expressed in early hematopoietic progenitors, erythroid precursors, and lymphoid lineages, but not in mature RBCs, myeloid progenitors and granulocytes. Consistently, flow cytometric analysis and in vitro colony forming assay revealed that deletion of Trib2 mainly affected erythroid lineage development, and had no effect on either granulocyte or megakaryocyte lineages in bone marrow. Furthermore, a genetic approach using double knockout of Trib2 and C/ebpα genes in mice suggested that Trib2 promotes erythropoiesis independent of C/ebpα proteins in vivo. Finally, ectopic expression of human Trib2 in zebrafish embryos resulted in increased expression of erythropoiesis-related genes and of hemoglobin. Taking all data together, our results suggest that Trib2 positively promotes early erythrocyte differentiation and is essential for tolerance to hemolysis. PMID:27550848

  8. Transcription of the hypersensitive site HS2 enhancer in erythroid cells

    SciTech Connect

    Tuan, D.; Suming Kong; Hu, K. )

    1992-12-01

    In the human genome, the erythroid-specific hypersensitive site HS2 enhancer regulates the transcription of the downstream [beta]-like globin genes 10-50 kilobases away. The mechanism of HS2 enhancer function is not known. The present study employs RNA protection assays to analyze the transcriptional status of the HS2 enhancer in transfected recombinant chloramphenicol acetyltransferase (CAT) plasmids. In erythroid K562 cells in which the HS2 enhancer is active, the HS2 sequence directs the synthesis of long enhancer transcripts that are initiated apparently from within the enhancer and elongated through the intervening DNA into the cis-linked CAT gene. In nonerythroid HL-60 cells in which the HS2 enhancer is inactive, long enhancer transcripts are not detectable. Splitting the HS2 enhancer between two tandem Ap1 sites abolishes the synthesis of a group of long enhancer transcripts and results in loss of enhancer function and transcriptional silencing of the cis-linked CAT gene. In directing the synthesis of RNA through the intervening DNA and the gene by a tracking and transcription mechanism, the HS2 enhancer may (i) open up the chromatin structure of a gene domain and (ii) deliver enhancer binding proteins to the promoter sequence where they may stimulate the transcription of the gene at the cap site. 42 refs., 4 figs., 1 tab.

  9. Structural and functional characterization of an atypical activation domain in erythroid Kruppel-like factor (EKLF).

    PubMed

    Mas, Caroline; Lussier-Price, Mathieu; Soni, Shefali; Morse, Thomas; Arseneault, Geneviève; Di Lello, Paola; Lafrance-Vanasse, Julien; Bieker, James J; Omichinski, James G

    2011-06-28

    Erythroid Krüppel-like factor (EKLF) plays an important role in erythroid development by stimulating β-globin gene expression. We have examined the details by which the minimal transactivation domain (TAD) of EKLF (EKLFTAD) interacts with several transcriptional regulatory factors. We report that EKLFTAD displays homology to the p53TAD and, like the p53TAD, can be divided into two functional subdomains (EKLFTAD1 and EKLFTAD2). Based on sequence analysis, we found that EKLFTAD2 is conserved in KLF2, KLF4, KLF5, and KLF15. In addition, we demonstrate that EKLFTAD2 binds the amino-terminal PH domain of the Tfb1/p62 subunit of TFIIH (Tfb1PH/p62PH) and four domains of CREB-binding protein/p300. The solution structure of the EKLFTAD2/Tfb1PH complex indicates that EKLFTAD2 binds Tfb1PH in an extended conformation, which is in contrast to the α-helical conformation seen for p53TAD2 in complex with Tfb1PH. These studies provide detailed mechanistic information into EKLFTAD functions as well as insights into potential interactions of the TADs of other KLF proteins. In addition, they suggest that not only have acidic TADs evolved so that they bind using different conformations on a common target, but that transitioning from a disordered to a more ordered state is not a requirement for their ability to bind multiple partners. PMID:21670263

  10. Interleukin 3 promotes erythroid burst formation in serum-free cultures without detectable erythropoietin

    SciTech Connect

    Goodman, J.W.; Hall, E.A.; Miller, K.L.; Shinpock, S.G.

    1985-05-01

    Erythroid burst-forming units (BFU-E) from mouse bone marrow were grown for 7 days in agar or serum-free methylcellulose cultures in the presence or absence of erythropoietin (Ep) and/or interleukin 3 (IL-3). It was found that IL-3, even in the absence of serum and detectable Ep, was able to stimulate the full development of many erythroid bursts. This IL-3 effect was cell-dose dependent and did not appear to correlate with Ep dose. Spontaneous bursts and those stimulated by Ep only were rare and when seen were very small relative to those produced by IL-3 or IL-3 plus Ep. When addition of IL-3 or Ep to 7-day cultures was delayed, IL-3 but not Ep was shown to maintain BFU-E. No evidence was found by radioimmunoassay that Ep was produced or released in 7-day, serum-free cultures of bone marrow nor was Ep activity detected in culture media except those to which it had been added deliberately.

  11. VLA-5-mediated Adhesion to Fibronectin Accelerates Hemin-stimulated Erythroid Differentiation of K562 Cells through Induction of VLA-4 Expression*

    PubMed Central

    Tanaka, Rika; Owaki, Toshiyuki; Kamiya, Sadahiro; Matsunaga, Takuya; Shimoda, Kazuya; Kodama, Hiroaki; Hayashi, Ryo; Abe, Takashi; Harada, Yosei P.; Shimonaka, Motoyuki; Yajima, Hirofumi; Terada, Hiroshi; Fukai, Fumio

    2009-01-01

    Fibronectin plays important roles in erythropoiesis through the fibronectin receptors VLA-4 and VLA-5. However, the substantial role of these fibronectin receptors and their functional assignment in erythroid differentiation are not yet fully understood. Here, we investigated the effects of cell adhesion to fibronectin on erythroid differentiation using K562 human erythroid progenitor cells. Erythroid differentiation could be induced in K562 cells in suspension by stimulating with hemin. This hemin-stimulated erythroid differentiation was highly accelerated when cells were induced to adhere to fibronectin by treatment with TNIIIA2, a peptide derived from tenascin-C, which has recently been found to induce β1-integrin activation. Another integrin activator, Mn2+, also accelerated hemin-stimulated erythroid differentiation. Adhesive interaction with fibronectin via VLA-4 as well as VLA-5 was responsible for acceleration of the hemin-stimulated erythroid differentiation in response to TNIIIA2, although K562 cells should have been lacking in VLA-4. Adhesion to fibronectin forced by TNIIIA2 causally induced VLA-4 expression in K562 cells, and this was blocked by the RGD peptide, an antagonist for VLA-5. The resulting adhesive interaction with fibronectin via VLA-4 strongly enhanced the hemin-stimulated activation of p38 mitogen-activated protein kinase, which was shown to serve as a signaling molecule crucial for erythroid differentiation. Suppression of VLA-4 expression by RNA interference abrogated acceleration of hemin-stimulated erythroid differentiation in response to TNIIIA2. Thus, VLA-4 and VLA-5 may contribute to erythropoiesis at different stages of erythroid differentiation. PMID:19460753

  12. Rps14 haploinsufficiency causes a block in erythroid differentiation mediated by S100A8/S100A9

    PubMed Central

    Schneider, Rebekka K.; Schenone, Monica; Ferreira, Monica Ventura; Kramann, Rafael; Joyce, Cailin E.; Hartigan, Christina; Beier, Fabian; Brümmendorf, Tim H.; Gehrming, Ulrich; Platzbecker, Uwe; Büsche, Guntram; Knüchel, Ruth; Chen, Michelle C.; Waters, Christopher S.; Chen, Edwin; Chu, Lisa P.; Novina, Carl D.; Lindsley, R. Coleman; Carr, Steven A.; Ebert, Benjamin L.

    2016-01-01

    Heterozygous deletion of RPS14 occurs in del(5q) MDS and has been linked to impaired erythropoiesis, characteristic of this disease subtype. We generated a murine model with conditional inactivation of Rps14 and demonstrated a p53-dependent erythroid differentiation defect with apoptosis at the transition from polychromatic to orthochromatic erythroblasts resulting in age-dependent progressive anemia, megakaryocyte dysplasia, and loss of hematopoietic stem cell (HSC) quiescence. Using quantitative proteomics, we identified significantly increased expression of proteins involved in innate immune signaling, particularly the heterodimeric S100a8/S100a9 proteins in purified erythroblasts. S100a8 expression was significantly increased in erythroblasts, monocytes and macrophages and recombinant S100a8 was sufficient to induce an erythroid differentiation defect in wild-type cells. We rescued the erythroid differentiation defect in Rps14 haploinsufficient HSCs by genetic inactivation of S100a8 expression. Our data link Rps14 haploinsufficiency to activation of the innate immune system via induction of S100A8/A9 and the p53-dependant erythroid differentiation defect in del(5q) MDS. PMID:26878232

  13. Spi-1/PU.1 participates in erythroleukemogenesis by inhibiting apoptosis in cooperation with Epo signaling and by blocking erythroid differentiation.

    PubMed

    Rimmelé, Pauline; Kosmider, Olivier; Mayeux, Patrick; Moreau-Gachelin, Françoise; Guillouf, Christel

    2007-04-01

    Overexpression of the transcription factor Spi-1/PU.1 in mice leads to acute erythroleukemia characterized by a differentiation block at the proerythroblastic stage. In this study, we made use of a new cellular system allowing us to reach graded expression of Spi-1 in preleukemic cells to dissect mechanisms of Spi-1/ PU-1 in erythroleukemogenesis. This system is based on conditional production of 1 or 2 spi-1-interfering RNAs stably inserted into spi-1 transgenic proerythroblasts. We show that Spi-1 knock-down was sufficient to reinstate the erythroid differentiation program. This differentiation process was associated with an exit from the cell cycle. Evidence is provided that in the presence of erythropoietin (Epo), Spi-1 displays an antiapoptotic role that is independent of its function in blocking erythroid differentiation. Apoptosis inhibited by Spi-1 did not involve activation of the Fas/FasL signaling pathway nor a failure to activate Epo receptor (EpoR). Furthermore, we found that reducing the Spi-1 level yields to ERK dephosphorylation and increased phosphorylation of AKT and STAT5, suggesting that Spi-1 may affect major signaling pathways downstream of the EpoR in erythroid cells. These findings reveal 2 distinct roles for Spi-1 during erythroleukemogenesis: Spi-1 blocks the erythroid differentiation program and acts to impair apoptotic death in cooperation with an Epo signaling.

  14. Erythroid cell growth and differentiation in vitro in the simulated microgravity environment of the NASA rotating wall vessel bioreactor

    NASA Technical Reports Server (NTRS)

    Sytkowski, A. J.; Davis, K. L.

    2001-01-01

    Prolonged exposure of humans and experimental animals to the altered gravitational conditions of space flight has adverse effects on the lymphoid and erythroid hematopoietic systems. Although some information is available regarding the cellular and molecular changes in lymphocytes exposed to microgravity, little is known about the erythroid cellular changes that may underlie the reduction in erythropoiesis and resultant anemia. We now report a reduction in erythroid growth and a profound inhibition of erythropoietin (Epo)-induced differentiation in a ground-based simulated microgravity model system. Rauscher murine erythroleukemia cells were grown either in tissue culture vessels at 1 x g or in the simulated microgravity environment of the NASA-designed rotating wall vessel (RWV) bioreactor. Logarithmic growth was observed under both conditions; however, the doubling time in simulated microgravity was only one-half of that seen at 1 x g. No difference in apoptosis was detected. Induction with Epo at the initiation of the culture resulted in differentiation of approximately 25% of the cells at 1 x g, consistent with our previous observations. In contrast, induction with Epo at the initiation of simulated microgravity resulted in only one-half of this degree of differentiation. Significantly, the growth of cells in simulated microgravity for 24 h prior to Epo induction inhibited the differentiation almost completely. The results suggest that the NASA RWV bioreactor may serve as a suitable ground-based microgravity simulator to model the cellular and molecular changes in erythroid cells observed in true microgravity.

  15. Control of erythroid cell production via caspase-mediated cleavage of transcription factor SCL/Tal-1.

    PubMed

    Zeuner, A; Eramo, A; Testa, U; Felli, N; Pelosi, E; Mariani, G; Srinivasula, S M; Alnemri, E S; Condorelli, G; Peschle, C; De Maria, R

    2003-08-01

    SCL/Tal-1 is a helix-loop-helix (HLH) transcription factor required for blood cell development, whose abnormal expression is responsible for induction of T-cell acute lymphoblastic leukemia. We show here that SCL/Tal-1 is a key target of caspases in developing erythroblasts. SCL/Tal-1 degradation occurred rapidly after caspase activation and preceded the cleavage of the major erythroid transcription factor GATA-1. Expression of a caspase-resistant SCL/Tal-1 in erythroid progenitors was able to prevent amplification of caspase activation, GATA-1 degradation and impaired erythropoiesis induced by growth factor deprivation or death receptor triggering. The potent proerythropoietic activity of uncleavable SCL/Tal-1 was clearly evident in the absence of erythropoietin, a condition that did not allow survival of normal erythroid cells or expansion of erythroblasts expressing caspase-resistant GATA-1. In the absence of erythropoietin, cells expressing caspase-resistant SCL/Tal-1 maintain high levels of Bcl-X(L), which inhibits amplification of the caspase cascade and mediates protection from apoptosis. Thus, SCL/TAL-1 is a survival factor for erythroid cells, whereas caspase-mediated cleavage of SCL/Tal-1 results in amplification of caspase activation, GATA-1 degradation and impaired erythropoiesis.

  16. Erythroid-specific expression of beta-globin by the sleeping beauty transposon for Sickle cell disease.

    PubMed

    Zhu, Jianhui; Kren, Betsy T; Park, Chang Won; Bilgim, Rasim; Wong, Phillip Y-P; Steer, Clifford J

    2007-06-12

    Sickle cell disease (SCD) results predominately from a single monogenic mutation that affects thousands of individuals worldwide. Gene therapy approaches have focused on using viral vectors to transfer wild-type beta- or gamma-globin transgenes into hematopoietic stem cells for long-term expression of the recombinant globins. In this study, we investigated the use of a novel nonviral vector system, the Sleeping Beauty (SB) transposon (Tn) to insert a wild-type beta-globin expression cassette into the human genome for sustained expression of beta-globin. We initially constructed a beta-globin expression vector composed of the hybrid cytomegalovirus (CMV) enhancer chicken beta-actin promoter (CAGGS) and full-length beta-globin cDNA, as well as truncated forms lacking either the 3' or 3' and 5' untranslated regions (UTRs), to optimize expression of beta-globin. Beta-globin with its 5' UTR was efficiently expressed from its cDNA in K-562 cells induced with hemin. However, expression was constitutive and not erythroid-specific. We then constructed cis SB-Tn-beta-globin plasmids using a minimal beta-globin gene driven by hybrid promoter IHK (human ALAS2 intron 8 erythroid-specific enhancer, HS40 core element from human alphaLCR, ankyrin-1 promoter), IHbetap (human ALAS2 intron 8 erythroid-specific enhancer, HS40 core element from human alphaLCR, beta-globin promoter), or HS3betap (HS3 core element from human betaLCR, beta-globin promoter) to establish erythroid-specific expression of beta-globin. Stable genomic insertion of the minimal gene and expression of the beta-globin transgene for >5 months at a level comparable to that of the endogenous gamma-globin gene were achieved using a SB-Tn beta-globin cis construct. Interestingly, erythroid-specific expression of beta-globin driven by IHK was regulated primarily at the translational level, in contrast to post-transcriptional regulation in non-erythroid cells. The SB-Tn system is a promising nonviral vector for efficient

  17. Thymoma complicated by acquired amegakaryocytic thrombocytopenia and pure red cell aplasia.

    PubMed

    Gay, Carl M; William, William N; Wang, Sa A; Oo, Thein Hlaing

    2014-11-01

    Although the association of pure red cell aplasia (PRCA) and aplastic anemia with thymoma is well-known, acquired amegakaryocytic thrombocytopenia (AAMT) is not a recognized paraneoplastic manifestation of thymoma. This report discusses a patient with recurrent thymoma complicated by myasthenia gravis, PRCA, and AAMT. Both PRCA and AAMT are diagnosed after a thymoma recurrence, 11 years after complete resection of the initial tumor and 9 months after chemotherapy for the relapsed disease. Both PRCA and AAMT responded to immunosuppression with cyclosporine, corticosteroid, and an abbreviated course of antithymocyte globulin, achieving a very good erythroid response and a complete remission for AAMT, suggesting that AAMT, although extremely rare, can be an immune-mediated paraneoplastic manifestation of thymoma.

  18. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells

    PubMed Central

    Steiner, Laurie A.; Schulz, Vincent; Makismova, Yelena; Lezon-Geyda, Kimberly; Gallagher, Patrick G.

    2016-01-01

    Background CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC) and primary human erythroid cells from single donors. Results Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner. Conclusion These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis. PMID:27219007

  19. The effect of high intensity microwave exposure on enucleation of murine erythroid cells in vitro.

    PubMed

    Sciandra, J J; Repasky, E; Subjeck, J R; Johnson, R J

    1982-03-01

    We have examined the effects of microwave vs sham exposure on the enucleation phase of murine erythroid cells in vitro. While enucleation occurs rapidly in vivo, it occurs somewhat slower in vitro and can be quantitated in terms of rate. Exposure to 915 MHz electromagnetic radiation is found to significantly reduce the rate of enucleation (P less than 0.001). Exposure is carried out in a TE10 mode energized water-filled temperature-controlled waveguide. It is hypothesized that the effects of the exposure are on cytoplasmic or plasma membrane-associated structures since the nucleus at this stage of maturation is completely condensed and inactive. This assay is of direct interest in itself as well as providing a tool for the investigation of biological response to microwave exposure.

  20. Iron overload impairs proliferation of erythroid progenitors cells (BFU-E) from patients with myelodysplastic syndromes.

    PubMed

    Hartmann, Julia; Braulke, Friederike; Sinzig, Ursula; Wulf, Gerald; Maas, Jens Holger; Konietschke, Frank; Haase, Detlef

    2013-03-01

    In patients with myelodysplastic syndromes (MDS) iron overload caused by long-term red blood cell transfusions is an important factor for comorbidity especially in low-risk MDS. In this report we present the results of a comparative study based on colony formation assays of hematopoietic cells in MDS patients with and without iron overload. We demonstrate that iron overload suppresses the proliferation of erythroid progenitors cells (BFU-E), while the myeloid compartment (CFU-GM) was not found to be affected. Even patients with slightly elevated ferritin values show an impaired proliferation capacity in comparison to patients with normal ferritin levels. Furthermore, we show that this negative impact is reversible by sufficient iron chelation therapy.

  1. Critical role of the matricellular protein SPARC in mediating erythroid progenitor cell development in zebrafish.

    PubMed

    Ceinos, Rosa M; Torres-Nuñez, Eva; Chamorro, Ruben; Novoa, Beatriz; Figueras, Antonio; Ruane, Neil M; Rotllant, Josep

    2013-01-01

    Sparc (osteonectin) is a multifunctional matricellular glycoprotein expressed by many differentiated cells. Members of this family mediate cell-matrix interactions rather than acting as structural components of the extracellular matrix (ECM); therefore, they can influence many remodelling events, including haematopoiesis. We have investigated the role of sparc in embryonic haematopoiesis using a morpholino antisense oligonucleotide-based knockdown approach. Knockdown of sparc function resulted in specific erythroid progenitor cell differentiation defects that were highlighted by changes in gene expression and morphology, which could be rescued by injection of sparc mRNA. Furthermore, a comparison of blood phenotypes of sparc and fgfs knockdowns with similar defects and the sparc rescue of the fgf21 blood phenotype places sparc downstream of fgf21 in the genetic network regulating haematopoiesis in zebrafish. These results establish a role for an ECM protein (Sparc) as an important regulator of embryonic haematopoiesis during early development in zebrafish.

  2. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )

    1993-10-01

    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  3. Multiple physical stresses induce γ-globin gene expression and fetal hemoglobin production in erythroid cells.

    PubMed

    Schaeffer, Emily K; West, Rachel J; Conine, Sarah J; Lowrey, Christopher H

    2014-04-01

    Increased fetal hemoglobin (HbF) expression is beneficial for β-hemoglobinopathy patients; however, current inducing agents do not possess the ideal combination of efficacy, safety and ease of use. Better understanding the mechanisms involved in γ-globin gene induction is critical for designing improved therapies, as no complete mechanism for any inducing agent has been identified. Given the cytotoxic nature of most known inducing drugs, we hypothesized that γ-globin is a cell stress response gene, and that induction occurs via activation of cell stress signaling pathways. We tested this hypothesis by investigating the ability of physical stresses including heat-shock (HS), UV- and X-irradiation and osmotic shock to increase γ-globin gene expression in erythroid cells. Experiments in K562 and KU812 cells showed that each of these stresses increased steady-state γ-globin mRNA levels, but only after 3-5days of treatments. HS and UV also increased γ-globin mRNA and HbF levels in differentiating primary human erythroid cells. Mechanistic studies showed that HS affects γ-globin mRNA at multiple levels, including nascent transcription and transcript stability, and that induction is dependent on neither the master regulator of the canonical HS response, HSF1, nor p38 MAPK. Inhibitor panel testing identified PI3K inhibitor LY294002 as a novel inducing agent and revealed potential roles for NFκB and VEGFR/PDGFR/Raf kinases in HS-mediated γ-globin gene induction. These findings suggest that cell stress signaling pathways play an important role in γ-globin gene induction and may provide novel targets for the pharmacologic induction of fetal hemoglobin.

  4. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    PubMed Central

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  5. Recombinant erythroid Kruppel-like factor fused to GATA1 up-regulates delta- and gamma-globin expression in erythroid cells.

    PubMed

    Zhu, Jianqiong; Chin, Kyung; Aerbajinai, Wulin; Trainor, Cecelia; Gao, Peter; Rodgers, Griffin P

    2011-03-17

    The β-hemoglobinopathies sickle cell disease and β-thalassemia are among the most common human genetic disorders worldwide. Hemoglobin A2 (HbA2, α₂δ₂) and fetal hemoglobin (HbF, α₂γ₂) both inhibit the polymerization of hemoglobin S, which results in erythrocyte sickling. Expression of erythroid Kruppel-like factor (EKLF) and GATA1 is critical for transitioning hemoglobin from HbF to hemoglobin A (HbA, α₂β₂) and HbA2. The lower levels of δ-globin expression compared with β-globin expression seen in adulthood are likely due to the absence of an EKLF-binding motif in the δ-globin proximal promoter. In an effort to up-regulate δ-globin to increase HbA2 expression, we created a series of EKLF-GATA1 fusion constructs composed of the transactivation domain of EKLF and the DNA-binding domain of GATA1, and then tested their effects on hemoglobin expression. EKLF-GATA1 fusion proteins activated δ-, γ-, and β-globin promoters in K562 cells, and significantly up-regulated δ- and γ-globin RNA transcript and protein expression in K562 and/or CD34(+) cells. The binding of EKLF-GATA1 fusion proteins at the GATA1 consensus site in the δ-globin promoter was confirmed by chromatin immunoprecipitation assay. Our studies demonstrate that EKLF-GATA1 fusion proteins can enhance δ-globin expression through interaction with the δ-globin promoter, and may represent a new genetic therapeutic approach to β-hemoglobinopathies.

  6. "Pure" cutaneous histiocytosis-X.

    PubMed

    Wolfson, S L; Botero, F; Hurwitz, S; Pearson, H A

    1981-11-15

    The case histories of two young children who experienced skin rashes involving various areas of the body are reported. The diagnosis of pure cutaneous histiocytosis-X was established after extensive studies revealed no other organ involvement. The patients were treated with oral corticosteroids. Currently, both children are in good health, show no evidence of disease, and have been followed over a four-to-five-year period. Therapy with corticosteroids may not be indicated with pure cutaneous histiocytosis-X unless there is evidence of extracutaneous dissemination or rapid progression of the disease.

  7. Production of substantially pure fructose

    DOEpatents

    Hatcher, Herbert J.; Gallian, John J.; Leeper, Stephen A.

    1990-01-01

    A process is disclosed for the production of substantially pure fructose from sucrose-containing substrates. The process comprises converting the sucrose to levan and glucose, purifying the levan by membrane technology, hydrolyzing the levan to form fructose monomers, and recovering the fructose.

  8. Increase of microRNA-210, Decrease of Raptor Gene Expression and Alteration of Mammalian Target of Rapamycin Regulated Proteins following Mithramycin Treatment of Human Erythroid Cells

    PubMed Central

    Bianchi, Nicoletta; Finotti, Alessia; Ferracin, Manuela; Lampronti, Ilaria; Zuccato, Cristina; Breveglieri, Giulia; Brognara, Eleonora; Fabbri, Enrica; Borgatti, Monica; Negrini, Massimo; Gambari, Roberto

    2015-01-01

    Expression and regulation of microRNAs is an emerging issue in erythroid differentiation and globin gene expression in hemoglobin disorders. In the first part of this study microarray analysis was performed both in mithramycin-induced K562 cells and erythroid precursors from healthy subjects or β-thalassemia patients producing low or high levels of fetal hemoglobin. We demonstrated that: (a) microRNA-210 expression is higher in erythroid precursors from β-thalassemia patients with high production of fetal hemoglobin; (b) microRNA-210 increases as a consequence of mithramycin treatment of K562 cells and human erythroid progenitors both from healthy and β-thalassemia subjects; (c) this increase is associated with erythroid induction and elevated expression of γ-globin genes; (d) an anti-microRNA against microRNA-210 interferes with the mithramycin-induced changes of gene expression. In the second part of the study we have obtained convergent evidences suggesting raptor mRNA as a putative target of microRNA-210. Indeed, microRNA-210 binding sites of its 3’-UTR region were involved in expression and are targets of microRNA-210-mediated modulation in a luciferase reporter assays. Furthermore, (i) raptor mRNA and protein are down-regulated upon mithramycin-induction both in K562 cells and erythroid progenitors from healthy and β-thalassemia subjects. In addition, (ii) administration of anti-microRNA-210 to K562 cells decreased endogenous microRNA-210 and increased raptor mRNA and protein expression. Finally, (iii) treatment of K562 cells with premicroRNA-210 led to a decrease of raptor mRNA and protein. In conclusion, microRNA-210 and raptor are involved in mithramycin-mediated erythroid differentiation of K562 cells and participate to the fine-tuning and control of γ-globin gene expression in erythroid precursor cells. PMID:25849663

  9. The DEK Oncoprotein Is a Critical Component of the EKLF/KLF1 Enhancer in Erythroid Cells

    PubMed Central

    Lohmann, Felix; Dangeti, Mohan; Soni, Shefali; Chen, Xiaoyong; Planutis, Antanas; Baron, Margaret H.; Choi, Kyunghee

    2015-01-01

    Understanding how transcriptional regulators are themselves controlled is important in attaining a complete picture of the intracellular effects that follow signaling cascades during early development and cell-restricted differentiation. We have addressed this issue by focusing on the regulation of EKLF/KLF1, a zinc finger transcription factor that plays a necessary role in the global regulation of erythroid gene expression. Using biochemical affinity purification, we have identified the DEK oncoprotein as a critical factor that interacts with an essential upstream enhancer element of the EKLF promoter and exerts a positive effect on EKLF levels. This element also binds a core set of erythroid transcription factors, suggesting that DEK is part of a tissue-restricted enhanceosome that contains BMP4-dependent and -independent components. Together with local enrichment of properly coded histones and an open chromatin domain, optimal transcriptional activation of the EKLF locus can be established. PMID:26303528

  10. Gaucher Disease-Induced Pluripotent Stem Cells Display Decreased Erythroid Potential and Aberrant Myelopoiesis

    PubMed Central

    Sgambato, Judi A.; Park, Tea Soon; Miller, Diana; Panicker, Leelamma M.; Sidransky, Ellen; Lun, Yu; Awad, Ola; Bentzen, Søren M.; Zambidis, Elias T.

    2015-01-01

    Gaucher disease (GD) is the most common lysosomal storage disease resulting from mutations in the lysosomal enzyme glucocerebrosidase (GCase). The hematopoietic abnormalities in GD include the presence of characteristic Gaucher macrophages that infiltrate patient tissues and cytopenias. At present, it is not clear whether these cytopenias are secondary to the pathological activity of Gaucher cells or a direct effect of GCase deficiency on hematopoietic development. To address this question, we differentiated induced pluripotent stem cells (iPSCs) derived from patients with types 1, 2, and 3 GD to CD34+/CD45+/CD43+/CD143+ hematopoietic progenitor cells (HPCs) and examined their developmental potential. The formation of GD-HPCs was unaffected. However, these progenitors demonstrated a skewed lineage commitment, with increased myeloid differentiation and decreased erythroid differentiation and maturation. Interestingly, myeloid colony-formation assays revealed that GD-HPCs, but not control-HPCs, gave rise to adherent, macrophage-like cells, another indication of abnormal myelopoiesis. The extent of these hematologic abnormalities correlated with the severity of the GCase mutations. All the phenotypic abnormalities of GD-HPCs observed were reversed by incubation with recombinant GCase, indicating that these developmental defects were caused by the mutated GCase. Our results show that GCase deficiency directly impairs hematopoietic development. Additionally, our results suggest that aberrant myelopoiesis might contribute to the pathological properties of Gaucher macrophages, which are central to GD manifestations. The hematopoietic developmental defects we observed reflect hematologic abnormalities in patients with GD, demonstrating the utility of GD-iPSCs for modeling this disease. Significance This study showed that hematopoietic progenitors from patients with Gaucher disease (GD) have intrinsic developmental abnormalities that reflect characteristic clinical

  11. Function of caspases in regulating apoptosis caused by erythropoietin deprivation in erythroid progenitors.

    PubMed

    Gregoli, P A; Bondurant, M C

    1999-02-01

    Erythropoietin (EP) is required by late stage erythroid progenitor cells to prevent apoptosis. In a previous study (Gregoli and Bondurant, 1997, Blood 90:630-640), it was shown that rapid proteolytic conversion of procaspase 3 to the fully activated enzyme occurred when erythroblasts were deprived of EP for as little as 2 h. In the present study, protein and mRNA analyses of erythroblasts indicated the presence of the proenzyme precursors of caspases 1, 2, 3, 5, 6, 7, 8, and 9. The effects of various caspase inhibitors on caspase 3 processing and on apoptosis were examined. These inhibitors were benzyloxycarbonyl (z-) and fluoromethyl-ketone (FMK) derivatives of peptides that serve as substrates for selected caspases. z-VAD-FMK, t-butoxycarbonyl-aspartate-FMK (Boc-D-FMK), and z-IETD-FMK blocked the initial cleavage of procaspase 3, while z-DEVD-FMK, z-VEID-FMK, and z-VDVAD-FMK did not block the initial cleavage but had some effect on blocking apoptosis. The peptide inhibitor z-FA-FMK, which inhibits cathepsins B and L but is not known to inhibit caspases, altered caspase 3 processing to a final 19 kDa large subunit that appeared to retain enzymatic activity. The action of z-FA-FMK in preventing the usual conversion to a 1 7 kDa subunit suggests the possibility that a noncaspase protease may be involved in caspase 3 processing. Studies with the peptide inhibitors and EP were done to determine the short- and long-term effectiveness of the caspase inhibitors in protecting EP-deprived cells from apoptosis. Although several of the inhibitors were effective, z-IETD-FMK was studied most extensively because of its specificity for enzymes which cleave procaspase 3 at aspartate 175 (IETD175). Large percentages of EP-deprived erythroblasts treated with z-IETD-FMK appeared morphologically normal and negative by a DNA strand breakage (TUNEL) assay at 24 h (75%) compared to EP-deprived controls (10%) which were not treated with inhibitor. However, inhibitor-treated erythroid

  12. Canonical Thermal Pure Quantum State

    NASA Astrophysics Data System (ADS)

    Sugiura, Sho; Shimizu, Akira

    2013-07-01

    A thermal equilibrium state of a quantum many-body system can be represented by a typical pure state, which we call a thermal pure quantum (TPQ) state. We construct the canonical TPQ state, which corresponds to the canonical ensemble of the conventional statistical mechanics. It is related to the microcanonical TPQ state, which corresponds to the microcanonical ensemble, by simple analytic transformations. Both TPQ states give identical thermodynamic results, if both ensembles do, in the thermodynamic limit. The TPQ states corresponding to other ensembles can also be constructed. We have thus established the TPQ formulation of statistical mechanics, according to which all quantities of statistical-mechanical interest are obtained from a single realization of any TPQ state. We also show that it has great advantages in practical applications. As an illustration, we study the spin-1/2 kagome Heisenberg antiferromagnet.

  13. The heme exporter Flvcr1 regulates expansion and differentiation of committed erythroid progenitors by controlling intracellular heme accumulation.

    PubMed

    Mercurio, Sonia; Petrillo, Sara; Chiabrando, Deborah; Bassi, Zuni Irma; Gays, Dafne; Camporeale, Annalisa; Vacaru, Andrei; Miniscalco, Barbara; Valperga, Giulio; Silengo, Lorenzo; Altruda, Fiorella; Baron, Margaret H; Santoro, Massimo Mattia; Tolosano, Emanuela

    2015-06-01

    Feline leukemia virus subgroup C receptor 1 (Flvcr1) encodes two heme exporters: FLVCR1a, which localizes to the plasma membrane, and FLVCR1b, which localizes to mitochondria. Here, we investigated the role of the two Flvcr1 isoforms during erythropoiesis. We showed that, in mice and zebrafish, Flvcr1a is required for the expansion of committed erythroid progenitors but cannot drive their terminal differentiation, while Flvcr1b contributes to the expansion phase and is required for differentiation. FLVCR1a-down-regulated K562 cells have defective proliferation, enhanced differentiation, and heme loading in the cytosol, while FLVCR1a/1b-deficient K562 cells show impairment in both proliferation and differentiation, and accumulate heme in mitochondria. These data support a model in which the coordinated expression of Flvcr1a and Flvcr1b contributes to control the size of the cytosolic heme pool required to sustain metabolic activity during the expansion of erythroid progenitors and to allow hemoglobinization during their terminal maturation. Consistently, reduction or increase of the cytosolic heme rescued the erythroid defects in zebrafish deficient in Flvcr1a or Flvcr1b, respectively. Thus, heme export represents a tightly regulated process that controls erythropoiesis.

  14. Inactivation of Rb and E2f8 Synergizes To Trigger Stressed DNA Replication during Erythroid Terminal Differentiation

    PubMed Central

    Ghazaryan, Seda; Sy, Chandler; Hu, Tinghui; An, Xiuli; Mohandas, Narla; Fu, Haiqing; Aladjem, Mirit I.; Chang, Victor T.; Opavsky, Rene

    2014-01-01

    Rb is critical for promoting cell cycle exit in cells undergoing terminal differentiation. Here we show that during erythroid terminal differentiation, Rb plays a previously unappreciated and unorthodox role in promoting DNA replication and cell cycle progression. Specifically, inactivation of Rb in erythroid cells led to stressed DNA replication, increased DNA damage, and impaired cell cycle progression, culminating in defective terminal differentiation and anemia. Importantly, all of these defects associated with Rb loss were exacerbated by the concomitant inactivation of E2f8. Gene expression profiling and chromatin immunoprecipitation (ChIP) revealed that Rb and E2F8 cosuppressed a large array of E2F target genes that are critical for DNA replication and cell cycle progression. Remarkably, inactivation of E2f2 rescued the erythropoietic defects resulting from Rb and E2f8 deficiencies. Interestingly, real-time quantitative PCR (qPCR) on E2F2 ChIPs indicated that inactivation of Rb and E2f8 synergizes to increase E2F2 binding to its target gene promoters. Taken together, we propose that Rb and E2F8 collaborate to promote DNA replication and erythroid terminal differentiation by preventing E2F2-mediated aberrant transcriptional activation through the ability of Rb to bind and sequester E2F2 and the ability of E2F8 to compete with E2F2 for E2f-binding sites on target gene promoters. PMID:24865965

  15. Glucocorticoids improve erythroid progenitor maintenance and dampen Trp53 response in a mouse model of Diamond-Blackfan anaemia.

    PubMed

    Sjögren, Sara E; Siva, Kavitha; Soneji, Shamit; George, Amee J; Winkler, Marcus; Jaako, Pekka; Wlodarski, Marcin; Karlsson, Stefan; Hannan, Ross D; Flygare, Johan

    2015-11-01

    Diamond-Blackfan anaemia (DBA) is a rare congenital disease causing severe anaemia and progressive bone marrow failure. The majority of patients carry mutations in ribosomal proteins, which leads to depletion of erythroid progenitors in the bone marrow. As many as 40% of all DBA patients receive glucocorticoids to alleviate their anaemia. However, despite their use in DBA treatment for more than half a century, the therapeutic mechanisms of glucocorticoids remain largely unknown. Therefore we sought to study disease specific effects of glucocorticoid treatment using a ribosomal protein s19 (Rps19) deficient mouse model of DBA. This study determines for the first time that a mouse model of DBA can respond to glucocorticoid treatment, similar to DBA patients. Our results demonstrate that glucocorticoid treatment reduces apoptosis, rescues erythroid progenitor depletion and premature differentiation of erythroid cells. Furthermore, glucocorticoids prevent Trp53 activation in Rps19-deficient cells- in a disease-specific manner. Dissecting the therapeutic mechanisms behind glucocorticoid treatment of DBA provides indispensible insight into DBA pathogenesis. Identifying mechanisms important for DBA treatment also enables development of more disease-specific treatments of DBA. PMID:26305041

  16. Glucocorticoids improve erythroid progenitor maintenance and dampen Trp53 response in a mouse model of Diamond-Blackfan anaemia.

    PubMed

    Sjögren, Sara E; Siva, Kavitha; Soneji, Shamit; George, Amee J; Winkler, Marcus; Jaako, Pekka; Wlodarski, Marcin; Karlsson, Stefan; Hannan, Ross D; Flygare, Johan

    2015-11-01

    Diamond-Blackfan anaemia (DBA) is a rare congenital disease causing severe anaemia and progressive bone marrow failure. The majority of patients carry mutations in ribosomal proteins, which leads to depletion of erythroid progenitors in the bone marrow. As many as 40% of all DBA patients receive glucocorticoids to alleviate their anaemia. However, despite their use in DBA treatment for more than half a century, the therapeutic mechanisms of glucocorticoids remain largely unknown. Therefore we sought to study disease specific effects of glucocorticoid treatment using a ribosomal protein s19 (Rps19) deficient mouse model of DBA. This study determines for the first time that a mouse model of DBA can respond to glucocorticoid treatment, similar to DBA patients. Our results demonstrate that glucocorticoid treatment reduces apoptosis, rescues erythroid progenitor depletion and premature differentiation of erythroid cells. Furthermore, glucocorticoids prevent Trp53 activation in Rps19-deficient cells- in a disease-specific manner. Dissecting the therapeutic mechanisms behind glucocorticoid treatment of DBA provides indispensible insight into DBA pathogenesis. Identifying mechanisms important for DBA treatment also enables development of more disease-specific treatments of DBA.

  17. The glucocorticoid receptor is a key regulator of the decision between self-renewal and differentiation in erythroid progenitors.

    PubMed Central

    Wessely, O; Deiner, E M; Beug, H; von Lindern, M

    1997-01-01

    During development and in regenerating tissues such as the bone marrow, progenitor cells constantly need to make decisions between proliferation and differentiation. We have used a model system, normal erythroid progenitors of the chicken, to determine the molecular players involved in making this decision. The molecules identified comprised receptor tyrosine kinases (c-Kit and c-ErbB) and members of the nuclear hormone receptor superfamily (thyroid hormone receptor and estrogen receptor). Here we identify the glucocorticoid receptor (GR) as a key regulator of erythroid progenitor self-renewal (i.e. continuous proliferation in the absence of differentiation). In media lacking a GR ligand or containing a GR antagonist, erythroid progenitors failed to self-renew, even if c-Kit, c-ErbB and the estrogen receptor were activated simultaneously. To induce self-renewal, the GR required the continuous presence of an activated receptor tyrosine kinase and had to cooperate with the estrogen receptor for full activity. Mutant analysis showed that DNA binding and a functional AF-2 transactivation domain are required for proliferation stimulation and differentiation arrest. c-myb was identified as a potential target gene of the GR in erythroblasts. It could be demonstrated that delta c-Myb, an activated c-Myb protein, can functionally replace the GR. PMID:9029148

  18. Chelation efficacy and erythroid response during deferasirox treatment in patients with myeloproliferative neoplasms in fibrotic phase.

    PubMed

    Latagliata, Roberto; Montagna, Chiara; Porrini, Raffaele; Di Veroli, Ambra; Leonetti, Sabrina Crescenzi; Niscola, Pasquale; Ciccone, Fabrizio; Spadea, Antonio; Breccia, Massimo; Maurillo, Luca; Rago, Angela; Spirito, Francesca; Cedrone, Michele; De Muro, Marianna; Montanaro, Marco; Andriani, Alessandro; Bagnato, Antonino; Montefusco, Enrico; Alimena, Giuliana

    2016-06-01

    At present, very few data are available on deferasirox (DFX) in the treatment of patients with Philadelphia-negative myeloproliferative neoplasms in fibrotic phase (FP-MPN) and transfusion dependence. To address this issue, a retrospective analysis of 28 patients (22 male and 6 female) with FP-MPN and iron overload secondary to transfusion dependence was performed, based on patients enrolled in the database of our regional cooperative group who received treatment with DFX. DFX was started after a median interval from diagnosis of 12.8 months (IR 7.1-43.1) with median ferritin values of 1415 ng/mL (IR 1168-1768). Extra-hematological toxicity was reported in 16 of 28 patients (57.1%), but only two patients discontinued treatment due to toxicity. Among 26 patients evaluable for response (≥6 months of treatment), after a median treatment period of 15.4 months (IR 8.1-22.3), 11 patients (42.3%) achieved a stable and consistent reduction in ferritin levels <1000 ng/mL. As for hematological improvement, 6 of 26 patients (23%) showed a persistent (>3 months) rise of Hb levels >1.5 g/dL, with disappearance of transfusion dependence in four cases. Treatment with DFX is feasible and effective in FP-MPN with iron overload. Moreover, in this setting, an erythroid response can occur in a significant proportion of patients.

  19. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival

    PubMed Central

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I.; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E.; Natarajan, Viswanathan; Jacobson, Jeffrey R.; Zhang, Donna D.; Garcia, Joe G. N.; Wang, Ting

    2015-01-01

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer. PMID:26596768

  20. Erythropoietin, a novel versatile player regulating energy metabolism beyond the erythroid system.

    PubMed

    Wang, Li; Di, Lijun; Noguchi, Constance Tom

    2014-01-01

    Erythropoietin (EPO), the required cytokine for promoting the proliferation and differentiation of erythroid cells to stimulate erythropoiesis, has been reported to act as a pleiotropic cytokine beyond hematopoietic system. The various activities of EPO are determined by the widespread distribution of its cell surface EPO receptor (EpoR) in multiple tissues including endothelial, neural, myoblasts, adipocytes and other cell types. EPO activity has been linked to angiogenesis, neuroprotection, cardioprotection, stress protection, anti-inflammation and especially the energy metabolism regulation that is recently revealed. The investigations of EPO activity in animals and the expression analysis of EpoR provide more insights on the potential of EPO in regulating energy metabolism and homeostasis. The findings of crosstalk between EPO and some important energy sensors and the regulation of EPO in the cellular respiration and mitochondrial function further provide molecular mechanisms for EPO activity in metabolic activity regulation. In this review, we will summarize the roles of EPO in energy metabolism regulation and the activity of EPO in tissues that are tightly associated with energy metabolism. We will also discuss the effects of EPO in regulating oxidative metabolism and mitochondrial function, the interactions between EPO and important energy regulation factors, and the protective role of EPO from stresses that are related to metabolism, providing a brief overview of previously less appreciated EPO biological function in energy metabolism and homeostasis. PMID:25170305

  1. Nuclear factor erythroid 2-related factor gene variants and susceptibility of arsenic-related skin lesions.

    PubMed

    Cordova, E J; Valenzuela, O L; Sánchez-Peña, L C; Escamilla-Guerrero, G; Hernández-Zavala, A; Orozco, L; Del Razo, L M

    2014-06-01

    Inorganic arsenic (iAs) is an important pollutant associated with various chronic-degenerative diseases. The cytoprotective protein nuclear factor erythroid 2-related factor (NRF2) has been proposed as an important responsive mechanism against iAs exposure. The aim of this study was to determine whether the risk of skin lesions in people exposed to iAs-contaminated water could be modified by the presence of single nucleotide polymorphisms in the NRF2 coding gene. We studied 117 individuals with long-term iAs exposure and 120 nonexposed individuals. Total As was determined in water, meanwhile iAs and its metabolites were measured in urine. The iAs-induced skin lesion status was evaluated by expert dermatologists. We sequenced the promoter region of NRF2 in a sample of 120 healthy donors. We found four polymorphisms previously reported and one novel polymorphism in the 5' regulatory region of the NRF2. In this study, we did not find allelic and genotype association of NRF2 polymorphisms with iAs-related skin lesion. However, the analysis of haplotypes composed by -653GA, and -617CA NRF2 single nucleotide polymorphisms showed a significant association with protection against skin lesions in the low-As exposure group. This is the first report studying the association between NRF2 polymorphisms and susceptibility of As-related skin lesions. Increasing the sample size will allow us to confirm this data. PMID:24107458

  2. Chelation efficacy and erythroid response during deferasirox treatment in patients with myeloproliferative neoplasms in fibrotic phase.

    PubMed

    Latagliata, Roberto; Montagna, Chiara; Porrini, Raffaele; Di Veroli, Ambra; Leonetti, Sabrina Crescenzi; Niscola, Pasquale; Ciccone, Fabrizio; Spadea, Antonio; Breccia, Massimo; Maurillo, Luca; Rago, Angela; Spirito, Francesca; Cedrone, Michele; De Muro, Marianna; Montanaro, Marco; Andriani, Alessandro; Bagnato, Antonino; Montefusco, Enrico; Alimena, Giuliana

    2016-06-01

    At present, very few data are available on deferasirox (DFX) in the treatment of patients with Philadelphia-negative myeloproliferative neoplasms in fibrotic phase (FP-MPN) and transfusion dependence. To address this issue, a retrospective analysis of 28 patients (22 male and 6 female) with FP-MPN and iron overload secondary to transfusion dependence was performed, based on patients enrolled in the database of our regional cooperative group who received treatment with DFX. DFX was started after a median interval from diagnosis of 12.8 months (IR 7.1-43.1) with median ferritin values of 1415 ng/mL (IR 1168-1768). Extra-hematological toxicity was reported in 16 of 28 patients (57.1%), but only two patients discontinued treatment due to toxicity. Among 26 patients evaluable for response (≥6 months of treatment), after a median treatment period of 15.4 months (IR 8.1-22.3), 11 patients (42.3%) achieved a stable and consistent reduction in ferritin levels <1000 ng/mL. As for hematological improvement, 6 of 26 patients (23%) showed a persistent (>3 months) rise of Hb levels >1.5 g/dL, with disappearance of transfusion dependence in four cases. Treatment with DFX is feasible and effective in FP-MPN with iron overload. Moreover, in this setting, an erythroid response can occur in a significant proportion of patients. PMID:26277477

  3. Iron as the Key Modulator of Hepcidin Expression in Erythroid Antibody-Mediated Hypoplasia

    PubMed Central

    Fernandes, J. C.; Garrido, P.; Ribeiro, S.; Rocha-Pereira, P.; Bronze-da-Rocha, E.; Belo, L.; Costa, E.; Reis, F.; Santos-Silva, A.

    2014-01-01

    Erythroid hypoplasia (EH) is a rare complication associated with recombinant human erythropoietin (rHuEPO) therapies, due to development of anti-rHuEPO antibodies; however, the underlying mechanisms remain poorly clarified. Our aim was to manage a rat model of antibody-mediated EH induced by rHuEPO and study the impact on iron metabolism and erythropoiesis. Wistar rats treated during 9 weeks with a high rHuEPO dose (200 IU) developed EH, as shown by anemia, reduced erythroblasts, reticulocytopenia, and plasmatic anti-rHuEPO antibodies. Serum iron was increased and associated with mRNA overexpression of hepatic hepcidin and other iron regulatory mediators and downregulation of matriptase-2; overexpression of divalent metal transporter 1 and ferroportin was observed in duodenum and liver. Decreased EPO expression was observed in kidney and liver, while EPO receptor was overexpressed in liver. Endogenous EPO levels were normal, suggesting that anti-rHuEPO antibodies blunted EPO function. Our results suggest that anti-rHuEPO antibodies inhibit erythropoiesis causing anemia. This leads to a serum iron increase, which seems to stimulate hepcidin expression despite no evidence of inflammation, thus suggesting iron as the key modulator of hepcidin synthesis. These findings might contribute to improving new therapeutic strategies against rHuEPO resistance and/or development of antibody-mediated EH in patients under rHuEPO therapy. PMID:25580431

  4. Acute megakaryoblastic leukemia, unlike acute erythroid leukemia, predicts an unfavorable outcome after allogeneic HSCT.

    PubMed

    Ishiyama, Ken; Yamaguchi, Takuhiro; Eto, Tetsuya; Ohashi, Kazuteru; Uchida, Naoyuki; Kanamori, Heiwa; Fukuda, Takahiro; Miyamura, Koichi; Inoue, Yoshiko; Taguchi, Jun; Mori, Takehiko; Iwato, Koji; Morishima, Yasuo; Nagamura-Inoue, Tokiko; Atsuta, Yoshiko; Sakamaki, Hisashi; Takami, Akiyoshi

    2016-08-01

    Acute erythroid leukemia (FAB-M6) and acute megakaryoblastic leukemia (FAB-M7) exhibit closely related properties in cells regarding morphology and the gene expression profile. Although allogeneic hematopoietic stem cell transplantation (allo-HSCT) is considered the mainstay of the treatment for both subtypes of leukemia due to their refractoriness to chemotherapy and high rates of relapse, it remains unclear whether allo-HSCT is curative in such cases due to their scarcity. We retrospectively examined the impact of allo-HSCT in 382 patients with M6 and 108 patients with M7 using nationwide HSCT data and found the overall survival (OS) and relapse rates of the M6 patients to be significantly better than those of the M7 patients after adjusting for confounding factors and statistically comparable with those of the patients with M0/M1/M2/M4/M5 disease. Consequently, the factors of age, gender, performance status, karyotype, disease status at HSCT and development of graft-vs.-host disease predicted the OS for the M6 patients, while the performance status and disease status at HSCT were predictive of the OS for the M7 patients. These findings substantiate the importance of distinguishing between M6 and M7 in the HSCT setting and suggest that unknown mechanisms influence the HSCT outcomes of these closely related subtypes of leukemia. PMID:27244257

  5. Nuclear factor erythroid 2-related factor gene variants and susceptibility of arsenic-related skin lesions.

    PubMed

    Cordova, E J; Valenzuela, O L; Sánchez-Peña, L C; Escamilla-Guerrero, G; Hernández-Zavala, A; Orozco, L; Del Razo, L M

    2014-06-01

    Inorganic arsenic (iAs) is an important pollutant associated with various chronic-degenerative diseases. The cytoprotective protein nuclear factor erythroid 2-related factor (NRF2) has been proposed as an important responsive mechanism against iAs exposure. The aim of this study was to determine whether the risk of skin lesions in people exposed to iAs-contaminated water could be modified by the presence of single nucleotide polymorphisms in the NRF2 coding gene. We studied 117 individuals with long-term iAs exposure and 120 nonexposed individuals. Total As was determined in water, meanwhile iAs and its metabolites were measured in urine. The iAs-induced skin lesion status was evaluated by expert dermatologists. We sequenced the promoter region of NRF2 in a sample of 120 healthy donors. We found four polymorphisms previously reported and one novel polymorphism in the 5' regulatory region of the NRF2. In this study, we did not find allelic and genotype association of NRF2 polymorphisms with iAs-related skin lesion. However, the analysis of haplotypes composed by -653GA, and -617CA NRF2 single nucleotide polymorphisms showed a significant association with protection against skin lesions in the low-As exposure group. This is the first report studying the association between NRF2 polymorphisms and susceptibility of As-related skin lesions. Increasing the sample size will allow us to confirm this data.

  6. FOXP1 Expression in Normal and Neoplastic Erythroid and Myeloid Cells.

    PubMed

    Lovrić, Eva; Pavlov, Katarina Horvat; Korać, Petra; Dominis, Mara

    2015-09-01

    FOXP1 protein was firstly analyzed in normal tissues, and afterwards in different tumor tissues, mainly carcinoma and lymphoma. In B-cell malignancies, its role was well explored; its expression was shown to be connected with disease prognosis in certain B-non Hodgkin lymphomas. In this study, 16 bone marrow trephine samples from patients with no hematopoietic malignancies and 10 samples from peripheral blood of healthy individuals were immunostained with anti-FOXP1 antibody. Positive cells in bone marrows were not only lymphocytes, but also cells that are immunohistochemically positive for glycophorin C or myeloperoxidase. Peripheral blood samples showed no other positive cells, but small round lymphocytes. Additionally 60 samples from patients with myeloid lineage neoplasms were analyzed. 25 samples from patients with myelodysplastic syndrome (MDS) and 35 patients with myeloproliferative disease (MPD) were double immunostained with anti-FOXP1/anti-glycophorin C and anti-FOXP1/anti-myeloperoxidase antibodies. FOXP1 was found to be expressed in 22 cases of MDS and in none of MPD cases. Its expression in MDS was observed mostly in myeloperoxidase positive cells in contrast to gylcophorin C positive cells. Only two cases revealed both myeloperoxidase positive cells and gylcophorin C positive cells expressing FOXP1 transcription factor. Our results show that FOXP1 is present in normal cells of erythroid and myeloid linages and thus suggest its possible role in development of all hematopoetic cells as well as possible involvement in neoplasm development of myeloid disorders. PMID:26898077

  7. An erythroid chaperone that facilitates folding of α-globin subunits for hemoglobin synthesis

    PubMed Central

    Yu, Xiang; Kong, Yi; Dore, Louis C.; Abdulmalik, Osheiza; Katein, Anne M.; Zhou, Suiping; Choi, John K.; Gell, David; Mackay, Joel P.; Gow, Andrew J.; Weiss, Mitchell J.

    2007-01-01

    Erythrocyte precursors produce abundant α- and β-globin proteins, which assemble with each other to form hemoglobin A (HbA), the major blood oxygen carrier. αHb-stabilizing protein (AHSP) binds free α subunits reversibly to maintain their structure and limit their ability to generate reactive oxygen species. Accordingly, loss of AHSP aggravates the toxicity of excessive free α-globin caused by β-globin gene disruption in mice. Surprisingly, we found that AHSP also has important functions when free α-globin is limited. Thus, compound mutants lacking both Ahsp and 1 of 4 α-globin genes (genotype Ahsp–/–α-globin*α/αα) exhibited more severe anemia and Hb instability than mice with either mutation alone. In vitro, recombinant AHSP promoted folding of newly translated α-globin, enhanced its refolding after denaturation, and facilitated its incorporation into HbA. Moreover, in erythroid precursors, newly formed free α-globin was destabilized by loss of AHSP. Therefore, in addition to its previously defined role in detoxification of excess α-globin, AHSP also acts as a molecular chaperone to stabilize nascent α-globin for HbA assembly. Our findings illustrate what we believe to be a novel adaptive mechanism by which a specialized cell coordinates high-level production of a multisubunit protein and protects against various synthetic imbalances. PMID:17607360

  8. Perturbation of nucleosome structure by the erythroid transcription factor GATA-1.

    PubMed

    Boyes, J; Omichinski, J; Clark, D; Pikaart, M; Felsenfeld, G

    1998-06-12

    The ability of transcription factors to gain access to their sites in chromatin requires the disruption or displacement of nucleosomes covering the promoter, signalled by the generation of a nuclease hypersensitive site. We characterise here the alterations in nucleosome structure caused by binding of the erythroid factor GATA-1 to a nucleosome carrying GATA-1 sites. DNase I and micrococcal nuclease probes show that GATA-1 binding causes extensive, cooperative breakage of the histone/DNA contacts to generate a complex very similar to that formed by the factor with free DNA. The only region which differs is confined to about 50 bp surrounding the nucleosome dyad axis which appears to be the domain of residual contact between the DNA and histone octamer. Despite considerable breakage of the histone/DNA contacts, the complex is completely stable in solution, and disruption of the nucleosome is entirely reversible: it is regenerated quantitatively upon removal of the transcription factor. Moreover, the histone 2A/2B component of the octamer does not exchange to external competitor. We suggest that formation of this complex may be a step in the generation of a fully hypersensitive site in vivo over regulatory elements containing GATA family binding sites. PMID:9641976

  9. Therapeutic Effects of Erythroid Differentiation Regulator 1 on Imiquimod-Induced Psoriasis-Like Skin Inflammation

    PubMed Central

    Kim, Kyung Eun; Houh, Younkyung; Park, Hyun Jeong; Cho, Daeho

    2016-01-01

    Psoriasis is a common skin disease accompanied by chronic inflammation. In previous studies, erythroid differentiation regulator 1 (ERDR1) was shown to have a negative correlation with proinflammatory cytokine IL-18. However, the role of ERDR1 in the inflammatory skin disease psoriasis has not been evaluated. In this study, to investigate the role of ERDR1 in psoriasis, recombinant ERDR1 was injected intraperitoneally into a psoriasis mouse model. Recombinant ERDR1 (rERDR1) significantly alleviated the symptoms of psoriasis-like skin inflammation and reduced the mRNA of various psoriasis-related markers, including keratin 14, S100A8, and Th17-related cytokines IL-17 and IL-22, suggesting that rERDR1 exerts therapeutic effects on psoriasis via the regulation of Th17 functions. Additionally, the expression of CCL20, a well-known Th17 attracting chemokine, was determined. CCL20 expression significantly decreased in the rERDR1-injected group compared with the vehicle (PBS)-injected group. CCR6 expression in the psoriatic lesional skin was also decreased by rERDR1 administration, implying the inhibition of CCR6-expressing Th17 cell chemotaxis via the downregulation of CCL20. Taken together, this study provides the first evidence that ERDR1 may be a potential therapeutic target for psoriasis. PMID:26901187

  10. Synthesis of Enantiomerically Pure Anthracyclinones

    NASA Astrophysics Data System (ADS)

    Achmatowicz, Osman; Szechner, Barbara

    The anthracycline antibiotics are among the most important clinical drugs used in the treatment of human cancer. The search for new agents with improved therapeutic efficacy and reduced cardiotoxicity stimulated considerable efforts in the synthesis of new analogues. Since the biological activity of anthracyclines depends on their natural absolute configuration, various strategies for the synthesis of enantiomerically pure anthracyclinones (aglycones) have been developed. They comprise: resolution of racemic intermediate, incorporation of a chiral fragment derived from natural and non-natural chiral pools, asymmetric synthesis with the use of a chiral auxiliary or a chiral reagent, and enantioselective catalysis. Synthetic advances towards enantiopure anthracyclinones reported over the last 17 years are reviewed.

  11. Production of substantially pure fructose

    SciTech Connect

    Hatcher, H.J.; Gallian, J.J.; Leeper, S.A.

    1990-05-22

    This patent describes a process for the production of a substantially pure product containing greater than 60% fructose. It comprises: combining a sucrose-containing substrate with effective amounts of a levansucrase enzyme preparation to form levan and glucose; purifying the levan by at least one of the following purification methods: ultrafiltration, diafiltration, hyperfiltration, reverse osmosis, liquid--liquid partition, solvent extraction, chromatography, and precipitation; hydrolyzing the levan to form fructose substantially free of glucose and sucrose; and recovering the fructose by at least one of the following recovery methods: hyperfiltration, reverse osmosis, evaporation, drying, crystallization, and chromatography.

  12. Expression of nuclear factor, erythroid 2-like 2-mediated genes differentiates tuberculosis.

    PubMed

    Qian, Zhongqing; Lv, Jingzhu; Kelly, Gabriel T; Wang, Hongtao; Zhang, Xiaojie; Gu, Wanjun; Yin, Xiaofeng; Wang, Ting; Zhou, Tong

    2016-07-01

    During infection and host defense, nuclear factor, erythroid 2-like 2 (Nrf2) dependent signaling is an efficient antioxidant defensive mechanism used by host cells to control the destructive effects of reactive oxygen species. This allows for effective defense responses against microbes while minimizing oxidative injury to the host cell itself. As a central regulator of antioxidant genes, Nrf2 has gained great attention in its pivotal role in infection, especially in tuberculosis (TB), the top infectious disease killer worldwide. To elucidate the genes potentially regulated by Nrf2 in TB, we conducted a meta-analysis on published gene expression datasets. Firstly, we compared the global gene expression profiles between control and Nrf2-deficient human cells. The differentially expressed genes were deemed as "Nrf2-mediated genes". Next, the whole blood gene expression pattern of TB patients was compared with that of healthy controls, pneumonia patients, and lung cancer patients. We found that the genes deregulated in TB significantly overlap with the Nrf2-mediated genes. Based on the intersection of Nrf2-mediated and TB-regulated genes, we identified an Nrf2-mediated 17-gene signature, which reflects a cluster of gene ontology terms highly related to TB physiology. We demonstrated that the 17-gene signature can be used to distinguish TB patients from healthy controls and patients with latent TB infection, pneumonia, or lung cancer. Also, the Nrf2-mediated gene signature can be used as an indicator of the anti-TB therapeutic response. More importantly, we confirmed that the predictive power of the Nrf2-mediated 17-gene signature is significantly better than the random gene sets selected from the human transcriptome. Also, the 17-gene signature performs even better than the random gene signatures selected from TB-associated genes. Our study confirms the central role of Nrf2 in TB pathogenesis and provides a novel and useful diagnostic method to differentiate TB

  13. Recombinant erythroid differentiation regulator 1 inhibits both inflammation and angiogenesis in a mouse model of rosacea.

    PubMed

    Kim, Miri; Kim, Kyung-Eun; Jung, Haw Young; Jo, Hyunmu; Jeong, Seo-Won; Lee, Jahyung; Kim, Chang Han; Kim, Heejong; Cho, Daeho; Park, Hyun Jeong

    2015-09-01

    The erythroid differentiation regulator 1 (Erdr1), which is a novel and highly conserved factor, was recently reported to be negatively regulated by IL-18 and to play a crucial role as an antimetastatic factor. IL-18 is a proinflammatory cytokine that functions as an angiogenic mediator in inflammation. Rosacea is a chronic inflammatory skin disorder that is characterized by abnormal inflammation and vascular hyperactivity of the facial skin. To determine whether Erdr1 contributes to the regulation of the chronic inflammatory process in the development of rosacea, an immunohistochemical analysis was performed in healthy donors and patients with rosacea. In this study, we showed that Erdr1 was downregulated, whereas IL-18 was upregulated, in patients with rosacea, which led us to question the role of Erdr1 in this disorder. Moreover, a rosacea-like BALB/c mouse model was used to determine the role of Erdr1 in rosacea in vivo. LL-37 injection induced typical rosacea features, including erythema, telangiectasia and inflammation. Treatment with recombinant Erdr1 (rErdr1) resulted in a significant reduction of erythema, inflammatory cell infiltration (including CD4(+) and CD8(+) T cells), and microvessel density with vascular endothelial growth factor (VEGF). Taken together, our findings suggest that rErdr1 may be involved in attenuating the inflammation and angiogenesis associated with the pathogenesis of rosacea. Thus, these results provide new insight into the mechanism involved in this condition and indicate that rErdr1 could be a potential target for therapeutic intervention of rosacea.

  14. PARP-2 sustains erythropoiesis in mice by limiting replicative stress in erythroid progenitors

    PubMed Central

    Farrés, J; Llacuna, L; Martin-Caballero, J; Martínez, C; Lozano, J J; Ampurdanés, C; López-Contreras, A J; Florensa, L; Navarro, J; Ottina, E; Dantzer, F; Schreiber, V; Villunger, A; Fernández-Capetillo, O; Yélamos, J

    2015-01-01

    Erythropoiesis is a tightly regulated process in which multipotential hematopoietic stem cells produce mature red blood cells. Here we show that deletion of poly(ADP-ribose) polymerase-2 (PARP-2) in mice leads to chronic anemia at steady state, despite increased erythropoietin plasma levels, a phenomenon not observed in mice lacking PARP-1. Loss of PARP-2 causes shortened lifespan of erythrocytes and impaired differentiation of erythroid progenitors. In erythroblasts, PARP-2 deficiency triggers replicative stress, as indicated by the presence of micronuclei, the accumulation of γ-H2AX (phospho-histone H2AX) in S-phase cells and constitutive CHK1 and replication protein A phosphorylation. Transcriptome analyses revealed the activation of the p53-dependent DNA-damage response pathways in PARP-2-deficient cells, culminating in the upregulation of cell-cycle and cell death regulators, concomitant with G2/M arrest and apoptosis. Strikingly, while loss of the proapoptotic p53 target gene Puma restored hematocrit levels in the PARP-2-deficient mice, loss of the cell-cycle regulator and CDK inhibitor p21 leads to perinatal death by exacerbating impaired fetal liver erythropoiesis in PARP-2-deficient embryos. Although the anemia displayed by PARP-2-deficient mice is compatible with life, mice die rapidly when exposed to stress-induced enhanced hemolysis. Our results pinpoint an essential role for PARP-2 in erythropoiesis by limiting replicative stress that becomes essential in the absence of p21 and in the context of enhanced hemolysis, highlighting the potential effect that might arise from the design and use of PARP inhibitors that specifically inactivate PARP proteins. PMID:25501596

  15. 76 FR 69284 - Pure Magnesium From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... COMMISSION Pure Magnesium From China Determination On the basis of the record \\1\\ developed in the subject... order on pure magnesium from China would be likely to lead to continuation or recurrence of material... USITC Publication 4274 (October 2011), entitled Pure Magnesium from China: Investigation No....

  16. Ablation of Gata1 in adult mice results in aplastic crisis, revealing its essential role in steady-state and stress erythropoiesis.

    PubMed

    Gutiérrez, Laura; Tsukamoto, Saho; Suzuki, Mikiko; Yamamoto-Mukai, Harumi; Yamamoto, Masayuki; Philipsen, Sjaak; Ohneda, Kinuko

    2008-04-15

    The transcription factor Gata1 is expressed in several hematopoietic lineages and plays essential roles in normal hematopoietic development during embryonic stages. The lethality of Gata1-null embryos has precluded determination of its role in adult erythropoiesis. Here we have examined the effects of Gata1 loss in adult erythropoiesis using conditional Gata1 knockout mice expressing either interferon- or tamoxifen-inducible Cre recombinase (Mx-Cre and Tx-Cre, respectively). Mx-Cre-mediated Gata1 recombination, although incomplete, resulted in maturation arrest of Gata1-null erythroid cells at the proerythroblast stage, thrombocytopenia, and excessive proliferation of megakaryocytes in the spleen. Tx-Cre-mediated Gata1 recombination resulted in depletion of the erythroid compartment in bone marrow and spleen. Formation of the early and late erythroid progenitors in bone marrow was significantly reduced in the absence of Gata1. Furthermore, on treatment with a hemolytic agent, these mice failed to activate a stress erythropoietic response, despite the rising erythropoietin levels. These results indicate that, in addition to the requirement of Gata1 in adult megakaryopoiesis, Gata1 is necessary for steady-state erythropoiesis and for erythroid expansion in response to anemia. Thus, ablation of Gata1 in adult mice results in a condition resembling aplastic crisis in human.

  17. Expression of oncogenic K-ras from its endogenous promoter leads to a partial block of erythroid differentiation and hyperactivation of cytokine-dependent signaling pathways.

    PubMed

    Zhang, Jing; Liu, Yangang; Beard, Caroline; Tuveson, David A; Jaenisch, Rudolf; Jacks, Tyler E; Lodish, Harvey F

    2007-06-15

    When overexpressed in primary erythroid progenitors, oncogenic Ras leads to the constitutive activation of its downstream signaling pathways, severe block of terminal erythroid differentiation, and cytokine-independent growth of primary erythroid progenitors. However, whether high-level expression of oncogenic Ras is required for these phenotypes is unknown. To address this issue, we expressed oncogenic K-ras (K-ras(G12D)) from its endogenous promoter using a tetracycline-inducible system. We show that endogenous K-ras(G12D) leads to a partial block of terminal erythroid differentiation in vivo. In contrast to results obtained when oncogenic Ras was overexpressed from retroviral vectors, endogenous levels of K-ras(G12D) fail to constitutively activate but rather hyperactivate cytokine-dependent signaling pathways, including Stat5, Akt, and p44/42 MAPK, in primary erythroid progenitors. This explains previous observations that hematopoietic progenitors expressing endogenous K-ras(G12D) display hypersensitivity to cytokine stimulation in various colony assays. Our results support efforts to modulate Ras signaling for treating hematopoietic malignancies.

  18. Aberrant splicing of genes involved in haemoglobin synthesis and impaired terminal erythroid maturation in SF3B1 mutated refractory anaemia with ring sideroblasts.

    PubMed

    Conte, Simona; Katayama, Shintaro; Vesterlund, Liselotte; Karimi, Mohsen; Dimitriou, Marios; Jansson, Monika; Mortera-Blanco, Teresa; Unneberg, Per; Papaemmanuil, Elli; Sander, Birgitta; Skoog, Tiina; Campbell, Peter; Walfridsson, Julian; Kere, Juha; Hellström-Lindberg, Eva

    2015-11-01

    Refractory anaemia with ring sideroblasts (RARS) is distinguished by hyperplastic inefficient erythropoiesis, aberrant mitochondrial ferritin accumulation and anaemia. Heterozygous mutations in the spliceosome gene SF3B1 are found in a majority of RARS cases. To explore the link between SF3B1 mutations and anaemia, we studied mutated RARS CD34(+) marrow cells with regard to transcriptome sequencing, splice patterns and mutational allele burden during erythroid differentiation. Transcriptome profiling during early erythroid differentiation revealed a marked up-regulation of genes involved in haemoglobin synthesis and in the oxidative phosphorylation process, and down-regulation of mitochondrial ABC transporters compared to normal bone marrow. Moreover, mis-splicing of genes involved in transcription regulation, particularly haemoglobin synthesis, was confirmed, indicating a compromised haemoglobinization during RARS erythropoiesis. In order to define the phase during which erythroid maturation of SF3B1 mutated cells is most affected, we assessed allele burden during erythroid differentiation in vitro and in vivo and found that SF3B1 mutated erythroblasts showed stable expansion until late erythroblast stage but that terminal maturation to reticulocytes was significantly reduced. In conclusion, SF3B1 mutated RARS progenitors display impaired splicing with potential downstream consequences for genes of key importance for haemoglobin synthesis and terminal erythroid differentiation.

  19. Sequential induction of heme pathway enzymes during erythroid differentiation of mouse Friend leukemia virus-infected cells

    PubMed Central

    1976-01-01

    The process of erythroid differentiation in mouse Friend leukemia virus transformed cells (T3-C1-2) was examined by following changes in several enzyme activities of the heme biosynthetic pathway and in heme concentration while the cells were undergoing erythroid differentiation after treatment with dimethylsulfoxide. Untreated cells on the one hand, have a limited capacity for spontaneous differentiation. On the other hand, dimethylsulfoxide(DMSO)-treated cells showed an increase in the activities of delta-aminolevulinic acid (ALA) synthetase, ALA dehydratase, uroporphyrinogen-I synthetase, ferrochelatase, and heme concentration by days 1, 1.5, 2, and 4, respectively. The increase of the heme pathway enzymes and heme concentration followed the order of these enzymes or products as they are arranged in the heme biosynthetic pathway. These changes induced by DMSO were effectively inhibited by treatment with actinomycin D, suggesting that continued RNA synthesis is required for the differentiation process. 5-bromo-2'-deoxyuridine (BrdU) (10(-5) M) inhibited the DMSO-induced changes of the heme pathway enzymes. BrdU was most effective when it was present during the first 2 days of cell culture. It gradually lost its inhibitory effect when added after the 3rd day or later. The BrdU-mediated inhibition was completely overcome by the addition of thymidine (7 x 10(-5) M), but not by uridine (7 x 10(-5) M). All these data suggest that a sequential induction of the heme pathway enzyme takes place during erythroid differentiation of Friend leukemia cells, and that the sequential induction of the enzymes may be due to a sequential activation of genes coding for these enzyme activities. PMID:1249519

  20. Mixtures of maximally entangled pure states

    NASA Astrophysics Data System (ADS)

    Flores, M. M.; Galapon, E. A.

    2016-09-01

    We study the conditions when mixtures of maximally entangled pure states remain entangled. We found that the resulting mixed state remains entangled when the number of entangled pure states to be mixed is less than or equal to the dimension of the pure states. For the latter case of mixing a number of pure states equal to their dimension, we found that the mixed state is entangled provided that the entangled pure states to be mixed are not equally weighted. We also found that one can restrict the set of pure states that one can mix from in order to ensure that the resulting mixed state is genuinely entangled. Also, we demonstrate how these results could be applied as a way to detect entanglement in mixtures of the entangled pure states with noise.

  1. Activation of Stat 5b in erythroid progenitors correlates with the ability of ErbB to induce sustained cell proliferation.

    PubMed Central

    Mellitzer, G; Wessely, O; Decker, T; Meinke, A; Hayman, M J; Beug, H

    1996-01-01

    Self renewal of normal erythroid progenitors is induced by the receptor tyrosine kinase c-ErbB, whereas other receptors (c-Kit/Epo-R) regulate erythroid differentiation. To address possible mechanisms that could explain this selective activity of c-ErbB, we analyzed the ability of these receptors to activate the different members of the Stat transcription factor family. Ligand activation of c-ErbB induced the tyrosine phosphorylation, DNA-binding, and reporter gene transcription of Stat 5b in erythroblasts. In contrast, ligand activation of c-Kit was unable to induce any of these effects in the same cells. Activation of the erythropoietin receptor caused specific DNA-binding of Stat 5b, but failed to induce reporter gene transcription. These biochemical findings correlate perfectly with the selective ability of c-ErbB to cause sustained self renewal in erythroid progenitors. Images Fig. 1 Fig. 3 Fig. 4 PMID:8790376

  2. Isomerically Pure Tetramethylrhodamine Voltage Reporters.

    PubMed

    Deal, Parker E; Kulkarni, Rishikesh U; Al-Abdullatif, Sarah H; Miller, Evan W

    2016-07-27

    We present the design, synthesis, and application of a new family of fluorescent voltage indicators based on isomerically pure tetramethylrhodamines. These new Rhodamine Voltage Reporters, or RhoVRs, use photoinduced electron transfer (PeT) as a trigger for voltage sensing, display excitation and emission profiles in the green to orange region of the visible spectrum, demonstrate high sensitivity to membrane potential changes (up to 47% ΔF/F per 100 mV), and employ a tertiary amide derived from sarcosine, which aids in membrane localization and simultaneously simplifies the synthetic route to the voltage sensors. The most sensitive of the RhoVR dyes, RhoVR 1, features a methoxy-substituted diethylaniline donor and phenylenevinylene molecular wire at the 5'-position of the rhodamine aryl ring, exhibits the highest voltage sensitivity to date for red-shifted PeT-based voltage sensors, and is compatible with simultaneous imaging alongside green fluorescent protein-based indicators. The discoveries that sarcosine-based tertiary amides in the context of molecular-wire voltage indicators prevent dye internalization and 5'-substituted voltage indicators exhibit improved voltage sensitivity should be broadly applicable to other types of PeT-based voltage-sensitive fluorophores. PMID:27428174

  3. Bringing Planctomycetes into pure culture

    PubMed Central

    Lage, Olga M.; Bondoso, Joana

    2012-01-01

    Planctomycetes have been known since the description of Planctomyces bekefii by Gimesi at the beginning of the twentieth century (1924), although the first axenic cultures were only obtained in the 1970s. Since then, 11 genera with 14 species have been validly named and five candidatus genera belonging to the anaerobic ammonium oxidation, anammox bacteria have also been discovered. However, Planctomycetes diversity is much broader than these numbers indicate, as shown by environmental molecular studies. In recent years, the authors have attempted to isolate and cultivate additional strains of Planctomycetes. This paper provides a summary of the isolation work that was carried out to obtain in pure culture Planctomycetes from several environmental sources. The following strains of planctomycetes have been successfully isolated: two freshwater strains from the sediments of an aquarium, which were described as a new genus and species, Aquisphaera giovannonii; several Rhodopirellula strains from the sediments of a water treatment recycling tank of a marine fish farm; and more than 140 planctomycetes from the biofilm community of macroalgae. This collection comprises several novel taxa that are being characterized and described. Improvements in the isolation methodology were made in order to optimize and enlarge the number of Planctomycetes isolated from the macroalgae. The existence of an intimate and an important relationship between planctomycetes and macroalgae reported before by molecular studies is therefore supported by culture-dependent methods. PMID:23335915

  4. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis.

    PubMed

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J; Pandolfi, Pier Paolo

    2009-10-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential antiapoptotic role during terminal erythroid differentiation. We find that loss of Lrf leads to lethal anemia in embryos, due to increased apoptosis of late-stage erythroblasts. This programmed cell death is Arf and p53 independent and is instead mediated by upregulation of the proapoptotic factor Bim. We identify Lrf as a direct repressor of Bim transcription. In strong support of this mechanism, genetic Bim loss delays the lethality of Lrf-deficient embryos and rescues their anemia phenotype. Thus, our data define a key transcriptional cascade for effective erythropoiesis, whereby GATA-1 suppresses BIM-mediated apoptosis via LRF. PMID:19853566

  5. Evolving insights into the synergy between erythropoietin and thrombopoietin and the bipotent erythroid/megakaryocytic progenitor cell.

    PubMed

    Papayannopoulou, Thalia; Kaushansky, Kenneth

    2016-08-01

    Although the synergy between erythropoietin and thrombopoietin has previously been pointed out, the clonal demonstration of a human bipotent erythroid/megakaryocytic progenitor (MEP) was first published in Experimental Hematology (Papayannopoulou T, Brice M, Farrer D, Kaushansky K. Exp Hematol. 1996;24:660-669) and later in the same year in Blood (Debili N, Coulombel L, Croisille L, et al. Blood. 1996;88:1284-1296). This demonstration, and the fact that both bipotent and monopotent erythroid or megakaryocytic progenitors co-express markers of both lineages and respond to both lineage-specific transcription factors, has provided a background for the extensive use of MEP assessment by fluorescence-activated cell sorting in many subsequent studies. Beyond this, the demonstration of shared regulatory elements and the presence of single mutations affecting both lineages have inspired further studies to decipher how the shift in transcription factor networks occurs from one lineage to the other. Furthermore, in addition to shared effects, erythropoietin and thrombopoietin have additional independent effects. Most notable for thrombopoietin is its effect on hematopoietic stem cells illustrated by in vitro and in vivo approaches. PMID:26773569

  6. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis.

    PubMed

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J; Pandolfi, Pier Paolo

    2009-10-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential antiapoptotic role during terminal erythroid differentiation. We find that loss of Lrf leads to lethal anemia in embryos, due to increased apoptosis of late-stage erythroblasts. This programmed cell death is Arf and p53 independent and is instead mediated by upregulation of the proapoptotic factor Bim. We identify Lrf as a direct repressor of Bim transcription. In strong support of this mechanism, genetic Bim loss delays the lethality of Lrf-deficient embryos and rescues their anemia phenotype. Thus, our data define a key transcriptional cascade for effective erythropoiesis, whereby GATA-1 suppresses BIM-mediated apoptosis via LRF.

  7. Immunophenotypic Profiling of Erythroid Progenitor-Derived Extracellular Vesicles in Diamond-Blackfan Anaemia: A New Diagnostic Strategy.

    PubMed

    Macrì, Serena; Pavesi, Elisa; Crescitelli, Rossella; Aspesi, Anna; Vizziello, Claudia; Botto, Carlotta; Corti, Paola; Quarello, Paola; Notari, Patrizia; Ramenghi, Ugo; Ellis, Steven Robert; Dianzani, Irma

    2015-01-01

    Diamond-Blackfan Anaemia (DBA) is a rare inherited anaemia caused by heterozygous mutations in one of 13 ribosomal protein genes. Erythroid progenitors (BFU-E and CFU-E) in bone marrow (BM) show a proapoptotic phenotype. Suspicion of DBA is reached after exclusion of other forms of BM failure syndromes. To improve DBA diagnosis, which is confirmed by mutation analysis, we tested a new approach based on the study of extracellular vesicles (EVs) isolated from plasma by differential centrifugations and analysed by flow cytometry. We chose CD34, CD71 and CD235a markers to study erythroid EVs. We characterised the EVs immunophentoypic profiles of 13 DBA patients, 22 healthy controls and 16 patients with other haematological diseases. Among the three EVs clusters we found, only the CD34+/CD71low population showed statistically significant differences between DBA patients and controls (p< 0.05). The absence of this cluster is in agreement with the low levels of BFU-E found in DBA patients. The assessment of ROC curves demonstrated the potential diagnostic value of this population. We suggest that this assay may be useful to improve DBA diagnosis as a quicker and less invasive alternative to BM BFU-E culture analysis. PMID:26394034

  8. Erythroid pyrimidine 5'-nucleotidase: cloning, developmental expression, and regulation by cAMP and in vivo hypoxia.

    PubMed

    Mass, Markus; Simo, Erika; Dragon, Stefanie

    2003-12-01

    A characteristic process of terminal erythroid differentiation is the degradation of ribosomal RNA into mononucleotides. The pyrimidine mononucleotides can be dephosphorylated by pyrimidine 5'-nucleotidase (P5N-I). In humans, a lack of this enzyme causes hemolytic anemia with ribosomal structures and trinucleotides retained in the red blood cells (RBCs). Although the protein/nucleotide sequence of P5N-I is known in mammals, the onset and regulation of P5N-I during erythroid maturation is unknown. However, in circulating chicken embryonic RBCs, the enzyme is induced together with carbonic anhydrase (CAII) and 2,3-bisphosphoglycerate (2,3-BPG) by norepinephrine (NE) and adenosine, which are released by the embryo under hypoxic conditions. Here, we present the chicken P5N-I sequence and the gene expression of P5N-I during RBC maturation; the profile of gene expression follows the enzyme activity with a rise between days 13 and 16 of embryonic development. The p5n-I expression is induced (1) in definitive but not primitive RBCs by stimulation of beta-adrenergic/adenosine receptors, and (2) in definitive RBCs by hypoxic incubation of the chicken embryo. Since embryonic RBCs increase their hemoglobin-oxygen affinity by degradation of nucleotides such as uridine triphosphate (UTP) and cytidine triphosphate (CTP), the induction of p5n-I expression can be seen as an adaptive response to hypoxia.

  9. Immunophenotypic Profiling of Erythroid Progenitor-Derived Extracellular Vesicles in Diamond-Blackfan Anaemia: A New Diagnostic Strategy.

    PubMed

    Macrì, Serena; Pavesi, Elisa; Crescitelli, Rossella; Aspesi, Anna; Vizziello, Claudia; Botto, Carlotta; Corti, Paola; Quarello, Paola; Notari, Patrizia; Ramenghi, Ugo; Ellis, Steven Robert; Dianzani, Irma

    2015-01-01

    Diamond-Blackfan Anaemia (DBA) is a rare inherited anaemia caused by heterozygous mutations in one of 13 ribosomal protein genes. Erythroid progenitors (BFU-E and CFU-E) in bone marrow (BM) show a proapoptotic phenotype. Suspicion of DBA is reached after exclusion of other forms of BM failure syndromes. To improve DBA diagnosis, which is confirmed by mutation analysis, we tested a new approach based on the study of extracellular vesicles (EVs) isolated from plasma by differential centrifugations and analysed by flow cytometry. We chose CD34, CD71 and CD235a markers to study erythroid EVs. We characterised the EVs immunophentoypic profiles of 13 DBA patients, 22 healthy controls and 16 patients with other haematological diseases. Among the three EVs clusters we found, only the CD34+/CD71low population showed statistically significant differences between DBA patients and controls (p< 0.05). The absence of this cluster is in agreement with the low levels of BFU-E found in DBA patients. The assessment of ROC curves demonstrated the potential diagnostic value of this population. We suggest that this assay may be useful to improve DBA diagnosis as a quicker and less invasive alternative to BM BFU-E culture analysis.

  10. Erythroid-Specific Expression of β-globin from Sleeping Beauty-Transduced Human Hematopoietic Progenitor Cells

    PubMed Central

    Sjeklocha, Lucas M.; Park, Chang-Won; Wong, Phillip Y-P; Roney, Mark J.; Belcher, John D.; Kaufman, Dan S.; Vercellotti, Gregory M.; Hebbel, Robert P.; Steer, Clifford J.

    2011-01-01

    Gene therapy for sickle cell disease will require efficient delivery of a tightly regulated and stably expressed gene product to provide an effective therapy. In this study we utilized the non-viral Sleeping Beauty (SB) transposon system using the SB100X hyperactive transposase to transduce human cord blood CD34+ cells with DsRed and a hybrid IHK–β-globin transgene. IHK transduced cells were successfully differentiated into multiple lineages which all showed transgene integration. The mature erythroid cells had an increased β-globin to γ-globin ratio from 0.66±0.08 to 1.05±0.12 (p = 0.05), indicating expression of β-globin from the integrated SB transgene. IHK–β-globin mRNA was found in non-erythroid cell types, similar to native β-globin mRNA that was also expressed at low levels. Additional studies in the hematopoietic K562 cell line confirmed the ability of cHS4 insulator elements to protect DsRed and IHK–β-globin transgenes from silencing in long-term culture studies. Insulated transgenes had statistically significant improvement in the maintenance of long term expression, while preserving transgene regulation. These results support the use of Sleeping Beauty vectors in carrying an insulated IHK–β-globin transgene for gene therapy of sickle cell disease. PMID:22216176

  11. Erythroid-specific expression of β-globin from Sleeping Beauty-transduced human hematopoietic progenitor cells.

    PubMed

    Sjeklocha, Lucas M; Park, Chang-Won; Wong, Phillip Y-P; Roney, Mark J; Belcher, John D; Kaufman, Dan S; Vercellotti, Gregory M; Hebbel, Robert P; Steer, Clifford J

    2011-01-01

    Gene therapy for sickle cell disease will require efficient delivery of a tightly regulated and stably expressed gene product to provide an effective therapy. In this study we utilized the non-viral Sleeping Beauty (SB) transposon system using the SB100X hyperactive transposase to transduce human cord blood CD34(+) cells with DsRed and a hybrid IHK-β-globin transgene. IHK transduced cells were successfully differentiated into multiple lineages which all showed transgene integration. The mature erythroid cells had an increased β-globin to γ-globin ratio from 0.66±0.08 to 1.05±0.12 (p=0.05), indicating expression of β-globin from the integrated SB transgene. IHK-β-globin mRNA was found in non-erythroid cell types, similar to native β-globin mRNA that was also expressed at low levels. Additional studies in the hematopoietic K562 cell line confirmed the ability of cHS4 insulator elements to protect DsRed and IHK-β-globin transgenes from silencing in long-term culture studies. Insulated transgenes had statistically significant improvement in the maintenance of long term expression, while preserving transgene regulation. These results support the use of Sleeping Beauty vectors in carrying an insulated IHK-β-globin transgene for gene therapy of sickle cell disease.

  12. Immunophenotypic Profiling of Erythroid Progenitor-Derived Extracellular Vesicles in Diamond-Blackfan Anaemia: A New Diagnostic Strategy

    PubMed Central

    Macrì, Serena; Aspesi, Anna; Vizziello, Claudia; Botto, Carlotta; Corti, Paola; Quarello, Paola; Notari, Patrizia; Ramenghi, Ugo; Ellis, Steven Robert; Dianzani, Irma

    2015-01-01

    Diamond-Blackfan Anaemia (DBA) is a rare inherited anaemia caused by heterozygous mutations in one of 13 ribosomal protein genes. Erythroid progenitors (BFU-E and CFU-E) in bone marrow (BM) show a proapoptotic phenotype. Suspicion of DBA is reached after exclusion of other forms of BM failure syndromes. To improve DBA diagnosis, which is confirmed by mutation analysis, we tested a new approach based on the study of extracellular vesicles (EVs) isolated from plasma by differential centrifugations and analysed by flow cytometry. We chose CD34, CD71 and CD235a markers to study erythroid EVs. We characterised the EVs immunophentoypic profiles of 13 DBA patients, 22 healthy controls and 16 patients with other haematological diseases. Among the three EVs clusters we found, only the CD34+/CD71low population showed statistically significant differences between DBA patients and controls (p< 0.05). The absence of this cluster is in agreement with the low levels of BFU-E found in DBA patients. The assessment of ROC curves demonstrated the potential diagnostic value of this population. We suggest that this assay may be useful to improve DBA diagnosis as a quicker and less invasive alternative to BM BFU-E culture analysis. PMID:26394034

  13. Structural and functional characterization of an atypical activation domain in erythroid Krüppel-like factor (EKLF)

    PubMed Central

    Mas, Caroline; Lussier-Price, Mathieu; Soni, Shefali; Morse, Thomas; Arseneault, Geneviève; Di Lello, Paola; Lafrance-Vanasse, Julien; Bieker, James J.; Omichinski, James G.

    2011-01-01

    Erythroid Krüppel-like factor (EKLF) plays an important role in erythroid development by stimulating β-globin gene expression. We have examined the details by which the minimal transactivation domain (TAD) of EKLF (EKLFTAD) interacts with several transcriptional regulatory factors. We report that EKLFTAD displays homology to the p53TAD and, like the p53TAD, can be divided into two functional subdomains (EKLFTAD1 and EKLFTAD2). Based on sequence analysis, we found that EKLFTAD2 is conserved in KLF2, KLF4, KLF5, and KLF15. In addition, we demonstrate that EKLFTAD2 binds the amino-terminal PH domain of the Tfb1/p62 subunit of TFIIH (Tfb1PH/p62PH) and four domains of CREB-binding protein/p300. The solution structure of the EKLFTAD2/Tfb1PH complex indicates that EKLFTAD2 binds Tfb1PH in an extended conformation, which is in contrast to the α-helical conformation seen for p53TAD2 in complex with Tfb1PH. These studies provide detailed mechanistic information into EKLFTAD functions as well as insights into potential interactions of the TADs of other KLF proteins. In addition, they suggest that not only have acidic TADs evolved so that they bind using different conformations on a common target, but that transitioning from a disordered to a more ordered state is not a requirement for their ability to bind multiple partners. PMID:21670263

  14. Method of preparing pure fluorine gas

    DOEpatents

    Asprey, Larned B.

    1976-01-01

    A simple, inexpensive system for purifying and storing pure fluorine is described. The method utilizes alkali metal-nickel fluorides to absorb tank fluorine by forming nickel complex salts and leaving the gaseous impurities which are pumped away. The complex nickel fluoride is then heated to evolve back pure gaseous fluorine.

  15. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells

    PubMed Central

    Salopiata, Florian; Depner, Sofia; Wäsch, Marvin; Böhm, Martin E.; Mücke, Oliver; Plass, Christoph; Lehmann, Wolf D.; Kreutz, Clemens; Timmer, Jens; Klingmüller, Ursula

    2016-01-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  16. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    PubMed Central

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M.; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M.; Ribeiro, Maria L.; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A.; Davis, Brian R.; Segovia, Jose C.

    2015-01-01

    Summary Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses. PMID:26549847

  17. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells.

    PubMed

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M; Ribeiro, Maria L; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A; Davis, Brian R; Segovia, Jose C

    2015-12-01

    Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  18. Global transcriptome and chromatin occupancy analysis reveal the short isoform of GATA1 is deficient for erythroid specification and gene expression.

    PubMed

    Chlon, Timothy M; McNulty, Maureen; Goldenson, Benjamin; Rosinski, Alexander; Crispino, John D

    2015-05-01

    GATA1 is a master transcriptional regulator of the differentiation of several related myeloid blood cell types, including erythrocytes and megakaryocytes. Germ-line mutations that cause loss of full length GATA1, but allow for expression of the short isoform (GATA1s), are associated with defective erythropoiesis in a subset of patients with Diamond Blackfan Anemia. Despite extensive studies of GATA1s in megakaryopoiesis, the mechanism by which GATA1s fails to support normal erythropoiesis is not understood. In this study, we used global gene expression and chromatin occupancy analysis to compare the transcriptional activity of GATA1s to GATA1. We discovered that compared to GATA1, GATA1s is less able to activate the erythroid gene expression program and terminal differentiation in cells with dual erythroid-megakaryocytic differentiation potential. Moreover, we found that GATA1s bound to many of its erythroid-specific target genes less efficiently than full length GATA1. These results suggest that the impaired ability of GATA1s to promote erythropoiesis in DBA may be caused by failure to occupy erythroid-specific gene regulatory elements. PMID:25682601

  19. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells.

    PubMed

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M; Ribeiro, Maria L; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A; Davis, Brian R; Segovia, Jose C

    2015-12-01

    Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses. PMID:26549847

  20. Defects of protein production in erythroid cells revealed in a zebrafish Diamond-Blackfan anemia model for mutation in RPS19.

    PubMed

    Zhang, Y; Ear, J; Yang, Z; Morimoto, K; Zhang, B; Lin, S

    2014-01-01

    Diamond-Blackfan anemia (DBA) is a rare congenital red cell aplasia that classically presents during early infancy in DBA patients. Approximately, 25% of patients carry a mutation in the ribosomal protein (RP) S19 gene; mutations in RPS24, RPS17, RPL35A, RPL11, and RPL5 have been reported. How ribosome protein deficiency causes defects specifically to red blood cells in DBA has not been well elucidated. To genetically model the predominant ribosome defect in DBA, we generated an rps19 null mutant through the use of TALEN-mediated gene targeting in zebrafish. Molecular characterization of this mutant line demonstrated that rps19 deficiency reproduced the erythroid defects of DBA, including a lack of mature red blood cells and p53 activation. Notably, we found that rps19 mutants' production of globin proteins was significantly inhibited; however, globin transcript level was either increased or unaffected in rps19 mutant embryos. This dissociation of RNA/protein levels of globin genes was confirmed in another zebrafish DBA model with defects in rpl11. Using transgenic zebrafish with specific expression of mCherry in erythroid cells, we showed that protein production in erythroid cells was decreased when either rps19 or rpl11 was mutated. L-Leucine treatment alleviated the defects of protein production in erythroid cells and partially rescued the anemic phenotype in both rps19 and rpl11 mutants. Analysis of this model suggests that the decreased protein production in erythroid cells likely contributes to the blood-specific phenotype of DBA. Furthermore, the newly generated rps19 zebrafish mutant should serve as a useful animal model to study DBA. Our in vivo findings may provide clues for the future therapy strategy for DBA.

  1. Subtle distinct regulations of late erythroid molecular events by PI3K/AKT-mediated activation of Spi-1/PU.1 oncogene autoregulation loop.

    PubMed

    Breig, O; Théoleyre, O; Douablin, A; Baklouti, F

    2010-05-13

    Spi-1/PU.1 oncogene is downregulated as proerythroblasts undergo terminal differentiation. Insertion of the Friend virus upstream of the Spi-1/PU.1 locus leads to the constitutive upregulation of Spi-1/PU.1, and a subsequent block in the differentiation of the affected erythroblasts. We have shown that sustained overexpression of Spi-1/PU.1 also inhibits the erythroid splicing of protein 4.1R exon 16, irrespective of chemical induction of differentiation. Here, we show a positive feedback loop that couples constitutive phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling to high expression of Spi-1/PU.1 in Friend erythroleukemia cells. Inhibition of PI3K/AKT results in Spi-1/PU.1 downregulation in a stepwise manner and induces cell differentiation. Chromatin immunoprecipitation assays further supported the positive autoregulatory effect of Spi-1/PU.1. Mutational analysis indicated that Ser41, but not Ser148, is necessary for Spi-1/PU.1-mediated repression of hemoglobin expression, whereas both Ser residues are required for Spi-1/PU.1 inhibition of the erythroid splicing event. We further show that inhibition of the erythroid transcriptional and splicing events are strictly dependent on distinct Spi-1/PU.1 phosphorylation modifications rather than Spi-1/PU.1 expression level per se. Our data further support the fact that Spi-1/PU.1 inhibits 4.1R erythroid splicing through two different pathways, and bring new insights into the extracellular signal impact triggered by erythropoietin on late erythroid regulatory program, including pre-mRNA splicing.

  2. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-01

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  3. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-01

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site. PMID:10037146

  4. The small 11kDa nonstructural protein of human parvovirus B19 plays a key role in inducing apoptosis during B19 virus infection of primary erythroid progenitor cells

    PubMed Central

    Chen, Aaron Yun; Zhang, Elizabeth Yan; Guan, Wuxiang; Cheng, Fang; Kleiboeker, Steve; Yankee, Thomas M.

    2010-01-01

    Human parvovirus B19 (B19V) infection shows a strong erythroid tropism and drastically destroys erythroid progenitor cells, thus leading to most of the disease outcomes associated with B19V infection. In this study, we systematically examined the 3 B19V nonstructural proteins, 7.5kDa, 11kDa, and NS1, for their function in inducing apoptosis in transfection of primary ex vivo–expanded erythroid progenitor cells, in comparison with apoptosis induced during B19V infection. Our results show that 11kDa is a more significant inducer of apoptosis than NS1, whereas 7.5kDa does not induce apoptosis. Furthermore, we determined that caspase-10, an initiator caspase in death receptor signaling, is the most active caspase in apoptotic erythroid progenitors induced by 11kDa and NS1 as well as during B19V infection. More importantly, cytoplasm-localized 11kDa is expressed at least 100 times more than nucleus-localized NS1 at the protein level in primary erythroid progenitor cells infected with B19V; and inhibition of 11kDa expression using antisense oligos targeting specifically to the 11kDa-encoding mRNAs reduces apoptosis significantly during B19V infection of erythroid progenitor cells. Taken together, these results demonstrate that the 11kDa protein contributes to erythroid progenitor cell death during B19V infection. PMID:19861680

  5. Complete genomic organization of the human erythroid p55 gene (MPP1), a membrane-associated guanylate kinase homologue

    SciTech Connect

    Kim, A.C.; Metzenberg, A.B.; Sahr, K.E.

    1996-01-15

    Human p55 is an abundantly palmitoylated phosphoprotein of the erythroid membrane. It is the prototype of a newly discovered family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologues). The MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. Here, we report the complete intron-exon map of the human erythroid p55 gene (HGMW-approved symbol MPP1). The structure of the p55 gene was determined from cosmid clones isolated from a cosmid library specific for the human X chromosome. There is a single copy of the p55 gene, composed of 12 exons and spanning approximately 28 kb in the q28 region of the human X chromosome. The exon sizes range from 69 (exon 5) to 203 bp (intron 2) to {approximately}14 kb (intron 1). The intron-exon boundaries conform to the donor/acceptor consensus sequence, GT-AG, for splice junctions. Several of the exon boundaries correspond to the boundaries of functional domains in the p55 protein. These domains include a SH3 motif and a region that binds to cytoskeletal protein 4.1. In addition, a comparison of the genomic and the primary structures of p55 reveals a highly conserved phosphotyrosine domain located between the protein 4.1 binding domain and the guanylate kinase domain. Finally, promoter activity measurements of the region immediately upstream of the p55 gene, which contains several cis-elements commonly found in housekeeping genes, suggest that a CpG island may be associated with the p55 gene expression in vivo. 42 refs., 5 figs., 1 tab.

  6. Human Erythroid 5-Aminolevulinate Synthase Mutations Associated with X-Linked Protoporphyria Disrupt Conformational Equilibrium and Enhance Product Release†

    PubMed Central

    Fratz, Erica J.; Clayton, Jerome; Hunter, Gregory A.; Ducamp, Sarah; Breydo, Leonid; Uversky, Vladimir N.; Deybach, Jean-Charles; Gouya, Laurent; Puy, Hervé; Ferreira, Gloria C.

    2015-01-01

    Regulation of 5-aminolevulinate synthase (ALAS) is at the origin of balanced heme production in mammals. Mutations in the C-terminal region of human erythroid-specific ALAS (hALAS2) are associated with X-linked protoporphyria (XLPP), a disease characterized by extreme photosensitivity, with elevated blood concentrations of free protoporphyrin IX and zinc protoporphyrin. To investigate the molecular basis for this disease, recombinant hALAS2 and variants of the enzyme harboring the gain-of-function XLPP mutations were constructed, purified, and analyzed kinetically, spectroscopically and thermodynamically. Enhanced activities of the XLPP variants resulted from accelerations in the rate at which the product 5-aminolevulinate (ALA) was released from the enzyme. Circular dichroism spectroscopy revealed that the XLPP mutations altered the microenvironment of the pyridoxal 5’-phosphate cofactor, which underwent further and specific alterations upon succinyl-CoA binding. Transient kinetic analyses of the variant-catalyzed reactions and protein fluorescence quenching upon ALA binding to the XLPP variants demonstrated that the protein conformational transition step associated with product release was predominantly affected. Of relevance, XLPP could also be modeled in cell culture. We propose that 1) the XLPP mutations destabilize the succinyl-CoA-induced hALAS2 closed conformation and thus accelerate ALA release, 2) the extended C-terminus of wild-type mammalian ALAS2 provides a regulatory role that allows for allosteric modulation of activity, thereby controlling the rate of erythroid heme biosynthesis, and 3) this control is disrupted in XLPP, resulting in porphyrin accumulation. PMID:26300302

  7. Reprogramming of human peripheral blood monocytes to erythroid lineage by blocking of the PU-1 gene expression.

    PubMed

    Nouri, Masoumeh; Deezagi, Abdolkhalegh; Ebrahimi, Marzieh

    2016-03-01

    In hematopoietic system development, PU.1 and GATA-1 as lineage-specific transcription factors (TF) are expressed in common myeloid progenitors. The cross antagonism between them ascertains gene expression programs of monocytic and erythroid cells, respectively. This concept in transdifferentiation approaches has not been well considered yet, especially in intralineage conversion systems. To demonstrate whether PU.1 suppression induces monocyte lineage conversion into red blood cells, a combination of three PU.1-specific siRNAs was implemented to knock down PU.1 gene expression and generate the balance in favor of GATA-1 expression to induce erythroid differentiation. For this purpose, monocytes were isolated from human peripheral blood and transfected by PU.1 siRNAs. In transfected monocytes, the rate of PU.1 expression in mRNA level was significantly decreased until 0.38 ± 0.118 when compared to untreated monocytes at 72 h (p value ≤0.05) which resulted in significant overexpression of GATA1 of 16.1 ± 0.343-fold compared to the untreated group (p value ≤0.01). Subsequently, overexpression of hemoglobin (α 13.26 ± 1.34-fold; p value≤0.0001) and β-globin (37.55 ± 16.56-fold; p value≤0.0001) was observed when compared to control groups. The results of western immunoblotting confirm those findings too. While, reduced expression of monocyte, CD14 gene, was observed in qRT-PCR and flow cytometry results. Our results suggest that manipulating the ratio of the two TFs in bifurcation differentiation pathways via applying siRNA technology can possibly change the cells' fate as a safe way for therapeutics application.

  8. Quantifying the coherence of pure quantum states

    NASA Astrophysics Data System (ADS)

    Chen, Jianxin; Grogan, Shane; Johnston, Nathaniel; Li, Chi-Kwong; Plosker, Sarah

    2016-10-01

    In recent years, several measures have been proposed for characterizing the coherence of a given quantum state. We derive several results that illuminate how these measures behave when restricted to pure states. Notably, we present an explicit characterization of the closest incoherent state to a given pure state under the trace distance measure of coherence. We then use this result to show that the states maximizing the trace distance of coherence are exactly the maximally coherent states. We define the trace distance of entanglement and show that it coincides with the trace distance of coherence for pure states. Finally, we give an alternate proof to a recent result that the ℓ1 measure of coherence of a pure state is never smaller than its relative entropy of coherence.

  9. Dark fermentation on biohydrogen production: Pure culture.

    PubMed

    Lee, Duu-Jong; Show, Kuan-Yeow; Su, Ay

    2011-09-01

    Biohydrogen is regarded as an attractive future clean energy carrier due to its high energy content and environmental-friendly conversion. While biohydrogen production is still in the early stage of development, there have been a variety of laboratory- and pilot-scale systems developed with promising potential. This work presents a review of literature reports on the pure hydrogen-producers under anaerobic environment. Challenges and perspective of biohydrogen production with pure cultures are also outlined.

  10. Rehabilitation of pure alexia: A review

    PubMed Central

    Starrfelt, Randi; Ólafsdóttir, Rannveig Rós; Arendt, Ida-Marie

    2013-01-01

    Acquired reading problems caused by brain injury (alexia) are common, either as a part of an aphasic syndrome, or as an isolated symptom. In pure alexia, reading is impaired while other language functions, including writing, are spared. Being in many ways a simple syndrome, one would think that pure alexia was an easy target for rehabilitation efforts. We review the literature on rehabilitation of pure alexia from 1990 to the present, and find that patients differ widely on several dimensions, such as alexia severity and associated deficits. Many patients reported to have pure alexia in the reviewed studies, have associated deficits such as agraphia or aphasia and thus do not strictly conform to the diagnosis. Few studies report clear and generalisable effects of training, none report control data, and in many cases the reported findings are not supported by statistics. We can, however, tentatively conclude that Multiple Oral Re-reading techniques may have some effect in mild pure alexia where diminished reading speed is the main problem, while Tacile-Kinesthetic training may improve letter identification in more severe cases of alexia. There is, however, still a great need for well-designed and controlled studies of rehabilitation of pure alexia. PMID:23808895

  11. cAMP and in vivo hypoxia induce tob, ifr1, and fos expression in erythroid cells of the chick embryo.

    PubMed

    Dragon, Stefanie; Offenhäuser, Nina; Baumann, Rosemarie

    2002-04-01

    During avian embryonic development, terminal erythroid differentiation occurs in the circulation. Some of the key events, such as the induction of erythroid 2,3-bisphosphoglycerate (2,3-BPG), carbonic anhydrase (CAII), and pyrimidine 5'-nucleotidase (P5N) synthesis are oxygen dependent (Baumann R, Haller EA, Schöning U, and Weber M, Dev Biol 116: 548-551, 1986; Dragon S and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 280: R870-R878, 2001; Dragon S, Carey C, Martin K, and Baumann R, J Exp Biol 202: 2787-2795, 1999; Dragon S, Glombitza S, Götz R, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996; Dragon S, Hille R, Götz R, and Baumann R, Blood 91: 3052-3058, 1998; Million D, Zillner P, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 261: R1188-R1196, 1991) in an indirect way: hypoxia stimulates the release of norepinephrine (NE)/adenosine into the circulation (Dragon et al., J Exp Biol 202: 2787-2795, 1999; Dragon et al., Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996). This leads via erythroid beta-adrenergic/adenosine A(2) receptor activation to a cAMP signal inducing several proteins in a transcription-dependent manner (Dragon et al., Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996; Dragon et al., Blood 91: 3052-3058, 1998; Glombitza S, Dragon S, Berghammer M, Pannermayr M, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 271: R973-R981, 1996). To understand how the cAMP-dependent processes are initiated, we screened an erythroid cDNA library for cAMP-regulated genes. We detected three genes that were strongly upregulated (>5-fold) by cAMP in definitive and primitive red blood cells. They are homologous to the mammalian Tob, Ifr1, and Fos proteins. In addition, the genes are induced in the intact embryo during short-term hypoxia. Because the genes are regulators of proliferation and differentiation in other cell types, we suggest that c

  12. Action of antithymocyte globulin on normal human erythroid progenitor cell proliferation in vitro: erythropoietic growth-enhancing factors are released from marrow accessory cells.

    PubMed

    Mangan, K F; D'Alessandro, L; Mullaney, M T

    1986-04-01

    Studies were undertaken to determine the mechanism of action of a horse antithymocyte globulin preparation (ATGAM) (HATG) and its control preparation of horse gamma globulin (HIgG) on the proliferation of normal human marrow and blood erythroid progenitor cells (CFU-E, BFU-E) in vitro. In preincubation studies with marrow mononuclear cells and complement, HATG did not significantly augment CFU-E or BFU-E growth greater than that expected because of removal of marrow T cells by this agent. However, direct addition of HATG but not HIgG to marrow cultures significantly stimulated CFU-E and BFU-E up to two to four times that of media or HIgG controls (P less than 0.05). The peak effect was observed at 10 to 100 micrograms/ml HATG; HATG was toxic at 1000 micrograms/ml. By contrast, the OKT3 monoclonal antibody was less stimulatory than HATG. The in vitro erythropoietic stimulatory effect of HATG was dependent on the presence of accessory cells because removal of T cells or monocytes (less than 2% to 5%) or adsorptions of HATG with T cells or monocytes reduced its stimulatory effect, highly purified BFU-E nearly devoid of accessory cells required irradiated accessory cells for demonstration of the HATG stimulatory effect, and an erythroid burst-promoting activity was released from T cells or unseparated mononuclear cells in the presence of HATG but not HIgG. The HATG enhancing effect was optimal in the first 96 hours of cultures in the presence of erythropoietin, and was reproducible with three separate lots of HATG. Up to 16% of HATG-stimulated erythroid colonies expressed nonerythroid lineage cells. Iron 59 incorporation into heme of CFU-E- or BFU-E-derived colonies was augmented equally by HATG or HIgG at 10 micrograms/ml. Erythropoietin dose-response curves and studies with antierythropoietin sera suggested that HATG also increased the sensitivity of erythroid progenitor cells to very low concentrations of erythropoietin. We conclude that HATG but not HIgG control

  13. Primary Sjögren syndrome presenting with hemolytic anemia and pure red cell aplasia following delivery due to Coombs-negative autoimmune hemolytic anemia and hemophagocytosis.

    PubMed

    Komaru, Yohei; Higuchi, Takakazu; Koyamada, Ryosuke; Haji, Youichiro; Okada, Masato; Kamesaki, Toyomi; Okada, Sadamu

    2013-01-01

    A 36-year-old woman presented with hemolytic anemia without a reticulocyte response 38 days after delivery. A marked reduction in erythroid cells and an increase in macrophages with active hemophagocytosis were noted in the bone marrow. While conventional Coombs' tests were negative, the level of red blood cell (RBC)-bound immunoglobulin G (IgG) was increased. The patient was diagnosed with primary Sjögren syndrome (pSS) based on her symptoms, positive anti-SS-A antibodies, Coombs-negative autoimmune hemolytic anemia and pure red cell aplasia associated with RBC-bound IgG and hemophagocytosis. The unique presentation was considered to be a consequence of immunological derangement associated with pSS, pregnancy and delivery.

  14. Engineering arbitrary pure and mixed quantum states

    SciTech Connect

    Pechen, Alexander

    2011-10-15

    Controlled manipulation by atomic- and molecular-scale quantum systems has attracted a lot of research attention in recent years. A fundamental problem is to provide deterministic methods for controlled engineering of arbitrary quantum states. This work proposes a deterministic method for engineering arbitrary pure and mixed states of a wide class of quantum systems. The method exploits a special combination of incoherent and coherent controls (incoherent and coherent radiation) and has two properties which are specifically important for manipulating by quantum systems: it realizes the strongest possible degree of their state control, complete density matrix controllability, meaning the ability to steer arbitrary pure and mixed initial states into any desired pure or mixed final state, and it is all-to-one, such that each particular control transfers all initial system states into one target state.

  15. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    PubMed

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies. PMID:25998414

  16. Hydrogen Sulfide Levels and Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) Activity Are Attenuated in the Setting of Critical Limb Ischemia (CLI)

    PubMed Central

    Islam, Kazi N; Polhemus, David J; Donnarumma, Erminia; Brewster, Luke P; Lefer, David J

    2015-01-01

    Background Cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase are endogenous enzymatic sources of hydrogen sulfide (H2S). Functions of H2S are mediated by several targets including ion channels and signaling proteins. Nuclear factor-erythroid 2-related factor 2 is responsible for the expression of antioxidant response element–regulated genes and is known to be upregulated by H2S. We examined the levels of H2S, H2S-producing enzymes, and nuclear factor-erythroid 2-related factor 2 activation status in skeletal muscle obtained from critical limb ischemia (CLI) patients. Methods and Results Gastrocnemius tissues were attained postamputation from human CLI and healthy control patients. We found mRNA and protein levels of cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase were significantly decreased in skeletal muscle of CLI patients as compared to control. H2S and sulfane sulfur levels were significantly decreased in skeletal muscle of CLI patients. We also observed significant reductions in nuclear factor-erythroid 2-related factor 2 activation as well as antioxidant proteins, such as Cu, Zn-superoxide dismutase, catalase, and glutathione peroxidase in skeletal muscle of CLI patients. Biomarkers of oxidative stress, such as malondialdehyde and protein carbonyl formation, were significantly increased in skeletal muscle of CLI patients as compared to healthy controls. Conclusions The data demonstrate that H2S bioavailability and nuclear factor-erythroid 2-related factor 2 activation are both attenuated in CLI tissues concomitant with significantly increased oxidative stress. Reductions in the activity of H2S-producing enzymes may contribute to the pathogenesis of CLI. PMID:25977470

  17. Pure neuritic leprosy: Current status and relevance.

    PubMed

    Rao, P Narasimha; Suneetha, Sujai

    2016-01-01

    Pure neuritic leprosy has always been an enigma due to its clinical and management ambiguities. Although only the Indian Association of Leprologist's classification recognizes 'pure neuritic leprosy' as a distinct sub group of leprosy, cases nonetheless are reported from various countries of Asia, Africa, South America and Europe, indicating its global relevance. It is important to maintain pure neuritic leprosy as a subgroup as it constitutes a good percentage of leprosy cases reported from India, which contributes to more than half of global leprosy numbers. Unfortunately, a high proportion of these patients present with Grade 2 disability at the time of initial reporting itself due to the early nerve involvement. Although skin lesions are absent by definition, when skin biopsies were performed from the skin along the distribution of the affected nerve, a proportion of patients demonstrated leprosy pathology, revealing sub-clinical skin involvement. In addition on follow-up, skin lesions are noted to develop in up to 20% of pure neuritic leprosy cases, indicating its progression to manifest cutaneous disease. Over the decades, the confirmation of diagnosis of pure neuritic leprosy has been subjective, however, with the arrival and use of high-resolution ultrasonography (HRUS) for nerve imaging, we have a tool not only to objectively measure and record the nerve thickening but also to assess the morphological alterations in the nerve including echo texture, fascicular pattern and vascularity. Management of pure neuritic leprosy requires multidrug therapy along with appropriate dose of systemic corticosteroids, for both acute and silent neuritis. Measures for pain relief, self-care of limbs and physiotherapy are important to prevent as well as manage disabilities in this group of patients. PMID:27088926

  18. Pure Apraxia of Speech - A Case Report -

    PubMed Central

    Kang, Young Ae; Yun, Sang Jin

    2011-01-01

    Apraxia of speech (AOS) is the impairment of motor programming. However, the exact nature of this deficit remains unclear. In particular, AOS without other speech-language deficit is called pure AOS, but it is very rare. When diagnosing AOS, the characteristic of articulation is considered a crucial criterion, which has been proposed for differentiating AOS from phonological and dysarthric disorders. The present study reports on pure AOS in a 37-year-old right-handed male after a left insular, front, temporal infarction. This report may be useful for further AOS study and diagnosis in the clinical setting. PMID:22506197

  19. BRST and the pure spinor formalism

    SciTech Connect

    Garcia, J. Antonio

    2008-03-06

    The aim of this talk is to show the relation between the standard BRST approach of the GS superstring with the quantization technics used in the pure spinor approach to superstring. To that end we will use the Batalin-Fradkin-Tyutin (BFT) conversion program of second class constraints to first class constraints in the GS superstring using light cone coordinates. By applying this systematic procedure we were able to obtain a gauge system that is equivalent to the recent model proposed in [1] to relate the GS superstring to the pure spinor formalism.

  20. Primary hematopoietic cells from DBA patients with mutations in RPL11 and RPS19 genes exhibit distinct erythroid phenotype in vitro.

    PubMed

    Moniz, H; Gastou, M; Leblanc, T; Hurtaud, C; Crétien, A; Lécluse, Y; Raslova, H; Larghero, J; Croisille, L; Faubladier, M; Bluteau, O; Lordier, L; Tchernia, G; Vainchenker, W; Mohandas, N; Da Costa, L

    2012-01-01

    Diamond-Blackfan anemia (DBA) is caused by aberrant ribosomal biogenesis due to ribosomal protein (RP) gene mutations. To develop mechanistic understanding of DBA pathogenesis, we studied CD34⁺ cells from peripheral blood of DBA patients carrying RPL11 and RPS19 ribosomal gene mutations and determined their ability to undergo erythroid differentiation in vitro. RPS19 mutations induced a decrease in proliferation of progenitor cells, but the terminal erythroid differentiation was normal with little or no apoptosis. This phenotype was related to a G₀/G₁ cell cycle arrest associated with activation of the p53 pathway. In marked contrast, RPL11 mutations led to a dramatic decrease in progenitor cell proliferation and a delayed erythroid differentiation with a marked increase in apoptosis and G₀/G₁ cell cycle arrest with activation of p53. Infection of cord blood CD34⁺ cells with specific short hairpin (sh) RNAs against RPS19 or RPL11 recapitulated the two distinct phenotypes in concordance with findings from primary cells. In both cases, the phenotype has been reverted by shRNA p53 knockdown. These results show that p53 pathway activation has an important role in pathogenesis of DBA and can be independent of the RPL11 pathway. These findings shed new insights into the pathogenesis of DBA. PMID:22833095

  1. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  2. Beta-globin active chromatin Hub formation in differentiating erythroid cells and in p45 NF-E2 knock-out mice.

    PubMed

    Kooren, Jurgen; Palstra, Robert-Jan; Klous, Petra; Splinter, Erik; von Lindern, Marieke; Grosveld, Frank; de Laat, Wouter

    2007-06-01

    Expression of the beta-globin genes proceeds from basal to exceptionally high levels during erythroid differentiation in vivo. High expression is dependent on the locus control region (LCR) and coincides with more frequent LCR-gene contacts. These contacts are established in the context of an active chromatin hub (ACH), a spatial chromatin configuration in which the LCR, together with other regulatory sequences, loops toward the active beta-globin-like genes. Here, we used recently established I/11 cells as a model system that faithfully recapitulates the in vivo erythroid differentiation program to study the molecular events that accompany and underlie ACH formation. Upon I/11 cell induction, histone modifications changed, the ACH was formed, and the beta-globin-like genes were transcribed at rates similar to those observed in vivo. The establishment of frequent LCR-gene contacts coincided with a more efficient loading of polymerase onto the beta-globin promoter. Binding of the transcription factors GATA-1 and EKLF to the locus, although previously shown to be required, was not sufficient for ACH formation. Moreover, we used knock-out mice to show that the erythroid transcription factor p45 NF-E2, which has been implicated in beta-globin gene regulation, is dispensable for beta-globin ACH formation.

  3. Transcription factors Fli1 and EKLF in the differentiation of megakaryocytic and erythroid progenitor in 5q- syndrome and in Diamond-Blackfan anemia.

    PubMed

    Neuwirtova, Radana; Fuchs, Ota; Holicka, Monika; Vostry, Martin; Kostecka, Arnost; Hajkova, Hana; Jonasova, Anna; Cermak, Jaroslav; Cmejla, Radek; Pospisilova, Dagmar; Belickova, Monika; Siskova, Magda; Hochova, Ivana; Vondrakova, Jana; Sponerova, Dana; Kadlckova, Eva; Novakova, Ludmila; Brezinova, Jana; Michalova, Kyra

    2013-01-01

    Friend leukemia virus integration 1 (Fli1) and erythroid Krüppel-like factor (EKLF) participate under experimental conditions in the differentiation of megakaryocytic and erythroid progenitor in cooperation with other transcription factors, cytokines, cytokine receptors, and microRNAs. Defective erythropoiesis with refractory anemia and effective megakaryopoiesis with normal or increased platelet count is typical for 5q- syndrome. We decided to evaluate the roles of EKLF and Fli1 in the pathogenesis of this syndrome and of another ribosomopathy, Diamond-Blackfan anemia (DBA). Fli1 and EKLF mRNA levels were examined in mononuclear blood and bone marrow cells from patients with 5q- syndrome, low-risk MDS patients with normal chromosome 5, DBA patients, and healthy controls. In 5q- syndrome, high Fli1 mRNA levels in the blood and bone marrow mononuclear cells were found. In DBA, Fli1 expression did not differ from the controls. EKLF mRNA level was significantly decreased in the blood and bone marrow of 5q- syndrome and in all DBA patients. We propose that the elevated Fli1 in 5q- syndrome protects megakaryocytic cells from ribosomal stress contrary to erythroid cells and contributes to effective though dysplastic megakaryopoiesis.

  4. Haem-regulated eIF2α kinase is necessary for adaptive gene expression in erythroid precursors under the stress of iron deficiency

    PubMed Central

    Liu, Sijin; Bhattacharya, Sanchita; Han, Anping; Suragani, Rajasekhar N. V. S.; Zhao, Wanting; Fry, Rebecca C.; Chen, Jane-Jane

    2016-01-01

    Summary Haem-regulated eIF2α kinase (HRI) is essential for the regulation of globin gene translation and the survival of erythroid precursors in iron/haem deficiency. This study found that that in iron deficiency, fetal definitive erythropoiesis is inhibited at the basophilic erythroblast stage with increased proliferation and elevated apoptosis. This hallmark of ineffective erythropoiesis is more severe in HRI deficiency. Microarray gene profiling analysis showed that HRI was required for adaptive gene expression in erythroid precursors during chronic iron deficiency. The number of genes with expression affected more than twofold increased, from 213 in iron deficiency and 73 in HRI deficiency, to 3135 in combined iron and HRI deficiencies. Many of these genes are regulated by Gata1 and Fog1. We demonstrate for the first time that Gata1 expression in developing erythroid precursors is decreased in iron deficiency, and is decreased further in combined iron and HRI deficiencies. Additionally, Fog1 expression is decreased in combined deficiencies, but not in iron or HRI deficiency alone. Our results indicate that HRI confers adaptive gene expression in developing erythroblasts during iron deficiency through maintaining Gata1/Fog1 expression. PMID:18665838

  5. Primary hematopoietic cells from DBA patients with mutations in RPL11 and RPS19 genes exhibit distinct erythroid phenotype in vitro

    PubMed Central

    Moniz, H; Gastou, M; Leblanc, T; Hurtaud, C; Crétien, A; Lécluse, Y; Raslova, H; Larghero, J; Croisille, L; Faubladier, M; Bluteau, O; Lordier, L; Tchernia, G; Vainchenker, W; Mohandas, N; Da Costa, L

    2012-01-01

    Diamond-Blackfan anemia (DBA) is caused by aberrant ribosomal biogenesis due to ribosomal protein (RP) gene mutations. To develop mechanistic understanding of DBA pathogenesis, we studied CD34+ cells from peripheral blood of DBA patients carrying RPL11 and RPS19 ribosomal gene mutations and determined their ability to undergo erythroid differentiation in vitro. RPS19 mutations induced a decrease in proliferation of progenitor cells, but the terminal erythroid differentiation was normal with little or no apoptosis. This phenotype was related to a G0/G1 cell cycle arrest associated with activation of the p53 pathway. In marked contrast, RPL11 mutations led to a dramatic decrease in progenitor cell proliferation and a delayed erythroid differentiation with a marked increase in apoptosis and G0/G1 cell cycle arrest with activation of p53. Infection of cord blood CD34+ cells with specific short hairpin (sh) RNAs against RPS19 or RPL11 recapitulated the two distinct phenotypes in concordance with findings from primary cells. In both cases, the phenotype has been reverted by shRNA p53 knockdown. These results show that p53 pathway activation has an important role in pathogenesis of DBA and can be independent of the RPL11 pathway. These findings shed new insights into the pathogenesis of DBA. PMID:22833095

  6. Radioprotection of mice with interleukin-1: Relationship to the number of erythroid and granulocyte-macrophage colony-forming cells

    SciTech Connect

    Schwartz, G.N.; Patchen, M.L.; Neta, R.; MacVittie, T.J.

    1990-01-01

    This report presents the results of an investigation of changes in the number of erythroid and granulocyte-macrophage colony forming cells (GM-CFC) that had occurred in tissues of normal B6D2F1 mice 20 h after administration of a radioprotective dose (150 ng) of human recombinant interleukin-1 (rIL-1). Neutrophilia in the peripheral blood and changes in the tissue distribution of GM-CFC demonstrated that cells were mobilized from the bone marrow in response to rIL-1 injection. For example, 20 h after rIL-1 injection marrow GM-CFC numbers were 80% of the numbers in bone marrow from saline-injected mice. Associated with this decrease there was a twofold increase in the number of peripheral blood and splenic GM-CFC. Also, as determined by hydroxyurea injection, there was an increase in the number of GM-CFC in S phase of the cell cycle in the spleen, but not in the bone marrow. Data in this report suggest that when compared to the spleen, stimulation of granulopoiesis after rIL-1 injection is delayed in the bone marrow.

  7. Resveratrol: Antioxidant activity and induction of fetal hemoglobin in erythroid cells from normal donors and β-thalassemia patients.

    PubMed

    Fibach, Eitan; Prus, Eugenia; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Finotti, Alessia; Lipucci di Paola, Michele; Brognara, Eleonora; Lampronti, Ilaria; Borgatti, Monica; Gambari, Roberto

    2012-06-01

    Thalassemia and sickle-cell anemia (SCA) present a major public health problem in countries where the number of carriers and affected individuals is high. As a result of the abnormalities in hemoglobin production, cells of thalassemia and SCA patients exhibit oxidative stress, which ultimately is responsible for the chronic anemia observed. Therefore, identification of compounds exhibiting both antioxidant and hemoglobin-inducing activities is highly needed. Our results demonstrate resveratrol to be such a compound. This was shown both in the human K562 cell line, as well as in erythroid precursors derived from normal donors and β-thalassemia patients. Resveratrol was shown to exhibit antioxidant activity and to stimulate the expression of the γ-globin genes and the accumulation of fetal hemoglobin (HbF). To the best of our knowledge, this is the first report pointing to such a double effect of resveratrol. Since this natural product is already marketed as an antioxidant, future investigations should concentrate on demonstrating its potential to augment HbF production in experimental animal models (e.g., thalassemia and SCA mice) as well as in patients. We believe that the potential of clinical use of resveratrol as an antioxidant and HbF stimulator may offer a simple and inexpensive treatment to patients.

  8. The lipocalin alpha1-microglobulin protects erythroid K562 cells against oxidative damage induced by heme and reactive oxygen species.

    PubMed

    Olsson, Magnus G; Olofsson, Tor; Tapper, Hans; Akerstrom, Bo

    2008-08-01

    Alpha(1)-microglobulin is a 26 kDa plasma and tissue glycoprotein that belongs to the lipocalin protein superfamily. Recent reports show that it is a reductase and radical scavenger and that it binds heme and has heme-degrading properties. This study has investigated the protective effects of alpha(1)-microglobulin against oxidation by heme and reactive oxygen species in the human erythroid cell line, K562. The results show that alpha(1)-microglobulin prevents intracellular oxidation and up-regulation of heme oxygenase-1 induced by heme, hydrogen peroxide and Fenton reaction-generated hydroxyl radicals in the culture medium. It also reduces the cytosol of non-oxidized cells. Endogeneous expression of alpha(1)-microglobulin was up-regulated by these oxidants and silencing of the alpha(1)-microglobulin expression increased the cytosol oxidation. alpha(1)-microglobulin also inhibited cell death caused by heme and cleared cells from bound heme. Binding of heme to alpha(1)-microglobulin increased the radical reductase activity of the protein as compared to the apo-protein. Finally, alpha(1)-microglobulin was localized mainly at the cell surface both when administered exogeneously and in non-treated cells. The results suggest that alpha(1)-microglobulin is involved in the defence against oxidative cellular injury caused by haemoglobin and heme and that the protein may employ both heme-scavenging and one-electron reduction of radicals to achieve this.

  9. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    SciTech Connect

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  10. Structure of the Membrane Proximal Oxioreductase Domain of Human Steap3, the Dominant Ferrireductase of the Erythroid Transferrin Cycle

    SciTech Connect

    Sendamarai, A.K.; Ohgami, R.S.; Fleming, M.D.; Lawrence, C.M.

    2009-05-27

    The daily production of 200 billion erythrocytes requires 20 mg of iron, accounting for nearly 80% of the iron demand in humans. Thus, erythroid precursor cells possess an efficient mechanism for iron uptake in which iron loaded transferrin (Tf) binds to the transferrin receptor (TfR) at the cell surface. The Tf:TfR complex then enters the endosome via receptor-mediated endocytosis. Upon endosomal acidification, iron is released from Tf, reduced to Fe{sup 2+} by Steap3, and transported across the endosomal membrane by divalent metal iron transporter 1. Steap3, the major ferrireductase in erythrocyte endosomes, is a member of a unique family of reductases. Steap3 is comprised of an N-terminal cytosolic oxidoreductase domain and a C-terminal heme-containing transmembrane domain. Cytosolic NADPH and a flavin are predicted cofactors, but the NADPH/flavin binding domain differs significantly from those in other eukaryotic reductases. Instead, Steap3 shows remarkable, although limited homology to FNO, an archaeal oxidoreductase. We have determined the crystal structure of the human Steap3 oxidoreductase domain in the absence and presence of NADPH. The structure reveals an FNO-like domain with an unexpected dimer interface and substrate binding sites that are well positioned to direct electron transfer from the cytosol to a heme moiety predicted to be fixed within the transmembrane domain. Here, we discuss possible gating mechanisms for electron transfer across the endosomal membrane.

  11. Human and Murine Hematopoietic Stem Cell Aging Is Associated with Functional Impairments and Intrinsic Megakaryocytic/Erythroid Bias

    PubMed Central

    Rundberg Nilsson, Alexandra; Soneji, Shamit; Adolfsson, Sofia; Bryder, David; Pronk, Cornelis Jan

    2016-01-01

    Aging within the human hematopoietic system associates with various deficiencies and disease states, including anemia, myeloid neoplasms and reduced adaptive immune responses. Similar phenotypes are observed in mice and have been linked to alterations arising at the hematopoietic stem cell (HSC) level. Such an association is, however, less established in human hematopoiesis and prompted us here to detail characteristics of the most primitive human hematopoietic compartments throughout ontogeny. In addition, we also attempted to interrogate similarities between aging human and murine hematopoiesis. Coupled to the transition from human cord blood (CB) to young and aged bone marrow (BM), we observed a gradual increase in frequency of candidate HSCs. This was accompanied by functional impairments, including decreased lymphoid output and reduced proliferative potential. Downstream of human HSCs, we observed decreasing levels of common lymphoid progenitors (CLPs), and increasing frequencies of megakaryocyte/erythrocyte progenitors (MEPs) with age, which could be linked to changes in lineage-affiliated gene expression patterns in aged human HSCs. These findings were paralleled in mice. Therefore, our data support the notion that age-related changes also in human hematopoiesis involve the HSC pool, with a prominent skewing towards the megakaryocytic/erythroid lineages, and suggests conserved mechanisms underlying aging of the blood cell system. PMID:27368054

  12. Structural characterization of a noncovalent complex between ubiquitin and the transactivation domain of the erythroid-specific factor EKLF.

    PubMed

    Raiola, Luca; Lussier-Price, Mathieu; Gagnon, David; Lafrance-Vanasse, Julien; Mascle, Xavier; Arseneault, Genevieve; Legault, Pascale; Archambault, Jacques; Omichinski, James G

    2013-11-01

    Like other acidic transactivation domains (TAD), the minimal TAD from the erythroid-specific transcription factor EKLF (EKLFTAD) has been shown to contribute both to its transcriptional activity as well as to its ubiquitin(UBI)-mediated degradation. In this article, we examine the activation-degradation role of the acidic TAD of EKLF and demonstrate that the first 40 residues (EKLFTAD1) within this region form a noncovalent interaction with UBI. Nuclear magnetic resonance (NMR) structural studies of an EKLFTAD1-UBI complex show that EKLFTAD1 adopts a 14-residue α helix that forms the recognition interface with UBI in a similar manner as the UBI-interacting helix of Rabex5. We also identify a similar interaction between UBI and the activation-degradation region of SREBP1a, but not with the activation-degradation regions of p53, GAL4, and VP16. These results suggest that select activation-degradation regions like the ones found in EKLF and SREBP1a function in part through their ability to form noncovalent interactions with UBI. PMID:24139988

  13. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involve the nuclear erythroid 2-related factor 2 pathway

    PubMed Central

    Han, Jing; Xiao, Qing; Lin, Yan-hua; Zheng, Zhen-zhu; He, Zhao-dong; Hu, Juan; Chen, Li-dian

    2015-01-01

    Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg) reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke. PMID:26889188

  14. Reactive Oxygen Species and Nuclear Factor Erythroid 2-Related Factor 2 Activation in Diabetic Nephropathy: A Hidden Target

    PubMed Central

    Abdo, Shaaban; Zhang, Shao-Ling; Chan, John S.D.

    2015-01-01

    Hyperglycemia, oxidative stress and renin-angiotensin system (RAS) dysfunction have been implicated in diabetic nephropathy (DN) progression, but the underlying molecular mechanisms are far from being fully understood. In addition to the systemic RAS, the existence of a local intrarenal RAS in renal proximal tubular cells has been recognized. Angiotensinogen is the sole precursor of all angiotensins (Ang). Intrarenal reactive oxygen species (ROS) generation, Ang II level and RAS gene expression are up-regulated in diabetes, indicating that intrarenal ROS and RAS activation play an important role in DN. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is one of the major protective processes that occurs in response to intracellular oxidative stress. Nrf2 stimulates an array of antioxidant enzymes that convert excessive ROS to less reactive or less damaging forms. Recent studies have, however, revealed that Nrf2 activation might have other undesirable effects in diabetic animals and in diabetic patients with chronic kidney disease. This mini-review summarizes current knowledge of the relationship between ROS, Nrf2 and intra renal RAS activation in DN progression as well as possible novel target(s) for DN treatment. PMID:26213634

  15. Adult Books for Young Adults.

    ERIC Educational Resources Information Center

    Carter, Betty

    1997-01-01

    Considers the differences between young adult and adult books and maintains that teachers must be familiar with young adults' tastes for both. Suggests that traffic between these publishing divisions is a two-way street, with young adults reading adult books and adults reading young adult books. (TB)

  16. Pure agraphia after deep left hemisphere haematoma.

    PubMed Central

    Croisile, B; Laurent, B; Michel, D; Trillet, M

    1990-01-01

    Pure agraphia is reported following haematoma in the left centrum semiovale sparing both parietal and frontal cortices. There was total inability to produce graphemes in the absence of limb apraxia. The lesion is assumed to have prevented linguistic and graphemic systems from gaining access to the frontal motor programme. Images PMID:2324759

  17. A fatal case of pure metaphyseal chondroblastoma.

    PubMed

    Binesh, Fariba; Moghadam, Reza Nafisi; Abrisham, Jalil

    2013-08-23

    The chondroblastoma (CB) is a rare cartilaginous tumour; it represents less than 1% of all bone tumours. It is mostly localised at the level of the epiphysis of long bones. We report a fatal case of pure metaphyseal CB of the tibia in a 9-year-old boy whose pulmonary metastases developed soon after operative therapy of the primary tumour.

  18. Temporal Ventriloquism in a Purely Temporal Context

    ERIC Educational Resources Information Center

    Hartcher-O'Brien, Jessica; Alais, David

    2011-01-01

    This study examines how audiovisual signals are combined in time for a temporal analogue of the ventriloquist effect in a purely temporal context, that is, no spatial grounding of signals or other spatial facilitation. Observers were presented with two successive intervals, each defined by a 1250-ms tone, and indicated in which interval a brief…

  19. Pure progressive amnesia: An atypical amnestic syndrome?

    PubMed

    Barbeau, Emmanuel J; Didic, Mira; Felician, Olivier; Tramoni, Eve; Guedj, Eric; Ceccaldi, Mathieu; Poncet, Michel

    2006-12-01

    We report on M.S., an 83-year-old patient with isolated pure progressive amnesia. This rare, recently identified, form of amnesia has been described in elderly patients. Neuropathological studies suggest that this syndrome is an atypical clinical presentation of Alzheimer's disease. The aim of our study was to characterize the neuropsychological pattern of pure progressive amnesia in comparison with other amnestic syndromes and memory dissociations reported in the literature. Our results indicate that pure progressive amnesia is characterized by a highly unusual dissociation in the realm of memory, with severe deficits on tests based on recognition and recall of verbal and visual single items, contrasting with relatively preserved anterograde autobiographical and spatial memory and normal recall of complex material such as stories. These findings suggest that memory for single items could depend on an independent system. One hypothesis is that M.S.'s unusual memory profile results from relative dysfunction of the ventral medial temporal lobe pathway. An alternative explanation implicates cognitive reserve. Further studies are required in order to progress on this matter. In any case, pure progressive amnesia is a clinical syndrome that may provide further insight into the organization of declarative memory.

  20. A fatal case of pure metaphyseal chondroblastoma.

    PubMed

    Binesh, Fariba; Moghadam, Reza Nafisi; Abrisham, Jalil

    2013-01-01

    The chondroblastoma (CB) is a rare cartilaginous tumour; it represents less than 1% of all bone tumours. It is mostly localised at the level of the epiphysis of long bones. We report a fatal case of pure metaphyseal CB of the tibia in a 9-year-old boy whose pulmonary metastases developed soon after operative therapy of the primary tumour. PMID:23975916

  1. Implicit Reading in Chinese Pure Alexia

    ERIC Educational Resources Information Center

    Shan, Chunlei; Zhu, Renjing; Xu, Mingwei; Luo, Benyan; Weng, Xuchu

    2010-01-01

    A number of recent studies have shown that some patients with pure alexia display evidence of implicit access to lexical and semantic information about words that they cannot read explicitly. This phenomenon has not been investigated systematically in Chinese patients. We report here a case study of a Chinese patient who met the criteria for pure…

  2. Pure science and the problem of progress.

    PubMed

    Douglas, Heather

    2014-06-01

    How should we understand scientific progress? Kuhn famously discussed science as its own internally driven venture, structured by paradigms. He also famously had a problem describing progress in science, as problem-solving ability failed to provide a clear rubric across paradigm change--paradigm changes tossed out problems as well as solving them. I argue here that much of Kuhn's inability to articulate a clear view of scientific progress stems from his focus on pure science and a neglect of applied science. I trace the history of the distinction between pure and applied science, showing how the distinction came about, the rhetorical uses to which the distinction has been put, and how pure science came to be both more valued by scientists and philosophers. I argue that the distinction between pure and applied science does not stand up to philosophical scrutiny, and that once we relinquish it, we can provide Kuhn with a clear sense of scientific progress. It is not one, though, that will ultimately prove acceptable. For that, societal evaluations of scientific work are needed.

  3. A Pure Theory of Lifelong Learning.

    ERIC Educational Resources Information Center

    Hatton, Michael J.

    Charles Tiebout's Pure Theory of Local Expenditures serves as a helpful framework in examining the emergence of the learning society, communications technologies, freer trade, and the effects these will have on the educational infrastructure. Tiebout argued that the failure of market-type systems of public good at the central government level does…

  4. Exploring the simplest purely baryonic decay processes

    NASA Astrophysics Data System (ADS)

    Geng, C. Q.; Hsiao, Y. K.; Rodrigues, Eduardo

    2016-07-01

    Though not considered in general, purely baryonic decays could shed light on the puzzle of the baryon number asymmetry in the universe by means of a better understanding of the baryonic nature of our matter world. As such, they constitute a yet unexplored class of decay processes worth investigating. We propose to search for purely baryonic decay processes at the LHCb experiment. No such type of decay has ever been observed. In particular, we concentrate on the decay Λb0→p p ¯n , which is the simplest purely baryonic decay mode, with solely spin-1 /2 baryons involved. We predict its decay branching ratio to be B (Λb0→p p ¯ n )=(2. 0-0.2+0.3)×10-6 , which is sufficiently large to make the decay mode accessible to LHCb. Our study can be extended to other purely baryonic decays such as Λb0→p p ¯ Λ , Λb0→Λ p ¯ Λ , and Λb0→Λ Λ ¯Λ , as well as to similar decays of antitriplet b baryons such as Ξb0 ,-.

  5. Global Genetic Architecture of an Erythroid Quantitative Trait Locus, HMIP-2

    PubMed Central

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-01-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed “A” and “B.” These typically occurred together (“A–B”) on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for “A” and “B,” we interrogated public population datasets. Haplotypes carrying only “A” or “B” were typical for populations in Sub-Saharan Africa. The “A–B” combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene–environment interaction during human migration and adaptation. PMID:25069958

  6. Global genetic architecture of an erythroid quantitative trait locus, HMIP-2.

    PubMed

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-11-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed "A" and "B." These typically occurred together ("A-B") on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for "A" and "B," we interrogated public population datasets. Haplotypes carrying only "A" or "B" were typical for populations in Sub-Saharan Africa. The "A-B" combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene-environment interaction during human migration and adaptation.

  7. Dynamics of α-globin locus chromatin structure and gene expression during erythroid differentiation of human CD34+ cells in culture

    PubMed Central

    Mahajan, Milind C; Karmakar, Subhradip; Krause, Diane; Weissman, Sherman M

    2009-01-01

    Objective The aim of the present study has been to establish serum free culture conditions for the ex vivo expansion and differentiation of human CD34+ cells into erythroid lineage and to study the chromatin structure, gene expression and transcription factor recruitment at the α–globin locus in the developing erythron. Methods A basal IMDM cell culture medium with 1% bovine serum albumin as a serum replacement and a combination of cytokines and growth factors was used for the expansion and differentiation of the CD34+ cells. Expression patterns of the alpha and beta like genes at various stages of erythropoiesis was studied by Reverse transcriptase (RT)-qPCR analysis, profile of key erythroid transcription factors was investigated by western blotting, and the chromatin structure and transcription factor recruitment at the alpha globin locus was investigated by ChIP-qPCR analysis. Results Human CD34+ cells in the serum free medium undergo near synchronous erythroid differentiation to yield large amount of cells at different differentiation stages. We observe distinct patterns of the histone modifications and transcription factor binding at the α-globin locus during erythroid differentiation of CD34+ cells. NF-E2 was present at upstream activator sites even before addition of erythropoietin (Epo), while bound GATA-1 was only detectable after Epo treatment. After seven days of erythropoietin treatment, H3K4Me2 modification uniformly increases throughout the α–globin locus. Acetylation at H3K9 and binding of Pol II, NF-E2 and GATA-1 were restricted to certain HS sites of the enhancer and theta gene, and were conspicuously low at the α-like globin promoters. Rearrangement of the insulator binding factor CTCF took place at and around the α-globin locus as CD34+ cells differentiated into erythroid pathway. Conclusion Our results indicate that remodeling of the upstream elements may be the primary event in activation of α–globin gene expression. Activation of

  8. Fibrillin-1 microfibrils influence adult bone marrow hematopoiesis.

    PubMed

    Smaldone, Silvia; Bigarella, Carolina L; Del Solar, Maria; Ghaffari, Saghi; Ramirez, Francesco

    2016-01-01

    We have recently demonstrated that fibrillin-1 assemblies regulate the fate of skeletal stem cells (aka, mesenchymal stem cells [MSCs]) by modulating TGFβ activity within the microenvironment of adult bone marrow niches. Since MSCs can also influence hematopoietic stem cell (HSC) activities, here we investigated adult hematopoiesis in mice with Cre-mediated inactivation of the fibrillin-1 (Fbn1) gene in the mesenchyme of the forming limbs (Fbn1(Prx1-/-) mice). Analyses of 3-month-old Fbn1(Prx1-/-) mice revealed a statistically significant increase of circulating red blood cells, which a differentiation assay correlated with augmented erythropoiesis. This finding, together with evidence of fibrillin-1 deposition in erythroblastic niches, supported the notion that this extracellular matrix protein normally restricts differentiation of erythroid progenitors. Whereas flow cytometry measurements identified a decreased HSC frequency in mutant relative to wild type mice, no appreciable differences were noted with regard to the relative abundance and differentiation potential of myeloid progenitor cells. Together these findings implied that fibrillin-1 normally promotes HSC expansion but does not influence cell lineage commitment. Since local TGFβ hyperactivity has been associated with abnormal osteogenesis in Fbn1(Prx1-/-) mice, 1-month-old mutant and wild type animals were systemically treated for 8weeks with either a pan-TGF-β-neutralizing antibody or an antibody of the same IgG1 isotype. The distinct outcomes of these pharmacological interventions strongly suggest that fibrillin-1 differentially modulates TGFβ activity in HSC vs. erythroid niches.

  9. Pomalidomide reverses γ-globin silencing through the transcriptional reprogramming of adult hematopoietic progenitors.

    PubMed

    Dulmovits, Brian M; Appiah-Kubi, Abena O; Papoin, Julien; Hale, John; He, Mingzhu; Al-Abed, Yousef; Didier, Sebastien; Gould, Michael; Husain-Krautter, Sehba; Singh, Sharon A; Chan, Kyle W H; Vlachos, Adrianna; Allen, Steven L; Taylor, Naomi; Marambaud, Philippe; An, Xiuli; Gallagher, Patrick G; Mohandas, Narla; Lipton, Jeffrey M; Liu, Johnson M; Blanc, Lionel

    2016-03-17

    Current therapeutic strategies for sickle cell anemia are aimed at reactivating fetal hemoglobin. Pomalidomide, a third-generation immunomodulatory drug, was proposed to induce fetal hemoglobin production by an unknown mechanism. Here, we report that pomalidomide induced a fetal-like erythroid differentiation program, leading to a reversion of γ-globin silencing in adult human erythroblasts. Pomalidomide acted early by transiently delaying erythropoiesis at the burst-forming unit-erythroid/colony-forming unit-erythroid transition, but without affecting terminal differentiation. Further, the transcription networks involved in γ-globin repression were selectively and differentially affected by pomalidomide including BCL11A, SOX6, IKZF1, KLF1, and LSD1. IKAROS (IKZF1), a known target of pomalidomide, was degraded by the proteasome, but was not the key effector of this program, because genetic ablation of IKZF1 did not phenocopy pomalidomide treatment. Notably, the pomalidomide-induced reprogramming was conserved in hematopoietic progenitors from individuals with sickle cell anemia. Moreover, multiple myeloma patients treated with pomalidomide demonstrated increased in vivo γ-globin levels in their erythrocytes. Together, these data reveal the molecular mechanisms by which pomalidomide reactivates fetal hemoglobin, reinforcing its potential as a treatment for patients with β-hemoglobinopathies.

  10. Heat engine driven by purely quantum information.

    PubMed

    Park, Jung Jun; Kim, Kang-Hwan; Sagawa, Takahiro; Kim, Sang Wook

    2013-12-01

    The key question of this Letter is whether work can be extracted from a heat engine by using purely quantum mechanical information. If the answer is yes, what is its mathematical formula? First, by using a bipartite memory we show that the work extractable from a heat engine is bounded not only by the free energy change and the sum of the entropy change of an individual memory but also by the change of quantum mutual information contained inside the memory. We then find that the engine can be driven by purely quantum information, expressed as the so-called quantum discord, forming a part of the quantum mutual information. To confirm it, as a physical example we present the Szilard engine containing a diatomic molecule with a semipermeable wall.

  11. Pure field theories and MACSYMA algorithms

    NASA Technical Reports Server (NTRS)

    Ament, W. S.

    1977-01-01

    A pure field theory attempts to describe physical phenomena through singularity-free solutions of field equations resulting from an action principle. The physics goes into forming the action principle and interpreting specific results. Algorithms for the intervening mathematical steps are sketched. Vacuum general relativity is a pure field theory, serving as model and providing checks for generalizations. The fields of general relativity are the 10 components of a symmetric Riemannian metric tensor; those of the Einstein-Straus generalization are the 16 components of a nonsymmetric. Algebraic properties are exploited in top level MACSYMA commands toward performing some of the algorithms of that generalization. The light cone for the theory as left by Einstein and Straus is found and simplifications of that theory are discussed.

  12. Symmetries of Type N Pure Radiation Fields

    NASA Astrophysics Data System (ADS)

    Ahsan, Zafar; Ali, Musavvir

    2015-05-01

    The geometrical symmetries corresponding to the continuous groups of collineations and motions generated by a null vector l are considered. These symmetries have been translated into the language of Newman-Penrose formalism for pure radiation (PR) type N fields. It is seen that for such fields, conformal, special conformal and homothetic motions degenerate to motion. The concept of free curvature, matter curvature and matter affine collineations have been discussed and the conditions under which PR type N fields admit such collineations have been obtained. Moreover, it is shown that the projective collineation degenerate to matter affine, special projective, conformal, special conformal, null geodesic and special null geodesic collineations. It is also seen that type N pure radiation fields admit Maxwell collineation along the propagation vector l.

  13. Grip for fatigue testing pure aluminium

    NASA Astrophysics Data System (ADS)

    Lehmann, P.; Yuan, G. S.; Hartwig, K. T.

    A simple method of clamping pure aluminium for fatigue tests at cryogenic temperatures is described. Easily machined cylindrical specimens are aligned and held firmly by collet grips that counteract sample shrinkage during cooldown. Specimens are quickly mounted and removed after testing without distortion or thermal treatment 99.999% aluminium, aluminium alloys and copper were gripped successfully through tens of thousands of fully reversed tension-compression cycles at 295, 77 and 4.2 K.

  14. Pure connection action principle for general relativity.

    PubMed

    Krasnov, Kirill

    2011-06-24

    It has already been known for two decades that general relativity can be reformulated as a certain gauge theory, so that the only dynamical field is an SO(3) connection and the spacetime metric appears as a derived object. However, no simple action principle realizing these ideas has been available. A new elegant action principle for such a "pure connection" formulation of GR is described.

  15. Stable freestanding thin films of pure water

    SciTech Connect

    Weon, B. M.; Je, J. H.; Hwu, Y.; Margaritondo, G.

    2008-03-10

    Obtaining water microstructures is very difficult because of low viscosity and high surface tension. We produced stable freestanding thin films of pure water by x-ray bombardment of small liquid volumes in capillary tubes. A detailed characterization with phase-contrast radiology demonstrated a lifetime beyond 1 h with no chemical stabilizer for micron-thickness films with half-millimeter-level diameter. This can be attributed to the interplay of two x-ray effects: water evaporation and surface charging.

  16. Decitabine With or Without Bortezomib in Treating Older Patients With Acute Myeloid Leukemia

    ClinicalTrials.gov

    2016-03-14

    Acute Myeloid Leukemia Arising From Previous Myelodysplastic Syndrome; Adult Acute Megakaryoblastic Leukemia; Adult Acute Monoblastic Leukemia; Adult Acute Monocytic Leukemia; Adult Acute Myeloid Leukemia With Minimal Differentiation; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Myeloid Leukemia Without Maturation; Adult Erythroleukemia; Adult Pure Erythroid Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

  17. On constructing purely affine theories with matter

    NASA Astrophysics Data System (ADS)

    Cervantes-Cota, Jorge L.; Liebscher, D.-E.

    2016-08-01

    We explore ways to obtain the very existence of a space-time metric from an action principle that does not refer to it a priori. Although there are reasons to believe that only a non-local theory can viably achieve this goal, we investigate here local theories that start with Schrödinger's purely affine theory (Schrödinger in Space-time structure. Cambridge UP, Cambridge, 1950), where he gave reasons to set the metric proportional to the Ricci curvature aposteriori. When we leave the context of unified field theory, and we couple the non-gravitational matter using some weak equivalence principle, we can show that the propagation of shock waves does not define a lightcone when the purely affine theory is local and avoids the explicit use of the Ricci tensor in realizing the weak equivalence principle. When the Ricci tensor is substituted for the metric, the equations seem to have only a very limited set of solutions. This backs the conviction that viable purely affine theories have to be non-local.

  18. Graphical calculus for Gaussian pure states

    SciTech Connect

    Menicucci, Nicolas C.; Flammia, Steven T.; Loock, Peter van

    2011-04-15

    We provide a unified graphical calculus for all Gaussian pure states, including graph transformation rules for all local and semilocal Gaussian unitary operations, as well as local quadrature measurements. We then use this graphical calculus to analyze continuous-variable (CV) cluster states, the essential resource for one-way quantum computing with CV systems. Current graphical approaches to CV cluster states are only valid in the unphysical limit of infinite squeezing, and the associated graph transformation rules only apply when the initial and final states are of this form. Our formalism applies to all Gaussian pure states and subsumes these rules in a natural way. In addition, the term 'CV graph state' currently has several inequivalent definitions in use. Using this formalism we provide a single unifying definition that encompasses all of them. We provide many examples of how the formalism may be used in the context of CV cluster states: defining the 'closest' CV cluster state to a given Gaussian pure state and quantifying the error in the approximation due to finite squeezing; analyzing the optimality of certain methods of generating CV cluster states; drawing connections between this graphical formalism and bosonic Hamiltonians with Gaussian ground states, including those useful for CV one-way quantum computing; and deriving a graphical measure of bipartite entanglement for certain classes of CV cluster states. We mention other possible applications of this formalism and conclude with a brief note on fault tolerance in CV one-way quantum computing.

  19. Crystal Structure of the Nonerythroid [alpha]-Spectrin Tetramerization Site Reveals Differences between Erythroid and Nonerythroid Spectrin Tetramer Formation

    SciTech Connect

    Mehboob, Shahila; Song, Yuanli; Witek, Marta; Long, Fei; Santarsiero, Bernard D.; Johnson, Michael E.; Fung, Leslie W.-M.

    2010-06-21

    We have solved the crystal structure of a segment of nonerythroid {alpha}-spectrin ({alpha}II) consisting of the first 147 residues to a resolution of 2.3 {angstrom}. We find that the structure of this segment is generally similar to a corresponding segment from erythroid {alpha}-spectrin ({alpha}I) but exhibits unique differences with functional significance. Specific features include the following: (i) an irregular and frayed first helix (Helix C{prime}); (ii) a helical conformation in the junction region connecting Helix C{prime} with the first structural domain (D1); (iii) a long A1B1 loop in D1; and (iv) specific inter-helix hydrogen bonds/salt bridges that stabilize D1. Our findings suggest that the hydrogen bond networks contribute to structural domain stability, and thus rigidity, in {alpha}II, and the lack of such hydrogen bond networks in {alpha}I leads to flexibility in {alpha}I. We have previously shown the junction region connecting Helix C{prime} to D1 to be unstructured in {alpha}I (Park, S., Caffrey, M. S., Johnson, M. E., and Fung, L. W. (2003) J. Biol. Chem. 278, 21837-21844) and now find it to be helical in {alpha}II, an important difference for {alpha}-spectrin association with {beta}-spectrin in forming tetramers. Homology modeling and molecular dynamics simulation studies of the structure of the tetramerization site, a triple helical bundle of partial domain helices, show that mutations in {alpha}-spectrin will affect Helix C{prime} structural flexibility and/or the junction region conformation and may alter the equilibrium between spectrin dimers and tetramers in cells. Mutations leading to reduced levels of functional tetramers in cells may potentially lead to abnormal neuronal functions.

  20. Asn-150 of Murine Erythroid 5-Aminolevulinate Synthase Modulates the Catalytic Balance between the Rates of the Reversible Reaction.

    PubMed

    Stojanovski, Bosko M; Ferreira, Gloria C

    2015-12-25

    5-Aminolevulinate synthase (ALAS) catalyzes the first step in mammalian heme biosynthesis, the pyridoxal 5'-phosphate (PLP)-dependent and reversible reaction between glycine and succinyl-CoA to generate CoA, CO2, and 5-aminolevulinate (ALA). Apart from coordinating the positioning of succinyl-CoA, Rhodobacter capsulatus ALAS Asn-85 has a proposed role in regulating the opening of an active site channel. Here, we constructed a library of murine erythroid ALAS variants with substitutions at the position occupied by the analogous bacterial asparagine, screened for ALAS function, and characterized the catalytic properties of the N150H and N150F variants. Quinonoid intermediate formation occurred with a significantly reduced rate for either the N150H- or N150F-catalyzed condensation of glycine with succinyl-CoA during a single turnover. The introduced mutations caused modifications in the ALAS active site such that the resulting variants tipped the balance between the forward- and reverse-catalyzed reactions. Although wild-type ALAS catalyzes the conversion of ALA into the quinonoid intermediate at a rate 6.3-fold slower than the formation of the same quinonoid intermediate from glycine and succinyl-CoA, the N150F variant catalyzes the forward reaction at a mere 1.2-fold faster rate than that of the reverse reaction, and the N150H variant reverses the rate values with a 1.7-fold faster rate for the reverse reaction than that for the forward reaction. We conclude that the evolutionary selection of Asn-150 was significant for optimizing the forward enzymatic reaction at the expense of the reverse, thus ensuring that ALA is predominantly available for heme biosynthesis.

  1. V-erbA generates ribosomes devoid of RPL11 and regulates translational activity in avian erythroid progenitors.

    PubMed

    Nguyen-Lefebvre, A T; Leprun, G; Morin, V; Viñuelas, J; Couté, Y; Madjar, J-J; Gandrillon, O; Gonin-Giraud, S

    2014-03-20

    The v-erbA oncogene transforms chicken erythrocytic progenitors (T2EC) by blocking their differentiation and freezing them in a state of self-renewal. Transcriptomes of T2EC, expressing either v-erbA or a non-transforming form of v-erbA (S61G), were compared using serial analysis of gene expression and some, but not all, mRNA-encoding ribosomal proteins were seen to be affected by v-erbA. These results suggest that this oncogene could modulate the composition of ribosomes. In the present study, we demonstrate, using two-dimensional difference in gel electrophoresis, that v-erbA-expressing cells have a lower amount of RPL11 associated with the ribosomes. The presence of ribosomes devoid of RPL11 in v-erbA-expressing cells was further confirmed by immunoprecipitation. In order to assess the possible impact of these specialized ribosomes on the translational activity, we analyzed proteomes of either v-erbA or S61G-expressing cells using 2D/mass spectrometry, and identified nine proteins present in differing amounts within these cells. Among these proteins, we focused on HSP70 because of its involvement in erythroid differentiation. Our results indicate that, in v-erbA-expressing cells, hsp70 is not only transcribed but also translated more efficiently, as shown by polyribosome fractionation experiments. We demonstrate here, for the first time, the existence of ribosomes with different protein components, notably ribosomes devoid of RPL11, and a regulation of mRNA translation depending on v-erbA oncogene expression.

  2. The Nuclear Factor (Erythroid-derived 2)-like 2 and Proteasome Maturation Protein Axis Mediate Bortezomib Resistance in Multiple Myeloma.

    PubMed

    Li, Bingzong; Fu, Jinxiang; Chen, Ping; Ge, Xueping; Li, Yali; Kuiatse, Isere; Wang, Hua; Wang, Huihan; Zhang, Xingding; Orlowski, Robert Z

    2015-12-11

    Resistance to the proteasome inhibitor bortezomib is an emerging clinical problem whose mechanisms have not been fully elucidated. We considered the possibility that this could be associated with enhanced proteasome activity in part through the action of the proteasome maturation protein (POMP). Bortezomib-resistant myeloma models were used to examine the correlation between POMP expression and bortezomib sensitivity. POMP expression was then modulated using genetic and pharmacologic approaches to determine the effects on proteasome inhibitor sensitivity in cell lines and in vivo models. Resistant cell lines were found to overexpress POMP, and while its suppression in cell lines enhanced bortezomib sensitivity, POMP overexpression in drug-naive cells conferred resistance. Overexpression of POMP was associated with increased levels of nuclear factor (erythroid-derived 2)-like (NRF2), and NRF2 was found to bind to and activate the POMP promoter. Knockdown of NRF2 in bortezomib-resistant cells reduced POMP levels and proteasome activity, whereas its overexpression in drug-naive cells increased POMP and proteasome activity. The NRF2 inhibitor all-trans-retinoic acid reduced cellular NRF2 levels and increased the anti-proliferative and pro-apoptotic activities of bortezomib in resistant cells, while decreasing proteasome capacity. Finally, the combination of all-trans-retinoic acid with bortezomib showed enhanced activity against primary patient samples and in a murine model of bortezomib-resistant myeloma. Taken together, these studies validate a role for the NRF2/POMP axis in bortezomib resistance and identify NRF2 and POMP as potentially attractive targets for chemosensitization to this proteasome inhibitor.

  3. Computational models of adult neurogenesis

    NASA Astrophysics Data System (ADS)

    Cecchi, Guillermo A.; Magnasco, Marcelo O.

    2005-10-01

    Experimental results in recent years have shown that adult neurogenesis is a significant phenomenon in the mammalian brain. Little is known, however, about the functional role played by the generation and destruction of neurons in the context of an adult brain. Here, we propose two models where new projection neurons are incorporated. We show that in both models, using incorporation and removal of neurons as a computational tool, it is possible to achieve a higher computational efficiency that in purely static, synapse-learning-driven networks. We also discuss the implication for understanding the role of adult neurogenesis in specific brain areas like the olfactory bulb and the dentate gyrus.

  4. Augmenting The HST Pure Parallel Observations

    NASA Astrophysics Data System (ADS)

    Patterson, Alan; Soutchkova, G.; Workman, W.

    2012-05-01

    Pure Parallel (PP) programs, designated GO/PAR, are a subgroup of General Observer (GO) programs. PP execute simultaneously with prime GO observations to which they are "attached". The PP observations can be performed with ACS/WFC, WFC3/UVIS or WFC3/IR and can be attached only to GO visits in which the instruments are either COS or STIS. The current HST Parallel Observation Processing System (POPS) was introduced after the Servicing Mission 4. It increased the HST productivity by 10% in terms of the utilization of HST prime orbits and was highly appreciated by the HST observers, allowing them to design efficient, multi-orbit survey projects for collecting large amounts of data on identifiable targets. The results of the WFC3 Infrared Spectroscopic Parallel Survey (WISP), Hubble Infrared Pure Parallel Imaging Extragalactic Survey (HIPPIES), and The Brightest-of-Reionizing Galaxies Pure Parallel Survey (BoRG) exemplify this benefit. In Cycle 19, however, the full advantage of GO/PARs came under risk. Whereas each of the previous cycles provided over one million seconds of exposure time for PP, in Cycle 19 that number reduced to 680,000 seconds. This dramatic decline occurred because of fundamental changes in the construction of COS prime observations. To preserve the science output of PP, the PP Working Group was tasked to find a way to recover the lost time and maximize the total time available for PP observing. The solution was to expand the definition of a PP opportunity to allow PP exposures to span one or more primary exposure readouts. So starting in HST Cycle 20, PP opportunities will no longer be limited to GO visits with a single uninterrupted exposure in an orbit. The resulting enhancements in HST Cycle 20 to the PP opportunity identification and matching process are expected to restore the PP time to previously achieved and possibly even greater levels.

  5. chemf: A purely functional chemistry toolkit

    PubMed Central

    2012-01-01

    Background Although programming in a type-safe and referentially transparent style offers several advantages over working with mutable data structures and side effects, this style of programming has not seen much use in chemistry-related software. Since functional programming languages were designed with referential transparency in mind, these languages offer a lot of support when writing immutable data structures and side-effects free code. We therefore started implementing our own toolkit based on the above programming paradigms in a modern, versatile programming language. Results We present our initial results with functional programming in chemistry by first describing an immutable data structure for molecular graphs together with a couple of simple algorithms to calculate basic molecular properties before writing a complete SMILES parser in accordance with the OpenSMILES specification. Along the way we show how to deal with input validation, error handling, bulk operations, and parallelization in a purely functional way. At the end we also analyze and improve our algorithms and data structures in terms of performance and compare it to existing toolkits both object-oriented and purely functional. All code was written in Scala, a modern multi-paradigm programming language with a strong support for functional programming and a highly sophisticated type system. Conclusions We have successfully made the first important steps towards a purely functional chemistry toolkit. The data structures and algorithms presented in this article perform well while at the same time they can be safely used in parallelized applications, such as computer aided drug design experiments, without further adjustments. This stands in contrast to existing object-oriented toolkits where thread safety of data structures and algorithms is a deliberate design decision that can be hard to implement. Finally, the level of type-safety achieved by Scala highly increased the reliability of our code

  6. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    PubMed

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles.

  7. Are all maximally entangled states pure?

    NASA Astrophysics Data System (ADS)

    Cavalcanti, D.; Brandão, F. G. S. L.; Terra Cunha, M. O.

    2005-10-01

    We study if all maximally entangled states are pure through several entanglement monotones. In the bipartite case, we find that the same conditions which lead to the uniqueness of the entropy of entanglement as a measure of entanglement exclude the existence of maximally mixed entangled states. In the multipartite scenario, our conclusions allow us to generalize the idea of the monogamy of entanglement: we establish the polygamy of entanglement, expressing that if a general state is maximally entangled with respect to some kind of multipartite entanglement, then it is necessarily factorized of any other system.

  8. Electrostatic Precipitation in Nearly Pure Gaseous Nitrogen

    NASA Technical Reports Server (NTRS)

    Buhler, Charles; Calle, Carlos; Clements, Sid; Cox, Bobby; Ritz, Mindy

    2008-01-01

    Electrostatic precipitation was performed in a nearly pure gaseous nitrogen system as a possible remedy for black dust contaminant from high pressure 6000 psi lines at the NASA Kennedy Space Center. The results of a prototype electrostatic precipitator that was built and tested using nitrogen gas at standard atmospheric pressures is presented. High voltage pulsed waveforms are generated using a rotating spark gap system at 30 Hz. A unique dust delivery system utilizing the Venturi effect was devised that supplies a given amount of dust per unit time for testing purposes.

  9. Preparation of a pure molecular quantum gas.

    PubMed

    Herbig, Jens; Kraemer, Tobias; Mark, Michael; Weber, Tino; Chin, Cheng; Nägerl, Hanns-Christoph; Grimm, Rudolf

    2003-09-12

    An ultracold molecular quantum gas is created by application of a magnetic field sweep across a Feshbach resonance to a Bose-Einstein condensate of cesium atoms. The ability to separate the molecules from the atoms permits direct imaging of the pure molecular sample. Magnetic levitation enables study of the dynamics of the ensemble on extended time scales. We measured ultralow expansion energies in the range of a few nanokelvin for a sample of 3000 molecules. Our observations are consistent with the presence of a macroscopic molecular matter wave. PMID:12934014

  10. Synthesis of highly phase pure BSCCO superconductors

    DOEpatents

    Dorris, S.E.; Poeppel, R.B.; Prorok, B.C.; Lanagan, M.T.; Maroni, V.A.

    1995-11-21

    An article and method of manufacture (Bi, Pb)-Sr-Ca-Cu-O superconductor are disclosed. The superconductor is manufactured by preparing a first powdered mixture of bismuth oxide, lead oxide, strontium carbonate, calcium carbonate and copper oxide. A second powdered mixture is then prepared of strontium carbonate, calcium carbonate and copper oxide. The mixtures are calcined separately with the two mixtures then combined. The resulting combined mixture is then subjected to a powder in tube deformation and thermal processing to produce a substantially phase pure (Bi, Pb)-Sr-Ca-Cu-O superconductor. 5 figs.

  11. Synthesis of highly phase pure BSCCO superconductors

    DOEpatents

    Dorris, Stephen E.; Poeppel, Roger B.; Prorok, Barton C.; Lanagan, Michael T.; Maroni, Victor A.

    1995-01-01

    An article and method of manufacture of (Bi, Pb)-Sr-Ca-Cu-O superconductor. The superconductor is manufactured by preparing a first powdered mixture of bismuth oxide, lead oxide, strontium carbonate, calcium carbonate and copper oxide. A second powdered mixture is then prepared of strontium carbonate, calcium carbonate and copper oxide. The mixtures are calcined separately with the two mixtures then combined. The resulting combined mixture is then subjected to a powder in tube deformation and thermal processing to produce a substantially phase pure (Bi, Pb)-Sr-Ca-Cu-O superconductor.

  12. Optical pure spin current injection in graphene

    NASA Astrophysics Data System (ADS)

    Rioux, Julien; Burkard, Guido

    2013-03-01

    Pure spin current injection by optical methods is investigated in single-layer and bilayer graphene within the tight-binding model, including bias and interlayer coupling effects. Interlayer coupling in bilayer graphene has a distinct qualitative effect on the polarization dependence of the spin current injection. In combination with interlayer coupling, which induces trigonal warping of the electronic bands, the bias voltage allows to control the warping at the Fermi surface. The resulting implications for the spin current injection are presented. Unlike the previously presented charge current injection [J. Rioux et al., PRB 83, 195406 (2011)], the effect presented here relies on a single monochromatic beam.

  13. Femtosecond pulses propagation through pure water

    NASA Astrophysics Data System (ADS)

    Naveira, Lucas; Sokolov, Alexei; Byeon, Joong-Hyeok; Kattawar, George

    2007-10-01

    Recently, considerable attention has been dedicated to the field of optical precursors, which can possibly be applied to long-distance underwater communications. Input beam intensities have been carefully adjusted to keep experiments in the linear regime, and some experiments have shown violation of the Beer-Lambert law. We are presently carrying out experiments using femtosecond laser pulses propagating through pure water strictly in the linear regime to study this interesting and important behavior. We are also employing several new and innovative schemes to more clearly define the phenomena.

  14. Purely cubic action for string field theory

    NASA Technical Reports Server (NTRS)

    Horowitz, G. T.; Lykken, J.; Rohm, R.; Strominger, A.

    1986-01-01

    It is shown that Witten's (1986) open-bosonic-string field-theory action and a closed-string analog can be written as a purely cubic interaction term. The conventional form of the action arises by expansion around particular solutions of the classical equations of motion. The explicit background dependence of the conventional action via the Becchi-Rouet-Stora-Tyutin operator is eliminated in the cubic formulation. A closed-form expression is found for the full nonlinear gauge-transformation law.

  15. Towards chirality-pure carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Zhang, Yani; Zheng, Lianxi

    2010-10-01

    Current as-grown single-walled carbon nanotubes vary in diameter and chirality, which results in variations in their electronic and optical properties. Two approaches have been intensively studied to obtain chirality-pure nanotube structures and thus uniform properties for advanced applications. The first approach involves the post-synthesis separation according to the nanotubes' chiral vectors (n, m), and the second one involves direct synthes of carbon nanotubes with the same (n, m). This paper reviews the efforts along these two directions, with emphasis on the most recent progress of post-synthesis separation and the perspectives of controllable synthesis.

  16. Are all maximally entangled states pure?

    SciTech Connect

    Cavalcanti, D.; Brandao, F.G.S.L.; Terra Cunha, M.O.

    2005-10-15

    We study if all maximally entangled states are pure through several entanglement monotones. In the bipartite case, we find that the same conditions which lead to the uniqueness of the entropy of entanglement as a measure of entanglement exclude the existence of maximally mixed entangled states. In the multipartite scenario, our conclusions allow us to generalize the idea of the monogamy of entanglement: we establish the polygamy of entanglement, expressing that if a general state is maximally entangled with respect to some kind of multipartite entanglement, then it is necessarily factorized of any other system.

  17. Cold-Sprayed Nanostructured Pure Cobalt Coatings

    NASA Astrophysics Data System (ADS)

    Cavaliere, P.; Perrone, A.; Silvello, A.

    2016-08-01

    Cold-sprayed pure cobalt coatings were deposited on carbon-steel substrate. Submicrometer particles for spraying were produced via cryomilling. Deposits were produced using different processing conditions (gas temperature and pressure, nozzle-to-substrate distance) to evaluate the resulting variations in grain size dimension, microhardness, adhesion strength, and porosity. The coating mechanical properties improved greatly with higher temperature and carrying-gas pressure. The coating microstructure was analyzed as a function of spraying condition by transmission electron microscopy (TEM) observations, revealing many different microstructural features for coatings experiencing low or high strain rates during deposition.

  18. Pure phase decoherence in a ring geometry

    SciTech Connect

    Zhu, Z.; Aharony, A.; Entin-Wohlman, O.; Stamp, P. C. E.

    2010-06-15

    We study the dynamics of pure phase decoherence for a particle hopping around an N-site ring, coupled both to a spin bath and to an Aharonov-Bohm flux which threads the ring. Analytic results are found for the dynamics of the influence functional and of the reduced density matrix of the particle, both for initial single wave-packet states, and for states split initially into two separate wave packets moving at different velocities. We also give results for the dynamics of the current as a function of time.

  19. Beyond Sex Education: How Adults Relate to Children's Sensuality.

    ERIC Educational Resources Information Center

    Fogel, Alan

    Current cultural attitudes toward children's sexuality resemble attitudes toward adults' sexuality; there is an emphasis on purely genital and orgasmic pleasure. Adults and children need warmth, physical contact, and a sense of belonging for which genital stimulation may be unnecessary or inappropriate. Children's sexual advances to adults, as…

  20. Tipifarnib in Treating Older Patients With Previously Untreated Acute Myeloid Leukemia

    ClinicalTrials.gov

    2013-03-22

    Acute Myeloid Leukemia With Multilineage Dysplasia Following Myelodysplastic Syndrome; Adult Acute Basophilic Leukemia; Adult Acute Eosinophilic Leukemia; Adult Acute Erythroid Leukemia (M6); Adult Acute Megakaryoblastic Leukemia (M7); Adult Acute Minimally Differentiated Myeloid Leukemia (M0); Adult Acute Monoblastic Leukemia (M5a); Adult Acute Monoblastic Leukemia and Acute Monocytic Leukemia (M5); Adult Acute Monocytic Leukemia (M5b); Adult Acute Myeloblastic Leukemia With Maturation (M2); Adult Acute Myeloblastic Leukemia Without Maturation (M1); Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Acute Myelomonocytic Leukemia (M4); Adult Erythroleukemia (M6a); Adult Pure Erythroid Leukemia (M6b); Cellular Diagnosis, Adult Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

  1. Nanoporous Au: an unsupported pure gold catalyst?

    SciTech Connect

    Wittstock, A; Neumann, B; Schaefer, A; Dumbuya, K; Kuebel, C; Biener, M; Zielasek, V; Steinrueck, H; Gottfried, M; Biener, J; Hamza, A; B?umer, M

    2008-09-04

    The unique properties of gold especially in low temperature CO oxidation have been ascribed to a combination of various effects. In particular, particle sizes below a few nm and specific particle-support interactions have been shown to play important roles. On the contrary, recent reports revealed that monolithic nanoporous gold (npAu) prepared by leaching a less noble metal, such as Ag, out of the corresponding alloy can also exhibit remarkably high catalytic activity for CO oxidation, even though no support is present. Therefore, it was claimed to be a pure and unsupported gold catalyst. We investigated npAu with respect to its morphology, surface composition and catalytic properties. In particular, we studied the reaction kinetics for low temperature CO oxidation in detail taking mass transport limitation due to the porous structure of the material into account. Our results reveal that Ag, even if removed almost completely from the bulk, segregates to the surface resulting in surface concentrations of up to 10 at%. Our data suggest that this Ag plays a significant role in activation of molecular oxygen. Therefore, npAu should be considered as a bimetallic catalyst rather than a pure Au catalyst.

  2. LHC Signals of Pure Gravity Mediation

    NASA Astrophysics Data System (ADS)

    Feldstein, Brian

    2013-05-01

    Evidence is mounting that natural supersymmetry at the weak scale is not realized in nature. This evidence comes from collider searches, a lack of new flavor changing neutral current effects, and now also the size of the measured Higgs mass. On the other hand, string theory suggests that supersymmetry might be present at some energy scale, and gauge coupling unification and dark matter imply that that energy scale may be relatively low. The simplest model to address all of these hints is arguably "pure gravity mediation", in which the scalar superpartner masses are taken to be perhaps 100 TeV, with gauginos automatically acquiring loop factor suppressed masses of order TeV. The gauginos might then be the only superpartners accessible to the LHC. Unification and LSP dark matter are maintained (with a wino LSP) at the cost of a 10-5 or 10-6 fine tuning. Here I will discuss the structure and LHC phenomenology of pure gravity mediation.

  3. Light Higgsinos in pure gravity mediation

    NASA Astrophysics Data System (ADS)

    Evans, Jason L.; Ibe, Masahiro; Olive, Keith A.; Yanagida, Tsutomu T.

    2015-03-01

    Pure gravity mediation, with two free parameters, is a minimalistic approach to supergravity models, yet it is capable of incorporating radiative electroweak symmetry breaking, a Higgs mass in agreement with the experimental measurement, without violating any phenomenological constraints. The model may also contain a viable dark matter candidate in the form of a wino. Here, we extend the minimal model by allowing the μ term to be a free parameter equivalent to allowing the two Higgs soft masses, m1 and m2, to differ from other scalar masses, which are set by the gravitino mass. In particular, we examine the region of parameter space where μ ≪m3 /2, in which case the Higgsino becomes the lightest supersymmetric particle and a dark matter candidate. We also consider a generalization of pure gravity mediation that incorporates a Peccei-Quinn symmetry which determines the μ term dynamically. In this case we show that the dark matter may either be in the form of an axion and/or a neutralino and that the lightest supersymmetric particle may be either a wino, bino, or Higgsino.

  4. Cosmic Shear - with ACS Pure Parallel Observations

    NASA Astrophysics Data System (ADS)

    Ratnatunga, Kavan

    2002-07-01

    The ACS, with greater sensitivity and sky coverage, will extend our ability to measure the weak gravitational lensing of galaxy images caused by the large scale distribution of dark matter. We propose to use the ACS in pure parallel {non- proprietary} mode, following the guidelines of the ACS Default Pure Parallel Program. Using the HST Medium Deep Survey WFPC2 database we have measured cosmic shear at arc-min angular scales. The MDS image parameters, in particular the galaxy orientations and axis ratios, are such that any residual corrections due to errors in the PSF or jitter are much smaller than the measured signal. This situation is in stark contrast with ground-based observations. We have also developed a statistical analysis procedure to derive unbiased estimates of cosmic shear from a large number of fields, each of which has a very small number of galaxies. We have therefore set the stage for measurements with the ACS at fainter apparent magnitudes and smaller, 10 arc-second scales corresponding to larger cosmological distances. We will adapt existing MDS WFPC2 maximum likelihood galaxy image analysis algorithms to work with the ACS. The analysis would also yield an online database similar to that in archive.stsci.edu/mds/

  5. Time Evolution of Pure Gravitational Waves

    NASA Astrophysics Data System (ADS)

    Miyama, S. M.

    1981-03-01

    Numerical solutions to the Einstein equations in the case of pure gravitational waves are given. The system is assumed to be axially symmetric and non-rotating. The time symmetric initial data and the conformally flat initial data are obtained by solving the constraint equations at t=0. The time evolution of these initial data depends strongly on the initial amplitude of the gravitational waves. In the case of the low initial amplitude, waves only disperse to null infinity. By comparing the initial gravitational energy with the total energy loss through an r=constant surface, it is concluded that the Newman-Penrose method and the Gibbon-Hawking method are the most desirable for measuring the energy flux of gravitational radiation numerically. In the case that the initial ratio of the spatial extent of the gravitational waves to the Schwarzschild radius (M/2) is smaller than about 300, the waves collapse by themselves, leading to formation of a black hole. The analytic solutions of the linearized Einstein equations for the pure gravitational waves are also shown.

  6. Reflections on Remaining Obstacles in a Primary-Care Oriented Pure PBL Curriculum after Twelve Years of Implementation

    ERIC Educational Resources Information Center

    D'Ottavio, Alberto Enrique; Bassan, Norberto David

    2014-01-01

    A pioneer primary-care oriented pure PBL curriculum, based on constructivism and adult learning theories combined with Morin's complex thinking, was implemented in our medical school since 2002. Regardless of warnings opportunely made because the basic requirements for its successful implementation could not be fully fulfilled in practice, the…

  7. Pure versus Co-Occurring Externalizing and Internalizing Symptoms in Children: The Potential Role of Socio-Developmental Milestones

    ERIC Educational Resources Information Center

    Oland, Alyssa A.; Shaw, Daniel S.

    2005-01-01

    Co-occurring internalizing and externalizing disorders are moderately prevalent in children, adolescents, and adults (Anderson, Williams, McGee, & Silva, 1987; McConaughy & Skiba, 1994), but much remains to be understood regarding why some children show "pure" versus co-occurring internalizing and externalizing symptoms. One possible influence…

  8. Infection of the erythroid cell line, KU812Ep6 with human parvovirus B19 and its application to titration of B19 infectivity.

    PubMed

    Miyagawa, E; Yoshida, T; Takahashi, H; Yamaguchi, K; Nagano, T; Kiriyama, Y; Okochi, K; Sato, H

    1999-12-01

    A human parvovirus B19 (B19) infectivity assay was developed using the erythroid cell line, KU812Ep6. KU812Ep6 was cloned for high efficiency infection with B19 in vitro, in the presence of erythropoietin by a limiting dilution method from the parent cell line, KU812. B19 was effectively propagated in KU812Ep6 and was detected for B19 antigens, VP1 and VP2. The titers of B19 positive sera measured with KU812Ep6 cells were in the range of 10(6) to 10(8) TCID50 ml. This KU812Ep6 infectivity assay had a 10(3)-10(4.5) higher sensitivity than the colony forming unit-erythroid (CFU-e) injury assay. It was calculated that one TCID50 needed 10(3) B19 genome copies, judging from the infectivity assay and semi-quantitative PCR. The KU812Ep6 infectivity assay was also used to determine infectivity of B19 in vitro, and to evaluate inactivation, as well as clearance of the virus. The inactivation of B19 by heating was carried out and infectivity declined from 10(4) TCID50 ml to < 10 TCID50 ml (lower limit of detection) at 60 degrees C for 3 h or at 70 degrees C for 30 min, but only decreased to 10(2.5) TCID50 ml at 50 degrees C for 8 h.

  9. In utero and in vitro effects of benzene and its metabolites on erythroid differentiation and the role of reactive oxygen species

    SciTech Connect

    Badham, Helen J.; Winn, Louise M.

    2010-05-01

    Benzene is a ubiquitous occupational and environmental toxicant. Exposures to benzene both prenatally and during adulthood are associated with the development of disorders such as aplastic anemia and leukemia. Mechanisms of benzene toxicity are unknown; however, generation of reactive oxygen species (ROS) by benzene metabolites may play a role. Little is known regarding the effects of benzene metabolites on erythropoiesis. Therefore, to determine the effects of in utero exposure to benzene on the growth and differentiation of fetal erythroid progenitor cells (CFU-E), pregnant CD-1 mice were exposed to benzene and CFU-E numbers were assessed in fetal liver (hematopoietic) tissue. In addition, to determine the effect of benzene metabolite-induced ROS generation on erythropoiesis, HD3 chicken erythroblast cells were exposed to benzene, phenol, or hydroquinone followed by stimulation of erythrocyte differentiation. Our results show that in utero exposure to benzene caused significant alterations in female offspring CFU-E numbers. In addition, exposure to hydroquinone, but not benzene or phenol, significantly reduced the percentage of differentiated HD3 cells, which was associated with an increase in ROS. Pretreatment of HD3 cells with polyethylene glycol-conjugated superoxide dismutase (PEG-SOD) prevented hydroquinone-induced inhibition of erythropoiesis, supporting the hypothesis that ROS generation is involved in the development of benzene erythrotoxicity. In conclusion, this study provided evidence that ROS generated as a result of benzene metabolism may significantly alter erythroid differentiation, potentially leading to the development of Blood Disorders.

  10. Control of erythroid differentiation: asynchronous expression of the anion transporter and the peripheral components of the membrane skeleton in AEV- and S13-transformed cells

    PubMed Central

    1986-01-01

    Chicken erythroblasts transformed with avian erythroblastosis virus or S13 virus provide suitable model systems with which to analyze the maturation of immature erythroblasts into erythrocytes. The transformed cells are blocked in differentiation at around the colony-forming unit- erythroid stage of development but can be induced to differentiate in vitro. Analysis of the expression and assembly of components of the membrane skeleton indicates that these cells simultaneously synthesize alpha-spectrin, beta-spectrin, ankyrin, and protein 4.1 at levels that are comparable to those of mature erythroblasts. However, they do not express any detectable amounts of anion transporter. The peripheral membrane skeleton components assemble transiently and are subsequently rapidly catabolized, resulting in 20-40-fold lower steady-state levels than are found in maturing erythrocytes. Upon spontaneous or chemically induced terminal differentiation of these cells expression of the anion transporter is initiated with a concommitant increase in the steady- state levels of the peripheral membrane-skeletal components. These results suggest that during erythropoiesis, expression of the peripheral components of the membrane skeleton is initiated earlier than that of the anion transporter. Furthermore, they point a key role for the anion transporter in conferring long-term stability to the assembled erythroid membrane skeleton during terminal differentiation. PMID:2946700

  11. Thalidomide is more efficient than sodium butyrate in enhancing GATA-1 and EKLF gene expression in erythroid progenitors derived from HSCs with β-globin gene mutation

    PubMed Central

    Jalali Far, Mohammad Ali; Dehghani Fard, Ali; Hajizamani, Saiedeh; Mossahebi-Mohammadi, Majid; Yaghooti, Hamid; Saki, Najmaldin

    2016-01-01

    Background: Efficient induction of fetal hemoglobin (HbF) is considered as an effective therapeutic approach in beta thalassemia. HbF inducer agents can induce the expression of γ-globin gene and produce high levels of HbF via different epigenetic and molecular mechanisms. Thalidomide and sodium butyrate are known as HbF inducer drugs. Material and methods: CD133+ stem cells were isolated from umbilical cord blood of a newborn with minor β-thalassemia in order to evaluate the effects of these two drugs on the in vitro expression of GATA-1 and EKLF genes as erythroid transcription factors. CD133+ stem cells were expanded and differentiated into erythroid lineage and then treated with thalidomide and sodium butyrate and finally analyzed by quantitative real-time PCR. Statistical analysis was performed using student’s t-test by SPSS software. Results: Thalidomide and sodium butyrate increased GATA-1 and EKLF gene expression, compared to the non-treated control (P<0.05). Conclusion: Thalidomide was more efficient than sodium butyrate in augmenting expression of GATA-1 and EKLF genes. It seems that GATA-1 and EKLF have crucial roles in the efficient induction of HbF by thalidomide. PMID:27047649

  12. Transcriptional Activity of Erythroid Kruppel-like Factor (EKLF/KLF1) Modulated by PIAS3 (Protein Inhibitor of Activated STAT3)*

    PubMed Central

    Siatecka, Miroslawa; Soni, Shefali; Planutis, Antanas; Bieker, James J.

    2015-01-01

    Erythroid Kruppel-like factor (EKLF or KLF1) is a transcription factor crucial for red cell development that is directly involved in regulation of a large number of erythroid genes. EKLF serves mostly as an activator of expression of these genes; however, it can act also as a repressor. Here, we present evidence that EKLF interacts with proteins from the PIAS (protein inhibitor of activated STAT) family that convey repressive activity to EKLF in the absence of sumoylation. Our studies identify PIAS3 as a transcriptional corepressor of EKLF for at least a subset of its target genes during erythropoiesis (e.g. β-globin, α-hemoglobin stabilizing protein). We demonstrate an interaction between EKLF and PIAS proteins confirmed by in vivo coimmunoprecipitation assays with both exogenous and endogenous proteins. We identified an LXXLL signature motif located near the N terminus of PIAS proteins that, although not involved in the EKLF-PIAS3 interaction, is required for the transrepression activity. Knockdown of endogenous PIAS3 accelerates differentiation of both murine erythroleukemia cells, as well as fetal liver cells, whereas an increase in PIAS3 levels inhibits this increase. Using chromatin immunoprecipitation assays, we show that PIAS3 preferentially occupies the β-globin promoter in undifferentiated murine erythroleukemia cells. Together these results demonstrate that an interaction between EKLF and PIAS3 provides a novel mode of regulation of EKLF activity in the absence of sumolylation and furthermore shows an important involvement of PIAS proteins in erythropoiesis. PMID:25713074

  13. Parvovirus B19 Infection of Human Primary Erythroid Progenitor Cells Triggers ATR-Chk1 Signaling, Which Promotes B19 Virus Replication ▿

    PubMed Central

    Luo, Yong; Lou, Sai; Deng, Xuefeng; Liu, Zhengwen; Li, Yi; Kleiboeker, Steve; Qiu, Jianming

    2011-01-01

    Human parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells of the human bone marrow. Although the mechanism by which the B19V genome replicates in these cells has not been studied in great detail, accumulating evidence has implicated involvement of the cellular DNA damage machinery in this process. Here, we report that, in ex vivo-expanded human erythroid progenitor cells, B19V infection induces a broad range of DNA damage responses by triggering phosphorylation of all the upstream kinases of each of three repair pathways: ATM (ataxia-telangiectasi mutated), ATR (ATM and Rad3 related), and DNA-PKcs (DNA-dependent protein kinase catalytic subunit). We found that phosphorylated ATM, ATR, and DNA-PKcs, and also their downstream substrates and components (Chk2, Chk1, and Ku70/Ku80 complex, respectively), localized within the B19V replication center. Notably, inhibition of kinase phosphorylation (through treatment with either kinase-specific inhibitors or kinase-specific shRNAs) revealed requirements for signaling of ATR and DNA-PKcs, but not ATM, in virus replication. Inhibition of the ATR substrate Chk1 led to similar levels of decreased virus replication, indicating that signaling via the ATR-Chk1 pathway is critical to B19V replication. Notably, the cell cycle arrest characteristic of B19V infection was not rescued by interference with the activity of any of the three repair pathway kinases. PMID:21680529

  14. Cis-vaccenic acid induces differentiation and up-regulates gamma globin synthesis in K562, JK1 and transgenic mice erythroid progenitor stem cells.

    PubMed

    Aimola, Idowu A; Inuwa, Hajiya M; Nok, Andrew J; Mamman, Aisha I; Bieker, James J

    2016-04-01

    Gamma globin induction remains a promising pharmacological therapeutic treatment mode for sickle cell anemia and beta thalassemia, however Hydroxyurea remains the only FDA approved drug which works via this mechanism. In this regard, we assayed the γ-globin inducing capacity of Cis-vaccenic acid (CVA). CVA induced differentiation of K562, JK1 and transgenic mice primary bone marrow hematopoietic progenitor stem cells. CVA also significantly up-regulated γ-globin gene expression in JK-1 and transgenic mice bone marrow erythroid progenitor stem cells (TMbmEPSCs) but not K562 cells without altering cell viability. Increased γ-globin expression was accompanied by KLF1 suppression in CVA induced JK-1 cells. Erythropoietin induced differentiation of JK-1 cells 24h before CVA induction did not significantly alter CVA induced differentiation and γ-globin expression in JK-1 cells. Inhibition of JK-1 and Transgenic mice bone marrow erythroid progenitor stem cells Fatty acid elongase 5 (Elovl5) and Δ(9) desaturase suppressed the γ-globin inductive effects of CVA. CVA treatment failed to rescue γ-globin expression in Elovl5 and Δ(9)-desaturase inhibited cells 48 h post inhibition in JK-1 cells. The data suggests that CVA directly modulates differentiation of JK-1 and TMbmEPSCs, and indirectly modulates γ-globin gene expression in these cells. Our findings provide important clues for further evaluations of CVA as a potential fetal hemoglobin therapeutic inducer. PMID:26879870

  15. Anomalous rectification in a purely electronic memristor

    NASA Astrophysics Data System (ADS)

    Wang, Jingrui; Pan, Ruobing; Cao, Hongtao; Wang, Yang; Liang, Lingyan; Zhang, Hongliang; Gao, Junhua; Zhuge, Fei

    2016-10-01

    An anomalous rectification was observed in a purely electronic memristive device Ti/ZnO/Pt. It could be due to (1) an Ohmic or quasi-Ohmic contact at the ZnO/Pt interface and (2) a Schottky contact at the Ti/ZnO interface. The Ohmic contact originates from the reduction of ZnO occurring in the whole film instead of only at the Ti/ZnO interface. The Schottky contact may come from moisture adsorbed in the nanoporous ZnO. The conduction in the electroformed device is controlled by the carrier trapping/detrapping of the trap sites, inducing a poor rectification and high nonlinearity. Furthermore, a complementary resistive switching was achieved.

  16. Bipedal nanowalker by pure physical mechanisms.

    PubMed

    Cheng, Juan; Sreelatha, Sarangapani; Hou, Ruizheng; Efremov, Artem; Liu, Ruchuan; van der Maarel, Johan R C; Wang, Zhisong

    2012-12-01

    Artificial nanowalkers are inspired by biomolecular counterparts from living cells, but remain far from comparable to the latter in design principles. The walkers reported to date mostly rely on chemical mechanisms to gain a direction; they all produce chemical wastes. Here we report a light-powered DNA bipedal walker based on a design principle derived from cellular walkers. The walker has two identical feet and the track has equal binding sites; yet the walker gains a direction by pure physical mechanisms that autonomously amplify an intrasite asymmetry into a ratchet effect. The nanowalker is free of any chemical waste. It has a distinct thermodynamic feature that it possesses the same equilibrium before and after operation, but generates a truly nonequilibrium distribution during operation. The demonstrated design principle exploits mechanical effects and is adaptable for use in other nanomachines.

  17. Pure White Cell Aplasia and Necrotizing Myositis

    PubMed Central

    Kim, Peter Geon; Suh, Joome; Adelman, Max W.; Oduro, Kwadwo; Williams, Erik; Brunner, Andrew M.; Kuter, David J.

    2016-01-01

    Pure white cell aplasia (PWCA) is a rare hematologic disorder characterized by the absence of neutrophil lineages in the bone marrow with intact megakaryopoiesis and erythropoiesis. PWCA has been associated with autoimmune, drug-induced, and viral exposures. Here, we report a case of a 74-year-old female who presented with severe proximal weakness without pain and was found to have PWCA with nonspecific inflammatory necrotizing myositis and acute liver injury on biopsies. These findings were associated with a recent course of azithromycin and her daily use of a statin. Myositis improved on prednisone but PWCA persisted. With intravenous immunoglobulin and granulocyte-colony stimulating factor therapies, her symptoms and neutrophil counts improved and were sustained for months. PMID:27073704

  18. Fock expansion of multimode pure Gaussian states

    SciTech Connect

    Cariolaro, Gianfranco; Pierobon, Gianfranco

    2015-12-15

    The Fock expansion of multimode pure Gaussian states is derived starting from their representation as displaced and squeezed multimode vacuum states. The approach is new and appears to be simpler and more general than previous ones starting from the phase-space representation given by the characteristic or Wigner function. Fock expansion is performed in terms of easily evaluable two-variable Hermite–Kampé de Fériet polynomials. A relatively simple and compact expression for the joint statistical distribution of the photon numbers in the different modes is obtained. In particular, this result enables one to give a simple characterization of separable and entangled states, as shown for two-mode and three-mode Gaussian states.

  19. Pure Varus Injury to the Knee Joint.

    PubMed

    Yoo, Jae Ho; Lee, Jung Ha; Chang, Chong Bum

    2015-06-01

    A 30-year-old male was involved in a car accident. Radiographs revealed a depressed marginal fracture of the medial tibial plateau and an avulsion fracture of the fibular head. Magnetic resonance imaging showed avulsion fracture of Gerdy's tubercle, injury to the posterior cruciate ligament (PCL), posterior horn of the medial meniscus, and the attachments of the lateral collateral ligament and the biceps femoris tendon. The depressed fracture of the medial tibial plateau was elevated and stabilized using a cannulated screw and washer. The injured lateral and posterolateral corner (PLC) structures were repaired and augmented by PLC reconstruction. However, the avulsion fracture of Gerdy's tubercle was not fixed because it was minimally displaced and the torn PCL was also not repaired or reconstructed. We present a unique case of pure varus injury to the knee joint. This case contributes to our understanding of the mechanism of knee injury and provides insight regarding appropriate treatment plans for this type of injury. PMID:26217477

  20. Adsorption of hydroxyacetone on pure ice surfaces.

    PubMed

    Petitjean, Mélanie; Darvas, Maria; Picaud, Sylvain; Jedlovszky, Pál; Le Calvé, Stéphane

    2010-12-17

    The adsorption of hydroxyacetone molecules at the surface of ice is investigated by means of flow-tube reactor measurements in the temperature range: 213-253 K. The number of molecules adsorbed per surface unit is conventionally plotted as a function of the absolute gas concentration of hydroxyacetone and is compared to that previously obtained for acetone and ethanol. The enthalpy of adsorption and the monolayer capacity at the ice surface are determined. In addition, molecular dynamics simulations are performed to support the experimental results. However, it is shown that the available interaction potential between hydroxyacetone and ice is not accurate enough to allow a robust detailed analysis of the adsorption process. Finally, a rapid estimation of the hydroxyacetone partitioning between the gas phase and ice shows that in the densest ice clouds, up to 29% of hydroxyacetone could be adsorbed on pure ice surfaces at 203 K.

  1. Synaptic devices based on purely electronic memristors

    NASA Astrophysics Data System (ADS)

    Pan, Ruobing; Li, Jun; Zhuge, Fei; Zhu, Liqiang; Liang, Lingyan; Zhang, Hongliang; Gao, Junhua; Cao, Hongtao; Fu, Bing; Li, Kang

    2016-01-01

    Memristive devices have been widely employed to emulate biological synaptic behavior. In these cases, the memristive switching generally originates from electrical field induced ion migration or Joule heating induced phase change. In this letter, the Ti/ZnO/Pt structure was found to show memristive switching ascribed to a carrier trapping/detrapping of the trap sites (e.g., oxygen vacancies or zinc interstitials) in ZnO. The carrier trapping/detrapping level can be controllably adjusted by regulating the current compliance level or voltage amplitude. Multi-level conductance states can, therefore, be realized in such memristive device. The spike-timing-dependent plasticity, an important Hebbian learning rule, has been implemented in this type of synaptic device. Compared with filamentary-type memristive devices, purely electronic memristors have potential to reduce their energy consumption and work more stably and reliably, since no structural distortion occurs.

  2. Preparation and accurate measurement of pure ozone.

    PubMed

    Janssen, Christof; Simone, Daniela; Guinet, Mickaël

    2011-03-01

    Preparation of high purity ozone as well as precise and accurate measurement of its pressure are metrological requirements that are difficult to meet due to ozone decomposition occurring in pressure sensors. The most stable and precise transducer heads are heated and, therefore, prone to accelerated ozone decomposition, limiting measurement accuracy and compromising purity. Here, we describe a vacuum system and a method for ozone production, suitable to accurately determine the pressure of pure ozone by avoiding the problem of decomposition. We use an inert gas in a particularly designed buffer volume and can thus achieve high measurement accuracy and negligible degradation of ozone with purities of 99.8% or better. The high degree of purity is ensured by comprehensive compositional analyses of ozone samples. The method may also be applied to other reactive gases. PMID:21456766

  3. Pure Rotational Spectroscopy of Vinyl Mercaptan

    NASA Astrophysics Data System (ADS)

    Martin-Drumel, Marie-Aline; Zingsheim, Oliver; Thorwirth, Sven; Müller, Holger S. P.; Lewen, Frank; Schlemmer, Stephan

    2014-06-01

    Vinyl mercaptan (ethenethiol, CH_2=CHSH) exists in the gas phase in two distinct rotameric forms, syn (planar) and anti (quasi-planar in the ground vibrational state). The microwave spectra of these two isomers were investigated previously, however not exceeding frequencies of about 65 GHz. In the present investigation, the pure rotational spectra of both species have been investigated at millimeter wavelengths. Vinyl mercaptan was produced in a radiofrequency discharge through a constant flow of ethanedithiol at low pressure. Both syn and anti rotamers were observed and new extensive sets of molecular parameters were obtained. Owing to its close structural relationship to vinyl alcohol and the astronomical abundance of complex sulfur-bearing molecules, vinyl mercaptan is a plausible candidate for future radio astronomical searches. M. Tanimoto et al. J. Mol. Spectrosc. 78, 95--105 & 106--119 (1979)

  4. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined...

  5. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 3 2014-01-01 2014-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined...

  6. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined...

  7. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 3 2013-01-01 2013-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined...

  8. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Tolerances § 201.64 Pure live seed. The tolerance for pure live seed shall be determined...

  9. ThermoData Engine Database - Pure Compounds and Binary Mixtures

    National Institute of Standards and Technology Data Gateway

    SRD 103b NIST ThermoData Engine Version 6.0 - Pure CompoThermoData Engine Database - Pure Compounds and Binary Mixtures (PC database for purchase)   This database contains property data for more than 21,000 pure compounds, 37,500 binary mixtures, 10,000 ternary mixtures, and 6,000 chemical reactions.

  10. Social cognition in "pure" delusional disorder.

    PubMed

    Bömmer, Isabel; Brüne, Martin

    2006-09-01

    Introduction. Delusional disorders are characterised by monothematic, "encapsulated" and incorrigible false beliefs and misinterpretations of social signals. Due to the rarity of cases with "pure" delusional disorder (DD) in clinical settings most studies of social cognition in delusional patients have focused on patients with paranoid schizophrenia. In the present study we sought to examine emotion recognition, theory of mind abilities, and pragmatic language comprehension in patients with delusional disorder. Methods. Social cognition was assessed in 21 patients recruited over a 3-year period who were diagnosed with delusional disorder, paranoid, erotomanic, or jealous type. In addition to an emotion recognition and theory of mind test battery, we included a novel German Proverb Test, which has been found indicative of subtle theory of mind deficits in schizophrenic patients. Executive functioning was assessed using the Wisconsin Card Sorting Test (WCST). Psychopathology was measured using the Positive and Negative Symptoms Scale (PANSS). Patients' task performance was compared to a group of 22 healthy control persons paralleled for verbal intelligence, education, and age. Results. Patients with DD made significantly more perseverative errors in the WCST, they performed more poorly on the theory of mind tasks and the proverb test, but were unimpaired in basic emotion recognition abilities relative to controls. When executive functioning was co-varied out, the group differences in theory of mind disappeared, whereas the greater propensity of patients with DD to interpret proverbs literally remained significant. Conclusions. In "pure" DD the basic social cognitive abilities appear to be preserved. Difficulties in metaphorical speech comprehension and executive functioning could, however, indicate more subtle social cognitive deficits in these patients. PMID:17354084

  11. [Pure form of primary ovarian choriocarcinoma. Report of a case].

    PubMed

    Trigueros Velázquez, M; Sereno Coló, J A; Villagrán Urive, J

    1995-08-01

    Ovarian choriocarcinoma from the germ cells is a very rare malignant neoplasia. About the pure form, very few cases have been reported in medical literature. Ovarian choriocarcinoma may originate in three modalities. As primary choriocarcinoma associated to ovarian pregnancy, 2. As a metastatic ovarian carcinoma, from other organs, mainly the uterus, 3. As a primary tumour of germ cells with differentiation to trophoblastic structures. The latter grows in girls or in adult woman, generally young, where necessarily pregnancy has to be excluded. A case is presented of a 21 years old woman, treated at Hospital General "Dr. Miguel Silva", Morelia, Mich. single, without sexual life, with an abdomino-pelvic tumor of 24 cm, from the right ovary and adhered to ascending colon. Beta subunity of chorionic gonadotrophin was 200,000 mUI/ml of blood plasma. At laparotomy a right ovarian tumour, with infiltration to ascending colon, was found; this required total hysterectomy with bilateral salpingo-oophorectomy and right hemicolectomy. After surgery the patient received chemotherapy with cisplatin, bleomicin and vinblastine. After the third treatment cycle and at three months, chorionic gonadotropin became negative; and at four years follow up residual tumoural activity is absent. Largest mortality with these tumors appears during early post-operative stage and it is atributed to the tumour itself or to post-operative complications. If the patient survives this stage and with a good chemotherapeutic program, survival and even complete cure, occurs.

  12. The evolution of pure alexia: a longitudinal study of recovery.

    PubMed

    Behrmann, M; Black, S E; Bub, D

    1990-10-01

    This case report documents the partial recovery, over a 12-month period, of pure alexia in an adult female following a left occipital infarction. Measures of speed and accuracy were obtained on an oral reading and a lexical decision task immediately postonset and then on 10 subsequent occasions. Explicit letter-by-letter reading was observed only during the first week poststroke but a significant effect of word length was seen in all testing sessions. Reading accuracy was relatively good at all stages and reading latency showed a remarkable decrease over time but did not reach normal reading rates. The inability to use higher-order orthographic knowledge, as manifest in the absence of a word superiority effect, was still noted at one year postonset. We therefore concluded that the change in behavior was attributable to increased proficiency in the use of the adaptive letter-by-letter procedure rather than to the resolution of the underlying deficit. It is suggested that longitudinal neurobehavioral studies add to our understanding of the alexic deficit and provide insight into the recovery process. PMID:2285860

  13. In-house pureed food production in long-term care: perspectives of dietary staff and implications for improvement.

    PubMed

    Ilhamto, Nila; Anciado, Katrina; Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Texture modification of foods to a pureed consistency is a common management approach for older adults with dysphagia. Long-term care (LTC) facilities commonly produce some pureed food in-house. This study investigated challenges and preferred practices associated with the production of pureed food in LTC facilities. Nutrition Managers (n = 27) and cooks (n = 26) from 25 Ontario LTC facilities were recruited for one-on-one, semistructured interviews. Interviews were digitally recorded, transcribed, and analyzed using inductive thematic analysis. Four themes arose from the data to exemplify challenges in production, including (a) difficulty in using standardized recipes, (b) varied interpretation of governmental guidelines, (c) lack of consistency in terminology and texture, and (d) wanting to improve the visual appeal. These challenges were reported to reduce the quality of in-house produced pureed food. Preferred practices to overcome these challenges were also provided by participants, such as involving cooks in pureed recipe improvements and tailoring to the specific needs of residents. Incorporation of these practices into pureed food production may help to shape and improve future practice and pureed food products.

  14. Accelerating degradation rate of pure iron by zinc ion implantation.

    PubMed

    Huang, Tao; Zheng, Yufeng; Han, Yong

    2016-12-01

    Pure iron has been considered as a promising candidate for biodegradable implant applications. However, a faster degradation rate of pure iron is needed to meet the clinical requirement. In this work, metal vapor vacuum arc technology was adopted to implant zinc ions into the surface of pure iron. Results showed that the implantation depth of zinc ions was about 60 nm. The degradation rate of pure iron was found to be accelerated after zinc ion implantation. The cytotoxicity tests revealed that the implanted zinc ions brought a slight increase on cytotoxicity of the tested cells. In terms of hemocompatibility, the hemolysis of zinc ion implanted pure iron was lower than 2%. However, zinc ions might induce more adhered and activated platelets on the surface of pure iron. Overall, zinc ion implantation can be a feasible way to accelerate the degradation rate of pure iron for biodegradable applications. PMID:27482462

  15. Accelerating degradation rate of pure iron by zinc ion implantation

    PubMed Central

    Huang, Tao; Zheng, Yufeng; Han, Yong

    2016-01-01

    Pure iron has been considered as a promising candidate for biodegradable implant applications. However, a faster degradation rate of pure iron is needed to meet the clinical requirement. In this work, metal vapor vacuum arc technology was adopted to implant zinc ions into the surface of pure iron. Results showed that the implantation depth of zinc ions was about 60 nm. The degradation rate of pure iron was found to be accelerated after zinc ion implantation. The cytotoxicity tests revealed that the implanted zinc ions brought a slight increase on cytotoxicity of the tested cells. In terms of hemocompatibility, the hemolysis of zinc ion implanted pure iron was lower than 2%. However, zinc ions might induce more adhered and activated platelets on the surface of pure iron. Overall, zinc ion implantation can be a feasible way to accelerate the degradation rate of pure iron for biodegradable applications. PMID:27482462

  16. Stable pure state quantum tomography from five orthonormal bases

    NASA Astrophysics Data System (ADS)

    Carmeli, Claudio; Heinosaari, Teiko; Kech, Michael; Schultz, Jussi; Toigo, Alessandro

    2016-08-01

    For any finite-dimensional Hilbert space, we construct explicitly five orthonormal bases such that the corresponding measurements allow for efficient tomography of an arbitrary pure quantum state. This means that such measurements can be used to distinguish an arbitrary pure state from any other state, pure or mixed, and the pure state can be reconstructed from the outcome distribution in a feasible way. The set of measurements we construct is independent of the unknown state, and therefore our results provide a fixed scheme for pure state tomography, as opposed to the adaptive (state-dependent) scheme proposed by Goyeneche et al. (Phys. Rev. Lett., 115 (2015) 090401). We show that our scheme is robust with respect to noise, in the sense that any measurement scheme which approximates these measurements well enough is equally suitable for pure state tomography. Finally, we present two convex programs which can be used to reconstruct the unknown pure state from the measurement outcome distributions.

  17. AgraPure Mississippi Biomass Project

    SciTech Connect

    Blackwell,D.A; Broadhead, L.W.; Harrell, W.J.

    2006-03-31

    The AgraPure Mississippi Biomass project was a congressionally directed project, initiated to study the utilization of Mississippi agricultural byproducts and waste products in the production of bio-energy and to determine the feasibility of commercialization of these agricultural byproducts and waste products as feedstocks in the production of energy. The final products from this project were two business plans; one for a Thermal plant, and one for a Biodiesel/Ethanol plant. Agricultural waste fired steam and electrical generating plants and biodiesel plants were deemed the best prospects for developing commercially viable industries. Additionally, oil extraction methods were studied, both traditional and two novel techniques, and incorporated into the development plans. Mississippi produced crop and animal waste biomasses were analyzed for use as raw materials for both industries. The relevant factors, availability, costs, transportation, storage, location, and energetic value criteria were considered. Since feedstock accounts for more than 70 percent of the total cost of producing biodiesel, any local advantages are considered extremely important in developing this particular industry. The same factors must be evaluated in assessing the prospects of commercial operation of a steam and electrical generation plant. Additionally, the access to the markets for electricity is more limited, regulated and tightly controlled than the liquid fuel markets. Domestically produced biofuels, both biodiesel and ethanol, are gaining more attention and popularity with the consuming public as prices rise and supplies of foreign crude become less secure. Biodiesel requires no major modifications to existing diesel engines or supply chain and offers significant environmental benefits. Currently the biodiesel industry requires Federal and State incentives to allow the industry to develop and become self-sustaining. Mississippi has available the necessary feedstocks and is

  18. Memory for pure tone sequences without contour.

    PubMed

    Lefebvre, Christine; Jolicœur, Pierre

    2016-06-01

    We presented pure tones interspersed with white noise sounds to disrupt contour perception in an acoustic short-term memory (ASTM) experiment during which we recorded the electroencephalogram. The memory set consisted of seven stimuli, 0, 1, 2, 3, or 4 of which were to-be-remembered tones. We estimated each participant׳s capacity, K, for each set size and measured the amplitude of the SAN (sustained anterior negativity, an ERP related to acoustic short-term memory). We correlated their K slopes with their SAN amplitude slopes as a function of set size, and found a significant link between performance and the SAN: a larger increase in SAN amplitude was linked with a larger number of stimuli maintained in ASTM. The SAN decreased in amplitude in the later portion of the silent retention interval, but the correlation between the SAN and capacity remained strong. These results show the SAN is not an index of contour but rather an index of the maintenance of individual objects in STM. This article is part of a Special Issue entitled SI: Auditory working memory. PMID:26903419

  19. Electron Acoustic Waves in Pure Ion Plasmas

    NASA Astrophysics Data System (ADS)

    Anderegg, F.; Affolter, M.; Driscoll, C. F.; O'Neil, T. M.; Valentini, F.

    2012-10-01

    Electron Acoustic Waves (EAWs) are the low-frequency branch of near-linear Langmuir (plasma) waves: the frequency is such that the complex dielectric function (Dr, Di) has Dr= 0; and ``flattening'' of f(v) near the wave phase velocity vph gives Di=0 and eliminates Landau damping. Here, we observe standing axisymmetric EAWs in a pure ion column.footnotetextF. Anderegg, et al., Phys. Rev. Lett. 102, 095001 (2009). At low excitation amplitudes, the EAWs have vph˜1.4 v, in close agreement with near-linear theory. At moderate excitation strengths, EAW waves are observed over a range of frequencies, with 1.3 v < vph< 2.1 v. Here, the final wave frequency may differ from the excitation frequency since the excitation modifies f (v); and recent theory analyzes frequency shifts from ``corners'' of a plateau at vph.footnotetextF. Valentini et al., arXiv:1206.3500v1. Large amplitude EAWs have strong phase-locked harmonic content, and experiments will be compared to same-geometry simulations, and to simulations of KEENfootnotetextB. Afeyan et al., Proc. Inertial Fusion Sci. and Applications 2003, A.N.S. Monterey (2004), p. 213. waves in HEDLP geometries.

  20. Peccei-Quinn symmetric pure gravity mediation

    NASA Astrophysics Data System (ADS)

    Evans, Jason L.; Ibe, Masahiro; Olive, Keith A.; Yanagida, Tsutomu T.

    2014-07-01

    Successful models of pure gravity mediation (PGM) with radiative electroweak symmetry breaking can be expressed with as few as two free parameters, which can be taken as the gravitino mass and . These models easily support a 125-126 GeV Higgs mass at the expense of a scalar spectrum in the multi-TeV range and a much lighter wino as the lightest supersymmetric particle. In these models, it is also quite generic that the Higgs mixing mass parameter, , which is determined by the minimization of the Higgs potential is also in the multi-TeV range. For , the thermal relic density of winos is too small to account for the dark matter. The same is true for unless the gravitino mass is of order 500 TeV. Here, we consider the origin of a multi-TeV parameter arising from the breakdown of a Peccei-Quinn (PQ) symmetry. A coupling of the PQ-symmetry breaking field, , to the MSSM Higgs doublets, naturally leads to a value of TeV and of the order that is required in PGM models. In this case, axions make up the dark matter or some fraction of the dark matter with the remainder made up from thermal or non-thermal winos. We also provide solutions to the problem of isocurvature fluctuations with axion dark matter in this context.

  1. Foaming of mixtures of pure hydrocarbons

    NASA Technical Reports Server (NTRS)

    Robinson, J. V.; Woods, W. W.

    1950-01-01

    Mixtures of pure liquid hydrocarbons are capable of foaming. Nine hydrocarbons were mixed in pairs, in all possible combinations, and four proportions of each combination. These mixtures were sealed in glass tubes, and the foaming was tested by shaking. Mixtures of aliphatic with other aliphatic hydrocarbons, or of alkyl benzenes with other alkyl benzenes, did not foam. Mixtures of aliphatic hydrocarbons with alkyl benzenes did foam. The proportions of the mixtures greatly affected the foaming, the maximum foaming of 12 of 20 pairs being at the composition 20 percent aliphatic hydrocarbon, 80 percent alkyl benzene. Six seconds was the maximum foam lifetime of any of these mixtures. Aeroshell 120 lubricating oil was fractionated into 52 fractions and a residue by extraction with acetone in a fractionating extractor. The index of refraction, foam lifetime, color, and viscosity of these fractions were measured. Low viscosity and high index fractions were extracted first. The viscosity of the fractions extracted rose and the index decreased as fractionation proceeded. Foam lifetimes and color were lowest in the middle fractions. Significance is attached to the observation that none of the foam lifetimes of the fractions or residue is as high as the foam lifetime of the original Aeroshell, indicating that the foaming is not due to a particular foaming constituent, but rather to the entire mixture.

  2. Memory for pure tone sequences without contour.

    PubMed

    Lefebvre, Christine; Jolicœur, Pierre

    2016-06-01

    We presented pure tones interspersed with white noise sounds to disrupt contour perception in an acoustic short-term memory (ASTM) experiment during which we recorded the electroencephalogram. The memory set consisted of seven stimuli, 0, 1, 2, 3, or 4 of which were to-be-remembered tones. We estimated each participant׳s capacity, K, for each set size and measured the amplitude of the SAN (sustained anterior negativity, an ERP related to acoustic short-term memory). We correlated their K slopes with their SAN amplitude slopes as a function of set size, and found a significant link between performance and the SAN: a larger increase in SAN amplitude was linked with a larger number of stimuli maintained in ASTM. The SAN decreased in amplitude in the later portion of the silent retention interval, but the correlation between the SAN and capacity remained strong. These results show the SAN is not an index of contour but rather an index of the maintenance of individual objects in STM. This article is part of a Special Issue entitled SI: Auditory working memory.

  3. Pure inorganic separator for lithium ion batteries.

    PubMed

    He, Meinan; Zhang, Xinjie; Jiang, Kuiyang; Wang, Joe; Wang, Yan

    2015-01-14

    Battery safety is critical for many applications including portable electronics, hybrid and electric vehicles, and grid storage. For lithium ion batteries, the conventional polymer based separator is unstable at 120 °C and above. In this research, we have developed a pure aluminum oxide nanowire based separator; this separator does not contain any polymer additives or binders; additionally, it is a bendable ceramic. The physical and electrochemical properties of the separator are investigated. The separator has a pore size of about 100 nm, and it shows excellent electrochemical properties under both room and high temperatures. At room temperature, the ceramic separator shows a higher rate capability compared to the conventional Celgard 2500 separator and life cycle performance does not show any degradation. At 120 °C, the cell with the ceramic separator showed a much better cycle performance than the conventional Celgard 2500 separator. Therefore, we believe that this research is really an exciting scientific breakthrough for ceramic separators and lithium ion batteries and could be potentially used in the next generation lithium ion batteries requiring high safety and reliability.

  4. Shifting from preconceptions to pure wonderment.

    PubMed

    Porr, Caroline

    2005-07-01

    The author reflects upon her role as a public health nurse striving to attain practice authenticity. Client assessment and nursing interventions were seemingly sufficient until she became curious about 'Who is this person sitting across from me?' and 'What are her experiences in the world as a lone parent living in poverty at the margins of society?' The author begins to think that she could shift from mere client investigation to pure wonderment about the Other by imagining herself as a researcher, an explorer of another's life world. Ultimately this process enables her to enhance the 'caring' in her practice with the knowledge gained of the perceptions and meanings impoverished clients assigned to their everyday lives. Jurgen Habermas' theory of communicative competence serves as the reference map guiding exploration. The author uses Habermas' theoretical principles of intersubjective mutuality--the validity claims of comprehensibility, truth, sincerity, and legitimacy. Comprehensibility embodies understanding, an attitude of unconditional acceptance, and care respect of another's individual person and self-defined reality. Intersubjective mutuality also requires that one dwell in the moment with the Other, satisfied that communication is founded on truth. Sincerity implies fostering the Other's expression of authentic self apart from oppressive distracters. Lastly, legitimacy reconciles the author's altruistic pursuit to know the Other's ontological truth with the reality of the present world.

  5. Calibration of sound velocimeter in pure water

    NASA Astrophysics Data System (ADS)

    Li, Zhiwei; Zhang, Baofeng; Li, Tao; Zhu, Junchao; Xie, Ziming

    2016-01-01

    Accurate measurement of sound speed is important to calibrate a sound velocity profiler which provides real-time sound velocity to the sonar equipment in oceanographic survey. The sound velocity profiler calculates the sound speed by measuring the time-of-flight of a 1 MHz single acoustic pulse to travel over about 300 mm path. A standard sound velocimeter instrument was invited to calibrate the sound velocity profiler in pure water at temperatures of 278,283, 288, 293, 298, 303 and 308K in a thermostatic vessel at one atmosphere. The sound velocity profiler was deployed in the thermostatic vessel alongside the standard sound velocimeter instrument and two platinum resistance thermometers (PRT) which were calibrated to 0.002k by comparison with a standard PRT. Time of flight circuit board was used to measure the time-of-flight to 22 picosecond precision. The sound speed which was measured by the sound velocity profiler was compared to the standard sound speed calculated by UNESCO to give the laboratory calibration coefficients and was demonstrated agreement with CTD-derived sound speed using Del Grosso's seawater equation after removing a bias.

  6. Localization of aerial pure tones by pinnipeds

    NASA Astrophysics Data System (ADS)

    Holt, Marla M.; Schusterman, Ronald J.; Kastak, David; Southall, Brandon L.

    2005-12-01

    In this study, minimum audible angles (MAAs) of aerial pure tones were measured in and compared between a northern elephant seal (Mirounga angustirostris), a harbor seal (Phoca vitulina), and a California sea lion (Zalophus californianus). Testing was conducted between 0.8 and 16 kHz in the elephant seal and 0.8 and 20 kHz in the harbor seal and sea lion in a hemi-anechoic chamber using a left/right psychophysical procedure. Performance for the same frequencies was also quantified for discrete speaker separation of 5° from the mid-line. For all subjects, MAAs ranged from approximately 3° to 15° and were generally equal to or larger than those previously measured in the same subjects with a broadband signal. Performance at 5° ranged from chance to 97% correct, depending on frequency and subject. Poorest performance in the sea lion and harbor seal occurred at intermediate frequencies, which is consistent with the duplex theory of sound localization. In contrast, the elephant seal's poorest performance occurred at higher frequencies. The elephant seal's result suggests an inferior ability to utilize interaural level differences and is perhaps related to best hearing sensitivity shifted toward lower frequencies in this species relative to other pinnipeds.

  7. Photoionization Dynamics in Pure Helium Droplets

    SciTech Connect

    Peterka, Darcy S.; Kim, Jeong Hyun; Wang, Chia C.; Poisson,Lionel; Neumark, Daniel M.

    2007-02-04

    The photoionization and photoelectron spectroscopy of pure He droplets are investigated at photon energies between 24.6 eV (the ionization energy of He) and 28 eV. Time-of-flight mass spectra and photoelectron images were obtained at a series of molecular beam source temperatures and pressures to assess the effect of droplet size on the photoionization dynamics. At source temperatures below 16 K, the photoelectron images are dominated by fast electrons produced via direct ionization of He atoms, with a small contribution from very slow electrons with kinetic energies below 1 meV arising from an indirect mechanism. The fast photoelectrons have as much as 0.5 eV more kinetic energy than those from atomic He at the same photon energy. This result is interpreted and simulated within the context of a 'dimer model', in which one assumes vertical ionization from two nearest neighbor He atoms to the attractive region of the He2+ potential energy curve. Possible mechanism for the slow electrons, which were also seen at energies below IE(He), are discussed, including vibrational autoionizaton of Rydberg states comprising an electron weakly bound to the surface of a large HeN+ core.

  8. Characterizing commercial pureed foods: sensory, nutritional, and textural analysis.

    PubMed

    Ettinger, Laurel; Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Dysphagia (swallowing impairment) is a common consequence of stroke and degenerative diseases such as Parkinson's and Alzheimer's. Limited research is available on pureed foods, specifically the qualities of commercial products. Because research has linked pureed foods, specifically in-house pureed products, to malnutrition due to inferior sensory and nutritional qualities, commercial purees also need to be investigated. Proprietary research on sensory attributes of commercial foods is available; however direct comparisons of commercial pureed foods have never been reported. Descriptive sensory analysis as well as nutritional and texture analysis of commercially pureed prepared products was performed using a trained descriptive analysis panel. The pureed foods tested included four brands of carrots, of turkey, and two of bread. Each commercial puree was analyzed for fat (Soxhlet), protein (Dumas), carbohydrate (proximate analysis), fiber (total fiber), and sodium content (Quantab titrator strips). The purees were also texturally compared with a line spread test and a back extrusion test. Differences were found in the purees for sensory attributes as well as nutritional and textural properties. Findings suggest that implementation of standards is required to reduce variability between products, specifically regarding the textural components of the products. This would ensure all commercial products available in Canada meet standards established as being considered safe for swallowing.

  9. Pure-phase and pure-amplitude hologram design using the method of generalized projections

    NASA Astrophysics Data System (ADS)

    Catino, William Charles

    The overall contribution of the research presented in this dissertation is a systematic procedure for designing computer-generated holograms subject to far-field image constraints. The method of generalized projections is used to design pure-phase and pure-amplitude diffraction holograms that generate prescribed gray-scale images in the Fourier frequency plane. Performance is demonstrated with objective measures (error, efficiency, and variance), as well as with subjective comparison of images. Test images include a photographic quality image of Lena, a uniform intensity spot array, and a binary amplitude block text image. Projection algorithms are derived for pure-phase holograms with both continuous and quantized phase characteristics from a prescribed far-field magnitude constraint. The performance of the pure-phase hologram designs, as measured in the far-field image, is always very good for the continuous phase case and for the quantized phase case with a large number of phase quantization levels. However, as the number of quantization levels decreases, the performance typically degrades. Performance is significantly improved by constraining the energy in mutually exclusive cliques, that is, groups of image plane (far-field) pixels, instead of constraining the intensity of each individual pixel. Even for the binary phase case, acceptable images are generated with the clique energy algorithm. The method of generalized projections is also used to design pure-amplitude diffraction holograms using a prescribed image intensity constraint. Two algorithms are derived: the direct method, which nonlinearly constrains the hologram transmittance to the range of real values in (0,1); and the indirect method, which constrains the transmittance values to the real axis, and linearly transforms the resulting values to the range (0,1). Digital amplitude holograms are simulated by quantizing the amplitude holograms resulting from the indirect method. The indirect method

  10. Pure Obsessive Compulsive Disorder in Three Generations

    PubMed Central

    Rahimi, Alireza; Haghighi, Mohammad; Shamsaei, Farshid

    2015-01-01

    Introduction: Obsessive-compulsive disorder (OCD) is a psychiatric disorder, which has been shown to affect 2 - 3.5% of people, during their lifetimes. Identification of familial more homogenous characteristics of OCD may help to define relevant subtypes and increase the power of genetic and neurobiological studies of OCD. Case Presentation; This case report describes an adult woman suffering from symptoms of energy loss, insomnia, lack of appetite, and depressed mood. The patient history was positive for counting coercion. The patient’s genogram revealed counting coercion in three generations of her family. Conclusions: This case highlights the issue whether counting can be a distinctive feature among inflicted and not inflicted individuals, such as hoarding. Also, it is still unclear what is it really transferred; the vulnerability to disease, which is transferred among three generations, or the symptoms of counting itself, by genes. Further studies are required to answer the debates on this issue. PMID:26288641

  11. Pure Java-based streaming MPEG player

    NASA Astrophysics Data System (ADS)

    Tolba, Osama; Briceno, Hector; McMillan, Leonard

    1999-01-01

    We present a pure Java-based streaming MPEG-1 video player. By implementing the player entirely in Java, we guarantee its functionality across platforms within any Java-enabled web browsers, without the need for native libraries. This allows greater sue of MPEG video sequences, because the users will no longer need to pre-install any software to display video, beyond Java compatibility. This player features a novel forward-mapping IDCT algorithm that allows it to play locally stored, CIF-sized video sequences at 11 frames per second, when run on a personal computer with Java 'just-in-time' compiler. The IDCT algorithm can run with greater speed when the sequence is viewed at reduced size; e.g., performing approximately 1/4 the amount of computation when the user resizes the sequence to 1/2 its original width and height. We are able to play video streams stored anywhere on the Internet with acceptable performance using a proxy server, eliminating the need for large-capacity auxiliary storage. Thus, the player is well suited to small devices, such as digital TV set-top decoders, requiring little more memory than is required for three video frames. Because of our modular design, it is possible to assemble multiple video streams from remote sources and present them simultaneously to the viewers, subject to network and local performance limitations. The same modular system can further provide viewers with their own customized view of each sessions; e.g., moving and resizing the video display window dynamically, and selecting their preferred set of video controls.

  12. Predictions of pure liquid shock Hugoniots

    SciTech Connect

    Hobbs, M.L.; Baer, M.R.

    1998-06-01

    Determination of product species and associated equations-of-state (EOS) for energetic materials such as pyrotechnics with complex elemental compositions remains a major unsolved problem. Although, empirical EOS models may be calibrated to replicate detonation conditions within experimental variability (5--10%), different states, e.g. expansion, may produce significant discrepancy with data if the basic form of the EOS model is incorrect. A more physically realistic EOS model based on intermolecular potentials, such as the Jacobs Cowperthwaite Zwisler (JCZ3) EOS, is needed to predict detonation states as well as expanded states. Predictive capability for any EOS requires a large species data base composed of a wide variety of elements. Unfortunately, only 20 species have known exponential 6 (EXP 6) molecular force constants which are used in the JCZ3-EOS. Of these 20 species, only 10 have been adequately compared to experimental data such as molecular scattering or shock Hugoniot data. Since data in the strongly repulsive region of the molecular potential is limited, alternative methods must be found to deduce force constants for a larger number of species. The objective of the present study is to determine JCZ3 product species force constants using corresponding state theory. Intermolecular potential parameters were obtained for a variety of gas species using a simple corresponding states technique with critical volume and critical temperature. A more complex, four parameter corresponding state method with shape and polarity corrections was also used to obtain intermolecular potential parameters. Both corresponding state methods were used to predict shock Hugoniot data obtained from pure liquids. The simple corresponding state method is shown to give adequate agreement with shock Hugoniot data.

  13. Growth of erythroid burst-forming units (BFU-E) in cultures of canine bone marrow and peripheral blood cells: effect of serum from irradiated dogs

    SciTech Connect

    Kreja, L.; Baltschukat, K.; Nothdurft, W.

    1988-08-01

    Erythroid burst-forming units (BFU-E) from canine bone marrow and peripheral blood could be grown in methylcellulose in the presence of an appropriate batch of fetal calf serum (FCS), transferrin, and erythropoietin (Epo). However, improved colony formation (size and number of bursts) was obtained when serum from total body irradiated dogs was present in the culture. This serum, obtained from dogs at day 9 after total body irradiation with a dose of 3.9 Gy, reduced markedly the Epo requirement of BFU-E. Furthermore, it allowed the omission of FCS from the culture medium if cholesterol and bovine serum albumin (BSA) were used as FCS substitutes. BFU-E concentrations were found to be rather different in the peripheral blood and in bone marrow samples from different sites (i.e., iliac crest, sternum, and humerus) of normal beagles. The studies further show that canine bone marrow BFU-E can be cryopreserved in liquid nitrogen.

  14. Adult immunization

    PubMed Central

    Mehta, Bharti; Chawla, Sumit; Kumar Dharma, Vijay; Jindal, Harashish; Bhatt, Bhumika

    2014-01-01

    Vaccination is recommended throughout life to prevent vaccine-preventable diseases and their sequel. The primary focus of vaccination programs has historically been directed to childhood immunizations. For adults, chronic diseases have been the primary focus of preventive and medical health care, though there has been increased emphasis on preventing infectious diseases. Adult vaccination coverage, however, remains low for most of the routinely recommended vaccines. Though adults are less susceptible to fall prey to traditional infectious agents, the probability of exposure to infectious agents has increased manifold owing to globalization and increasing travel opportunities both within and across the countries. Thus, there is an urgent need to address the problem of adult immunization. The adult immunization enterprise is more complex, encompassing a wide variety of vaccines and a very diverse target population. There is no coordinated public health infrastructure to support an adult immunization program as there is for children. Moreover, there is little coordination among adult healthcare providers in terms of vaccine provision. Substantial improvement in adult vaccination is needed to reduce the health consequences of vaccine-preventable diseases among adults. Routine assessment of adult patient vaccination needs, recommendation, and offer of needed vaccines for adults should be incorporated into routine clinical care of adults. PMID:24128707

  15. Erythroid progenitor cells (CFU-E*) from Friend virus-infected mice undergo VVFe suicide in vitro in the absence of added erythropoietin

    SciTech Connect

    Del Rizzo, D.F.; Axelrad, A.A.

    1985-11-01

    The authors have investigated the effect of VVFe on the survival in suspension of erythropoietin (epo)-independent erythroid progenitor cells (CFU-E*) induced by Friend polycythemia virus (FV). Spleen cells from C3Hf/Bi mice previously infected with FV were exposed to carrier-free VVFe, and the survival of CFU-E* as a function of time in liquid medium was determined from the number of erythroid colonies that developed from these cells seeded in plasma cultures without added epo. The results showed that spleen CFU-E* were highly vulnerable to VVFe. Marrow CFU-E* behaved in a similar manner. The VVFe responsible for their suicide had been presented to the progenitor cells only during the 4-h period of incubation, after which they were washed and plated in excess nonradioactive iron. They therefore conclude that CFU-E* themselves, and not only their progeny, are capable of actively incorporating iron. Under the same conditions in the absence of added epo, the effect of VVFe on the survival of normal spleen or marrow CFU-E could not be assessed because two few normal CFU-E survived the incubation period. Normal bone marrow cells incubated in complete medium containing epo retained their capacity for erythrocytic colony formation, and CFU-E could then be shown to be vulnerable to VVFe. Thus, either the iron-incorporating system of normal CFU-E was inducible by epo, or else epo permitted survival of the CFU-E so that the activity of a constitutive iron-incorporating system could be recognized.

  16. Downregulation of the Spi-1/PU.1 oncogene induces the expression of TRIM10/HERF1, a key factor required for terminal erythroid cell differentiation and survival.

    PubMed

    Blaybel, Rand; Théoleyre, Orianne; Douablin, Alexandre; Baklouti, Faouzi

    2008-08-01

    Sustained expression of the Spi-1/PU.1 and Fli-1 oncoproteins blocks globin gene activation in mouse erythroleukemia cells; however, only Spi-1/PU.1 expression inhibits the inclusion of exon 16 in the mature 4.1R mRNA. This splicing event is crucial for a functional 4.1R protein and, therefore, for red blood cell membrane integrity. This report demonstrates that Spi-1/PU.1 downregulation induces the activation of TRIM10/hematopoietic RING finger 1 (HERF1), a member of the tripartite motif (TRIM)/RBCC protein family needed for globin gene transcription. Additionally, we demonstrate that TRIM10/HERF1 is required for the regulated splicing of exon 16 during late erythroid differentiation. Using inducible overexpression and silencing approaches, we found that: (1) TRIM10/HERF1 knockdown inhibits hemoglobin production and exon splicing and triggers cell apoptosis in dimethylsulfoxide (DMSO)-induced cells; (2) TRIM10/HERF1 upregulation is required but is insufficient on its own to activate exon retention; (3) Fli-1 has no effect on TRIM10/HERF1 expression, whereas either DMSO-induced downregulation or shRNA-knockdown of Spi-1/PU.1 expression is sufficient to activate TRIM10/HERF1 expression; and (4) Spi-1/PU.1 knockdown triggers both the transcription and the splicing events independently of the chemical induction. Altogether, these data indicate that primary Spi-1/PU.1 downregulation acts on late erythroid differentiation through at least two pathways, one of which requires TRIM10/HERF1 upregulation and parallels the Spi-1/PU.1-induced Fli-1 shutoff regulatory cascade.

  17. Recombinant adeno-associated virus (rAAV)-mediated expression of a human gamma-globin gene in human progenitor-derived erythroid cells.

    PubMed

    Miller, J L; Donahue, R E; Sellers, S E; Samulski, R J; Young, N S; Nienhuis, A W

    1994-10-11

    Effective gene therapy for the severe hemoglobin (Hb) disorders, sickle-cell anemia and thalassemia, will require an efficient method to transfer, integrate, and express a globin gene in primary erythroid cells. To evaluate recombinant adeno-associated virus (rAAV) for this purpose, we constructed a rAAV vector encoding a human gamma-globin gene (pJM24/vHS432A gamma). Its 4725-nucleotide genome consists of two 180-bp AAV inverted terminal repeats flanking the core elements of hypersensitive sites 2, 3, and 4 from the locus control region of the beta-globin gene cluster, linked to a mutationally marked A gamma-globin gene (A gamma) containing native promoter and RNA processing signals. CD34+ human hematopoietic cells were exposed to rAAV particles at a multiplicity of infection of 500-1000 and cultured in semisolid medium containing several cytokines. A reverse transcriptase polymerase chain reaction assay distinguished mRNA signals derived from transduced and endogenous human gamma-globin genes. Twenty to 40% of human erythroid burst-forming unit-derived colonies expressed the rAAV-transduced A gamma-globin gene at levels 4-71% that of the endogenous gamma-globin genes. The HbF content of pooled control colonies was 26%, whereas HbF was 40% of the total in pooled colonies derived from rAAV transduced progenitors. These data establish that rAAV containing elements from the locus control region linked to a gamma-globin gene are capable of transferring and expressing that gene in primary human hematopoietic cells resulting in a substantial increase in HbF content.

  18. Recombinant adeno-associated virus (rAAV)-mediated expression of a human gamma-globin gene in human progenitor-derived erythroid cells.

    PubMed Central

    Miller, J L; Donahue, R E; Sellers, S E; Samulski, R J; Young, N S; Nienhuis, A W

    1994-01-01

    Effective gene therapy for the severe hemoglobin (Hb) disorders, sickle-cell anemia and thalassemia, will require an efficient method to transfer, integrate, and express a globin gene in primary erythroid cells. To evaluate recombinant adeno-associated virus (rAAV) for this purpose, we constructed a rAAV vector encoding a human gamma-globin gene (pJM24/vHS432A gamma). Its 4725-nucleotide genome consists of two 180-bp AAV inverted terminal repeats flanking the core elements of hypersensitive sites 2, 3, and 4 from the locus control region of the beta-globin gene cluster, linked to a mutationally marked A gamma-globin gene (A gamma) containing native promoter and RNA processing signals. CD34+ human hematopoietic cells were exposed to rAAV particles at a multiplicity of infection of 500-1000 and cultured in semisolid medium containing several cytokines. A reverse transcriptase polymerase chain reaction assay distinguished mRNA signals derived from transduced and endogenous human gamma-globin genes. Twenty to 40% of human erythroid burst-forming unit-derived colonies expressed the rAAV-transduced A gamma-globin gene at levels 4-71% that of the endogenous gamma-globin genes. The HbF content of pooled control colonies was 26%, whereas HbF was 40% of the total in pooled colonies derived from rAAV transduced progenitors. These data establish that rAAV containing elements from the locus control region linked to a gamma-globin gene are capable of transferring and expressing that gene in primary human hematopoietic cells resulting in a substantial increase in HbF content. Images PMID:7524085

  19. Entanglement bound for multipartite pure states based on local measurements

    SciTech Connect

    Jiang Lizhen; Chen Xiaoyu; Ye Tianyu

    2011-10-15

    An entanglement bound based on local measurements is introduced for multipartite pure states. It is the upper bound of the geometric measure and the relative entropy of entanglement. It is the lower bound of the minimal-measurement entropy. For pure bipartite states, the bound is equal to the entanglement entropy. The bound is applied to pure tripartite qubit states and the exact tripartite relative entropy of entanglement is obtained for a wide class of states.

  20. Typical pure nonequilibrium steady states and irreversibility for quantum transport.

    PubMed

    Monnai, Takaaki; Yuasa, Kazuya

    2016-07-01

    It is known that each single typical pure state in an energy shell of a large isolated quantum system well represents a thermal equilibrium state of the system. We show that such typicality holds also for nonequilibrium steady states (NESS's). We consider a small quantum system coupled to multiple infinite reservoirs. In the long run, the total system reaches a unique NESS. We identify a large Hilbert space from which pure states of the system are to be sampled randomly and show that the typical pure states well describe the NESS. We also point out that the irreversible relaxation to the unique NESS is important to the typicality of the pure NESS's.

  1. Typical pure nonequilibrium steady states and irreversibility for quantum transport

    NASA Astrophysics Data System (ADS)

    Monnai, Takaaki; Yuasa, Kazuya

    2016-07-01

    It is known that each single typical pure state in an energy shell of a large isolated quantum system well represents a thermal equilibrium state of the system. We show that such typicality holds also for nonequilibrium steady states (NESS's). We consider a small quantum system coupled to multiple infinite reservoirs. In the long run, the total system reaches a unique NESS. We identify a large Hilbert space from which pure states of the system are to be sampled randomly and show that the typical pure states well describe the NESS. We also point out that the irreversible relaxation to the unique NESS is important to the typicality of the pure NESS's.

  2. Efficient decomposition of cosmic microwave background polarization maps into pure E, pure B, and ambiguous components

    SciTech Connect

    Bunn, Emory F.

    2011-04-15

    Separation of the B component of a cosmic microwave background (CMB) polarization map from the much larger E component is an essential step in CMB polarimetry. For a map with incomplete sky coverage, this separation is necessarily hampered by the presence of ambiguous modes which could be either E or B modes. I present an efficient pixel-space algorithm for removing the ambiguous modes and separating the map into pure E and B components. The method, which works for arbitrary geometries, does not involve generating a complete basis of such modes and scales the cube of the number of pixels on the boundary of the map.

  3. 1. SOUTH AND WEST ELEVATION OF ILLINOIS PURE ALUMINUM (IPA) ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. SOUTH AND WEST ELEVATION OF ILLINOIS PURE ALUMINUM (IPA) COMPANY FACTORY; SOUTH ELEVATION FACING ILLINOIS CENTRAL GULF RAILROAD TRACKS AND MAIN STREET. THE ONE-STORY BRICK BUILDING TO THE LEFT IS AN ABANDONED COMMONWEALTH EDISON COMPANY ELECTRICAL SUBSTATION. - Illinois Pure Aluminum Company, 109 Holmes Street, Lemont, Cook County, IL

  4. Physical and Spiritual Education within the Framework of Pure Life

    ERIC Educational Resources Information Center

    Bagheri Noaparast, Khosrow

    2013-01-01

    This paper aims at showing the dimensions of spirituality in childhood education by suggesting a new analysis of the concept of "pure life" used in the Qur'an. Putting spirituality in the framework of the pure life provides us with a rich framework in dealing with spirituality as the latter will be extended to all dimensions of a life. In the…

  5. Adult-onset mitochondrial myopathy.

    PubMed Central

    Fernandez-Sola, J.; Casademont, J.; Grau, J. M.; Graus, F.; Cardellach, F.; Pedrol, E.; Urbano-Marquez, A.

    1992-01-01

    Mitochondrial diseases are polymorphic entities which may affect many organs and systems. Skeletal muscle involvement is frequent in the context of systemic mitochondrial disease, but adult-onset pure mitochondrial myopathy appears to be rare. We report 3 patients with progressive skeletal mitochondrial myopathy starting in adult age. In all cases, the proximal myopathy was the only clinical feature. Mitochondrial pathology was confirmed by evidence of ragged-red fibres in muscle histochemistry, an abnormal mitochondrial morphology in electron microscopy and by exclusion of other underlying diseases. No deletions of mitochondrial DNA were found. We emphasize the need to look for a mitochondrial disorder in some non-specific myopathies starting in adult life. Images Figure 1 Figure 2 PMID:1589382

  6. Urinary tract infection - adults

    MedlinePlus

    Bladder infection - adults; UTI - adults; Cystitis - bacterial - adults; Pyelonephritis - adults; Kidney infection - adults ... to the hospital if you: Are an older adult Have kidney stones or changes in the anatomy ...

  7. Shunting arc plasma source for pure carbon ion beam.

    PubMed

    Koguchi, H; Sakakita, H; Kiyama, S; Shimada, T; Sato, Y; Hirano, Y

    2012-02-01

    A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA∕mm(2) at the peak of the pulse.

  8. Shunting arc plasma source for pure carbon ion beama)

    NASA Astrophysics Data System (ADS)

    Koguchi, H.; Sakakita, H.; Kiyama, S.; Shimada, T.; Sato, Y.; Hirano, Y.

    2012-02-01

    A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA/mm2 at the peak of the pulse.

  9. Pure-state informationally complete and 'really' complete measurements

    SciTech Connect

    Finkelstein, J.

    2004-11-01

    I construct a positive-operator-valued measure (POVM) which has 2d rank-1 elements and which is informationally complete for generic pure states in d dimensions, thus confirming a conjecture made by Flammia, Silberfarb, and Caves (e-print quant-ph/0404137). I show that if a rank-1 POVM is required to be informationally complete for all pure states in d dimensions, it must have at least 3d-2 elements. I also show that, in a POVM which is informationally complete for all pure states in d dimensions, for any vector there must be at least 2d-1 POVM elements which do not annihilate that vector.

  10. Effect of humidity on fretting wear of several pure metals

    NASA Technical Reports Server (NTRS)

    Goto, H.; Buckley, D. H.

    1984-01-01

    Fretting wear experiments with several pure metals were conducted in air at various relative humidity levels. The materials used were iron, aluminum, copper, silver, chromium, titanium, and nickel. Each pure metal had a maximum fretting wear volume at a specific humidity level RH sub max that was not dependent on mechanical factors such as contact load, fretting amplitude, and frequency in the ranges studied. The weight loss due to fretting wear at RH sub max for each pure metal decreased with increasing heat of oxygen adsorption on the metal, indicating that adhesive wear dominated at RH sub max.

  11. Interleukin-10 inhibits burst-forming unit-erythroid growth by suppression of endogenous granulocyte-macrophage colony-stimulating factor production from T cells.

    PubMed

    Oehler, L; Kollars, M; Bohle, B; Berer, A; Reiter, E; Lechner, K; Geissler, K

    1999-02-01

    Numerous cytokines released from accessory cells have been shown to exert either stimulatory or inhibitory growth signals on burst-forming unit-erythroid (BFU-E) growth. Because of its cytokine synthesis-inhibiting effects on T cells and monocytes, interleukin-10 (IL-10) may be a potential candidate for indirectly affecting erythropoiesis. We investigated the effects of IL-10 on BFU-E growth from normal human peripheral blood mononuclear cells (PBMC) using a clonogenic progenitor cell assay. The addition of recombinant human IL-10 to cultures containing recombinant human erythropoietin suppressed BFU-E growth in a dose-dependent manner (by 55.2%, range 47.3-63.3%, p < 0.01, at 10 ng/mL). In contrast, no inhibitory effect of IL-10 was seen when cultivating highly enriched CD34+ cells. BFU-E growth from PBMC also was markedly suppressed in the presence of a neutralizing anti-granulocyte-macrophage colony-stimulating factor (GM-CSF) antibody (by 48.7%, range 32.9-61.2% inhibition,p < 0.01), but not by neutralizing antibodies against granulocyte colony-stimulating factor and interleukin-3. This suggests a stimulatory role of endogenously released GM-CSF on BFU-E formation. Also, the addition of exogenous GM-CSF completely restored IL-10-induced suppression of BFU-E growth. To determine the cellular source of GM-CSF production, we analyzed GM-CSF levels in suspension cultures containing PBMC that were either depleted of monocytes or T cells. Monocyte-depleted PBMC showed spontaneous production of increasing amounts of GM-CSF on days 3, 5, and 7, respectively, which could be suppressed by IL-10, whereas GM-CSF levels did not increase in cultures containing T-cell-depleted PBMC. Our data indicate that IL-10 inhibits the growth of erythroid progenitor cells in vitro, most likely by suppression of endogenous GM-CSF production from T cells.

  12. Differential effect of pure isoflavones and soymilk on estrogen receptor activity in mice

    SciTech Connect

    Rando, Gianpaolo; Ramachandran, Balaji; Rebecchi, Monica; Ciana, Paolo; Maggi, Adriana

    2009-06-15

    Background: Because of the complexity of estrogen receptor (ER) physiological activity, the interaction of pure isoflavones or soy-based diets on ER needs to be clearly demonstrated. Objectives: To investigate the effects of the administration of isoflavones as a pure compound or as a component of diet on the ER transcriptional activity in adult mice. Methods: Effects of acute (6 h) and chronic (21 days) oral administration of soy milk, pure genistein and a mix of genistein and daidzein was studied in living ERE-Luc mice. In this animal model, the synthesis of luciferase is under the state of ER transcriptional activity. Luciferase activity was measured in living mice by daily bioluminescence imaging sessions and in tissue extracts by enzymatic assay. Results: Acute, oral administration of genistein or soymilk caused a significant increase of ER activity in liver. In a 20 day long treatment, soymilk was more potent than genistein in liver and appeared to extend its influence on ER transcriptional activity in other tissues, such as the digestive tract. A mixture of pure genistein and daidzein at the same concentration as in soymilk failed to induce significant changes during acute and chronic studies suggesting an important, uncharacterized role of the soymilk matrix. Consistent with this observation, synergistic effects of the matrix plus isoflavones were observed in MCF-7 cells stably transfected with the ERE-luc construct. Conclusions: This study underlines the limitations of the analysis of single food components in the evaluation of their effects on estrogen receptor activity and advocates the necessity to use complex organisms for the full comprehension of the effects of compounds altering the endocrine balance.

  13. Faster and cleaner real-time pure shift NMR experiments

    NASA Astrophysics Data System (ADS)

    Mauhart, Johannes; Glanzer, Simon; Sakhaii, Peyman; Bermel, Wolfgang; Zangger, Klaus

    2015-10-01

    Real-time pure shift experiments provide highly resolved proton NMR spectra which do not require any special processing. Although being more sensitive than their pseudo 2D counterparts, their signal intensities per unit time are still far below regular NMR spectra. In addition, scalar coupling evolution during the individual data chunks produces decoupling sidebands. Here we show that faster and cleaner real-time pure shift spectra can be obtained through the implementation of two parameter alterations. Variation of the FID chunk lengths between individual transients significantly suppresses decoupling sidebands for any kind of real-time pure shift spectra and thus allows for example the analysis of minor components in compound mixtures. Shifting the excitation frequency between individual scans of real-time slice-selective pure shift spectra increases their sensitivity obtainable in unit time by allowing faster repetitions of acquisitions.

  14. [Neurolinguistic analysis of a case of pure agraphia].

    PubMed

    Petrillo, S; Poli, R; Piccirilli, M

    1990-01-01

    A patient with a pure acquired dysgraphia is reported. The pattern of the patient's performance is discussed in relation to current functional models of writing. The case may be interpreted by assuming a selective impairment to the graphemic buffer.

  15. Typical pure nonequilibrium steady states and irreversibility for quantum transport.

    PubMed

    Monnai, Takaaki; Yuasa, Kazuya

    2016-07-01

    It is known that each single typical pure state in an energy shell of a large isolated quantum system well represents a thermal equilibrium state of the system. We show that such typicality holds also for nonequilibrium steady states (NESS's). We consider a small quantum system coupled to multiple infinite reservoirs. In the long run, the total system reaches a unique NESS. We identify a large Hilbert space from which pure states of the system are to be sampled randomly and show that the typical pure states well describe the NESS. We also point out that the irreversible relaxation to the unique NESS is important to the typicality of the pure NESS's. PMID:27575115

  16. Pure gonadal dysgenesis (46 XX type) with a familial pattern.

    PubMed

    Kohmanaee, Shahin; Dalili, Setila; Rad, Afagh Hassanzadeh

    2015-01-01

    46, XX gonadal dysgenesis without the phenotype of Turner's syndrome is described as "pure". Although, previous investigations obtained that commonly gonadal dysgenesis did not cause breast development as a result of low levels of circulating estradiol. However, in this study, we aimed to report a familial pure gonadal dysgenesis with and without normal secondary sexual characteristics. In this study, we reported three siblings with pure gonadal dysgenesis with and without normal secondary sexual characteristics. The elder two sisters had a normal female phenotype and the youngest had amenorrhea with no breast development (B1) and pubic hair. In addition, it seems that the absence of pubic hair occurred due to delayed constitutional puberty. According to results, it seems that clinicians should consider different presentations for pure gonadal dysgenesis with familial pattern.

  17. The effect of pure state structure on nonequilibrium dynamics

    NASA Astrophysics Data System (ADS)

    Newman, C. M.; Stein, D. L.

    2008-06-01

    Motivated by short-range Ising spin glasses, we review some rigorous results and their consequences for the relation between the number/nature of equilibrium pure states and nonequilibrium dynamics. Two of the consequences for spin glass dynamics following an instantaneous deep quench to a temperature with broken spin flip symmetry are: (1) almost all initial configurations lie on the boundary between the basins of attraction of multiple pure states; (2) unless there are uncountably many pure states with almost all pairs having zero overlap, there can be no equilibration to a pure state as time t \\to \\infty . We discuss the relevance of these results to the difficulty of equilibration of spin glasses. We also review some results concerning the 'nature versus nurture' problem of whether the large-t behavior of both ferromagnets and spin glasses following a deep quench is determined more by the initial configuration (nature) or by the dynamics realization (nurture).

  18. Acquired pure megakaryocytic aplasia successfully treated with cyclosporine.

    PubMed

    Omri, Halima El; Ibrahim, Firyal; Taha, Ruba Yasin; Negm, Riham Hassan; Khinji, Aisha Al; Yassin, Mohammed; Hijji, Ibrahim Al; Ayoubi, Hanadi El; Baden, Hussein

    2010-12-01

    Acquired pure megakaryocytic aplasia is a rare hematological disorder characterized by thrombocytopenia with absent or markedly reduced megakaryocytes in the bone marrow. We report a case of a 25-year-old male diagnosed as acquired pure megakaryocytic aplasia. Treatment with prednisone and intravenous immunoglobulin failed, but he was successfully treated with cyclosporine, with complete remission after 90 days and normal platelet count maintained thereafter. PMID:27263744

  19. Clinical study of 222 patients with pure motor stroke.

    PubMed

    Arboix, A; Padilla, I; Massons, J; García-Eroles, L; Comes, E; Targa, C

    2001-08-01

    The objective was to assess the frequency of pure motor stroke caused by different stroke subtypes and to compare demographic, clinical, neuroimaging, and outcome data of pure motor stroke with those of patients with other lacunar stroke as well as with those of patients with non-lacunar stroke. Data from 2000 patients with acute stroke (n=1761) or transient ischaemic attack (n=239) admitted consecutively to the department of neurology of an acute care 350 bed teaching hospital were prospectively collected in the Sagrat Cor Hospital of Barcelona stroke registry over a 10 year period. For the purpose of the study 222 (12.7%) patients with pure motor stroke were selected. The other study groups included 218 (12.3%) patients with other lacunar strokes and 1321 (75%) patients with non-lacunar stroke. In relation to stroke subtype, lacunar infarcts were found in 189 (85%) patients, whereas ischaemic lacunar syndromes not due to lacunar infarcts occurred in 23 (10.4%) patients (atherothrombotic stroke in 12, cardioembolic stroke in seven, infarction of undetermined origin in three, and infarction of unusual aetiology in one) and haemorrhagic lacunar syndromes in 10 (4.5%). Patients with pure motor stroke showed a better outcome than patients with non-lacunar stroke with a significantly lower number of complications and in hospital mortality rate, shorter duration of hospital stay, and a higher number of symptom free patients at hospital discharge. After multivariate analysis, hypertension, diabetes, obesity, hyperlipidaemia, non-sudden stroke onset, internal capsule involvement, and pons topography seemed to be independent factors of pure motor stroke in patients with acute stroke. In conclusion, about one of every 10 patients with acute stroke had a pure motor stroke. Pure motor stroke was caused by a lacunar infarct in 85% of patients and by other stroke subtypes in 15%. Several clinical features are more frequent in patients with pure motor stroke than in patients

  20. Adiabatic expansion of a strongly correlated pure electron plasma

    SciTech Connect

    Dubin, D.H.E.; O'Neil, T.M.

    1986-02-17

    Adiabatic expansion is proposed as a method of increasing the degree of correlation of a magnetically confined pure electron plasma. Quantum mechanical effects and correlation effects make the physics of the expansion quite different from that for a classical ideal gas. The proposed expansion may be useful in a current experimental effort to cool a pure electron plasma to the liquid and solid (crystalline) states.

  1. Adiabatic expansion of a strongly correlated pure electron plasma

    NASA Astrophysics Data System (ADS)

    Dubin, D. H. E.; Oneil, T. M.

    1986-02-01

    Adiabatic expansion is proposed as a method of increasing the degree of correlation of a magnetically confined pure electron plasma. Quantum mechanical effects and correlation effects make the physics of the expansion quite different from that for a classical ideal gas. The proposed expansion may be useful in a current experimental effort to cool a pure electron plasma to the liquid and solid (crystalline) states.

  2. Hybrids, pure cultures, and pure lines: from nineteenth-century biology to twentieth-century genetics.

    PubMed

    Müller-Wille, Staffan

    2007-12-01

    Prompted by recent recognitions of the omnipresence of horizontal gene transfer among microbial species and the associated emphasis on exchange, rather than isolation, as the driving force of evolution, this essay will reflect on hybridization as one of the central concerns of nineteenth-century biology. I will argue that an emphasis on horizontal exchange was already endorsed by 'biology' when it came into being around 1800 and was brought to full fruition with the emergence of genetics in 1900. The true revolution in nineteenth-century life sciences, I maintain, consisted in a fundamental shift in ontology, which eroded the boundaries between individual and species, and allowed biologists to move up and down the scale of organic complexity. Life became a property extending both 'downwards', to the parts that organisms were composed of, as well as 'upwards', to the collective entities constituted by the relations of exchange and interaction that organisms engage in to reproduce. This mode of thinking was crystallized by Gregor Mendel and consolidated in the late nineteenth-century conjunction of biochemistry, microbiology and breeding in agro-industrial settings. This conjunction and its implications are especially exemplified by Wilhelm Johannsen's and Martinus Beijerinck's work on pure lines and cultures. An understanding of the subsequent constraints imposed by the evolutionary synthesis of the twentieth century on models of genetic systems may require us to rethink the history of biology and displace Darwin's theory of natural selection from that history's centre. PMID:18053934

  3. Pure-tone birdsong by resonance filtering of harmonic overtones

    PubMed Central

    Beckers, Gabriël J. L.; Suthers, Roderick A.; Cate, Carel ten

    2003-01-01

    Pure-tone song is a common and widespread phenomenon in birds. The mechanistic origin of this type of phonation has been the subject of long-standing discussion. Currently, there are three hypotheses. (i) A vibrating valve in the avian vocal organ, the syrinx, generates a multifrequency harmonic source sound, which is filtered to a pure tone by a vocal tract filter (“source-filter” model, analogous to human speech production). (ii) Vocal tract resonances couple with a vibrating valve source, suppressing the normal production of harmonic overtones at this source (“soprano” model, analogous to human soprano singing). (iii) Pure-tone sound is produced as such by a sound-generating mechanism that is fundamentally different from a vibrating valve. Here we present direct evidence of a source-filter mechanism in the production of pure-tone birdsong. Using tracheal thermistors and air sac pressure cannulae, we recorded sound signals close to the syringeal sound source during spontaneous, pure-tone vocalizations of two species of turtledove. The results show that pure-tone dove vocalizations originate through filtering of a multifrequency harmonic sound source. PMID:12764226

  4. Umbelliferone and daphnetin ameliorate carbon tetrachloride-induced hepatotoxicity in rats via nuclear factor erythroid 2-related factor 2-mediated heme oxygenase-1 expression.

    PubMed

    Mohamed, Mohamed R; Emam, Manal A; Hassan, Nahla S; Mogadem, Abeer I

    2014-09-01

    Among various phytochemicals, coumarins comprise a very large class of plant phenolic compounds that have good nutritive value, in addition to their antioxidant effects. The purpose of the present study was to investigate the protective effects of two coumarin derivatives, umbelliferone and daphnetin, against carbon tetrachloride (CCl4)-induced hepatotoxicity in rats and elucidate the underlying mechanism. Treatment of rats with either umbelliferone or daphnetin significantly improved the CCl4-induced biochemical alterations. In addition, both compounds alleviated the induced-lipid peroxidation and boosted the antioxidant defense system. Moreover, the investigated compounds attenuated CCl4-induced histopathological alterations of the liver. Finally, umbelliferone and daphnetin induced the nuclear translocation of the nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), thereby inducing the expression and activity of the cytoprotective heme oxygenase-1 (HO-1). These results suggest that umbelliferone and daphnetin ameliorate oxidative stress-related hepatotoxicity via their ability to augment cellular antioxidant defenses by activating Nrf2-mediated HO-1 expression.

  5. Integrative genomic analysis in K562 chronic myelogenous leukemia cells reveals that proximal NCOR1 binding positively regulates genes that govern erythroid differentiation and Imatinib sensitivity

    PubMed Central

    Long, Mark D.; van den Berg, Patrick R.; Russell, James L.; Singh, Prashant K.; Battaglia, Sebastiano; Campbell, Moray J.

    2015-01-01

    To define the functions of NCOR1 we developed an integrative analysis that combined ENCODE and NCI-60 data, followed by in vitro validation. NCOR1 and H3K9me3 ChIP-Seq, FAIRE-seq and DNA CpG methylation interactions were related to gene expression using bootstrapping approaches. Most NCOR1 combinations (24/44) were associated with significantly elevated level expression of protein coding genes and only very few combinations related to gene repression. DAVID's biological process annotation revealed that elevated gene expression was uniquely associated with acetylation and ETS binding. A matrix of gene and drug interactions built on NCI-60 data identified that Imatinib significantly targeted the NCOR1 governed transcriptome. Stable knockdown of NCOR1 in K562 cells slowed growth and significantly repressed genes associated with NCOR1 cistrome, again, with the GO terms acetylation and ETS binding, and significantly dampened sensitivity to Imatinib-induced erythroid differentiation. Mining public microarray data revealed that NCOR1-targeted genes were significantly enriched in Imatinib response gene signatures in cell lines and chronic myelogenous leukemia (CML) patients. These approaches integrated cistrome, transcriptome and drug sensitivity relationships to reveal that NCOR1 function is surprisingly most associated with elevated gene expression, and that these targets, both in CML cell lines and patients, associate with sensitivity to Imatinib. PMID:26117541

  6. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    PubMed Central

    Chico, Lucia; Borgia, Loredana; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  7. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    PubMed

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  8. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  9. Nuclear factor erythroid 2-related factor 2 antibody attenuates thermal hyperalgesia in the dorsal root ganglion: Neurochemical changes and behavioral studies after sciatic nerve-pinch injury.

    PubMed

    Xiang, Qiong; Yu, Chao; Zhu, Yao-Feng; Li, Chun-Yan; Tian, Rong-Bo; Li, Xian-Hui

    2016-08-01

    Oxidative stress is generated in several peripheral nerve injury models.Nuclear factor erythroid 2-related factor 2 (Nrf2) is activated to have a role in antioxidant effect. After nerve injury, the severely painful behavior is also performed. However, little has been explored regarding the function of Nrf2 in this painful process. Therefore, in this study, we compared the effects of Nrf2 antibody administration following sciatic nerve-pinch injury on painful behavior induced in young mice and neurochemical changes in dorsal root ganglion neurons. After pinch nerve injury, we found that the magnitude of the thermal allodynia was significantly decreased after application of Nrf2 antibody (5ul, 1mg/ml) in such injured animals and phosphorylated ERK(p-ERK) as well as the apoptotic protein (i.e., Bcl-6) in DRG neurons were also down-regulated in the anti-Nrf2-treated injured groups compared to the saline-treated groups. Taken collectively, these data suggested that the Nrf2 antibody reduced thermal hyperalgesia via ERK pathway and the down regulation of Bcl-6 protein from the apoptosis pathway might be protecting against the protein deletions caused by anti-Nrf2 effect and suggested the new therapeutic strategy with Nrf2 inhibitor following nerve injury. PMID:27316447

  10. Argon protects against hypoxic-ischemic brain injury in neonatal rats through activation of nuclear factor (erythroid-derived 2)-like 2

    PubMed Central

    Zhao, Hailin; Mitchell, Sian; Ciechanowicz, Sarah; Savage, Sinead; Wang, Tianlong; Ji, Xunming; Ma, Daqing

    2016-01-01

    Perinatal hypoxic ischaemic encephalopathy (HIE) has a high mortality rate with neuropsychological impairment. This study investigated the neuroprotective effects of argon against neonatal hypoxic-ischaemic brain injury. In vitro cortical neuronal cell cultures derived from rat foetuses were subjected to an oxygen and glucose deprivation (OGD) challenge for 90 minutes and then exposed to 70% argon or nitrogen with 5% carbon dioxide and balanced with oxygen for 2 hours. In vivo, seven-day-old rats were subjected to unilateral common carotid artery ligation followed by hypoxic (8% oxygen balanced with nitrogen) insult for 90 minutes. They were exposed to 70% argon or nitrogen balanced with oxygen for 2 hours. In vitro, argon treatment of cortical neuronal cultures resulted in a significant increase of p-mTOR and Nuclear factor (erythroid-derived 2)-like 2(Nrf2) and protection against OGD challenge. Inhibition of m-TOR through Rapamycin or Nrf2 through siRNA abolished argon-mediated cyto-protection. In vivo, argon exposure significantly enhanced Nrf2 and its down-stream effector NAD(P)H Dehydrogenase, Quinone 1(NQO1) and superoxide dismutase 1(SOD1). Oxidative stress, neuroinflammation and neuronal cell death were significantly decreased and brain infarction was markedly reduced. Blocking PI-3K through wortmannin or ERK1/2 through U0126 attenuated argon-mediated neuroprotection. These data provide a new molecular mechanism for the potential application of argon as a neuroprotectant in HIE. PMID:27016422

  11. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    PubMed Central

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients. PMID:27274779

  12. Integrative genomic analysis in K562 chronic myelogenous leukemia cells reveals that proximal NCOR1 binding positively regulates genes that govern erythroid differentiation and Imatinib sensitivity.

    PubMed

    Long, Mark D; van den Berg, Patrick R; Russell, James L; Singh, Prashant K; Battaglia, Sebastiano; Campbell, Moray J

    2015-09-01

    To define the functions of NCOR1 we developed an integrative analysis that combined ENCODE and NCI-60 data, followed by in vitro validation. NCOR1 and H3K9me3 ChIP-Seq, FAIRE-seq and DNA CpG methylation interactions were related to gene expression using bootstrapping approaches. Most NCOR1 combinations (24/44) were associated with significantly elevated level expression of protein coding genes and only very few combinations related to gene repression. DAVID's biological process annotation revealed that elevated gene expression was uniquely associated with acetylation and ETS binding. A matrix of gene and drug interactions built on NCI-60 data identified that Imatinib significantly targeted the NCOR1 governed transcriptome. Stable knockdown of NCOR1 in K562 cells slowed growth and significantly repressed genes associated with NCOR1 cistrome, again, with the GO terms acetylation and ETS binding, and significantly dampened sensitivity to Imatinib-induced erythroid differentiation. Mining public microarray data revealed that NCOR1-targeted genes were significantly enriched in Imatinib response gene signatures in cell lines and chronic myelogenous leukemia (CML) patients. These approaches integrated cistrome, transcriptome and drug sensitivity relationships to reveal that NCOR1 function is surprisingly most associated with elevated gene expression, and that these targets, both in CML cell lines and patients, associate with sensitivity to Imatinib.

  13. Low O2 concentrations enhance the positive effect of IL-17 on the maintenance of erythroid progenitors during co-culture of CD34+ and mesenchymal stem cells.

    PubMed

    Krstić, Aleksandra; Vlaski, Marija; Hammoud, Mohammad; Chevaleyre, Jean; Duchez, Pascale; Jovcić, Gordana; Bugarski, Diana; Milenković, Pavle; Bourin, Philippe; Boiron, Jean-Michel; Praloran, Vincent; Ivanović, Zoran

    2009-03-01

    Co-culture of haematopoietic cells with a stromal cell layer does not mimic the physiological, micro-environmental niche, whose major feature is a low oxygen (O2) concentration. Thus, in order to study the effects of IL-17 in a context which better approximates the physiological state, we investigated its effects on cell expansion, colony-forming ability, and the phenotypical profile of normal, human blood CD34+ cells co-cultured for five days with MSC layers at various O2 concentrations (20%, 12.5% and 3% O2. We demonstrated that IL-17 enhances CD34+ and total CFC production during the five days of MSC/CD34+ co-culture. This effect depends upon the O2 concentration, reaching its maximum at 3% O2, and is more pronounced on erythroid progenitors (BFU-E). In addition, the stimulation of IL-6 production by IL-17 in MSC cultures and co-cultures is enhanced by low O2 concentration. The expression of some differentiation markers (CD34, CD13 and CD41) on haematopoietic cells in co-cultures also depends upon the oxygen concentration. Our results strengthen the concept that physiological levels of O2 (mistakenly called hypoxia), should be considered as an important environmental factor that significantly influences cytokine activity.

  14. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds.

    PubMed

    Denzer, Isabel; Münch, Gerald; Friedland, Kristina

    2016-01-01

    Oxidative stress and mitochondrial dysfunction are early events in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Mitochondria are important key players in cellular function based on mitochondrial energy production and their major role in cell physiology. Since neurons are highly depending on mitochondrial energy production due to their high energy demand and their reduced glycolytic capacity mitochondrial dysfunction has fatal consequences for neuronal function and survival. The transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2) is the major regulator of cellular response to oxidative stress. Activation of Nrf2 induces the transcriptional regulation of antioxidant response element (ARE)-dependent expression of a battery of cytoprotective and antioxidant enzymes and proteins. Moreover, activation of Nrf2 protects mitochondria from dysfunction and promotes mitochondrial biogenesis. Therefore, the Nrf2/ARE pathway has become an attractive target for the prevention and treatment of oxidative stress-related neurodegenerative diseases. Small food-derived inducers of the Nrf2/ARE pathway including l-sulforaphane from broccoli and isoliquiritigenin from licorice displayed promising protection of mitochondrial function in models of oxidative stress and neurodegenerative diseases and represent a novel approach to prevent and treat aging-associated neurodegenerative diseases.

  15. Nuclear Factor (Erythroid-Derived)-Related Factor 2-Associated Retinal Pigment Epithelial Cell Protection under Blue Light-Induced Oxidative Stress

    PubMed Central

    Kataoka, Keiko; Kimoto, Reona; Hwang, Shiang-Jyi; Nagasaka, Yosuke; Tsunekawa, Taichi; Nonobe, Norie; Ito, Yasuki; Terasaki, Hiroko

    2016-01-01

    Purpose. It is a matter of increasing concern that exposure to light-emitting diodes (LED), particularly blue light (BL), damages retinal cells. This study aimed to investigate the retinal pigment epithelium (RPE) damage caused by BL and to elucidate the role of nuclear factor (erythroid-derived)-related factor 2 (Nrf2) in the pathogenesis of BL-induced RPE damage. Methods. ARPE-19, a human RPE cell line, and mouse primary RPE cells from wild-type and Nrf2 knockout (Nrf2−/−) mice were cultured under blue LED exposure (intermediate wavelength, 450 nm). Cell death rate and reactive oxygen species (ROS) generation were measured. TUNEL staining was performed to detect apoptosis. Real-time polymerase chain reaction was performed on NRF2 mRNA, and western blotting was performed to detect Nrf2 proteins in the nucleus or cytoplasm of RPE cells. Results. BL exposure increased cell death rate and ROS generation in ARPE-19 cells in a time-dependent manner; cell death was caused by apoptosis. Moreover, BL exposure induced NRF2 mRNA upregulation and Nrf2 nuclear translocation in RPE. Cell death rate was significantly higher in RPE cells from Nrf2−/− mice than from wild-type mice. Conclusions. The Nrf2 pathway plays an important role in protecting RPE cells against BL-induced oxidative stress. PMID:27774118

  16. Argon protects against hypoxic-ischemic brain injury in neonatal rats through activation of nuclear factor (erythroid-derived 2)-like 2.

    PubMed

    Zhao, Hailin; Mitchell, Sian; Ciechanowicz, Sarah; Savage, Sinead; Wang, Tianlong; Ji, Xunming; Ma, Daqing

    2016-05-01

    Perinatal hypoxic ischaemic encephalopathy (HIE) has a high mortality rate with neuropsychological impairment. This study investigated the neuroprotective effects of argon against neonatal hypoxic-ischaemic brain injury.In vitro cortical neuronal cell cultures derived from rat foetuses were subjected to an oxygen and glucose deprivation (OGD) challenge for 90 minutes and then exposed to 70% argon or nitrogen with 5% carbon dioxide and balanced with oxygen for 2 hours.In vivo, seven-day-old rats were subjected to unilateral common carotid artery ligation followed by hypoxic (8% oxygen balanced with nitrogen) insult for 90 minutes. They were exposed to 70% argon or nitrogen balanced with oxygen for 2 hours. In vitro, argon treatment of cortical neuronal cultures resulted in a significant increase of p-mTOR and Nuclear factor (erythroid-derived 2)-like 2(Nrf2) and protection against OGD challenge. Inhibition of m-TOR through Rapamycin or Nrf2 through siRNA abolished argon-mediated cyto-protection. In vivo, argon exposure significantly enhanced Nrf2 and its down-stream effector NAD(P)H Dehydrogenase, Quinone 1(NQO1) and superoxide dismutase 1(SOD1). Oxidative stress, neuroinflammation and neuronal cell death were significantly decreased and brain infarction was markedly reduced. Blocking PI-3K through wortmannin or ERK1/2 through U0126 attenuated argon-mediated neuroprotection.These data provide a new molecular mechanism for the potential application of Argon as a neuroprotectant in HIE.

  17. A small single-"finger" peptide from the erythroid transcription factor GATA-1 binds specifically to DNA as a zinc or iron complex.

    PubMed

    Omichinski, J G; Trainor, C; Evans, T; Gronenborn, A M; Clore, G M; Felsenfeld, G

    1993-03-01

    Sequence-specific DNA binding has been demonstrated for a synthetic peptide comprising only one of the two "finger"-like domains of the erythroid transcription factor GATA-1 (also termed Eryf-1, NF-E1, or GF-1). Quantitative analysis of gel-retardation assays yields a specific association constant of 1.2 x 10(8) M, compared with values of about 10(9) M for the full-length natural GATA-1 protein. By the use of peptides of various lengths, it was possible to delineate the smallest region necessary for specific binding. A single C-terminal finger of the double-finger motif is necessary but not sufficient for sequence-specific interaction. Basic amino acids located C-terminal to the finger (some more than 20 amino acids away) are also essential for tight binding. In addition to demonstrating that zinc is important for the formation of an active binding complex, we show that other ions, notably Fe2+, can fulfill this role. Our results make it clear that the GATA-1 metal binding motif is quite distinct from that found in the steroid hormone family and that GATA-1 is a member of a separate class of DNA binding proteins. PMID:8446581

  18. Nuclear Factor Erythroid 2-Related Factor 2 Drives Podocyte-Specific Expression of Peroxisome Proliferator-Activated Receptor γ Essential for Resistance to Crescentic GN.

    PubMed

    Henique, Carole; Bollee, Guillaume; Lenoir, Olivia; Dhaun, Neeraj; Camus, Marine; Chipont, Anna; Flosseau, Kathleen; Mandet, Chantal; Yamamoto, Masayuki; Karras, Alexandre; Thervet, Eric; Bruneval, Patrick; Nochy, Dominique; Mesnard, Laurent; Tharaux, Pierre-Louis

    2016-01-01

    Necrotizing and crescentic rapidly progressive GN (RPGN) is a life-threatening syndrome characterized by a rapid loss of renal function. Evidence suggests that podocyte expression of the transcription factor peroxisome proliferator-activated receptor γ (PPARγ) may prevent podocyte injury, but the function of glomerular PPARγ in acute, severe inflammatory GN is unknown. Here, we observed marked loss of PPARγ abundance and transcriptional activity in glomerular podocytes in experimental RPGN. Blunted expression of PPARγ in podocyte nuclei was also found in kidneys from patients diagnosed with crescentic GN. Podocyte-specific Pparγ gene targeting accentuated glomerular damage, with increased urinary loss of albumin and severe kidney failure. Furthermore, a PPARγ gain-of-function approach achieved by systemic administration of thiazolidinedione (TZD) failed to prevent severe RPGN in mice with podocyte-specific Pparγ gene deficiency. In nuclear factor erythroid 2-related factor 2 (NRF2)-deficient mice, loss of podocyte PPARγ was observed at baseline. NRF2 deficiency markedly aggravated the course of RPGN, an effect that was partially prevented by TZD administration. Furthermore, delayed administration of TZD, initiated after the onset of RPGN, still alleviated the severity of experimental RPGN. These findings establish a requirement for the NRF2-PPARγ cascade in podocytes, and we suggest that these transcription factors have a role in augmenting the tolerance of glomeruli to severe immune-complex mediated injury. The NRF2-PPARγ pathway may be a therapeutic target for RPGN. PMID:25999406

  19. Adult intussusception.

    PubMed Central

    Azar, T; Berger, D L

    1997-01-01

    OBJECTIVE: The objectives were to review adult intussusception, its diagnosis, and its treatment. SUMMARY BACKGROUND DATA: Adult intussusception represents 1% of all bowel obstructions, 5% of all intussusceptions, and 0.003%-0.02% of all hospital admissions. Intussusception is a different entity in adults than it is in children. METHODS: The records of all patients 18 years and older with the postoperative diagnosis of intussusception at the Massachusetts General Hospital during the years 1964 through 1993 were reviewed retrospectively. The 58 patients were divided into those with benign enteric, malignant enteric, benign colonic, and malignant colonic lesions associated with their intussusception. The diagnosis and treatment of each were reviewed. RESULTS: In 30 years at the Massachusetts General Hospital, there are 58 cases of surgically proven adult intussusception. The patients' mean age was 54.4 years. Most patients presented with symptoms consistent with bowel obstruction. There were 44 enteric and 14 colonic intussusceptions. Ninety-three percent of the intussusceptions were associated with a pathologic lesion. Forty-eight percent of the enteric lesions were malignant and 52% were benign. Forty-three percent of the colonic lesions were malignant and 57% were benign. CONCLUSIONS: Intussusception occurs rarely in adults. It presents with a variety of acute, intermittent, and chronic symptoms, thus making its preoperative diagnosis difficult. Computed tomography scanning proved to be the most useful diagnostic radiologic method. The diagnosis and treatment of adult intussusception are surgical. Surgical resection of the intussusception without reduction is the preferred treatment in adults, as almost half of both colonic and enteric intussusceptions are associated with malignancy. PMID:9296505

  20. Extraction of distance restraints from pure shift NOE experiments

    NASA Astrophysics Data System (ADS)

    Kaltschnee, Lukas; Knoll, Kevin; Schmidts, Volker; Adams, Ralph W.; Nilsson, Mathias; Morris, Gareth A.; Thiele, Christina M.

    2016-10-01

    NMR techniques incorporating pure shift methods to improve signal resolution have recently attracted much attention, owing to their potential use in studies of increasingly complex molecular systems. Extraction of frequencies from these simplified spectra enables easier structure determination, but only a few of the methods presented provide structural parameters derived from signal integral measurements. In particular, for quantification of the nuclear Overhauser effect (NOE) it is highly desirable to utilize pure shift techniques where signal overlap normally prevents accurate signal integration, to enable measurement of a larger number of interatomic distances. However, robust methods for the measurement of interatomic distances using the recently developed pure shift techniques have not been reported to date. In this work we discuss some of the factors determining the accuracy of measurements of signal integrals in interferogram-based Zangger-Sterk (ZS) pure shift NMR experiments. The ZS broadband homodecoupling technique is used in different experiments designed for quantitative NOE determination from pure shift spectra. It is shown that the techniques studied can be used for quantitative extraction of NOE-derived distance restraints, as exemplified for the test case of strychnine.

  1. The neuroanatomy of pure apraxia of speech in stroke

    PubMed Central

    Graff-Radford, Jonathan; Jones, David T.; Strand, Edythe A.; Rabinstein, Alejandro A.; Duffy, Joseph R.; Josephs, Keith A.

    2014-01-01

    The left insula or Broca’s area have been proposed as the neuroanatomical correlate for apraxia of speech (AOS) based on studies of patients with both AOS and aphasia due to stroke. Studies of neurodegenerative AOS suggest the premotor area and the supplementary motor areas as the anatomical correlates. The study objective was to determine the common infarction area in patients with pure AOS due to stroke. Patients with AOS and no or equivocal aphasia due to ischemic stroke were identified through a pre-existing database. Seven subjects were identified. Five had pure AOS, and two had equivocal aphasia. MRI lesion analysis revealed maximal overlap spanning the left premotor and motor cortices. While both neurodegenerative AOS and stroke induced pure AOS involve the premotor cortex, further studies are needed to establish whether stroke-induced AOS and neurodegenerative AOS share a common anatomic substrate. PMID:24556336

  2. Excitation of coherent propagating spin waves by pure spin currents

    PubMed Central

    Demidov, Vladislav E.; Urazhdin, Sergei; Liu, Ronghua; Divinskiy, Boris; Telegin, Andrey; Demokritov, Sergej O.

    2016-01-01

    Utilization of pure spin currents not accompanied by the flow of electrical charge provides unprecedented opportunities for the emerging technologies based on the electron's spin degree of freedom, such as spintronics and magnonics. It was recently shown that pure spin currents can be used to excite coherent magnetization dynamics in magnetic nanostructures. However, because of the intrinsic nonlinear self-localization effects, magnetic auto-oscillations in the demonstrated devices were spatially confined, preventing their applications as sources of propagating spin waves in magnonic circuits using these waves as signal carriers. Here, we experimentally demonstrate efficient excitation and directional propagation of coherent spin waves generated by pure spin current. We show that this can be achieved by using the nonlocal spin injection mechanism, which enables flexible design of magnetic nanosystems and allows one to efficiently control their dynamic characteristics. PMID:26818232

  3. The neuroanatomy of pure apraxia of speech in stroke.

    PubMed

    Graff-Radford, Jonathan; Jones, David T; Strand, Edythe A; Rabinstein, Alejandro A; Duffy, Joseph R; Josephs, Keith A

    2014-02-01

    The left insula or Broca's area have been proposed as the neuroanatomical correlate for apraxia of speech (AOS) based on studies of patients with both AOS and aphasia due to stroke. Studies of neurodegenerative AOS suggest the premotor area and the supplementary motor areas as the anatomical correlates. The study objective was to determine the common infarction area in patients with pure AOS due to stroke. Patients with AOS and no or equivocal aphasia due to ischemic stroke were identified through a pre-existing database. Seven subjects were identified. Five had pure AOS, and two had equivocal aphasia. MRI lesion analysis revealed maximal overlap spanning the left premotor and motor cortices. While both neurodegenerative AOS and stroke induced pure AOS involve the premotor cortex, further studies are needed to establish whether stroke-induced AOS and neurodegenerative AOS share a common anatomic substrate. PMID:24556336

  4. Fast word reading in pure alexia: "fast, yet serial".

    PubMed

    Bormann, Tobias; Wolfer, Sascha; Hachmann, Wibke; Neubauer, Claudia; Konieczny, Lars

    2015-01-01

    Pure alexia is a severe impairment of word reading in which individuals process letters serially with a pronounced length effect. Yet, there is considerable variation in the performance of alexic readers with generally very slow, but also occasionally fast responses, an observation addressed rarely in previous reports. It has been suggested that "fast" responses in pure alexia reflect residual parallel letter processing or that they may even be subserved by an independent reading system. Four experiments assessed fast and slow reading in a participant (DN) with pure alexia. Two behavioral experiments investigated frequency, neighborhood, and length effects in forced fast reading. Two further experiments measured eye movements when DN was forced to read quickly, or could respond faster because words were easier to process. Taken together, there was little support for the proposal that "qualitatively different" mechanisms or reading strategies underlie both types of responses in DN. Instead, fast responses are argued to be generated by the same serial-reading strategy.

  5. Noninformative prior in the quantum statistical model of pure states

    NASA Astrophysics Data System (ADS)

    Tanaka, Fuyuhiko

    2012-06-01

    In the present paper, we consider a suitable definition of a noninformative prior on the quantum statistical model of pure states. While the full pure-states model is invariant under unitary rotation and admits the Haar measure, restricted models, which we often see in quantum channel estimation and quantum process tomography, have less symmetry and no compelling rationale for any choice. We adopt a game-theoretic approach that is applicable to classical Bayesian statistics and yields a noninformative prior for a general class of probability distributions. We define the quantum detection game and show that there exist noninformative priors for a general class of a pure-states model. Theoretically, it gives one of the ways that we represent ignorance on the given quantum system with partial information. Practically, our method proposes a default distribution on the model in order to use the Bayesian technique in the quantum-state tomography with a small sample.

  6. Faithful Transfer Arbitrary Pure States with Mixed Resources

    NASA Astrophysics Data System (ADS)

    Luo, Ming-Xing; Li, Lin; Ma, Song-Ya; Chen, Xiu-Bo; Yang, Yi-Xian

    2013-09-01

    In this paper, we show that some special mixed quantum resource experience the same property of pure entanglement such as Bell state for quantum teleportation. It is shown that one mixed state and three bits of classical communication cost can be used to teleport one unknown qubit compared with two bits via pure resources. The schemes are easily implement with model physical techniques. Moreover, these resources are also optimal and typical for faithfully remotely prepare an arbitrary qubit, two-qubit and three-qubit states with mixed quantum resources. Our schemes are completed as same as those with pure quantum entanglement resources except only 1 bit additional classical communication cost required. The success probability is independent of the form of the mixed resources.

  7. Fisher-Symmetric Informationally Complete Measurements for Pure States.

    PubMed

    Li, Nan; Ferrie, Christopher; Gross, Jonathan A; Kalev, Amir; Caves, Carlton M

    2016-05-01

    We introduce a new kind of quantum measurement that is defined to be symmetric in the sense of uniform Fisher information across a set of parameters that uniquely represent pure quantum states in the neighborhood of a fiducial pure state. The measurement is locally informationally complete-i.e., it uniquely determines these parameters, as opposed to distinguishing two arbitrary quantum states-and it is maximal in the sense of a multiparameter quantum Cramér-Rao bound. For a d-dimensional quantum system, requiring only local informational completeness allows us to reduce the number of outcomes of the measurement from a minimum close to but below 4d-3, for the usual notion of global pure-state informational completeness, to 2d-1. PMID:27203310

  8. Pure Oats as Part of the Canadian Gluten-Free Diet in Celiac Disease: The Need to Revisit the Issue.

    PubMed

    de Souza, M Cristina P; Deschênes, Marie-Eve; Laurencelle, Suzanne; Godet, Patrick; Roy, Claude C; Djilali-Saiah, Idriss

    2016-01-01

    The question about recommending pure, noncontaminated oats as part of the gluten-free diet of patients with celiac disease remains controversial. This might be due to gluten cross contamination and to the possible immunogenicity of some oat cultivars. In view of this controversy, a review of the scientific literature was conducted to highlight the latest findings published between 2008 and 2014 to examine the current knowledge on oats safety and celiac disease in Europe and North America. Results showed that regular oats consumed in Canada are largely contaminated. Overall, the consumption of pure oats has been generally considered to be safe for adults and children. However, it appears that some oat cultivars may trigger an immune response in sensitive individuals. Therefore, further long-term studies on the impact of consumption of oats identifying the cultivar(s) constitute an important step forward for drawing final recommendations. Furthermore, a closer and more accurate monitoring of the dietary intake of noncontaminated oats would be paramount to better determine what its actual contribution in the gluten-free diet of adults and children with celiac disease are in order to draw sound recommendations on the safety of pure oats as part of the gluten-free diet.

  9. Pure Oats as Part of the Canadian Gluten-Free Diet in Celiac Disease: The Need to Revisit the Issue

    PubMed Central

    de Souza, M. Cristina P.; Deschênes, Marie-Eve; Laurencelle, Suzanne; Godet, Patrick; Roy, Claude C.; Djilali-Saiah, Idriss

    2016-01-01

    The question about recommending pure, noncontaminated oats as part of the gluten-free diet of patients with celiac disease remains controversial. This might be due to gluten cross contamination and to the possible immunogenicity of some oat cultivars. In view of this controversy, a review of the scientific literature was conducted to highlight the latest findings published between 2008 and 2014 to examine the current knowledge on oats safety and celiac disease in Europe and North America. Results showed that regular oats consumed in Canada are largely contaminated. Overall, the consumption of pure oats has been generally considered to be safe for adults and children. However, it appears that some oat cultivars may trigger an immune response in sensitive individuals. Therefore, further long-term studies on the impact of consumption of oats identifying the cultivar(s) constitute an important step forward for drawing final recommendations. Furthermore, a closer and more accurate monitoring of the dietary intake of noncontaminated oats would be paramount to better determine what its actual contribution in the gluten-free diet of adults and children with celiac disease are in order to draw sound recommendations on the safety of pure oats as part of the gluten-free diet. PMID:27446824

  10. Pure Oats as Part of the Canadian Gluten-Free Diet in Celiac Disease: The Need to Revisit the Issue.

    PubMed

    de Souza, M Cristina P; Deschênes, Marie-Eve; Laurencelle, Suzanne; Godet, Patrick; Roy, Claude C; Djilali-Saiah, Idriss

    2016-01-01

    The question about recommending pure, noncontaminated oats as part of the gluten-free diet of patients with celiac disease remains controversial. This might be due to gluten cross contamination and to the possible immunogenicity of some oat cultivars. In view of this controversy, a review of the scientific literature was conducted to highlight the latest findings published between 2008 and 2014 to examine the current knowledge on oats safety and celiac disease in Europe and North America. Results showed that regular oats consumed in Canada are largely contaminated. Overall, the consumption of pure oats has been generally considered to be safe for adults and children. However, it appears that some oat cultivars may trigger an immune response in sensitive individuals. Therefore, further long-term studies on the impact of consumption of oats identifying the cultivar(s) constitute an important step forward for drawing final recommendations. Furthermore, a closer and more accurate monitoring of the dietary intake of noncontaminated oats would be paramount to better determine what its actual contribution in the gluten-free diet of adults and children with celiac disease are in order to draw sound recommendations on the safety of pure oats as part of the gluten-free diet. PMID:27446824

  11. Actuating dielectric elastomers in pure shear deformation by elastomeric conductors

    SciTech Connect

    Wang, Yin; Chen, Baohong; Zhou, Jinxiong; Bai, Yuanyuan; Wang, Hong

    2014-02-10

    Pure shear experiments are commonly used to characterize dielectric elastomer (DE) material properties and to evaluate DE actuator/generator performance. It is increasingly important for many applications to replace conventional carbon grease electrodes with stretchable elastomeric conductors. We formulate a theory for DE with elastomeric conductors, synthesize transparent hydrogel as ionic conductors, and measure actuation of DE in pure shear deformation. Maximum 67% actuation strain is demonstrated. The theory agrees well with our measurement and also correlates well with reported experiments on DE with electronic conductors.

  12. Six open string disk amplitude in pure spinor superspace

    NASA Astrophysics Data System (ADS)

    Mafra, Carlos R.; Schlotterer, Oliver; Stieberger, Stephan; Tsimpis, Dimitrios

    2011-05-01

    The tree-level amplitude of six massless open strings is computed using the pure spinor formalism. The OPE poles among integrated and unintegrated vertices can be efficiently organized according to the cohomology of pure spinor superspace. The identification and use of these BRST structures and their interplay with the system of equations fulfilled by the generalized Euler integrals allow the full supersymmetric six-point amplitude to be written in compact form. Furthermore, the complete set of extended Bern-Carrasco-Johansson relations are derived from the monodromy properties of the disk world-sheet and explicitly verified for the supersymmetric numerator factors.

  13. PURE CULTIVATION IN VIVO OF VACCINE VIRUS FREE FROM BACTERIA

    PubMed Central

    Noguchi, Hideyo

    1915-01-01

    Vaccine virus freed from all associated bacteria by means of suitable disinfecting agents can be propagated in a pure state in the testicles of rabbits and bulls. The virus cultivated in this manner is not only devoid of all bacteria, but appears capable of indefinite transfer from one animal to another. Sixty passages in rabbits of a pure strain have been made within one year. Several transfers from testicle to testicle are required to bring about accurate adaptation of the virus to the testicular parenchyma, so that continued propagation in this way can be certainly secured. During the first transfers from testicle to testicle the activity of the virus may be less than the original skin specimen from which the pure strain was derived; but as the transfers proceed the activity rises until, when the adaptation is complete, the activity of the testicular equals that of the skin strain. The multiplication of the virus within the testicle is maximum on the fourth or fifth day after inoculation; the quantity of virus remains about stationary until the eighth day, when diminution begins. At the expiration of five weeks no more virus could be detected in the testicle. The vaccinal processes in the skin, cornea, and testicle of rabbits are practically identical whether the virus employed for the inoculation has been the original skin strain or the pure testicular strain; and the skin lesions produced in the calf with the two strains are also identical. In conformity with the finding mentioned in the last paragraph it has been found that human beings react to the pure testicular strain of vaccine virus in an entirely typical manner. In the case both of original vaccination and revaccination the vaccinal effects cannot be distinguished from those arising from uncomplicated skin virus. Pure strains of testicular virus are readily produced, and once secured they may be propagated in a pure state by the method described in rabbits or bulls without difficulty and with economy

  14. Clinical study of 222 patients with pure motor stroke

    PubMed Central

    Arboix, A; Padilla, I; Massons, J; Garcia-Eroles, L; Comes, E; Targa, C

    2001-01-01

    The objective was to assess the frequency of pure motor stroke caused by different stroke subtypes and to compare demographic, clinical, neuroimaging, and outcome data of pure motor stroke with those of patients with other lacunar stroke as well as with those of patients with non-lacunar stroke.
Data from 2000 patients with acute stroke (n=1761) or transient ischaemic attack (n=239) admitted consecutively to the department of neurology of an acute care 350 bed teaching hospital were prospectively collected in the Sagrat Cor Hospital of Barcelona stroke registry over a 10 year period. For the purpose of the study 222 (12.7%) patients with pure motor stroke were selected. The other study groups included 218 (12.3%) patients with other lacunar strokes and 1321 (75%) patients with non-lacunar stroke.
In relation to stroke subtype, lacunar infarcts were found in 189 (85%) patients, whereas ischaemic lacunar syndromes not due to lacunar infarcts occurred in 23 (10.4%) patients (atherothrombotic stroke in 12, cardioembolic stroke in seven, infarction of undetermined origin in three, and infarction of unusual aetiology in one) and haemorrhagic lacunar syndromes in 10 (4.5%). Patients with pure motor stroke showed a better outcome than patients with non-lacunar stroke with a significantly lower number of complications and in hospital mortality rate, shorter duration of hospital stay, and a higher number of symptom free patients at hospital discharge. After multivariate analysis, hypertension, diabetes, obesity, hyperlipidaemia, non-sudden stroke onset, internal capsule involvement, and pons topography seemed to be independent factors of pure motor stroke in patients with acute stroke.
In conclusion, about one of every 10 patients with acute stroke had a pure motor stroke. Pure motor stroke was caused by a lacunar infarct in 85% of patients and by other stroke subtypes in 15%. Several clinical features are more frequent in patients with pure motor stroke than in

  15. Pure tone audiometry: comparison of general practice and hospital services

    PubMed Central

    Smith, Michael C.F.; Cable, Hugh R.; Wilmot, John F.

    1988-01-01

    Pure tone audiometry was obtained for both ears of 32 children by a general practitioner using a simple audiometer in his surgery, and by audiometricians in a hospital department on the same day. Comparing the worst hearing threshold at any of the three tested frequencies, the general practitioner did not find any ears to hear more than 10 dB better than the hospital (no false negatives). However, there were six false positives (9%) where the general practitioner identified an apparent hearing loss of greater than 15 dB. It is concluded that pure tone audiometry could be carried out accurately in the practice. PMID:3267745

  16. Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Mediates Neuroprotection in Traumatic Brain Injury at Least in Part by Inactivating Microglia

    PubMed Central

    Wu, Gang; Liu, Zongying

    2016-01-01

    Background Microglial activation has been reported to be involved in traumatic brain injury (TBI). Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in protecting against TBI-induced secondary brain injury. However, the exact mechanism is not clearly understood. The present study aimed to explore whether Nrf2 protects against TBI partly by regulating microglia function. Material/Methods Microglia cells were isolated from C57BL/6 mouse brains (postnatal day 1–3). The expression of Nrf2 was suppressed by transfection with Nrf2-specific small interfering RNA (siRNA), and overexpressed by transfections with pcDNA3.1-Nrf2. The expression of Nrf2 was confirmed by real-time PCR and Western blotting. After transfection, cell viability, phagocytic ability, and the expression of pro-inflammatory cytokines (tumor necrosis factor (TNF)-α and interleukin (IL)-6) were determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) colorimetric assay, phagocytosis assay, and enzyme-linked immunosorbent assay (ELISA), respectively. Results mRNA and protein expression levels of Nrf2 were significantly reduced by transfection with Nrf2-specific siRNA (both P<0.05) but were elevated by transfection with pcDNA3.1-Nrf2 (both P<0.01). The cell viability, phagocytic ability, and the expression of TNF-α and IL-6 were all significantly reduced by overexpression of Nrf2 but were significantly increased by silencing of Nrf2 compared with the control group. Conclusions Our results suggest that Nrf2 protects against TBI, at least part by regulating microglia function. PMID:27336674

  17. Sodium arsenite induced reactive oxygen species generation, nuclear factor (erythroid-2 related) factor 2 activation, heme oxygenase-1 expression, and glutathione elevation in Chang human hepatocytes.

    PubMed

    Li, Bing; Li, Xin; Zhu, Bo; Zhang, Xinyu; Wang, Yi; Xu, Yuanyuan; Wang, Huihui; Hou, Yongyong; Zheng, Quanmei; Sun, Guifan

    2013-07-01

    Liver is one of the major target organs of arsenic toxicity and carcinogenesis. Nuclear factor (erythroid-2 related) factor 2 (Nrf2) is a redox-sensitive transcription factor, regulating critically cellular defense responses against the toxic metallic arsenic in many cell types and tissues. This study was conducted to evaluate the hepato-cellular Nrf2 and Nrf2-regulated antioxidant reactions of sodium arsenite exposure in Chang human hepatocytes. Nrf2 and heme oxygenase-1 (HO-1) protein levels were detected by Western blot, and Nrf2-regulated HO-1 mRNA expressions were determined using semiquantitative RT-PCR by 0∼50 μmol/L of sodium arsenite exposure for 2, 6, 12, and 24 h. We also observed the changes of intracellular reactive oxygen species (ROS) and total cellular glutathione (GSH) by flow cytometry and spectrophotometry, respectively. Our results showed that intracellular ROS were both dose- and time-dependent induced by inorganic arsenic; Cellular Nrf2 protein levels increased rapidly after 2 h of exposure, elevated significantly at 6 h, and reached the maximum at 12 h. The endogenous Nrf2-regulated downstream HO-1 mRNA and protein were also induced dramatically and lasted for as long as 24 h. In addition, intracellular GSH levels elevated in consistent with Nrf2 activation. Our findings here suggest that inorganic arsenic alters cellular redox balance in hepatocytes to trigger Nrf2-regulated antioxidant responses promptly, which may represent an adaptive cell defense mechanism against inorganic arsenic induced liver injuries and hepatoxicity.

  18. Morris Water Maze Training in Mice Elevates Hippocampal Levels of Transcription Factors Nuclear Factor (Erythroid-derived 2)-like 2 and Nuclear Factor Kappa B p65

    PubMed Central

    Snow, Wanda M.; Pahlavan, Payam S.; Djordjevic, Jelena; McAllister, Danielle; Platt, Eric E.; Alashmali, Shoug; Bernstein, Michael J.; Suh, Miyoung; Albensi, Benedict C.

    2015-01-01

    Research has identified several transcription factors that regulate activity-dependent plasticity and memory, with cAMP-response element binding protein (CREB) being the most well-studied. In neurons, CREB activation is influenced by the transcription factor nuclear factor kappa B (NF-κB), considered central to immunity but more recently implicated in memory. The transcription factor early growth response-2 (Egr-2), an NF-κB gene target, is also associated with learning and memory. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), an antioxidant transcription factor linked to NF-κB in pathological conditions, has not been studied in normal memory. Given that numerous transcription factors implicated in activity-dependent plasticity demonstrate connections to NF-κB, this study simultaneously evaluated protein levels of NF-κB, CREB, Egr-2, Nrf2, and actin in hippocampi from young (1 month-old) weanling CD1 mice after training in the Morris water maze, a hippocampal-dependent spatial memory task. After a 6-day acquisition period, time to locate the hidden platform decreased in the Morris water maze. Mice spent more time in the target vs. non-target quadrants of the maze, suggestive of recall of the platform location. Western blot data revealed a decrease in NF-κB p50 protein after training relative to controls, whereas NF-κB p65, Nrf2 and actin increased. Nrf2 levels were correlated with platform crosses in nearly all tested animals. These data demonstrate that training in a spatial memory task results in alterations in and associations with particular transcription factors in the hippocampus, including upregulation of NF-κB p65 and Nrf2. Training-induced increases in actin protein levels caution against its use as a loading control in immunoblot studies examining activity-dependent plasticity, learning, and memory. PMID:26635523

  19. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  20. Downregulation of Nuclear Factor Erythroid 2-Related Factor and Associated Antioxidant Genes Contributes to Redox-Sensitive Vascular Dysfunction in Hypertension.

    PubMed

    Lopes, Rhéure A; Neves, Karla B; Tostes, Rita C; Montezano, Augusto C; Touyz, Rhian M

    2015-12-01

    Oxidative stress is implicated in vascular dysfunction in hypertension. Although mechanisms regulating vascular pro-oxidants are emerging, there is a paucity of information on antioxidant systems, particularly nuclear factor erythroid 2-related factor (Nrf2), a master regulator of antioxidants enzymes. We evaluated the vascular regulatory role of Nrf2 in hypertension and examined molecular mechanisms, whereby Nrf2 influences redox signaling in small arteries and vascular smooth muscle cells from Wistar Kyoto (WKY) and stroke-prone spontaneously hypertensive rats (SHRSP). Cells were stimulated with angiotensin II in the absence/presence of Nrf2 activators (bardoxolone/L-sulforaphane). Increased vascular reactive oxygen species production (chemiluminescence and amplex red) was associated with reduced Nrf2 activity in arteries (18%) and vascular smooth muscle cells (48%) in SHRSP (P<0.05 versus WKY). Expression of antioxidant enzymes, including superoxide dismutase-1 (64%), catalase (60%), peroxiredoxin 1 (75%), and glutathione peroxidase (54%), was reduced in SHRSP. L-sulforaphane reversed these effects. Angiotensin II increased nuclear accumulation of Nrf2 in vascular smooth muscle cells from WKY (197% versus vehicle), with blunted effects in SHRSP (44% versus vehicle). These responses were associated with increased antioxidant expression (superoxide dismutase-1, 32%; catalase, 42%; thioredoxin, 71%; peroxiredoxin, 1%-90%; quinone oxidoreductase, 84%; P<0.05 versus vehicle) and increased activity of superoxide dismutase-1, catalase, and thioredoxin in WKY but not in SHRSP, which exhibited increased Bach1 expression. Nrf2 activators blocked angiotensin II-induced reactive oxygen species generation. Vascular function demonstrated increased contractility (Emax WKY 113.4±5.6 versus SHRSP 159.0±8.3) and decreased endothelial-dependent relaxation (Emax WKY 88.6±3.1 versus SHRSP 74.6±3.2, P<0.05) in SHRSP, effects corrected by L-sulforaphane. Our findings suggest that

  1. Zinc protects against diabetes-induced pathogenic changes in the aorta: roles of metallothionein and nuclear factor (erythroid-derived 2)-like 2

    PubMed Central

    2013-01-01

    Background Cardiovascular diseases remain a leading cause of the mortality world-wide, which is related to several risks, including the life style change and the increased diabetes prevalence. The present study was to explore the preventive effect of zinc on the pathogenic changes in the aorta. Methods A genetic type 1 diabetic OVE26 mouse model was used with/without zinc supplementation for 3 months. To determine gender difference either for pathogenic changes in the aorta of diabetic mice or for zinc protective effects on diabetes-induced pathogenic changes, both males and females were investigated in parallel by histopathological and immunohistochemical examinations, in combination of real-time PCR assay. Results Diabetes induced significant increases in aortic oxidative damage, inflammation, and remodeling (increased fibrosis and wall thickness) without significant difference between genders. Zinc treatment of these diabetic mice for three months completely prevented the above pathogenic changes in the aorta, and also significantly up-regulated the expression and function of nuclear factor (erythroid-derived 2)-like 2 (Nrf2), a pivotal regulator of anti-oxidative mechanism, and the expression of metallothionein (MT), a potent antioxidant. There was gender difference for the protective effect of zinc against diabetes-induced pathogenic changes and the up-regulated levels of Nrf2 and MT in the aorta. Conclusions These results suggest that zinc supplementation provides a significant protection against diabetes-induced pathogenic changes in the aorta without gender difference in the type 1 diabetic mouse model. The aortic protection by zinc against diabetes-induced pathogenic changes is associated with the up-regulation of both MT and Nrf2 expression. PMID:23536959

  2. Antioxidative effects of the spice cardamom against non-melanoma skin cancer by modulating nuclear factor erythroid-2-related factor 2 and NF-κB signalling pathways.

    PubMed

    Das, Ila; Acharya, Asha; Berry, Deborah L; Sen, Supti; Williams, Elizabeth; Permaul, Eva; Sengupta, Archana; Bhattacharya, Sudin; Saha, Tapas

    2012-09-28

    The role of dietary factors in inhibiting or delaying the development of non-melanoma skin cancer (NMSC) has been investigated for many years. Cardamom, which is a dietary phytoproduct, has been commonly used in cuisines for flavour and has numerous health benefits, such as improving digestion and stimulating metabolism and having antitumorigenic effects. We have investigated the efficacy of dietary cardamom against 7,12-dimethylbenz[a]anthracene (DMBA)-induced skin papillomatogenesis in Swiss albino mice that closely resembles human NMSC. Mice were grouped into normal wild type (untreated), vehicle-treated (acetone), carcinogen-treated (DMBA), and DMBA and cardamom-treated (DMBA+CARD) to delineate the role of cardamom against DMBA-induced papillomatogenesis. Oral administration of cardamom to DMBA-treated mice up-regulated the phase II detoxification enzymes, such as glutathione-S-transferase and glutathione peroxidase, probably via activation of nuclear factor erythroid-2-related factor 2 transcription factor in 'DMBA+CARD' mice. Furthermore, reduced glutathione, glutathione reductase, superoxide dismutase and catalase were also up-regulated by cardamom in the same 'DMBA+CARD' group of mice compared with DMBA-treated mice. Cardamom ingestion in DMBA-treated mice blocked NF-κB activation and down-regulated cyclo-oxygenase-2 expression. As a consequence, both the size and the number of skin papillomas generated on the skin due to the DMBA treatment were reduced in the 'DMBA+CARD' group. Thus, the results from the present study suggest that cardamom has a potential to become a pivotal chemopreventive agent to prevent papillomagenesis on the skin. PMID:22182368

  3. Nuclear Factor Erythroid 2-Related Factor 2 Deletion Impairs Glucose Tolerance and Exacerbates Hyperglycemia in Type 1 Diabetic MiceS⃞

    PubMed Central

    Aleksunes, Lauren M.; Reisman, Scott A.; Yeager, Ronnie L.; Goedken, Michael J.

    2010-01-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic β-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum β-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels. PMID:20086057

  4. A single mRNA, transcribed from an alternative, erythroid-specific, promoter, codes for two non-myristylated forms of NADH-cytochrome b5 reductase

    PubMed Central

    1992-01-01

    Two forms of NADH-cytochrome b5 reductase are produced from one gene: a myristylated membrane-bound enzyme, expressed in all tissues, and a soluble, erythrocyte-specific, isoform. The two forms are identical in a large cytoplasmic domain (Mr approximately 30,000) and differ at the NH2-terminus, which, in the membrane form, is responsible for binding to the bilayer, and which contains the myristylation consensus sequence and an additional 14 uncharged amino acids. To investigate how the two differently targeted forms of the reductase are produced, we cloned a reductase transcript from reticulocytes, and studied its relationship to the previously cloned liver cDNA. The reticulocyte transcript differs from the liver transcript in the 5' non-coding portion and at the beginning of the coding portion, where the seven codons specifying the myristoylation consensus are replaced by a reticulocyte-specific sequence which codes for 13 non-charged amino acids. Analysis of genomic reductase clones indicated that the ubiquitous transcript is generated from an upstream "housekeeping" type promoter, while the reticulocyte transcript originates from a downstream, erythroid- specific, promoter. In vitro translation of the reticulocyte-specific mRNA generated two products: a minor one originating from the first AUG, and a major one starting from a downstream AUG, as indicated by mutational analysis. Both the AUGs used as initiation codons were in an unfavorable sequence context. The major, lower relative molecular mass product behaved as a soluble protein, while the NH2-terminally extended minor product interacted with microsomes in vitro. The generation of soluble reductase from a downstream AUG was confirmed in vivo, in Xenopus oocytes. Thus, differently localized products, with respect both to tissues and to subcellular compartments, are generated from the same gene by a combination of transcriptional and translational mechanisms. PMID:1577871

  5. Morris Water Maze Training in Mice Elevates Hippocampal Levels of Transcription Factors Nuclear Factor (Erythroid-derived 2)-like 2 and Nuclear Factor Kappa B p65.

    PubMed

    Snow, Wanda M; Pahlavan, Payam S; Djordjevic, Jelena; McAllister, Danielle; Platt, Eric E; Alashmali, Shoug; Bernstein, Michael J; Suh, Miyoung; Albensi, Benedict C

    2015-01-01

    Research has identified several transcription factors that regulate activity-dependent plasticity and memory, with cAMP-response element binding protein (CREB) being the most well-studied. In neurons, CREB activation is influenced by the transcription factor nuclear factor kappa B (NF-κB), considered central to immunity but more recently implicated in memory. The transcription factor early growth response-2 (Egr-2), an NF-κB gene target, is also associated with learning and memory. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), an antioxidant transcription factor linked to NF-κB in pathological conditions, has not been studied in normal memory. Given that numerous transcription factors implicated in activity-dependent plasticity demonstrate connections to NF-κB, this study simultaneously evaluated protein levels of NF-κB, CREB, Egr-2, Nrf2, and actin in hippocampi from young (1 month-old) weanling CD1 mice after training in the Morris water maze, a hippocampal-dependent spatial memory task. After a 6-day acquisition period, time to locate the hidden platform decreased in the Morris water maze. Mice spent more time in the target vs. non-target quadrants of the maze, suggestive of recall of the platform location. Western blot data revealed a decrease in NF-κB p50 protein after training relative to controls, whereas NF-κB p65, Nrf2 and actin increased. Nrf2 levels were correlated with platform crosses in nearly all tested animals. These data demonstrate that training in a spatial memory task results in alterations in and associations with particular transcription factors in the hippocampus, including upregulation of NF-κB p65 and Nrf2. Training-induced increases in actin protein levels caution against its use as a loading control in immunoblot studies examining activity-dependent plasticity, learning, and memory.

  6. Sulphur antioxidants inhibit oxidative stress induced retinal ganglion cell death by scavenging reactive oxygen species but influence nuclear factor (erythroid-derived 2)-like 2 signalling pathway differently.

    PubMed

    Majid, Aman Shah Abdul; Yin, Zheng Qin; Ji, Dan

    2013-01-01

    This study aimed to show if two different sulphur containing drugs sulbutiamine and acetylcysteine (NAC) could attenuate the effects of two different insults being serum deprivation and glutamate/buthionine sulfoximine (GB)-induced death to transformed retinal ganglion cell line (RGC-5) in culture. Cells were exposed to either 5 mM of GB for 24 h or serum deprivation for 48 h with inclusion of either NAC or sulbutiamine. Cell viability, microscopic evidence for apoptosis, caspase 3 activity, reactive oxygen species (ROS), glutathione (GSH), catalase and gluthathione-S-transferase (GST) were determined. The effects of NAC and sulbutiamine on the oxidative stress related transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2) levels and its dependent phase II enzyme haemeoxygenase-1 (HO-1) were carried out using Western blot and quantitative-polymerase chain reaction (PCR). NAC and sulbutiamine dose-dependently attenuated serum deprivation-induced cell death. However NAC but not sulbutiamine attenuated GB-induced cell death. NAC and sulbutiamine both independently stimulated the GSH and GST production but scavenged different types of ROS with different efficacy. Moreover only sulbutiamine stimulated catalase and significantly increased Nrf-2 and HO-1 levels. In addition, the pan caspase inhibitor, benzoylcarbonyl-Val-Ala-Asp-fluoromethyl ketone (z-VAD-fmk) attenuated the negative effect of serum deprivation while the necroptosis inhibitor (necrostatin-1) counteracted solely an insult of GB. The neuroprotective actions of NAC and sulbutiamine in GB or serum-deprivation insult are therefore different. PMID:23811559

  7. Plant Extracts of the Family Lauraceae: A Potential Resource for Chemopreventive Agents that Activate the Nuclear Factor-Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway

    PubMed Central

    Shen, Tao; Chen, Xue-Mei; Harder, Bryan; Long, Min; Wang, Xiao-Ning; Lou, Hong-Xiang; Wondrak, Georg T.; Ren, Dong-Mei; Zhang, Donna D.

    2015-01-01

    Cells and tissues counteract insults from exogenous or endogenous carcinogens through the expression of genes encoding antioxidants and phase II detoxifying enzymes regulated by antioxidant response element promoter regions. Nuclear factor-erythroid 2-related factor 2 plays a key role in regulating the antioxidant response elements-target gene expression. Hence, the Nrf2/ARE pathway represents a vital cellular defense mechanism against damage caused by oxidative stress and xenobiotics, and is recognized as a potential molecular target for discovering chemo-preventive agents. Using a stable antioxidant response element luciferase reporter cell line derived from human breast cancer MDA-MB-231 cells combined with a 96-well high-throughput screening system, we have identified a series of plant extracts from the family Lauraceae that harbor Nrf2-inducing effects. These extracts, including Litsea garrettii (ZK-08), Cinnamomum chartophyllum (ZK-02), C. mollifolium (ZK-04), C. camphora var. linaloolifera (ZK-05), and C. burmannii (ZK-10), promoted nuclear translocation of Nrf2, enhanced protein expression of Nrf2 and its target genes, and augmented intracellular glutathione levels. Cytoprotective activity of these extracts against two electrophilic toxicants, sodium arsenite and H2O2, was investigated. Treatment of human bronchial epithelial cells with extracts of ZK-02, ZK-05, and ZK-10 significantly improved cell survival in response to sodium arsenite and H2O2, while ZK-08 showed a protective effect against only H2O2. Importantly, their protective effects against insults from both sodium arsenite and H2O2 were Nrf2-dependent. Therefore, our data provide evidence that the selected plants from the family Lauraceae are potential sources for chemopreventive agents targeting the Nrf2/ARE pathway. PMID:24585092

  8. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  9. Antioxidative effects of the spice cardamom against non-melanoma skin cancer by modulating nuclear factor erythroid-2-related factor 2 and NF-κB signalling pathways.

    PubMed

    Das, Ila; Acharya, Asha; Berry, Deborah L; Sen, Supti; Williams, Elizabeth; Permaul, Eva; Sengupta, Archana; Bhattacharya, Sudin; Saha, Tapas

    2012-09-28

    The role of dietary factors in inhibiting or delaying the development of non-melanoma skin cancer (NMSC) has been investigated for many years. Cardamom, which is a dietary phytoproduct, has been commonly used in cuisines for flavour and has numerous health benefits, such as improving digestion and stimulating metabolism and having antitumorigenic effects. We have investigated the efficacy of dietary cardamom against 7,12-dimethylbenz[a]anthracene (DMBA)-induced skin papillomatogenesis in Swiss albino mice that closely resembles human NMSC. Mice were grouped into normal wild type (untreated), vehicle-treated (acetone), carcinogen-treated (DMBA), and DMBA and cardamom-treated (DMBA+CARD) to delineate the role of cardamom against DMBA-induced papillomatogenesis. Oral administration of cardamom to DMBA-treated mice up-regulated the phase II detoxification enzymes, such as glutathione-S-transferase and glutathione peroxidase, probably via activation of nuclear factor erythroid-2-related factor 2 transcription factor in 'DMBA+CARD' mice. Furthermore, reduced glutathione, glutathione reductase, superoxide dismutase and catalase were also up-regulated by cardamom in the same 'DMBA+CARD' group of mice compared with DMBA-treated mice. Cardamom ingestion in DMBA-treated mice blocked NF-κB activation and down-regulated cyclo-oxygenase-2 expression. As a consequence, both the size and the number of skin papillomas generated on the skin due to the DMBA treatment were reduced in the 'DMBA+CARD' group. Thus, the results from the present study suggest that cardamom has a potential to become a pivotal chemopreventive agent to prevent papillomagenesis on the skin.

  10. HnRNP A1 tethers KSRP to an exon splicing silencer that inhibits an erythroid-specific splicing event in PU.1-induced erythroleukemia

    PubMed Central

    Douablin, Alexandre; Deguillien, Mireille; Breig, Osman; Baklouti, Faouzi

    2015-01-01

    Exon 16 inclusion is a critical splicing event that triggers the production of a functional protein 4.1R in mature normal erythroblasts, and is obviated in PU.1-induced erythroleukemia cells. Exon 16 contains an exonic splicing silencer (ESS16) that interacts with hnRNP A/B in heterologous cell context. We here show that ESS16 promotes the recruitment of a protein complex containing hnRNP A1 and a 79-kDa protein in nuclear extracts from either proliferative erythroleukemia cells or cells induced to terminal differentiation. By using 2D gel fractionation and mass spectrometry, we unambiguously identified KSRP as the 79-kDa component interacting with ESS16. Furthermore, we show that KSRP slightly decreases in erythroleukemia cells induced to terminal erythroid differentiation. Yet, KSRP inducible knockdown, through stable transfection of small hairpin KSRP RNA, did not alter exon 16 splicing, suggesting that KSRP alone does not modulate the splicing event. Interestingly, absence of hnRNP A1 prevented KSRP from binding to ESS16. Reciprocally, KSRP interaction with ESS16 was recovered when hnRNP A1 expression is restored in hnRNP A1-null cells. Collectively, this study establishes that hnRNPA1 is part of a KSRP-containing RNP complex, and emphasizes that, aside from its function in AU-rich element-mediated mRNA decay and its role in microRNA biogenesis, KSRP associates with hnRNP A1 to bind an ESS. These findings further support the role of members of the KH-domain protein family in organizing large RNA-protein complex formation, rather than primarily in modulating specific splicing events. PMID:26101706

  11. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae)

    PubMed Central

    Liu, Di; Irwin, David M.; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  12. Bortezomib in Treating Patients With High-Risk Acute Myeloid Leukemia in Remission

    ClinicalTrials.gov

    2014-10-30

    Acute Myeloid Leukemia With Multilineage Dysplasia Following Myelodysplastic Syndrome; Adult Acute Minimally Differentiated Myeloid Leukemia (M0); Adult Acute Myeloblastic Leukemia Without Maturation (M1); Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Promyelocytic Leukemia (M3); Adult Erythroleukemia (M6a); Adult Pure Erythroid Leukemia (M6b); Secondary Acute Myeloid Leukemia

  13. Similarities and differences between learning abilities, "pure" learning disabilities, "pure" ADHD and comorbid ADHD with learning disabilities.

    PubMed

    Mangina, Constantine A; Beuzeron-Mangina, Helen

    2009-08-01

    This research pursues the crucial question of the differentiation of preadolescents with "Pure" ADHD, comorbid ADHD with learning disabilities, "Pure" learning disabilities and age-matched normal controls. For this purpose, Topographic Mapping of Event-Related Brain Potentials (ERPs) to a Memory Workload Paradigm with visually presented words, Bilateral Electrodermal Activity during cognitive workload and Mangina-Test performance were used. The analysis of Topographic distribution of amplitudes revealed that normal preadolescents were significantly different from "Pure" ADHD (P<0.0001), "Pure" learning disabilities (P<0.0001), and comorbid ADHD with learning disabilities (P<0.0009), by displaying enhanced prefrontal and frontal negativities (N450). In contrast, preadolescents with "Pure" ADHD and comorbid ADHD with learning disabilities have shown a marked reduction of prefrontal and frontal negativities (N450). As for the "Pure" Learning Disabled preadolescents, very small positivities (P450) in prefrontal and frontal regions were obtained as compared to the other pathological groups. Bilateral Electrodermal Activity during cognitive workload revealed a significant main effect for groups (P<0.00001), Left versus Right (P=0.0029) and sessions (P=0.0136). A significant main effect for the Mangina-Test performance which separated the four groups was found (P<0.000001). Overall, these data support the existence of clear differences and similarities between the pathological preadolescent groups as opposed to age-matched normal controls. The psychophysiological differentiation of these groups, provides distinct biological markers which integrate central, autonomic and neuropsychometric variables by targeting the key features of these pathologies for diagnosis and intervention strategies and by providing knowledge for the understanding of normal neurocognitive processes and functions.

  14. Adult Children.

    ERIC Educational Resources Information Center

    Frazier, Billie H.

    This document contains a brief bibliography of peer-reviewed literature, with abstracts, on adult children. It is one of 12 bibliographies on aging prepared by the National Agricultural Library for its "Pathfinders" series of publications. Topics covered by the other 11 bibliographies include aging parents, dementia and Alzheimer's disease in the…

  15. Adult Psychology.

    ERIC Educational Resources Information Center

    Bischof, Ledford J.

    This volume comprehensively reviews the research on the psychology of the middle aged (ages 40-65). Topics include the concept of maturity and maturation models, the measurement and influences of adult self image; marriage and sexual patterns; intergenerational relationships between and children; vocations and avocations (work, retirement, play,…

  16. Idealization in Chemistry: Pure Substance and Laboratory Product

    ERIC Educational Resources Information Center

    Fernández-González, Manuel

    2013-01-01

    This article analyzes the concept of idealization in chemistry and the role played by pure substance and laboratory product. This topic has evident repercussions in the educational contexts that are applied to the science classroom, which are highlighted throughout the text. A common structure for knowledge construction is proposed for both…

  17. A Hybrid Sensing Approach for Pure and Adulterated Honey Classification

    PubMed Central

    Subari, Norazian; Saleh, Junita Mohamad; Shakaff, Ali Yeon Md; Zakaria, Ammar

    2012-01-01

    This paper presents a comparison between data from single modality and fusion methods to classify Tualang honey as pure or adulterated using Linear Discriminant Analysis (LDA) and Principal Component Analysis (PCA) statistical classification approaches. Ten different brands of certified pure Tualang honey were obtained throughout peninsular Malaysia and Sumatera, Indonesia. Various concentrations of two types of sugar solution (beet and cane sugar) were used in this investigation to create honey samples of 20%, 40%, 60% and 80% adulteration concentrations. Honey data extracted from an electronic nose (e-nose) and Fourier Transform Infrared Spectroscopy (FTIR) were gathered, analyzed and compared based on fusion methods. Visual observation of classification plots revealed that the PCA approach able to distinct pure and adulterated honey samples better than the LDA technique. Overall, the validated classification results based on FTIR data (88.0%) gave higher classification accuracy than e-nose data (76.5%) using the LDA technique. Honey classification based on normalized low-level and intermediate-level FTIR and e-nose fusion data scored classification accuracies of 92.2% and 88.7%, respectively using the Stepwise LDA method. The results suggested that pure and adulterated honey samples were better classified using FTIR and e-nose fusion data than single modality data. PMID:23202033

  18. About the Role of Visual Field Defects in Pure Alexia

    ERIC Educational Resources Information Center

    Pflugshaupt, Tobias; Gutbrod, Klemens; Wurtz, Pascal; von Wartburg, Roman; Nyffeler, Thomas; de Haan, Bianca; Karnath, Hans-Otto; Mueri, Rene M.

    2009-01-01

    Pure alexia is an acquired reading disorder characterized by a disproportionate prolongation of reading time as a function of word length. Although the vast majority of cases reported in the literature show a right-sided visual defect, little is known about the contribution of this low-level visual impairment to their reading difficulties. The…

  19. Computer Pure-Tone and Operator Stress: Report III.

    ERIC Educational Resources Information Center

    Dow, Caroline; Covert, Douglas C.

    Pure-tone sound at 15,750 Herz generated by flyback transformers in many computer and video display terminal (VDT) monitors has stress-related productivity effects in some operators, especially women. College-age women in a controlled experiment simulating half a normal work day showed responses within the first half hour of exposure to a tone…

  20. Effect of dissociation on thermodynamic properties of pure diatomic gases

    NASA Technical Reports Server (NTRS)

    Woolley, Harold W

    1955-01-01

    A graphical method is described by which the enthalpy, entropy, and compressibility factor for the equilibrium mixture of atoms and diatomic molecules for pure gaseous elements may be obtained and shown for any dissociating element for which the necessary data exist. Results are given for hydrogen, oxygen, and nitrogen. The effect of dissociation on the heat capacity is discussed briefly.

  1. Chemical modification of pure titanium surfaces for oral implants.

    PubMed

    Pimenta, J; Castro, F

    1999-01-01

    A technique that achieves different pure titanium surfaces depending on acid concentration and exposure time is described. It is possible to obtain, with the same chemical treatment, both large pits and small rugosities. This technique may have interesting applications in oral implants.

  2. Complex windmill transformation producing new purely magnetic fluids

    NASA Astrophysics Data System (ADS)

    Lozanovski, C.; Wylleman, L.

    2011-04-01

    Minimal complex windmill transformations of G2IB(ii) spacetimes (admitting a two-dimensional Abelian group of motions of the so-called Wainwright B(ii) class) are defined and the compatibility with a purely magnetic Weyl tensor is investigated. It is shown that the transformed spacetimes cannot be perfect fluids or purely magnetic Einstein spaces. We then determine which purely magnetic perfect fluids (PMpfs) can be windmill-transformed into purely magnetic anisotropic fluids (PMafs). Assuming separation of variables, complete integration produces two, algebraically general, G2I-B(ii) PMpfs: a solution with zero 4-acceleration vector and spatial energy-density gradient, previously found by the authors, and a new solution in terms of Kummer's functions, where these vectors are aligned and non-zero. The associated windmill PMafs are rotating but non-expanding. Finally, an attempt to relate the spacetimes to each other by a simple procedure leads to a G2I-B(ii) one-parameter PMaf generalization of the previously found metric.

  3. Pure Mediated Priming: A Retrospective Semantic Matching Model

    ERIC Educational Resources Information Center

    Jones, Lara L.

    2010-01-01

    Mediated priming refers to the activation of a target (e.g., "stripes") by a prime (e.g., "lion") that is related indirectly via a connecting mediator (e.g., tiger). In previous mediated priming studies (e.g., McNamara & Altarriba, 1988), the mediator was associatively related to the prime. In contrast, pure mediated priming (e.g., "spoon" [right…

  4. A pure-sampling quantum Monte Carlo algorithm

    SciTech Connect

    Ospadov, Egor; Rothstein, Stuart M.

    2015-01-14

    The objective of pure-sampling quantum Monte Carlo is to calculate physical properties that are independent of the importance sampling function being employed in the calculation, save for the mismatch of its nodal hypersurface with that of the exact wave function. To achieve this objective, we report a pure-sampling algorithm that combines features of forward walking methods of pure-sampling and reptation quantum Monte Carlo (RQMC). The new algorithm accurately samples properties from the mixed and pure distributions simultaneously in runs performed at a single set of time-steps, over which extrapolation to zero time-step is performed. In a detailed comparison, we found RQMC to be less efficient. It requires different sets of time-steps to accurately determine the energy and other properties, such as the dipole moment. We implement our algorithm by systematically increasing an algorithmic parameter until the properties converge to statistically equivalent values. As a proof in principle, we calculated the fixed-node energy, static α polarizability, and other one-electron expectation values for the ground-states of LiH and water molecules. These quantities are free from importance sampling bias, population control bias, time-step bias, extrapolation-model bias, and the finite-field approximation. We found excellent agreement with the accepted values for the energy and a variety of other properties for those systems.

  5. Pure Spinor Formalism for Osp N\\vert 4) Backgrounds

    NASA Astrophysics Data System (ADS)

    Fré, Pietro; Grassi, Pietro Antonio

    2012-12-01

    We start from the Maurer-Cartan (MC) equations of the Osp(N\\vert 4) superalgebras satisfied by the left-invariant superforms realized on supercoset manifolds of the corresponding supergroups and we derive some new pure spinor constraints. They are obtained by "ghostifying" the MC forms and extending the differential d to a BRST differential. From the superalgebras \\hat G = Osp(N\\vert 4) we single out different subalgebras H \\subset \\hat G associated with the different cosets \\hat {G}/H: each choice of ℍ leads to a different weakening of the pure spinor constraints. In each case, the number of parameter is counted and we show that in the cases of Osp(6|4)/U(3)×SO(1, 3), Osp(4|4)/SO(3) ×SO(1, 3) and finally Osp(4|4)/U(2) ×SO(1, 3) the bosonic and fermionic degrees of freedom match in order to provide a c = 0 superconformal field theory. We construct both the Green-Schwarz and the pure spinor sigma model for the case Osp(6|4)/U(3)×SO(1, 3) corresponding to AdS4 ×ℙ3. The pure spinor sigma model can be consistently quantized.

  6. Number Reading in Pure Alexia--A Review

    ERIC Educational Resources Information Center

    Starrfelt, Randi; Behrmann, Marlene

    2011-01-01

    It is commonly assumed that number reading can be intact in patients with pure alexia, and that this dissociation between letter/word recognition and number reading strongly constrains theories of visual word processing. A truly selective deficit in letter/word processing would strongly support the hypothesis that there is a specialized system or…

  7. Three Variations on a Theme: The Power of Pure Empathy.

    ERIC Educational Resources Information Center

    Kottler, Jeffrey A.; Montgomery, Marilyn J.; Marbley, Aretha Faye

    1998-01-01

    With the counseling profession's increased emphasis on developing brief therapies, applying innovative techniques, and measuring outcomes, helping someone feel understood is sometimes neglected. Three narratives by humanistic practitioners illustrate the value of pure empathy in our work with clients, students, and others in our diverse…

  8. 77 FR 59979 - Pure Magnesium (Granular) From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-01

    ... this five-year review. Background The Commission instituted this review on February 1, 2012 (77 FR 5049) and determined on May 7, 2012 that it would conduct an expedited review (77 FR 32668, June 1, 2012... COMMISSION Pure Magnesium (Granular) From China Determination On the basis of the record \\1\\ developed in...

  9. In vitro degradation of pure Mg in response to glucose

    PubMed Central

    Zeng, Rong-Chang; Li, Xiao-Ting; Li, Shuo-Qi; Zhang, Fen; Han, En-Hou

    2015-01-01

    Magnesium and its alloys are promising biodegradable biomaterials but are still challenging to be used in person with high levels of blood glucose or diabetes. To date, the influence of glucose on magnesium degradation has not yet been elucidated, this issue requires more attention. Herein, we present pure Mg exhibiting different corrosion responses to saline and Hank’s solutions with different glucose contents, and the degradation mechanism of pure Mg in the saline solution with glucose in comparison with mannitol as a control. On one hand, the corrosion rate of pure Mg increases with the glucose concentration in saline solutions. Glucose rapidly transforms into gluconic acid, which attacks the oxides of the metal and decreases the pH of the solution; it also promotes the absorption of chloride ions on the Mg surface and consequently accelerates corrosion. On the other hand, better corrosion resistance is obtained with increasing glucose content in Hank’s solution due to the fact that glucose coordinates Ca2+ ions in Hank’s solution and thus improves the formation of Ca-P compounds on the pure Mg surface. This finding will open up new avenues for research on the biodegradation of bio-Mg materials in general, which could yield many new and interesting results. PMID:26264413

  10. Molarity (Aromic Density) of the Elements as Pure Crystals.

    ERIC Educational Resources Information Center

    Pauling, Linus; Herman, Zelek S.

    1985-01-01

    Provides background information for teachers on the atomic density of the elements as pure crystals. Atomic density is defined as the reciprocal of the atomic volume. Includes atomic-density diagrams which were prepared using the atomic-volume values given by Singman, supplemented by additional values for some allotropes. (JN)

  11. A Graphical Representation for the Fugacity of a Pure Substance

    ERIC Educational Resources Information Center

    Book, Neil L.; Sitton, Oliver C.

    2010-01-01

    The thermodynamic equations used to define and compute the fugacity of a pure substance are depicted as processes on a semi-logarithmic plot of pressure vs. molar Gibbs energy (PG diagram) with isotherms for the substance behaving as an ideal gas superimposed. The PG diagram clearly demonstrates the physical basis for the definitions and the…

  12. In vitro degradation of pure Mg in response to glucose

    NASA Astrophysics Data System (ADS)

    Zeng, Rong-Chang; Li, Xiao-Ting; Li, Shuo-Qi; Zhang, Fen; Han, En-Hou

    2015-08-01

    Magnesium and its alloys are promising biodegradable biomaterials but are still challenging to be used in person with high levels of blood glucose or diabetes. To date, the influence of glucose on magnesium degradation has not yet been elucidated, this issue requires more attention. Herein, we present pure Mg exhibiting different corrosion responses to saline and Hank’s solutions with different glucose contents, and the degradation mechanism of pure Mg in the saline solution with glucose in comparison with mannitol as a control. On one hand, the corrosion rate of pure Mg increases with the glucose concentration in saline solutions. Glucose rapidly transforms into gluconic acid, which attacks the oxides of the metal and decreases the pH of the solution; it also promotes the absorption of chloride ions on the Mg surface and consequently accelerates corrosion. On the other hand, better corrosion resistance is obtained with increasing glucose content in Hank’s solution due to the fact that glucose coordinates Ca2+ ions in Hank’s solution and thus improves the formation of Ca-P compounds on the pure Mg surface. This finding will open up new avenues for research on the biodegradation of bio-Mg materials in general, which could yield many new and interesting results.

  13. Information balance in quantum teleportation with an arbitrary pure state

    SciTech Connect

    Li Li; Chen Zengbing

    2005-07-15

    We study a general teleportation scheme with an arbitrary two-party pure state and derive a tight bound of the teleportation fidelity with a predesigned estimation of the unknown state to be teleported. This bound shows a piecewise balance between information gain and state disturbance. We also explain possible physical significance of the balance.

  14. A pure-sampling quantum Monte Carlo algorithm

    NASA Astrophysics Data System (ADS)

    Ospadov, Egor; Rothstein, Stuart M.

    2015-01-01

    The objective of pure-sampling quantum Monte Carlo is to calculate physical properties that are independent of the importance sampling function being employed in the calculation, save for the mismatch of its nodal hypersurface with that of the exact wave function. To achieve this objective, we report a pure-sampling algorithm that combines features of forward walking methods of pure-sampling and reptation quantum Monte Carlo (RQMC). The new algorithm accurately samples properties from the mixed and pure distributions simultaneously in runs performed at a single set of time-steps, over which extrapolation to zero time-step is performed. In a detailed comparison, we found RQMC to be less efficient. It requires different sets of time-steps to accurately determine the energy and other properties, such as the dipole moment. We implement our algorithm by systematically increasing an algorithmic parameter until the properties converge to statistically equivalent values. As a proof in principle, we calculated the fixed-node energy, static α polarizability, and other one-electron expectation values for the ground-states of LiH and water molecules. These quantities are free from importance sampling bias, population control bias, time-step bias, extrapolation-model bias, and the finite-field approximation. We found excellent agreement with the accepted values for the energy and a variety of other properties for those systems.

  15. Enzymatic Synthesis of Single-Stranded Clonal Pure Oligonucleotides.

    PubMed

    Ducani, Cosimo; Högberg, Björn

    2017-01-01

    Single-stranded oligonucleotides, or oligodeoxyribonucleotides (ODNs), are very important in several fields of science such as molecular biology, diagnostics, nanotechnology, and gene therapy. They are usually chemically synthesized. Here we describe an enzymatic method which enables us to synthesize pure oligonucleotides which can be up to several hundred long bases. PMID:27671934

  16. Entropy for quantum pure states and quantum H theorem

    NASA Astrophysics Data System (ADS)

    Han, Xizhi; Wu, Biao

    2015-06-01

    We construct a complete set of Wannier functions that are localized at both given positions and momenta. This allows us to introduce the quantum phase space, onto which a quantum pure state can be mapped unitarily. Using its probability distribution in quantum phase space, we define an entropy for a quantum pure state. We prove an inequality regarding the long-time behavior of our entropy's fluctuation. For a typical initial state, this inequality indicates that our entropy can relax dynamically to a maximized value and stay there most of time with small fluctuations. This result echoes the quantum H theorem proved by von Neumann [Zeitschrift für Physik 57, 30 (1929), 10.1007/BF01339852]. Our entropy is different from the standard von Neumann entropy, which is always zero for quantum pure states. According to our definition, a system always has bigger entropy than its subsystem even when the system is described by a pure state. As the construction of the Wannier basis can be implemented numerically, the dynamical evolution of our entropy is illustrated with an example.

  17. A hybrid sensing approach for pure and adulterated honey classification.

    PubMed

    Subari, Norazian; Mohamad Saleh, Junita; Md Shakaff, Ali Yeon; Zakaria, Ammar

    2012-01-01

    This paper presents a comparison between data from single modality and fusion methods to classify Tualang honey as pure or adulterated using Linear Discriminant Analysis (LDA) and Principal Component Analysis (PCA) statistical classification approaches. Ten different brands of certified pure Tualang honey were obtained throughout peninsular Malaysia and Sumatera, Indonesia. Various concentrations of two types of sugar solution (beet and cane sugar) were used in this investigation to create honey samples of 20%, 40%, 60% and 80% adulteration concentrations. Honey data extracted from an electronic nose (e-nose) and Fourier Transform Infrared Spectroscopy (FTIR) were gathered, analyzed and compared based on fusion methods. Visual observation of classification plots revealed that the PCA approach able to distinct pure and adulterated honey samples better than the LDA technique. Overall, the validated classification results based on FTIR data (88.0%) gave higher classification accuracy than e-nose data (76.5%) using the LDA technique. Honey classification based on normalized low-level and intermediate-level FTIR and e-nose fusion data scored classification accuracies of 92.2% and 88.7%, respectively using the Stepwise LDA method. The results suggested that pure and adulterated honey samples were better classified using FTIR and e-nose fusion data than single modality data. PMID:23202033

  18. Pure spin current transport in Alq3 by spin pumping

    NASA Astrophysics Data System (ADS)

    Jiang, Shengwei; Wang, Peng; Luan, Zhongzhi; Tao, Xinde; Ding, Haifeng; Wu, Di

    2015-03-01

    The use of organic semiconductors (OSCs) in spintronics has aroused considerable interests, owing to their much longer spin-relaxation times of OSCs than those of inorganic counterparts. The most studied example is the organic spin valve (OSV), in which magnetoresistance (MR) effect is frequently reported. However, studies on pure spin current injection and transport in OSCs are scarce. Recently, the pioneering work by Watanabe et al. demonstrated that pure spin current can be pumped into and propagates in semiconducting polymers. In the present work we extend the study to small molecule OSCs, and demonstrate that pure spin current can be injected into Alq3 from the adjacent magnetic insulator Y3Fe5O12 (YIG) by spin pumping. The pure spin current is detected by inverse spin Hall effect (ISHE) in Pd after propagation through Alq3. From the ISHE voltage VISHE as a function of the Alq3 thickness, the spin diffusion length is determined to be ~ 50 nm and does not depend on temperature. This result indicates the MR decrease as increasing temperature in OSVs is not due to the reduced spin diffusion length.

  19. Open-close movements in the human temporomandibular joint: does a pure rotation around the intercondylar hinge axis exist?

    PubMed

    Ferrario, V F; Sforza, C; Miani, A; Serrao, G; Tartaglia, G

    1996-06-01

    Mandibular movements near the maximum intercuspal position were analysed for the location of the mean instantaneous centre of curvature of the interincisal point path. Measurements were performed using a kinesiograph in 28 healthy young adults with sound dentitions and free from temporomandibular joint disorders. The subjects performed habitual open-close cycles at different speeds; opening movements starting from the centric relation occlusion were also analysed. In none of the 28 subjects was the interincisal point path derived from pure rotation movements performed around the intercondylar axis, not even in the first millimetres of motion. Translation and rotation were always combined, and the position of the centre of curvature changed during the motion, showing different characteristics in the open and close movements; these patterns were also dependent upon motion speed. The results show that the hinge axis theory cannot explain the mandibular movements because a pure rotation did not occur around the intercondylar axis.

  20. Distortion-Product Emissions and Pure-Tone Behavioral Thresholds.

    NASA Astrophysics Data System (ADS)

    Harris, Frances Pauline

    Distortion-product emissions (DPEs) are tonal responses that may be detected in the ear canal when the ear is stimulated simultaneously by two tones that are closely spaced in frequency. In experimental animals, DPEs are reduced in amplitude or are eliminated when cochlear function is disrupted. This association has not been investigated in human subjects. This study was designed to investigate the relation of cochlear status, as determined by pure -tone behavioral thresholds, to DPE amplitude in human subjects. Forty men were selected as subjects. Twenty had normal hearing and 20 had high-frequency sensorineural hearing loss. Pure-tone behavioral thresholds were determined using conventional audiometric procedures for eight frequencies from 750 to 8000 Hz. DPEs were generated in the test ear of each subject by stimulating the ear with two tones, f1 and f2. The stimuli were selected to approximate audiometric test frequencies. Responses were detected by a sensitive microphone that was placed in the ear canal and were extracted by spectral analysis. Results of the study indicated that DPE amplitude was associated with pure-tone threshold. When audiometric threshold was <=10 dB HL, DPEs could be elicited at all test frequencies for 98% of subjects in both groups. Mean maximum emission amplitude ranged from 3 to 13 dB SPL across frequency. When pure-tone threshold was above 50 dB HL, DPEs were absent or were significantly attenuated. DPEs varied in amplitude when audiometric threshold was between these two extremes. The association of DPE amplitude were pure-tone threshold was frequency specific. DPE amplitude was maximal when pure-tone thresholds were <=10 dB HL and decreased as pure-tone behavioral threshold increased in the same subject. Repetition of the DPE protocol with five subjects from each group during separate test sessions indicated that the results were reliable over time. Results of the study have clinical implications. The technique may have potential