Science.gov

Sample records for adult pure erythroid

  1. Acute myeloid leukaemia (M6B: pure acute erythroid leukaemia) in a Thoroughbred foal.

    PubMed

    Forbes, G; Feary, D J; Savage, C J; Nath, L; Church, S; Lording, P

    2011-07-01

    A 10-week-old Thoroughbred filly was referred for anaemia of 4 weeks' duration. Haematology revealed severe anaemia and panleucopenia. Cytological examination of bone marrow smears revealed a myeloid to erythroid ratio <0.02:1 (reference range 0.5-2.4:1.0) and an abundance of erythroid precursor cells. The erythroid cell population included rubriblasts, prorubricytes and rubricytes, with only scant numbers of metarubricytes present. There were numerous mitotic erythroid cells, some of which were atypical and megaloblastic. These cytomorphological changes are consistent with pure acute erythroid leukaemia. No treatment was instituted and the filly died three days after presentation. This case illustrates the need to consider both haematology and bone marrow findings to establish a diagnosis of pure erythroid leukaemia. To our knowledge, there is no documented case of acute myeloproliferative disease in horses involving cells of erythroid lineage, but this condition should be considered a differential diagnosis for horses presenting with anaemia. PMID:21696377

  2. Pure Erythroid Leukemia Mimicking Ewing Sarcoma/Primitive Neuroectodermal Tumor in an Infant.

    PubMed

    Lapadat, Razvan; Tower, Richard L; Tam, Wayne; Orazi, Attilio; Gheorghe, Gabriela

    2016-05-01

    Pure erythroid leukemia (PEL) is a rare type of acute myeloid leukemia (AML) with a very aggressive clinical course. Presentation as a myeloid/erythroid sarcoma is exceedingly rare. We describe an infantile PEL presenting as a multifocal myeloid sarcoma, clinically and pathologically mimicking Ewing sarcoma/PNET family of tumors. The patient died 8 weeks after the initial presentation due to widespread disease. Our case shows that PEL needs to be considered in the differential diagnosis of small round blue cell tumors in infancy. A meticulous workup including immunohistochemistry, flow cytometry, molecular, and cytogenetic studies was required to reach the diagnosis. PMID:26773805

  3. [Short-term curative effect of amifostine combined with rhbeta-EPO on patients with pure erythroid aplasia].

    PubMed

    Li, Su-Xia; Zhu, Hong-Li; Lu, Xue-Chun; Fan, Hui; Guo, Bo; Zhai, Bing

    2008-10-01

    The aim of this study was to investigate the curative effects of amifostine (AMF) combined with recombinant human beta-erythropoietin (rhbeta-EPO) on patients with pure erythroid aplasia (PEA). Two patients with PEA were treated with amifostine and rhbeta-EPO. The therapeutic regimen was adopted with AMF 0.4 g/day given by intravenous injection for 5 days first, then after a break of 2 days it went on for 3 weeks consecutively, that was considered as one treatment cycle. The rhbeta-EPO 6 000 U was used by subcutaneous injection for 3 times per week. The results showed that the red cell count, hemoglobin and reticulocyte count of two patients obviously increased after treatment. The erythroid ratio in bone marrow increased. Bone marrow biopsy showed that the erythroid proliferation improved. Intervals of red cell transfusions (RCT) in the two patients who live by red cell transfusion were prolonged after AMF treatments, and the amounts of each RCT was decreased obviously. The main side effect of amifostine was discomfort of digestive system, but was tolerated by all patients. In conclusion, amifostine plus rhbeta-EPO may be a new, effective and safety method especially for the elder PEA patients. The long-term curative effects and mechanism of amifostine still need further evaluation. PMID:18928605

  4. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    SciTech Connect

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-06-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes.

  5. Modulation of retinoblastoma gene in normal adult hematopoiesis: peak expression and functional role in advanced erythroid differentiation.

    PubMed Central

    Condorelli, G L; Testa, U; Valtieri, M; Vitelli, L; De Luca, A; Barberi, T; Montesoro, E; Campisi, S; Giordano, A; Peschle, C

    1995-01-01

    The retinoblastoma (RB) gene specifies a nuclear phosphoprotein (pRb 105), which is a prototype tumor suppressor inactivated in a variety of human tumors. Recent studies suggest that RB is also involved in embryonic development of murine central nervous and hematopoietic systems. We have investigated RB expression and function in human adult hematopoiesis--i.e., in liquid suspension culture of purified quiescent hematopoietic progenitor cells (HPCs) induced by growth factor stimulus to proliferation and unilinage differentiation/maturation through the erythroid or granulocytic lineage. In the initial HPC differentiation stages, the RB gene is gradually induced at the mRNA and protein level in both erythroid and granulopoietic cultures. In late HPC differentiation and then precursor maturation, RB gene expression is sustained in the erythroid lineage, whereas it is sharply downmodulated in the granulocytic series. Functional studies were performed by treatment of HPC differentiation culture with phosphorothioate antisense oligomer targeting Rb mRNA; coherent with the expression pattern, oligomer treatment of late HPCs causes a dose-dependent and selective inhibition of erythroid colony formation. These observations suggest that the RB gene plays an erythroid- and stage-specific functional role in normal adult hematopoiesis, particularly at the level of late erythroid HPCs. Images Fig. 2 Fig. 3 Fig. 4 PMID:7761404

  6. Pharmacological Induction of Human Fetal Globin Gene in Hydroxyurea-Resistant Primary Adult Erythroid Cells.

    PubMed

    Chou, Yu-Chi; Chen, Ruei-Lin; Lai, Zheng-Sheng; Song, Jen-Shin; Chao, Yu-Sheng; Shen, Che-Kun James

    2015-07-01

    Pharmacological induction of the fetal γ globin gene and the consequent formation of HbF (α2/γ2) in adult erythroid cells are one feasible therapeutic strategy for sickle cell disease (SCD) and severe β-thalassemias. Hydroxyurea (HU) is the current drug of choice for SCD, but serious side effects limit its clinical use. Moreover, 30 to 50% of patients are irresponsive to HU treatment. We have used high-throughput screening to identify benzo[de]benzo[4,5]imidazo[2,1-a]isoquinolin-7-one and its derivatives (compounds I to VI) as potent γ globin inducers. Of the compounds, I to V exert superior γ globin induction and have better therapeutic potential than HU, likely because of their activation of the p38 mitogen-activated protein kinase (MAPK) signaling pathway and modulation of expression levels and/or chromosome binding of γ globin gene regulators, including BCL11A, and chromatin structure over the γ globin promoter. Unlike sodium butyrate (NaB), the global levels of acetylated histones H3 and H4 are not changed by compound II treatment. Remarkably, compound II induces the γ globin gene in HU-resistant primary human adult erythroid cells, the p38 signaling pathway of which appears to be irresponsive to HU and NaB as well as compound II. This study provides a new framework for the development of new and superior compounds for treating SCD and severe β-thalassemias. PMID:25986606

  7. Development of methods for characterizing fetal and adult somatic mutations detected in human erythroid precursor

    SciTech Connect

    Langlois, R.G.; Manchester, D.K.

    1994-12-31

    The glycophorin A (GPA) assay was developed to quantify somatic mutations in humans by measuring the frequency of peripheral erythrocytes with mutant phenotypes that are presumed to be progeny of mutated erythroid precursor cells. This assay has been used to identify GPA variant cells in unexposed individuals at a frequency of {approximately}10 per million erythrocytes, and to demonstrate significant increases in variant frequency after mutagenic exposures. Characterization of the mutations responsible for these variant cells requires that the assay be modified to allow flow analysis and sorting of variant erythroid precursor cells that contain nucleic acids. Cord blood samples contain low levels of both reticulocytes and nucleated erythrocytes. We have developed enrichment methods using centrifugation that yield samples containing up to 30% nucleated erythrocytes, and immunomagnetic separation methods that yield samples containing up to 90% reticulocytes. Enrichment methods for these two cell types are also being developed for adult bone marrow samples. We have confirmed that enrichment and labeling with a nucleic acid-specific dye are compatible with GPA analysis of erythrocytes, reticulocytes, and nucleated erythrocytes. Enriched samples have been successfully used for flow cytometric detection of GPA variant reticulocytes in cord blood. PCR-based analysis methods are being developed for molecular characterization of sorted variant cells at the mRNA level.

  8. RUNX1B Expression Is Highly Heterogeneous and Distinguishes Megakaryocytic and Erythroid Lineage Fate in Adult Mouse Hematopoiesis

    PubMed Central

    Draper, Julia E.; Sroczynska, Patrycja; Tsoulaki, Olga; Leong, Hui Sun; Fadlullah, Muhammad Z. H.; Miller, Crispin; Kouskoff, Valerie; Lacaud, Georges

    2016-01-01

    The Core Binding Factor (CBF) protein RUNX1 is a master regulator of definitive hematopoiesis, crucial for hematopoietic stem cell (HSC) emergence during ontogeny. RUNX1 also plays vital roles in adult mice, in regulating the correct specification of numerous blood lineages. Akin to the other mammalian Runx genes, Runx1 has two promoters P1 (distal) and P2 (proximal) which generate distinct protein isoforms. The activities and specific relevance of these two promoters in adult hematopoiesis remain to be fully elucidated. Utilizing a dual reporter mouse model we demonstrate that the distal P1 promoter is broadly active in adult hematopoietic stem and progenitor cell (HSPC) populations. By contrast the activity of the proximal P2 promoter is more restricted and its upregulation, in both the immature Lineage- Sca1high cKithigh (LSK) and bipotential Pre-Megakaryocytic/Erythroid Progenitor (PreMegE) populations, coincides with a loss of erythroid (Ery) specification. Accordingly the PreMegE population can be prospectively separated into “pro-erythroid” and “pro-megakaryocyte” populations based on Runx1 P2 activity. Comparative gene expression analyses between Runx1 P2+ and P2- populations indicated that levels of CD34 expression could substitute for P2 activity to distinguish these two cell populations in wild type (WT) bone marrow (BM). Prospective isolation of these two populations will enable the further investigation of molecular mechanisms involved in megakaryocytic/erythroid (Mk/Ery) cell fate decisions. Having characterized the extensive activity of P1, we utilized a P1-GFP homozygous mouse model to analyze the impact of the complete absence of Runx1 P1 expression in adult mice and observed strong defects in the T cell lineage. Finally, we investigated how the leukemic fusion protein AML1-ETO9a might influence Runx1 promoter usage. Short-term AML1-ETO9a induction in BM resulted in preferential P2 upregulation, suggesting its expression may be important to

  9. Effect of AGM and fetal liver-derived stromal cell lines on globin expression in adult baboon (P. anubis) bone marrow-derived erythroid progenitors.

    PubMed

    Lavelle, Donald; Vaitkus, Kestutis; Ruiz, Maria Armila; Ibanez, Vinzon; Kouznetsova, Tatiana; Saunthararajah, Yogen; Mahmud, Nadim; DeSimone, Joseph

    2012-01-01

    This study was performed to investigate the hypothesis that the erythroid micro-environment plays a role in regulation of globin gene expression during adult erythroid differentiation. Adult baboon bone marrow and human cord blood CD34+ progenitors were grown in methylcellulose, liquid media, and in co-culture with stromal cell lines derived from different developmental stages in identical media supporting erythroid differentiation to examine the effect of the micro-environment on globin gene expression. Adult progenitors express high levels of γ-globin in liquid and methylcellulose media but low, physiological levels in stromal cell co-cultures. In contrast, γ-globin expression remained high in cord blood progenitors in stromal cell line co-cultures. Differences in γ-globin gene expression between adult progenitors in stromal cell line co-cultures and liquid media required cell-cell contact and were associated with differences in rate of differentiation and γ-globin promoter DNA methylation. We conclude that γ-globin expression in adult-derived erythroid cells can be influenced by the micro-environment, suggesting new potential targets for HbF induction. PMID:22693559

  10. Effect of AGM and Fetal Liver-Derived Stromal Cell Lines on Globin Expression in Adult Baboon (P. anubis) Bone Marrow-Derived Erythroid Progenitors

    PubMed Central

    Lavelle, Donald; Vaitkus, Kestutis; Ruiz, Maria Armila; Ibanez, Vinzon; Kouznetsova, Tatiana; Saunthararajah, Yogen; Mahmud, Nadim; DeSimone, Joseph

    2012-01-01

    This study was performed to investigate the hypothesis that the erythroid micro-environment plays a role in regulation of globin gene expression during adult erythroid differentiation. Adult baboon bone marrow and human cord blood CD34+ progenitors were grown in methylcellulose, liquid media, and in co-culture with stromal cell lines derived from different developmental stages in identical media supporting erythroid differentiation to examine the effect of the micro-environment on globin gene expression. Adult progenitors express high levels of γ-globin in liquid and methylcellulose media but low, physiological levels in stromal cell co-cultures. In contrast, γ-globin expression remained high in cord blood progenitors in stromal cell line co-cultures. Differences in γ-globin gene expression between adult progenitors in stromal cell line co-cultures and liquid media required cell-cell contact and were associated with differences in rate of differentiation and γ-globin promoter DNA methylation. We conclude that γ-globin expression in adult-derived erythroid cells can be influenced by the micro-environment, suggesting new potential targets for HbF induction. PMID:22693559

  11. Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

    PubMed

    Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

    2016-06-01

    The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. PMID:27026582

  12. Erythroid-Specific Expression of LIN28A Is Sufficient for Robust Gamma-Globin Gene and Protein Expression in Adult Erythroblasts

    PubMed Central

    Byrnes, Colleen; Kaushal, Megha; Rabel, Antoinette; Tumburu, Laxminath; Allwardt, Joshua M.; Miller, Jeffery L.

    2015-01-01

    Increasing fetal hemoglobin (HbF) levels in adult humans remains an active area in hematologic research. Here we explored erythroid-specific LIN28A expression for its effect in regulating gamma-globin gene expression and HbF levels in cultured adult erythroblasts. For this purpose, lentiviral transduction vectors were produced with LIN28A expression driven by erythroid-specific gene promoter regions of the human KLF1 or SPTA1 genes. Transgene expression of LIN28A with a linked puromycin resistance marker was restricted to the erythroid lineage as demonstrated by selective survival of erythroid colonies (greater than 95% of all colonies). Erythroblast LIN28A over-expression (LIN28A-OE) did not significantly affect proliferation or inhibit differentiation. Greater than 70% suppression of total let-7 microRNA levels was confirmed in LIN28A-OE cells. Increases in gamma-globin mRNA and protein expression with HbF levels reaching 30–40% were achieved. These data suggest that erythroblast targeting of LIN28A expression is sufficient for increasing fetal hemoglobin expression in adult human erythroblasts. PMID:26675483

  13. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    PubMed Central

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  14. Comparison of the Proteome of Adult and Cord Erythroid Cells, and Changes in the Proteome Following Reticulocyte Maturation.

    PubMed

    Wilson, Marieangela C; Trakarnsanga, Kongtana; Heesom, Kate J; Cogan, Nicola; Green, Carole; Toye, Ashley M; Parsons, Steve F; Anstee, David J; Frayne, Jan

    2016-06-01

    Cord blood stem cells are an attractive starting source for the production of red blood cells in vitro for therapy because of additional expansion potential compared with adult peripheral blood progenitors and cord blood banks usually being more representative of national populations than blood donors. Consequently, it is important to establish how similar cord RBCs are to adult cells. In this study, we used multiplex tandem mass tag labeling combined with nano-LC-MS/MS to compare the proteome of adult and cord RBCs and reticulocytes. 2838 unique proteins were identified, providing the most comprehensive compendium of RBC proteins to date. Using stringent criteria, 1674 proteins were quantified, and only a small number differed in amount between adult and cord RBC. We focused on proteins critical for RBC function. Of these, only the expected differences in globin subunits, along with higher levels of carbonic anhydrase 1 and 2 and aquaporin-1 in adult RBCs would be expected to have a phenotypic effect since they are associated with the differences in gaseous exchange between adults and neonates. Since the RBC and reticulocyte samples used were autologous, we catalogue the change in proteome following reticulocyte maturation. The majority of proteins (>60% of the 1671 quantified) reduced in abundance between 2- and 100-fold following maturation. However, ∼5% were at a higher level in RBCs, localized almost exclusively to cell membranes, in keeping with the known clearance of intracellular recycling pools during reticulocyte maturation. Overall, these data suggest that, with respect to the proteome, there is no barrier to the use of cord progenitors for the in vitro generation of RBCs for transfusion to adults other than the expression of fetal, not adult, hemoglobin. PMID:27006477

  15. Functional erythroid promoters created by interaction of the transcription factor GATA-1 with CACCC and AP-1/NFE-2 elements.

    PubMed Central

    Walters, M; Martin, D I

    1992-01-01

    We have investigated interactions between the erythroid transcription factor GATA-1 and factors binding two cis-acting elements commonly linked to GATA sites in erythroid control elements. GATA-1 is present at all stages of erythroid differentiation, is necessary for erythropoiesis, and binds sites in all erythroid control elements. However, minimal promoters containing GATA-1 sites are inactive when tested in erythroid cells. Based on this observation, two erythroid cis elements, here termed CACCC and AP-1/NFE-2, were linked to GATA sites in minimal promoters. None of the elements linked only to a TATA box created an active promoter, but GATA sites linked to either CACCC or AP-1/NFE-2 elements formed strong erythroid promoters. A mutation of T to C at position -175 in the gamma-globin promoter GATA site, associated with hereditary persistence of fetal hemoglobin (HPFH), increased expression of these promoters in both fetal and adult cells. A construct bearing the beta-globin CACCC element was more active in adult and less active in fetal erythroid cells, when compared with the gamma-globin CACCC element. These studies suggest that erythroid control elements are formed by the interactions of at least three transcription factors, none of which functions alone. Images PMID:1438231

  16. Haemoglobin biosynthesis site in rabbit embryo erythroid cells.

    PubMed

    Cianciarullo, Aurora M; Bertho, Alvaro L; Soares, Maurilio J; Hosoda, Tânia M; Nogueira-Silva, Simone; Beçak, Willy

    2003-01-01

    Properly metabolized globin synthesis and iron uptake are indispensable for erythroid cell differentiation and maturation. Mitochondrial participation is crucial in the process of haeme synthesis for cytochromes and haemoglobin. We studied the final biosynthesis site of haemoglobin using an ultrastructural approach, with erythroid cells obtained from rabbit embryos, in order to compare these results with those of animals treated with saponine or phenylhydrazine. Our results are similar to those obtained in assays with adult mammals, birds, amphibians, reptiles and fish, after induction of haemolytic anaemia. Therefore, the treatment did not interfere with the process studied, confirming our previous findings. Immunoelectron microscopy showed no labelling of mitochondria or other cellular organelles supposedly involved in the final biosynthesis of haemoglobin molecules, suggesting instead that it occurs free in the cytoplasm immediately after the liberation of haeme from the mitochondria, by electrostatic attraction between haeme and globin chains. PMID:12972280

  17. Global transcriptome analyses of human and murine terminal erythroid differentiation

    PubMed Central

    An, Xiuli; Schulz, Vincent P.; Li, Jie; Wu, Kunlu; Liu, Jing; Xue, Fumin; Hu, Jingping; Mohandas, Narla

    2014-01-01

    We recently developed fluorescence-activated cell sorting (FACS)-based methods to purify morphologically and functionally discrete populations of cells, each representing specific stages of terminal erythroid differentiation. We used these techniques to obtain pure populations of both human and murine erythroblasts at distinct developmental stages. RNA was prepared from these cells and subjected to RNA sequencing analyses, creating unbiased, stage-specific transcriptomes. Tight clustering of transcriptomes from differing stages, even between biologically different replicates, validated the utility of the FACS-based assays. Bioinformatic analyses revealed that there were marked differences between differentiation stages, with both shared and dissimilar gene expression profiles defining each stage within transcriptional space. There were vast temporal changes in gene expression across the differentiation stages, with each stage exhibiting unique transcriptomes. Clustering and network analyses revealed that varying stage-specific patterns of expression observed across differentiation were enriched for genes of differing function. Numerous differences were present between human and murine transcriptomes, with significant variation in the global patterns of gene expression. These data provide a significant resource for studies of normal and perturbed erythropoiesis, allowing a deeper understanding of mechanisms of erythroid development in various inherited and acquired erythroid disorders. PMID:24637361

  18. Setd1a and NURF mediate chromatin dynamics and gene regulation during erythroid lineage commitment and differentiation

    PubMed Central

    Li, Ying; Schulz, Vincent P.; Deng, Changwang; Li, Guangyao; Shen, Yong; Tusi, Betsabeh K.; Ma, Gina; Stees, Jared; Qiu, Yi; Steiner, Laurie A.; Zhou, Lei; Zhao, Keji; Bungert, Jörg; Gallagher, Patrick G.; Huang, Suming

    2016-01-01

    The modulation of chromatin structure is a key step in transcription regulation in mammalian cells and eventually determines lineage commitment and differentiation. USF1/2, Setd1a and NURF complexes interact to regulate chromatin architecture in erythropoiesis, but the mechanistic basis for this regulation is hitherto unknown. Here we showed that Setd1a and NURF complexes bind to promoters to control chromatin structural alterations and gene activation in a cell context dependent manner. In human primary erythroid cells USF1/2, H3K4me3 and the NURF complex were significantly co-enriched at transcription start sites of erythroid genes, and their binding was associated with promoter/enhancer accessibility that resulted from nucleosome repositioning. Mice deficient for Setd1a, an H3K4 trimethylase, in the erythroid compartment exhibited reduced Ter119/CD71 positive erythroblasts, peripheral blood RBCs and hemoglobin levels. Loss of Setd1a led to a reduction of promoter-associated H3K4 methylation, inhibition of gene transcription and blockade of erythroid differentiation. This was associated with alterations in NURF complex occupancy at erythroid gene promoters and reduced chromatin accessibility. Setd1a deficiency caused decreased associations between enhancer and promoter looped interactions as well as reduced expression of erythroid genes such as the adult β-globin gene. These data indicate that Setd1a and NURF complexes are specifically targeted to and coordinately regulate erythroid promoter chromatin dynamics during erythroid lineage differentiation. PMID:27141965

  19. Identification of human erythroid lineage-committed progenitors.

    PubMed

    Mori, Yasuo; Akashi, Koichi; Weissman, Irving L

    2016-05-01

    Elucidating the developmental pathway leading to erythrocytes and being able to isolate their progenitors is crucial to understanding and treating disorders of red cell imbalance such as anemia, myelodysplastic syndrome, and polycythemia vera. Endoglin (CD105) is a key marker for purifying mouse erythroid lineage-committed progenitors (EPs) from bone marrow. Herein, we show that human EPs can also be isolated from adult bone marrow. We identified three subfractions that possessed different expression patterns of CD105 and CD71 within the previously defined human megakaryocyte/erythrocyte progenitor (hMEP; Lineage-CD34(+)CD38(+)IL-3Rα(-)CD45RA(-)) population. Both CD71(-)CD105(-) and CD71(+)CD105(-) MEPs, at least in vitro, retained bipotency for the megakaryocyte (MegK) and erythrocyte (E) lineages, although the latter sub-population had a differentiation potential skewed toward the E-lineage. Notably, the differentiation output of the CD71(+)CD105(+) subset of cells within the MEP population was completely restricted to the E-lineage with the loss of MegK potential; thus, we termed CD71(+)CD105(-) MEPs and CD71(+)CD105(+) cells as E-biased MEPs (E-MEPs) and EPs, respectively. These previously unclassified populations may facilitate understanding of the molecular mechanisms governing human erythroid development and serve as potential therapeutic targets in disorders of the erythroid lineage. PMID:27263782

  20. Cytarabine With or Without SCH 900776 in Treating Adult Patients With Relapsed Acute Myeloid Leukemia

    ClinicalTrials.gov

    2016-07-20

    Adult Acute Megakaryoblastic Leukemia; Adult Acute Monoblastic Leukemia; Adult Acute Monocytic Leukemia; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With Maturation; Adult Acute Myeloid Leukemia With Minimal Differentiation; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Myeloid Leukemia Without Maturation; Adult Acute Myelomonocytic Leukemia; Adult Erythroleukemia; Adult Pure Erythroid Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Recurrent Adult Acute Myeloid Leukemia

  1. In vitro apoptotic cell death during erythroid differentiation.

    PubMed

    Zamai, L; Burattini, S; Luchetti, F; Canonico, B; Ferri, P; Melloni, E; Gonelli, A; Guidotti, L; Papa, S; Falcieri, E

    2004-03-01

    Erythropoiesis occurs in bone marrow and it has been shown that during in vivo erythroid differentiation some immature erythroblasts undergo apoptosis. In this regard, it is known that immature erythroblasts are FasL- and TRAIL-sensitive and can be killed by cells expressing these ligand molecules. In the present study, we have investigated the cell death phenomenon that occurs during a common unilineage model of erythroid development. Purified CD34+ human haemopoietic progenitors were cultured in vitro in the presence of SCF, IL-3 and erythropoietin. Their differentiation stages and apoptosis were followed by multiple technical approaches. Flow cytometric evaluation of surface and intracellular molecules revealed that glycophorin A appeared at day 3-4 of incubation and about 75% of viable cells co-expressed high density glycophorin A (Gly(bright)) and adult haemoglobin at day 14 of culture, indicating that this system reasonably recapitulates in vivo normal erythropoiesis. Interestingly, when mature (Gly(bright)) erythroid cells reached their higher percentages (day 14) almost half of cultured cells were apoptotic. Morphological studies indicated that the majority of dead cells contained cytoplasmic granular material typical of basophilic stage, and DNA analysis by flow cytometry and TUNEL reaction revealed nuclear fragmentation. These observations indicate that in vitro unilineage erythroid differentiation, as in vivo, is associated with apoptotic cell death of cells with characteristics of basophilic erythroblasts. We suggest that the interactions between different death receptors on immature basophilic erythroblasts with their ligands on more mature erythroblasts may contribute to induce apoptosis in vitro. PMID:15004520

  2. High yield extraction of pure spinal motor neurons, astrocytes and microglia from single embryo and adult mouse spinal cord

    PubMed Central

    Beaudet, Marie-Josée; Yang, Qiurui; Cadau, Sébastien; Blais, Mathieu; Bellenfant, Sabrina; Gros-Louis, François; Berthod, François

    2015-01-01

    Extraction of mouse spinal motor neurons from transgenic mouse embryos recapitulating some aspects of neurodegenerative diseases like amyotrophic lateral sclerosis has met with limited success. Furthermore, extraction and long-term culture of adult mouse spinal motor neurons and glia remain also challenging. We present here a protocol designed to extract and purify high yields of motor neurons and glia from individual spinal cords collected on embryos and adult (5-month-old) normal or transgenic mice. This method is based on mild digestion of tissue followed by gradient density separation allowing to obtain two millions motor neurons over 92% pure from one E14.5 single embryo and more than 30,000 from an adult mouse. These cells can be cultured more than 14 days in vitro at a density of 100,000 cells/cm2 to maintain optimal viability. Functional astrocytes and microglia and small gamma motor neurons can be purified at the same time. This protocol will be a powerful and reliable method to obtain motor neurons and glia to better understand mechanisms underlying spinal cord diseases. PMID:26577180

  3. Differential regulation of the α-globin locus by Krüppel-like factor 3 in erythroid and non-erythroid cells

    PubMed Central

    2014-01-01

    Background Krüppel-like Factor 3 (KLF3) is a broadly expressed zinc-finger transcriptional repressor with diverse biological roles. During erythropoiesis, KLF3 acts as a feedback repressor of a set of genes that are activated by Krüppel-like Factor 1 (KLF1). Noting that KLF1 binds α-globin gene regulatory sequences during erythroid maturation, we sought to determine whether KLF3 also interacts with the α-globin locus to regulate transcription. Results We found that expression of a human transgenic α-globin reporter gene is markedly up-regulated in fetal and adult erythroid cells of Klf3−/− mice. Inspection of the mouse and human α-globin promoters revealed a number of canonical KLF-binding sites, and indeed, KLF3 was shown to bind to these regions both in vitro and in vivo. Despite these observations, we did not detect an increase in endogenous murine α-globin expression in Klf3 −/− erythroid tissue. However, examination of murine embryonic fibroblasts lacking KLF3 revealed significant de-repression of α-globin gene expression. This suggests that KLF3 may contribute to the silencing of the α-globin locus in non-erythroid tissue. Moreover, ChIP-Seq analysis of murine fibroblasts demonstrated that across the locus, KLF3 does not occupy the promoter regions of the α-globin genes in these cells, but rather, binds to upstream, DNase hypersensitive regulatory regions. Conclusions These findings reveal that the occupancy profile of KLF3 at the α-globin locus differs in erythroid and non-erythroid cells. In erythroid cells, KLF3 primarily binds to the promoters of the adult α-globin genes, but appears dispensable for normal transcriptional regulation. In non-erythroid cells, KLF3 distinctly binds to the HS-12 and HS-26 elements and plays a non-redundant, albeit modest, role in the silencing of α-globin expression. PMID:24885809

  4. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation.

    PubMed

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5 hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5 mC) and 5 hmC at a CCGG site within the 5' γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5 mC and 5 hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5 hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5 hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5 hmC and negatively correlated with 5 mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5 hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  5. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation

    PubMed Central

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5mC) and 5hmC at a CCGG site within the 5′ γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5mC and 5hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5hmC and negatively correlated with 5mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  6. JAK-STAT and AKT pathway-coupled genes in erythroid progenitor cells through ontogeny

    PubMed Central

    2012-01-01

    Background It has been reported that the phosphatidylinositol 3-kinase (PI3K)-AKT signaling pathway regulates erythropoietin (EPO)-induced survival, proliferation, and maturation of early erythroid progenitors. Erythroid cell proliferation and survival have also been related to activation of the JAK-STAT pathway. The goal of this study was to observe the function of EPO activation of JAK-STAT and PI3K/AKT pathways in the development of erythroid progenitors from hematopoietic CD34+ progenitor cells, as well as to distinguish early EPO target genes in human erythroid progenitors during ontogeny. Methods Hematopoietic CD34+ progenitor cells, isolated from fetal and adult hematopoietic tissues, were differentiated into erythroid progenitor cells. We have used microarray analysis to examine JAK-STAT and PI3K/AKT related genes, as well as broad gene expression modulation in these human erythroid progenitor cells. Results In microarray studies, a total of 1755 genes were expressed in fetal liver, 3844 in cord blood, 1770 in adult bone marrow, and 1325 genes in peripheral blood-derived erythroid progenitor cells. The erythroid progenitor cells shared 1011 common genes. Using the Ingenuity Pathways Analysis software, we evaluated the network pathways of genes linked to hematological system development, cellular growth and proliferation. The KITLG, EPO, GATA1, PIM1 and STAT3 genes represent the major connection points in the hematological system development linked genes. Some JAK-STAT signaling pathway-linked genes were steadily upregulated throughout ontogeny (PIM1, SOCS2, MYC, PTPN11), while others were downregulated (PTPN6, PIAS, SPRED2). In addition, some JAK-STAT pathway related genes are differentially expressed only in some stages of ontogeny (STATs, GRB2, CREBB). Beside the continuously upregulated (AKT1, PPP2CA, CHUK, NFKB1) and downregulated (FOXO1, PDPK1, PIK3CG) genes in the PI3K-AKT signaling pathway, we also observed intermittently regulated gene expression

  7. Randomized effectiveness trial of an Internet, pure self-help, cognitive behavioral intervention for depressive symptoms in young adults.

    PubMed

    Clarke, Greg; Kelleher, Chris; Hornbrook, Matt; Debar, Lynn; Dickerson, John; Gullion, Christina

    2009-01-01

    This study evaluated an Internet-delivered, cognitive behavioral skills training program versus a treatment-as-usual (TAU) control condition targeting depression symptoms in young adults aged 18 to 24 years. Potential participants were mailed a recruitment brochure; if interested, they accessed the study website to complete an online consent and baseline assessment. Intervention participants could access the website at their own pace and at any time. Reminder postcards were mailed periodically to encourage return use of the intervention. The pure self-help intervention was delivered without contact with a live therapist. The primary depression outcome measure was the Patient Health Questionnaire, administered at 0, 5, 10, 16, and 32 weeks after enrollment. A small but significant between-group effect was found from Week 0 to Week 32 for the entire sample (N = 160, d = .20, 95% confidence interval [CI] 0.00-0.50), with a moderate effect among women (n = 128, d .42, 95%C1 = 0.09-0.77). Greater depression reduction was associated with two measures of lower website usage, total minutes, and total number of page hits. Although intervention effects were modest, they were observed against a background of substantial TAU depression pharmacotherapy and psychosocial services. Highly disseminable, low-cost, and self-help interventions such as this have the potential to deliver a significant public health benefit. PMID:19440896

  8. A novel role for nuclear factor-erythroid 2 in erythroid maturation by modulation of mitochondrial autophagy.

    PubMed

    Gothwal, Monika; Wehrle, Julius; Aumann, Konrad; Zimmermann, Vanessa; Gründer, Albert; Pahl, Heike L

    2016-09-01

    We have recently demonstrated that the transcription factor nuclear factor-erythroid 2, which is critical for erythroid maturation and globin gene expression, plays an important role in the pathophysiology of myeloproliferative neoplasms. Myeloproliferative neoplasm patients display elevated levels of nuclear factor-erythroid 2 and transgenic mice overexpressing the transcription factor develop myeloproliferative neoplasm, albeit, surprisingly without erythrocytosis. Nuclear factor-erythroid 2 transgenic mice show both a reticulocytosis and a concomitant increase in iron deposits in the spleen, suggesting both enhanced erythrocyte production and increased red blood cell destruction. We therefore hypothesized that elevated nuclear factor-erythroid 2 levels may lead to increased erythrocyte destruction by interfering with organelle clearance during erythroid maturation. We have previously shown that nuclear factor-erythroid 2 overexpression delays erythroid maturation of human hematopoietic stem cells. Here we report that increased nuclear factor-erythroid 2 levels also impede murine maturation by retarding mitochondrial depolarization and delaying mitochondrial elimination. In addition, ribosome autophagy is delayed in transgenics. We demonstrate that the autophagy genes NIX and ULK1 are direct novel nuclear factor-erythroid 2 target genes, as these loci are bound by nuclear factor-erythroid 2 in chromatin immunoprecipitation assays. Moreover, Nix and Ulk1 expression is increased in transgenic mice and in granulocytes from polycythemia vera patients. This is the first report implying a role for nuclear factor-erythroid 2 in erythroid maturation by affecting autophagy. PMID:27479815

  9. Calcium Signaling Is Required for Erythroid Enucleation

    PubMed Central

    Russell, Sarah M.; Humbert, Patrick O.

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation. PMID:26731108

  10. Reproducible erythroid aplasia caused by mycophenolate mofetil.

    PubMed

    Arbeiter, K; Greenbaum, L; Balzar, E; Müller, T; Hofmeister, F; Bidmon, B; Aufricht, C

    2000-03-01

    Anemia secondary to mycophenolate mofetil (MMF) was recently described in experimental animals. A clinical association between MMF and anemia has been observed, but there are no proven reports. We describe a girl with chronic graft failure who developed erythroid aplasia under immunosuppression with MMF. She showed prompt resolution when MMF was discontinued and a recurrence of this clinical course when MMF was restarted. As re-challenge with a medication is the most definitive approach for showing a direct relationship between the drug and the side effect, this case clearly demonstrates that MMF can cause erythroid aplasia. PMID:10752755

  11. Calcium Signaling Is Required for Erythroid Enucleation.

    PubMed

    Wölwer, Christina B; Pase, Luke B; Russell, Sarah M; Humbert, Patrick O

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation. PMID:26731108

  12. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    PubMed Central

    Kim, Ah Ram; Olsen, Jayme L.; England, Samantha J.; Huang, Yu-Shan; Fegan, Katherine H.; Delgadillo, Luis F.; McGrath, Kathleen E.; Kingsley, Paul D.; Waugh, Richard E.; Palis, James

    2015-01-01

    Summary Red blood cells (RBCs), responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs) to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy. PMID:26028528

  13. Isolation and in vitro differentiation of human erythroid precursor cells.

    PubMed

    Kim, H C; Marks, P A; Rifking, R A; Maniatis, G M; Bank, A

    1976-05-01

    There is decreased beta-globin production in beta-thalassemic reticulocytes and nucleated erythroid cells. In this study, we have examined whether unbalanced globin synthesis is expressed at all stages of human erythroid cell maturation. In order to determine the pattern of globin synthesis in early erythroid cells during erythroid cell maturation, an in vitro culture system using human bone marrow erythroid precursor cells has been developed. Early erythroid precursor cells (proerythroblasts and basophilic erythroblasts) have been isolated from nonthalassemic and thalassemic human bone marrows by lysing more mature erythroid cells, using complement and a rabbit antiserum prepared against normal human red cells. In the presence of erythropoietin, differentiation and proliferation of erythroid cells in demonstrable in liquid suspension culture for 24-48 hr, as determined by morphological criteria and by an increase in globin synthesis. The ratio of alpha- to beta-globin chain synthesis in nonthalassemic cells in approximately 1 at all stages of erythroid cell differentiation during culture. In cells from four patients with homozygous beta- thalassemia there is decreased beta-globin synthesis compared to alpha-globin synthesis, both in early erythroid precursor cells and during their maturation in culture. These findings indicate that unbalanced globin chain synthesis is expressed at all stages of red cell maturation in homozygous beta-thalassemia. PMID:1260133

  14. Erythropoietin guides multipotent hematopoietic progenitor cells toward an erythroid fate

    PubMed Central

    Grover, Amit; Mancini, Elena; Moore, Susan; Mead, Adam J.; Atkinson, Deborah; Rasmussen, Kasper D.; O’Carroll, Donal; Jacobsen, Sten Eirik W.

    2014-01-01

    The erythroid stress cytokine erythropoietin (Epo) supports the development of committed erythroid progenitors, but its ability to act on upstream, multipotent cells remains to be established. We observe that high systemic levels of Epo reprogram the transcriptomes of multi- and bipotent hematopoietic stem/progenitor cells in vivo. This induces erythroid lineage bias at all lineage bifurcations known to exist between hematopoietic stem cells (HSCs) and committed erythroid progenitors, leading to increased erythroid and decreased myeloid HSC output. Epo, therefore, has a lineage instructive role in vivo, through suppression of non-erythroid fate options, demonstrating the ability of a cytokine to systematically bias successive lineage choices in favor of the generation of a specific cell type. PMID:24493804

  15. Ultrastructural studies on erythropoiesis in the avian thymus. II. A stereological analysis of the lymphoid and erythroid cells.

    PubMed

    Kendall, M D

    1979-06-01

    The cortex of enlarging thymic lobes from adult haemorrhaged Quelea quelea were found to be similar to those of wild birds where the thymic enlargement was occurring naturally. A detailed stereological analysis of cells broadly designated as lymphoid, and the construction of models to account for the results, indicates that the enlarging thymic lobe contains both large and small blast cells, a heterogenous group of medium lymphocytes, erythroid cells, and two types of very small lymphocytes. The distinction between early erythroid cells and some lymphocytes, despite this detailed analysis is very difficult, but it is possible in enlarging thymic lobes that up to 42% of the lymphoid cells may have erythroid characteristics. PMID:466698

  16. Globin gene expression in correlation with G protein-related genes during erythroid differentiation

    PubMed Central

    2013-01-01

    Background The guanine nucleotide binding protein (G protein)-coupled receptors (GPCRs) regulate cell growth, proliferation and differentiation. G proteins are also implicated in erythroid differentiation, and some of them are expressed principally in hematopoietic cells. GPCRs-linked NO/cGMP and p38 MAPK signaling pathways already demonstrated potency for globin gene stimulation. By analyzing erythroid progenitors, derived from hematopoietic cells through in vitro ontogeny, our study intends to determine early markers and signaling pathways of globin gene regulation and their relation to GPCR expression. Results Human hematopoietic CD34+ progenitors are isolated from fetal liver (FL), cord blood (CB), adult bone marrow (BM), peripheral blood (PB) and G-CSF stimulated mobilized PB (mPB), and then differentiated in vitro into erythroid progenitors. We find that growth capacity is most abundant in FL- and CB-derived erythroid cells. The erythroid progenitor cells are sorted as 100% CD71+, but we did not find statistical significance in the variations of CD34, CD36 and GlyA antigens and that confirms similarity in maturation of studied ontogenic periods. During ontogeny, beta-globin gene expression reaches maximum levels in cells of adult blood origin (176 fmol/μg), while gamma-globin gene expression is consistently up-regulated in CB-derived cells (60 fmol/μg). During gamma-globin induction by hydroxycarbamide, we identify stimulated GPCRs (PTGDR, PTGER1) and GPCRs-coupled genes known to be activated via the cAMP/PKA (ADIPOQ), MAPK pathway (JUN) and NO/cGMP (PRPF18) signaling pathways. During ontogeny, GPR45 and ARRDC1 genes have the most prominent expression in FL-derived erythroid progenitor cells, GNL3 and GRP65 genes in CB-derived cells (high gamma-globin gene expression), GPR110 and GNG10 in BM-derived cells, GPR89C and GPR172A in PB-derived cells, and GPR44 and GNAQ genes in mPB-derived cells (high beta-globin gene expression). Conclusions These results

  17. Hematopoiesis and aging. IV. Mass and distribution of erythroid marrow in aged mice

    SciTech Connect

    Boggs, D.R.

    1985-11-01

    Aged mice are ''anemic,'' i.e., they have a lower hematocrit than young adult mice, but this appears to be a ''dilutional'' anemia; the red cell mass is normal. Other observations have supported the hypothesis that basal erythropoiesis does not change as mice grow old. In the present study, the percentage of injected VZFe found in the skeleton and spleen, VZFe distribution between various bones and bone groups, and the number of nucleated erythroid cells per humerus were studied and the total mass of erythroid precursors was calculated. There was no significant difference in any of these values between mice aged 3-27 months. The variability of VZFe distribution within various skeletal parts was no greater in aged than in young mice. Thus, these data further strengthen the case for normal basal rates of erythropoiesis in aged mice.

  18. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  19. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  20. Chromatin looping as a target for altering erythroid gene expression.

    PubMed

    Krivega, Ivan; Dean, Ann

    2016-03-01

    The β-hemoglobinopathies are the most common monogenic disorders in humans, with symptoms arising after birth when the fetal γ-globin genes are silenced and the adult β-globin gene is activated. There is a growing appreciation that genome organization and the folding of chromosomes are key determinants of gene transcription. Underlying this function is the activity of transcriptional enhancers that increase the transcription of target genes over long linear distances. To accomplish this, enhancers engage in close physical contact with target promoters through chromosome folding or looping that is orchestrated by protein complexes that bind to both sites and stabilize their interaction. We find that enhancer activity can be redirected with concomitant changes in gene transcription. Both targeting the β-globin locus control region (LCR) to the γ-globin gene in adult erythroid cells by tethering and epigenetic unmasking of a silenced γ-globin gene lead to increased frequency of LCR/γ-globin contacts and reduced LCR/β-globin contacts. The outcome of these manipulations is robust, pancellular γ-globin transcription activation with a concomitant reduction in β-globin transcription. These examples show that chromosome looping may be considered a therapeutic target for gene activation in β-thalassemia and sickle cell disease. PMID:26918894

  1. Sublethal radiation injury uncovers a functional transition during erythroid maturation

    PubMed Central

    Peslak, Scott A.; Wenger, Jesse; Bemis, Jeffrey C.; Kingsley, Paul D.; Frame, Jenna M.; Koniski, Anne D.; Chen, Yuhchyau; Williams, Jacqueline P.; McGrath, Kathleen E.; Dertinger, Stephen D.; Palis, James

    2012-01-01

    Objective Clastogenic injury of the erythroid lineage results in anemia, reticulocytopenia, and transient appearance of micronucleated reticulocytes (MN-RET). However, the MN-RET dose-response in murine models is only linear to 2 Gy total body irradiation (TBI) and paradoxically decreases at higher exposures, suggesting complex radiation effects on erythroid intermediates. To better understand this phenomenon, we investigated the kinetics and apoptotic response of the erythron to sublethal radiation injury. Materials and Methods We analyzed the response to 1 and 4 Gy TBI of erythroid progenitors and precursors using colony assays and imaging flow cytometry (IFC), respectively. We also investigated cell cycling and apoptotic gene expression of the steady-state erythron. Results Following 1 Gy TBI, erythroid progenitors and precursors were partially depleted. In contrast, essentially all bone marrow erythroid progenitors and precursors were lost within two days following 4 Gy irradiation. IFC analysis revealed preferential loss of phenotypic erythroid colony-forming units (CFU-E) and proerythroblasts immediately following sublethal irradiation. Furthermore, these populations underwent radiation-induced apoptosis, without changes in steady-state cellular proliferation, at much higher frequencies than later-stage erythroid precursors. Primary erythroid precursor maturation is associated with marked Bcl-xL upregulation and Bax and Bid down-regulation. Conclusions MN-RET loss following higher sublethal radiation exposures results from rapid depletion of erythroid progenitors and precursors. This injury reveals that CFU-E and proerythroblasts constitute a particularly proapoptotic compartment within the erythron. We conclude that the functional transition of primary proerythroblasts to later-stage erythroid precursors is characterized by a shift from a pro-apoptotic to an anti-apoptotic phenotype. PMID:21291953

  2. Erythroid Heme Biosynthesis and Its Disorders

    PubMed Central

    Meissner, Peter N.

    2013-01-01

    Heme, which is composed of iron and the small organic molecule protoporphyrin, is an essential component of hemoglobin as well as a variety of physiologically important hemoproteins. During erythropoiesis, heme synthesis is induced before, and is essential for, globin synthesis. Although all cells possess the ability to synthesize heme, there are distinct differences between regulation of the pathway in developing erythroid cells and all other types of cells. Disorders that compromise the ability of the developing red cell to synthesize heme can have profound medical implications. The biosynthetic pathway for heme and key regulatory features are reviewed herein, along with specific human genetic disorders that arise from defective heme synthesis such as X-linked sideroblastic anemia and erythropoietic protoporphyria. PMID:23471474

  3. Suppression of erythroid development in vitro by Plasmodium vivax

    PubMed Central

    2012-01-01

    Background Severe anaemia due to dyserythropoiesis has been documented in patients infected with Plasmodium vivax, however the mechanism responsible for anaemia in vivax malaria is poorly understood. In order to better understand the role of P. vivax infection in anaemia the inhibition of erythropoiesis using haematopoietic stem cells was investigated. Methods Haematopoietic stem cells/CD34+ cells, isolated from normal human cord blood were used to generate growing erythroid cells. Exposure of CD34+ cells and growing erythroid cells to P. vivax parasites either from intact or lysed infected erythrocytes (IE) was examined for the effect on inhibition of cell development compared with untreated controls. Results Both lysed and intact infected erythrocytes significantly inhibited erythroid growth. The reduction of erythroid growth did not differ significantly between exposure to intact and lysed IE and the mean growth relative to unexposed controls was 59.4 ± 5.2 for lysed IE and 57 ± 8.5% for intact IE. Interestingly, CD34+ cells/erythroid progenitor cells were susceptible to the inhibitory effect of P. vivax on cell expansion. Exposure to P. vivax also inhibited erythroid development, as determined by the reduced expression of glycophorin A (28.1%) and CD 71 (43.9%). Moreover, vivax parasites perturbed the division of erythroid cells, as measured by the Cytokinesis Block Proliferation Index, which was reduced to 1.35 ± 0.05 (P-value < 0.01) from a value of 2.08 ± 0.07 in controls. Neither TNF-a nor IFN-g was detected in the culture medium of erythroid cells treated with P. vivax, indicating that impaired erythropoiesis was independent of these cytokines. Conclusions This study shows for the first time that P. vivax parasites inhibit erythroid development leading to ineffective erythropoiesis and highlights the potential of P. vivax to cause severe anaemia. PMID:22624872

  4. Randomized Effectiveness Trial of an Internet, Pure Self-Help, Cognitive Behavioral Intervention for Depressive Symptoms in Young Adults

    PubMed Central

    Clarke, Greg; Kelleher, Chris; Hornbrook, Matt; DeBar, Lynn; Dickerson, John; Gullion, Christina

    2008-01-01

    This study evaluated an Internet-delivered, cognitive behavioral skills training program versus a treatment-as-usual (TAU) control condition targeting depression symptoms in youth ages 18 to 24. Potential participants were mailed a recruitment brochure; if interested they accessed the study website to complete an online consent and baseline assessment. Intervention participants could access the website at their own pace and at any time. Reminder postcards were mailed periodically to encourage return use of the intervention. The pure self-help intervention was delivered without contact with a live therapist. The primary depression outcome measure was the Patient Health Questionnaire (PHQ-8), administered at 0, 5, 10, 16, and 32 weeks after enrollment. A small but significant between-group effect was found from week 0 to week 32 for the entire sample (n=160; d=.20, 95% CI=0.00-0.50), with a moderate effect among females (n=128; d=.42, 95% CI=0.09-0.77). Greater depression reduction was associated with two measures of lower website usage, total minutes and total number of page hits. While intervention effects were modest, they were observed against a background of substantial TAU depression pharmacotherapy and psychosocial services. Highly disseminable, low-cost, and self-help interventions such as this have the potential to deliver a significant public health benefit. PMID:19440896

  5. The exosome complex establishes a barricade to erythroid maturation.

    PubMed

    McIver, Skye C; Kang, Yoon-A; DeVilbiss, Andrew W; O'Driscoll, Chelsea A; Ouellette, Jonathan N; Pope, Nathaniel J; Camprecios, Genis; Chang, Chan-Jung; Yang, David; Bouhassira, Eric E; Ghaffari, Saghi; Bresnick, Emery H

    2014-10-01

    Complex genetic networks control hematopoietic stem cell differentiation into progenitors that give rise to billions of erythrocytes daily. Previously, we described a role for the master regulator of erythropoiesis, GATA-1, in inducing genes encoding components of the autophagy machinery. In this context, the Forkhead transcription factor, Foxo3, amplified GATA-1-mediated transcriptional activation. To determine the scope of the GATA-1/Foxo3 cooperativity, and to develop functional insights, we analyzed the GATA-1/Foxo3-dependent transcriptome in erythroid cells. GATA-1/Foxo3 repressed expression of Exosc8, a pivotal component of the exosome complex, which mediates RNA surveillance and epigenetic regulation. Strikingly, downregulating Exosc8, or additional exosome complex components, in primary erythroid precursor cells induced erythroid cell maturation. Our results demonstrate a new mode of controlling erythropoiesis in which multiple components of the exosome complex are endogenous suppressors of the erythroid developmental program. PMID:25115889

  6. The exosome complex establishes a barricade to erythroid maturation

    PubMed Central

    McIver, Skye C.; Kang, Yoon-A; DeVilbiss, Andrew W.; O’Driscoll, Chelsea A.; Ouellette, Jonathan N.; Pope, Nathaniel J.; Camprecios, Genis; Chang, Chan-Jung; Yang, David; Bouhassira, Eric E.; Ghaffari, Saghi

    2014-01-01

    Complex genetic networks control hematopoietic stem cell differentiation into progenitors that give rise to billions of erythrocytes daily. Previously, we described a role for the master regulator of erythropoiesis, GATA-1, in inducing genes encoding components of the autophagy machinery. In this context, the Forkhead transcription factor, Foxo3, amplified GATA-1–mediated transcriptional activation. To determine the scope of the GATA-1/Foxo3 cooperativity, and to develop functional insights, we analyzed the GATA-1/Foxo3-dependent transcriptome in erythroid cells. GATA-1/Foxo3 repressed expression of Exosc8, a pivotal component of the exosome complex, which mediates RNA surveillance and epigenetic regulation. Strikingly, downregulating Exosc8, or additional exosome complex components, in primary erythroid precursor cells induced erythroid cell maturation. Our results demonstrate a new mode of controlling erythropoiesis in which multiple components of the exosome complex are endogenous suppressors of the erythroid developmental program. PMID:25115889

  7. PPAR-α and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal.

    PubMed

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M Inmaculada; Li, Hu; Elmes, Russell R; Peters, Luanne L; Lodish, Harvey F

    2015-06-25

    Many acute and chronic anaemias, including haemolysis, sepsis and genetic bone marrow failure diseases such as Diamond-Blackfan anaemia, are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production. Treatment of these anaemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently, we showed that glucocorticoids specifically stimulate self-renewal of an early erythroid progenitor, burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells. Here we show that activation of the peroxisome proliferator-activated receptor α (PPAR-α) by the PPAR-α agonists GW7647 and fenofibrate synergizes with the glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures of both mouse fetal liver BFU-Es and mobilized human adult CD34(+) peripheral blood progenitors, with a new and effective culture system being used for the human cells that generates normal enucleated reticulocytes. Although Ppara(-/-) mice show no haematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPAR-α agonists facilitate recovery of wild-type but not Ppara(-/-) mice from PHZ-induced acute haemolytic anaemia. We also show that PPAR-α alleviates anaemia in a mouse model of chronic anaemia. Finally, both in control and corticosteroid-treated BFU-E cells, PPAR-α co-occupies many chromatin sites with GR; when activated by PPAR-α agonists, additional PPAR-α is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPAR-α agonists in stimulating self-renewal of early erythroid

  8. PPARα and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal

    PubMed Central

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M. Inmaculada; Li, Hu; Elmes, Russell R.; Peters, Luanne L.; Lodish, Harvey F.

    2015-01-01

    Summary Many acute and chronic anemias, including hemolysis, sepsis, and genetic bone marrow failure diseases such as Diamond-Blackfan Anemia (DBA), are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production 1,2,3–5,6,7,8,9. Treatment of these anemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently we showed that glucocorticoids specifically stimulate self-renewal of the early erythroid progenitor, the burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells 10,11. Here we demonstrate that activation of the peroxisome proliferator-activated receptor alpha (PPARα) by PPARα agonists, GW7647 and fenofibrate, synergizes with glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures both of mouse fetal liver BFU-Es and of mobilized human adult CD34+ peripheral blood progenitors, the latter employing a new and effective culture system that generates normal enucleated reticulocytes. While PPARα−/− mice show no hematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPARα agonists facilitate recovery of wild-type mice, but not PPARα−/− mice, from PHZ-induced acute hemolytic anemia. We also showed that PPARα alleviates anemia in a mouse model of chronic anemia. Finally, both in control and corticosteroid-treated BFU-E cells PPARα co-occupies many chromatin sites with GR; when activated by PPARα agonists, additional PPARα is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPARα agonists in stimulating self

  9. Reference ranges of handgrip strength from 125,462 healthy adults in 21 countries: a prospective urban rural epidemiologic (PURE) study

    PubMed Central

    Teo, Koon K.; Rangarajan, Sumathy; Kutty, V. Raman; Lanas, Fernando; Hui, Chen; Quanyong, Xiang; Zhenzhen, Qian; Jinhua, Tang; Noorhassim, Ismail; AlHabib, Khalid F; Moss, Sarah J.; Rosengren, Annika; Akalin, Ayse Arzu; Rahman, Omar; Chifamba, Jephat; Orlandini, Andrés; Kumar, Rajesh; Yeates, Karen; Gupta, Rajeev; Yusufali, Afzalhussein; Dans, Antonio; Avezum, Álvaro; Lopez‐Jaramillo, Patricio; Poirier, Paul; Heidari, Hosein; Zatonska, Katarzyna; Iqbal, Romaina; Khatib, Rasha; Yusuf, Salim

    2016-01-01

    Abstract Background The measurement of handgrip strength (HGS) has prognostic value with respect to all‐cause mortality, cardiovascular mortality and cardiovascular disease, and is an important part of the evaluation of frailty. Published reference ranges for HGS are mostly derived from Caucasian populations in high‐income countries. There is a paucity of information on normative HGS values in non‐Caucasian populations from low‐ or middle‐income countries. The objective of this study was to develop reference HGS ranges for healthy adults from a broad range of ethnicities and socioeconomically diverse geographic regions. Methods HGS was measured using a Jamar dynamometer in 125,462 healthy adults aged 35‐70 years from 21 countries in the Prospective Urban Rural Epidemiology (PURE) study. Results HGS values differed among individuals from different geographic regions. HGS values were highest among those from Europe/North America, lowest among those from South Asia, South East Asia and Africa, and intermediate among those from China, South America, and the Middle East. Reference ranges stratified by geographic region, age, and sex are presented. These ranges varied from a median (25th–75th percentile) 50 kg (43–56 kg) in men <40 years from Europe/North America to 18 kg (14–20 kg) in women >60 years from South East Asia. Reference ranges by ethnicity and body‐mass index are also reported. Conclusions Individual HGS measurements should be interpreted using region/ethnic‐specific reference ranges. PMID:27104109

  10. MEIS1 regulates early erythroid and megakaryocytic cell fate

    PubMed Central

    Zeddies, Sabrina; Jansen, Sjoert B. G.; di Summa, Franca; Geerts, Dirk; Zwaginga, Jaap J.; van der Schoot, C. Ellen; von Lindern, Marieke; Thijssen-Timmer, Daphne C.

    2014-01-01

    MEIS1 is a transcription factor expressed in hematopoietic stem and progenitor cells and in mature megakaryocytes. This biphasic expression of MEIS1 suggests that the function of MEIS1 in stem cells is distinct from its function in lineage committed cells. Mouse models show that Meis1 is required for renewal of stem cells, but the function of MEIS1 in human hematopoietic progenitor cells has not been investigated. We show that two MEIS1 splice variants are expressed in hematopoietic progenitor cells. Constitutive expression of both variants directed human hematopoietic progenitors towards a megakaryocyte-erythrocyte progenitor fate. Ectopic expression of either MEIS1 splice variant in common myeloid progenitor cells, and even in granulocyte-monocyte progenitors, resulted in increased erythroid differentiation at the expense of granulocyte and macrophage differentiation. Conversely, silencing MEIS1 expression in progenitor cells induced a block in erythroid expansion and decreased megakaryocytic colony formation capacity. Gene expression profiling revealed that both MEIS1 splice variants induce a transcriptional program enriched for erythroid and megakaryocytic genes. Our results indicate that MEIS1 expression induces lineage commitment towards a megakaryocyte-erythroid progenitor cell fate in common myeloid progenitor cells through activation of genes that define a megakaryocyte-erythroid-specific gene expression program. PMID:25107888

  11. Racial and gender effects on pure-tone thresholds and distortion-product otoacoustic emissions (DPOAEs) in normal-hearing young adults.

    PubMed

    Dreisbach, Laura E; Kramer, Steven J; Cobos, Sandra; Cowart, Kristin

    2007-08-01

    This study examined racial and gender effects on behavioral thresholds and distortion-product otoacoustic emissions (DPOAEs) in the same subjects. Pure-tone behavioral thresholds and DPOAEs were measured in 60 young normal-hearing adult subjects (20 Caucasian, 20 Asian, 20 African-American, with ten females and ten males in each group). Behavioral thresholds were measured from 1000 through 16,000 Hz using Békèsy tracking. A DPOAE frequency sweep was measured with primary stimulus levels of L(1)/L(2)=60/45 dB SPL, and an f(2)/f(1) of 1.2 at discrete f(2) frequencies between 2000 through 12,000 Hz for each subject. Significant racial and gender differences in behavioral thresholds were found at 14,000 and 16,000 Hz, with the African Americans and females having the best hearing sensitivity. Based on the current results, similar findings for DPOAE frequency sweeps can be expected amongst different racial groups given that no significant differences were identified between the groups. To further define the effects of race and gender on auditory measures, future studies should include larger numbers of subjects, measurement of body size and middle ear reflectance, and examine emission generators. PMID:17654083

  12. The Cut-Off Point and Boundary Values of Waist-to-Height Ratio as an Indicator for Cardiovascular Risk Factors in Chinese Adults from the PURE Study

    PubMed Central

    Peng, Yaguang; Li, Wei; Wang, Yang; Bo, Jian; Chen, Hui

    2015-01-01

    To explore a scientific boundary of WHtR to evaluate central obesity and CVD risk factors in a Chinese adult population. The data are from the Prospective Urban Rural Epidemiology (PURE) China study that was conducted from 2005–2007. The final study sample consisted of 43 841 participants (18 019 men and 25 822 women) aged 35–70 years. According to the group of CVD risk factors proposed by Joint National Committee 7 version and the clustering of risk factors, some diagnosis parameters, such as sensitivity, specificity and receiver operating characteristic (ROC) curve least distance were calculated for hypertension, diabetes, high serum triglyceride (TG), high serum low density lipoprotein cholesterol (LDL-C), low serum high density lipoprotein cholesterol (HDL-C) and clustering of risk factors (number≥2) to evaluate the efficacy at each value of the WHtR cut-off point. The upper boundary value for severity was fixed on the point where the specificity was above 90%. The lower boundary value, which indicated above underweight, was determined by the percentile distribution of WHtR, specifically the 5th percentile (P5) for both males and females population. Then, based on convenience and practical use, the optimal boundary values of WHtR for underweight and obvious central obesity were determined. For the whole study population, the optimal WHtR cut-off point for the CVD risk factor cluster was 0.50. The cut-off points for severe central obesity were 0.57 in the whole population. The upper boundary values of WHtR to detect the risk factor cluster with specificity above 90% were 0.55 and 0.58 for men and women, respectively. Additionally, the cut-off points of WHtR for each of four cardiovascular risk factors with specificity above 90% in males ranged from 0.55 to 0.56, whereas in females, it ranged from 0.57 to 0.58. The P5 of WHtR, which represents the lower boundary values of WHtR that indicates above underweight, was 0.40 in the whole population. WHtR 0.50 was

  13. Biology of Heme in Mammalian Erythroid Cells and Related Disorders

    PubMed Central

    Fujiwara, Tohru; Harigae, Hideo

    2015-01-01

    Heme is a prosthetic group comprising ferrous iron (Fe2+) and protoporphyrin IX and is an essential cofactor in various biological processes such as oxygen transport (hemoglobin) and storage (myoglobin) and electron transfer (respiratory cytochromes) in addition to its role as a structural component of hemoproteins. Heme biosynthesis is induced during erythroid differentiation and is coordinated with the expression of genes involved in globin formation and iron acquisition/transport. However, erythroid and nonerythroid cells exhibit distinct differences in the heme biosynthetic pathway regulation. Defects of heme biosynthesis in developing erythroblasts can have profound medical implications, as represented by sideroblastic anemia. This review will focus on the biology of heme in mammalian erythroid cells, including the heme biosynthetic pathway as well as the regulatory role of heme and human disorders that arise from defective heme synthesis. PMID:26557657

  14. Evaluation of hematopoietic cells and myeloid/erythroid ratio in the bone marrow of the pheasant (Phasianus colchicus).

    PubMed

    Tadjalli, Mina; Nazifi, Saeed; Haghjoo, Rahil

    2013-01-01

    In order to study the normal hematopoiesis, cellular components and myeloid/erythroid (M/E) ratio in the bone marrow of the pheasant (Phasianus colchicus), bone marrow samples were collected from the proximal tibiotarsus bone of 16 clinically healthy adult pheasant. The bone marrow smears were stained using the Giemsa stain. The results indicated that the development and formation of blood cells in the bone marrow of pheasant were similar to other birds, whereas the morphology of the cells was similar to chickens, ducks, quail, and black-head gull. The mean M/E ratio was 1.24, the mean erythroid percentage was 42.24, the mean myeloid percentage was 52.62, and the mean percentage of all other cells percentage was 5.38. There was no significant difference in any of the cellular composition between male and female. PMID:25653783

  15. Erythroid differentiation is augmented in Reelin-deficient K562 cells and homozygous reeler mice.

    PubMed

    Chu, Hui-Chun; Lee, Hsing-Ying; Huang, Yen-Shu; Tseng, Wei-Lien; Yen, Ching-Ju; Cheng, Ju-Chien; Tseng, Ching-Ping

    2014-01-01

    Reelin is an extracellular glycoprotein that is highly conserved in mammals. In addition to its expression in the nervous system, Reelin is present in erythroid cells but its function there is unknown. We report in this study that Reelin is up-regulated during erythroid differentiation of human erythroleukemic K562 cells and is expressed in the erythroid progenitors of murine bone marrow. Reelin deficiency promotes erythroid differentiation of K562 cells and augments erythroid production in murine bone marrow. In accordance with these findings, Reelin deficiency attenuates AKT phosphorylation of the Ter119(+)CD71(+) erythroid progenitors and alters the cell number and frequency of the progenitors at different erythroid differentiation stages. A regulatory role of Reelin in erythroid differentiation is thus defined. PMID:24239537

  16. Glucocorticoid receptor mediates the expansion of splenic late erythroid progenitors during chronic psychological stress.

    PubMed

    Vignjevic, S; Budec, M; Markovic, D; Dikic, D; Mitrovic, O; Diklic, M; Suboticki, T; Cokic, V; Jovcic, G

    2015-02-01

    Stress evokes an integrated neuroendocrine response perturbing the homeostasis of different physiological systems. In contrast to well established physiologica linteractions between neuroendocrine and immune systems during chronic stress, there has been relatively little information on the effects of psychological stress on erythroid cells. Since stress-induced erythropoiesis occurs predominantly in the spleen, in the current study, we investigated the influence of chronic psychological stress on splenic erythroid progenitors and examined a role of glucocorticoid receptor (GR) in observed effect using a mouse model of restraint. The adult male mice were subjected to 2 hours daily restraint stress for 7 or 14 consecutive days and the role of GR in erythropoietic response to stress was assessed by pretreatment of mice with GR antagonist mifepristone 60 min prior to restraint. The results showed that chronic restraint stress induced an increase in spleen weight as well as in the cellularity of red pulp, as compared to controls. Furthermore, 7 and 14 days of restraint stress resulted in markedly increased number of both splenic early (BFU-E) and late (CFU-E) erythroid progenitors. Blockade of GR with mifepristone did not affect the number of BFU-E in stressed mice, but it completely abolished the effect of repeated psychological stress on CFU-E cells. Additionally, plasma corticosterone concentration was enhanced whereas the GR expression was significantly decreased within splenic red pulp after one and two weeks of stress exposure. Obtained findings suggest for the first time an indispensable role for GR in the expansion of CFU-E progenitors in the spleen under conditions of chronic psychological stress. PMID:25716969

  17. Proliferation and maturation of human erythroid progenitors in liquid culture.

    PubMed

    Fibach, E; Manor, D; Oppenheim, A; Rachmilewitz, E A

    1989-01-01

    Hemopoiesis is studied in vitro mainly in semisolid culture, where hemopoietic progenitors develop into discrete colonies. We describe a liquid culture system that supports the proliferation and maturation of human erythroid progenitors. We seeded mononuclear cells from the peripheral blood (PB) of patients with beta-thalassemia in liquid medium in the presence of conditioned medium from human bladder carcinoma cells. Seven days later, RBCs, normoblasts, granulocytes, and monocytes disappeared, and the number of lymphocytes dropped considerably. In contrast, erythroid colony-forming cells increased fourfold to tenfold. The next step entailed the removal of colony-stimulating factor (CSF) and CSF-secreting cells, the exclusion of macrophages by harvesting nonadherent cells, and the lysis of T lymphocytes by treatment with monoclonal rat antihuman lymphocyte antibodies (CAMPATH-1) and complement. Reculture of the remaining cells in liquid medium supplemented with recombinant erythropoietin (EPO) resulted in the exclusive development of erythroid cells, with myeloid cells reduced to less than 2%. Stainable hemoglobin (Hb) appeared on day 3, with over 85% of the population containing hemoglobin by day 11 and the cell number increasing from 0.2 X 10(6) to 3 X 10(6) mL. By permitting the manipulation of culture conditions and components and increasing the cell yield, the liquid system may facilitate quantitative analysis of growth kinetics as well as biochemical and immunologic characterization of the developing erythroid cell. PMID:2910352

  18. Tissue specific transcription of the human epsilon-globin gene following transfection into the embryonic erythroid cell line K562.

    PubMed Central

    Allan, M; Montague, P; Grindlay, G J; Sibbet, G; Donovan-Peluso, M; Bank, A; Paul, J

    1985-01-01

    We have introduced a plasmid containing the human epsilon-globin gene either stably or transiently into a number of erythroid or non-erythroid cell lines, and analysed the accuracy and efficiency of transcription. In non-erythroid cells (or in mouse erythroleukaemia (MEL) cells in which adult but not embryonic globin genes are expressed) transcription of the epsilon-globin gene occurs mainly from a site 200 bp upstream of the major cap site (the -200 cap site). In the human K562 cell line, in which the endogenous epsilon-globin gene is transcribed at high levels, transcription initiation from the introduced gene occurs mainly from the major cap site. Transcriptional activity of the epsilon-globin gene introduced into K562 cell is quantitatively similar to that of the endogenous gene. This suggests the presence (or absence) in K562 cells of factor(s) which activate (or repress) the epsilon-globin gene in a tissue specific manner. Images PMID:2995916

  19. Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

    PubMed Central

    2012-01-01

    Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2

  20. UFBP1, a Key Component of the Ufm1 Conjugation System, Is Essential for Ufmylation-Mediated Regulation of Erythroid Development.

    PubMed

    Cai, Yafei; Pi, Wenhu; Sivaprakasam, Satish; Zhu, Xiaobin; Zhang, Mingsheng; Chen, Jijun; Makala, Levi; Lu, Chunwan; Wu, Jianchu; Teng, Yong; Pace, Betty; Tuan, Dorothy; Singh, Nagendra; Li, Honglin

    2015-11-01

    The Ufm1 conjugation system is an ubiquitin-like modification system that consists of Ufm1, Uba5 (E1), Ufc1 (E2), and less defined E3 ligase(s) and targets. The biological importance of this system is highlighted by its essential role in embryogenesis and erythroid development, but the underlying mechanism is poorly understood. UFBP1 (Ufm1 binding protein 1, also known as DDRGK1, Dashurin and C20orf116) is a putative Ufm1 target, yet its exact physiological function and impact of its ufmylation remain largely undefined. In this study, we report that UFBP1 is indispensable for embryonic development and hematopoiesis. While germ-line deletion of UFBP1 caused defective erythroid development and embryonic lethality, somatic ablation of UFBP1 impaired adult hematopoiesis, resulting in pancytopenia and animal death. At the cellular level, UFBP1 deficiency led to elevated ER (endoplasmic reticulum) stress and activation of unfolded protein response (UPR), and consequently cell death of hematopoietic stem/progenitor cells. In addition, loss of UFBP1 suppressed expression of erythroid transcription factors GATA-1 and KLF1 and blocked erythroid differentiation from CFU-Es (colony forming unit-erythroid) to proerythroblasts. Interestingly, depletion of Uba5, a Ufm1 E1 enzyme, also caused elevation of ER stress and under-expression of erythroid transcription factors in erythroleukemia K562 cells. By contrast, knockdown of ASC1, a newly identified Ufm1 target that functions as a transcriptional co-activator of hormone receptors, led to down-regulation of erythroid transcription factors, but did not elevate basal ER stress. Furthermore, we found that ASC1 was associated with the promoters of GATA-1 and Klf1 in a UFBP1-dependent manner. Taken together, our findings suggest that UFBP1, along with ASC1 and other ufmylation components, play pleiotropic roles in regulation of hematopoietic cell survival and differentiation via modulating ER homeostasis and erythroid lineage

  1. UFBP1, a Key Component of the Ufm1 Conjugation System, Is Essential for Ufmylation-Mediated Regulation of Erythroid Development

    PubMed Central

    Cai, Yafei; Pi, Wenhu; Sivaprakasam, Satish; Zhu, Xiaobin; Zhang, Mingsheng; Chen, Jijun; Makala, Levi; Lu, Chunwan; Wu, Jianchu; Teng, Yong; Pace, Betty; Tuan, Dorothy; Singh, Nagendra; Li, Honglin

    2015-01-01

    The Ufm1 conjugation system is an ubiquitin-like modification system that consists of Ufm1, Uba5 (E1), Ufc1 (E2), and less defined E3 ligase(s) and targets. The biological importance of this system is highlighted by its essential role in embryogenesis and erythroid development, but the underlying mechanism is poorly understood. UFBP1 (Ufm1 binding protein 1, also known as DDRGK1, Dashurin and C20orf116) is a putative Ufm1 target, yet its exact physiological function and impact of its ufmylation remain largely undefined. In this study, we report that UFBP1 is indispensable for embryonic development and hematopoiesis. While germ-line deletion of UFBP1 caused defective erythroid development and embryonic lethality, somatic ablation of UFBP1 impaired adult hematopoiesis, resulting in pancytopenia and animal death. At the cellular level, UFBP1 deficiency led to elevated ER (endoplasmic reticulum) stress and activation of unfolded protein response (UPR), and consequently cell death of hematopoietic stem/progenitor cells. In addition, loss of UFBP1 suppressed expression of erythroid transcription factors GATA-1 and KLF1 and blocked erythroid differentiation from CFU-Es (colony forming unit-erythroid) to proerythroblasts. Interestingly, depletion of Uba5, a Ufm1 E1 enzyme, also caused elevation of ER stress and under-expression of erythroid transcription factors in erythroleukemia K562 cells. By contrast, knockdown of ASC1, a newly identified Ufm1 target that functions as a transcriptional co-activator of hormone receptors, led to down-regulation of erythroid transcription factors, but did not elevate basal ER stress. Furthermore, we found that ASC1 was associated with the promoters of GATA-1 and Klf1 in a UFBP1-dependent manner. Taken together, our findings suggest that UFBP1, along with ASC1 and other ufmylation components, play pleiotropic roles in regulation of hematopoietic cell survival and differentiation via modulating ER homeostasis and erythroid lineage

  2. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    SciTech Connect

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  3. siDNMT1 Increases γ-globin Expression in Chemical-Inducer-of-Dimerization (CID)-Dependent Mouse βYAC Bone Marrow Cells and in Baboon Erythroid Progenitor Cell Cultures

    PubMed Central

    Banzon, Virryan; Ibanez, Vinzon; Vaitkus, Kestis; Ruiz, Maria Armila; Peterson, Kenneth; DeSimone, Joseph; Lavelle, Donald

    2014-01-01

    1) Objective These studies were performed to test the hypothesis that DNMT1 is required for maintenance of DNA methylation and repression of the γ-globin gene in adult stage erythroid cells. 2) Methods DNMT1 levels were reduced by nucleofection of siRNA targeting DNMT1 in chemical-inducer-of-dimerization (CID)-dependent multipotential mouse bone marrow (BM) cells containing the human β-globin gene locus in the context of a yeast artificial chromosome (βYAC) and in primary cultures of erythroid progenitor cells derived from CD34+ baboon BM cells. The effect of reduced DNMT1 levels on globin gene expression was measured by real time PCR and the effect on globin chain synthesis in primary erythroid progenitor cell cultures was determined by biosynthetic radiolabelling of globin chains followed by HPLC analysis. The effect on DNA methylation was determined by bisulfite sequence analysis. 3) Results Reduced DNMT1 levels in cells treated with siDNMT1 were associated with increased expression of γ-globin mRNA, an increased γ/γ+β chain ratio in cultured erythroid progenitors, and decreased DNA methylation of the γ-globin promoter. Similar effects were observed in cells treated with decitabine, a pharmacological inhibitor of DNA methyltransferase inhibitor. 4) Conclusion DNMT1 is required to maintain DNA methylation of the γ-globin gene promoters and repress γ-globin gene expression in adult-stage erythroid cells. PMID:20974210

  4. Survival and proliferative roles of erythropoietin beyond the erythroid lineage

    PubMed Central

    Noguchi, Constance Tom; Wang, Li; Rogers, Heather M.; Teng, Ruifeng; Jia, Yi

    2011-01-01

    Since the isolation and purification of erythropoietin (EPO) in 1977, the essential role of EPO for mature red blood cell production has been well established. The cloning and production of recombinant human EPO led to its widespread use in treating patients with anaemia. However, the biological activity of EPO is not restricted to regulation of erythropoiesis. EPO receptor (EPOR) expression is also found in endothelial, brain, cardiovascular and other tissues, although at levels considerably lower than that of erythroid progenitor cells. This review discusses the survival and proliferative activity of EPO that extends beyond erythroid progenitor cells. Loss of EpoR expression in mouse models provides evidence for the role of endogenous EPO signalling in nonhaematopoietic tissue during development or for tissue maintenance and/or repair. Determining the extent and distribution of receptor expression provides insights into the potential protective activity of erythropoietin in brain, heart and other nonhaematopoietic tissues. PMID:19040789

  5. The effect of iron overload and chelation on erythroid differentiation.

    PubMed

    Taoka, Kazuki; Kumano, Keiki; Nakamura, Fumihiko; Hosoi, Masataka; Goyama, Susumu; Imai, Yoichi; Hangaishi, Akira; Kurokawa, Mineo

    2012-02-01

    We investigated the mechanisms of hematopoietic disorders caused by iron overload and chelation, in particular, the inhibition of erythroblast differentiation. Murine c-kit(+) progenitor cells or human CD34(+) peripheral blood hematopoietic progenitors were differentiated in vitro to the erythroid lineage with free iron and/or an iron chelator. Under iron overload, formation of erythroid burst-forming unit colonies and differentiation to mature erythroblasts were significantly suppressed; these effects were canceled by iron chelation with deferoxamine (DFO). Moreover, excessive iron burden promoted apoptosis in immature erythroblasts by elevating intracellular reactive oxygen species (ROS). Interestingly, both DFO and a potent anti-oxidant agent reduced intracellular ROS levels and suppressed apoptosis, thus restoring differentiation to mature erythroblasts. Accordingly, intracellular ROS may represent a new therapeutic target in the treatment of iron overload. PMID:22193844

  6. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation.

    PubMed

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F

    2014-09-29

    While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of posttranscriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid-important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3, Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus, transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation. PMID:25220394

  7. Transformation of erythroid progenitors by viral and cellular tyrosine kinases.

    PubMed

    Beug, H; Schroeder, C; Wessely, O; Deiner, E; Meyer, S; Ischenko, I D; Hayman, M J

    1995-08-01

    Recently, two different normal avian erythroid progenitors were described. They differ in the receptor tyrosine kinases they express and in their ability to undergo self-renewal in culture. A common progenitor, termed stem cell factor (SCF) progenitor, expresses the receptor for avian SCF c-Kit, and undergoes short-term self-renewal when grown in the presence of avian SCF. A second progenitor, referred to as SCF/transforming growth factor-alpha progenitor, coexpresses c-Kit and the avian epidermal growth factor receptor homologue c-ErbB. These progenitors undergo sustained self-renewal when grown in the presence of transforming growth factor-alpha plus estradiol. The phenotype of the normal SCF/transforming growth factor-alpha progenitors closely corresponded to that of erythroid cells transformed by the tyrosine kinase oncogenes v-erbB or v-sea. This suggested that these cells, but not the SCF progenitors, would be the target cells for erythroblast transformation by these oncogenes. However, we demonstrate that both progenitor cells can be transformed by the v-erbB and v-sea oncogenes and also by the ligand-activated proto-oncogene product c-ErbB. We conclude that the target cell specificity of certain tyrosine kinase oncoproteins for erythroid cells is a reflection of their ability to provide signals for self-renewal that normally emanate from the endogenous c-ErbB protein. PMID:8547228

  8. Lipid changes associated with erythroid differentiation of Friend erythroleukemia cells.

    PubMed

    Fallani, A; Arcangeli, A; Ruggieri, S

    1987-01-01

    Friend erythroleukemia cells were induced to differentiate by dimethyl sulfoxide (DMSO) and hexamethylene-bis-acetamide (HBMA) in order to investigate whether their lipid characteristics, common to other systems of transformed cells, revert to a normal differentiation pattern. DBA/2 mouse erythrocytes were examined as a model of terminal differentiation in erythroid lineage. Variants of erythroleukemia cells not inducible to erythroid differentiation by DMSO and HMBA were also used in this study, in order to test whether lipid modifications occurring in differentiated erythroleukemia cells were related to the differentiation process or caused by specific effects of the inducers. Friend erythroleukemia cells showed the same lipid characteristics as those found in other transformed cell types. That is, a high level of ether-linked lipids and low percentages of long chain polyunsaturated fatty acids along with an accumulation of monoenoic fatty acids in phospholipids. These lipid characteristics remained unchanged when erythroleukemia cells were induced to differentiation by either DMSO or HMBA. However, other lipid components of erythroleukemia cells, e.g., phosphatidylethanolamine and triglycerides, were affected by erythroid differentiation. There were also changes of some lipid components of erythroleukemia cells, such as cholesteryl esters, which were related to specific effects of the inducers. Both DMSO- and HMBA-resistant variants differed from the inducible erythroleukemia cells, mainly in their ether-linked phospholipid pattern. PMID:3475757

  9. Embryonic----Fetal Hb switch in humans: studies on erythroid bursts generated by embryonic progenitors from yolk sac and liver.

    PubMed

    Peschle, C; Migliaccio, A R; Migliaccio, G; Petrini, M; Calandrini, M; Russo, G; Mastroberardino, G; Presta, M; Gianni, A M; Comi, P

    1984-04-01

    The synthesis of embryonic (zeta, epsilon), fetal (alpha, gamma), and adult (beta) globin was evaluated in human yolk sacs (YS) and livers at different ontogenic stages (i.e., from 6 through 10-12 wk of age) by means of analytical isoelectric focusing. Globin production was comparatively evaluated in vivo (i.e., in directly labeled erythroblasts from YS and liver) and in vitro [i.e., in erythroid bursts generated in culture by erythroid burst-forming units (BFU-E) from the same erythropoietic tissues]. Erythroid bursts generated in vitro by BFU-E from 6-wk livers and YS show essentially a "fetal" globin synthetic pattern: this is in sharp contrast to the "embryonic" pattern in corresponding liver and YS erythroblasts directly labeled in vivo. The invitro phenomenon suggests that (i) 6-wk BFU-E constitute a new generation of progenitors, which have already switched from an embryonic to a fetal program, and/or (ii) expression of their fetal program is induced by unknown in vitro factor(s), which may underlie the in vivo switch at later ontogenic stages. It is emphasized that 6- to 7-wk BFU-E are endowed with the potential for in vitro synthesis of not only epsilon- and gamma-chains but also some beta-globin. In general, we observed an inverse correlation between the levels of epsilon- and beta-chain synthesis. These results, together with previous studies on fetal, perinatal, and adult BFU-E, are compatible with models suggesting that in ontogeny the chromatin configuration is gradually modified at the level of the non-alpha gene cluster, thus leading to a 5'----3' activation of globin genes in a balanced fashion. PMID:6201856

  10. Monoclonal gammopathy-associated pure red cell aplasia.

    PubMed

    Korde, Neha; Zhang, Yong; Loeliger, Kelsey; Poon, Andrea; Simakova, Olga; Zingone, Adriana; Costello, Rene; Childs, Richard; Noel, Pierre; Silver, Samuel; Kwok, Mary; Mo, Clifton; Young, Neal; Landgren, Ola; Sloand, Elaine; Maric, Irina

    2016-06-01

    Pure red cell aplasia (PRCA) is a rare disorder characterized by inhibition of erythroid precursors in the bone marrow and normochromic, normocytic anaemia with reticulocytopenia. Among 51 PRCA patients, we identified 12 (24%) patients having monoclonal gammopathy, monoclonal gammopathy of undetermined significance or smouldering multiple myeloma, with presence of monoclonal protein or abnormal serum free light chains and atypical bone marrow features of clonal plasmacytosis, hypercellularity and fibrosis. Thus far, three patients treated with anti-myeloma based therapeutics have responded with reticulocyte recovery and clinical transfusion independence, suggesting plasma cells play a key role in the pathogenesis of this specific monoclonal gammopathy-associated PRCA. PMID:26999424

  11. Pure red cell aplasia induced by epoetin zeta.

    PubMed

    Panichi, Vincenzo; Ricchiuti, Guido; Scatena, Alessia; Del Vecchio, Lucia; Locatelli, Francesco

    2016-08-01

    Pure red cell aplasia (PRCA) may develop in patients with chronic kidney disease receiving erythropoiesis-stimulating agents (ESA). We report on a 72-year-old patient who developed hypo-proliferative anaemia unresponsive to ESA following the administration of epoetin zeta subcutaneously for 7 months. On the basis of severe isolated hypoplasia of the erythroid line in the bone marrow and high-titre neutralizing anti-erythropoietin antibodies (Ab), a diagnosis of Ab-mediated PRCA was made. Epoetin zeta was discontinued and the patient was given steroids. This was associated with anaemia recovery. To our knowledge this is the first PRCA case related to epoetin zeta. PMID:27478604

  12. Pure red cell aplasia induced by epoetin zeta

    PubMed Central

    Panichi, Vincenzo; Ricchiuti, Guido; Scatena, Alessia; Del Vecchio, Lucia; Locatelli, Francesco

    2016-01-01

    Pure red cell aplasia (PRCA) may develop in patients with chronic kidney disease receiving erythropoiesis-stimulating agents (ESA). We report on a 72-year-old patient who developed hypo-proliferative anaemia unresponsive to ESA following the administration of epoetin zeta subcutaneously for 7 months. On the basis of severe isolated hypoplasia of the erythroid line in the bone marrow and high-titre neutralizing anti-erythropoietin antibodies (Ab), a diagnosis of Ab-mediated PRCA was made. Epoetin zeta was discontinued and the patient was given steroids. This was associated with anaemia recovery. To our knowledge this is the first PRCA case related to epoetin zeta. PMID:27478604

  13. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    PubMed

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  14. RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation.

    PubMed

    Kuvardina, Olga N; Herglotz, Julia; Kolodziej, Stephan; Kohrs, Nicole; Herkt, Stefanie; Wojcik, Bartosch; Oellerich, Thomas; Corso, Jasmin; Behrens, Kira; Kumar, Ashok; Hussong, Helge; Urlaub, Henning; Koch, Joachim; Serve, Hubert; Bonig, Halvard; Stocking, Carol; Rieger, Michael A; Lausen, Jörn

    2015-06-01

    The activity of antagonizing transcription factors represents a mechanistic paradigm of bidirectional lineage-fate control during hematopoiesis. At the megakaryocytic/erythroid bifurcation, the cross-antagonism of krueppel-like factor 1 (KLF1) and friend leukemia integration 1 (FLI1) has such a decisive role. However, how this antagonism is resolved during lineage specification is poorly understood. We found that runt-related transcription factor 1 (RUNX1) inhibits erythroid differentiation of murine megakaryocytic/erythroid progenitors and primary human CD34(+) progenitor cells. We show that RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation by epigenetic repression of the erythroid master regulator KLF1. RUNX1 binding to the KLF1 locus is increased during megakaryocytic differentiation and counterbalances the activating role of T-cell acute lymphocytic leukemia 1 (TAL1). We found that corepressor recruitment by RUNX1 contributes to a block of the KLF1-dependent erythroid gene expression program. Our data indicate that the repressive function of RUNX1 influences the balance between erythroid and megakaryocytic differentiation by shifting the balance between KLF1 and FLI1 in the direction of FLI1. Taken together, we show that RUNX1 is a key player within a network of transcription factors that represses the erythroid gene expression program. PMID:25911237

  15. NF-E2 Overexpression Delays Erythroid Maturation and Increases Erythrocyte Production

    PubMed Central

    Mutschler, Manuel; Magin, Angela S.; Buerge, Martina; Roelz, Roland; Schanne, Daniel H.; Will, Britta; Pilz, Ingo H.; Migliaccio, Anna Rita; Pahl, Heike L.

    2009-01-01

    Summary The transcription factor Nuclear Factor-Erythroid 2 (NF-E2) is overexpressed in the vast majority of patients with polycythaemia vera (PV). In murine models, NF-E2 overexpression increases proliferation and promotes cellular viability in the absence of erythropoietin (EPO). EPO-independent growth is a hallmark of PV. We therefore hypothesized that NF-E2 overexpression contributes to erythrocytosis, the pathognomonic feature of PV. Consequently, we investigated the effect of NF-E2 overexpression in healthy CD34+ cells. NF-E2 overexpression led to a delay in erythroid maturation, manifested by a belated appearance of glycophorin A-positive erythroid precursors. Maturation delay was similarly observed in primary PV patient erythroid cultures compared to healthy controls. Protracted maturation led to a significant increase in the accumulated number of erythroid cells both in PV cultures and in CD34+ cells overexpressing NF-E2. Similarly, NF-E2 overexpression altered erythroid colony formation, leading to an increase in BFU-E formation. These data indicate that NF-E2 overexpression delays the early phase of erythroid maturation, resulting in an expansion of erythroid progenitors, thereby increasing the number of erythrocytes derived from one CD34+ cell. These data propose a role for NF-E2 in mediating the erythrocytosis of PV. PMID:19466964

  16. miR-150 inhibits terminal erythroid proliferation and differentiation

    PubMed Central

    Sun, Zhiwei; Wang, Ye; Han, Xu; Zhao, Xielan; Peng, Yuanliang; Li, Yusheng; Peng, Minyuan; Song, Jianhui; Wu, Kunlu; Sun, Shumin; Zhou, Weihua; Qi, Biwei; Zhou, Chufan; Chen, Huiyong; An, Xiuli; Liu, Jing

    2015-01-01

    MicroRNAs (miRNAs), a class of small non-coding linear RNAs, have been shown to play a crucial role in erythropoiesis. To evaluate the indispensable role of constant suppression of miR-150 during terminal erythropoiesis, we performed miR-150 gain- and loss-of-function experiments on hemin-induced K562 cells and EPO-induced human CD34+ cells. We found that forced expression of miR-150 suppresses commitment of hemoglobinization and CD235a labeling in both cell types. Erythroid proliferation is also inhibited via inducing apoptosis and blocking the cell cycle when miR-150 is overexpressed. In contrast, miR-150 inhibition promotes terminal erythropoiesis. 4.1 R gene is a new target of miR-150 during terminal erythropoiesis, and its abundance ensures the mechanical stability and deformability of the membrane. However, knockdown of 4.1 R did not affect terminal erythropoiesis. Transcriptional profiling identified more molecules involved in terminal erythroid dysregulation derived from miR-150 overexpression. These results shed light on the role of miR-150 during human terminal erythropoiesis. This is the first report highlighting the relationship between miRNA and membrane protein and enhancing our understanding of how miRNA works in the hematopoietic system. PMID:26543232

  17. Erythropoietin receptor signals both proliferation and erythroid-specific differentiation.

    PubMed Central

    Liboi, E; Carroll, M; D'Andrea, A D; Mathey-Prevot, B

    1993-01-01

    Ectopic expression of the erythropoietin receptor (EPO-R) in Ba/F3, an interleukin 3-dependent progenitor cell line, confers EPO-dependent cell growth. To examine whether the introduced EPO-R could affect differentiation, we isolated Ba/F3-EPO-R subclones in interleukin 3 and assayed for the induction of beta-globin mRNA synthesis after exposure to EPO. Detection of beta-globin mRNA was observed within 3 days of EPO treatment, with peak levels accumulating after 10 days. When EPO was withdrawn, expression of beta-globin mRNA persisted in most clones, suggesting that commitment to erythroid differentiation had occurred. Although EPO-R expression also supports EPO-dependent proliferation of CTLL-2, a mature T-cell line, those cells did not produce globin transcripts, presumably because they lack requisite cellular factors involved in erythrocyte differentiation. We conclude that the EPO-R transmits signals important for both proliferation and differentiation along the erythroid lineage. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248252

  18. Experimental validation of predicted mammalian erythroid cis-regulatory modules

    PubMed Central

    Wang, Hao; Zhang, Ying; Cheng, Yong; Zhou, Yuepin; King, David C.; Taylor, James; Chiaromonte, Francesca; Kasturi, Jyotsna; Petrykowska, Hanna; Gibb, Brian; Dorman, Christine; Miller, Webb; Dore, Louis C.; Welch, John; Weiss, Mitchell J.; Hardison, Ross C.

    2006-01-01

    Multiple alignments of genome sequences are helpful guides to functional analysis, but predicting cis-regulatory modules (CRMs) accurately from such alignments remains an elusive goal. We predict CRMs for mammalian genes expressed in red blood cells by combining two properties gleaned from aligned, noncoding genome sequences: a positive regulatory potential (RP) score, which detects similarity to patterns in alignments distinctive for regulatory regions, and conservation of a binding site motif for the essential erythroid transcription factor GATA-1. Within eight target loci, we tested 75 noncoding segments by reporter gene assays in transiently transfected human K562 cells and/or after site-directed integration into murine erythroleukemia cells. Segments with a high RP score and a conserved exact match to the binding site consensus are validated at a good rate (50%–100%, with rates increasing at higher RP), whereas segments with lower RP scores or nonconsensus binding motifs tend to be inactive. Active DNA segments were shown to be occupied by GATA-1 protein by chromatin immunoprecipitation, whereas sites predicted to be inactive were not occupied. We verify four previously known erythroid CRMs and identify 28 novel ones. Thus, high RP in combination with another feature of a CRM, such as a conserved transcription factor binding site, is a good predictor of functional CRMs. Genome-wide predictions based on RP and a large set of well-defined transcription factor binding sites are available through servers at http://www.bx.psu.edu/. PMID:17038566

  19. Identification of a novel agrin-dependent pathway in cell signaling and adhesion within the erythroid niche

    PubMed Central

    Anselmo, A; Lauranzano, E; Soldani, C; Ploia, C; Angioni, R; D'amico, G; Sarukhan, A; Mazzon, C; Viola, A

    2016-01-01

    Establishment of cell–cell adhesion is crucial in embryonic development as well as within the stem cell niches of an adult. Adhesion between macrophages and erythroblasts is required for the formation of erythroblastic islands, specialized niches where erythroblasts proliferate and differentiate to produce red blood cells throughout life. The Eph family is the largest known family of receptor tyrosine kinases (RTKs) and controls cell adhesion, migration, invasion and morphology by modulating integrin and adhesion molecule activity and by modifying the actin cytoskeleton. Here, we identify the proteoglycan agrin as a novel regulator of Eph receptor signaling and characterize a novel mechanism controlling cell–cell adhesion and red cell development within the erythroid niche. We demonstrate that agrin induces clustering and activation of EphB1 receptors on developing erythroblasts, leading to the activation of α5β1 integrins. In agreement, agrin knockout mice display severe anemia owing to defective adhesion to macrophages and impaired maturation of erythroid cells. These results position agrin-EphB1 as a novel key signaling couple regulating cell adhesion and erythropoiesis. PMID:26990660

  20. Induction of gamma-globin gene transcription by hydroxycarbamide in primary erythroid cell cultures from Lepore patients.

    PubMed

    Calzolari, Roberta; Pecoraro, Alice; Borruso, Vito; Troia, Antonio; Acuto, Santina; Maggio, Aurelio; Di Marzo, Rosalba

    2008-05-01

    Increased expression of fetal haemoglobin (HbF) may ameliorate the clinical course of beta-thalassemia and sickle cell disease. Some pharmacological agents, such as hydroxycarbamide (HC), can increase fetal haemoglobin synthesis during adult life. Cellular selection and/or molecular mechanisms have been proposed to account for this increase. To explore the mechanism of action of HC we focused on homozygous Hb-Lepore patients that presented with high fetal haemoglobin levels and were good responders to HC treatment "in vivo". We performed primary erythroid cultures from peripheral blood of four homozygous Lepore patients. The increase in HBG (gamma-globin) transcription levels and HbF content in these cultures, after HC treatment, were detected by quantitative real time polymerase chain reaction analysis and flow cytometric analysis. Primary transcript "in-situ" hybridization analysis showed a 2-fold increase in the number of cells expressing both HBG alleles in HC-treated erythroid cultures. These studies, demonstrating the larger number of biallelic HBG expressing cells, suggest that HC is able to stimulate the activation of HBG transcription. These observations provide evidences that the molecular mechanism of action is involved in the increase of fetal haemoglobin production by HC. PMID:18422777

  1. Identification of a novel agrin-dependent pathway in cell signaling and adhesion within the erythroid niche.

    PubMed

    Anselmo, A; Lauranzano, E; Soldani, C; Ploia, C; Angioni, R; D'amico, G; Sarukhan, A; Mazzon, C; Viola, A

    2016-08-01

    Establishment of cell-cell adhesion is crucial in embryonic development as well as within the stem cell niches of an adult. Adhesion between macrophages and erythroblasts is required for the formation of erythroblastic islands, specialized niches where erythroblasts proliferate and differentiate to produce red blood cells throughout life. The Eph family is the largest known family of receptor tyrosine kinases (RTKs) and controls cell adhesion, migration, invasion and morphology by modulating integrin and adhesion molecule activity and by modifying the actin cytoskeleton. Here, we identify the proteoglycan agrin as a novel regulator of Eph receptor signaling and characterize a novel mechanism controlling cell-cell adhesion and red cell development within the erythroid niche. We demonstrate that agrin induces clustering and activation of EphB1 receptors on developing erythroblasts, leading to the activation of α5β1 integrins. In agreement, agrin knockout mice display severe anemia owing to defective adhesion to macrophages and impaired maturation of erythroid cells. These results position agrin-EphB1 as a novel key signaling couple regulating cell adhesion and erythropoiesis. PMID:26990660

  2. Gender-Specific Toxicological Effects of Chronic Exposure to Pure Microcystin-LR or Complex Microcystis aeruginosa Extracts on Adult Medaka Fish.

    PubMed

    Le Manach, Séverine; Khenfech, Nour; Huet, Hélène; Qiao, Qin; Duval, Charlotte; Marie, Arul; Bolbach, Gérard; Clodic, Gilles; Djediat, Chakib; Bernard, Cécile; Edery, Marc; Marie, Benjamin

    2016-08-01

    Cyanobacterial blooms often occur in freshwater lakes and constitute a potential health risk to human populations, as well as to other organisms. However, their overall and specific implications for the health of aquatic organisms that are chronically and environmentally exposed to cyanobacteria producing hepatotoxins, such as microcystins (MCs), together with other bioactive compounds have still not been clearly established and remain difficult to assess. The medaka fish was chosen as the experimental aquatic model for studying the cellular and molecular toxicological effects on the liver after chronic exposures (28 days) to environmentally relevant concentrations of pure MC-LR, complex extracts of MC producing or nonproducing cyanobacterial biomasses, and of a Microcystis aeruginosa natural bloom. Our results showed a higher susceptibility of females to the different treatments compared to males at both the cellular and the molecular levels. Although hepatocyte lysis increased with MC-containing treatments, lysis always appeared more severe in the liver of females compare to males, and the glycogen cellular reserves also appeared to decrease more in the liver of females compared to those in the males. Proteomic investigations reveal divergent responses between males and females exposed to all treatments, especially for proteins involved in metabolic and homeostasis processes. Our observations also highlighted the dysregulation of proteins involved in oogenesis in female livers. These results suggest that fish populations exposed to cyanobacteria blooms may potentially face several ecotoxicological issues. PMID:27409512

  3. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    SciTech Connect

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C. )

    1991-03-15

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase.

  4. The RNA binding protein RBM38 (RNPC1) regulates splicing during late erythroid differentiation.

    PubMed

    Heinicke, Laurie A; Nabet, Behnam; Shen, Shihao; Jiang, Peng; van Zalen, Sebastiaan; Cieply, Benjamin; Russell, J Eric; Xing, Yi; Carstens, Russ P

    2013-01-01

    Alternative pre-mRNA splicing is a prevalent mechanism in mammals that promotes proteomic diversity, including expression of cell-type specific protein isoforms. We characterized a role for RBM38 (RNPC1) in regulation of alternative splicing during late erythroid differentiation. We used an Affymetrix human exon junction (HJAY) splicing microarray to identify a panel of RBM38-regulated alternatively spliced transcripts. Using microarray databases, we noted high RBM38 expression levels in CD71(+) erythroid cells and thus chose to examine RBM38 expression during erythroid differentiation of human hematopoietic stem cells, detecting enhanced RBM38 expression during late erythroid differentiation. In differentiated erythroid cells, we validated a subset of RBM38-regulated splicing events and determined that RBM38 regulates activation of Protein 4.1R (EPB41) exon 16 during late erythroid differentiation. Using Epb41 minigenes, Rbm38 was found to be a robust activator of exon 16 splicing. To further address the mechanism of RBM38-regulated alternative splicing, a novel mammalian protein expression system, followed by SELEX-Seq, was used to identify a GU-rich RBM38 binding motif. Lastly, using a tethering assay, we determined that RBM38 can directly activate splicing when recruited to a downstream intron. Together, our data support the role of RBM38 in regulating alternative splicing during erythroid differentiation. PMID:24250749

  5. The RNA Binding Protein RBM38 (RNPC1) Regulates Splicing during Late Erythroid Differentiation

    PubMed Central

    Heinicke, Laurie A.; Nabet, Behnam; Shen, Shihao; Jiang, Peng; van Zalen, Sebastiaan; Cieply, Benjamin; Russell, J. Eric; Xing, Yi; Carstens, Russ P.

    2013-01-01

    Alternative pre-mRNA splicing is a prevalent mechanism in mammals that promotes proteomic diversity, including expression of cell-type specific protein isoforms. We characterized a role for RBM38 (RNPC1) in regulation of alternative splicing during late erythroid differentiation. We used an Affymetrix human exon junction (HJAY) splicing microarray to identify a panel of RBM38-regulated alternatively spliced transcripts. Using microarray databases, we noted high RBM38 expression levels in CD71+ erythroid cells and thus chose to examine RBM38 expression during erythroid differentiation of human hematopoietic stem cells, detecting enhanced RBM38 expression during late erythroid differentiation. In differentiated erythroid cells, we validated a subset of RBM38-regulated splicing events and determined that RBM38 regulates activation of Protein 4.1R (EPB41) exon 16 during late erythroid differentiation. Using Epb41 minigenes, Rbm38 was found to be a robust activator of exon 16 splicing. To further address the mechanism of RBM38-regulated alternative splicing, a novel mammalian protein expression system, followed by SELEX-Seq, was used to identify a GU-rich RBM38 binding motif. Lastly, using a tethering assay, we determined that RBM38 can directly activate splicing when recruited to a downstream intron. Together, our data support the role of RBM38 in regulating alternative splicing during erythroid differentiation. PMID:24250749

  6. Glutathione peroxidase 4 prevents necroptosis in mouse erythroid precursors

    PubMed Central

    Canli, Özge; Alankuş, Yasemin B.; Grootjans, Sasker; Vegi, Naidu; Hültner, Lothar; Hoppe, Philipp S.; Schroeder, Timm; Vandenabeele, Peter; Bornkamm, Georg W.

    2016-01-01

    Maintaining cellular redox balance is vital for cell survival and tissue homoeostasis because imbalanced production of reactive oxygen species (ROS) may lead to oxidative stress and cell death. The antioxidant enzyme glutathione peroxidase 4 (Gpx4) is a key regulator of oxidative stress–induced cell death. We show that mice with deletion of Gpx4 in hematopoietic cells develop anemia and that Gpx4 is essential for preventing receptor-interacting protein 3 (RIP3)-dependent necroptosis in erythroid precursor cells. Absence of Gpx4 leads to functional inactivation of caspase 8 by glutathionylation, resulting in necroptosis, which occurs independently of tumor necrosis factor α activation. Although genetic ablation of Rip3 normalizes reticulocyte maturation and prevents anemia, ROS accumulation and lipid peroxidation in Gpx4-deficient cells remain high. Our results demonstrate that ROS and lipid hydroperoxides function as not-yet-recognized unconventional upstream signaling activators of RIP3-dependent necroptosis. PMID:26463424

  7. Desensitization to hydroxycarbamide following long-term treatment of thalassaemia intermedia as observed in vivo and in primary erythroid cultures from treated patients.

    PubMed

    Rigano, Paolo; Pecoraro, Alice; Calzolari, Roberta; Troia, Antonio; Acuto, Santina; Renda, Disma; Pantalone, Gaetano Restivo; Maggio, Aurelio; Di Marzo, Rosalba

    2010-12-01

    Hydroxycarbamide (HC) is a pharmacological agent capable of stimulating fetal haemoglobin (HbF) production during adult life. High levels of HbF may ameliorate the clinical course of β-thalassaemia and sickle cell disease. The efficacy of HC for the treatment of thalassaemia major and thalassaemia intermedia is variable. Although an increase of HbF has been observed in most patients, only some patients experience significant improvement in total haemoglobin levels. This study aimed to determine the effectiveness and safety of short- (1 year) and long-term (mean follow-up 68 months) HC treatment in 24 thalassaemia intermedia patients. Additionally, we evaluated if primary erythroid progenitor cells cultured from treated patients responded to HC treatment in a manner similar to that observed in vivo. Our results confirm a good response to HC after a short-term follow-up in 70% of thalassaemia intermedia patients and a reduction of clinical response in patients with a long follow-up. Erythroid cultures obtained from patients during treatment reproduced the observed in vivo response. Interestingly, haematopoietic stem cells from long-term treated patients showed reduced ability to develop into primary erythroid cultures some months before the reduction of the 'in vivo' response. The mechanism of this loss of response to HC remains to be determined. PMID:20955403

  8. Twisted partially pure spinors

    NASA Astrophysics Data System (ADS)

    Herrera, Rafael; Tellez, Ivan

    2016-08-01

    Motivated by the relationship between orthogonal complex structures and pure spinors, we define twisted partially pure spinors in order to characterize spinorially subspaces of Euclidean space endowed with a complex structure.

  9. Distinct Domains of the GATA-1 Cofactor FOG-1 Differentially Influence Erythroid versus Megakaryocytic Maturation

    PubMed Central

    Cantor, Alan B.; Katz, Samuel G.; Orkin, Stuart H.

    2002-01-01

    FOG family zinc finger proteins play essential roles in development through physical interaction with GATA factors. FOG-1, like its interacting partner GATA-1, is required for normal differentiation of erythroid and megakaryocytic cells. Here, we have developed a functional assay for FOG-1 based on its ability to rescue erythroid and megakaryocytic maturation of a genetically engineered FOG-1−/− cell line. We demonstrate that interaction through only one of FOG-1's four GATA-binding zinc fingers is sufficient for rescue, providing evidence against a model in which FOG-1 acts to bridge multiple GATA-binding DNA elements. Importantly, we find that distinct regions of FOG-1 differentially influence erythroid versus megakaryocyte maturation. As such, we propose that FOG-1 may modulate the fate of a bipotential erythroid/megakaryocytic precursor cell. PMID:12024038

  10. Assessment of erythroid dysplasia by "difference from normal" in routine clinical flow cytometry work-up.

    PubMed

    Eidenschink Brodersen, Lisa; Menssen, Andrew J; Wangen, Jamie R; Stephenson, Christine F; de Baca, Monica E; Zehentner, Barbara K; Wells, Denise A; Loken, Michael R

    2014-10-21

    Introduction: While multidimensional flow cytometry (MDF) has great utility in diagnostic work-ups of patients with suspected myelodysplastic syndromes (MDS), only the myeloid lineage has demonstrated reproducible abnormalities from multiple laboratories. With the effects of ammonium chloride (NH4 Cl) lysis on erythroid progenitors previously described, we applied this protocol to a patient cohort with diagnosed MDS to investigate phenotypic abnormalities that indicate erythroid dysplasia. Method: Bone marrow specimens [39 MDS, 9 acute myeloid leukemia (AML), 7 JAK2(V617F) positive myeloproliferative neoplasms (MPN), 5 nutritional deficiencies] were processed by NH4 Cl lysis and Ficoll preparation and evaluated by MDF using a difference from normal algorithm. Results: For the MDS cohort, phenotypic abnormalities on the mature erythroid progenitors were frequent for CD71 and CD36 (36% for each antigen); abnormalities for CD235a (8%) were observed. Among immature erythroid progenitors, abnormal maturation patterns (≤5%) and increased CD105 intensity (9%) were seen. Increased frequency of CD105 bright cells was observed (18%). While antigenic abnormalities correlated between NH4 Cl lysis and Ficoll preparation, the lysis method demonstrated the most consistent quantitative antigen intensities. Mean erythroid phenotypic abnormalities and prognostic cytogenetic subgroups correlated strongly. Morphologic and erythroid phenotypic abnormalities correlated, as did increasing FCSS and number of erythroid abnormalities, albeit without further increase for AML patients. Discussion: These data expand the understanding of erythropoiesis and define immunophenotypic abnormalities that indicate dyserythropoiesis in MDS utilizing a lysis protocol practical for routine implementation in clinical flow cytometric work-up. Preliminary studies also indicate strong correlation between phenotypic erythroid dysplasia and poor prognosis, as classified cytogenetically. © 2014 Clinical

  11. Holoprosencephaly and Pure Red Cell Aplasia in a Feline Leukaemia Virus-Positive Kitten.

    PubMed

    Southard, T L; Rodriguez-Ramos Fernandez, J; Priest, H; Stokol, T

    2016-01-01

    A 9-month-old, female, domestic longhair cat with severe anaemia tested positive for feline leukaemia virus (FeLV) and was humanely destroyed and submitted for necropsy examination. Gross findings included a non-divided rostral telencephalon, consistent with semilobar holoprosencephaly. Histological examination of the bone marrow revealed an almost complete absence of erythroid precursor cells, consistent with pure red cell aplasia, and mild to moderate myelofibrosis. This case demonstrates a very unusual central nervous system defect, as well as an atypical presentation of pure red cell aplasia, in a FeLV-positive kitten. PMID:26897097

  12. Age-related alterations in erythroid and granulopoietic progenitors in Diamond-Blackfan anaemia.

    PubMed

    Casadevall, N; Croisille, L; Auffray, I; Tchernia, G; Coulombel, L

    1994-06-01

    Mechanisms involved in the erythroid failure characterizing Diamond-Blackfan anaemia (DBA) remain unidentified. The general consensus is that the defect is intrinsic to the marrow erythroid progenitor, but the target progenitor cell has not been precisely identified, and in vitro studies have revealed considerable heterogeneity between patients. In order to understand better the meaning of such a biological heterogeneity, we examined the in vitro response of erythroid progenitors CFU-E (colony-forming unit-erythroid) and BFU-E (burst-forming unit-erythroid) to erythropoietin (Epo), interleukin-3 (IL-3) and stem cell factor (SCF) in a large series of 24 patients from 1 month to over 20 years of age. Results of colony assays revealed a striking correlation between the age of the patient and the extent of the abnormalities detected in vitro. Therefore, despite profound anaemia, 80% (7/10) of the patients studied within 1 year of diagnosis had normal numbers of both CFU-E and BFU-E which exhibited a normal response to cytokines. In contrast, 12/14 patients followed up for more than 3 years had decreased numbers of erythroid progenitors, in seven cases associated with decreased colony-forming unit granulocyte-macrophage (CFU-GM). The number of CFU-E and BFU-E was not normalized even by the addition of high concentrations of combined Epo, IL-3 and SCF.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7524624

  13. Tracking erythroid progenitor cells in times of need and times of plenty.

    PubMed

    Koury, Mark J

    2016-08-01

    Red blood cell production rates increase rapidly following blood loss or hemolysis, but the expansion of erythropoiesis in these anemic states is tightly regulated such that rebound polycythemia does not occur. The erythroid cells that respond to erythropoietic stimulation or suppression are the progenitor stages of burst-forming units-erythroid (BFU-Es) and colony-forming units-erythroid (CFU-Es). Results from an early study of the changes in the size, location, and cell cycling status of BFU-E and CFU-E populations in mice under normal conditions, erythropoietic stimulation, and erythropoietic suppression are used as reference points to review subsequent developments related to erythroid progenitor populations and regulation of their size. The review concerns development of erythroid progenitor populations mainly in mice and humans, with a focus on the mechanisms related to the rapid but highly regulated expansion of erythropoiesis in spleens of erythropoietically stimulated mice. Current knowledge is used as a model of erythroid progenitor populations in mice under normal, erythropoietically suppressed, and erythropoietically stimulated conditions. Clinical applications of information learned from studies of erythropoietic expansion, in terms of current therapies for anemia, are reviewed. PMID:26646992

  14. Histone Methyltransferase Setd8 Represses Gata2 Expression and Regulates Erythroid Maturation

    PubMed Central

    Malik, Jeffrey; Getman, Michael

    2015-01-01

    Setd8 is the sole histone methyltransferase in mammals capable of monomethylating histone H4 lysine 20 (H4K20me1). Setd8 is expressed at significantly higher levels in erythroid cells than any other cell or tissue type, suggesting that Setd8 has an erythroid-cell-specific function. To test this hypothesis, stable Setd8 knockdown was established in extensively self-renewing erythroblasts (ESREs), a well-characterized, nontransformed model of erythroid maturation. Knockdown of Setd8 resulted in impaired erythroid maturation characterized by a delay in hemoglobin accumulation, larger mean cell area, persistent ckit expression, incomplete nuclear condensation, and lower rates of enucleation. Setd8 knockdown did not alter ESRE proliferation or viability or result in accumulation of DNA damage. Global gene expression analyses following Setd8 knockdown demonstrated that in erythroid cells, Setd8 functions primarily as a repressor. Most notably, Gata2 expression was significantly higher in knockdown cells than in control cells and Gata2 knockdown rescued some of the maturation impairments associated with Setd8 disruption. Setd8 occupies critical regulatory elements in the Gata2 locus, and knockdown of Setd8 resulted in loss of H4K20me1 and gain of H4 acetylation at the Gata2 1S promoter. These results suggest that Setd8 is an important regulator of erythroid maturation that works in part through repression of Gata2 expression. PMID:25848090

  15. Repression by RB1 characterizes genes involved in the penultimate stage of erythroid development.

    PubMed

    Zhang, Ji; Loyd, Melanie R; Randall, Mindy S; Morris, John J; Shah, Jayesh G; Ney, Paul A

    2015-01-01

    Retinoblastoma-1 (RB1), and the RB1-related proteins p107 and p130, are key regulators of the cell cycle. Although RB1 is required for normal erythroid development in vitro, it is largely dispensable for erythropoiesis in vivo. The modest phenotype caused by RB1 deficiency in mice raises questions about redundancy within the RB1 family, and the role of RB1 in erythroid differentiation. Here we show that RB1 is the major pocket protein that regulates terminal erythroid differentiation. Erythroid cells lacking all pocket proteins exhibit the same cell cycle defects as those deficient for RB1 alone. RB1 has broad repressive effects on gene transcription in erythroid cells. As a group, RB1-repressed genes are generally well expressed but downregulated at the final stage of erythroid development. Repression correlates with E2F binding, implicating E2Fs in the recruitment of RB1 to repressed genes. Merging differential and time-dependent changes in expression, we define a group of approximately 800 RB1-repressed genes. Bioinformatics analysis shows that this list is enriched for terms related to the cell cycle, but also for terms related to terminal differentiation. Some of these have not been previously linked to RB1. These results expand the range of processes potentially regulated by RB1, and suggest that a principal role of RB1 in development is coordinating the events required for terminal differentiation. PMID:26397180

  16. Force Dependent Changes in Non-Erythroid Spectrin and Ankyrins

    NASA Astrophysics Data System (ADS)

    Degaga, Eleni; Forstner, Martin

    2012-02-01

    Mechanotransduction in cells describes the process by which external physical stimuli are converted into biochemical activity and plays an important role in many biological functions on both the cell and tissue level. However, the specific mechanisms by which mechanical forces lead to particular molecular and cellular responses are much less understood. We investigate the changes in non-erythroid spectrin and ankyrins as a result of equi-biaxial strain application to live cells in culture. Specifically, we focus on the spectrins' role in the ubiquitination process - a vital process in the regulation of protein degradation- of spectrin and ankyrins. We utilize immune-fluorescence staining and fluorescent fusion proteins for quantitative fluorescence imaging as well as biochemical methods to measure changes in of cell's spectrin and ankyrin content. Protein expression levels and localization between cells exposed to mechanical stimuli of different temporal and spatial profiles are compared. In addition, the threshold behavior of cell proliferation - as measured by number densities - of a variety of cell types as a function of mechano-stimulation is investigated.

  17. Candidate ligand for the c-kit transmembrane kinase receptor: KL, a fibroblast derived growth factor stimulates mast cells and erythroid progenitors.

    PubMed Central

    Nocka, K; Buck, J; Levi, E; Besmer, P

    1990-01-01

    The c-kit proto-oncogene encodes a transmembrane tyrosine kinase receptor for an unidentified ligand and is allelic with the murine white-spotting locus (W). W mutations affect melanogenesis, gametogenesis and hematopoiesis during development and in adult life. Cellular targets of W mutations in hematopoiesis include distinct cell populations in the erythroid and mast cell lineages as well as stem cells. In the absence of interleukin-3 (IL-3) mast cells derived from normal mice but not from W mutant mice can be maintained by co-culture with 3T3 fibroblasts. Based on the defective proliferative response of W mast cells in the 3T3 fibroblast co-culture system it had been proposed that fibroblasts produce the c-kit ligand. We have used a mast cell proliferation assay to purify a 30 kd protein, designated KL, from conditioned medium of Balb/3T3 fibroblasts to apparent homogeneity. KL stimulates the proliferation of normal bone marrow derived mast cells but not mast cells from W mice, although both normal and mutant mast cells respond similarly to IL-3. Connective tissue-type mast cells derived from the peritoneal cavity of normal mice were found to express a high level of c-kit protein on their surface and to proliferate in response to KL. The effect of KL on erythroid progenitor cells was investigated as well. In combination with erythropoietin, KL was found to stimulate early erythroid progenitors (BFU-E) from fetal liver and spleen cells but not from bone marrow cells of adult mice and from fetal liver cells of W/W mice.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 3. Fig. 5. Fig. 7. PMID:1698611

  18. Myc Inhibits p27-Induced Erythroid Differentiation of Leukemia Cells by Repressing Erythroid Master Genes without Reversing p27-Mediated Cell Cycle Arrest▿ ‡

    PubMed Central

    Acosta, Juan C.; Ferrándiz, Nuria; Bretones, Gabriel; Torrano, Verónica; Blanco, Rosa; Richard, Carlos; O'Connell, Brenda; Sedivy, John; Delgado, M. Dolores; León, Javier

    2008-01-01

    Inhibition of differentiation has been proposed as an important mechanism for Myc-induced tumorigenesis, but the mechanisms involved are unclear. We have established a genetically defined differentiation model in human leukemia K562 cells by conditional expression of the cyclin-dependent kinase (Cdk) inhibitor p27 (inducible by Zn2+) and Myc (activatable by 4-hydroxy-tamoxifen). Induction of p27 resulted in erythroid differentiation, accompanied by Cdk inhibition and G1 arrest. Interestingly, activation of Myc inhibited p27-mediated erythroid differentiation without affecting p27-mediated proliferation arrest. Microarray-based gene expression indicated that, in the presence of p27, Myc blocked the upregulation of several erythroid-cell-specific genes, including NFE2, JUNB, and GATA1 (transcription factors with a pivotal role in erythropoiesis). Moreover, Myc also blocked the upregulation of Mad1, a transcriptional antagonist of Myc that is able to induce erythroid differentiation. Cotransfection experiments demonstrated that Myc-mediated inhibition of differentiation is partly dependent on the repression of Mad1 and GATA1. In conclusion, this model demonstrates that Myc-mediated inhibition of differentiation depends on the regulation of a specific gene program, whereas it is independent of p27-mediated cell cycle arrest. Our results support the hypothesis that differentiation inhibition is an important Myc tumorigenic mechanism that is independent of cell proliferation. PMID:18838534

  19. Myc inhibits p27-induced erythroid differentiation of leukemia cells by repressing erythroid master genes without reversing p27-mediated cell cycle arrest.

    PubMed

    Acosta, Juan C; Ferrándiz, Nuria; Bretones, Gabriel; Torrano, Verónica; Blanco, Rosa; Richard, Carlos; O'Connell, Brenda; Sedivy, John; Delgado, M Dolores; León, Javier

    2008-12-01

    Inhibition of differentiation has been proposed as an important mechanism for Myc-induced tumorigenesis, but the mechanisms involved are unclear. We have established a genetically defined differentiation model in human leukemia K562 cells by conditional expression of the cyclin-dependent kinase (Cdk) inhibitor p27 (inducible by Zn(2+)) and Myc (activatable by 4-hydroxy-tamoxifen). Induction of p27 resulted in erythroid differentiation, accompanied by Cdk inhibition and G(1) arrest. Interestingly, activation of Myc inhibited p27-mediated erythroid differentiation without affecting p27-mediated proliferation arrest. Microarray-based gene expression indicated that, in the presence of p27, Myc blocked the upregulation of several erythroid-cell-specific genes, including NFE2, JUNB, and GATA1 (transcription factors with a pivotal role in erythropoiesis). Moreover, Myc also blocked the upregulation of Mad1, a transcriptional antagonist of Myc that is able to induce erythroid differentiation. Cotransfection experiments demonstrated that Myc-mediated inhibition of differentiation is partly dependent on the repression of Mad1 and GATA1. In conclusion, this model demonstrates that Myc-mediated inhibition of differentiation depends on the regulation of a specific gene program, whereas it is independent of p27-mediated cell cycle arrest. Our results support the hypothesis that differentiation inhibition is an important Myc tumorigenic mechanism that is independent of cell proliferation. PMID:18838534

  20. 7 CFR 916.16 - Pure grower or pure producer.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Pure grower or pure producer. 916.16 Section 916.16... Order Regulating Handling Definitions § 916.16 Pure grower or pure producer. (a) Pure grower means any...); or (2) Who produces and handles his or her own product; Provided, That a pure grower can pack...

  1. 7 CFR 916.16 - Pure grower or pure producer.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 8 2011-01-01 2011-01-01 false Pure grower or pure producer. 916.16 Section 916.16... Order Regulating Handling Definitions § 916.16 Pure grower or pure producer. (a) Pure grower means any...); or (2) Who produces and handles his or her own product; Provided, That a pure grower can pack...

  2. Mitochondrial Hspa9/Mortalin regulates erythroid differentiation via iron-sulfur cluster assembly.

    PubMed

    Shan, Yuxi; Cortopassi, Gino

    2016-01-01

    Mitochondrial iron-sulfur cluster (ISC) biogenesis provides iron-sulfur cofactors to several mitochondrial proteins, but the extent to which ISC biogenesis regulates hematopoiesis has been unclear. The blood disease Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis, and the disease overlaps with the gene Hspa9/Mortalin in multiple ways: the HSPA9 locus maps to 5q31.2 that is frequently deleted in human MDS; mutant Hspa9 causes zebrafish MDS; and Hspa9 knockdown mice have decreased hematopoiesis. We show here that HSPA9 functions in mitochondrial ISC biogenesis, and is required for erythroid differentiation. HSPA9 interacts with and stabilizes the mitochondrial ISC biogenesis proteins frataxin, Nfs1, ISCU, and Nfu. MDS-causing mutations in HSPA9 protein change its interactions with ISC biogenesis proteins. Depletion of HSPA9 decreases aconitase activity, which requires an ISC at its active site, but not that of the non-ISC requiring malate dehydrogenase, and increases IRP1 binding activity. In erythroid cell lines, Hspa9 depletion inhibited erythroid differentiation, post-transcriptionally regulating the expression of Alas2 and FeCH, as expected through known ISC control of the IRE response elements in these genes. By contrast, the Alas2 open reading frame rescued the Hspa9-dependent defect in erythroid differentiation, but not when uncoupled from its 5'-IRE sequence. Thus, Hspa9 depletion causes a mitochondrial ISC deficit, altering IRP1-IRE binding and FeCH stability, which consequently inhibits Alas2 translation, heme synthesis, and erythroid differentiation, i.e.: Hspa9->ISC->IRP/IRE->Alas2->heme synthesis->erythroid differentiation. Thus Hspa9 regulates erythroid differentiation through ISC cluster assembly, providing a pathophysiological mechanism for an MDS subtype characterized by HSPA9 haploinsufficiency, and suggests hemin and other pharmacological stimulators of ISC synthesis as potential routes to therapy. PMID:26702583

  3. The SOD1 transgene expressed in erythroid cells alleviates fatal phenotype in congenic NZB/NZW-F1 mice.

    PubMed

    Otsuki, Noriyuki; Konno, Tasuku; Kurahashi, Toshihiro; Suzuki, Saori; Lee, Jaeyong; Okada, Futoshi; Iuchi, Yoshihito; Homma, Takujiro; Fujii, Junichi

    2016-07-01

    Oxidative stress due to a superoxide dismutase 1 (SOD1) deficiency causes anemia and autoimmune responses, which are phenotypically similar to autoimmune hemolytic anemia (AIHA) and systemic lupus erythematosus (SLE) in C57BL/6 mice and aggravates AIHA pathogenesis in New Zealand black (NZB) mice. We report herein on an evaluation of the role of reactive oxygen species (ROS) in a model mouse with inherited SLE, that is, F1 mice of the NZB × New Zealand white (NZW) strain. The ROS levels within red blood cells (RBCs) of the F1 mice were similar to the NZW mice but lower compared to the NZB mice throughout adult period. Regarding SLE pathogenesis, we examined the effects of an SOD1 deficiency or the overexpression of human SOD1 in erythroid cells by establishing corresponding congenic F1 mice. A SOD1 deficiency caused an elevation in ROS production, methemoglobin content, and hyperoxidation of peroxiredoxin in RBC of the F1 mice, which were all consistent with elevated oxidative stress. However, while the overexpression of human SOD1 in erythroid cells extended the life span of the congenic F1 mice, the SOD1 deficiency had no effect on life span compared to wild-type F1 mice. It is generally recognized that NZW mice possess a larval defect in the immune system and that NZB mice trigger an autoimmune reaction in the F1 mice. Our results suggest that the oxidative insult originated from the NZB mouse background has a functional role in triggering an aberrant immune reaction, leading to fatal responses in F1 mice. PMID:27080108

  4. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection.

    PubMed

    Elahi, Shokrollah; Ertelt, James M; Kinder, Jeremy M; Jiang, Tony T; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S; Qualls, Joseph E; Steinbrecher, Kris A; Kalfa, Theodosia A; Shaaban, Aimen F; Way, Sing Sing

    2013-12-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71(+) erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71(+) cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with L-arginine overrides immunosuppression. In addition, the ablation of CD71(+) cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli. However, CD71(+) cell-mediated susceptibility to infection is counterbalanced by CD71(+) cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition. Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71(+) cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that

  5. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    PubMed Central

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2014-01-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions1–7. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with l-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli8,9. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition10,11.Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that

  6. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    NASA Astrophysics Data System (ADS)

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2013-12-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with L-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition. Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that these

  7. Purely lytic osteosarcoma

    SciTech Connect

    De Santos, L.A.; Eideken, B.

    1982-11-01

    The radiographic features of 42 purely lytic osteosarcomas are presented. Purely lytic osteosarcoma is identified as a lytic lesion of bone with no demonstrable osteoid matrix by conventional radiographic modalities. Purely lytic osteosarcoma represented 13.7% of a group of 305 osteosarcomas. The most common presentation was that of a lytic illdefined lesion with a moderate to large extraosseous mass component. Nine lesions presented with benign radiographic features. The differential diagnosis is outlined. The need for awareness of this type of presentation of osteosarcoma is stressed.

  8. Science: Pure or Applied?

    ERIC Educational Resources Information Center

    Evans, Peter

    1980-01-01

    Through a description of some of the activities which take place in his science classroom, the author makes a strong case for the inclusion of technology, or applied science, rather than pure science in the primary curriculum. (KC)

  9. Pure-quartic solitons.

    PubMed

    Blanco-Redondo, Andrea; de Sterke, C Martijn; Martijn, de Sterke C; Sipe, J E; Krauss, Thomas F; Eggleton, Benjamin J; Husko, Chad

    2016-01-01

    Temporal optical solitons have been the subject of intense research due to their intriguing physics and applications in ultrafast optics and supercontinuum generation. Conventional bright optical solitons result from the interaction of anomalous group-velocity dispersion and self-phase modulation. Here we experimentally demonstrate a class of bright soliton arising purely from the interaction of negative fourth-order dispersion and self-phase modulation, which can occur even for normal group-velocity dispersion. We provide experimental and numerical evidence of shape-preserving propagation and flat temporal phase for the fundamental pure-quartic soliton and periodically modulated propagation for the higher-order pure-quartic solitons. We derive the approximate shape of the fundamental pure-quartic soliton and discover that is surprisingly Gaussian, exhibiting excellent agreement with our experimental observations. Our discovery, enabled by precise dispersion engineering, could find applications in communications, frequency combs and ultrafast lasers. PMID:26822758

  10. Pure-quartic solitons

    PubMed Central

    Blanco-Redondo, Andrea; Martijn, de Sterke C.; Sipe, J.E.; Krauss, Thomas F.; Eggleton, Benjamin J.; Husko, Chad

    2016-01-01

    Temporal optical solitons have been the subject of intense research due to their intriguing physics and applications in ultrafast optics and supercontinuum generation. Conventional bright optical solitons result from the interaction of anomalous group-velocity dispersion and self-phase modulation. Here we experimentally demonstrate a class of bright soliton arising purely from the interaction of negative fourth-order dispersion and self-phase modulation, which can occur even for normal group-velocity dispersion. We provide experimental and numerical evidence of shape-preserving propagation and flat temporal phase for the fundamental pure-quartic soliton and periodically modulated propagation for the higher-order pure-quartic solitons. We derive the approximate shape of the fundamental pure-quartic soliton and discover that is surprisingly Gaussian, exhibiting excellent agreement with our experimental observations. Our discovery, enabled by precise dispersion engineering, could find applications in communications, frequency combs and ultrafast lasers. PMID:26822758

  11. Pure-quartic solitons

    NASA Astrophysics Data System (ADS)

    Blanco-Redondo, Andrea; Martijn, De Sterke C.; Sipe, J. E.; Krauss, Thomas F.; Eggleton, Benjamin J.; Husko, Chad

    2016-01-01

    Temporal optical solitons have been the subject of intense research due to their intriguing physics and applications in ultrafast optics and supercontinuum generation. Conventional bright optical solitons result from the interaction of anomalous group-velocity dispersion and self-phase modulation. Here we experimentally demonstrate a class of bright soliton arising purely from the interaction of negative fourth-order dispersion and self-phase modulation, which can occur even for normal group-velocity dispersion. We provide experimental and numerical evidence of shape-preserving propagation and flat temporal phase for the fundamental pure-quartic soliton and periodically modulated propagation for the higher-order pure-quartic solitons. We derive the approximate shape of the fundamental pure-quartic soliton and discover that is surprisingly Gaussian, exhibiting excellent agreement with our experimental observations. Our discovery, enabled by precise dispersion engineering, could find applications in communications, frequency combs and ultrafast lasers.

  12. Geomorphology: Pure and applied

    SciTech Connect

    Hart, M.G.

    1986-01-01

    The book summarizes the history of intellectual debate in geomorphology and describes modern developments both ''pure'' and ''applied.'' The history begins well before W.M. Davis and follows through to such debates as those concerned with the Pleistocene. Modern developments in pure geomorphology are cast in terms of chapters on form, process, materials, and methods analysis. The applied chapters concentrate on environmental hazards and resources, and their management.

  13. Non-random subcellular distribution of variant EKLF in erythroid cells

    SciTech Connect

    Quadrini, Karen J.; Gruzglin, Eugenia; Bieker, James J.

    2008-04-15

    EKLF protein plays a prominent role during erythroid development as a nuclear transcription factor. Not surprisingly, exogenous EKLF quickly localizes to the nucleus. However, using two different assays we have unexpectedly found that a substantial proportion of endogenous EKLF resides in the cytoplasm at steady state in all erythroid cells examined. While EKLF localization does not appear to change during either erythroid development or terminal differentiation, we find that the protein displays subtle yet distinct biochemical and functional differences depending on which subcellular compartment it is isolated from, with PEST sequences possibly playing a role in these differences. Localization is unaffected by inhibition of CRM1 activity and the two populations are not differentiated by stability. Heterokaryon assays demonstrate that EKLF is able to shuttle out of the nucleus although its nuclear re-entry is rapid. These studies suggest there is an unexplored role for EKLF in the cytoplasm that is separate from its well-characterized nuclear function.

  14. Specific erythroid-lineage defect in mice conditionally deficient for Mediator subunit Med1.

    PubMed

    Stumpf, Melanie; Yue, Xiaojing; Schmitz, Sandra; Luche, Hervé; Reddy, Janardan K; Borggrefe, Tilman

    2010-12-14

    The Mediator complex forms the bridge between transcriptional activators and the RNA polymerase II. Med1 (also known as PBP or TRAP220) is a key component of Mediator that interacts with nuclear hormone receptors and GATA transcription factors. Here, we show dynamic recruitment of GATA-1, TFIIB, Mediator, and RNA polymerase II to the β-globin locus in induced mouse erythroid leukemia cells and in an erythropoietin-inducible hematopoietic progenitor cell line. Using Med1 conditional knockout mice, we demonstrate a specific block in erythroid development but not in myeloid or lymphoid development, highlighted by the complete absence of β-globin gene expression. Thus, Mediator subunit Med1 plays a pivotal role in erythroid development and in β-globin gene activation. PMID:21098667

  15. Non-random subcellular distribution of variant EKLF in erythroid cells.

    PubMed

    Quadrini, Karen J; Gruzglin, Eugenia; Bieker, James J

    2008-04-15

    EKLF protein plays a prominent role during erythroid development as a nuclear transcription factor. Not surprisingly, exogenous EKLF quickly localizes to the nucleus. However, using two different assays we have unexpectedly found that a substantial proportion of endogenous EKLF resides in the cytoplasm at steady state in all erythroid cells examined. While EKLF localization does not appear to change during either erythroid development or terminal differentiation, we find that the protein displays subtle yet distinct biochemical and functional differences depending on which subcellular compartment it is isolated from, with PEST sequences possibly playing a role in these differences. Localization is unaffected by inhibition of CRM1 activity and the two populations are not differentiated by stability. Heterokaryon assays demonstrate that EKLF is able to shuttle out of the nucleus although its nuclear re-entry is rapid. These studies suggest there is an unexplored role for EKLF in the cytoplasm that is separate from its well-characterized nuclear function. PMID:18329016

  16. Identification of a novel putative mitochondrial protein FAM210B associated with erythroid differentiation.

    PubMed

    Kondo, Aiko; Fujiwara, Tohru; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Nakamura, Yukio; Sawada, Kenichi; Harigae, Hideo

    2016-04-01

    The transcription factor GATA-1 plays an essential role in erythroid differentiation. To identify novel GATA-1 target genes, we analyzed a merged ChIP-seq and expression profiling dataset. We identified FAM210B as a putative novel GATA-1 target gene. Study results demonstrated that GATA-1 directly regulates FAM210B expression, presumably by binding to an intronic enhancer region. Both human and murine FAM210B are abundantly expressed in the later stages of erythroblast development. Moreover, the deduced amino acid sequence predicted that FAM210B is a membrane protein, and Western blot analysis demonstrated its mitochondrial localization. Loss-of-function analysis in erythroid cells suggested that FAM210B may be involved in erythroid differentiation. The identification and characterization of FAM210B provides new insights in the study of erythropoiesis and hereditary anemias. PMID:26968549

  17. Interleukin-6 Directly Impairs the Erythroid Development of Human TF-1 Erythroleukemic Cells

    PubMed Central

    McCranor, Bryan J.; Kim, Min Jung; Cruz, Nicole M.; Xue, Qian-Li; Berger, Alan E.; Walston, Jeremy D.; Civin, Curt I.; Roy, Cindy N.

    2013-01-01

    Anemia of inflammation or chronic disease is a highly prevalent form of anemia. The inflammatory cytokine interleukin-6 (IL-6) negatively correlates with hemoglobin concentration in many disease states. The IL-6-hepcidin antimicrobial peptide axis promotes iron-restricted anemia; however the full role of IL-6 in anemia of inflammation is not well-defined. We previously reported that chronic inflammation had a negative impact on maturation of erythroid progenitors in a mouse model. We hypothesized that IL-6 may be responsible for impaired erythropoiesis, independent of iron restriction. To test the hypothesis we utilized the human erythroleukemia TF-1 cell line to model erythroid maturation and exposed them to varying doses of IL-6 over six days. At 10 ng/ml, IL-6 significantly repressed erythropoietin-dependent TF-1 erythroid maturation. While IL-6 did not decrease the expression of genes associated with hemoglobin synthesis, we observed impaired hemoglobin synthesis as demonstrated by decreased benzidine staining. We also observed that IL-6 down regulated expression of the gene SLC4a1 which is expressed late in erythropoiesis. Those findings suggested that IL-6-dependent inhibition of hemoglobin synthesis might occur. We investigated the impact of IL-6 on mitochondria. IL-6 decreased the mitochondrial membrane potential at all treatment doses, and significantly decreased mitochondrial mass at the highest dose. Our studies indicate that IL-6 may impair mitochondrial function in maturing erythroid cells resulting in impaired hemoglobin production and erythroid maturation. Our findings may indicate a novel pathway of action for IL-6 in the anemia of inflammation, and draw attention to the potential for new therapeutic targets that affect late erythroid development. PMID:24119518

  18. miR-451 regulates zebrafish erythroid maturation in vivo via its target gata2

    PubMed Central

    Pase, Luke; Layton, Judith E.; Kloosterman, Wigard P.; Carradice, Duncan; Waterhouse, Peter M.

    2009-01-01

    We demonstrate that in zebrafish, the microRNA miR-451 plays a crucial role in promoting erythroid maturation, in part via its target transcript gata2. Zebrafish miR-144 and miR-451 are processed from a single precursor transcript selectively expressed in erythrocytes. In contrast to other hematopoietic mutants, the zebrafish mutant meunier (mnr) showed intact erythroid specification but diminished miR-144/451 expression. Although erythropoiesis initiated normally in mnr, erythrocyte maturation was morphologically retarded. Morpholino knockdown of miR-451 increased erythrocyte immaturity in wild-type embryos, and miR-451 RNA duplexes partially rescued erythroid maturation in mnr, demonstrating a requirement and role for miR-451 in erythrocyte maturation. mnr provided a selectively miR-144/451-deficient background, facilitating studies to discern miRNA function and validate candidate targets. Among computer-predicted miR-451 targets potentially mediating these biologic effects, the pro-stem cell transcription factor gata2 was an attractive candidate. In vivo reporter assays validated the predicted miR-451/gata2-3′UTR interaction, gata2 down-regulation was delayed in miR-451-knockdown and mnr embryos, and gata2 knockdown partially restored erythroid maturation in mnr, collectively confirming gata2 down-regulation as pivotal for miR-451-driven erythroid maturation. These studies define a new genetic pathway promoting erythroid maturation (mnr/miR-451/gata2) and provide a rare example of partial rescue of a mutant phenotype solely by miRNA overexpression. PMID:18849488

  19. Regulation of erythroid differentiation by miR-376a and its targets

    PubMed Central

    Wang, Fang; Yu, Jia; Yang, Gui-Hua; Wang, Xiao-Shuang; Zhang, Jun-Wu

    2011-01-01

    Lineage differentiation is a continuous process during which fated progenitor cells execute specific programs to produce mature counterparts. This lineage-restricted pathway can be controlled by particular regulators, which are usually exclusively expressed in certain cell types or at specific differentiation stages. Here we report that miR-376a participates in the regulation of the early stages of human erythropoiesis by targeting cyclin-dependent kinase 2 (CDK2) and Argonaute 2 (Ago2). Among various human leukemia cell lines, miR-376a was only detected in K562 cells which originated from a progenitor common to the erythroid and megakaryotic lineages. Enforced expression of miR-376a or silencing of CDK2 and Ago2 by RNAi inhibits erythroid differentiation of K562 cells. Hematopoietic progenitor cells transduced with miR-376a showed a significant reduction of their erythroid clonogenic capacity. MiR-376a is relatively abundant in erythroid progenitor cells, where it reduces expression of CDK2 and maintains a low level of differentiation due to cell cycle arrest and decreased cell growth. Following erythroid induction, miR-376a is significantly down-regulated and CDK2 is released from miR-376a inhibition, thereby facilitating the escape of progenitor cells from the quiescent state into erythroid differentiation. Moreover, our results establish a functional link between miR-376a and Ago2, a key factor in miRNA biogenesis and silencing pathways with novel roles in human hematopoiesis. PMID:21556037

  20. Pure uterine lipoma.

    PubMed

    Erdem, Gulnur; Celik, Onder; Karakas, Hakki Muammer; Alkan, Alpay; Hascalik, Seyma

    2007-10-01

    Lipomatous tumors of the uterus are unusual, benign neoplasms seen in postmenopausal women. Although many of the mixed-type cases such as lipoleiomyoma and fibrolipoma have been reported, pure uterine lipomas are extremely rare. In the literature, a few cases with pure uterine lipoma have been reported. We first present the advanced magnetic resonance findings of pure uterine lipoma, followed by those of ultrasonography (US) and computed tomography (CT). We markedly detected lipid peaks on the magnetic resonance spectroscopy (MRS) and the apparent diffusion coefficient value to be 0.00 due to chemical-shift effects with diffusion-weighted imaging (DWI). Although pelvic lipomatous tumors can be diagnosed with US and CT, in some cases, further workup may be required to localize the lesion. MRI may yield more valuable data for differential diagnosis. MRS and DWI findings provide additional clues on the nature of the lesion. PMID:17905250

  1. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    PubMed Central

    Mirabelli, Peppino; Di Noto, Rosa; Lo Pardo, Catia; Morabito, Paolo; Abate, Giovanna; Gorrese, Marisa; Raia, Maddalena; Pascariello, Caterina; Scalia, Giulia; Gemei, Marica; Mariotti, Elisabetta; Del Vecchio, Luigi

    2008-01-01

    Background Aldehyde dehydrogenase (ALDH) is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007). The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i) multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii) fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii) detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively). As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a). Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA). Conclusion Our study, comparing surface antigen expression of ALDH+/CD34+, ALDH

  2. Production of pure metals

    NASA Technical Reports Server (NTRS)

    Philipp, W. H.; Marsik, S. J.; May, C. E. (Inventor)

    1974-01-01

    A process for depositing elements by irradiating liquids is reported. Ultra pure elements are precipitated from aqueous solutions or suspensions of compounds. A solution of a salt of a metal to be prepared is irradiated, and the insoluble reaction product settles out. Some chemical compounds may also be prepared in this manner.

  3. Dahlbeck and Pure Ontology

    ERIC Educational Resources Information Center

    Mackenzie, Jim

    2016-01-01

    This article responds to Johan Dahlbeck's "Towards a pure ontology: Children's bodies and morality" ["Educational Philosophy and Theory," vol. 46 (1), 2014, pp. 8-23 (EJ1026561)]. His arguments from Nietzsche and Spinoza do not carry the weight he supposes, and the conclusions he draws from them about pedagogy would be…

  4. Cytoplasmic poly(A) binding protein C4 serves a critical role in erythroid differentiation.

    PubMed

    Kini, Hemant K; Kong, Jian; Liebhaber, Stephen A

    2014-04-01

    The expression of an mRNA is strongly impacted by its 3' poly(A) tail and associated poly(A)-binding proteins (PABPs). Vertebrates encode six PABP isoforms that vary in abundance, distribution, developmental control, and subcellular localization. Here we demonstrate that the minor PABP isoform PABPC4 is expressed in erythroid cells and impacts the steady-state expression of a subset of erythroid mRNAs. Motif analyses reveal a high-value AU-rich motif in the 3' untranslated regions (UTRs) of PABPC4-impacted mRNAs. This motif enhances the association of PABPC4 with mRNAs containing critically shortened poly(A) tails. This association may serve to protect a subset of mRNAs from accelerated decay. Finally, we demonstrate that selective depletion of PABPC4 in an erythroblast cell line inhibits terminal erythroid maturation with corresponding alterations in the erythroid gene expression. These observations lead us to conclude that PABPC4 plays an essential role in posttranscriptional control of a major developmental pathway. PMID:24469397

  5. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation

    PubMed Central

    Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F.

    2014-01-01

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly, many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7. PMID:25092175

  6. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  7. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  8. Regulation of alternative pre-mRNA splicing during erythroid differentiation.

    PubMed

    Hou, V C; Conboy, J G

    2001-03-01

    Although the mature enucleated erythrocyte is no longer active in nuclear processes such as pre-mRNA splicing, the function of many of its major structural proteins is dependent on alternative splicing choices made during the earlier stages of erythropoiesis. These splicing decisions fundamentally regulate many aspects of protein structure and function by governing the inclusion or exclusion of exons that encode protein interaction domains, regulatory signals, or translation initiation or termination sites. Alternative splicing events may be partially or entirely erythroid-specific, ie, distinct from the splicing patterns imposed on the same transcripts in nonerythroid cells. Moreover, differentiation stage-specific splicing "switches" may alter the structure and function of erythroid proteins in physiologically important ways as the cell is morphologically and functionally remodeled during normal differentiation. Derangements in the splicing of individual mutated pre-mRNAs can produce synthesis of truncated or unstable proteins that are responsible for numerous erythrocyte disorders. This review will summarize the salient features of regulated alternative splicing in general, review existing information concerning the widespread extent of alternative splicing among erythroid genes, and describe recent studies that are beginning to uncover the mechanisms that regulate an erythroid splicing switch in the protein 4.1R gene. PMID:11224680

  9. Ldb1-nucleated transcription complexes function as primary mediators of global erythroid gene activation.

    PubMed

    Li, LiQi; Freudenberg, Johannes; Cui, Kairong; Dale, Ryan; Song, Sang-Hyun; Dean, Ann; Zhao, Keji; Jothi, Raja; Love, Paul E

    2013-05-30

    Erythropoiesis is dependent on the lineage-specific transcription factors Gata1, Tal1, and Klf1. Several erythroid genes have been shown to require all 3 factors for their expression, suggesting that they function synergistically; however, there is little direct evidence for widespread cooperation. Gata1 and Tal1 can assemble within higher-order protein complexes (Ldb1 complexes) that include the adapter molecules Lmo2 and Ldb1. Ldb1 proteins are capable of coassociation, and long-range Ldb1-mediated oligomerization of enhancer- and promoter-bound Ldb1 complexes has been shown to be required for β-globin gene expression. In this study, we generated a genomewide map of Ldb1 complex binding sites that revealed widespread binding at erythroid genes and at known erythroid enhancer elements. Ldb1 complex binding sites frequently colocalized with Klf1 binding sites and with consensus binding motifs for other erythroid transcription factors. Transcriptomic analysis demonstrated a strong correlation between Ldb1 complex binding and Ldb1 dependency for gene expression and identified a large cohort of genes coregulated by Ldb1 complexes and Klf1. Together, these results provide a foundation for defining the mechanism and scope of Ldb1 complex activity during erythropoiesis. PMID:23610375

  10. Ldb1 complexes: the new master regulators of erythroid gene transcription.

    PubMed

    Love, Paul E; Warzecha, Claude; Li, LiQi

    2014-01-01

    Elucidation of the genetic pathways that control red blood cell development has been a central goal of erythropoiesis research over the past decade. Notably, data from several recent studies have provided new insights into the regulation of erythroid gene transcription. Transcription profiling demonstrates that erythropoiesis is mainly controlled by a small group of lineage-restricted transcription factors [Gata binding protein 1 (Gata1), T cell acute lymphocytic leukemia 1 protein (Tal1), and Erythroid Kruppel-like factor (EKLF; henceforth referred to as Klf1)]. Binding-site mapping using ChIP-Seq indicates that most DNA-bound Gata1 and Tal1 proteins are contained within higher order complexes (Ldb1 complexes) that include the nuclear adapters Ldb1 and Lmo2. Ldb1 complexes regulate Klf1, and Ldb1 complex-binding sites frequently colocalize with Klf1 at erythroid genes and cis-regulatory elements, indicating strong functional synergy between Gata1, Tal1, and Klf1. Together with new data demonstrating that Ldb1 can mediate long-range promoter-enhancer interactions, these findings provide a foundation for the first comprehensive models of the global regulation of erythroid gene transcription. PMID:24290192

  11. Cytotoxicity of quantum dots and graphene oxide to erythroid cells and macrophages

    NASA Astrophysics Data System (ADS)

    Qu, Guangbo; Wang, Xiaoyan; Wang, Zhe; Liu, Sijin; Jiang, Guibing

    2013-04-01

    Great concerns have been raised about the exposure and possible adverse influence of nanomaterials due to their wide applications in a variety of fields, such as biomedicine and daily lives. The blood circulation system and blood cells form an important barrier against invaders, including nanomaterials. However, studies of the biological effects of nanomaterials on blood cells have been limited and without clear conclusions thus far. In the current study, the biological influence of quantum dots (QDs) with various surface coating on erythroid cells and graphene oxide (GO) on macrophages was closely investigated. We found that QDs posed great damage to macrophages through intracellular accumulation of QDs coupled with reactive oxygen species generation, particularly for QDs coated with PEG-NH2. QD modified with polyethylene glycol-conjugated amine particles exerted robust inhibition on cell proliferation of J744A.1 macrophages, irrespective of apoptosis. Additionally, to the best of our knowledge, our study is the first to have demonstrated that GO could provoke apoptosis of erythroid cells through oxidative stress in E14.5 fetal liver erythroid cells and in vivo administration of GO-diminished erythroid population in spleen, associated with disordered erythropoiesis in mice.

  12. Cytoplasmic Poly(A) Binding Protein C4 Serves a Critical Role in Erythroid Differentiation

    PubMed Central

    Kini, Hemant K.; Kong, Jian

    2014-01-01

    The expression of an mRNA is strongly impacted by its 3′ poly(A) tail and associated poly(A)-binding proteins (PABPs). Vertebrates encode six PABP isoforms that vary in abundance, distribution, developmental control, and subcellular localization. Here we demonstrate that the minor PABP isoform PABPC4 is expressed in erythroid cells and impacts the steady-state expression of a subset of erythroid mRNAs. Motif analyses reveal a high-value AU-rich motif in the 3′ untranslated regions (UTRs) of PABPC4-impacted mRNAs. This motif enhances the association of PABPC4 with mRNAs containing critically shortened poly(A) tails. This association may serve to protect a subset of mRNAs from accelerated decay. Finally, we demonstrate that selective depletion of PABPC4 in an erythroblast cell line inhibits terminal erythroid maturation with corresponding alterations in the erythroid gene expression. These observations lead us to conclude that PABPC4 plays an essential role in posttranscriptional control of a major developmental pathway. PMID:24469397

  13. Probing conformational stability and dynamics of erythroid and nonerythroid spectrin: effects of urea and guanidine hydrochloride.

    PubMed

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  14. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    PubMed Central

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  15. Effects of THAP11 on Erythroid Differentiation and Megakaryocytic Differentiation of K562 Cells

    PubMed Central

    Kong, Xiang-Zhen; Yin, Rong-Hua; Ning, Hong-Mei; Zheng, Wei-Wei; Dong, Xiao-Ming; Yang, Yang; Xu, Fei-Fei; Li, Jian-Jie; Zhan, Yi-Qun; Yu, Miao; Ge, Chang-Hui; Zhang, Jian-Hong; Chen, Hui; Li, Chang-Yan; Yang, Xiao-Ming

    2014-01-01

    Hematopoiesis is a complex process regulated by sets of transcription factors in a stage-specific and context-dependent manner. THAP11 is a transcription factor involved in cell growth, ES cell pluripotency, and embryogenesis. Here we showed that THAP11 was down-regulated during erythroid differentiation but up-regulated during megakaryocytic differentiation of cord blood CD34+ cells. Overexpression of THAP11 in K562 cells inhibited the erythroid differentiation induced by hemin with decreased numbers of benzidine-positive cells and decreased mRNA levels of α-globin (HBA) and glycophorin A (GPA), and knockdown of THAP11 enhanced the erythroid differentiation. Conversely, THAP11 overexpression accelerated the megakaryocytic differentiation induced by phorbol myristate acetate (PMA) with increased percentage of CD41+ cells, increased numbers of 4N cells, and elevated CD61 mRNA levels, and THAP11 knockdown attenuated the megakaryocytic differentiation. The expression levels of transcription factors such as c-Myc, c-Myb, GATA-2, and Fli1 were changed by THAP11 overexpression. In this way, our results suggested that THAP11 reversibly regulated erythroid and megakaryocytic differentiation. PMID:24637716

  16. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin

    PubMed Central

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J.; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F.; Psathaki, Olympia E.; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R.; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34+ hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34+ hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34+ hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34+ cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. PMID:25326431

  17. Id2 intrinsically regulates lymphoid and erythroid development via interaction with different target proteins

    PubMed Central

    Ji, Ming; Li, Huajie; Suh, Hyung Chan; Klarmann, Kimberly D.; Yokota, Yoshifumi

    2008-01-01

    Inhibitors of DNA binding (Id) family members are key regulators of cellular differentiation and proliferation. These activities are related to the ability of Id proteins to antagonize E proteins and other transcription factors. As negative regulators of E proteins, Id proteins have been implicated in lymphocyte development. Overexpression of Id1, Id2, or Id3 has similar effects on lymphocyte development. However, which Id protein plays a physiologic role during lymphocyte development is not clear. By analyzing Id2 knock-out mice and retroviral transduced hematopoietic progenitors, we demonstrated that Id2 is an intrinsic negative regulator of B-cell development. Hematopoietic progenitor cells overexpressing Id2 did not reconstitute B-cell development in vivo, which resembled the phenotype of E2A null mice. The B-cell population in bone marrow was significantly expanded in Id2 knock-out mice compared with their wild-type littermates. Knock-down of Id2 by shRNA in hematopoietic progenitor cells promoted B-cell differentiation and induced the expression of B-cell lineage–specific genes. These data identified Id2 as a physiologically relevant regulator of E2A during B lymphopoiesis. Furthermore, we identified a novel Id2 function in erythroid development. Overexpression of Id2 enhanced erythroid development, and decreased level of Id2 impaired normal erythroid development. Id2 regulation of erythroid development is mediated via interacting with transcription factor PU.1 and modulating PU.1 and GATA-1 activities. We conclude that Id2 regulates lymphoid and erythroid development via interaction with different target proteins. PMID:18523151

  18. Leukemia-induced bone marrow depression: effects of gangliosides on erythroid cell production.

    PubMed

    Sietsma, H; Kamps, W A; Dontje, B; Hendriks, D; Kok, J W; Vellenga, E; Nijhof, W

    1999-07-01

    Bone marrow depression is a common feature in hematological malignancies or other bone marrow-involving cancers. The mechanism of this hemopoietic suppression resulting in pancytopenia and especially anemia has not been elucidated. Gangliosides can be shed by cancer cells. Therefore, we investigated the effects of exogenously added gangliosides on erythropoiesis in a human and murine in vitro system. A dose-dependent inhibition of murine colony-forming-unit-erythroid (CFU-E) and burst-forming-unit-erythroid (BFU-E) colony growth was observed. Furthermore the maturation of BFU-Es into CFU-Es was inhibited. The inhibition by gangliosides was not abolished by increasing the dose of erythropoietin (10 U/ml). FACS-analysis studies with human CD34+ cells cultured with gangliosides (GM3), erythropoietin (EPO) and stem cell factor (SCF) demonstrated a strong inhibition on cell growth. This resulted in a significantly higher percentage of immature cells (CD34+/GpA-, 24% vs. 3%), and a lower percentage of mature erythroid cells (CD34-/GpA+, 36% vs. 89%). Under these circumstances the effects on erythroid cell growth were much higher than on other cell lineages. The inhibitory effect of gangliosides isolated from acute lymphoblastic leukemic patients on in vitro erythropoiesis suggests that in vivo hemopoietic suppression might have its origin in the gangliosides present and probably shed by the malignant cells in the microenvironment and plasma. Our results show that gangliosides inhibit erythropoiesis in vitro at several stages of development, by a mechanism involving modulation of the maturation of erythroid cells. PMID:10360826

  19. Methylation of alpha-type embryonic globin gene alpha pi represses transcription in primary erythroid cells.

    PubMed

    Singal, Rakesh; vanWert, Jane M; Ferdinand, Larry

    2002-12-01

    The inverse relationship between expression and methylation of beta-type globin genes is well established. However, little is known about the relationship between expression and methylation of avian alpha-type globin genes. The embryonic alpha(pi)-globin promoter was unmethylated, and alpha(pi)-globin RNA was easily detected in 5-day chicken erythroid cells. A progressive methylation of the CpG dinucleotides in the alpha(pi) promoter associated with loss of expression of alpha(pi)-globin gene was seen during development in primary erythroid cells. A 315-bp alpha(pi)-globin promoter region was cloned in an expression construct (alpha(pi)pGL3E) containing a luciferase reporter gene and SV40 enhancer. The alpha(pi)pGL3E construct was transfected into primary erythroid cells derived from 5-day-old chicken embryos. Methylation of alpha(pi)pGL3E plasmid and alpha(pi)-globin promoter alone resulted in a 20-fold and 7-fold inhibition of expression, respectively. The fully methylated but not the unmethylated 315-bp alpha(pi)-globin gene promoter fragment formed a methyl cytosine-binding protein complex (MeCPC). Chromatin immunoprecipitation assays were combined with quantitative real-time polymerase chain reaction to assess histone acetylation associated with the alpha(pi)-globin gene promoter. Slight hyperacetylation of histone H3 but a marked hyperacetylation of histone H4 was seen in 5-day when compared with 14-day erythroid cells. These results demonstrate that methylation can silence transcription of an avian alpha-type embryonic globin gene in homologous primary erythroid cells, possibly by interacting with an MeCPC and histone deacetylase complex. PMID:12393573

  20. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    SciTech Connect

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  1. Pure Lovelock Kasner metrics

    NASA Astrophysics Data System (ADS)

    Camanho, Xián O.; Dadhich, Naresh; Molina, Alfred

    2015-09-01

    We study pure Lovelock vacuum and perfect fluid equations for Kasner-type metrics. These equations correspond to a single Nth order Lovelock term in the action in d=2N+1,2N+2 dimensions, and they capture the relevant gravitational dynamics when aproaching the big-bang singularity within the Lovelock family of theories. Pure Lovelock gravity also bears out the general feature that vacuum in the critical odd dimension, d=2N+1, is kinematic, i.e. we may define an analogue Lovelock-Riemann tensor that vanishes in vacuum for d=2N+1, yet the Riemann curvature is non-zero. We completely classify isotropic and vacuum Kasner metrics for this class of theories in several isotropy types. The different families can be characterized by means of certain higher order 4th rank tensors. We also analyze in detail the space of vacuum solutions for five- and six dimensional pure Gauss-Bonnet theory. It possesses an interesting and illuminating geometric structure and symmetries that carry over to the general case. We also comment on a closely related family of exponential solutions and on the possibility of solutions with complex Kasner exponents. We show that the latter imply the existence of closed timelike curves in the geometry.

  2. 7 CFR 917.8 - Pure grower or pure producer.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE FRESH PEARS AND PEACHES GROWN IN CALIFORNIA Order Regulating Handling Definitions § 917.8 Pure grower or pure producer. (a) For peaches,...

  3. 7 CFR 917.8 - Pure grower or pure producer.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE FRESH PEARS AND PEACHES GROWN IN CALIFORNIA Order Regulating Handling Definitions § 917.8 Pure grower or pure producer. (a) For peaches,...

  4. Follistatin-like 1 attenuates differentiation and survival of erythroid cells through Smad2/3 signaling.

    PubMed

    Wu, Jianping; Dong, Yingying; Teng, Xiaomei; Cheng, Maohua; Shen, Zhenya; Chen, Weiqian

    2015-10-30

    Hematopoiesis is a complex process tightly controlled by sets of transcription factors in a context-dependent and stage-specific manner. Smad2/3 transcription factor plays a central role in differentiation and survival of erythroid cells. Here we report that follistatin-like 1 (FSTL1) treatment impairs hemin-induced erythroid differentiation and cell survival. FSTL1 differentially regulates transforming growth factor beta (TGF-β) and bone morphogenetic protein (BMP) signaling. Blockade of Smad2/3 signaling with the ALK5/type I TGF-βR kinase inhibitor, SB-525334, was efficacious for rescue of erythroid differentiation blockage and apoptosis. Reversely, activation of Smad1/5/8 signaling with BMP4 cannot rescue FSTL1-mediated erythroid differentiation blockage and apoptosis. Collectively, these data provide mechanistic insight into the regulation of erythropoiesis by FSTL1 signaling and lay a foundation for exploring FSTL1 signaling as a therapeutic target for anemia. PMID:26365350

  5. A qualitative and quantitative cytochemical assay of dihydrofolate reductase in erythroid cells.

    PubMed

    Nano, R; Gerzeli, G; Invernizzi, R; Supino, R

    1989-01-01

    The distribution and intensity of dihydrofolate reductase (DHFR) cytochemically demonstrable was studied in erythroid cells. Cells of normal human bone marrow, of human erythroleukaemia (M6), and cells of the Friend (MEL) clone 745A murine erythroleukaemia (also after differentiation with dimethylsulphoxide, DMSO) were stained according to Gerzeli and de Piceis Polver (1969) technique; quantification of the reaction product was made using a Vickers M86 microdensitometer. The enzyme activity progressively decreased during the normal differentiation of the erythropoietic series while persisted at high levels in erythroleukaemia cells. It can be suggested that in the 1st case, the cytochemical pattern of dihydrofolate reductase may be a useful added tool for studying the erythroid differentiation. In the 2nd case, the increased level of this enzyme may be related to an amplification of the gene of DHFR in the malignant transformation. PMID:2496572

  6. The presence of erythroid cells in the thymus gland of man.

    PubMed Central

    Kendall, M D; Singh, J

    1980-01-01

    Biopsies of the right lobe of normal thymus glands without signs of neoplasia or germinal centre formation from 35 patients ranging in age from 20 to 60 years of age, and from 3 children aged 6, 7 and 12, showed on electron microscopic examination of the material from 14 patients that in 12 cases erythroid cells of all stages of development past the beginning of haemoglobinisation were present in some degree. Earlier erythroid cells could not be identified on morphological grounds with certainty, but cells which could have been lymphoblasts, proerythroblasts and stem cell were all observed. A section of a megakaryocyte was seen in one thymus. The importance of erythropoiesis within the thymus gland is briefly discussed. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7364659

  7. Biochemical measurements on single erythroid progenitor cells shed light on the combinatorial regulation of red blood cell production.

    PubMed

    Wang, Weijia; Akbarian, Vahe; Audet, Julie

    2013-02-01

    Adult bone marrow (BM) erythrocyte colony-forming units (CFU-Es) are important cellular targets for the treatment of anemia and also for the manufacture of red blood cells (RBCs) ex vivo. We obtained quantitative biochemical measurements from single and small numbers of CFU-Es by isolating and analyzing c-Kit(+)CD71(high)Ter119(-) cells from adult mouse BM and this allowed us to identify two mechanisms that can be manipulated to increase RBC production. As expected, maximum RBC output was obtained when CFU-Es were stimulated with a combination of Stem Cell Factor (SCF) and Erythropoietin (EPO) mainly because SCF supports a transient CFU-E expansion and EPO promotes the survival and terminal differentiation of erythroid progenitors. However, we found that one of the main factors limiting the output in RBCs was that EPO induces a downregulation of c-Kit expression which limits the transient expansion of CFU-Es. In the presence of SCF, the EPO-mediated downregulation of c-Kit on CFU-Es is delayed but still significant. Moreover, treatment of CFU-Es with 1-Naphthyl PP1 could partially inhibit the downregulation of c-Kit induced by EPO, suggesting that this process is dependent on a Src family kinase, v-Src and/or c-Fyn. We also found that CFU-E survival and proliferation was dependent on the level of time-integrated extracellular-regulated kinase (ERK) activation in these cells, all of which could be significantly increased when SCF and EPO were combined with mouse fetal liver-derived factors. Taken together, these results suggest two novel molecular strategies to increase RBC production and regeneration. PMID:23168618

  8. TRAIL regulates normal erythroid maturation through an ERK-dependent pathway.

    PubMed

    Secchiero, Paola; Melloni, Elisabetta; Heikinheimo, Markku; Mannisto, Susanna; Di Pietro, Roberta; Iacone, Antonio; Zauli, Giorgio

    2004-01-15

    In order to investigate the biologic activity of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) on human erythropoiesis, glycophorin A (GPA)+ erythroid cells were generated in serum-free liquid phase from human cord blood (CB) CD34+ progenitor cells. The surface expression of TRAIL-R1 was weakly detectable in the early-intermediate phase of erythroid differentiation (days 4-6; dim-intermediate GPA expression), whereas a clear-cut expression of TRAIL-R2 was observed through the entire course of erythroid differentiation (up to days 12-14; bright GPA expression). On the other hand, surface TRAIL-R3 and -R4 were not detected at any culture time. Besides inducing a rapid but small increase of apoptotic cell death, which was abrogated by the pan-caspase inhibitor z-VAD-fmk, the addition of recombinant TRAIL at day 6 of culture inhibited the generation of morphologically mature erythroblasts. Among the intracellular pathways investigated, TRAIL significantly stimulated the extracellular signal-regulated kinase 1/2 (ERK1/2) but not the p38/mitogen-activated protein kinase (MAPK) or the c-Jun NH2-terminal kinase (JNK) pathway. Consistently with a key role of ERK1/2 in mediating the negative effects of TRAIL on erythroid maturation, PD98059, a pharmacologic inhibitor of the ERK pathway, but not z-VAD-fmk or SB203580, a pharmacologic inhibitor of p38/MAPK, reverted the antidifferentiative effect of TRAIL on CB-derived erythroblasts. PMID:12969966

  9. RHEX, a novel regulator of human erythroid progenitor cell expansion and erythroblast development.

    PubMed

    Verma, Rakesh; Su, Su; McCrann, Donald J; Green, Jennifer M; Leu, Karen; Young, Peter R; Schatz, Peter J; Silva, Jeffrey C; Stokes, Matthew P; Wojchowski, Don M

    2014-08-25

    Ligation of erythropoietin (EPO) receptor (EPOR) JAK2 kinase complexes propagates signals within erythroid progenitor cells (EPCs) that are essential for red blood cell production. To reveal hypothesized novel EPOR/JAK2 targets, a phosphotyrosine (PY) phosphoproteomics approach was applied. Beyond known signal transduction factors, 32 new targets of EPO-modulated tyrosine phosphorylation were defined. Molecular adaptors comprised one major set including growth factor receptor-bound protein 2 (GRB2)-associated binding proteins 1-3 (GAB1-3), insulin receptor substrate 2 (IRS2), docking protein 1 (DOK1), Src homology 2 domain containing transforming protein 1 (SHC1), and sprouty homologue 1 (SPRY1) as validating targets, and SPRY2, SH2 domain containing 2A (SH2D2A), and signal transducing adaptor molecule 2 (STAM2) as novel candidate adaptors together with an ORF factor designated as regulator of human erythroid cell expansion (RHEX). RHEX is well conserved in Homo sapiens and primates but absent from mouse, rat, and lower vertebrate genomes. Among tissues and lineages, RHEX was elevated in EPCs, occurred as a plasma membrane protein, was rapidly PY-phosphorylated >20-fold upon EPO exposure, and coimmunoprecipitated with the EPOR. In UT7epo cells, knockdown of RHEX inhibited EPO-dependent growth. This was associated with extracellular signal-regulated kinase 1,2 (ERK1,2) modulation, and RHEX coupling to GRB2. In primary human EPCs, shRNA knockdown studies confirmed RHEX regulation of erythroid progenitor expansion and further revealed roles in promoting the formation of hemoglobinizing erythroblasts. RHEX therefore comprises a new EPO/EPOR target and regulator of human erythroid cell expansion that additionally acts to support late-stage erythroblast development. PMID:25092874

  10. Regulatory elements of the EKLF gene that direct erythroid cell-specific expression during mammalian development.

    PubMed

    Xue, Li; Chen, Xiaoyong; Chang, Yanjie; Bieker, James J

    2004-06-01

    Erythroid Krüppel-like factor (EKLF) plays an essential role in enabling beta-globin expression during erythroid ontogeny. It is first expressed in the extraembryonic mesoderm of the yolk sac within the morphologically unique cells that give rise to the blood islands, and then later within the hepatic primordia. The BMP4/Smad pathway plays a critical role in the induction of EKLF, and transient transfection analyses demonstrate that sequences located within less than 1 kb of its transcription initiation site are sufficient for high-level erythroid-specific transcription. We have used transgenic analyses to verify that 950 bp located adjacent to the EKLF start site of transcription is sufficient to generate lacZ expression within the blood islands as well as the fetal liver during embryonic development. Of particular importance are 3 regions, 2 of which overlap endogenous erythroid-specific DNase hypersensitive sites, and 1 of which includes the proximal promoter region. The onset of transgene expression mimics that of endogenous EKLF as it begins by day 7.5 (d7.5) to d8.0. In addition, it exhibits a strict hematopoietic specificity, localized only to these cells and not to the adjacent vasculature at all stages examined. Finally, expression is heterocellular, implying that although these elements are sufficient for tissue-specific expression, they do not shield against the position effects of adjacent chromatin. These analyses demonstrate that a surprisingly small DNA segment contains all the information needed to target a linked gene to the hematopoietic compartment at both early and later stages of development, and may be a useful cassette for this purpose. PMID:14764531

  11. The DNA binding factor Hmg20b is a repressor of erythroid differentiation

    PubMed Central

    Esteghamat, Fatemehsadat; van Dijk, Thamar Bryn; Braun, Harald; Dekker, Sylvia; van der Linden, Reinier; Hou, Jun; Fanis, Pavlos; Demmers, Jeroen; van IJcken, Wilfred; Özgür, Zeliha; Horos, Rastislav; Pourfarzad, Farzin; von Lindern, Marieke; Philipsen, Sjaak

    2011-01-01

    Background In erythroblasts, the CoREST repressor complex is recruited to target promoters by the transcription factor Gfi1b, leading to repression of genes mainly involved in erythroid differentiation. Hmg20b is a subunit of CoREST, but its role in erythropoiesis has not yet been established. Design and Methods To study the role of Hmg20b in erythropoiesis, we performed knockdown experiments in a differentiation-competent mouse fetal liver cell line, and in primary mouse fetal liver cells. The effects on globin gene expression were determined. We used microarrays to investigate global gene expression changes induced by Hmg20b knockdown. Functional analysis was carried out on Hrasls3, an Hmg20b target gene. Results We show that Hmg20b depletion induces spontaneous differentiation. To identify the target genes of Hmg20b, microarray analysis was performed on Hmg20b knockdown cells and controls. In line with its association to the CoREST complex, we found that 85% (527 out of 620) of the deregulated genes are up-regulated when Hmg20b levels are reduced. Among the few down-regulated genes was Gfi1b, a known repressor of erythroid differentiation. Among the consistently up-regulated targets were embryonic β-like globins and the phospholipase HRAS-like suppressor 3 (Hrasls3). We show that Hrasls3 expression is induced during erythroid differentiation and that knockdown of Hrasls3 inhibits terminal differentiation of proerythroblasts. Conclusions We conclude that Hmg20b acts as an inhibitor of erythroid differentiation, through the down-regulation of genes involved in differentiation such as Hrasls3, and activation of repressors of differentiation such as Gfi1b. In addition, Hmg20b suppresses embryonic β-like globins. PMID:21606163

  12. The Effect of Mir-451 Upregulation on Erythroid Lineage Differentiation of Murine Embryonic Stem Cells

    PubMed Central

    Obeidi, Narges; Pourfathollah, Ali Akbar; Soleimani, Masoud; Nikougoftar Zarif, Mahin; Kouhkan, Fatemeh

    2016-01-01

    Objective MicroRNAs (miRNAs) are small endogenous non-coding regulatory RNAs that control mRNAs post-transcriptionally. Several mouse stem cells miRNAs are cloned differentially regulated in different hematopoietic lineages, suggesting their possible role in hematopoietic lineage differentiation. Recent studies have shown that specific miRNAs such as Mir-451 have key roles in erythropoiesis. Materials and Methods In this experimental study, murine embryonic stem cells (mESCs) were infected with lentiviruses containing pCDH-Mir-451. Erythroid differentiation was assessed based on the expression level of transcriptional factors (Gata-1, Klf-1, Epor) and hemoglobin chains (α, β, γ , ε and ζ) genes using quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and presence of erythroid surface antigens (TER-119 and CD235a) using flow cytometery. Colony-forming unit (CFU) assay was also on days 14thand 21thafter transduction. Results Mature Mir-451 expression level increased by 3.434-fold relative to the untreated mESCs on day 4 after transduction (P<0.001). Mir-451 up-regulation correlated with the induction of transcriptional factor (Gata-1, Klf-1, Epor) and hemoglobin chain (α, β, γ, ε and ζ) genes in mESCs (P<0.001) and also showed a strong correlation with presence of CD235a and Ter- 119 markers in these cells (13.084and 13.327-fold increse, respectively) (P<0.05). Moreover, mESCs treated with pCDH-Mir-451 showed a significant raise in CFU-erythroid (CFU-E) colonies (5.2-fold) compared with untreated control group (P<0.05). Conclusion Our results showed that Mir-451 up-regulation strongly induces erythroid differentiation and maturation of mESCs. Overexpression of Mir-451 may have the potential to produce artificial red blood cells (RBCs) without the presence of any stimulatory cytokines. PMID:27540521

  13. Reduced DOCK4 expression leads to erythroid dysplasia in myelodysplastic syndromes

    PubMed Central

    Sundaravel, Sriram; Duggan, Ryan; Bhagat, Tushar; Ebenezer, David L.; Liu, Hui; Yu, Yiting; Bartenstein, Matthias; Unnikrishnan, Madhu; Karmakar, Subhradip; Liu, Ting-Chun; Torregroza, Ingrid; Quenon, Thomas; Anastasi, John; McGraw, Kathy L.; Pellagatti, Andrea; Boultwood, Jacqueline; Yajnik, Vijay; Artz, Andrew; Le Beau, Michelle M.; Steidl, Ulrich; List, Alan F.; Evans, Todd; Verma, Amit; Wickrema, Amittha

    2015-01-01

    Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator of cytokinesis 4 (DOCK4) is a GTPase exchange factor, and its gene maps to the commonly deleted 7q region. We demonstrate that DOCK4 is underexpressed in MDS bone marrow samples and that the reduced expression is associated with decreased overall survival in patients. We show that depletion of DOCK4 levels leads to erythroid cells with dysplastic morphology both in vivo and in vitro. We established a novel single-cell assay to quantify disrupted F-actin filament network in erythroblasts and demonstrate that reduced expression of DOCK4 leads to disruption of the actin filaments, resulting in erythroid dysplasia that phenocopies the red blood cell (RBC) defects seen in samples from MDS patients. Reexpression of DOCK4 in −7q MDS patient erythroblasts resulted in significant erythropoietic improvements. Mechanisms underlying F-actin disruption revealed that DOCK4 knockdown reduces ras-related C3 botulinum toxin substrate 1 (RAC1) GTPase activation, leading to increased phosphorylation of the actin-stabilizing protein ADDUCIN in MDS samples. These data identify DOCK4 as a putative 7q gene whose reduced expression can lead to erythroid dysplasia. PMID:26578796

  14. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

    PubMed Central

    Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  15. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies.

    PubMed

    Amanatiadou, Elsa P; Papadopoulos, Giorgio L; Strouboulis, John; Vizirianakis, Ioannis S

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  16. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  17. FOG-1 and GATA-1 act sequentially to specify definitive megakaryocytic and erythroid progenitors

    PubMed Central

    Mancini, Elena; Sanjuan-Pla, Alejandra; Luciani, Luisa; Moore, Susan; Grover, Amit; Zay, Agnes; Rasmussen, Kasper D; Luc, Sidinh; Bilbao, Daniel; O'Carroll, Donal; Jacobsen, Sten Eirik; Nerlov, Claus

    2012-01-01

    The transcription factors that control lineage specification of haematopoietic stem cells (HSCs) have been well described for the myeloid and lymphoid lineages, whereas transcriptional control of erythroid (E) and megakaryocytic (Mk) fate is less understood. We here use conditional removal of the GATA-1 and FOG-1 transcription factors to identify FOG-1 as required for the formation of all committed Mk- and E-lineage progenitors, whereas GATA-1 was observed to be specifically required for E-lineage commitment. FOG-1-deficient HSCs and preMegEs, the latter normally bipotent for the Mk and E lineages, underwent myeloid transcriptional reprogramming, and formed myeloid, but not erythroid and megakaryocytic cells in vitro. These results identify FOG-1 and GATA-1 as required for formation of bipotent Mk/E progenitors and their E-lineage commitment, respectively, and show that FOG-1 mediates transcriptional Mk/E programming of HSCs as well as their subsequent Mk/E-lineage commitment. Finally, C/EBPs and FOG-1 exhibited transcriptional cross-regulation in early myelo-erythroid progenitors making their functional antagonism a potential mechanism for separation of the myeloid and Mk/E lineages. PMID:22068055

  18. Reduced DOCK4 expression leads to erythroid dysplasia in myelodysplastic syndromes.

    PubMed

    Sundaravel, Sriram; Duggan, Ryan; Bhagat, Tushar; Ebenezer, David L; Liu, Hui; Yu, Yiting; Bartenstein, Matthias; Unnikrishnan, Madhu; Karmakar, Subhradip; Liu, Ting-Chun; Torregroza, Ingrid; Quenon, Thomas; Anastasi, John; McGraw, Kathy L; Pellagatti, Andrea; Boultwood, Jacqueline; Yajnik, Vijay; Artz, Andrew; Le Beau, Michelle M; Steidl, Ulrich; List, Alan F; Evans, Todd; Verma, Amit; Wickrema, Amittha

    2015-11-17

    Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator of cytokinesis 4 (DOCK4) is a GTPase exchange factor, and its gene maps to the commonly deleted 7q region. We demonstrate that DOCK4 is underexpressed in MDS bone marrow samples and that the reduced expression is associated with decreased overall survival in patients. We show that depletion of DOCK4 levels leads to erythroid cells with dysplastic morphology both in vivo and in vitro. We established a novel single-cell assay to quantify disrupted F-actin filament network in erythroblasts and demonstrate that reduced expression of DOCK4 leads to disruption of the actin filaments, resulting in erythroid dysplasia that phenocopies the red blood cell (RBC) defects seen in samples from MDS patients. Reexpression of DOCK4 in -7q MDS patient erythroblasts resulted in significant erythropoietic improvements. Mechanisms underlying F-actin disruption revealed that DOCK4 knockdown reduces ras-related C3 botulinum toxin substrate 1 (RAC1) GTPase activation, leading to increased phosphorylation of the actin-stabilizing protein ADDUCIN in MDS samples. These data identify DOCK4 as a putative 7q gene whose reduced expression can lead to erythroid dysplasia. PMID:26578796

  19. Effects of p38 MAP kinase inhibitors on the differentiation and maturation of erythroid progenitors.

    PubMed

    Dalmas, Deidre A; Tierney, Lauren A; Zhang, Cindy; Narayanan, Padma K; Boyce, Rogely W; Schwartz, Lester W; Frazier, Kendall S; Scicchitano, Marshall S

    2008-12-01

    In rodents, p38 MAP kinase inhibitors (p38is) induce bone marrow hypocellularity and reduce reticulocyte and erythrocyte counts. To identify target cell populations affected, a differentiating primary liquid erythroid culture system using sca-1(+)cells from mouse bone marrow was developed and challenged with p38is SB-203580, SB-226882, and SB-267030. Drug-related alterations in genes involved at different stages of erythropoiesis, cell-surface antigen expression (CSAE), burst-forming unit erythroid (BFU-E) colony formation, and cellular morphology (CM), growth (CG), and viability were evaluated. CSAE, CM, and decreases in BFU-E formation indicated delayed maturation, while CG and viability were unaffected. Terminal differentiation was delayed until day 14 versus day 7 in controls. CSAE demonstrated higher percentages of sca-1(+)cells after day 2 and reduced percentages of ter119(+) cells after day 7 in all treated cultures. Real-time reverse transcriptase polymerase chain reaction revealed a transient delay in expression of genes involved at early, intermediate, and late stages of erythropoiesis, followed by rebound expression at later time points. Results demonstrate p38is do not irreversibly inhibit erythrogenesis but induce a potency-dependent, transient delay in erythropoietic activity. The delay in activity is suggestive of effects on sca-1(+)bone marrow cells caused by alterations in expression of genes related to erythroid commitment and differentiation resulting in delayed maturation. PMID:19126791

  20. Regulation of GATA factor expression is distinct between erythroid and mast cell lineages.

    PubMed

    Ohmori, Shin'ya; Takai, Jun; Ishijima, Yasushi; Suzuki, Mikiko; Moriguchi, Takashi; Philipsen, Sjaak; Yamamoto, Masayuki; Ohneda, Kinuko

    2012-12-01

    The zinc finger transcription factors GATA1 and GATA2 participate in mast cell development. Although the expression of these factors is regulated in a cell lineage-specific and differentiation stage-specific manner, their regulation during mast cell development has not been clarified. Here, we show that the GATA2 mRNA level was significantly increased while GATA1 was maintained at low levels during the differentiation of mast cells derived from mouse bone marrow (BMMCs). Unlike in erythroid cells, forced expression or small interfering RNA (siRNA)-mediated knockdown of GATA1 rarely affected GATA2 expression, and vice versa, in mast cells, indicating the absence of cross-regulation between Gata1 and Gata2 genes. Chromatin immunoprecipitation assays revealed that both GATA factors bound to most of the conserved GATA sites of Gata1 and Gata2 loci in BMMCs. However, the GATA1 hematopoietic enhancer (G1HE) of the Gata1 gene, which is essential for GATA1 expression in erythroid and megakaryocytic lineages, was bound only weakly by both GATA factors in BMMCs. Furthermore, transgenic-mouse reporter assays revealed that the G1HE is not essential for reporter expression in BMMCs and peritoneal mast cells. Collectively, these results demonstrate that the expression of GATA factors in mast cells is regulated in a manner quite distinct from that in erythroid cells. PMID:22988301

  1. Control of developmentally primed erythroid genes by combinatorial co-repressor actions

    PubMed Central

    Stadhouders, Ralph; Cico, Alba; Stephen, Tharshana; Thongjuea, Supat; Kolovos, Petros; Baymaz, H. Irem; Yu, Xiao; Demmers, Jeroen; Bezstarosti, Karel; Maas, Alex; Barroca, Vilma; Kockx, Christel; Ozgur, Zeliha; van Ijcken, Wilfred; Arcangeli, Marie-Laure; Andrieu-Soler, Charlotte; Lenhard, Boris; Grosveld, Frank; Soler, Eric

    2015-01-01

    How transcription factors (TFs) cooperate within large protein complexes to allow rapid modulation of gene expression during development is still largely unknown. Here we show that the key haematopoietic LIM-domain-binding protein-1 (LDB1) TF complex contains several activator and repressor components that together maintain an erythroid-specific gene expression programme primed for rapid activation until differentiation is induced. A combination of proteomics, functional genomics and in vivo studies presented here identifies known and novel co-repressors, most notably the ETO2 and IRF2BP2 proteins, involved in maintaining this primed state. The ETO2–IRF2BP2 axis, interacting with the NCOR1/SMRT co-repressor complex, suppresses the expression of the vast majority of archetypical erythroid genes and pathways until its decommissioning at the onset of terminal erythroid differentiation. Our experiments demonstrate that multimeric regulatory complexes feature a dynamic interplay between activating and repressing components that determines lineage-specific gene expression and cellular differentiation. PMID:26593974

  2. p73 Plays a Role in Erythroid Differentiation through GATA1 Induction*

    PubMed Central

    Marqués-García, Fernando; Ferrandiz, Nuria; Fernández-Alonso, Rosalía; González-Cano, Laura; Herreros-Villanueva, Marta; Rosa-Garrido, Manuel; Fernández-García, Belén; Vaque, José P.; Marqués, Margarita M.; Alonso, María Eugenia; Segovia, José Carlos; León, Javier; Marín, María C.

    2009-01-01

    The TP73 gene gives rise to transactivation domain-p73 isoforms (TAp73) as well as ΔNp73 variants with a truncated N terminus. Although TAp73α and -β proteins are capable of inducing cell cycle arrest, apoptosis, and differentiation, ΔNp73 acts in many cell types as a dominant-negative repressor of p53 and TAp73. It has been proposed that p73 is involved in myeloid differentiation, and its altered expression is involved in leukemic degeneration. However, there is little evidence as to which p73 variants (TA or ΔN) are expressed during differentiation and whether specific p73 isoforms have the capacity to induce, or hinder, this differentiation in leukemia cells. In this study we identify GATA1 as a direct transcriptional target of TAp73α. Furthermore, TAp73α induces GATA1 activity, and it is required for erythroid differentiation. Additionally, we describe a functional cooperation between TAp73 and ΔNp73 in the context of erythroid differentiation in human myeloid cells, K562 and UT-7. Moreover, the impaired expression of GATA1 and other erythroid genes in the liver of p73KO embryos, together with the moderated anemia observed in p73KO young mice, suggests a physiological role for TP73 in erythropoiesis. PMID:19509292

  3. Pure Autonomic Failure.

    PubMed

    Thaisetthawatkul, Pariwat

    2016-08-01

    Pure autonomic failure (PAF) is a rare sporadic neurodegenerative autonomic disorder characterized by slowly progressive pan autonomic failure without other features of neurologic dysfunctions. The main clinical symptoms result from neurogenic orthostatic hypotension and urinary and gastrointestinal autonomic dysfunctions. Autonomic failure in PAF is caused by neuronal degeneration of pre- and postganglionic sympathetic and parasympathetic neurons in the thoracic spinal cord and paravertebral autonomic ganglia. The presence of Lewy bodies and α-synuclein deposits in these neural structures suggests that PAF is one of Lewy body synucleinopathies, examples of which include multiple system atrophy, Parkinson disease, and Lewy body disease. There is currently no specific treatment to stop progression in PAF. Management of autonomic symptoms is the mainstay of treatment and includes management of orthostatic hypotension and supine hypertension. The prognosis for survival of PAF is better than for the other synucleinopathies. PMID:27338613

  4. Pure autonomic failure.

    PubMed

    Garland, Emily M; Hooper, William B; Robertson, David

    2013-01-01

    A 1925 report by Bradbury and Eggleston first described patients with extreme orthostatic hypotension and a low, steady heart rate. Evidence accumulated over the next two decades that patients with orthostatic hypotension include those with pure autonomic failure (PAF), characterized by isolated peripheral autonomic dysfunction and decreased norepinephrine synthesis; multiple system atrophy (MSA) with symptoms of a central Parkinson-like syndrome and normal resting plasma norepinephrine; and Parkinson's disease (PD), with lesions in postganglionic noradrenergic neurons and signs of autonomic dysfunction. All three disorders are classified as α-synucleinopathies. Insoluble deposits of α-synuclein are found in glia in MSA, whereas they take the form of neuronal cytoplasmic inclusions called Lewy bodies in PAF and PD. The exact relationship between α-synuclein deposits and the pathology remains undetermined. PAF occurs sporadically, and progresses slowly with a relatively good prognosis. However, it has been proposed that some cases of PAF may develop a central neurodegenerative disorder. Differentiation between PAF, MSA, and PD with autonomic failure can be facilitated by a number of biochemical and functional tests and by imaging studies. Cardiac sympathetic innervation is generally intact in MSA but decreased or absent in Parkinson's disease with autonomic failure and PAF. Treatment of PAF is directed at relieving symptoms with nonpharmacological interventions and with medications producing volume expansion and vasoconstriction. Future studies should focus on determining the factors that lead to central rather than solely peripheral neurodegeneration. PMID:24095130

  5. Erythroid-specific activity of the glycophorin B promoter requires GATA-1 mediated displacement of a repressor.

    PubMed Central

    Rahuel, C; Vinit, M A; Lemarchandel, V; Cartron, J P; Roméo, P H

    1992-01-01

    We have performed a detailed analysis of the cis-acting sequences involved in the erythroid-specific expression of the human glycophorin B (GPB) promoter and found that this promoter could be divided into two regions. The proximal region, -1 to -60, contains a GATA binding sequence around -37 and an SP1 binding sequence around -50. This region is active in erythroid and non-erythroid cells. The distal region, -60 to -95, contains two overlapping protein binding sites around -75, one for hGATA-1 and one for ubiquitous proteins. This distal region completely represses the activity of the proximal promoter in non-erythroid cells and defines the -95 GPB construct as a GPB promoter that displays erythroid specificity. Using site directed mutagenesis, we show that the -37 GATA and the -50 SP1 binding sites are necessary for efficient activity of the -95 GPB construct. Mutations that impair the -75 GATA-1 binding result in extinction of the -95 GPB construct activity if the -75 ubiquitous binding site is not altered, or in loss of erythroid specificity if the -75 ubiquitous binding site is also mutated. Using a cotransfection assay, we found that hGATA-1 can efficiently activate transcription of the -95 GPB construct in non-erythroid cells. This transactivation is abolished by mutations that impair either the -37 GATA-1 or the -50 SP1 binding. Mutations that impair the -75 GATA-1 binding and still allow the -75 ubiquitous binding also abolish the transactivation of the -95 GPB construct, indicating that hGATA-1 can remove repression of the GPB promoter by displacement of the ubiquitous proteins.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1396593

  6. ZFP36L2 is required for self-renewal of early burst-forming unit erythroid progenitors.

    PubMed

    Zhang, Lingbo; Prak, Lina; Rayon-Estrada, Violeta; Thiru, Prathapan; Flygare, Johan; Lim, Bing; Lodish, Harvey F

    2013-07-01

    Stem cells and progenitors in many lineages undergo self-renewing divisions, but the extracellular and intracellular proteins that regulate this process are largely unknown. Glucocorticoids stimulate red blood cell formation by promoting self-renewal of early burst-forming unit-erythroid (BFU-E) progenitors. Here we show that the RNA-binding protein ZFP36L2 is a transcriptional target of the glucocorticoid receptor (GR) in BFU-Es and is required for BFU-E self-renewal. ZFP36L2 is normally downregulated during erythroid differentiation from the BFU-E stage, but its expression is maintained by all tested GR agonists that stimulate BFU-E self-renewal, and the GR binds to several potential enhancer regions of ZFP36L2. Knockdown of ZFP36L2 in cultured BFU-E cells did not affect the rate of cell division but disrupted glucocorticoid-induced BFU-E self-renewal, and knockdown of ZFP36L2 in transplanted erythroid progenitors prevented expansion of erythroid lineage progenitors normally seen following induction of anaemia by phenylhydrazine treatment. ZFP36L2 preferentially binds to messenger RNAs that are induced or maintained at high expression levels during terminal erythroid differentiation and negatively regulates their expression levels. ZFP36L2 therefore functions as part of a molecular switch promoting BFU-E self-renewal and a subsequent increase in the total numbers of colony-forming unit-erythroid (CFU-E) progenitors and erythroid cells that are generated. PMID:23748442

  7. Inhibitory effect of the substance P and its derivative on erythropoietin-independent growth of erythroid progenitors in polycythemia vera.

    PubMed

    Le Gall, Christelle; Ianotto, Jean-Christophe; Hardy, Elisabeth; Ugo, Valérie; Eveillard, Jean-Richard; Ngo-Sack, Françoise; Bourquard, Pascal; Morice, Patrick; Berthou, Christian

    2008-05-01

    Regulation of normal hematopoiesis by neuropeptide substance P (SP) and its amino terminal fragment, SP(1-4), has been reported. Endogenous erythroid colony (EEC) formation without erythropoietin is characteristic of polycythemia vera (PV), a chronic myeloproliferative disorder. We investigated the effect(s) of SP and SP(1-4) on EEC formation from PV BM mononuclear cells (BMMCs) and purified CD36+ erythroid progenitors. We found a potent in vitro inhibitory effect of SP and SP(1-4) on PV EEC formation for both BMMCs and CD36+ erythroid progenitors. The influence of SP and SP(1-4) on PV progenitor erythroid differentiation and cell viability was also investigated, and the impact of neurokinin receptors and G proteins in the inhibition were analyzed by quantitative PCR and with specific inhibitors. This progenitor inhibition was: (1) not mediated by accessory cells; (2) characterized by an increase in cell death and inhibition of the EPOindependent terminal erythroid differentiation; and (3) not mediated by the same neurokinin receptor. NK-1R and NK-2R antagonists completely abrogated the SP inhibitory effect but not SP(1-4)-induced inhibition. Furthermore, the truncated form of the NK-1R was predominant over the full-length mRNA and could mediated the SP inhibitory effect on PV CD36+ erythroid progenitors. Different G proteins were also implicated according to the erythroid differentiation stage of the PV cells. The observation of an inhibitory effect of SP and its related peptide, SP(1-4), on PV EEC formation at physiological concentrations (10-8M) suggests that neuropeptides represent a way to downregulate pathologic expansion of PV progenitors. PMID:17980427

  8. Role of PI3K, MAPK/ERK1/2, and p38 in implementation of the proliferative and differentiation potential of erythroid progenitors after blood loss.

    PubMed

    Dygai, A M; Zhdanov, V V; Miroshnichenko, L A; Udut, E V; Zyuz'kov, G N; Simanina, E V; Sherstoboev, E Yu; Chaikovskii, A V; Stavrova, L A; Burmina, Ya V; Khrichkova, T Yu; Reichart, D V; Goldberg, V E

    2015-02-01

    The involvement of PI3K, ERK and p38-dependent signaling system in the regulation of functional activity of erythroid precursors after blood loss (30% of circulating volume) was studied. We demonstrated the important role of PI3K and p38 in the suppression of differentiation of erythroid precursors the contribution of p38 to stimulation of mitotic activity of erythroid CFU, which maintains the growth potential of the precursors at the optimal physiological level. The classical MAPK/ERK-kinase pathway does not determine the proliferative and differentiation status of erythroid CFU. PMID:25711660

  9. Pure optical photoacoustic microscopy

    PubMed Central

    Xie, Zhixing; Chen, Sung-Liang; Ling, Tao; Guo, L. Jay; Carson, Paul L.; Wang, Xueding

    2011-01-01

    The concept of pure optical photoacoustic microscopy(POPAM) was proposed based on optical rastering of a focused excitation beam and optically sensing the photoacoustic signal using a microring resonator fabricated by a nanoimprinting technique. After the refinements of the microring’s working wavelength and in the resonator structure and mold fabrication, an ultrahigh Q factor of 3.0×105 was achieved which provided high sensitivity with a noise equivalent detectable pressure(NEDP) value of 29Pa. This NEDP is much lower than the hundreds of Pascals achieved with existing optical resonant structures such as etalons, fiber gratings and dielectric multilayer interference filters available for acoustic measurement. The featured high sensitivity allowed the microring resonator to detect the weak photoacoustic signals from micro- or submicroscale objects. The inherent superbroad bandwidth of the optical microring resonator combined with an optically focused scanning beam provided POPAM with high resolution in the axial as well as both lateral directions while the axial resolution of conventional photoacoustic microscopy (PAM) suffers from the limited bandwidth of PZT detectors. Furthermore, the broadband microring resonator showed similar sensitivity to that of our most sensitive PZT detector. The current POPAM system provides a lateral resolution of 5 μm and an axial resolution of 8 μm, comparable to that achieved by optical microscopy while presenting the unique contrast of optical absorption and functional information complementing other optical modalities. The 3D structure of microvasculature, including capillary networks, and even individual red blood cells have been discerned successfully in the proof-of-concept experiments on mouse bladders ex vivo and mouse ears in vivo. The potential of approximately GHz bandwidth of the microring resonator also might allow much higher resolution than shown here in microscopy of optical absorption and acoustic propagation

  10. Treatment of pure red cell aplasia associated with multiple myeloma with biclonal gammopathy using cyclosporine A: a case report

    PubMed Central

    Lv, Yali; Qian, Wenbin

    2015-01-01

    We reported a rare case of pure red cell aplasia in a 44-year-old man with multiple myeloma with biclonal gammophathy (IgG lambda and IgA lambda type) with severe anemia. After treatment with bortezomib, adriamycin, and dexamethasone, the patient achieved very good partial response with disappearance of monoclonal gammopathy. However, his anemia was not significantly improved. Bone marrow analysis revealed selective erythroid hypoplasia. Thus, cyclosporine A was administered, which resulted in a complete recovery from anemia. The present case may provide some insight into the pathogenesis of PRAC and malignant plasma cell disorder. PMID:25785163

  11. Mathematical modeling reveals differential effects of erythropoietin on proliferation and lineage commitment of human hematopoietic progenitors in early erythroid culture

    PubMed Central

    Ward, Daniel; Carter, Deborah; Homer, Martin; Marucci, Lucia; Gampel, Alexandra

    2016-01-01

    Erythropoietin is essential for the production of mature erythroid cells, promoting both proliferation and survival. Whether erythropoietin and other cytokines can influence lineage commitment of hematopoietic stem and progenitor cells is of significant interest. To study lineage restriction of the common myeloid progenitor to the megakaryocyte/erythroid progenitor of peripheral blood CD34+ cells, we have shown that the cell surface protein CD36 identifies the earliest lineage restricted megakaryocyte/erythroid progenitor. Using this marker and carboxyfluorescein succinimidyl ester to track cell divisions in vitro, we have developed a mathematical model that accurately predicts population dynamics of erythroid culture. Parameters derived from the modeling of cultures without added erythropoietin indicate that the rate of lineage restriction is not affected by erythropoietin. By contrast, megakaryocyte/erythroid progenitor proliferation is sensitive to erythropoietin from the time that CD36 first appears at the cell surface. These results shed new light on the role of erythropoietin in erythropoiesis and provide a powerful tool for further study of hematopoietic progenitor lineage restriction and erythropoiesis. PMID:26589912

  12. Mathematical modeling reveals differential effects of erythropoietin on proliferation and lineage commitment of human hematopoietic progenitors in early erythroid culture.

    PubMed

    Ward, Daniel; Carter, Deborah; Homer, Martin; Marucci, Lucia; Gampel, Alexandra

    2016-03-01

    Erythropoietin is essential for the production of mature erythroid cells, promoting both proliferation and survival. Whether erythropoietin and other cytokines can influence lineage commitment of hematopoietic stem and progenitor cells is of significant interest. To study lineage restriction of the common myeloid progenitor to the megakaryocyte/erythroid progenitor of peripheral blood CD34(+) cells, we have shown that the cell surface protein CD36 identifies the earliest lineage restricted megakaryocyte/erythroid progenitor. Using this marker and carboxyfluorescein succinimidyl ester to track cell divisions in vitro, we have developed a mathematical model that accurately predicts population dynamics of erythroid culture. Parameters derived from the modeling of cultures without added erythropoietin indicate that the rate of lineage restriction is not affected by erythropoietin. By contrast, megakaryocyte/erythroid progenitor proliferation is sensitive to erythropoietin from the time that CD36 first appears at the cell surface. These results shed new light on the role of erythropoietin in erythropoiesis and provide a powerful tool for further study of hematopoietic progenitor lineage restriction and erythropoiesis. PMID:26589912

  13. Induction of foetal haemoglobin synthesis in erythroid progenitor stem cells: mediated by water-soluble components of Terminalia catappa.

    PubMed

    Aimola, I A; Inuwa, H M; Nok, A J; Mamman, A I

    2014-06-01

    Current novel therapeutic agents for the treatment of sickle cell anaemia (SCA) focus on increasing foetal haemoglobin (HbF) levels in SCA patients. Unfortunately, the only approved HbF-inducing agent, hydroxyurea, has long-term unpredictable side effects. Studies have shown the potential of plant compounds to modulate HbF synthesis in primary erythroid progenitor stem cells. We isolated a novel HbF-inducing Terminalia catappa distilled water active fraction (TCDWF) from Terminalia catappa leaves that induced the commitment of erythroid progenitor stem cells to the erythroid lineage and relatively higher HbF synthesis of 9.2- and 6.8-fold increases in both erythropoietin (EPO)-independent and EPO-dependent progenitor stem cells respectively. TCDWF was differentially cytotoxic to EPO-dependent and EPO-independent erythroid progenitor stem cell cultures as revealed by lactate dehydrogenase release from the cells. TCDWF demonstrated a protective effect on EPO-dependent and not EPO-independent progenitor cells. TCDWF induced a modest increase in caspase 3 activity in EPO-independent erythroid progenitor stem cell cultures compared with a significantly higher (P˂0.05) caspase 3 activity in EPO-dependent ones. The results demonstrate that TCDWF may hold promising HbF-inducing compounds, which work synergistically, and suggest a dual modulatory effect on erythropoiesis inherent in this active fraction. PMID:24470326

  14. Rps14 haploinsufficiency causes a block in erythroid differentiation mediated by S100A8 and S100A9.

    PubMed

    Schneider, Rebekka K; Schenone, Monica; Ferreira, Monica Ventura; Kramann, Rafael; Joyce, Cailin E; Hartigan, Christina; Beier, Fabian; Brümmendorf, Tim H; Germing, Ulrich; Platzbecker, Uwe; Büsche, Guntram; Knüchel, Ruth; Chen, Michelle C; Waters, Christopher S; Chen, Edwin; Chu, Lisa P; Novina, Carl D; Lindsley, R Coleman; Carr, Steven A; Ebert, Benjamin L

    2016-03-01

    Impaired erythropoiesis in the deletion 5q (del(5q)) subtype of myelodysplastic syndrome (MDS) has been linked to heterozygous deletion of RPS14, which encodes the ribosomal protein small subunit 14. We generated mice with conditional inactivation of Rps14 and demonstrated an erythroid differentiation defect that is dependent on the tumor suppressor protein p53 (encoded by Trp53 in mice) and is characterized by apoptosis at the transition from polychromatic to orthochromatic erythroblasts. This defect resulted in age-dependent progressive anemia, megakaryocyte dysplasia and loss of hematopoietic stem cell (HSC) quiescence. As assessed by quantitative proteomics, mutant erythroblasts expressed higher levels of proteins involved in innate immune signaling, notably the heterodimeric S100 calcium-binding proteins S100a8 and S100a9. S100a8--whose expression was increased in mutant erythroblasts, monocytes and macrophages--is functionally involved in the erythroid defect caused by the Rps14 deletion, as addition of recombinant S100a8 was sufficient to induce a differentiation defect in wild-type erythroid cells, and genetic inactivation of S100a8 expression rescued the erythroid differentiation defect of Rps14-haploinsufficient HSCs. Our data link Rps14 haploinsufficiency in del(5q) MDS to activation of the innate immune system and induction of S100A8-S100A9 expression, leading to a p53-dependent erythroid differentiation defect. PMID:26878232

  15. Pure seminoma: a review and update.

    PubMed

    Boujelbene, Noureddine; Cosinschi, Adrien; Boujelbene, Nadia; Khanfir, Kaouthar; Bhagwati, Shushila; Herrmann, Eveleyn; Mirimanoff, Rene-Olivier; Ozsahin, Mahmut; Zouhair, Abderrahim

    2011-01-01

    Pure seminoma is a rare pathology of the young adult, often discovered in the early stages. Its prognosis is generally excellent and many therapeutic options are available, especially in stage I tumors. High cure rates can be achieved in several ways: standard treatment with radiotherapy is challenged by surveillance and chemotherapy. Toxicity issues and the patients' preferences should be considered when management decisions are made. This paper describes firstly the management of primary seminoma and its nodal involvement and, secondly, the various therapeutic options according to stage. PMID:21819630

  16. Pure seminoma: A review and update

    PubMed Central

    2011-01-01

    Pure seminoma is a rare pathology of the young adult, often discovered in the early stages. Its prognosis is generally excellent and many therapeutic options are available, especially in stage I tumors. High cure rates can be achieved in several ways: standard treatment with radiotherapy is challenged by surveillance and chemotherapy. Toxicity issues and the patients' preferences should be considered when management decisions are made. This paper describes firstly the management of primary seminoma and its nodal involvement and, secondly, the various therapeutic options according to stage. PMID:21819630

  17. Altered chromatin occupancy of master regulators underlies evolutionary divergence in the transcriptional landscape of erythroid differentiation.

    PubMed

    Ulirsch, Jacob C; Lacy, Jessica N; An, Xiuli; Mohandas, Narla; Mikkelsen, Tarjei S; Sankaran, Vijay G

    2014-12-01

    Erythropoiesis is one of the best understood examples of cellular differentiation. Morphologically, erythroid differentiation proceeds in a nearly identical fashion between humans and mice, but recent evidence has shown that networks of gene expression governing this process are divergent between species. We undertook a systematic comparative analysis of six histone modifications and four transcriptional master regulators in primary proerythroblasts and erythroid cell lines to better understand the underlying basis of these transcriptional differences. Our analyses suggest that while chromatin structure across orthologous promoters is strongly conserved, subtle differences are associated with transcriptional divergence between species. Many transcription factor (TF) occupancy sites were poorly conserved across species (∼25% for GATA1, TAL1, and NFE2) but were more conserved between proerythroblasts and cell lines derived from the same species. We found that certain cis-regulatory modules co-occupied by GATA1, TAL1, and KLF1 are under strict evolutionary constraint and localize to genes necessary for erythroid cell identity. More generally, we show that conserved TF occupancy sites are indicative of active regulatory regions and strong gene expression that is sustained during maturation. Our results suggest that evolutionary turnover of TF binding sites associates with changes in the underlying chromatin structure, driving transcriptional divergence. We provide examples of how this framework can be applied to understand epigenomic variation in specific regulatory regions, such as the β-globin gene locus. Our findings have important implications for understanding epigenomic changes that mediate variation in cellular differentiation across species, while also providing a valuable resource for studies of hematopoiesis. PMID:25521328

  18. Fast apoptosis and erythroid differentiation induced by imatinib mesylate in JURL-MK1 cells.

    PubMed

    Kuzelová, Katerina; Grebenová, Dana; Marinov, Iuri; Hrkal, Zbynek

    2005-05-15

    We compare the effects of Imatinib mesylate (Glivec) on chronic myeloid leukemia derived cell lines K562 and JURL-MK1. In both cell lines, the cell cycle arrests in G(1)/G(0) phase within 24 h after the addition of 1 microM Imatinib. This is followed by a decrease of Ki-67 expression and the induction of apoptosis. In JURL-MK1 cells, the apoptosis is faster in comparison with K562 cells: the caspase-3 activity reaches the peak value (20 to 30 fold of the control) after about 40 h and the apoptosis proceeds to its culmination point, the DNA fragmentation, within 48 h following 1 microM Imatinib addition. Unlike K562 cells, JURL-MK1 cells possess a probably functional p53 protein inducible by TPA (tetradecanoyl phorbol acetate) or UV-B irradiation. However, no increase in p53 expression was observed in Imatinib-treated JURL-MK1 cells indicating that the difference in the apoptosis rate between the two cell lines is not due to the lack of p53 in K562 cells. Imatinib also triggers erythroid differentiation both in JURL-MK1 and K562 cells. Glycophorin A expression occurred simultaneously with the apoptosis, even at the single cell level. In K562 cells, but not in JURL-MK1 cells, the differentiation process involved increased hemoglobin synthesis. However, during spontaneous evolution of JURL-MK1 cells in culture, the effects produced by Imatinib progressively changed from the fast apoptosis to the more complete erythroid differentiation. We suggest that the apoptosis and the erythroid differentiation are parallel effects of Imatinib and their relative contributions, kinetics and completeness are related to the differentiation stage of the treated cells. PMID:15770664

  19. Altered Chromatin Occupancy of Master Regulators Underlies Evolutionary Divergence in the Transcriptional Landscape of Erythroid Differentiation

    PubMed Central

    Ulirsch, Jacob C.; Lacy, Jessica N.; An, Xiuli; Mohandas, Narla; Mikkelsen, Tarjei S.; Sankaran, Vijay G.

    2014-01-01

    Erythropoiesis is one of the best understood examples of cellular differentiation. Morphologically, erythroid differentiation proceeds in a nearly identical fashion between humans and mice, but recent evidence has shown that networks of gene expression governing this process are divergent between species. We undertook a systematic comparative analysis of six histone modifications and four transcriptional master regulators in primary proerythroblasts and erythroid cell lines to better understand the underlying basis of these transcriptional differences. Our analyses suggest that while chromatin structure across orthologous promoters is strongly conserved, subtle differences are associated with transcriptional divergence between species. Many transcription factor (TF) occupancy sites were poorly conserved across species (∼25% for GATA1, TAL1, and NFE2) but were more conserved between proerythroblasts and cell lines derived from the same species. We found that certain cis-regulatory modules co-occupied by GATA1, TAL1, and KLF1 are under strict evolutionary constraint and localize to genes necessary for erythroid cell identity. More generally, we show that conserved TF occupancy sites are indicative of active regulatory regions and strong gene expression that is sustained during maturation. Our results suggest that evolutionary turnover of TF binding sites associates with changes in the underlying chromatin structure, driving transcriptional divergence. We provide examples of how this framework can be applied to understand epigenomic variation in specific regulatory regions, such as the β-globin gene locus. Our findings have important implications for understanding epigenomic changes that mediate variation in cellular differentiation across species, while also providing a valuable resource for studies of hematopoiesis. PMID:25521328

  20. Epigenetic Determinants of Erythropoiesis: Role of the Histone Methyltransferase SetD8 in Promoting Erythroid Cell Maturation and Survival.

    PubMed

    DeVilbiss, Andrew W; Sanalkumar, Rajendran; Hall, Bryan D R; Katsumura, Koichi R; de Andrade, Isabela Fraga; Bresnick, Emery H

    2015-06-01

    Erythropoiesis, in which committed progenitor cells generate millions of erythrocytes daily, involves dramatic changes in the chromatin structure and transcriptome of erythroblasts, prior to their enucleation. While the involvement of the master-regulatory transcription factors GATA binding protein 1 (GATA-1) and GATA-2 in this process is established, the mechanistic contributions of many chromatin-modifying/remodeling enzymes in red cell biology remain enigmatic. We demonstrated that SetD8, a histone methyltransferase that catalyzes monomethylation of histone H4 at lysine 20 (H4K20me1), is a context-dependent GATA-1 corepressor in erythroid cells. To determine whether SetD8 controls erythroid maturation and/or function, we used a small hairpin RNA (shRNA)-based loss-of-function strategy in a primary murine erythroblast culture system. In this system, SetD8 promoted erythroblast maturation and survival, and this did not involve upregulation of the established regulator of erythroblast survival Bcl-x(L). SetD8 catalyzed H4K20me1 at a critical Gata2 cis element and restricted occupancy by an enhancer of Gata2 transcription, Scl/TAL1, thereby repressing Gata2 transcription. Elevating GATA-2 levels in erythroid precursors yielded a maturation block comparable to that induced by SetD8 downregulation. As lowering GATA-2 expression in the context of SetD8 knockdown did not rescue erythroid maturation, we propose that SetD8 regulation of erythroid maturation involves multiple target genes. These results establish SetD8 as a determinant of erythroid cell maturation and provide a framework for understanding how a broadly expressed histone-modifying enzyme mediates cell-type-specific GATA factor function. PMID:25855754

  1. Zfp36l2 is required for self-renewal of early erythroid BFU-E progenitors

    PubMed Central

    Zhang, Lingbo; Prak, Lina; Rayon-Estrada, Violeta; Thiru, Prathapan; Flygare, Johan; Lim, Bing; Lodish, Harvey F.

    2013-01-01

    Stem cells and progenitors in many lineages undergo self- renewing divisions, but the extracellular and intracellular proteins that regulate this process are largely unknown. Glucocorticoids stimulate red cell formation by promoting self-renewal of early erythroid burst forming unit-erythrocyte (BFU-E) progenitors1-4. Here we show that the RNA binding protein Zfp36l2 is a transcriptional target of the glucocorticoid receptor (GR) in BFU-Es and is required for BFU-E self-renewal. Zfp36l2 is normally downregulated during erythroid differentiation from the BFU-E stage but its expression is maintained by all tested GR agonists that stimulate BFU-E self-renewal, and the GR binds to several potential enhancer regions of Zfp36l2. Knockdown of Zfp36l2 in cultured BFU-E cells did not affect the rate of cell division but disrupted glucocorticoid-induced BFU-E self-renewal, and knockdown of Zfp36l2 in transplanted erythroid progenitors prevented expansion of erythroid lineage progenitors normally seen following induction of anemia by phenylhydrazine treatment. Zfp36l2 preferentially binds to mRNAs that are induced or maintained at high expression levels during terminal erythroid differentiation and negatively regulates their expression levels. Thus Zfp36l2 functions as part of molecular switch promoting BFU-E self-renewal and thus a subsequent increase in the total numbers of CFU-E progenitors and erythroid cells that are generated. PMID:23748442

  2. Olive leaf components apigenin 7-glucoside and luteolin 7-glucoside direct human hematopoietic stem cell differentiation towards erythroid lineage.

    PubMed

    Samet, Imen; Villareal, Myra O; Motojima, Hideko; Han, Junkyu; Sayadi, Sami; Isoda, Hiroko

    2015-06-01

    The generation of blood cellular components from hematopoietic stem cells is important for the therapy of a broad spectrum of hematological disorders. In recent years, several lines of evidence suggested that certain nutrients, vitamins and flavonoids may have important roles in controlling the stem cell fate decision by maintaining their self-renewal or stimulating the lineage-specific differentiation. In this study, main olive leaf phytochemicals oleuropein (Olp), apigenin 7-glucoside (Api7G) and luteolin 7-glucoside (Lut7G) were investigated for their potential effects on hematopoietic stem cell differentiation using both phenotypic and molecular analysis. Oleuropein and the combination of the three compounds enhanced the differentiation of CD34+ cells into myelomonocytic cells and lymphocytes progenitors and inhibited the commitment to megakaryocytic and erythroid lineages. Treatment with Lut7G stimulated both the erythroid and the myeloid differentiation, while treatment with Api7G specifically induced the differentiation of CD34+ cells towards the erythroid lineage and inhibited the myeloid differentiation. Erythroid differentiation induced by Api7G and Lut7G treatments was confirmed by the increase in hemoglobin genes expressions (α-hemoglobin, β-hemoglobin and γ-hemoglobin) and erythroid transcription factor GATA1 expression. As revealed by microarray analysis, the mechanisms underlying the erythroid differentiation-inducing effect of Api7G on hematopoietic stem cells involves the activation of JAK/STAT signaling pathway. These findings prove the differentiation-inducing effects of olive leaf compounds on hematopoietic stem cells and highlight their potential use in the ex vivo generation of blood cells. PMID:26299581

  3. Enhancements of the production of bilirubin and the expression of β-globin by carbon monoxide during erythroid differentiation.

    PubMed

    Mu, Anfeng; Li, Ming; Tanaka, Masakazu; Adachi, Yasushi; Tai, Tran Tien; Liem, Pham Hieu; Izawa, Shingo; Furuyama, Kazumichi; Taketani, Shigeru

    2016-05-01

    Heme is degraded by heme oxygenase to form iron, carbon monoxide (CO), and biliverdin. However, information about the catabolism of heme in erythroid cells is limited. In this study, we showed the production and export of bilirubin in murine erythroleukemia (MEL) cells. The production of bilirubin by MEL cells was enhanced when heme synthesis was induced. When mouse bone marrow cells were induced with erythropoietin to differentiate into erythroid cells, the synthesis of bilirubin increased. The expression of β-globin was enhanced by CO at the transcriptional level. These results indicate that constant production of CO from heme regulates erythropoiesis. PMID:27087140

  4. Murine tribbles homolog 2 deficiency affects erythroid progenitor development and confers macrocytic anemia on mice.

    PubMed

    Lin, Kou-Ray; Yang-Yen, Hsin-Fang; Lien, Huang-Wei; Liao, Wei-Hao; Huang, Chang-Jen; Lin, Liang-In; Li, Chung-Leung; Yen, Jeffrey Jong-Young

    2016-01-01

    Tribbles homolog 2 (Trib2) is a member of Tribbles protein pseudokinases and involves in apoptosis, autoimmunity, cancer, leukemia and erythropoiesis, however, the physiological function of Trib2 in hematopoietic system remains to be elucidated. Here, we report that Trib2 knockout (KO) mice manifest macrocytic anemia and increase of T lymphocytes. Although Trib2 deficient RBCs have similar half-life as the control RBCs, Trib2 KO mice are highly vulnerable to oxidant-induced hemolysis. Endogenous Trib2 mRNA is expressed in early hematopoietic progenitors, erythroid precursors, and lymphoid lineages, but not in mature RBCs, myeloid progenitors and granulocytes. Consistently, flow cytometric analysis and in vitro colony forming assay revealed that deletion of Trib2 mainly affected erythroid lineage development, and had no effect on either granulocyte or megakaryocyte lineages in bone marrow. Furthermore, a genetic approach using double knockout of Trib2 and C/ebpα genes in mice suggested that Trib2 promotes erythropoiesis independent of C/ebpα proteins in vivo. Finally, ectopic expression of human Trib2 in zebrafish embryos resulted in increased expression of erythropoiesis-related genes and of hemoglobin. Taking all data together, our results suggest that Trib2 positively promotes early erythrocyte differentiation and is essential for tolerance to hemolysis. PMID:27550848

  5. Immunocytochemical mapping of the hemoglobin biosynthesis site in amphibian erythroid cells.

    PubMed

    Cianciarullo, A M; Beçak, W; Soares, M J

    1999-06-01

    During the past 25 years, several studies have attempted to determine the site of integration of the heme and the four globin chains in vertebrate erythroid cells that is important in the formation of the hemoglobin molecule. Mitochondrion-like organelles or hemosomes were pointed out as responsible for this task. We performed several experiments to investigate this hypothesis. The intracellular distribution of hemoglobin in amphibian erythroid cells was detected by post-embedding immuno-electron microscopy, using a polyclonal anti-human hemoglobin-proteinA-gold complex. Hemoglobin mapping showed an intense labeling in the cell cytoplasm, but none in cytoplasmic structures such as endoplasmic reticulum, mitochondria, mitochondrion-like organelles, Golgi complex, ribosomes or ferruginous inclusions. The mitochondrial fraction obtained according to the protocol described for some authors, showed by ultrastructural examination that this fraction has a heterogeneous content, also composed by microvesicles rich in cytoplasmic hemoglobin, an artifact generated by mechanical action during cell fractionation. Thus, when this fraction is lysed and its content submitted to electrophoresis, hemoglobin bands would be found inevitably, causing false-positive results, erroneously attributed to hemoglobin content of mitochondrion-like organelles. Our data do not confirm the hypothesis that the final hemoglobin biosynthesis occurs inside mitochondrion-like organelles. They suggest that the hemoglobin molecule be assembled in the erythrocyte cytoplasm outside of mitochondria or hemosomes. PMID:10481306

  6. Erythroid 5-aminolevulinate synthase mediates the upregulation of membrane band 3 protein expression by iron.

    PubMed

    Huang, Qianchuan; Li, Jinying; Feng, Weihua; Xu, Yanqun; Huang, Zhenxia; Lv, Shuqing; Zhou, Hong; Gao, Lei

    2010-03-01

    Iron deficiency leads to abnormal expression and function of band 3 protein in erythrocytes, but the underlying mechanisms remain elusive. The mRNA of erythroid-specific 5-aminolevulinate synthase (eALAS) contains an iron response element and the eALAS protein is an important mediator of iron utilization by erythrocytes. In this study, we investigated the effect of short hairpin RNA (shRNA) mediated silencing of eALAS on the expression of band 3 protein induced by iron. By real-time RT-PCR and Western blot we showed that at mRNA and protein level iron-induced expression of band 3 protein was lower in eALAS-shRNA transfected K562 cells than in control cells. Of note, the lowest expression was detected in K562 cells cultured in iron deficiency condition (p < 0.01). Thus either iron deficiency or depletion of eALAS could suppress the expression of erythroid band 3 protein. These results demonstrated for the first time that iron and the iron-regulatory system regulate the expression of the erythrocyte membrane proteins. PMID:20087844

  7. Protein 4.1R–deficient mice are viable but have erythroid membrane skeleton abnormalities

    PubMed Central

    Shi, Zheng-Tao; Afzal, Veena; Coller, Barry; Patel, Dipti; Chasis, Joel A.; Parra, Marilyn; Lee, Gloria; Paszty, Chris; Stevens, Mary; Walensky, Loren; Peters, Luanne L.; Mohandas, Narla; Rubin, Edward; Conboy, John G.

    1999-01-01

    A diverse family of protein 4.1R isoforms is encoded by a complex gene on human chromosome 1. Although the prototypical 80-kDa 4.1R in mature erythrocytes is a key component of the erythroid membrane skeleton that regulates erythrocyte morphology and mechanical stability, little is known about 4.1R function in nucleated cells. Using gene knockout technology, we have generated mice with complete deficiency of all 4.1R protein isoforms. These 4.1R-null mice were viable, with moderate hemolytic anemia but no gross abnormalities. Erythrocytes from these mice exhibited abnormal morphology, lowered membrane stability, and reduced expression of other skeletal proteins including spectrin and ankyrin, suggesting that loss of 4.1R compromises membrane skeleton assembly in erythroid progenitors. Platelet morphology and function were essentially normal, indicating that 4.1R deficiency may have less impact on other hematopoietic lineages. Nonerythroid 4.1R expression patterns, viewed using histochemical staining for lacZ reporter activity incorporated into the targeted gene, revealed focal expression in specific neurons in the brain and in select cells of other major organs, challenging the view that 4.1R expression is widespread among nonerythroid cells. The 4.1R knockout mice represent a valuable animal model for exploring 4.1R function in nonerythroid cells and for determining pathophysiological sequelae to 4.1R deficiency. PMID:9927493

  8. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    PubMed

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. PMID:27071853

  9. In Vitro Differentiation of Embryonic Stem Cells into Hematopoietic Lineage: Towards Erythroid Progenitor's Production.

    PubMed

    Fauzi, Iliana; Panoskaltsis, Nicki; Mantalaris, Athanasios

    2016-01-01

    Embryonic stem cells (ESCs) differentiation via embryoid body (EB) formation is an established method that generates the three germ layers. However, EB differentiation poses several problems including formation of heterogeneous cell populations. Herein, we described a differentiation protocol on enhancing mesoderm derivation from murine ESCs (mESCs) using conditioned medium (CM) from HepG2 cells. We used this technique to direct hematopoiesis by generating "embryoid-like" colonies (ELCs) from murine (m) ESCs without following standard formation of EBs. Our CM-mESCs group yielded an almost fivefold increase in ELC formation (p ≤ 0.05) and higher expression of mesoderm genes;-Brachyury-T, Goosecoid, and Flk-1 compared with control mESCs group. Hematopoietic colony formation from CM-mESCs was also enhanced by twofold at days 7 and 14 with earlier colony commitment compared to control mESCs (p ≤ 0.05). This early clonogenic capacity was confirmed morphologically by the presence of nucleated erythrocytes and macrophages as early as day 7 in culture using standard 14-day colony-forming assay. Early expression of hematopoietic primitive (ζ-globin) and definitive (β-globin) erythroid genes and proteins was also observed by day 7 in the CM-treated culture. These data indicate that hematopoietic cells more quickly differentiate from CM-treated, compared with those using standard EB approaches, and provide an efficient bioprocess platform for erythroid-specific differentiation of ESCs. PMID:26160454

  10. Transcription of the hypersensitive site HS2 enhancer in erythroid cells

    SciTech Connect

    Tuan, D.; Suming Kong; Hu, K. )

    1992-12-01

    In the human genome, the erythroid-specific hypersensitive site HS2 enhancer regulates the transcription of the downstream [beta]-like globin genes 10-50 kilobases away. The mechanism of HS2 enhancer function is not known. The present study employs RNA protection assays to analyze the transcriptional status of the HS2 enhancer in transfected recombinant chloramphenicol acetyltransferase (CAT) plasmids. In erythroid K562 cells in which the HS2 enhancer is active, the HS2 sequence directs the synthesis of long enhancer transcripts that are initiated apparently from within the enhancer and elongated through the intervening DNA into the cis-linked CAT gene. In nonerythroid HL-60 cells in which the HS2 enhancer is inactive, long enhancer transcripts are not detectable. Splitting the HS2 enhancer between two tandem Ap1 sites abolishes the synthesis of a group of long enhancer transcripts and results in loss of enhancer function and transcriptional silencing of the cis-linked CAT gene. In directing the synthesis of RNA through the intervening DNA and the gene by a tracking and transcription mechanism, the HS2 enhancer may (i) open up the chromatin structure of a gene domain and (ii) deliver enhancer binding proteins to the promoter sequence where they may stimulate the transcription of the gene at the cap site. 42 refs., 4 figs., 1 tab.

  11. Structural and functional characterization of an atypical activation domain in erythroid Kruppel-like factor (EKLF).

    PubMed

    Mas, Caroline; Lussier-Price, Mathieu; Soni, Shefali; Morse, Thomas; Arseneault, Geneviève; Di Lello, Paola; Lafrance-Vanasse, Julien; Bieker, James J; Omichinski, James G

    2011-06-28

    Erythroid Krüppel-like factor (EKLF) plays an important role in erythroid development by stimulating β-globin gene expression. We have examined the details by which the minimal transactivation domain (TAD) of EKLF (EKLFTAD) interacts with several transcriptional regulatory factors. We report that EKLFTAD displays homology to the p53TAD and, like the p53TAD, can be divided into two functional subdomains (EKLFTAD1 and EKLFTAD2). Based on sequence analysis, we found that EKLFTAD2 is conserved in KLF2, KLF4, KLF5, and KLF15. In addition, we demonstrate that EKLFTAD2 binds the amino-terminal PH domain of the Tfb1/p62 subunit of TFIIH (Tfb1PH/p62PH) and four domains of CREB-binding protein/p300. The solution structure of the EKLFTAD2/Tfb1PH complex indicates that EKLFTAD2 binds Tfb1PH in an extended conformation, which is in contrast to the α-helical conformation seen for p53TAD2 in complex with Tfb1PH. These studies provide detailed mechanistic information into EKLFTAD functions as well as insights into potential interactions of the TADs of other KLF proteins. In addition, they suggest that not only have acidic TADs evolved so that they bind using different conformations on a common target, but that transitioning from a disordered to a more ordered state is not a requirement for their ability to bind multiple partners. PMID:21670263

  12. Transcription of the hypersensitive site HS2 enhancer in erythroid cells.

    PubMed Central

    Tuan, D; Kong, S; Hu, K

    1992-01-01

    In the human genome, the erythroid-specific hypersensitive site HS2 enhancer regulates the transcription of the downstream beta-like globin genes 10-50 kilobases away. The mechanism of HS2 enhancer function is not known. The present study employs RNA protection assays to analyze the transcriptional status of the HS2 enhancer in transfected recombinant chloramphenicol acetyltransferase (CAT) plasmids. In erythroid K562 cells in which the HS2 enhancer is active, the HS2 sequence directs the synthesis of long enhancer transcripts that are initiated apparently from within the enhancer and elongated through the intervening DNA into the cis-linked CAT gene. In nonerythroid HL-60 cells in which the HS2 enhancer is inactive, long enhancer transcripts are not detectable. Splitting the HS2 enhancer between two tandem Ap1 sites abolishes the synthesis of a group of long enhancer transcripts and results in loss of enhancer function and transcriptional silencing of the cis-linked CAT gene. In directing the synthesis of RNA through the intervening DNA and the gene by a tracking and transcription mechanism, the HS2 enhancer may (i) open up the chromatin structure of a gene domain and (ii) deliver enhancer binding proteins to the promoter sequence where they may stimulate the transcription of the gene at the cap site. Images PMID:1454801

  13. Murine tribbles homolog 2 deficiency affects erythroid progenitor development and confers macrocytic anemia on mice

    PubMed Central

    Lin, Kou-Ray; Yang-Yen, Hsin-Fang; Lien, Huang-Wei; Liao, Wei-Hao; Huang, Chang-Jen; Lin, Liang-In; Li, Chung-Leung; Yen, Jeffrey Jong-Young

    2016-01-01

    Tribbles homolog 2 (Trib2) is a member of Tribbles protein pseudokinases and involves in apoptosis, autoimmunity, cancer, leukemia and erythropoiesis, however, the physiological function of Trib2 in hematopoietic system remains to be elucidated. Here, we report that Trib2 knockout (KO) mice manifest macrocytic anemia and increase of T lymphocytes. Although Trib2 deficient RBCs have similar half-life as the control RBCs, Trib2 KO mice are highly vulnerable to oxidant-induced hemolysis. Endogenous Trib2 mRNA is expressed in early hematopoietic progenitors, erythroid precursors, and lymphoid lineages, but not in mature RBCs, myeloid progenitors and granulocytes. Consistently, flow cytometric analysis and in vitro colony forming assay revealed that deletion of Trib2 mainly affected erythroid lineage development, and had no effect on either granulocyte or megakaryocyte lineages in bone marrow. Furthermore, a genetic approach using double knockout of Trib2 and C/ebpα genes in mice suggested that Trib2 promotes erythropoiesis independent of C/ebpα proteins in vivo. Finally, ectopic expression of human Trib2 in zebrafish embryos resulted in increased expression of erythropoiesis-related genes and of hemoglobin. Taking all data together, our results suggest that Trib2 positively promotes early erythrocyte differentiation and is essential for tolerance to hemolysis. PMID:27550848

  14. Globin chain synthesis in single erythroid bursts from cord blood: studies on gamma leads to beta and G gamma leads to A gamma switches.

    PubMed

    Comi, P; Giglioni, B; Ottolenghi, S; Gianni, A M; Polli, E; Barba, P; Covelli, A; Migliaccio, G; Condorelli, M; Peschle, C

    1980-01-01

    Erythroid bursts from cord or adult blood were grown in methylcellulose cultures (3 international units of erythropoietin per plate). On day 13, single bursts were picked up and reincubated for 16-24 hr with [3H]leucine. Radioactive globin chains [alpha,beta,G gamma, and A gamma (Ala-136)] were analyzed by either isoelectric focusing on polyacrylamide gels and fluorography or carboxymethylcellulose chromatography. In all cases, alpha to non-alpha globin radioactivity ratios were close to 1. In single cord blood bursts, the values of both gamma-to-beta and G gamma-to-A gamma ratios were spread over a large spectrum and further characterized by a continuous rather than a bimodal distribution. Morever, the G gamma-to-A gamma ratios demonstrated in single bursts appeared to be directly correlated with the respective gamma-to-beta ratios. These data suggest that both the gamma leads to beta and the G gamma leads to A gamma switches are mediated via mechanisms modulating the relative activities of the different genes in the non-alpha globin gene cluster rather than via selection of clones committed to the preferential synthesis of beta and A gamma globins. In contrast with the results obtained with cord blood, individual adult blood bursts synthesize a lower and hence relatively more uniform amount of gamma globin chains. PMID:6153796

  15. Erythroid cell growth and differentiation in vitro in the simulated microgravity environment of the NASA rotating wall vessel bioreactor

    NASA Technical Reports Server (NTRS)

    Sytkowski, A. J.; Davis, K. L.

    2001-01-01

    Prolonged exposure of humans and experimental animals to the altered gravitational conditions of space flight has adverse effects on the lymphoid and erythroid hematopoietic systems. Although some information is available regarding the cellular and molecular changes in lymphocytes exposed to microgravity, little is known about the erythroid cellular changes that may underlie the reduction in erythropoiesis and resultant anemia. We now report a reduction in erythroid growth and a profound inhibition of erythropoietin (Epo)-induced differentiation in a ground-based simulated microgravity model system. Rauscher murine erythroleukemia cells were grown either in tissue culture vessels at 1 x g or in the simulated microgravity environment of the NASA-designed rotating wall vessel (RWV) bioreactor. Logarithmic growth was observed under both conditions; however, the doubling time in simulated microgravity was only one-half of that seen at 1 x g. No difference in apoptosis was detected. Induction with Epo at the initiation of the culture resulted in differentiation of approximately 25% of the cells at 1 x g, consistent with our previous observations. In contrast, induction with Epo at the initiation of simulated microgravity resulted in only one-half of this degree of differentiation. Significantly, the growth of cells in simulated microgravity for 24 h prior to Epo induction inhibited the differentiation almost completely. The results suggest that the NASA RWV bioreactor may serve as a suitable ground-based microgravity simulator to model the cellular and molecular changes in erythroid cells observed in true microgravity.

  16. MicroRNA-486-5p is an erythroid oncomiR of the myeloid leukemias of Down syndrome

    PubMed Central

    Shaham, Lital; Vendramini, Elena; Ge, Yubin; Goren, Yaron; Birger, Yehudit; Tijssen, Marloes R.; McNulty, Maureen; Geron, Ifat; Schwartzman, Omer; Goldberg, Liat; Chou, Stella T.; Pitman, Holly; Weiss, Mitchell J.; Michaeli, Shulamit; Sredni, Benjamin; Göttgens, Berthold; Crispino, John D.; Taub, Jeffrey W.

    2015-01-01

    Children with Down syndrome (DS) are at increased risk for acute myeloid leukemias (ML-DS) characterized by mixed megakaryocytic and erythroid phenotype and by acquired mutations in the GATA1 gene resulting in a short GATA1s isoform. The chromosome 21 microRNA (miR)-125b cluster has been previously shown to cooperate with GATA1s in transformation of fetal hematopoietic progenitors. In this study, we report that the expression of miR-486-5p is increased in ML-DS compared with non-DS acute megakaryocytic leukemias (AMKLs). miR-486-5p is regulated by GATA1 and GATA1s that bind to the promoter of its host gene ANK1. miR-486-5p is highly expressed in mouse erythroid precursors and knockdown (KD) in ML-DS cells reduced their erythroid phenotype. Ectopic expression and KD of miR-486-5p in primary fetal liver hematopoietic progenitors demonstrated that miR-486-5p cooperates with Gata1s to enhance their self renewal. Consistent with its activation of AKT, overexpression and KD experiments showed its importance for growth and survival of human leukemic cells. Thus, miR-486-5p cooperates with GATA1s in supporting the growth and survival, and the aberrant erythroid phenotype of the megakaryocytic leukemias of DS. PMID:25533034

  17. MicroRNA-486-5p is an erythroid oncomiR of the myeloid leukemias of Down syndrome.

    PubMed

    Shaham, Lital; Vendramini, Elena; Ge, Yubin; Goren, Yaron; Birger, Yehudit; Tijssen, Marloes R; McNulty, Maureen; Geron, Ifat; Schwartzman, Omer; Goldberg, Liat; Chou, Stella T; Pitman, Holly; Weiss, Mitchell J; Michaeli, Shulamit; Sredni, Benjamin; Göttgens, Berthold; Crispino, John D; Taub, Jeffrey W; Izraeli, Shai

    2015-02-19

    Children with Down syndrome (DS) are at increased risk for acute myeloid leukemias (ML-DS) characterized by mixed megakaryocytic and erythroid phenotype and by acquired mutations in the GATA1 gene resulting in a short GATA1s isoform. The chromosome 21 microRNA (miR)-125b cluster has been previously shown to cooperate with GATA1s in transformation of fetal hematopoietic progenitors. In this study, we report that the expression of miR-486-5p is increased in ML-DS compared with non-DS acute megakaryocytic leukemias (AMKLs). miR-486-5p is regulated by GATA1 and GATA1s that bind to the promoter of its host gene ANK1. miR-486-5p is highly expressed in mouse erythroid precursors and knockdown (KD) in ML-DS cells reduced their erythroid phenotype. Ectopic expression and KD of miR-486-5p in primary fetal liver hematopoietic progenitors demonstrated that miR-486-5p cooperates with Gata1s to enhance their self renewal. Consistent with its activation of AKT, overexpression and KD experiments showed its importance for growth and survival of human leukemic cells. Thus, miR-486-5p cooperates with GATA1s in supporting the growth and survival, and the aberrant erythroid phenotype of the megakaryocytic leukemias of DS. PMID:25533034

  18. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells

    PubMed Central

    Steiner, Laurie A.; Schulz, Vincent; Makismova, Yelena; Lezon-Geyda, Kimberly; Gallagher, Patrick G.

    2016-01-01

    Background CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC) and primary human erythroid cells from single donors. Results Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner. Conclusion These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis. PMID:27219007

  19. miR-214 protects erythroid cells against oxidative stress by targeting ATF4 and EZH2.

    PubMed

    Gao, Ming; Liu, Yun; Chen, Yue; Yin, Chunyang; Chen, Jane-Jane; Liu, Sijin

    2016-03-01

    Nuclear factor (erythroid-derived 2) like 2 (Nrf2) is a key regulator in protecting cells against stress by targeting many anti-stress response genes. Recent evidence also reveals that Nrf2 functions partially by targeting mircroRNAs (miRNAs). However, the understanding of Nrf2-mediated cytoprotection through miRNA-dependent mechanisms is largely unknown. In the current study, we identified a direct Nrf2 targeting miRNA, miR-214, and demonstrated a protective role of miR-214 in erythroid cells against oxidative stresses generated by radiation, excess iron and arsenic (As) exposure. miR-214 expression was transcriptionally repressed by Nrf2 through a canonical antioxidant response element (ARE) within its promoter region, and this repression is ROS-dependence. The suppression of miR-214 by Nrf2 could antagonize oxidative stress-induced cell death in erythroid cells by two ways. First, miR-214 directly targeted ATF4, a crucial transcriptional factor involved in anti-stress responses, down regulation of miR-214 releases the repression of ATF4 translation and leads to increased ATF4 protein content. Second, miR-214 was able to prevent cell death by targeting EZH2, the catalytic core component of PRC2 complex that is responsible for tri-methylation reaction at lysine 27 (K27) of histone 3 (H3) (H3K27me3), by which As-induced miR-214 reduction resulted in an increased global H3K27me3 level and a compromised overexpression of a pro-apoptotic gene Bim. These two pathways downstream of miR-214 synergistically cooperated to antagonize erythroid cell death upon oxidative stress. Our combined data revealed a protective role of miR-214 signaling in erythroid cells against oxidative stress, and also shed new light on Nrf2-mediated cytoprotective machinery. PMID:26791102

  20. Nuclear erythroid 2-related factor 2: a novel potential therapeutic target for liver fibrosis.

    PubMed

    Yang, Jing-Jing; Tao, Hui; Huang, Cheng; Li, Jun

    2013-09-01

    Hepatic stellate cells (HSC) are the key fibrogenic cells of the liver. HSC activation is a process of cellular transdifferentiation that occurs upon liver injury, but the mechanisms underlying liver fibrosis are unknown. Nuclear erythroid 2-related factor 2 (Nrf2) is an oxidative stress-mediated transcription factor with a variety of downstream targets aimed at cytoprotection. However, Nrf2 has recently been implicated as a new therapeutic target for the treatment of liver fibrosis. This review focuses on the transcriptional repressors that either control liver injury or regulate specific fibrogenic functions of liver fibrosis. We also show that Nrf2 may reveal significant gene expression changes, suggesting that Nrf2 activation may ameliorate liver fibrosis. PMID:23793039

  1. Restoration of hemoglobin A synthesis in erythroid cells from peripheral blood of thalassemic patients

    PubMed Central

    Lacerra, Giuseppina; Sierakowska, Halina; Carestia, Clementina; Fucharoen, Suthat; Summerton, James; Weller, Dwight; Kole, Ryszard

    2000-01-01

    Mononuclear cells from peripheral blood of thalassemic patients were treated with morpholino oligonucleotides antisense to aberrant splice sites in mutant β-globin precursor mRNAs (pre-mRNAs). The oligonucleotides restored correct splicing and translation of β-globin mRNA, increasing the hemoglobin (Hb) A synthesis in erythroid cells from patients with IVS2–654/βE, IVS2–745/IVS2–745, and IVS2–745/IVS2–1 genotypes. The maximal Hb A level for repaired IVS2–745 mutation was ≈30% of normal; Hb A was still detectable 9 days after a single treatment with oligonucleotide. Thus, expression of defective β-globin genes was repaired and significant level of Hb A was restored in a cell population that would be targeted in clinical applications of this approach. PMID:10944225

  2. Nuclear Factor-Erythroid-2-Related Factor 2 in Aging and Lung Fibrosis.

    PubMed

    Swamy, Shobha M; Rajasekaran, Namakkal S; Thannickal, Victor J

    2016-07-01

    Aging and age-related diseases have been associated with elevated oxidative stress, which may be related to increased production of reactive species and/or a deficiency in antioxidant defenses. The nuclear factor-erythroid-2-related factor 2 (Nrf2)-mediated antioxidant response pathway maintains cellular reduction-oxidation homeostasis by inducing the transcription of an array of cytoprotective genes. However, there is evidence of impaired Nrf2 response in aging contributing to age-related fibrotic diseases. Herein, we review mechanisms for the dysregulation of Nrf2 signaling in aging. This understanding will pave the way for the design of novel therapeutic strategies that restore Nrf2 signaling to reestablish cellular homeostasis in aging and age-related fibrotic diseases. PMID:27338106

  3. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    PubMed

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  4. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    PubMed Central

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  5. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )

    1993-10-01

    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  6. miR-451 protects against erythroid oxidant stress by repressing 14-3-3zeta.

    PubMed

    Yu, Duonan; dos Santos, Camila O; Zhao, Guowei; Jiang, Jing; Amigo, Julio D; Khandros, Eugene; Dore, Louis C; Yao, Yu; D'Souza, Janine; Zhang, Zhe; Ghaffari, Saghi; Choi, John; Friend, Sherree; Tong, Wei; Orange, Jordan S; Paw, Barry H; Weiss, Mitchell J

    2010-08-01

    The bicistronic microRNA (miRNA) locus miR-144/451 is highly expressed during erythrocyte development, although its physiological roles are poorly understood. We show that miR-144/451 ablation in mice causes mild erythrocyte instability and increased susceptibility to damage after exposure to oxidant drugs. This phenotype is deeply conserved, as miR-451 depletion synergizes with oxidant stress to cause profound anemia in zebrafish embryos. At least some protective activities of miR-451 stem from its ability to directly suppress production of 14-3-3zeta, a phospho-serine/threonine-binding protein that inhibits nuclear accumulation of transcription factor FoxO3, a positive regulator of erythroid anti-oxidant genes. Thus, in miR-144/451(-/-) erythroblasts, 14-3-3zeta accumulates, causing partial relocalization of FoxO3 from nucleus to cytoplasm with dampening of its transcriptional program, including anti-oxidant-encoding genes Cat and Gpx1. Supporting this mechanism, overexpression of 14-3-3zeta in erythroid cells and fibroblasts inhibits nuclear localization and activity of FoxO3. Moreover, shRNA suppression of 14-3-3zeta protects miR-144/451(-/-) erythrocytes against peroxide-induced destruction, and restores catalase activity. Our findings define a novel miRNA-regulated pathway that protects erythrocytes against oxidant stress, and, more generally, illustrate how a miRNA can influence gene expression by altering the activity of a key transcription factor. PMID:20679398

  7. The Effect of Baicalin as A PPAR Activator on Erythroid Differentiation of CD133+Hematopoietic Stem Cells in Umbilical Cord Blood

    PubMed Central

    Abbasi, Parvaneh; Shamsasenjan, Karim; Movassaghpour Akbari, Ali Akbar; Akbarzadehlaleh, Parvin; Dehdilani, Nima; Ejtehadifar, Mostafa

    2015-01-01

    Objective The peroxisome proliferator-activated receptors (PPARs) are a group of nu- clear receptor proteins whose functions as transcription factors regulate gene expres- sions. PPARs play essential roles in the regulation of cellular differentiation, development, and metabolism (carbohydrate, lipid, protein), and tumorigenesis of higher organisms. This study attempts to determine the effect of baicalin, a PPARγ activator, on erythroid differentiation of cluster of differentiation 133+(CD133+) cord blood hematopoietic stem cells (HSCs). Materials and Methods In this experimental study, in order to investigate the effects of the PPARγ agonists baicalin and troglitazone on erythropoiesis, we isolated CD133+ cells from human umbilical cord blood using the MACS method. Isolated cells were cultured in erythroid-inducing medium with or without various amounts of the two PPARγ activa- tors (baicalin and troglitazone). Erythroid differentiation of CD133+cord blood HSCs were assessed using microscopic morphology analysis, flow cytometric analysis of erythroid surface markers transferrin receptor (TfR) and glycophorin A (GPA) and bycolony forming assay. Results Microscopic and flow cytometric analysis revealed the erythroid differentiation of CD133+cord blood HSCs under applied erythroid inducing conditions. Our flow cytometric data showed that the TfR and GPA positive cell population diminished significantly in the presence of either troglitazone or baicalin. The suppression of erythroid differentiation in response to PPARγ agonists was dose-dependent. Erythroid colony-forming ability of HSC decreased significantly after treatment with both PPARγ agonists but troglitazone had a markedly greater effect. Conclusion Our results have demonstrated that PPARγ agonists modulate erythroid dif- ferentiation of CD133+HSCs, and therefore play an important role in regulation of normal erythropoiesis under physiologic conditions. Thus, considering the availability and applica

  8. Turbulence in pure superfluid flow

    SciTech Connect

    Ashton, R.A.; Opatowsky, L.B.; Tough, J.T.

    1981-03-09

    A series of experiments is described which provide an unambiguous description of the steady-state properties of turbulence in pure superfluid flow. The turbulence is qualitatively different from that observed in counterflow but comparable to the homogeneous turbulence described by theory.

  9. Production of substantially pure fructose

    DOEpatents

    Hatcher, Herbert J.; Gallian, John J.; Leeper, Stephen A.

    1990-01-01

    A process is disclosed for the production of substantially pure fructose from sucrose-containing substrates. The process comprises converting the sucrose to levan and glucose, purifying the levan by membrane technology, hydrolyzing the levan to form fructose monomers, and recovering the fructose.

  10. Increase of microRNA-210, Decrease of Raptor Gene Expression and Alteration of Mammalian Target of Rapamycin Regulated Proteins following Mithramycin Treatment of Human Erythroid Cells

    PubMed Central

    Bianchi, Nicoletta; Finotti, Alessia; Ferracin, Manuela; Lampronti, Ilaria; Zuccato, Cristina; Breveglieri, Giulia; Brognara, Eleonora; Fabbri, Enrica; Borgatti, Monica; Negrini, Massimo; Gambari, Roberto

    2015-01-01

    Expression and regulation of microRNAs is an emerging issue in erythroid differentiation and globin gene expression in hemoglobin disorders. In the first part of this study microarray analysis was performed both in mithramycin-induced K562 cells and erythroid precursors from healthy subjects or β-thalassemia patients producing low or high levels of fetal hemoglobin. We demonstrated that: (a) microRNA-210 expression is higher in erythroid precursors from β-thalassemia patients with high production of fetal hemoglobin; (b) microRNA-210 increases as a consequence of mithramycin treatment of K562 cells and human erythroid progenitors both from healthy and β-thalassemia subjects; (c) this increase is associated with erythroid induction and elevated expression of γ-globin genes; (d) an anti-microRNA against microRNA-210 interferes with the mithramycin-induced changes of gene expression. In the second part of the study we have obtained convergent evidences suggesting raptor mRNA as a putative target of microRNA-210. Indeed, microRNA-210 binding sites of its 3’-UTR region were involved in expression and are targets of microRNA-210-mediated modulation in a luciferase reporter assays. Furthermore, (i) raptor mRNA and protein are down-regulated upon mithramycin-induction both in K562 cells and erythroid progenitors from healthy and β-thalassemia subjects. In addition, (ii) administration of anti-microRNA-210 to K562 cells decreased endogenous microRNA-210 and increased raptor mRNA and protein expression. Finally, (iii) treatment of K562 cells with premicroRNA-210 led to a decrease of raptor mRNA and protein. In conclusion, microRNA-210 and raptor are involved in mithramycin-mediated erythroid differentiation of K562 cells and participate to the fine-tuning and control of γ-globin gene expression in erythroid precursor cells. PMID:25849663

  11. Canonical Thermal Pure Quantum State

    NASA Astrophysics Data System (ADS)

    Sugiura, Sho; Shimizu, Akira

    2013-07-01

    A thermal equilibrium state of a quantum many-body system can be represented by a typical pure state, which we call a thermal pure quantum (TPQ) state. We construct the canonical TPQ state, which corresponds to the canonical ensemble of the conventional statistical mechanics. It is related to the microcanonical TPQ state, which corresponds to the microcanonical ensemble, by simple analytic transformations. Both TPQ states give identical thermodynamic results, if both ensembles do, in the thermodynamic limit. The TPQ states corresponding to other ensembles can also be constructed. We have thus established the TPQ formulation of statistical mechanics, according to which all quantities of statistical-mechanical interest are obtained from a single realization of any TPQ state. We also show that it has great advantages in practical applications. As an illustration, we study the spin-1/2 kagome Heisenberg antiferromagnet.

  12. The DEK Oncoprotein Is a Critical Component of the EKLF/KLF1 Enhancer in Erythroid Cells

    PubMed Central

    Lohmann, Felix; Dangeti, Mohan; Soni, Shefali; Chen, Xiaoyong; Planutis, Antanas; Baron, Margaret H.; Choi, Kyunghee

    2015-01-01

    Understanding how transcriptional regulators are themselves controlled is important in attaining a complete picture of the intracellular effects that follow signaling cascades during early development and cell-restricted differentiation. We have addressed this issue by focusing on the regulation of EKLF/KLF1, a zinc finger transcription factor that plays a necessary role in the global regulation of erythroid gene expression. Using biochemical affinity purification, we have identified the DEK oncoprotein as a critical factor that interacts with an essential upstream enhancer element of the EKLF promoter and exerts a positive effect on EKLF levels. This element also binds a core set of erythroid transcription factors, suggesting that DEK is part of a tissue-restricted enhanceosome that contains BMP4-dependent and -independent components. Together with local enrichment of properly coded histones and an open chromatin domain, optimal transcriptional activation of the EKLF locus can be established. PMID:26303528

  13. TRPC3 is the erythropoietin-regulated calcium channel in human erythroid cells.

    PubMed

    Tong, Qin; Hirschler-Laszkiewicz, Iwona; Zhang, Wenyi; Conrad, Kathleen; Neagley, David W; Barber, Dwayne L; Cheung, Joseph Y; Miller, Barbara A

    2008-04-18

    Erythropoietin (Epo) stimulates a significant increase in the intracellular calcium concentration ([Ca(2+)](i)) through activation of the murine transient receptor potential channel TRPC2, but TRPC2 is a pseudogene in humans. TRPC3 expression increases on normal human erythroid progenitors during differentiation. Here, we determined that erythropoietin regulates calcium influx through TRPC3. Epo stimulation of HEK 293T cells transfected with Epo receptor and TRPC3 resulted in a dose-dependent increase in [Ca(2+)](i), which required extracellular calcium influx. Treatment with the phospholipase C (PLC) inhibitor U-73122 or down-regulation of PLCgamma1 by RNA interference inhibited the Epo-stimulated increase in [Ca(2+)](i) in TRPC3-transfected HEK 293T cells and in primary human erythroid precursors, demonstrating a requirement for PLC. TRPC3 associated with PLCgamma, and substitution of predicted PLCgamma Src homology 2 binding sites (Y226F, Y555F, Y648F, and Y674F) on TRPC3 reduced the interaction of TRPC3 with PLCgamma and inhibited the rise in [Ca(2+)](i). Substitution of Tyr(226) alone with phenylalanine significantly reduced the Epo-stimulated increase in [Ca(2+)](i) but not the association of PLCgamma with TRPC3. PLC activation results in production of inositol 1,4,5-trisphosphate (IP(3)). To determine whether IP(3) is involved in Epo activation of TRPC3, TRPC3 mutants were prepared with substitution or deletion of COOH-terminal IP(3) receptor (IP(3)R) binding domains. In cells expressing TRPC3 with mutant IP(3)R binding sites and Epo receptor, interaction of IP(3)R with TRPC3 was abolished, and Epo-modulated increase in [Ca(2+)](i) was reduced. Our data demonstrate that Epo modulates TRPC3 activation through a PLCgamma-mediated process that requires interaction of PLCgamma and IP(3)R with TRPC3. They also show that TRPC3 Tyr(226) is critical in Epo-dependent activation of TRPC3. These data demonstrate a redundancy of TRPC channel activation mechanisms by

  14. Transcription factor nuclear factor erythroid-2 mediates expression of the cytokine interleukin 8, a known predictor of inferior outcome in patients with myeloproliferative neoplasms

    PubMed Central

    Wehrle, Julius; Seeger, Thalia S.; Schwemmers, Sven; Pfeifer, Dietmar; Bulashevska, Alla; Pahl, Heike L.

    2013-01-01

    The transcription factor nuclear factor erythroid-2 is over-expressed in patients with myeloproliferative neoplasms irrespective of the presence of the JAK2V617F mutation. Our transgenic mouse model over-expressing nuclear factor erythroid-2, which recapitulates many features of myeloproliferative neoplasms including transformation to acute myeloid leukemia, clearly implicates this transcription factor in the pathophysiology of myeloproliferative neoplasms. Because the targets mediating nuclear factor erythroid-2 effects are not well characterized, we conducted microarray analysis of CD34+ cells lentivirally transduced to over-express nuclear factor erythroid-2 or to silence this transcription factor via shRNA, in order to identify novel target genes. Here, we report that the cytokine interleukin 8 is a novel target gene. Nuclear factor erythroid-2 directly binds the interleukin 8 promoter in vivo, and these binding sites are required for promoter activity. Serum levels of interleukin 8 are known to be elevated in both polycythemia vera and primary myelofibrosis patients. Recently, increased interleukin 8 levels have been shown to be predictive of inferior survival in primary myelofibrosis patients in multivariate analysis. Therefore, one of the mechanisms by which nuclear factor erythroid-2 contributes to myeloproliferative neoplasm pathology may be increased interleukin 8 expression. PMID:23445878

  15. Dissection of the erythroid-specific transcriptional promoter used by the gene encoding aminolevulinic acid dehydratase (ALAD)

    SciTech Connect

    Bishop, T.R.; Schaffer, T.; Pien, B.

    1994-09-01

    The gene encoding delta-aminolevulinate dehydratase (ALAD), the second enzyme of the heme biosynthetic pathway, exists as a single gene in most mammalian genomes and we have sequenced over 12 kb from overlapping lambda clones containing the murine ALAD gene. The gene has a dual promoter driving expression of two different first exons; exon1A is expressed in all tissues and exon1B only in erythroid cells, where heme production is induced to exceptionally high levels for hemoglobin synthesis. Erythroid-specific expression of the ALAD gene is presumably accomplished by using the exon1B promoter which we hypothesize is responsive to erythroid-specific transcriptional activators. In order to test this, we have used gel mobility shift assays and DNase footprint analyses to dissect and identify the critical upstream regulatory elements. Nuclear extracts, prepared from murine erythroleukemia cells (MELC), human chronic myelogenous leukemia cell line (K562) and human fibroblast cell line (HeLa), were used as sources of proteins to analyze DNA binding sites in the ALAD erythroid-specific promoter from -307 to +1. In this region, there are three potential GATA1 sites, two CACCC boxes, a CCAAT box and a GGTGG box. NF-E2 sites were explored by using in vitro translation products of cloned p18 and p45, the two heterologous components of NF-E2, and successfully gel-shifted a 29 bp double-stranded oligo found at 2.6 kb in front of the ALAD gene. Thus, the ALAD gene utilizes both a housekeeping and a tissue-specific promoter.

  16. Murine erythroid 5-aminolevulinate synthase: Truncation of a disordered N-terminal extension is not detrimental for catalysis.

    PubMed

    Stojanovski, Bosko M; Breydo, Leonid; Uversky, Vladimir N; Ferreira, Gloria C

    2016-05-01

    5-Aminolevulinate synthase (ALAS), a pyridoxal 5'-phosphate (PLP)-dependent homodimeric enzyme, catalyzes the initial step of heme biosynthesis in non-plant eukaryotes. The precursor form of the enzyme is translated in the cytosol, and upon mitochondrial import, the N-terminal targeting presequence is proteolytically cleaved to generate mature ALAS. In bone marrow-derived erythroid cells, a mitochondrial- and site-specific endoprotease of yet unknown primary structure, produces a protein shorter than mature erythroid ALAS (ALAS2) found in peripheral blood erythroid cells. This truncated ALAS2 lacks the presequence and the N-terminal sequence (corresponding to ~7 KDa molecular mass) present in ALAS2 from peripheral blood erythroid cells. How the truncation affects the structural topology and catalytic properties of ALAS2 is presently not known. To address this question, we created a recombinant, truncated, murine ALAS2 (ΔmALAS2) devoid of the cleavable N-terminal region and examined its catalytic and biophysical properties. The N-terminal truncation of mALAS2 did not significantly affect the organization of the secondary structure, but a subtle reduction in the rigidity of the tertiary structure was noted. Furthermore, thermal denaturation studies revealed a decrease of 4.3°C in the Tm value of ΔmALAS2, implicating lower thermal stability. While the kcat of ΔmALAS2 is slightly increased over that of the wild-type enzyme, the slowest step in the ΔmALAS2-catalyzed reaction remains dominated by ALA release. Importantly, intrinsic disorder algorithms imply that the N-terminal region of mALAS2 is highly disordered, and thus susceptible to proteolysis. We propose that the N-terminal truncation offers a cell-specific ALAS2 regulatory mechanism without hindering heme synthesis. PMID:26854603

  17. Complex patterns of sequence variation and multiple 5' and 3' ends are found among transcripts of the erythroid ankyrin gene.

    PubMed

    Birkenmeier, C S; White, R A; Peters, L L; Hall, E J; Lux, S E; Barker, J E

    1993-05-01

    The structural protein ankyrin functions in red blood cells to link the spectrin-based membrane skeleton to the plasma membrane. Ankyrin proteins are now known to occur in most cell types, and two distinct ankyrin genes have been identified (erythroid (Ank-1) and brain (Ank-2)). We have characterized transcripts of the mouse erythroid ankyrin gene by cDNA cloning and DNA sequencing. Ank-1 transcripts of 7.5 and 9.0 kilobases are found in erythroid tissues, and a 9.0-kilobase transcript is found in cerebellum. RNA hybridization blot analysis of 13 additional mouse tissues has detected four novel Ank-1 transcripts (5.0, 3.5, 2.0, and 1.6 kilobases in size). Sequencing of Ank-1 cDNA clones isolated from mouse reticulocyte, spleen, and cerebellar libraries has identified (i) multiple 5' ends that indicate possible multiple promoters; (ii) alternative polyadenylation sites that probably account for the 7.5- and 9.0-kilobase size difference; (iii) a variety of small insertions and deletions that could produce transcripts (and ultimately proteins) of nearly identical size, but different functions; and (iv) clones with large deletions of coding sequence that account for the smaller transcripts seen in spleen, skeletal muscle, and heart. PMID:8486643

  18. Glucocorticoids improve erythroid progenitor maintenance and dampen Trp53 response in a mouse model of Diamond-Blackfan anaemia.

    PubMed

    Sjögren, Sara E; Siva, Kavitha; Soneji, Shamit; George, Amee J; Winkler, Marcus; Jaako, Pekka; Wlodarski, Marcin; Karlsson, Stefan; Hannan, Ross D; Flygare, Johan

    2015-11-01

    Diamond-Blackfan anaemia (DBA) is a rare congenital disease causing severe anaemia and progressive bone marrow failure. The majority of patients carry mutations in ribosomal proteins, which leads to depletion of erythroid progenitors in the bone marrow. As many as 40% of all DBA patients receive glucocorticoids to alleviate their anaemia. However, despite their use in DBA treatment for more than half a century, the therapeutic mechanisms of glucocorticoids remain largely unknown. Therefore we sought to study disease specific effects of glucocorticoid treatment using a ribosomal protein s19 (Rps19) deficient mouse model of DBA. This study determines for the first time that a mouse model of DBA can respond to glucocorticoid treatment, similar to DBA patients. Our results demonstrate that glucocorticoid treatment reduces apoptosis, rescues erythroid progenitor depletion and premature differentiation of erythroid cells. Furthermore, glucocorticoids prevent Trp53 activation in Rps19-deficient cells- in a disease-specific manner. Dissecting the therapeutic mechanisms behind glucocorticoid treatment of DBA provides indispensible insight into DBA pathogenesis. Identifying mechanisms important for DBA treatment also enables development of more disease-specific treatments of DBA. PMID:26305041

  19. Inactivation of Rb and E2f8 Synergizes To Trigger Stressed DNA Replication during Erythroid Terminal Differentiation

    PubMed Central

    Ghazaryan, Seda; Sy, Chandler; Hu, Tinghui; An, Xiuli; Mohandas, Narla; Fu, Haiqing; Aladjem, Mirit I.; Chang, Victor T.; Opavsky, Rene

    2014-01-01

    Rb is critical for promoting cell cycle exit in cells undergoing terminal differentiation. Here we show that during erythroid terminal differentiation, Rb plays a previously unappreciated and unorthodox role in promoting DNA replication and cell cycle progression. Specifically, inactivation of Rb in erythroid cells led to stressed DNA replication, increased DNA damage, and impaired cell cycle progression, culminating in defective terminal differentiation and anemia. Importantly, all of these defects associated with Rb loss were exacerbated by the concomitant inactivation of E2f8. Gene expression profiling and chromatin immunoprecipitation (ChIP) revealed that Rb and E2F8 cosuppressed a large array of E2F target genes that are critical for DNA replication and cell cycle progression. Remarkably, inactivation of E2f2 rescued the erythropoietic defects resulting from Rb and E2f8 deficiencies. Interestingly, real-time quantitative PCR (qPCR) on E2F2 ChIPs indicated that inactivation of Rb and E2f8 synergizes to increase E2F2 binding to its target gene promoters. Taken together, we propose that Rb and E2F8 collaborate to promote DNA replication and erythroid terminal differentiation by preventing E2F2-mediated aberrant transcriptional activation through the ability of Rb to bind and sequester E2F2 and the ability of E2F8 to compete with E2F2 for E2f-binding sites on target gene promoters. PMID:24865965

  20. The heme exporter Flvcr1 regulates expansion and differentiation of committed erythroid progenitors by controlling intracellular heme accumulation.

    PubMed

    Mercurio, Sonia; Petrillo, Sara; Chiabrando, Deborah; Bassi, Zuni Irma; Gays, Dafne; Camporeale, Annalisa; Vacaru, Andrei; Miniscalco, Barbara; Valperga, Giulio; Silengo, Lorenzo; Altruda, Fiorella; Baron, Margaret H; Santoro, Massimo Mattia; Tolosano, Emanuela

    2015-06-01

    Feline leukemia virus subgroup C receptor 1 (Flvcr1) encodes two heme exporters: FLVCR1a, which localizes to the plasma membrane, and FLVCR1b, which localizes to mitochondria. Here, we investigated the role of the two Flvcr1 isoforms during erythropoiesis. We showed that, in mice and zebrafish, Flvcr1a is required for the expansion of committed erythroid progenitors but cannot drive their terminal differentiation, while Flvcr1b contributes to the expansion phase and is required for differentiation. FLVCR1a-down-regulated K562 cells have defective proliferation, enhanced differentiation, and heme loading in the cytosol, while FLVCR1a/1b-deficient K562 cells show impairment in both proliferation and differentiation, and accumulate heme in mitochondria. These data support a model in which the coordinated expression of Flvcr1a and Flvcr1b contributes to control the size of the cytosolic heme pool required to sustain metabolic activity during the expansion of erythroid progenitors and to allow hemoglobinization during their terminal maturation. Consistently, reduction or increase of the cytosolic heme rescued the erythroid defects in zebrafish deficient in Flvcr1a or Flvcr1b, respectively. Thus, heme export represents a tightly regulated process that controls erythropoiesis. PMID:25795718

  1. Pure red-cell aplasia as the presenting feature of the carcionoid tumor of the thymus: case report.

    PubMed

    Petakov, S M; Suvajdzić, N; Petakov, D M; Sefer, D; Ognjanović, S; Macut, D; Durović, M; Isailović, T; Subotić, D; Stojsić, J; Todorović, V; Damjanović, S

    2010-03-01

    Acquired pure red-cell aplasia (PRCA) is an uncommon disorder of erythrocytopoiesis that can develop in association with thymic tumors. We present the very rare case of a severely anemic 62-year-old man with PRCA and a concurrent neuroendocrine carcinoid tumor of the thymus. The anterior mediastinal thymus tumor was completely excised, and following histological and immunohistochemical analyses (showing positive staining for cytokeratin, chromogranin A, synaptophysin, and neuron-specific enolase) the diagnosis of a (grade I; T(1)N(0)M(0)) typical carcinoid tumor of the thymus was made. Postoperatively the anemia persisted despite no signs of residual tumor on CT chest. A hematological work up found: normocellularity with <0.5% erythroblasts and preserved megakaryocytopoiesis and granulocytopoiesis in a trephine biopsy; reduced numbers of Colony Forming Unit Erythroid (CFU-E) and normal numbers of Burst-Forming Unit Erythroid (BFU-E) in bone marrow colony-forming assays; a markedly increased level of serum erythropoietin; normal T and B-cell numbers with a normal CD4/CD8 ratio; and no clonal T-cell receptor -gamma and -delta gene rearrangement) The patient responded favorably to a therapeutic trial of glucocorticoid immunosuppressive treatment (prednisone 1 mg/kg/day) with a normalization of the reticulocyte count and hematocrit, suggesting an immunologic mechanism for the PRCA. Though the exact mechanisms underlying the association between the PRCA and the carcinoid tumor of the thymus remain unknown. PMID:19224408

  2. Krüppel-like Factor 4 activates HBG gene expression in primary erythroid cells

    PubMed Central

    Kalra, Inderdeep S.; Alam, Md M.; Choudhary, Pankaj K.; Pace, Betty S.

    2014-01-01

    Summary The SP1/Krüppel-like Factor (SP1/KLF) family of transcription factors plays a role in diverse cellular processes, including proliferation, differentiation and control of gene transcription. The discovery of KLF1 (EKLF), a key regulator of HBB (β-globin) gene expression, expanded our understanding of the role of KLFs in erythropoiesis. In this study, we investigated a mechanism of HBG (γ-globin) regulation by KLF4. siRNA-mediated gene silencing and enforced expression of KLF4 in K562 cells substantiated the ability of KLF4 to positively regulate endogenous HBG gene transcription. The physiological significance of this finding was confirmed in primary erythroid cells, where KLF4 knockdown at day 11 significantly attenuated HBG mRNA levels and enforced expression at day 28 stimulated the silenced HBG genes. In vitro binding characterization using the γ-CACCC and β-CACCC probes demonstrated KLF4 preferentially binds the endogenous γ-CACCC, while CREB binding protein (CREBBP) binding was not selective. Co-immunoprecipitation studies confirmed protein-protein interaction between KLF4 and CREBBP. Furthermore, sequential chromatin immunoprecipitation assays showed co-localization of both factors in the γ-CACCC region. Subsequent luciferase reporter studies demonstrated that KLF4 trans-activated HBG promoter activity and that CREBBP enforced expression resulted in gene repression. Our data supports a model of antagonistic interaction of KLF4/CREBBP trans-factors in HBG regulation. PMID:21539536

  3. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival

    PubMed Central

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I.; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E.; Natarajan, Viswanathan; Jacobson, Jeffrey R.; Zhang, Donna D.; Garcia, Joe G. N.; Wang, Ting

    2015-01-01

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer. PMID:26596768

  4. Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

    PubMed

    Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

    2016-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  5. Inducible Gata1 suppression expands megakaryocyte-erythroid progenitors from embryonic stem cells

    PubMed Central

    Noh, Ji-Yoon; Gandre-Babbe, Shilpa; Wang, Yuhuan; Hayes, Vincent; Yao, Yu; Gadue, Paul; Sullivan, Spencer K.; Chou, Stella T.; Machlus, Kellie R.; Italiano, Joseph E.; Kyba, Michael; Finkelstein, David; Ulirsch, Jacob C.; Sankaran, Vijay G.; French, Deborah L.; Poncz, Mortimer; Weiss, Mitchell J.

    2015-01-01

    Transfusion of donor-derived platelets is commonly used for thrombocytopenia, which results from a variety of clinical conditions and relies on a constant donor supply due to the limited shelf life of these cells. Embryonic stem (ES) and induced pluripotent stem (iPS) cells represent a potential source of megakaryocytes and platelets for transfusion therapies; however, the majority of current ES/iPS cell differentiation protocols are limited by low yields of hematopoietic progeny. In both mice and humans, mutations in the gene-encoding transcription factor GATA1 cause an accumulation of proliferating, developmentally arrested megakaryocytes, suggesting that GATA1 suppression in ES and iPS cell–derived hematopoietic progenitors may enhance megakaryocyte production. Here, we engineered ES cells from WT mice to express a doxycycline-regulated (dox-regulated) shRNA that targets Gata1 transcripts for degradation. Differentiation of these cells in the presence of dox and thrombopoietin (TPO) resulted in an exponential (at least 1013-fold) expansion of immature hematopoietic progenitors. Dox withdrawal in combination with multilineage cytokines restored GATA1 expression, resulting in differentiation into erythroblasts and megakaryocytes. Following transfusion into recipient animals, these dox-deprived mature megakaryocytes generated functional platelets. Our findings provide a readily reproducible strategy to exponentially expand ES cell–derived megakaryocyte-erythroid progenitors that have the capacity to differentiate into functional platelet-producing megakaryocytes. PMID:25961454

  6. Chelation efficacy and erythroid response during deferasirox treatment in patients with myeloproliferative neoplasms in fibrotic phase.

    PubMed

    Latagliata, Roberto; Montagna, Chiara; Porrini, Raffaele; Di Veroli, Ambra; Leonetti, Sabrina Crescenzi; Niscola, Pasquale; Ciccone, Fabrizio; Spadea, Antonio; Breccia, Massimo; Maurillo, Luca; Rago, Angela; Spirito, Francesca; Cedrone, Michele; De Muro, Marianna; Montanaro, Marco; Andriani, Alessandro; Bagnato, Antonino; Montefusco, Enrico; Alimena, Giuliana

    2016-06-01

    At present, very few data are available on deferasirox (DFX) in the treatment of patients with Philadelphia-negative myeloproliferative neoplasms in fibrotic phase (FP-MPN) and transfusion dependence. To address this issue, a retrospective analysis of 28 patients (22 male and 6 female) with FP-MPN and iron overload secondary to transfusion dependence was performed, based on patients enrolled in the database of our regional cooperative group who received treatment with DFX. DFX was started after a median interval from diagnosis of 12.8 months (IR 7.1-43.1) with median ferritin values of 1415 ng/mL (IR 1168-1768). Extra-hematological toxicity was reported in 16 of 28 patients (57.1%), but only two patients discontinued treatment due to toxicity. Among 26 patients evaluable for response (≥6 months of treatment), after a median treatment period of 15.4 months (IR 8.1-22.3), 11 patients (42.3%) achieved a stable and consistent reduction in ferritin levels <1000 ng/mL. As for hematological improvement, 6 of 26 patients (23%) showed a persistent (>3 months) rise of Hb levels >1.5 g/dL, with disappearance of transfusion dependence in four cases. Treatment with DFX is feasible and effective in FP-MPN with iron overload. Moreover, in this setting, an erythroid response can occur in a significant proportion of patients. PMID:26277477

  7. Erythropoietin, a Novel Versatile Player Regulating Energy Metabolism beyond the Erythroid System

    PubMed Central

    Wang, Li; Di, Lijun; Noguchi, Constance Tom

    2014-01-01

    Erythropoietin (EPO), the required cytokine for promoting the proliferation and differentiation of erythroid cells to stimulate erythropoiesis, has been reported to act as a pleiotropic cytokine beyond hematopoietic system. The various activities of EPO are determined by the widespread distribution of its cell surface EPO receptor (EpoR) in multiple tissues including endothelial, neural, myoblasts, adipocytes and other cell types. EPO activity has been linked to angiogenesis, neuroprotection, cardioprotection, stress protection, anti-inflammation and especially the energy metabolism regulation that is recently revealed. The investigations of EPO activity in animals and the expression analysis of EpoR provide more insights on the potential of EPO in regulating energy metabolism and homeostasis. The findings of crosstalk between EPO and some important energy sensors and the regulation of EPO in the cellular respiration and mitochondrial function further provide molecular mechanisms for EPO activity in metabolic activity regulation. In this review, we will summarize the roles of EPO in energy metabolism regulation and the activity of EPO in tissues that are tightly associated with energy metabolism. We will also discuss the effects of EPO in regulating oxidative metabolism and mitochondrial function, the interactions between EPO and important energy regulation factors, and the protective role of EPO from stresses that are related to metabolism, providing a brief overview of previously less appreciated EPO biological function in energy metabolism and homeostasis. PMID:25170305

  8. The structure and organization of the human erythroid anion exchanger (AE1) gene

    SciTech Connect

    Sahr, K.E.; Taylor, W.M.; Daniels, B.P.

    1994-12-01

    The AE1 (anion exchanger, band 3) protein is expressed in erythrocytes and in the A-type intercalated cells of the kidney distal collecting tubule. In both cell types it mediates the electroneutral transport of chloride and bicarbonate ions across the lipid bilayer, and, in erythrocytes, it also serves as the critical attachment site of the peripheral membrane skeleton. We have characterized the human AE1 gene using overlapping clones isolated from a phage library of human genomic DNA. The gene spans {approximately}20 kb and consists of 20 exons separated by 19 introns. The structure of the human AE1 gene corresponds closely with that of the previously characterized mouse AE1 gene, with a high degree of conservation of exon/intron junctions, as well as exon and intron nucleotide sequences. The putative upstream and internal promoter sequences of the human AE1 gene used in erythroid and kidney cells, respectively, are described. We also report the nucleotide sequence of the entire 3{prime} noncoding region of exon 20, which was lacking in the published cDNA sequences. In addition, we have characterized 9 Alu repeat elements found within the body of the human AE1 gene that are members of 4 related subfamilies that appear to have entered the genome at different times during primate evolution. 59 refs., 5 figs., 2 tabs.

  9. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival.

    PubMed

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E; Natarajan, Viswanathan; Jacobson, Jeffrey R; Zhang, Donna D; Garcia, Joe G N; Wang, Ting

    2015-01-01

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer. PMID:26596768

  10. Therapeutic Effects of Erythroid Differentiation Regulator 1 on Imiquimod-Induced Psoriasis-Like Skin Inflammation

    PubMed Central

    Kim, Kyung Eun; Houh, Younkyung; Park, Hyun Jeong; Cho, Daeho

    2016-01-01

    Psoriasis is a common skin disease accompanied by chronic inflammation. In previous studies, erythroid differentiation regulator 1 (ERDR1) was shown to have a negative correlation with proinflammatory cytokine IL-18. However, the role of ERDR1 in the inflammatory skin disease psoriasis has not been evaluated. In this study, to investigate the role of ERDR1 in psoriasis, recombinant ERDR1 was injected intraperitoneally into a psoriasis mouse model. Recombinant ERDR1 (rERDR1) significantly alleviated the symptoms of psoriasis-like skin inflammation and reduced the mRNA of various psoriasis-related markers, including keratin 14, S100A8, and Th17-related cytokines IL-17 and IL-22, suggesting that rERDR1 exerts therapeutic effects on psoriasis via the regulation of Th17 functions. Additionally, the expression of CCL20, a well-known Th17 attracting chemokine, was determined. CCL20 expression significantly decreased in the rERDR1-injected group compared with the vehicle (PBS)-injected group. CCR6 expression in the psoriatic lesional skin was also decreased by rERDR1 administration, implying the inhibition of CCR6-expressing Th17 cell chemotaxis via the downregulation of CCL20. Taken together, this study provides the first evidence that ERDR1 may be a potential therapeutic target for psoriasis. PMID:26901187

  11. FOXP1 Expression in Normal and Neoplastic Erythroid and Myeloid Cells.

    PubMed

    Lovrić, Eva; Pavlov, Katarina Horvat; Korać, Petra; Dominis, Mara

    2015-09-01

    FOXP1 protein was firstly analyzed in normal tissues, and afterwards in different tumor tissues, mainly carcinoma and lymphoma. In B-cell malignancies, its role was well explored; its expression was shown to be connected with disease prognosis in certain B-non Hodgkin lymphomas. In this study, 16 bone marrow trephine samples from patients with no hematopoietic malignancies and 10 samples from peripheral blood of healthy individuals were immunostained with anti-FOXP1 antibody. Positive cells in bone marrows were not only lymphocytes, but also cells that are immunohistochemically positive for glycophorin C or myeloperoxidase. Peripheral blood samples showed no other positive cells, but small round lymphocytes. Additionally 60 samples from patients with myeloid lineage neoplasms were analyzed. 25 samples from patients with myelodysplastic syndrome (MDS) and 35 patients with myeloproliferative disease (MPD) were double immunostained with anti-FOXP1/anti-glycophorin C and anti-FOXP1/anti-myeloperoxidase antibodies. FOXP1 was found to be expressed in 22 cases of MDS and in none of MPD cases. Its expression in MDS was observed mostly in myeloperoxidase positive cells in contrast to gylcophorin C positive cells. Only two cases revealed both myeloperoxidase positive cells and gylcophorin C positive cells expressing FOXP1 transcription factor. Our results show that FOXP1 is present in normal cells of erythroid and myeloid linages and thus suggest its possible role in development of all hematopoetic cells as well as possible involvement in neoplasm development of myeloid disorders. PMID:26898077

  12. Perturbation of nucleosome structure by the erythroid transcription factor GATA-1.

    PubMed

    Boyes, J; Omichinski, J; Clark, D; Pikaart, M; Felsenfeld, G

    1998-06-12

    The ability of transcription factors to gain access to their sites in chromatin requires the disruption or displacement of nucleosomes covering the promoter, signalled by the generation of a nuclease hypersensitive site. We characterise here the alterations in nucleosome structure caused by binding of the erythroid factor GATA-1 to a nucleosome carrying GATA-1 sites. DNase I and micrococcal nuclease probes show that GATA-1 binding causes extensive, cooperative breakage of the histone/DNA contacts to generate a complex very similar to that formed by the factor with free DNA. The only region which differs is confined to about 50 bp surrounding the nucleosome dyad axis which appears to be the domain of residual contact between the DNA and histone octamer. Despite considerable breakage of the histone/DNA contacts, the complex is completely stable in solution, and disruption of the nucleosome is entirely reversible: it is regenerated quantitatively upon removal of the transcription factor. Moreover, the histone 2A/2B component of the octamer does not exchange to external competitor. We suggest that formation of this complex may be a step in the generation of a fully hypersensitive site in vivo over regulatory elements containing GATA family binding sites. PMID:9641976

  13. Acute megakaryoblastic leukemia, unlike acute erythroid leukemia, predicts an unfavorable outcome after allogeneic HSCT.

    PubMed

    Ishiyama, Ken; Yamaguchi, Takuhiro; Eto, Tetsuya; Ohashi, Kazuteru; Uchida, Naoyuki; Kanamori, Heiwa; Fukuda, Takahiro; Miyamura, Koichi; Inoue, Yoshiko; Taguchi, Jun; Mori, Takehiko; Iwato, Koji; Morishima, Yasuo; Nagamura-Inoue, Tokiko; Atsuta, Yoshiko; Sakamaki, Hisashi; Takami, Akiyoshi

    2016-08-01

    Acute erythroid leukemia (FAB-M6) and acute megakaryoblastic leukemia (FAB-M7) exhibit closely related properties in cells regarding morphology and the gene expression profile. Although allogeneic hematopoietic stem cell transplantation (allo-HSCT) is considered the mainstay of the treatment for both subtypes of leukemia due to their refractoriness to chemotherapy and high rates of relapse, it remains unclear whether allo-HSCT is curative in such cases due to their scarcity. We retrospectively examined the impact of allo-HSCT in 382 patients with M6 and 108 patients with M7 using nationwide HSCT data and found the overall survival (OS) and relapse rates of the M6 patients to be significantly better than those of the M7 patients after adjusting for confounding factors and statistically comparable with those of the patients with M0/M1/M2/M4/M5 disease. Consequently, the factors of age, gender, performance status, karyotype, disease status at HSCT and development of graft-vs.-host disease predicted the OS for the M6 patients, while the performance status and disease status at HSCT were predictive of the OS for the M7 patients. These findings substantiate the importance of distinguishing between M6 and M7 in the HSCT setting and suggest that unknown mechanisms influence the HSCT outcomes of these closely related subtypes of leukemia. PMID:27244257

  14. Iron as the Key Modulator of Hepcidin Expression in Erythroid Antibody-Mediated Hypoplasia

    PubMed Central

    Fernandes, J. C.; Garrido, P.; Ribeiro, S.; Rocha-Pereira, P.; Bronze-da-Rocha, E.; Belo, L.; Costa, E.; Reis, F.; Santos-Silva, A.

    2014-01-01

    Erythroid hypoplasia (EH) is a rare complication associated with recombinant human erythropoietin (rHuEPO) therapies, due to development of anti-rHuEPO antibodies; however, the underlying mechanisms remain poorly clarified. Our aim was to manage a rat model of antibody-mediated EH induced by rHuEPO and study the impact on iron metabolism and erythropoiesis. Wistar rats treated during 9 weeks with a high rHuEPO dose (200 IU) developed EH, as shown by anemia, reduced erythroblasts, reticulocytopenia, and plasmatic anti-rHuEPO antibodies. Serum iron was increased and associated with mRNA overexpression of hepatic hepcidin and other iron regulatory mediators and downregulation of matriptase-2; overexpression of divalent metal transporter 1 and ferroportin was observed in duodenum and liver. Decreased EPO expression was observed in kidney and liver, while EPO receptor was overexpressed in liver. Endogenous EPO levels were normal, suggesting that anti-rHuEPO antibodies blunted EPO function. Our results suggest that anti-rHuEPO antibodies inhibit erythropoiesis causing anemia. This leads to a serum iron increase, which seems to stimulate hepcidin expression despite no evidence of inflammation, thus suggesting iron as the key modulator of hepcidin synthesis. These findings might contribute to improving new therapeutic strategies against rHuEPO resistance and/or development of antibody-mediated EH in patients under rHuEPO therapy. PMID:25580431

  15. pureS2HAT: S 2HAT-based Pure E/B Harmonic Transforms

    NASA Astrophysics Data System (ADS)

    Grain, J.; Stompor, R.; Tristram, M.

    2011-10-01

    The pS2HAT routines allow efficient, parallel calculation of the so-called 'pure' polarized multipoles. The computed multipole coefficients are equal to the standard pseudo-multipoles calculated for the apodized sky maps of the Stokes parameters Q and U subsequently corrected by so-called counterterms. If the applied apodizations fullfill certain boundary conditions, these multipoles correspond to the pure multipoles. Pure multipoles of one type, i.e., either E or B, are ensured not to contain contributions from the other one, at least to within numerical artifacts. They can be therefore further used in the estimation of the sky power spectra via the pseudo power spectrum technique, which has to however correctly account for the applied apodization on the one hand, and the presence of the counterterms, on the other. In addition, the package contains the routines permitting calculation of the spin-weighted apodizations, given an input scalar, i.e., spin-0 window. The former are needed to compute the counterterms. It also provides routines for maps and window manipulations. The routines are written in C and based on the S2HAT library, which is used to perform all required spherical harmonic transforms as well as all inter-processor communication. They are therefore parallelized using MPI and follow the distributed-memory computational model. The data distribution patterns, pixelization choices, conventions etc are all as those assumed/allowed by the S2HAT library.

  16. Pure Immature Teratoma of the Ovary in Adults

    PubMed Central

    Alwazzan, Ahmad Bakr; Popowich, Shaundra; Dean, Erin; Robinson, Christine; Lotocki, Robert; Altman, Alon D.

    2015-01-01

    Objective The aim of this study was to evaluate clinicopathologic characteristics, treatment outcome, and reproductive function in women diagnosed with ovarian immature teratoma (IT). Our standard chemotherapy regime is currently etoposide/cisplatin (EP), creating a unique opportunity to evaluate this protocol in ovarian ITs. Materials and Methods This study is a retrospective analysis. Twenty-seven women older than 18 years with ovarian IT stages IA to IIIC were identified and included in this study. Patients were treated at 1 institution, Health Sciences Center, Women’s Hospital, Winnipeg, Manitoba, Canada, between 1983 and 2013. Results The median age at diagnosis was 27.0 years (range, 18–36 years). Twenty-two (82%) presented with an International Federation of Gynecology and Obstetrics stage I disease, 3 (11%) had stage II, and 2 patients (7%) had stage III disease. The histologic grade distribution was grade I in 9 patients (33%), grade II in 3 patients (11%), and grade III in 15 patients (56%). Initial management was surgical for all patients: 3 (11%) hysterectomy and bilateral salpingo-oophorectomy, 1 (4%) cystectomy only, and 23 (85%) unilateral salpingo-oophorectomy. Twenty-one patients (78%) received adjuvant therapy. The median follow-up was 60 months (range, 36–72 months). One patient recurred (histological grade III) 6 months after surgery and had a complete clinical response to 4 cycles of EP chemotherapy. Twelve patients reported an attempt to conceive resulting in 10 pregnancies (8 after chemotherapy). Conclusions Ovarian IT is a curable disease. Fertility-sparing surgery should be offered. Adjuvant treatment with cisplatinum-based chemotherapy, typically with bleomycin, etoposide, and cisplatin, is still considered the standard in stages greater than stage IA grade I. Etoposide/cisplatin as a primary chemotherapy regime for early- or advanced-stage disease is an effective treatment with minimal adverse effects and high tolerability. This is the first published study examining EP as a primary treatment modality for IT. Further studies are needed to strengthen these findings. PMID:26332392

  17. How pure are your vesicles?

    PubMed

    Webber, Jason; Clayton, Aled

    2013-01-01

    We propose a straightforward method to estimate the purity of vesicle preparations by comparing the ratio of nano-vesicle counts to protein concentration, using tools such as the increasingly available NanoSight platform and a colorimetric protein assay such as the BCA-assay. Such an approach is simple enough to apply to every vesicle preparation within a given laboratory, assisting researchers as a routine quality control step. Also, the approach may aid in comparing/standardising vesicle purity across diverse studies, and may be of particular importance in evaluating vesicular biomarkers. We herein propose some criteria to aid in the definition of pure vesicles. PMID:24009896

  18. Production of substantially pure fructose

    SciTech Connect

    Hatcher, H.J.; Gallian, J.J.; Leeper, S.A.

    1990-05-22

    This patent describes a process for the production of a substantially pure product containing greater than 60% fructose. It comprises: combining a sucrose-containing substrate with effective amounts of a levansucrase enzyme preparation to form levan and glucose; purifying the levan by at least one of the following purification methods: ultrafiltration, diafiltration, hyperfiltration, reverse osmosis, liquid--liquid partition, solvent extraction, chromatography, and precipitation; hydrolyzing the levan to form fructose substantially free of glucose and sucrose; and recovering the fructose by at least one of the following recovery methods: hyperfiltration, reverse osmosis, evaporation, drying, crystallization, and chromatography.

  19. Synthesis of Enantiomerically Pure Anthracyclinones

    NASA Astrophysics Data System (ADS)

    Achmatowicz, Osman; Szechner, Barbara

    The anthracycline antibiotics are among the most important clinical drugs used in the treatment of human cancer. The search for new agents with improved therapeutic efficacy and reduced cardiotoxicity stimulated considerable efforts in the synthesis of new analogues. Since the biological activity of anthracyclines depends on their natural absolute configuration, various strategies for the synthesis of enantiomerically pure anthracyclinones (aglycones) have been developed. They comprise: resolution of racemic intermediate, incorporation of a chiral fragment derived from natural and non-natural chiral pools, asymmetric synthesis with the use of a chiral auxiliary or a chiral reagent, and enantioselective catalysis. Synthetic advances towards enantiopure anthracyclinones reported over the last 17 years are reviewed.

  20. Multiple pure tone noise prediction

    NASA Astrophysics Data System (ADS)

    Han, Fei; Sharma, Anupam; Paliath, Umesh; Shieh, Chingwei

    2014-12-01

    This paper presents a fully numerical method for predicting multiple pure tones, also known as “Buzzsaw” noise. It consists of three steps that account for noise source generation, nonlinear acoustic propagation with hard as well as lined walls inside the nacelle, and linear acoustic propagation outside the engine. Noise generation is modeled by steady, part-annulus computational fluid dynamics (CFD) simulations. A linear superposition algorithm is used to construct full-annulus shock/pressure pattern just upstream of the fan from part-annulus CFD results. Nonlinear wave propagation is carried out inside the duct using a pseudo-two-dimensional solution of Burgers' equation. Scattering from nacelle lip as well as radiation to farfield is performed using the commercial solver ACTRAN/TM. The proposed prediction process is verified by comparing against full-annulus CFD simulations as well as against static engine test data for a typical high bypass ratio aircraft engine with hardwall as well as lined inlets. Comparisons are drawn against nacelle unsteady pressure transducer measurements at two axial locations as well as against near- and far-field microphone array measurements outside the duct. This is the first fully numerical approach (no experimental or empirical input is required) to predict multiple pure tone noise generation, in-duct propagation and far-field radiation. It uses measured blade coordinates to calculate MPT noise.

  1. Pure optical dynamical color encryption.

    PubMed

    Mosso, Fabian; Tebaldi, Myrian; Barrera, John Fredy; Bolognini, Néstor; Torroba, Roberto

    2011-07-18

    We introduce a way to encrypt-decrypt a color dynamical phenomenon using a pure optical alternative. We split the three basic chromatic channels composing the input, and then each channel is processed through a 4f encoding method and a theta modulation applied to the each encrypted frame in every channel. All frames for a single channel are multiplexed. The same phase mask is used to encode all the information. Unlike the usual procedure we do not multiplex the three chromatic channels into a single encoding media, because we want to decrypt the information in real time. Then, we send to the decoding station the phase mask and the three packages each one containing the multiplexing of a single channel. The end user synchronizes and decodes the information contained in the separate channels. Finally, the decoding information is conveyed together to bring the decoded dynamical color phenomenon in real-time. We present material that supports our concepts. PMID:21934738

  2. Pure optical dynamical color encryption

    NASA Astrophysics Data System (ADS)

    Mosso, Fabian; Tebaldi, Myrian; Fredy Barrera, John; Bolognini, Néstor; Torroba, Roberto

    2011-07-01

    We introduce a way to encrypt-decrypt a color dynamical phenomenon using a pure optical alternative. We split the three basic chromatic channels composing the input, and then each channel is processed through a 4f encoding method and a theta modulation applied to the each encrypted frame in every channel. All frames for a single channel are multiplexed. The same phase mask is used to encode all the information. Unlike the usual procedure we do not multiplex the three chromatic channels into a single encoding media, because we want to decrypt the information in real time. Then, we send to the decoding station the phase mask and the three packages each one containing the multiplexing of a single channel. The end user synchronizes and decodes the information contained in the separate channels. Finally, the decoding information is conveyed together to bring the decoded dynamical color phenomenon in real-time. We present material that supports our concepts.

  3. Expression of nuclear factor, erythroid 2-like 2-mediated genes differentiates tuberculosis.

    PubMed

    Qian, Zhongqing; Lv, Jingzhu; Kelly, Gabriel T; Wang, Hongtao; Zhang, Xiaojie; Gu, Wanjun; Yin, Xiaofeng; Wang, Ting; Zhou, Tong

    2016-07-01

    During infection and host defense, nuclear factor, erythroid 2-like 2 (Nrf2) dependent signaling is an efficient antioxidant defensive mechanism used by host cells to control the destructive effects of reactive oxygen species. This allows for effective defense responses against microbes while minimizing oxidative injury to the host cell itself. As a central regulator of antioxidant genes, Nrf2 has gained great attention in its pivotal role in infection, especially in tuberculosis (TB), the top infectious disease killer worldwide. To elucidate the genes potentially regulated by Nrf2 in TB, we conducted a meta-analysis on published gene expression datasets. Firstly, we compared the global gene expression profiles between control and Nrf2-deficient human cells. The differentially expressed genes were deemed as "Nrf2-mediated genes". Next, the whole blood gene expression pattern of TB patients was compared with that of healthy controls, pneumonia patients, and lung cancer patients. We found that the genes deregulated in TB significantly overlap with the Nrf2-mediated genes. Based on the intersection of Nrf2-mediated and TB-regulated genes, we identified an Nrf2-mediated 17-gene signature, which reflects a cluster of gene ontology terms highly related to TB physiology. We demonstrated that the 17-gene signature can be used to distinguish TB patients from healthy controls and patients with latent TB infection, pneumonia, or lung cancer. Also, the Nrf2-mediated gene signature can be used as an indicator of the anti-TB therapeutic response. More importantly, we confirmed that the predictive power of the Nrf2-mediated 17-gene signature is significantly better than the random gene sets selected from the human transcriptome. Also, the 17-gene signature performs even better than the random gene signatures selected from TB-associated genes. Our study confirms the central role of Nrf2 in TB pathogenesis and provides a novel and useful diagnostic method to differentiate TB

  4. Dynamic Transcription Factor Activity Profiles Reveal Key Regulatory Interactions During Megakaryocytic and Erythroid Differentiation

    PubMed Central

    Duncan, Mark T.; Shin, Seungjin; Wu, Jia J.; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M.; Shea, Lonnie D.

    2014-01-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  5. Dynamic transcription factor activity profiles reveal key regulatory interactions during megakaryocytic and erythroid differentiation.

    PubMed

    Duncan, Mark T; Shin, Seungjin; Wu, Jia J; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M; Shea, Lonnie D

    2014-10-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  6. Recombinant erythroid differentiation regulator 1 inhibits both inflammation and angiogenesis in a mouse model of rosacea.

    PubMed

    Kim, Miri; Kim, Kyung-Eun; Jung, Haw Young; Jo, Hyunmu; Jeong, Seo-Won; Lee, Jahyung; Kim, Chang Han; Kim, Heejong; Cho, Daeho; Park, Hyun Jeong

    2015-09-01

    The erythroid differentiation regulator 1 (Erdr1), which is a novel and highly conserved factor, was recently reported to be negatively regulated by IL-18 and to play a crucial role as an antimetastatic factor. IL-18 is a proinflammatory cytokine that functions as an angiogenic mediator in inflammation. Rosacea is a chronic inflammatory skin disorder that is characterized by abnormal inflammation and vascular hyperactivity of the facial skin. To determine whether Erdr1 contributes to the regulation of the chronic inflammatory process in the development of rosacea, an immunohistochemical analysis was performed in healthy donors and patients with rosacea. In this study, we showed that Erdr1 was downregulated, whereas IL-18 was upregulated, in patients with rosacea, which led us to question the role of Erdr1 in this disorder. Moreover, a rosacea-like BALB/c mouse model was used to determine the role of Erdr1 in rosacea in vivo. LL-37 injection induced typical rosacea features, including erythema, telangiectasia and inflammation. Treatment with recombinant Erdr1 (rErdr1) resulted in a significant reduction of erythema, inflammatory cell infiltration (including CD4(+) and CD8(+) T cells), and microvessel density with vascular endothelial growth factor (VEGF). Taken together, our findings suggest that rErdr1 may be involved in attenuating the inflammation and angiogenesis associated with the pathogenesis of rosacea. Thus, these results provide new insight into the mechanism involved in this condition and indicate that rErdr1 could be a potential target for therapeutic intervention of rosacea. PMID:25940661

  7. 76 FR 69284 - Pure Magnesium From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... COMMISSION Pure Magnesium From China Determination On the basis of the record \\1\\ developed in the subject... order on pure magnesium from China would be likely to lead to continuation or recurrence of material... USITC Publication 4274 (October 2011), entitled Pure Magnesium from China: Investigation No....

  8. Decryption of pure-position permutation algorithms.

    PubMed

    Zhao, Xiao-Yu; Chen, Gang; Zhang, Dan; Wang, Xiao-Hong; Dong, Guang-Chang

    2004-07-01

    Pure position permutation image encryption algorithms, commonly used as image encryption investigated in this work are unfortunately frail under known-text attack. In view of the weakness of pure position permutation algorithm, we put forward an effective decryption algorithm for all pure-position permutation algorithms. First, a summary of the pure position permutation image encryption algorithms is given by introducing the concept of ergodic matrices. Then, by using probability theory and algebraic principles, the decryption probability of pure-position permutation algorithms is verified theoretically; and then, by defining the operation system of fuzzy ergodic matrices, we improve a specific decryption algorithm. Finally, some simulation results are shown. PMID:15495308

  9. Binding of polarity-sensitive hydrophobic ligands to erythroid and nonerythroid spectrin: fluorescence and molecular modeling studies.

    PubMed

    Patra, Malay; Mitra, Madhurima; Chakrabarti, Abhijit; Mukhopadhyay, Chaitali

    2014-01-01

    We have used three polarity-sensitive fluorescence probes, 6-propionyl 2-(N,N-dimethyl-amino) naphthalene (Prodan), pyrene and 8-anilino 1-naphthalene sulphonic acid, to study their binding with erythroid and nonerythroid spectrin, using fluorescence spectroscopy. We have found that both bind to prodan and pyrene with high affinities with apparent dissociation constants (Kd) of .50 and .17 μM, for prodan, and .04 and .02 μM, for pyrene, respectively. The most striking aspect of these bindings have been that the binding stoichiometry have been equal to 1 in erythroid spectrin, both in dimeric and tetrameric form, and in tetrameric nonerythroid spectrin. From an estimate of apparent dielectric constants, the polarity of the binding site in both erythroid and nonerythroid forms have been found to be extremely hydrophobic. Thermodynamic parameters associated with such binding revealed that the binding is favored by positive change in entropy. Molecular docking studies alone indicate that both prodan and pyrene bind to the four major structural domains, following the order in the strength of binding to the Ankyrin binding domain > SH3 domain > Self-association domain > N-terminal domain of α-spectrin of both forms of spectrin. The binding experiments, particularly with the tetrameric nonerythroid spectrin, however, indicate more toward the self association domain in offering the unique binding site, since the binding stoichiometry have been 1 in all forms of dimeric and tetrameric spectrin, so far studied by us. Further studies are needed to characterize the hydrophobic binding sites in both forms of spectrin. PMID:24404769

  10. Hematopoietic deletion of transferrin receptor 2 in mice leads to a block in erythroid differentiation during iron-deficient anemia.

    PubMed

    Rishi, Gautam; Secondes, Eriza S; Wallace, Daniel F; Subramaniam, V Nathan

    2016-08-01

    Iron metabolism and erythropoiesis are inherently interlinked physiological processes. Regulation of iron metabolism is mediated by the iron-regulatory hormone hepcidin. Hepcidin limits the amount of iron released into the blood by binding to and causing the internalization of the iron exporter, ferroportin. A number of molecules and physiological stimuli, including erythropoiesis, are known to regulate hepcidin. An increase in erythropoietic demand decreases hepcidin, resulting in increased bioavailable iron in the blood. Transferrin receptor 2 (TFR2) is involved in the systemic regulation of iron metabolism. Patients and mice with mutations in TFR2 develop hemochromatosis due to inappropriate hepcidin levels relative to body iron. Recent studies from our laboratory and others have suggested an additional role for TFR2 in response to iron-restricted erythropoiesis. These studies used mouse models with perturbed systemic iron metabolism: anemic mice lacking matriptase-2 and Tfr2, or bone marrow transplants from iron-loaded Tfr2 null mice. We developed a novel transgenic mouse model which lacks Tfr2 in the hematopoietic compartment, enabling the delineation of the role of Tfr2 in erythroid development without interfering with its role in systemic iron metabolism. We show that in the absence of hematopoietic Tfr2 immature polychromatic erythroblasts accumulate with a concordant reduction in the percentage of mature erythroid cells in the spleen and bone marrow of anemic mice. These results demonstrate that erythroid Tfr2 is essential for an appropriate erythropoietic response in iron-deficient anemia. These findings may be of relevance in clinical situations in which an immediate and efficient erythropoietic response is required. Am. J. Hematol. 91:812-818, 2016. © 2016 Wiley Periodicals, Inc. PMID:27169626

  11. Mixtures of maximally entangled pure states

    NASA Astrophysics Data System (ADS)

    Flores, M. M.; Galapon, E. A.

    2016-09-01

    We study the conditions when mixtures of maximally entangled pure states remain entangled. We found that the resulting mixed state remains entangled when the number of entangled pure states to be mixed is less than or equal to the dimension of the pure states. For the latter case of mixing a number of pure states equal to their dimension, we found that the mixed state is entangled provided that the entangled pure states to be mixed are not equally weighted. We also found that one can restrict the set of pure states that one can mix from in order to ensure that the resulting mixed state is genuinely entangled. Also, we demonstrate how these results could be applied as a way to detect entanglement in mixtures of the entangled pure states with noise.

  12. Bringing Planctomycetes into pure culture

    PubMed Central

    Lage, Olga M.; Bondoso, Joana

    2012-01-01

    Planctomycetes have been known since the description of Planctomyces bekefii by Gimesi at the beginning of the twentieth century (1924), although the first axenic cultures were only obtained in the 1970s. Since then, 11 genera with 14 species have been validly named and five candidatus genera belonging to the anaerobic ammonium oxidation, anammox bacteria have also been discovered. However, Planctomycetes diversity is much broader than these numbers indicate, as shown by environmental molecular studies. In recent years, the authors have attempted to isolate and cultivate additional strains of Planctomycetes. This paper provides a summary of the isolation work that was carried out to obtain in pure culture Planctomycetes from several environmental sources. The following strains of planctomycetes have been successfully isolated: two freshwater strains from the sediments of an aquarium, which were described as a new genus and species, Aquisphaera giovannonii; several Rhodopirellula strains from the sediments of a water treatment recycling tank of a marine fish farm; and more than 140 planctomycetes from the biofilm community of macroalgae. This collection comprises several novel taxa that are being characterized and described. Improvements in the isolation methodology were made in order to optimize and enlarge the number of Planctomycetes isolated from the macroalgae. The existence of an intimate and an important relationship between planctomycetes and macroalgae reported before by molecular studies is therefore supported by culture-dependent methods. PMID:23335915

  13. Isomerically Pure Tetramethylrhodamine Voltage Reporters.

    PubMed

    Deal, Parker E; Kulkarni, Rishikesh U; Al-Abdullatif, Sarah H; Miller, Evan W

    2016-07-27

    We present the design, synthesis, and application of a new family of fluorescent voltage indicators based on isomerically pure tetramethylrhodamines. These new Rhodamine Voltage Reporters, or RhoVRs, use photoinduced electron transfer (PeT) as a trigger for voltage sensing, display excitation and emission profiles in the green to orange region of the visible spectrum, demonstrate high sensitivity to membrane potential changes (up to 47% ΔF/F per 100 mV), and employ a tertiary amide derived from sarcosine, which aids in membrane localization and simultaneously simplifies the synthetic route to the voltage sensors. The most sensitive of the RhoVR dyes, RhoVR 1, features a methoxy-substituted diethylaniline donor and phenylenevinylene molecular wire at the 5'-position of the rhodamine aryl ring, exhibits the highest voltage sensitivity to date for red-shifted PeT-based voltage sensors, and is compatible with simultaneous imaging alongside green fluorescent protein-based indicators. The discoveries that sarcosine-based tertiary amides in the context of molecular-wire voltage indicators prevent dye internalization and 5'-substituted voltage indicators exhibit improved voltage sensitivity should be broadly applicable to other types of PeT-based voltage-sensitive fluorophores. PMID:27428174

  14. Desulfurization of pure coal macerals

    SciTech Connect

    Hippo, E.J. ); Crelling, J.C. )

    1988-06-01

    The objectives of this study were to modify the present density gradient centrifugation (DGC) techniques for coal macerals to obtain 10-20 grams of target maceral concentrates and to determine the reactivity or ease of removing the organic sulfur in the various macerals with supercritical methanol extraction. Although the chemistry needed for this objective is not difficult, the accumulation of 10 to 20 gram quantities of ''pure'' petrographically verified single maceral concentrates has not been possible until now. The results of recent work have demonstrated that the individual macerals can be separated and verified. The accumulation of much larger quantities than have previously been separated was a problem that has been overcome by pre-concentrating target macerals at their density cut points. Supercritical fluid extraction of coals has previously been reported as a method in the production of liquid fuel products from coal under mild conditions and as a medium for selective desulfurization of coal. Alcohols are expected to exhibit greater solubility for polar organic molecules due to hydrogen bonding and dipole attractive forces, also providing the opportunity for chemical reactions during the extraction due to the nucleophilicity of the alcohol oxygen and the tendency to act as a hydrogen donor. In addition, enol rearrangements may play a role in desulfurization. As previously reported different supercritical reaction conditions produced different extents of desulfurization of coals (33.9 - 65.7%). These variable desulfurizations are probably a result of differences in extents of conversion of the pyritic sulfur (to various alteration products, such as pyrrhotite), as well as organic sulfur functionalities (thiophenol, sulfide, and thiopenes) to light gases such as dimethylsulfide, hydrogen sulfide, and methylmercaptons.

  15. Desulfurization of pure coal macerals

    SciTech Connect

    Hippo, E.J.; Crelling, J.C. )

    1988-01-01

    The objectives of this study were to modify the present density gradient centrifugation (DGC) techniques for coal macerals to obtain 10-20 grams of target maceral concentrates and to determine the reactivity or ease of removing the organic sulfur in the various macerals with supercritical methanol extraction. Although the chemistry needed for this objective is not difficult, the accumulation of 10 to 20 gram quantities of pure petrographically verified single maceral concentrates has not been possible until now. The results of recent work have demonstrated that the individual macerals can be separated and verified. The accumulation of much larger quantities than have previously been separated was a problem that has been overcome by pre-concentrating target macerals at their density cut points. Supercritical fluid extraction of coals has previously been reported as a method in the production of liquid fuel products from coal under mild conditions and as a medium for selective desulfurization of coal. Alcohols are expected to exhibit greater solubility for polar organic molecules due to hydrogen bonding and dipole attractive forces, also providing the opportunity for chemical reactions during the extraction due to the nucleophilicity of the alcohol oxygen and the tendency to act as a hydrogen donor. In addition, enol rearrangements may play a role in desulfurization. As previously reported different supercritical reaction conditions produced different extents of desulfurization of coals (33.9 - 65.7%). These variable desulfurizations are probably a result of differences in extents of conversion of the pyritic sulfur (to various alteration products, such as pyrrhotite), as well as organic sulfur functionalities (thiophenol, sulfide, and thiophenes) to light gases such as dimethylsulfide, hydrogen sulfide, and methylmercaptons.

  16. [Peculiarities of antioxidant defense system in erythroid cells and tissues of pigs under action of chromium chloride].

    PubMed

    Iskra, R Ia; Vlizlo, V V

    2013-01-01

    The influence of CrCI3 in the amount of 400 mg Cr/kg of feed on antioxidant defense in populations of erythrocytes, erythroid bone marrow cells and tissues of pigs was studied. The increasing of the antioxidant defense of swine organism, as evidenced by the increase in superoxide dismutase and glutathione peroxidase activity in the fractions of "young" erythrocytes, was shown. Superoxide dismutase activity decreases, while glutathione and catalase activity increases in the erythroid cells of the bone marrow after of CrCl3 action. Oxidative processes are intensified in the liver of pigs of the experimental group, in contrast to other tissues, leading to the increase of content of TBARS-products, growth of superoxide dismutase activity and reduction of glutathione peroxidase activity. At the same time, the action of CrCl3 in other tissues activates antioxidant system, including the kidneys, lungs and myocardium, increases superoxide dismutase activity, and catalase activity in the spleen and kidneys. A decrease of content of TBARS-products and reduction of superoxide dismutase activity, as well as the increase of katalase activity and reduction of glutathione content were discovered in the skeletal muscles of pigs of the experimental group. As a result of research it is suggested to add CrCl3 to the diet of pigs to enhance antioxidant defense during their intensive growth. PMID:23940874

  17. Immunophenotypic Profiling of Erythroid Progenitor-Derived Extracellular Vesicles in Diamond-Blackfan Anaemia: A New Diagnostic Strategy

    PubMed Central

    Macrì, Serena; Aspesi, Anna; Vizziello, Claudia; Botto, Carlotta; Corti, Paola; Quarello, Paola; Notari, Patrizia; Ramenghi, Ugo; Ellis, Steven Robert; Dianzani, Irma

    2015-01-01

    Diamond-Blackfan Anaemia (DBA) is a rare inherited anaemia caused by heterozygous mutations in one of 13 ribosomal protein genes. Erythroid progenitors (BFU-E and CFU-E) in bone marrow (BM) show a proapoptotic phenotype. Suspicion of DBA is reached after exclusion of other forms of BM failure syndromes. To improve DBA diagnosis, which is confirmed by mutation analysis, we tested a new approach based on the study of extracellular vesicles (EVs) isolated from plasma by differential centrifugations and analysed by flow cytometry. We chose CD34, CD71 and CD235a markers to study erythroid EVs. We characterised the EVs immunophentoypic profiles of 13 DBA patients, 22 healthy controls and 16 patients with other haematological diseases. Among the three EVs clusters we found, only the CD34+/CD71low population showed statistically significant differences between DBA patients and controls (p< 0.05). The absence of this cluster is in agreement with the low levels of BFU-E found in DBA patients. The assessment of ROC curves demonstrated the potential diagnostic value of this population. We suggest that this assay may be useful to improve DBA diagnosis as a quicker and less invasive alternative to BM BFU-E culture analysis. PMID:26394034

  18. Evolving insights into the synergy between erythropoietin and thrombopoietin and the bipotent erythroid/megakaryocytic progenitor cell.

    PubMed

    Papayannopoulou, Thalia; Kaushansky, Kenneth

    2016-08-01

    Although the synergy between erythropoietin and thrombopoietin has previously been pointed out, the clonal demonstration of a human bipotent erythroid/megakaryocytic progenitor (MEP) was first published in Experimental Hematology (Papayannopoulou T, Brice M, Farrer D, Kaushansky K. Exp Hematol. 1996;24:660-669) and later in the same year in Blood (Debili N, Coulombel L, Croisille L, et al. Blood. 1996;88:1284-1296). This demonstration, and the fact that both bipotent and monopotent erythroid or megakaryocytic progenitors co-express markers of both lineages and respond to both lineage-specific transcription factors, has provided a background for the extensive use of MEP assessment by fluorescence-activated cell sorting in many subsequent studies. Beyond this, the demonstration of shared regulatory elements and the presence of single mutations affecting both lineages have inspired further studies to decipher how the shift in transcription factor networks occurs from one lineage to the other. Furthermore, in addition to shared effects, erythropoietin and thrombopoietin have additional independent effects. Most notable for thrombopoietin is its effect on hematopoietic stem cells illustrated by in vitro and in vivo approaches. PMID:26773569

  19. Immunophenotypic Profiling of Erythroid Progenitor-Derived Extracellular Vesicles in Diamond-Blackfan Anaemia: A New Diagnostic Strategy.

    PubMed

    Macrì, Serena; Pavesi, Elisa; Crescitelli, Rossella; Aspesi, Anna; Vizziello, Claudia; Botto, Carlotta; Corti, Paola; Quarello, Paola; Notari, Patrizia; Ramenghi, Ugo; Ellis, Steven Robert; Dianzani, Irma

    2015-01-01

    Diamond-Blackfan Anaemia (DBA) is a rare inherited anaemia caused by heterozygous mutations in one of 13 ribosomal protein genes. Erythroid progenitors (BFU-E and CFU-E) in bone marrow (BM) show a proapoptotic phenotype. Suspicion of DBA is reached after exclusion of other forms of BM failure syndromes. To improve DBA diagnosis, which is confirmed by mutation analysis, we tested a new approach based on the study of extracellular vesicles (EVs) isolated from plasma by differential centrifugations and analysed by flow cytometry. We chose CD34, CD71 and CD235a markers to study erythroid EVs. We characterised the EVs immunophentoypic profiles of 13 DBA patients, 22 healthy controls and 16 patients with other haematological diseases. Among the three EVs clusters we found, only the CD34+/CD71low population showed statistically significant differences between DBA patients and controls (p< 0.05). The absence of this cluster is in agreement with the low levels of BFU-E found in DBA patients. The assessment of ROC curves demonstrated the potential diagnostic value of this population. We suggest that this assay may be useful to improve DBA diagnosis as a quicker and less invasive alternative to BM BFU-E culture analysis. PMID:26394034

  20. Erythroid Krüppel-like factor (EKLF) contains a multifunctional transcriptional activation domain important for inter- and intramolecular interactions.

    PubMed Central

    Chen, X; Bieker, J J

    1996-01-01

    Erythroid Krüppel-like factor (EKLF) is a red cell-restricted transcriptional activator that plays a dominant role in establishing high levels of beta-globin gene expression during erythroid ontogeny. Although its DNA binding domain belongs to the well-studied class of Krüppel-like zinc fingers, its proline-rich activation region has not been thoroughly examined. We have analyzed this region by monitoring the functional effects of its mutagenesis upon EKLF activity in vivo and in vitro. First, using co-transfection assays, we find that the transactivation region contains discrete stimulatory and inhibitory subdomains. Second, in vitro binding assays indicate that the inhibitory domain exerts its effect in cis by interfering with DNA binding. Third, in vivo competition assays demonstrate that EKLF interacts with a positive-acting cellular factor, and that the domain responsible for this trans interaction lies within a 40 amino acid sequence that is coincident with the EKLF minimal transactivation domain. Finally, site-directed mutagenesis of this domain implies that conformation and/or phosphorylation status of its central core may be critical for such interactions. These results point towards post-translational steric and/or allosteric control of EKLF function that may be important not just for its DNA binding ability, but also for its potential to interact with other proteins that fully establish the correct stereospecific array leading to efficient switching of beta-globin transcription during development. Images PMID:8918466

  1. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    SciTech Connect

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-05-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-(/sup 14/C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells.

  2. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis.

    PubMed

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J; Pandolfi, Pier Paolo

    2009-10-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential antiapoptotic role during terminal erythroid differentiation. We find that loss of Lrf leads to lethal anemia in embryos, due to increased apoptosis of late-stage erythroblasts. This programmed cell death is Arf and p53 independent and is instead mediated by upregulation of the proapoptotic factor Bim. We identify Lrf as a direct repressor of Bim transcription. In strong support of this mechanism, genetic Bim loss delays the lethality of Lrf-deficient embryos and rescues their anemia phenotype. Thus, our data define a key transcriptional cascade for effective erythropoiesis, whereby GATA-1 suppresses BIM-mediated apoptosis via LRF. PMID:19853566

  3. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis

    PubMed Central

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M.; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C.; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J.; Pandolfi, Pier Paolo

    2011-01-01

    SUMMARY GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential anti-apoptotic role during terminal erythroid differentiation. We find that loss of Lrf leads to lethal anemia in embryos, due to increased apoptosis of late stage erythroblasts. This programmed cell death is Arf- and p53-independent and is instead mediated by up-regulation of the pro-apoptotic factor Bim. We identify Lrf as a direct repressor of Bim transcription. In strong support of this mechanism, genetic Bim-loss delays the lethality of Lrf-deficient embryos and rescues their anemia-phenotype. Thus, our data defines a key transcriptional cascade for effective erythropoiesis, whereby GATA-1 suppresses BIM-mediated apoptosis via LRF. PMID:19853566

  4. Structural and functional characterization of an atypical activation domain in erythroid Krüppel-like factor (EKLF)

    PubMed Central

    Mas, Caroline; Lussier-Price, Mathieu; Soni, Shefali; Morse, Thomas; Arseneault, Geneviève; Di Lello, Paola; Lafrance-Vanasse, Julien; Bieker, James J.; Omichinski, James G.

    2011-01-01

    Erythroid Krüppel-like factor (EKLF) plays an important role in erythroid development by stimulating β-globin gene expression. We have examined the details by which the minimal transactivation domain (TAD) of EKLF (EKLFTAD) interacts with several transcriptional regulatory factors. We report that EKLFTAD displays homology to the p53TAD and, like the p53TAD, can be divided into two functional subdomains (EKLFTAD1 and EKLFTAD2). Based on sequence analysis, we found that EKLFTAD2 is conserved in KLF2, KLF4, KLF5, and KLF15. In addition, we demonstrate that EKLFTAD2 binds the amino-terminal PH domain of the Tfb1/p62 subunit of TFIIH (Tfb1PH/p62PH) and four domains of CREB-binding protein/p300. The solution structure of the EKLFTAD2/Tfb1PH complex indicates that EKLFTAD2 binds Tfb1PH in an extended conformation, which is in contrast to the α-helical conformation seen for p53TAD2 in complex with Tfb1PH. These studies provide detailed mechanistic information into EKLFTAD functions as well as insights into potential interactions of the TADs of other KLF proteins. In addition, they suggest that not only have acidic TADs evolved so that they bind using different conformations on a common target, but that transitioning from a disordered to a more ordered state is not a requirement for their ability to bind multiple partners. PMID:21670263

  5. Haem is necessary for a continued increase in ferrochelatase mRNA in murine erythroleukaemia cells during erythroid differentiation.

    PubMed

    Fukuda, Y; Fujita, H; Taketani, S; Sassa, S

    1993-12-01

    The level of mRNA encoding ferrochelatase (FeC) was examined in two murine erythroleukaemia (MEL) clones, DS and DR, a DMSO-sensitive, and a DMSO-resistant clone, respectively. DS cells undergo erythroid differentiation by DMSO treatment with a marked increase in haem synthesis, while DR cells fail to do so due to the lack of the erythroid-specific delta-aminolaevulinate synthase (ALAS-E). Both DS and DR cells showed an increase in the level of FeC mRNA within 18 h of DMSO treatment. The level of FeC mRNA in DR cells was then decreased, while that in DS cells continued to increase for 72 h. Treatment with haemin significantly increased FeC mRNA in DR cells. When cells were treated with both DMSO and haemin, the level of FeC mRNA in DR cells increased to a level comparable to that in DS cells. These findings suggest that the failure to maintain increased FeC mRNA DR cells after DMSO treatment may be due to a deficiency of haem in these cells. PMID:7918029

  6. Method of preparing pure fluorine gas

    DOEpatents

    Asprey, Larned B.

    1976-01-01

    A simple, inexpensive system for purifying and storing pure fluorine is described. The method utilizes alkali metal-nickel fluorides to absorb tank fluorine by forming nickel complex salts and leaving the gaseous impurities which are pumped away. The complex nickel fluoride is then heated to evolve back pure gaseous fluorine.

  7. Global transcriptome and chromatin occupancy analysis reveal the short isoform of GATA1 is deficient for erythroid specification and gene expression

    PubMed Central

    Chlon, Timothy M.; McNulty, Maureen; Goldenson, Benjamin; Rosinski, Alexander; Crispino, John D.

    2015-01-01

    GATA1 is a master transcriptional regulator of the differentiation of several related myeloid blood cell types, including erythrocytes and megakaryocytes. Germ-line mutations that cause loss of full length GATA1, but allow for expression of the short isoform (GATA1s), are associated with defective erythropoiesis in a subset of patients with Diamond Blackfan Anemia. Despite extensive studies of GATA1s in megakaryopoiesis, the mechanism by which GATA1s fails to support normal erythropoiesis is not understood. In this study, we used global gene expression and chromatin occupancy analysis to compare the transcriptional activity of GATA1s to GATA1. We discovered that compared to GATA1, GATA1s is less able to activate the erythroid gene expression program and terminal differentiation in cells with dual erythroid-megakaryocytic differentiation potential. Moreover, we found that GATA1s bound to many of its erythroid-specific target genes less efficiently than full length GATA1. These results suggest that the impaired ability of GATA1s to promote erythropoiesis in DBA may be caused by failure to occupy erythroid-specific gene regulatory elements. PMID:25682601

  8. Global transcriptome and chromatin occupancy analysis reveal the short isoform of GATA1 is deficient for erythroid specification and gene expression.

    PubMed

    Chlon, Timothy M; McNulty, Maureen; Goldenson, Benjamin; Rosinski, Alexander; Crispino, John D

    2015-05-01

    GATA1 is a master transcriptional regulator of the differentiation of several related myeloid blood cell types, including erythrocytes and megakaryocytes. Germ-line mutations that cause loss of full length GATA1, but allow for expression of the short isoform (GATA1s), are associated with defective erythropoiesis in a subset of patients with Diamond Blackfan Anemia. Despite extensive studies of GATA1s in megakaryopoiesis, the mechanism by which GATA1s fails to support normal erythropoiesis is not understood. In this study, we used global gene expression and chromatin occupancy analysis to compare the transcriptional activity of GATA1s to GATA1. We discovered that compared to GATA1, GATA1s is less able to activate the erythroid gene expression program and terminal differentiation in cells with dual erythroid-megakaryocytic differentiation potential. Moreover, we found that GATA1s bound to many of its erythroid-specific target genes less efficiently than full length GATA1. These results suggest that the impaired ability of GATA1s to promote erythropoiesis in DBA may be caused by failure to occupy erythroid-specific gene regulatory elements. PMID:25682601

  9. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    PubMed Central

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M.; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M.; Ribeiro, Maria L.; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A.; Davis, Brian R.; Segovia, Jose C.

    2015-01-01

    Summary Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses. PMID:26549847

  10. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells.

    PubMed

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M; Ribeiro, Maria L; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A; Davis, Brian R; Segovia, Jose C

    2015-12-01

    Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses. PMID:26549847

  11. Association between Variants at BCL11A Erythroid-Specific Enhancer and Fetal Hemoglobin Levels among Sickle Cell Disease Patients in Cameroon: Implications for Future Therapeutic Interventions.

    PubMed

    Pule, Gift Dineo; Ngo Bitoungui, Valentina Josiane; Chetcha Chemegni, Bernard; Kengne, Andre Pascal; Antonarakis, Stylianos; Wonkam, Ambroise

    2015-10-01

    Variants in BCL11A were previously associated with fetal hemoglobin (HbF) levels among Cameroonian sickle cell disease (SCD) patients, however explaining only ∼2% of the variance. In the same patients, we have investigated the relationship between HbF and two SNPs in a BCL11A erythroid-specific enhancer (N=626). Minor allele frequencies in rs7606173 and rs1427407 were 0.42 and 0.24, respectively. Both variants were significantly associated with HbF levels (p=3.11e-08 and p=6.04e-06, respectively) and explained 8% and 6.2% variations, respectively. These data have confirmed a stronger effect on HbF of genomic variations at the BCL11A erythroid-specific enhancer among patients with SCD in Cameroon, the first report on a West African population. The relevance of these findings is of prime importance because the disruption of this enhancer would alter BCL11A expression in erythroid precursors and thus HbF expression, while sparing the induced functional challenges of any alterations on the expression of this transcription factor in non-erythroid lineages, thus providing an attractive approach for new treatment strategies of SCD. PMID:26393293

  12. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    PubMed

    Merkle, Ruth; Steiert, Bernhard; Salopiata, Florian; Depner, Sofia; Raue, Andreas; Iwamoto, Nao; Schelker, Max; Hass, Helge; Wäsch, Marvin; Böhm, Martin E; Mücke, Oliver; Lipka, Daniel B; Plass, Christoph; Lehmann, Wolf D; Kreutz, Clemens; Timmer, Jens; Schilling, Marcel; Klingmüller, Ursula

    2016-08-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  13. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells

    PubMed Central

    Salopiata, Florian; Depner, Sofia; Wäsch, Marvin; Böhm, Martin E.; Mücke, Oliver; Plass, Christoph; Lehmann, Wolf D.; Kreutz, Clemens; Timmer, Jens; Klingmüller, Ursula

    2016-01-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  14. Defects of protein production in erythroid cells revealed in a zebrafish Diamond-Blackfan anemia model for mutation in RPS19.

    PubMed

    Zhang, Y; Ear, J; Yang, Z; Morimoto, K; Zhang, B; Lin, S

    2014-01-01

    Diamond-Blackfan anemia (DBA) is a rare congenital red cell aplasia that classically presents during early infancy in DBA patients. Approximately, 25% of patients carry a mutation in the ribosomal protein (RP) S19 gene; mutations in RPS24, RPS17, RPL35A, RPL11, and RPL5 have been reported. How ribosome protein deficiency causes defects specifically to red blood cells in DBA has not been well elucidated. To genetically model the predominant ribosome defect in DBA, we generated an rps19 null mutant through the use of TALEN-mediated gene targeting in zebrafish. Molecular characterization of this mutant line demonstrated that rps19 deficiency reproduced the erythroid defects of DBA, including a lack of mature red blood cells and p53 activation. Notably, we found that rps19 mutants' production of globin proteins was significantly inhibited; however, globin transcript level was either increased or unaffected in rps19 mutant embryos. This dissociation of RNA/protein levels of globin genes was confirmed in another zebrafish DBA model with defects in rpl11. Using transgenic zebrafish with specific expression of mCherry in erythroid cells, we showed that protein production in erythroid cells was decreased when either rps19 or rpl11 was mutated. L-Leucine treatment alleviated the defects of protein production in erythroid cells and partially rescued the anemic phenotype in both rps19 and rpl11 mutants. Analysis of this model suggests that the decreased protein production in erythroid cells likely contributes to the blood-specific phenotype of DBA. Furthermore, the newly generated rps19 zebrafish mutant should serve as a useful animal model to study DBA. Our in vivo findings may provide clues for the future therapy strategy for DBA. PMID:25058426

  15. Identification of a novel erythroid-specific enhancer for the ALAS2 gene and its loss-of-function mutation which is associated with congenital sideroblastic anemia

    PubMed Central

    Kaneko, Kiriko; Furuyama, Kazumichi; Fujiwara, Tohru; Kobayashi, Ryoji; Ishida, Hiroyuki; Harigae, Hideo; Shibahara, Shigeki

    2014-01-01

    Erythroid-specific 5-aminolevulinate synthase (ALAS2) is the rate-limiting enzyme for heme biosynthesis in erythroid cells, and a missense mutation of the ALAS2 gene is associated with congenital sideroblastic anemia. However, the gene responsible for this form of anemia remains unclear in about 40% of patients. Here, we identify a novel erythroid-specific enhancer of 130 base pairs in the first intron of the ALAS2 gene. The newly identified enhancer contains a cis-acting element that is bound by the erythroid-specific transcription factor GATA1, as confirmed by chromatin immunoprecipitation analysis in vivo and by electrophoretic mobility shift assay in vitro. A promoter activity assay in K562 human erythroleukemia cells revealed that the presence of this 130-base pair region increased the promoter activity of the ALAS2 gene by 10–15-fold. Importantly, two mutations, each of which disrupts the GATA-binding site in the enhancer, were identified in unrelated male patients with congenital sideroblastic anemia, and the lower expression level of ALAS2 mRNA in bone marrow erythroblasts was confirmed in one of these patients. Moreover, GATA1 failed to bind to each mutant sequence at the GATA-binding site, and each mutation abolished the enhancer function on ALAS2 promoter activity in K562 cells. Thus, a mutation at the GATA-binding site in this enhancer may cause congenital sideroblastic anemia. These results suggest that the newly identified intronic enhancer is essential for the expression of the ALAS2 gene in erythroid cells. We propose that the 130-base pair enhancer region located in the first intron of the ALAS2 gene should be examined in patients with congenital sideroblastic anemia in whom the gene responsible is unknown. PMID:23935018

  16. Establishment of culturing system for ex-vivo expansion of angiogenic immature erythroid cells, and its application for treatment of patients with chronic severe lower limb ischemia.

    PubMed

    Oda, Masato; Toba, Ken; Ozawa, Takuya; Kato, Kiminori; Yanagawa, Takao; Ikarashi, Noboru; Takayama, Tsugumi; Suzuki, Tomoyasu; Hanawa, Haruo; Fuse, Ichiro; Nakata, Kou; Narita, Miwako; Takahashi, Masuhiro; Aizawa, Yoshifusa

    2010-09-01

    Angiogenesis therapy by bone marrow-mononuclear cell implantation (BMI) has been utilized. We found that erythroid cells played an essential role in angiogenesis by BMI. We then tried to establish a novel cell therapy by implantation of ex vivo expanded immature erythroblasts cultured from hematopoietic stem/precursor cells. Immature to mature erythroblasts were purified from human bone marrow, and mRNA expression were analyzed. Strongly expressed VEGF and PLGF in immature erythroid cells decreased according to erythroid maturation. To expand very immature erythroid cells, we established a two-step culturing system, i.e., bone marrow cells were cultured in the presence of Flt-3L, SCF and TPO for 7 days, and the cells were further cultured in the presence of SCF, IGF-I and EPO for an additional 7 days. The in vivo angiogenic effects of implantation of the ex vivo expanded cells were stronger than that of BMI in mouse limb ischemia model. Three patients with severe chronic lower limb ischemia accompanied by Burger's disease or collagen arteritis were enrolled in a pilot clinical trial of the novel cell therapy by transplantation of ex-vivo expanded immature erythroid cells. In the clinical trial, most clinical symptoms such as rest pain and skin ulcers improved in 4 weeks, and did not recur in the one-year follow-up. No adverse events were observed in any of the patients. Moreover this novel cell therapy required only a small amount of bone marrow collection. Further enrollment of patients with chronic severe lower limb ischemia is necessary to confirm the efficacy and safety of this novel cell therapy, and to estimate the necessary amount of bone marrow aspirate. PMID:20382155

  17. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-01

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site. PMID:10037146

  18. Deficiency in the nuclear-related factor erythroid 2 transcription factor (Nrf1) leads to genetic instability.

    PubMed

    Oh, Diane H; Rigas, Diamanda; Cho, Ara; Chan, Jefferson Y

    2012-11-01

    Nuclear factor erythroid-derived 2-related factor 1 (Nrf1) regulates cellular stress response genes, and has also been suggested to play a role in other cellular processes. We previously demonstrated that hepatocyte-specific deletion of Nrf1 in mice resulted in spontaneous apoptosis, inflammation, and development of liver tumors. Here, we showed that both fibroblasts derived from Nrf1 null mouse embryos and fibroblasts expressing a conditional Nrf1 allele showed increased micronuclei and formation of abnormal nuclei. Lentiviral shRNA-mediated knockdown of Nrf1 in SAOS-2 cells also resulted in increased micronuclei, abnormal mitosis and multi-nucleated cells. Metaphase analyses showed increased aneuploidy in Nrf1(-/-) embryonic fibroblasts. Nuclear defects in Nrf1-deficient cells were associated with decreased expression of various genes encoding kinetochore and mitotic checkpoint proteins. Our findings suggest that Nrf1 may play a role in maintaining genomic integrity, and that Nrf1 dysregulation may induce tumorigenesis. PMID:22971132

  19. Fms-like tyrosine kinase 3 (Flt3) ligand depletes erythroid island macrophages and blocks medullar erythropoiesis in the mouse.

    PubMed

    Jacobsen, Rebecca N; Nowlan, Bianca; Brunck, Marion E; Barbier, Valerie; Winkler, Ingrid G; Levesque, Jean-Pierre

    2016-03-01

    The cytokines granulocyte colony-stimulating factor (G-CSF) and Flt3 ligand (Flt3-L) mobilize hematopoietic stem and progenitor cells into the peripheral blood of primates, humans, and mice. We recently reported that G-CSF administration causes a transient blockade of medullar erythropoiesis by suppressing erythroblastic island (EI) macrophages in the bone marrow. In the study described here, we investigated the effect of mobilizing doses of Flt3-L on erythropoiesis in mice in vivo. Similar to G-CSF, Flt3-L caused whitening of the bone marrow with significant reduction in the numbers of EI macrophages and erythroblasts. This was compensated by an increase in the numbers of EI macrophages and erythroblasts in the spleen. However, unlike G-CSF, Flt3-L had an indirect effect on EI macrophages, as it was not detected at the surface of EI macrophages or erythroid progenitors. PMID:26607596

  20. H-Ferritin Is Preferentially Incorporated by Human Erythroid Cells through Transferrin Receptor 1 in a Threshold-Dependent Manner

    PubMed Central

    Sakamoto, Soichiro; Kawabata, Hiroshi; Masuda, Taro; Uchiyama, Tatsuki; Mizumoto, Chisaki; Ohmori, Katsuyuki; Koeffler, H. Phillip; Kadowaki, Norimitsu; Takaori-Kondo, Akifumi

    2015-01-01

    Ferritin is an iron-storage protein composed of different ratios of 24 light (L) and heavy (H) subunits. The serum level of ferritin is a clinical marker of the body’s iron level. Transferrin receptor (TFR)1 is the receptor not only for transferrin but also for H-ferritin, but how it binds two different ligands and the blood cell types that preferentially incorporate H-ferritin remain unknown. To address these questions, we investigated hematopoietic cell-specific ferritin uptake by flow cytometry. Alexa Fluor 488-labeled H-ferritin was preferentially incorporated by erythroid cells among various hematopoietic cell lines examined, and was almost exclusively incorporated by bone marrow erythroblasts among human primary hematopoietic cells of various lineages. H-ferritin uptake by erythroid cells was strongly inhibited by unlabeled H-ferritin but was only partially inhibited by a large excess of holo-transferrin. On the other hand, internalization of labeled holo-transferrin by these cells was not inhibited by H-ferritin. Chinese hamster ovary cells lacking functional endogenous TFR1 but expressing human TFR1 with a mutated RGD sequence, which is required for transferrin binding, efficiently incorporated H-ferritin, indicating that TFR1 has distinct binding sites for H-ferritin and holo-transferrin. H-ferritin uptake by these cells required a threshold level of cell surface TFR1 expression, whereas there was no threshold for holo-transferrin uptake. The requirement for a threshold level of TFR1 expression can explain why among primary human hematopoietic cells, only erythroblasts efficiently take up H-ferritin. PMID:26441243

  1. Multiple cis elements regulate an alternative splicing event at 4.1R pre-mRNA during erythroid differentiation.

    PubMed

    Deguillien, M; Huang, S C; Morinière, M; Dreumont, N; Benz, E J; Baklouti, F

    2001-12-15

    The inclusion of exon 16 in the mature protein 4.1R messenger RNA (mRNA) is a critical event in red blood cell membrane biogenesis. It occurs during late erythroid development and results in inclusion of the 10-kd domain needed for stabilization of the spectrin/actin lattice. In this study, an experimental model was established in murine erythroleukemia cells that reproduces the endogenous exon 16 splicing patterns from a transfected minigene. Exon 16 was excluded in predifferentiated and predominantly included after induction. This suggests that the minigene contained exon and abutting intronic sequences sufficient for splicing regulation. A systematic analysis of the cis-acting regulatory sequences that reside within the exon and flanking introns was performed. Results showed that (1) the upstream intron of 4.1R pre-mRNA is required for exon recognition and it displays 2 enhancer elements, a distal element acting in differentiating cells and a proximal constitutive enhancer that resides within the 25 nucleotides preceding the acceptor site; (2) the exon itself contains a strong constitutive splicing silencer; (3) the exon has a weak 5' splice site; and (4) the downstream intron contains at least 2 splicing enhancer elements acting in differentiating cells, a proximal element at the vicinity of the 5' splice site, and a distal element containing 3 copies of the UGCAUG motif. These results suggest that the interplay between negative and positive elements may determine the inclusion or exclusion of exon 16. The activation of the enhancer elements in late erythroid differentiation may play an important role in the retention of exon 16. PMID:11739190

  2. Complete genomic organization of the human erythroid p55 gene (MPP1), a membrane-associated guanylate kinase homologue

    SciTech Connect

    Kim, A.C.; Metzenberg, A.B.; Sahr, K.E.

    1996-01-15

    Human p55 is an abundantly palmitoylated phosphoprotein of the erythroid membrane. It is the prototype of a newly discovered family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologues). The MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. Here, we report the complete intron-exon map of the human erythroid p55 gene (HGMW-approved symbol MPP1). The structure of the p55 gene was determined from cosmid clones isolated from a cosmid library specific for the human X chromosome. There is a single copy of the p55 gene, composed of 12 exons and spanning approximately 28 kb in the q28 region of the human X chromosome. The exon sizes range from 69 (exon 5) to 203 bp (intron 2) to {approximately}14 kb (intron 1). The intron-exon boundaries conform to the donor/acceptor consensus sequence, GT-AG, for splice junctions. Several of the exon boundaries correspond to the boundaries of functional domains in the p55 protein. These domains include a SH3 motif and a region that binds to cytoskeletal protein 4.1. In addition, a comparison of the genomic and the primary structures of p55 reveals a highly conserved phosphotyrosine domain located between the protein 4.1 binding domain and the guanylate kinase domain. Finally, promoter activity measurements of the region immediately upstream of the p55 gene, which contains several cis-elements commonly found in housekeeping genes, suggest that a CpG island may be associated with the p55 gene expression in vivo. 42 refs., 5 figs., 1 tab.

  3. H-Ferritin Is Preferentially Incorporated by Human Erythroid Cells through Transferrin Receptor 1 in a Threshold-Dependent Manner.

    PubMed

    Sakamoto, Soichiro; Kawabata, Hiroshi; Masuda, Taro; Uchiyama, Tatsuki; Mizumoto, Chisaki; Ohmori, Katsuyuki; Koeffler, H Phillip; Kadowaki, Norimitsu; Takaori-Kondo, Akifumi

    2015-01-01

    Ferritin is an iron-storage protein composed of different ratios of 24 light (L) and heavy (H) subunits. The serum level of ferritin is a clinical marker of the body's iron level. Transferrin receptor (TFR)1 is the receptor not only for transferrin but also for H-ferritin, but how it binds two different ligands and the blood cell types that preferentially incorporate H-ferritin remain unknown. To address these questions, we investigated hematopoietic cell-specific ferritin uptake by flow cytometry. Alexa Fluor 488-labeled H-ferritin was preferentially incorporated by erythroid cells among various hematopoietic cell lines examined, and was almost exclusively incorporated by bone marrow erythroblasts among human primary hematopoietic cells of various lineages. H-ferritin uptake by erythroid cells was strongly inhibited by unlabeled H-ferritin but was only partially inhibited by a large excess of holo-transferrin. On the other hand, internalization of labeled holo-transferrin by these cells was not inhibited by H-ferritin. Chinese hamster ovary cells lacking functional endogenous TFR1 but expressing human TFR1 with a mutated RGD sequence, which is required for transferrin binding, efficiently incorporated H-ferritin, indicating that TFR1 has distinct binding sites for H-ferritin and holo-transferrin. H-ferritin uptake by these cells required a threshold level of cell surface TFR1 expression, whereas there was no threshold for holo-transferrin uptake. The requirement for a threshold level of TFR1 expression can explain why among primary human hematopoietic cells, only erythroblasts efficiently take up H-ferritin. PMID:26441243

  4. Human Erythroid 5-Aminolevulinate Synthase Mutations Associated with X-Linked Protoporphyria Disrupt the Conformational Equilibrium and Enhance Product Release.

    PubMed

    Fratz, Erica J; Clayton, Jerome; Hunter, Gregory A; Ducamp, Sarah; Breydo, Leonid; Uversky, Vladimir N; Deybach, Jean-Charles; Gouya, Laurent; Puy, Hervé; Ferreira, Gloria C

    2015-09-15

    Regulation of 5-aminolevulinate synthase (ALAS) is at the origin of balanced heme production in mammals. Mutations in the C-terminal region of human erythroid-specific ALAS (hALAS2) are associated with X-linked protoporphyria (XLPP), a disease characterized by extreme photosensitivity, with elevated blood concentrations of free protoporphyrin IX and zinc protoporphyrin. To investigate the molecular basis for this disease, recombinant hALAS2 and variants of the enzyme harboring the gain-of-function XLPP mutations were constructed, purified, and analyzed kinetically, spectroscopically, and thermodynamically. Enhanced activities of the XLPP variants resulted from increases in the rate at which the product 5-aminolevulinate (ALA) was released from the enzyme. Circular dichroism spectroscopy revealed that the XLPP mutations altered the microenvironment of the pyridoxal 5'-phosphate cofactor, which underwent further and specific alterations upon succinyl-CoA binding. Transient kinetic analyses of the variant-catalyzed reactions and protein fluorescence quenching upon binding of ALA to the XLPP variants demonstrated that the protein conformational transition step associated with product release was predominantly affected. Of relevance is the fact that XLPP could also be modeled in cell culture. We propose that (1) the XLPP mutations destabilize the succinyl-CoA-induced hALAS2 closed conformation and thus accelerate ALA release, (2) the extended C-terminus of wild-type mammalian ALAS2 provides a regulatory role that allows for allosteric modulation of activity, thereby controlling the rate of erythroid heme biosynthesis, and (3) this control is disrupted in XLPP, resulting in porphyrin accumulation. PMID:26300302

  5. Conformal pure radiation with parallel rays

    NASA Astrophysics Data System (ADS)

    Leistner, Thomas; Nurowski, Paweł

    2012-03-01

    We define pure radiation metrics with parallel rays to be n-dimensional pseudo-Riemannian metrics that admit a parallel null line bundle K and whose Ricci tensor vanishes on vectors that are orthogonal to K. We give necessary conditions in terms of the Weyl, Cotton and Bach tensors for a pseudo-Riemannian metric to be conformal to a pure radiation metric with parallel rays. Then, we derive conditions in terms of the tractor calculus that are equivalent to the existence of a pure radiation metric with parallel rays in a conformal class. We also give analogous results for n-dimensional pseudo-Riemannian pp-waves.

  6. Making Pure Fine-Grained Inorganic Powder

    NASA Technical Reports Server (NTRS)

    Wood, C.

    1985-01-01

    Sustained arc plasma chemical reactor fabricates very-fine-grained inorganic solids having low thermal conductivity. Powder fabrication method, based on plasma tube technique produces pure solids without contamination commonly produced by grinding.

  7. [Biological properties of immunochemically pure tetanus antitoxin].

    PubMed

    Kornilova, A V; Khavkin, Iu A; Batalova, T A; Aleksevich, Ia I; Baschenko, I A

    1983-02-01

    Immunochemically pure tetanus antitoxin obtained from enzyme-treated horse serum is less reactogenic and anaphylactogenic and possesses higher therapeutic properties than antitoxin purified by nonspecific physico-chemical methods and containing ballast antigens. Due to its increased persistence in the recipient's body, the immunochemically pure antitoxin induces passive immunity in considerably lower doses than the preparations purified by the method "Diaferm-3". PMID:6340393

  8. Notes on the ambitwistor pure spinor string

    NASA Astrophysics Data System (ADS)

    Jusinskas, Renann Lipinski

    2016-05-01

    In this work, some aspects of the ambitwistor pure spinor string are investigated. The b ghost is presented and its main properties are derived in a simple way, very similar to the usual pure spinor b ghost construction. The heterotic case is also addressed with a new proposal for the BRST charge. The BRST cohomology is shown to correctly describe the heterotic supergravity spectrum and a semi-composite b ghost is constructed.

  9. Rehabilitation of pure alexia: A review

    PubMed Central

    Starrfelt, Randi; Ólafsdóttir, Rannveig Rós; Arendt, Ida-Marie

    2013-01-01

    Acquired reading problems caused by brain injury (alexia) are common, either as a part of an aphasic syndrome, or as an isolated symptom. In pure alexia, reading is impaired while other language functions, including writing, are spared. Being in many ways a simple syndrome, one would think that pure alexia was an easy target for rehabilitation efforts. We review the literature on rehabilitation of pure alexia from 1990 to the present, and find that patients differ widely on several dimensions, such as alexia severity and associated deficits. Many patients reported to have pure alexia in the reviewed studies, have associated deficits such as agraphia or aphasia and thus do not strictly conform to the diagnosis. Few studies report clear and generalisable effects of training, none report control data, and in many cases the reported findings are not supported by statistics. We can, however, tentatively conclude that Multiple Oral Re-reading techniques may have some effect in mild pure alexia where diminished reading speed is the main problem, while Tacile-Kinesthetic training may improve letter identification in more severe cases of alexia. There is, however, still a great need for well-designed and controlled studies of rehabilitation of pure alexia. PMID:23808895

  10. Nokia PureView oversampling technology

    NASA Astrophysics Data System (ADS)

    Vuori, Tero; Alakarhu, Juha; Salmelin, Eero; Partinen, Ari

    2013-03-01

    This paper describes Nokia's PureView oversampling imaging technology as well as the product, Nokia 808 PureView, featuring it. The Nokia PureView imaging technology is the combination of a large, super high resolution 41Mpix with high performance Carl Zeiss optics. Large sensor enables a pixel oversampling technique that reduces an image taken at full resolution into a lower resolution picture, thus achieving higher definition and light sensitivity. One oversampled super pixel in image file is formed by using many sensor pixels. A large sensor enables also a lossless zoom. If a user wants to use the lossless zoom, the sensor image is cropped. However, up-scaling is not needed as in traditional digital zooming usually used in mobile devices. Lossless zooming means image quality that does not have the digital zooming artifacts as well as no optical zooming artifacts like zoom lens system distortions. Zooming with PureView is also completely silent. PureView imaging technology is the result of many years of research and development and the tangible fruits of this work are exceptional image quality, lossless zoom, and superior low light performance.

  11. [Study of pure titanium electrolytic polishing].

    PubMed

    Morita, N

    1990-03-01

    This study attempted to polish pure titanium test pieces electrolytically to mirror surface at the size of cast denture frames. Electrolytic polishing of pure titanium could be done on an area of 30 cm2 with a non-aqueous electrolyte. Small pure titanium plates could be polished electrolytically, but a uniformly smooth surface could not be obtained easily with large testpiece. The optimal electrolytic conditions were 30 V for 6 min at 25 degrees C using a solution consisting of 70 ml ethyl alcohol, 30 ml iso-propyl alcohol, 6 g aluminum chloride, and 25 g zinc chloride. The solution was safe and had less restriction of frequency of use. PMID:2135513

  12. Engineering arbitrary pure and mixed quantum states

    SciTech Connect

    Pechen, Alexander

    2011-10-15

    Controlled manipulation by atomic- and molecular-scale quantum systems has attracted a lot of research attention in recent years. A fundamental problem is to provide deterministic methods for controlled engineering of arbitrary quantum states. This work proposes a deterministic method for engineering arbitrary pure and mixed states of a wide class of quantum systems. The method exploits a special combination of incoherent and coherent controls (incoherent and coherent radiation) and has two properties which are specifically important for manipulating by quantum systems: it realizes the strongest possible degree of their state control, complete density matrix controllability, meaning the ability to steer arbitrary pure and mixed initial states into any desired pure or mixed final state, and it is all-to-one, such that each particular control transfers all initial system states into one target state.

  13. Surface vibrational spectroscopy of pure liquids

    SciTech Connect

    Superfine, R.; Huang, J.Y.; Du, Q.; Shen, Y.R.

    1991-03-01

    We report the use of infrared visible sum frequency generation (SFG) to obtain the surface vibrational spectra of pure liquid methanol and water. These are the first surface vibrational spectra ever obtained for pure liquids. We have also deduced from the SFG results the absolute orientations of molecules at the pure liquid/vapor interface. The surface methanol molecules appear to have their CH{sub 3} groups projecting out of the liquid in agreement with the theoretical prediction. For the orientation of surface water molecules, however, different calculations have yielded very different predictions. Our SFG measurement provides clear evidence that the molecules are oriented with an unbonded hydrogen projecting out of the liquid. 9 refs., 3 figs.

  14. Pure neuritic leprosy: Current status and relevance.

    PubMed

    Rao, P Narasimha; Suneetha, Sujai

    2016-01-01

    Pure neuritic leprosy has always been an enigma due to its clinical and management ambiguities. Although only the Indian Association of Leprologist's classification recognizes 'pure neuritic leprosy' as a distinct sub group of leprosy, cases nonetheless are reported from various countries of Asia, Africa, South America and Europe, indicating its global relevance. It is important to maintain pure neuritic leprosy as a subgroup as it constitutes a good percentage of leprosy cases reported from India, which contributes to more than half of global leprosy numbers. Unfortunately, a high proportion of these patients present with Grade 2 disability at the time of initial reporting itself due to the early nerve involvement. Although skin lesions are absent by definition, when skin biopsies were performed from the skin along the distribution of the affected nerve, a proportion of patients demonstrated leprosy pathology, revealing sub-clinical skin involvement. In addition on follow-up, skin lesions are noted to develop in up to 20% of pure neuritic leprosy cases, indicating its progression to manifest cutaneous disease. Over the decades, the confirmation of diagnosis of pure neuritic leprosy has been subjective, however, with the arrival and use of high-resolution ultrasonography (HRUS) for nerve imaging, we have a tool not only to objectively measure and record the nerve thickening but also to assess the morphological alterations in the nerve including echo texture, fascicular pattern and vascularity. Management of pure neuritic leprosy requires multidrug therapy along with appropriate dose of systemic corticosteroids, for both acute and silent neuritis. Measures for pain relief, self-care of limbs and physiotherapy are important to prevent as well as manage disabilities in this group of patients. PMID:27088926

  15. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    PubMed

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies. PMID:25998414

  16. Effect of Tumor Necrosis Factor-Alpha on Erythropoietin- and Erythropoietin Receptor-Induced Erythroid Progenitor Cell Proliferation in β-Thalassemia/Hemoglobin E Patients

    PubMed Central

    Tanyong, Dalina I; Panichob, Prapaporn; Kheansaard, Wasinee; Fucharoen, Suthat

    2015-01-01

    Objective: Thalassemia is one of the genetic diseases that cause anemia and ineffective erythropoiesis. Increased levels of several inflammatory cytokines have been reported in β-thalassemia and might contribute to ineffective erythropoiesis. However, the mechanism by which tumor necrosis factor-alpha (TNF-α) is involved in ineffective erythropoiesis in thalassemic patients remains unclear. The objective of this study is to investigate the effect of TNF-α on the erythropoietin (EPO) and erythropoietin receptor (EPOR) expression involved in proliferation of β-thalassemia/hemoglobin (Hb) E erythroid progenitor cells compared with cells from healthy subjects. Materials and Methods: CD34-positive cells were isolated from heparinized blood by using the EasySep® CD34 selection kit. Cells were then cultured with suitable culture medium in various concentrations of EPO for 14 days. The effect of TNF-α on percent cell viability was analyzed by trypan blue staining. In addition, the percentage of apoptosis and levels of EPOR protein were measured by flow cytometry. Results: Upon EPO treatment, a higher cell number was observed for erythroid progenitor cells from both healthy participants and β-thalassemia/Hb E patients. However, a reduction of apoptosis was found in EPO-treated cells especially for β-thalassemia/Hb E patients. Interestingly, TNF-α caused higher levels of cell apoptosis and lower levels of EPOR protein in thalassemic erythroid progenitor cells. Conclusion: TNF-α caused a reduction in the level of EPOR protein and EPO-induced erythroid progenitor cell proliferation. It is possible that TNF-α could be involved in the mechanism of ineffective erythropoiesis in β-thalassemia/Hb E patients. PMID:26376749

  17. Hydrogen Sulfide Levels and Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) Activity Are Attenuated in the Setting of Critical Limb Ischemia (CLI)

    PubMed Central

    Islam, Kazi N; Polhemus, David J; Donnarumma, Erminia; Brewster, Luke P; Lefer, David J

    2015-01-01

    Background Cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase are endogenous enzymatic sources of hydrogen sulfide (H2S). Functions of H2S are mediated by several targets including ion channels and signaling proteins. Nuclear factor-erythroid 2-related factor 2 is responsible for the expression of antioxidant response element–regulated genes and is known to be upregulated by H2S. We examined the levels of H2S, H2S-producing enzymes, and nuclear factor-erythroid 2-related factor 2 activation status in skeletal muscle obtained from critical limb ischemia (CLI) patients. Methods and Results Gastrocnemius tissues were attained postamputation from human CLI and healthy control patients. We found mRNA and protein levels of cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase were significantly decreased in skeletal muscle of CLI patients as compared to control. H2S and sulfane sulfur levels were significantly decreased in skeletal muscle of CLI patients. We also observed significant reductions in nuclear factor-erythroid 2-related factor 2 activation as well as antioxidant proteins, such as Cu, Zn-superoxide dismutase, catalase, and glutathione peroxidase in skeletal muscle of CLI patients. Biomarkers of oxidative stress, such as malondialdehyde and protein carbonyl formation, were significantly increased in skeletal muscle of CLI patients as compared to healthy controls. Conclusions The data demonstrate that H2S bioavailability and nuclear factor-erythroid 2-related factor 2 activation are both attenuated in CLI tissues concomitant with significantly increased oxidative stress. Reductions in the activity of H2S-producing enzymes may contribute to the pathogenesis of CLI. PMID:25977470

  18. BRST and the pure spinor formalism

    SciTech Connect

    Garcia, J. Antonio

    2008-03-06

    The aim of this talk is to show the relation between the standard BRST approach of the GS superstring with the quantization technics used in the pure spinor approach to superstring. To that end we will use the Batalin-Fradkin-Tyutin (BFT) conversion program of second class constraints to first class constraints in the GS superstring using light cone coordinates. By applying this systematic procedure we were able to obtain a gauge system that is equivalent to the recent model proposed in [1] to relate the GS superstring to the pure spinor formalism.

  19. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time. PMID:25987256

  20. The transactivation domain AF-2 but not the DNA-binding domain of the estrogen receptor is required to inhibit differentiation of avian erythroid progenitors.

    PubMed

    von Lindern, M; Boer, L; Wessely, O; Parker, M; Beug, H

    1998-02-01

    Earlier work demonstrated that an activated estrogen receptor (ER) is required for long-term self-renewal of c-ErbB-expressing avian erythroid progenitors. Here, we demonstrate that activation of the ER does not only arrest or retard differentiation of early progenitors but that it affects erythroid differentiation at all stages of erythroid maturation. A search for genes whose expression is affected by the ER showed that the 17beta-estradiol-activated receptor suppressed the differentiation-associated up-regulation of Gata-1, SCL-1, and globin genes in partially mature cells. In the same cells, the expression of carbonic anhydrase II (CAII) and histone H5 was enhanced. This led to premature expression of CAII, a possible explanation for the toxic effects of overexpressed ER. Repression specifically required the transactivation domain AF-2, but neither an intact DNA-binding domain (DBD) nor the AF-1 domain. The transcriptional activation of CAII, however, required both an intact AF-2 and a functional DBD. The requirement for the AF-2, but not the DBD, suggested that the ER may compete with other nuclear hormone receptors for transcriptional coactivators that bind AF-2, a domain well conserved within this family of transcription factors. We show, however, that this model does not apply for the most likely candidate, the avian thyroid hormone receptor. PMID:9482667

  1. The estrogen receptor cooperates with the TGF alpha receptor (c-erbB) in regulation of chicken erythroid progenitor self-renewal.

    PubMed

    Schroeder, C; Gibson, L; Nordström, C; Beug, H

    1993-03-01

    A unique combination of growth promoting factors is described that allows growth of large amounts (10(10)-10(11)) of normal erythroid progenitors from chick bone marrow. These erythroid progenitors express the estrogen receptor (ER) as well as the receptor tyrosine kinase TGF alpha R/c-erbB. They require both TGF alpha and estradiol for sustained self-renewal in vitro, but terminally differentiate upon withdrawal of TGF alpha and inactivation of the ER by an antagonist (ICI 164.384). Overexpression of the human ER in erythroblasts devoid of endogenous ER revealed that the hormone-activated ER alone arrested erythroid differentiation and repressed a large group of erythrocyte genes. When similarly overexpressed, TGF alpha R/c-erbB inhibited the expression of a distinct, but overlapping, set of genes. The endogenous ER and TGF alpha R/c-erbB affect erythrocyte gene expression in a similar, but less pronounced fashion. Surprisingly, suppression of ER function by antagonist efficiently inhibited erythroblast transformation by tyrosine kinase oncogenes, suggesting a role of the endogenous ER in leukemogenesis. We speculate that the oncogenes v-erbB and v-erbA cooperate in erythroleukemia induction by a mechanism that is employed by TGF alpha R/c-erbB and ER to regulate normal progenitor self-renewal in response to external signals. PMID:8458346

  2. Molecular tectonics: from enantiomerically pure sugars to enantiomerically pure triple stranded helical coordination network.

    PubMed

    Grosshans, Philippe; Jouaiti, Abdelaziz; Bulach, Véronique; Planeix, Jean-Marc; Hosseini, Mir Wais; Nicoud, Jean-François

    2003-06-21

    The self-assembly between a bis-monodentate tecton based on two pyridine units connected to an enantiomerically pure isomannide stereoisomer and HgCl2 leads to the formation of an enantiomerically pure triple stranded helical infinite coordination network which was structurally characterised by X-ray diffraction on single crystal. PMID:12841229

  3. Temporal Ventriloquism in a Purely Temporal Context

    ERIC Educational Resources Information Center

    Hartcher-O'Brien, Jessica; Alais, David

    2011-01-01

    This study examines how audiovisual signals are combined in time for a temporal analogue of the ventriloquist effect in a purely temporal context, that is, no spatial grounding of signals or other spatial facilitation. Observers were presented with two successive intervals, each defined by a 1250-ms tone, and indicated in which interval a brief…

  4. Thrust Measurement of Pure Magnetic Sail

    NASA Astrophysics Data System (ADS)

    Ueno, Kazuma; Kimura, Toshiyuki; Ayabe, Tomohiro; Funaki, Ikkoh; Yamakawa, Hiroshi; Horisawa, Hideyuki

    A Pure Magnetic Sail is a deep space propulsion system consisting of a coil mounted on a spacecraft. In order to predict the thrust characteristics of a Pure Magnetic Sail in space, thrust measurement and magnetic field measurement were conducted using a scale model in a laboratory. To simulate the solar wind, a magnetoplasmadynamic arcjet provides a high density (2×1019 m-3) and high velocity (47 km/s) plasma flow that impinges on a 20-turn 25-mm-radius coil simulating a Pure Magnetic Sail. When the magnetic cavity size of the scale model (L) is increased from 0.12 to 0.17 m, the thrust increases from 0.47 to 0.92 N. Scaling up, this experiment corresponds to a 300-km diameter Pure Magnetic Sail in space. The thrust also depends on the coil tilt angle, which is the angle between the direction of the solar wind flow and the coil axis. The maximum thrust of 1.5 N is obtained for a tilt angle of 90 degrees.

  5. Implicit Reading in Chinese Pure Alexia

    ERIC Educational Resources Information Center

    Shan, Chunlei; Zhu, Renjing; Xu, Mingwei; Luo, Benyan; Weng, Xuchu

    2010-01-01

    A number of recent studies have shown that some patients with pure alexia display evidence of implicit access to lexical and semantic information about words that they cannot read explicitly. This phenomenon has not been investigated systematically in Chinese patients. We report here a case study of a Chinese patient who met the criteria for pure…

  6. Exploring the simplest purely baryonic decay processes

    NASA Astrophysics Data System (ADS)

    Geng, C. Q.; Hsiao, Y. K.; Rodrigues, Eduardo

    2016-07-01

    Though not considered in general, purely baryonic decays could shed light on the puzzle of the baryon number asymmetry in the universe by means of a better understanding of the baryonic nature of our matter world. As such, they constitute a yet unexplored class of decay processes worth investigating. We propose to search for purely baryonic decay processes at the LHCb experiment. No such type of decay has ever been observed. In particular, we concentrate on the decay Λb0→p p ¯n , which is the simplest purely baryonic decay mode, with solely spin-1 /2 baryons involved. We predict its decay branching ratio to be B (Λb0→p p ¯ n )=(2. 0-0.2+0.3)×10-6 , which is sufficiently large to make the decay mode accessible to LHCb. Our study can be extended to other purely baryonic decays such as Λb0→p p ¯ Λ , Λb0→Λ p ¯ Λ , and Λb0→Λ Λ ¯Λ , as well as to similar decays of antitriplet b baryons such as Ξb0 ,-.

  7. A Pure Theory of Lifelong Learning.

    ERIC Educational Resources Information Center

    Hatton, Michael J.

    Charles Tiebout's Pure Theory of Local Expenditures serves as a helpful framework in examining the emergence of the learning society, communications technologies, freer trade, and the effects these will have on the educational infrastructure. Tiebout argued that the failure of market-type systems of public good at the central government level does…

  8. Radioprotection of mice with interleukin-1: Relationship to the number of erythroid and granulocyte-macrophage colony-forming cells

    SciTech Connect

    Schwartz, G.N.; Patchen, M.L.; Neta, R.; MacVittie, T.J.

    1990-01-01

    This report presents the results of an investigation of changes in the number of erythroid and granulocyte-macrophage colony forming cells (GM-CFC) that had occurred in tissues of normal B6D2F1 mice 20 h after administration of a radioprotective dose (150 ng) of human recombinant interleukin-1 (rIL-1). Neutrophilia in the peripheral blood and changes in the tissue distribution of GM-CFC demonstrated that cells were mobilized from the bone marrow in response to rIL-1 injection. For example, 20 h after rIL-1 injection marrow GM-CFC numbers were 80% of the numbers in bone marrow from saline-injected mice. Associated with this decrease there was a twofold increase in the number of peripheral blood and splenic GM-CFC. Also, as determined by hydroxyurea injection, there was an increase in the number of GM-CFC in S phase of the cell cycle in the spleen, but not in the bone marrow. Data in this report suggest that when compared to the spleen, stimulation of granulopoiesis after rIL-1 injection is delayed in the bone marrow.

  9. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    SciTech Connect

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  10. HIV-1 gp120 impairs the differentiation and survival of cord blood CD34+ HPCs induced to the erythroid lineage.

    PubMed

    Morini, Silvia; Musumeci, Giuseppina; Bon, Isabella; Miserocchi, Anna; Alviano, Francesco; Longo, Serena; Bertoldi, Alessia; Velati, Claudio V; Gibellini, Davide; Re, Maria Carla

    2016-01-01

    Anemia is the most common hematological abnormality in human immunodeficiency virus (HIV)-infected patients. Besides chronic disease, opportunistic infections, nutritional deficiencies and antiretroviral drug toxicity, the direct role of HIV in the development of anemia has not yet been fully investigated. To explore the HIV-related mechanisms involved in the genesis of anemia, we used two experimental designs. In the first, HPCs purified from cord blood were challenged with HIV-1IIIb or recombinant gp120 (rgp120) and then committed to erythrocyte differentiation (EPO-post-treated HPCs). In the second, HPCs were first committed to differentiate towards the erythroid lineage and only afterwards challenged with HIV-1IIIb or rgp120 (EPO-pre-treated HPCs). Our results showed that HPCs and EPO-induced HPCs were not susceptible to HIV-1 infection. In addition, the two experimental designs (EPO post or pre-treated HPCs) independently showed that HIV-1IIIb or rgp120 were able to induce the impairment of survival, proliferation, and differentiation albeit differing in kinetics and extent. Interestingly, the gp120 interaction with CD4 and CXCR4 played a pivotal role in the impairment of erythrocyte differentiation by inducing TGF-b1 expression. These observations reveal an important additional mechanism involved in the genesis of anemia suggesting a complex competition between EPO-positive regulation and HIV-negative priming regarding erythrocyte survival, proliferation and maturation. PMID:26922982

  11. Structure of the Membrane Proximal Oxioreductase Domain of Human Steap3, the Dominant Ferrireductase of the Erythroid Transferrin Cycle

    SciTech Connect

    Sendamarai, A.K.; Ohgami, R.S.; Fleming, M.D.; Lawrence, C.M.

    2009-05-27

    The daily production of 200 billion erythrocytes requires 20 mg of iron, accounting for nearly 80% of the iron demand in humans. Thus, erythroid precursor cells possess an efficient mechanism for iron uptake in which iron loaded transferrin (Tf) binds to the transferrin receptor (TfR) at the cell surface. The Tf:TfR complex then enters the endosome via receptor-mediated endocytosis. Upon endosomal acidification, iron is released from Tf, reduced to Fe{sup 2+} by Steap3, and transported across the endosomal membrane by divalent metal iron transporter 1. Steap3, the major ferrireductase in erythrocyte endosomes, is a member of a unique family of reductases. Steap3 is comprised of an N-terminal cytosolic oxidoreductase domain and a C-terminal heme-containing transmembrane domain. Cytosolic NADPH and a flavin are predicted cofactors, but the NADPH/flavin binding domain differs significantly from those in other eukaryotic reductases. Instead, Steap3 shows remarkable, although limited homology to FNO, an archaeal oxidoreductase. We have determined the crystal structure of the human Steap3 oxidoreductase domain in the absence and presence of NADPH. The structure reveals an FNO-like domain with an unexpected dimer interface and substrate binding sites that are well positioned to direct electron transfer from the cytosol to a heme moiety predicted to be fixed within the transmembrane domain. Here, we discuss possible gating mechanisms for electron transfer across the endosomal membrane.

  12. Nuclear Factor Erythroid 2-Related Factor 2 Deficiency Results in Amplification of the Liver Fat-Lowering Effect of Estrogen.

    PubMed

    Rui, Wenjuan; Zou, Yuhong; Lee, Joonyong; Nambiar, Shashank Manohar; Lin, Jingmei; Zhang, Linjie; Yang, Yan; Dai, Guoli

    2016-07-01

    Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) regulates multiple biologic processes, including hepatic lipid metabolism. Estrogen exerts actions affecting energy homeostasis, including a liver fat-lowering effect. Increasing evidence indicates the crosstalk between these two molecules. The aim of this study was to evaluate whether Nrf2 modulates estrogen signaling in hepatic lipid metabolism. Nonalcoholic fatty liver disease (NAFLD) was induced in wild-type and Nrf2-null mice fed a high-fat diet and the liver fat-lowering effect of exogenous estrogen was subsequently assessed. We found that exogenous estrogen eliminated 49% and 90% of hepatic triglycerides in wild-type and Nrf2-null mice with NAFLD, respectively. This observation demonstrates that Nrf2 signaling is antagonistic to estrogen signaling in hepatic fat metabolism; thus, Nrf2 absence results in striking amplification of the liver fat-lowering effect of estrogen. In addition, we found the association of trefoil factor 3 and fatty acid binding protein 5 with the liver fat-lowering effect of estrogen. In summary, we identified Nrf2 as a novel and potent inhibitor of estrogen signaling in hepatic lipid metabolism. Our finding may provide a potential strategy to treat NAFLD by dually targeting Nrf2 and estrogen signaling. PMID:27189962

  13. Structural characterization of a noncovalent complex between ubiquitin and the transactivation domain of the erythroid-specific factor EKLF.

    PubMed

    Raiola, Luca; Lussier-Price, Mathieu; Gagnon, David; Lafrance-Vanasse, Julien; Mascle, Xavier; Arseneault, Genevieve; Legault, Pascale; Archambault, Jacques; Omichinski, James G

    2013-11-01

    Like other acidic transactivation domains (TAD), the minimal TAD from the erythroid-specific transcription factor EKLF (EKLFTAD) has been shown to contribute both to its transcriptional activity as well as to its ubiquitin(UBI)-mediated degradation. In this article, we examine the activation-degradation role of the acidic TAD of EKLF and demonstrate that the first 40 residues (EKLFTAD1) within this region form a noncovalent interaction with UBI. Nuclear magnetic resonance (NMR) structural studies of an EKLFTAD1-UBI complex show that EKLFTAD1 adopts a 14-residue α helix that forms the recognition interface with UBI in a similar manner as the UBI-interacting helix of Rabex5. We also identify a similar interaction between UBI and the activation-degradation region of SREBP1a, but not with the activation-degradation regions of p53, GAL4, and VP16. These results suggest that select activation-degradation regions like the ones found in EKLF and SREBP1a function in part through their ability to form noncovalent interactions with UBI. PMID:24139988

  14. Human and Murine Hematopoietic Stem Cell Aging Is Associated with Functional Impairments and Intrinsic Megakaryocytic/Erythroid Bias

    PubMed Central

    Rundberg Nilsson, Alexandra; Soneji, Shamit; Adolfsson, Sofia; Bryder, David; Pronk, Cornelis Jan

    2016-01-01

    Aging within the human hematopoietic system associates with various deficiencies and disease states, including anemia, myeloid neoplasms and reduced adaptive immune responses. Similar phenotypes are observed in mice and have been linked to alterations arising at the hematopoietic stem cell (HSC) level. Such an association is, however, less established in human hematopoiesis and prompted us here to detail characteristics of the most primitive human hematopoietic compartments throughout ontogeny. In addition, we also attempted to interrogate similarities between aging human and murine hematopoiesis. Coupled to the transition from human cord blood (CB) to young and aged bone marrow (BM), we observed a gradual increase in frequency of candidate HSCs. This was accompanied by functional impairments, including decreased lymphoid output and reduced proliferative potential. Downstream of human HSCs, we observed decreasing levels of common lymphoid progenitors (CLPs), and increasing frequencies of megakaryocyte/erythrocyte progenitors (MEPs) with age, which could be linked to changes in lineage-affiliated gene expression patterns in aged human HSCs. These findings were paralleled in mice. Therefore, our data support the notion that age-related changes also in human hematopoiesis involve the HSC pool, with a prominent skewing towards the megakaryocytic/erythroid lineages, and suggests conserved mechanisms underlying aging of the blood cell system. PMID:27368054

  15. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involve the nuclear erythroid 2-related factor 2 pathway

    PubMed Central

    Han, Jing; Xiao, Qing; Lin, Yan-hua; Zheng, Zhen-zhu; He, Zhao-dong; Hu, Juan; Chen, Li-dian

    2015-01-01

    Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg) reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke. PMID:26889188

  16. Structure of the membrane proximal oxidoreductase domain of human Steap3, the dominant ferrireductase of the erythroid transferrin cycle

    PubMed Central

    Sendamarai, Anoop K.; Ohgami, Robert S.; Fleming, Mark D.; Lawrence, C. Martin

    2008-01-01

    The daily production of 200 billion erythrocytes requires 20 mg of iron, accounting for nearly 80% of the iron demand in humans. Thus, erythroid precursor cells possess an efficient mechanism for iron uptake in which iron loaded transferrin (Tf) binds to the transferrin receptor (TfR) at the cell surface. The Tf:TfR complex then enters the endosome via receptor-mediated endocytosis. Upon endosomal acidification, iron is released from Tf, reduced to Fe2+ by Steap3, and transported across the endosomal membrane by divalent metal iron transporter 1. Steap3, the major ferrireductase in erythrocyte endosomes, is a member of a unique family of reductases. Steap3 is comprised of an N-terminal cytosolic oxidoreductase domain and a C-terminal heme-containing transmembrane domain. Cytosolic NADPH and a flavin are predicted cofactors, but the NADPH/flavin binding domain differs significantly from those in other eukaryotic reductases. Instead, Steap3 shows remarkable, although limited homology to FNO, an archaeal oxidoreductase. We have determined the crystal structure of the human Steap3 oxidoreductase domain in the absence and presence of NADPH. The structure reveals an FNO-like domain with an unexpected dimer interface and substrate binding sites that are well positioned to direct electron transfer from the cytosol to a heme moiety predicted to be fixed within the transmembrane domain. Here, we discuss possible gating mechanisms for electron transfer across the endosomal membrane. PMID:18495927

  17. Correction of murine β-thalassemia after minimal lentiviral gene transfer and homeostatic in vivo erythroid expansion

    PubMed Central

    Negre, Olivier; Fusil, Floriane; Colomb, Charlotte; Roth, Shoshannah; Gillet-Legrand, Beatrix; Henri, Annie; Beuzard, Yves; Bushman, Frederic; Leboulch, Philippe

    2011-01-01

    A challenge for gene therapy of genetic diseases is to maintain corrected cell populations in subjects undergoing transplantation in cases in which the corrected cells do not have intrinsic selective advantage over nontransduced cells. For inherited hematopoietic disorders, limitations include inefficient transduction of stem cell pools, the requirement for toxic myelosuppression, and a lack of optimal methods for cell selection after transduction. Here, we have designed a lentiviral vector that encodes human β-globin and a truncated erythropoietin receptor, both under erythroid-specific transcriptional control. This truncated receptor confers enhanced sensitivity to erythropoietin and a benign course in human carriers. Transplantation of marrow transduced with the vector into syngenic thalassemic mice, which have elevated plasma erythropoietin levels, resulted in long-term correction of the disease even at low ratios of transduced/untransduced cells. Amplification of the red over the white blood cell lineages was self-controlled and averaged ∼ 100-fold instead of ∼ 5-fold for β-globin expression alone. There was no detectable amplification of white blood cells or alteration of hematopoietic homeostasis. Notwithstanding legitimate safety concerns in the context of randomly integrating vectors, this approach may prove especially valuable in combination with targeted integration or in situ homologous recombination/repair and may lower the required level of pretransplantation myelosuppression. PMID:21436071

  18. Adult-onset Diamond-Blackfan anemia with a novel mutation in the exon 5 of RPL11: too late and too rare

    PubMed Central

    Flores Ballester, Elena; Gil-Fernández, Juan José; Vázquez Blanco, Miguel; Mesa, José M; de Dios García, Juan; Tamayo, Ana T; Burgaleta, Carmen

    2015-01-01

    Key Clinical Message Diamond-Blackfan anemia (DBA) is a congenital erythroid aplasia usually diagnosed in the early infancy and associated with mutations or large deletions in 11 ribosomal protein (RP) genes. Adult patients with severe, transfusion dependence, aregenerative anemia might have a genetic-in-origin disease with an atypical presentation. Late onset nonclassical DBA should be ruled out and mutations of RP genes studied. PMID:26185635

  19. Adult-onset Diamond-Blackfan anemia with a novel mutation in the exon 5 of RPL11: too late and too rare.

    PubMed

    Flores Ballester, Elena; Gil-Fernández, Juan José; Vázquez Blanco, Miguel; Mesa, José M; de Dios García, Juan; Tamayo, Ana T; Burgaleta, Carmen

    2015-06-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid aplasia usually diagnosed in the early infancy and associated with mutations or large deletions in 11 ribosomal protein (RP) genes. Adult patients with severe, transfusion dependence, aregenerative anemia might have a genetic-in-origin disease with an atypical presentation. Late onset nonclassical DBA should be ruled out and mutations of RP genes studied. PMID:26185635

  20. Pomalidomide reverses γ-globin silencing through the transcriptional reprogramming of adult hematopoietic progenitors.

    PubMed

    Dulmovits, Brian M; Appiah-Kubi, Abena O; Papoin, Julien; Hale, John; He, Mingzhu; Al-Abed, Yousef; Didier, Sebastien; Gould, Michael; Husain-Krautter, Sehba; Singh, Sharon A; Chan, Kyle W H; Vlachos, Adrianna; Allen, Steven L; Taylor, Naomi; Marambaud, Philippe; An, Xiuli; Gallagher, Patrick G; Mohandas, Narla; Lipton, Jeffrey M; Liu, Johnson M; Blanc, Lionel

    2016-03-17

    Current therapeutic strategies for sickle cell anemia are aimed at reactivating fetal hemoglobin. Pomalidomide, a third-generation immunomodulatory drug, was proposed to induce fetal hemoglobin production by an unknown mechanism. Here, we report that pomalidomide induced a fetal-like erythroid differentiation program, leading to a reversion of γ-globin silencing in adult human erythroblasts. Pomalidomide acted early by transiently delaying erythropoiesis at the burst-forming unit-erythroid/colony-forming unit-erythroid transition, but without affecting terminal differentiation. Further, the transcription networks involved in γ-globin repression were selectively and differentially affected by pomalidomide including BCL11A, SOX6, IKZF1, KLF1, and LSD1. IKAROS (IKZF1), a known target of pomalidomide, was degraded by the proteasome, but was not the key effector of this program, because genetic ablation of IKZF1 did not phenocopy pomalidomide treatment. Notably, the pomalidomide-induced reprogramming was conserved in hematopoietic progenitors from individuals with sickle cell anemia. Moreover, multiple myeloma patients treated with pomalidomide demonstrated increased in vivo γ-globin levels in their erythrocytes. Together, these data reveal the molecular mechanisms by which pomalidomide reactivates fetal hemoglobin, reinforcing its potential as a treatment for patients with β-hemoglobinopathies. PMID:26679864

  1. Decitabine With or Without Bortezomib in Treating Older Patients With Acute Myeloid Leukemia

    ClinicalTrials.gov

    2016-03-14

    Acute Myeloid Leukemia Arising From Previous Myelodysplastic Syndrome; Adult Acute Megakaryoblastic Leukemia; Adult Acute Monoblastic Leukemia; Adult Acute Monocytic Leukemia; Adult Acute Myeloid Leukemia With Minimal Differentiation; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Myeloid Leukemia Without Maturation; Adult Erythroleukemia; Adult Pure Erythroid Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

  2. Dynamics of α-globin locus chromatin structure and gene expression during erythroid differentiation of human CD34+ cells in culture

    PubMed Central

    Mahajan, Milind C; Karmakar, Subhradip; Krause, Diane; Weissman, Sherman M

    2009-01-01

    Objective The aim of the present study has been to establish serum free culture conditions for the ex vivo expansion and differentiation of human CD34+ cells into erythroid lineage and to study the chromatin structure, gene expression and transcription factor recruitment at the α–globin locus in the developing erythron. Methods A basal IMDM cell culture medium with 1% bovine serum albumin as a serum replacement and a combination of cytokines and growth factors was used for the expansion and differentiation of the CD34+ cells. Expression patterns of the alpha and beta like genes at various stages of erythropoiesis was studied by Reverse transcriptase (RT)-qPCR analysis, profile of key erythroid transcription factors was investigated by western blotting, and the chromatin structure and transcription factor recruitment at the alpha globin locus was investigated by ChIP-qPCR analysis. Results Human CD34+ cells in the serum free medium undergo near synchronous erythroid differentiation to yield large amount of cells at different differentiation stages. We observe distinct patterns of the histone modifications and transcription factor binding at the α-globin locus during erythroid differentiation of CD34+ cells. NF-E2 was present at upstream activator sites even before addition of erythropoietin (Epo), while bound GATA-1 was only detectable after Epo treatment. After seven days of erythropoietin treatment, H3K4Me2 modification uniformly increases throughout the α–globin locus. Acetylation at H3K9 and binding of Pol II, NF-E2 and GATA-1 were restricted to certain HS sites of the enhancer and theta gene, and were conspicuously low at the α-like globin promoters. Rearrangement of the insulator binding factor CTCF took place at and around the α-globin locus as CD34+ cells differentiated into erythroid pathway. Conclusion Our results indicate that remodeling of the upstream elements may be the primary event in activation of α–globin gene expression. Activation of

  3. Global Genetic Architecture of an Erythroid Quantitative Trait Locus, HMIP-2

    PubMed Central

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-01-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed “A” and “B.” These typically occurred together (“A–B”) on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for “A” and “B,” we interrogated public population datasets. Haplotypes carrying only “A” or “B” were typical for populations in Sub-Saharan Africa. The “A–B” combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene–environment interaction during human migration and adaptation. PMID:25069958

  4. Global genetic architecture of an erythroid quantitative trait locus, HMIP-2.

    PubMed

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-11-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed "A" and "B." These typically occurred together ("A-B") on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for "A" and "B," we interrogated public population datasets. Haplotypes carrying only "A" or "B" were typical for populations in Sub-Saharan Africa. The "A-B" combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene-environment interaction during human migration and adaptation. PMID:25069958

  5. Computational models of adult neurogenesis

    NASA Astrophysics Data System (ADS)

    Cecchi, Guillermo A.; Magnasco, Marcelo O.

    2005-10-01

    Experimental results in recent years have shown that adult neurogenesis is a significant phenomenon in the mammalian brain. Little is known, however, about the functional role played by the generation and destruction of neurons in the context of an adult brain. Here, we propose two models where new projection neurons are incorporated. We show that in both models, using incorporation and removal of neurons as a computational tool, it is possible to achieve a higher computational efficiency that in purely static, synapse-learning-driven networks. We also discuss the implication for understanding the role of adult neurogenesis in specific brain areas like the olfactory bulb and the dentate gyrus.

  6. Pure field theories and MACSYMA algorithms

    NASA Technical Reports Server (NTRS)

    Ament, W. S.

    1977-01-01

    A pure field theory attempts to describe physical phenomena through singularity-free solutions of field equations resulting from an action principle. The physics goes into forming the action principle and interpreting specific results. Algorithms for the intervening mathematical steps are sketched. Vacuum general relativity is a pure field theory, serving as model and providing checks for generalizations. The fields of general relativity are the 10 components of a symmetric Riemannian metric tensor; those of the Einstein-Straus generalization are the 16 components of a nonsymmetric. Algebraic properties are exploited in top level MACSYMA commands toward performing some of the algorithms of that generalization. The light cone for the theory as left by Einstein and Straus is found and simplifications of that theory are discussed.

  7. Effective pure states for bulk quantum computation

    SciTech Connect

    Knill, E.; Chuang, I.; Laflamme, R.

    1997-11-01

    In bulk quantum computation one can manipulate a large number of indistinguishable quantum computers by parallel unitary operations and measure expectation values of certain observables with limited sensitivity. The initial state of each computer in the ensemble is known but not pure. Methods for obtaining effective pure input states by a series of manipulations have been described by Gershenfeld and Chuang (logical labeling) and Corey et al. (spatial averaging) for the case of quantum computation with nuclear magnetic resonance. We give a different technique called temporal averaging. This method is based on classical randomization, requires no ancilla qubits and can be implemented in nuclear magnetic resonance without using gradient fields. We introduce several temporal averaging algorithms suitable for both high temperature and low temperature bulk quantum computing and analyze the signal to noise behavior of each.

  8. Black Hole Attractors and Pure Spinors

    SciTech Connect

    Hsu, Jonathan P.; Maloney, Alexander; Tomasiello, Alessandro

    2006-02-21

    We construct black hole attractor solutions for a wide class of N = 2 compactifications. The analysis is carried out in ten dimensions and makes crucial use of pure spinor techniques. This formalism can accommodate non-Kaehler manifolds as well as compactifications with flux, in addition to the usual Calabi-Yau case. At the attractor point, the charges fix the moduli according to {Sigma}f{sub k} = Im(C{Phi}), where {Phi} is a pure spinor of odd (even) chirality in IIB (A). For IIB on a Calabi-Yau, {Phi} = {Omega} and the equation reduces to the usual one. Methods in generalized complex geometry can be used to study solutions to the attractor equation.

  9. Computing Properties Of Pure And Mixed Fluids

    NASA Technical Reports Server (NTRS)

    Fowler, J. R.; Hendricks, Robert C.

    1993-01-01

    GASPLUS created as two-part code: first designed for use with pure fluids and second designed for use with mixtures of fluids and phases. Offers routines for mathematical modeling of conditions of fluids in pumps, turbines, compressors and other machines. Other routines for calculating performance of para/ortho-hydrogen reactor and heat of para/normal-hydrogen reaction as well as unique convergence routine demonstrates engineering flavor of GASPLUS. Written in FORTRAN 77.

  10. Beyond Sex Education: How Adults Relate to Children's Sensuality.

    ERIC Educational Resources Information Center

    Fogel, Alan

    Current cultural attitudes toward children's sexuality resemble attitudes toward adults' sexuality; there is an emphasis on purely genital and orgasmic pleasure. Adults and children need warmth, physical contact, and a sense of belonging for which genital stimulation may be unnecessary or inappropriate. Children's sexual advances to adults, as…

  11. Effective pure states for bulk quantum computation

    SciTech Connect

    Knill, E.; Chuang, I.; Laflamme, R.

    1998-05-01

    In bulk quantum computation one can manipulate a large number of indistinguishable quantum computers by parallel unitary operations and measure expectation values of certain observables with limited sensitivity. The initial state of each computer in the ensemble is known but not pure. Methods for obtaining effective pure input states by a series of manipulations have been described by Gershenfeld and Chuang (logical labeling) [Science {bold 275}, 350 (1997)] and Cory {ital et al.} (spatial averaging) [Proc. Natl. Acad. Sci. USA {bold 94}, 1634 (1997)] for the case of quantum computation with nuclear magnetic resonance. We give a different technique called temporal averaging. This method is based on classical randomization, requires no ancilla quantum bits, and can be implemented in nuclear magnetic resonance without using gradient fields. We introduce several temporal averaging algorithms suitable for both high-temperature and low-temperature bulk quantum computing and analyze the signal-to-noise behavior of each. Most of these algorithms require only a constant multiple of the number of experiments needed by the other methods for creating effective pure states. {copyright} {ital 1998} {ital The American Physical Society}

  12. On constructing purely affine theories with matter

    NASA Astrophysics Data System (ADS)

    Cervantes-Cota, Jorge L.; Liebscher, D.-E.

    2016-08-01

    We explore ways to obtain the very existence of a space-time metric from an action principle that does not refer to it a priori. Although there are reasons to believe that only a non-local theory can viably achieve this goal, we investigate here local theories that start with Schrödinger's purely affine theory (Schrödinger in Space-time structure. Cambridge UP, Cambridge, 1950), where he gave reasons to set the metric proportional to the Ricci curvature aposteriori. When we leave the context of unified field theory, and we couple the non-gravitational matter using some weak equivalence principle, we can show that the propagation of shock waves does not define a lightcone when the purely affine theory is local and avoids the explicit use of the Ricci tensor in realizing the weak equivalence principle. When the Ricci tensor is substituted for the metric, the equations seem to have only a very limited set of solutions. This backs the conviction that viable purely affine theories have to be non-local.

  13. Graphical calculus for Gaussian pure states

    SciTech Connect

    Menicucci, Nicolas C.; Flammia, Steven T.; Loock, Peter van

    2011-04-15

    We provide a unified graphical calculus for all Gaussian pure states, including graph transformation rules for all local and semilocal Gaussian unitary operations, as well as local quadrature measurements. We then use this graphical calculus to analyze continuous-variable (CV) cluster states, the essential resource for one-way quantum computing with CV systems. Current graphical approaches to CV cluster states are only valid in the unphysical limit of infinite squeezing, and the associated graph transformation rules only apply when the initial and final states are of this form. Our formalism applies to all Gaussian pure states and subsumes these rules in a natural way. In addition, the term 'CV graph state' currently has several inequivalent definitions in use. Using this formalism we provide a single unifying definition that encompasses all of them. We provide many examples of how the formalism may be used in the context of CV cluster states: defining the 'closest' CV cluster state to a given Gaussian pure state and quantifying the error in the approximation due to finite squeezing; analyzing the optimality of certain methods of generating CV cluster states; drawing connections between this graphical formalism and bosonic Hamiltonians with Gaussian ground states, including those useful for CV one-way quantum computing; and deriving a graphical measure of bipartite entanglement for certain classes of CV cluster states. We mention other possible applications of this formalism and conclude with a brief note on fault tolerance in CV one-way quantum computing.

  14. Crystal Structure of the Nonerythroid [alpha]-Spectrin Tetramerization Site Reveals Differences between Erythroid and Nonerythroid Spectrin Tetramer Formation

    SciTech Connect

    Mehboob, Shahila; Song, Yuanli; Witek, Marta; Long, Fei; Santarsiero, Bernard D.; Johnson, Michael E.; Fung, Leslie W.-M.

    2010-06-21

    We have solved the crystal structure of a segment of nonerythroid {alpha}-spectrin ({alpha}II) consisting of the first 147 residues to a resolution of 2.3 {angstrom}. We find that the structure of this segment is generally similar to a corresponding segment from erythroid {alpha}-spectrin ({alpha}I) but exhibits unique differences with functional significance. Specific features include the following: (i) an irregular and frayed first helix (Helix C{prime}); (ii) a helical conformation in the junction region connecting Helix C{prime} with the first structural domain (D1); (iii) a long A1B1 loop in D1; and (iv) specific inter-helix hydrogen bonds/salt bridges that stabilize D1. Our findings suggest that the hydrogen bond networks contribute to structural domain stability, and thus rigidity, in {alpha}II, and the lack of such hydrogen bond networks in {alpha}I leads to flexibility in {alpha}I. We have previously shown the junction region connecting Helix C{prime} to D1 to be unstructured in {alpha}I (Park, S., Caffrey, M. S., Johnson, M. E., and Fung, L. W. (2003) J. Biol. Chem. 278, 21837-21844) and now find it to be helical in {alpha}II, an important difference for {alpha}-spectrin association with {beta}-spectrin in forming tetramers. Homology modeling and molecular dynamics simulation studies of the structure of the tetramerization site, a triple helical bundle of partial domain helices, show that mutations in {alpha}-spectrin will affect Helix C{prime} structural flexibility and/or the junction region conformation and may alter the equilibrium between spectrin dimers and tetramers in cells. Mutations leading to reduced levels of functional tetramers in cells may potentially lead to abnormal neuronal functions.

  15. Protective role of nuclear factor erythroid 2-related factor 2 in the hemorrhagic shock-induced inflammatory response

    PubMed Central

    ZHAO, HAIGE; HAO, SIJING; XU, HONGFEI; MA, LIANG; ZHANG, ZHENG; NI, YIMING; YU, LUYANG

    2016-01-01

    Hemorrhagic shock (HS) following trauma or major surgery significantly contributes to mortality. However, the mechanisms through which HS activates the inflammatory response are not yet fully understood. Nuclear factor-erythroid 2 (NF-E2) p45-related factor-2 (Nrf2), a bZIP transcription factor, is a master regulator of robust cytoprotective defenses. The present study investigated the role of Nrf2 in the pathophysiology of HS. Nrf2 expression in peripheral leukocytes obtained from patients with surgery-associated hemorrhage subjected to resuscitation treatment (termed HS patients) or healthy donors was examined by RT-qPCR. A marked increase in Nrf2 expression was detected in the leukocytes obtained from the HS patients, which indicates a correlation between Nrf2 expression and the development of HS. Wild-type (WT; Nrf2+/+) and Nrf2-deficient [Nrf2−/− or Nrf2-knockout (KO)] mice were subjected to surgery to induce HS. Systemic inflammation was significantly elevated in the Nrf2-KO mice compared with the WT mice following HS, as assessed by an increase in serum cytokine levels [interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-1β], as well as high-mobility group box 1 protein (HMGB1) expression. The Nrf2-KO mice exhibited more severe lung and liver injury following HS as evidenced by increased tissue damage, increased myeloperoxidase (MPO) activity and the increased production of pro-inflammatory cytokines. Additionally, Nrf2 deficiency augmented cytokine production induced by the exposure of peritoneal mouse macrophages to lipopolysaccha-ride (LPS) following HS. Taken together, these results suggest that Nrf2 is a critical host factor which limits immune dysregulation and organ injury following HS. PMID:26935388

  16. Asn-150 of Murine Erythroid 5-Aminolevulinate Synthase Modulates the Catalytic Balance between the Rates of the Reversible Reaction.

    PubMed

    Stojanovski, Bosko M; Ferreira, Gloria C

    2015-12-25

    5-Aminolevulinate synthase (ALAS) catalyzes the first step in mammalian heme biosynthesis, the pyridoxal 5'-phosphate (PLP)-dependent and reversible reaction between glycine and succinyl-CoA to generate CoA, CO2, and 5-aminolevulinate (ALA). Apart from coordinating the positioning of succinyl-CoA, Rhodobacter capsulatus ALAS Asn-85 has a proposed role in regulating the opening of an active site channel. Here, we constructed a library of murine erythroid ALAS variants with substitutions at the position occupied by the analogous bacterial asparagine, screened for ALAS function, and characterized the catalytic properties of the N150H and N150F variants. Quinonoid intermediate formation occurred with a significantly reduced rate for either the N150H- or N150F-catalyzed condensation of glycine with succinyl-CoA during a single turnover. The introduced mutations caused modifications in the ALAS active site such that the resulting variants tipped the balance between the forward- and reverse-catalyzed reactions. Although wild-type ALAS catalyzes the conversion of ALA into the quinonoid intermediate at a rate 6.3-fold slower than the formation of the same quinonoid intermediate from glycine and succinyl-CoA, the N150F variant catalyzes the forward reaction at a mere 1.2-fold faster rate than that of the reverse reaction, and the N150H variant reverses the rate values with a 1.7-fold faster rate for the reverse reaction than that for the forward reaction. We conclude that the evolutionary selection of Asn-150 was significant for optimizing the forward enzymatic reaction at the expense of the reverse, thus ensuring that ALA is predominantly available for heme biosynthesis. PMID:26511319

  17. Protective role of nuclear factor erythroid 2-related factor 2 in the hemorrhagic shock-induced inflammatory response.

    PubMed

    Zhao, Haige; Hao, Sijing; Xu, Hongfei; Ma, Liang; Zhang, Zheng; Ni, Yiming; Yu, Luyang

    2016-04-01

    Hemorrhagic shock (HS) following trauma or major surgery significantly contributes to mortality. However, the mechanisms through which HS activates the inflammatory response are not yet fully understood. Nuclear factor-erythroid 2 (NF-E2) p45-related factor-2 (Nrf2), a bZIP transcription factor, is a master regulator of robust cytoprotective defenses. The present study investigated the role of Nrf2 in the pathophysiology of HS. Nrf2 expression in peripheral leukocytes obtained from patients with surgery-associated hemorrhage subjected to resuscitation treatment (termed HS patients) or healthy donors was examined by RT-qPCR. A marked increase in Nrf2 expression was detected in the leukocytes obtained from the HS patients, which indicates a correlation between Nrf2 expression and the development of HS. Wild-type (WT; Nrf2+/+) and Nrf2-deficient [Nrf2-/- or Nrf2‑knockout (KO)] mice were subjected to surgery to induce HS. Systemic inflammation was significantly elevated in the Nrf2-KO mice compared with the WT mice following HS, as assessed by an increase in serum cytokine levels [interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-1β], as well as high-mobility group box 1 protein (HMGB1) expression. The Nrf2-KO mice exhibited more severe lung and liver injury following HS as evidenced by increased tissue damage, increased myeloperoxidase (MPO) activity and the increased production of pro-inflammatory cytokines. Additionally, Nrf2 deficiency augmented cytokine production induced by the exposure of peritoneal mouse macrophages to lipopolysaccharide (LPS) following HS. Taken together, these results suggest that Nrf2 is a critical host factor which limits immune dysregulation and organ injury following HS. PMID:26935388

  18. Oxidative Damage and Nuclear Factor Erythroid 2-Related Factor 2 Protein Expression in Normal Skin and Keloid Tissue

    PubMed Central

    Lee, Yoon Jin; Kwon, Sun Bum; Kim, Chul Han; Cho, Hyun Deuk; Nam, Hae Seon; Lee, Sang Han; Lee, Mi Woo; Nam, Doo Hyun; Choi, Chang Yong

    2015-01-01

    Background Reactive oxygen species (ROS) play an important role in the induction of apoptosis under pathological conditions. Recently, a significant increase in ROS production and disrupted apoptosis mechanisms in keloids have been reported. Nuclear factor erythroid 2-related factor 2 (Nrf2) represents one of the most important cellular defense mechanisms against oxidative stress and is implicated in the regulation of apoptosis. Recently, it has been reported that Nrf2 upregulates Bcl-2, an anti-apoptotic protein. Objective To compare Nrf2 protein expression in normal skin tissues to keloid tissues. Methods ROS generation in keloid tissues was evaluated with OxyBlot analysis. Western blotting and/or immunohistochemical staining approaches were used to study expression of Nrf2 or Bcl-2 in keloid and normal skin tissues. Cellular fractionation was performed to examine subcellular distribution of Nrf2. Transfection of fibroblasts with Nrf2-specific small interfering RNA (siRNA) was conducted to understand the relationship between Nrf2 expression and apoptosis induction. Results Protein oxidation, a marker of oxidative stress, is increased in keloid tissues. Western blot analysis clearly showed that Nrf2 and Bcl-2 are downregulated in keloid tissues. Immunohistochemical staining of Nrf2 confirmed the results of the western blot analysis. Transfection of fibroblasts with the Nrf2-specific siRNA results in increased apoptosis and decreased cell viability. Conclusion Collectively, our data indicate that Nrf2 expression is downregulated in keloid tissues, and that Nrf2 is involved in the development of apoptosis in Nrf2 siRNA-transfected fibroblasts. We propose that a defective antioxidant system and apoptotic dysregulation may participate in keloid pathogenesis. PMID:26512164

  19. The Nuclear Factor (Erythroid-derived 2)-like 2 and Proteasome Maturation Protein Axis Mediate Bortezomib Resistance in Multiple Myeloma.

    PubMed

    Li, Bingzong; Fu, Jinxiang; Chen, Ping; Ge, Xueping; Li, Yali; Kuiatse, Isere; Wang, Hua; Wang, Huihan; Zhang, Xingding; Orlowski, Robert Z

    2015-12-11

    Resistance to the proteasome inhibitor bortezomib is an emerging clinical problem whose mechanisms have not been fully elucidated. We considered the possibility that this could be associated with enhanced proteasome activity in part through the action of the proteasome maturation protein (POMP). Bortezomib-resistant myeloma models were used to examine the correlation between POMP expression and bortezomib sensitivity. POMP expression was then modulated using genetic and pharmacologic approaches to determine the effects on proteasome inhibitor sensitivity in cell lines and in vivo models. Resistant cell lines were found to overexpress POMP, and while its suppression in cell lines enhanced bortezomib sensitivity, POMP overexpression in drug-naive cells conferred resistance. Overexpression of POMP was associated with increased levels of nuclear factor (erythroid-derived 2)-like (NRF2), and NRF2 was found to bind to and activate the POMP promoter. Knockdown of NRF2 in bortezomib-resistant cells reduced POMP levels and proteasome activity, whereas its overexpression in drug-naive cells increased POMP and proteasome activity. The NRF2 inhibitor all-trans-retinoic acid reduced cellular NRF2 levels and increased the anti-proliferative and pro-apoptotic activities of bortezomib in resistant cells, while decreasing proteasome capacity. Finally, the combination of all-trans-retinoic acid with bortezomib showed enhanced activity against primary patient samples and in a murine model of bortezomib-resistant myeloma. Taken together, these studies validate a role for the NRF2/POMP axis in bortezomib resistance and identify NRF2 and POMP as potentially attractive targets for chemosensitization to this proteasome inhibitor. PMID:26483548

  20. Reflection on Teaching and Epistemological Structure: Reflective and Critically Reflective Processes in "Pure/Soft" and "Pure/Hard" Fields

    ERIC Educational Resources Information Center

    Kreber, Carolin; Castleden, Heather

    2009-01-01

    We empirically explored whether academics from pure/soft and pure/hard fields engage in reflective practice on teaching differently and, if so, whether these differences could be partially explained by the epistemological structure of their discipline. Interview data from academics in pure/hard (N = 30) and pure/soft fields (N = 10) were…

  1. Long-term follow-up of myelodysplastic syndrome patients with moderate/severe anaemia receiving human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3: independent positive impact of erythroid response on survival.

    PubMed

    Crisà, Elena; Foli, Cristina; Passera, Roberto; Darbesio, Antonella; Garvey, Kimberly B; Boccadoro, Mario; Ferrero, Dario

    2012-07-01

    We previously reported a 60% erythroid response rate with recombinant erythropoietin + 13-cis retinoic acid + dihydroxylated vitamin D3 in 63 elderly myelodysplastic patients (median age 75 years) with unfavourable features for response to erythropoietin alone [70% transfusion-dependent, 35% refractory anaemia with ring sideroblasts/refractory anaemia with excess of blasts type 1 (RAEB1), 70% with International Prognostic Scoring System (IPSS) Intermediate-1 or -2]. This report updates that case study at a 7-year follow-up, and compared the impact on overall survival of erythroid response to known prognostic factors. The erythroid response duration (median 17 months; 22 in non-RAEB patients, with 20% patients in response after 6 years of therapy) was longer than in most studies with erythropoietin alone. Overall survival (median 55 months in non-RAEB, 15 in RAEB1 patients) was negatively affected by RAEB1 diagnosis, IPSS and WPSS intermediate scores and transfusion-dependence. In the multivariate analysis, erythroid response maintained an independent positive impact on survival, particularly in non-RAEB patients in the first 3 years from diagnosis (90% survival compared to 50% of non-responders). In conclusion, the long-term follow-up confirmed the achievement, by our combined treatment, of fairly long-lasting erythroid response in the majority of MDS patients with unfavourable prognostic features for response to erythropoietin: this translated in a survival benefit that was independent from other prognostic features. PMID:22571649

  2. The effect of donor leukocyte infusion on refractory pure red blood cell aplasia after allogeneic stem cell transplantation in a patient with myelodysplastic syndrome developing from Kostmann syndrome.

    PubMed

    Ebihara, Yasuhiro; Manabe, Atsushi; Tsuruta, Toshihisa; Ishikawa, Kumiko; Hasegawa, Daisuke; Ohtsuka, Yoshitoshi; Kawasaki, Hirohide; Ogami, Kazuo; Wada, Yuka; Kanda, Tadayasu; Tsuji, Kohichiro

    2007-12-01

    We describe the clinical course of a patient who experienced refractory pure red cell aplasia (PRCA) after undergoing HLA-matched allogeneic peripheral blood stem cell transplantation (allo-PBSCT) for refractory anemia with an excess of blasts in transformation that had evolved from Kostmann syndrome. The treatment for patients with myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML) developing from Kostmann syndrome has not been standardized. We treated this patient with allo-PBSCT using a regimen combining high-dose cytosine arabinoside with granulocyte colony-stimulating factor, in addition to total body irradiation and cyclophosphamide without preceding intensive chemotherapy. The donor was ABO incompatible. Myeloid and platelet recoveries were achieved rapidly. Erythroid engraftment was not evident, however, and the patient was given a diagnosis of PRCA. Regimen-related toxicity and graft-versus-host disease (GVHD) were limited. The PRCA did not respond to various therapies, including the discontinuation of immunosuppressants for the induction of chronic GVHD, human recombinant erythropoietin, immunosuppressive treatment with steroids, cyclosporin A, and human anti-CD20 antibody (rituximab). The patient received transfusions 48 times until the resolution of his anemia by donor leukocyte infusion (DLI) at 25 months after PBSCT. He is now clinically well (performance status, 100%) with normal blood cell counts at 5 years after SCT. An in vitro study demonstrated that serum from the recipient blocked the differentiation of erythroid cells in the bone marrow. The results indicate that the conditioning regimen we describe seems safe and effective for those who have MDS/AML and that DLI might be a valuable approach for refractory PRCA after ABO-incompatible SCT. PMID:18192114

  3. Adult Brainstem Gliomas

    PubMed Central

    Reyes-Botero, German; Mokhtari, Karima; Martin-Duverneuil, Nadine; Delattre, Jean-Yves

    2012-01-01

    Brainstem gliomas are uncommon in adults and account for only 1%–2% of intracranial gliomas. They represent a heterogeneous group of tumors that differ from those found in their pediatric counterparts. In adults, a low-grade phenotype predominates, which is a feature that likely explains their better prognosis compared to that in children. Because biopsies are rarely performed, classifications based on the radiological aspect of magnetic resonance imaging results have been proposed to establish treatment strategies and to determine outcomes: (a) diffuse intrinsic low-grade, (b) enhancing malignant glioma, (c) focal tectal gliomas, and (d) exophytic gliomas. Despite significant advances in neuroradiology techniques, a purely radiological classification remains imperfect in the absence of a histological diagnosis. Whereas a biopsy may often be reasonably avoided in the diffuse nonenhancing forms, obtaining histological proof seems necessary in many contrast-enhanced brainstem lesions because of the wide variety of differential diagnoses in adults. Conventional radiotherapy is the standard treatment for diffuse intrinsic low-grade brainstem gliomas in adults (the median survival is 5 years). In malignant brainstem gliomas, radiotherapy is the standard treatment. However, the possible benefit of combined radiotherapy and chemotherapy (temozolomide or other agents) has not been thoroughly evaluated in adults. The role of anti-angiogenic therapies in brainstem gliomas remains to be defined. A better understanding of the biology of these tumors is of primary importance for identifying homogeneous subgroups and for improving therapy options and outcomes. PMID:22382458

  4. chemf: A purely functional chemistry toolkit

    PubMed Central

    2012-01-01

    Background Although programming in a type-safe and referentially transparent style offers several advantages over working with mutable data structures and side effects, this style of programming has not seen much use in chemistry-related software. Since functional programming languages were designed with referential transparency in mind, these languages offer a lot of support when writing immutable data structures and side-effects free code. We therefore started implementing our own toolkit based on the above programming paradigms in a modern, versatile programming language. Results We present our initial results with functional programming in chemistry by first describing an immutable data structure for molecular graphs together with a couple of simple algorithms to calculate basic molecular properties before writing a complete SMILES parser in accordance with the OpenSMILES specification. Along the way we show how to deal with input validation, error handling, bulk operations, and parallelization in a purely functional way. At the end we also analyze and improve our algorithms and data structures in terms of performance and compare it to existing toolkits both object-oriented and purely functional. All code was written in Scala, a modern multi-paradigm programming language with a strong support for functional programming and a highly sophisticated type system. Conclusions We have successfully made the first important steps towards a purely functional chemistry toolkit. The data structures and algorithms presented in this article perform well while at the same time they can be safely used in parallelized applications, such as computer aided drug design experiments, without further adjustments. This stands in contrast to existing object-oriented toolkits where thread safety of data structures and algorithms is a deliberate design decision that can be hard to implement. Finally, the level of type-safety achieved by Scala highly increased the reliability of our code

  5. Compounds of the anthracycline family of antibiotics elevate human gamma-globin expression both in erythroid cultures and in a transgenic mouse model.

    PubMed

    Spyrou, Pandelis; Phylactides, Marios; Lederer, Carsten W; Kithreotis, Lucas; Kirri, Andriani; Christou, Soteroulla; Kkolou, Elena; Kanavakis, Emanuel; Anagnou, Nicholas P; Stamatoyannopoulos, George; Kleanthous, Marina

    2010-01-01

    We examined the effect of the anthracyclines aclarubicin, bleomycin, daunorubicin, doxorubicin and idarubicin on human gamma- and beta-globin promoter activity in an in vitro luciferase assay, ex vivo in erythroid cultures and in vivo in transgenic mice carrying the human gamma-globin gene. Effects in erythroid liquid cultures derived from healthy donors were assayed by evaluating HbF production with high performance liquid chromatography and by measuring mRNA levels of the globin genes and the proportion of erythroblasts containing HbF. Compounds testing positive in the in vitro and ex vivo assays were applied to erythroid cultures derived from thalassaemic patients. Doxorubicin, idarubicin and daunorubicin increased HbF production in cultures of both, healthy and thalassaemic donors. Daunorubicin induced HbF in thalassaemic cells ex vivo with the highest statistical significance and, importantly and in contrast to the clinical HbF inducer hydroxyurea, showed specific induction of gamma-globin without associated induction of alpha-globin. Daunorubicin was screened in transgenic mice carrying the human (A)gamma-globin gene, and it resulted in increased (A)gamma-globin mRNA levels. Our results indicate that anthracyclines are a promising group of compounds with the potential to provide lead substances for the synthesis of new agents with clinical applications as gamma-globin gene inducers. In parallel, future studies of the epigenetic effects of the five anthracyclines on the beta-globin locus will generate possible mechanistic leads on the regulation of the globin genes. PMID:19914848

  6. Impaired ferritin mRNA translation in primary erythroid progenitors: shift to iron-dependent regulation by the v-ErbA oncoprotein.

    PubMed

    Mikulits, W; Schranzhofer, M; Bauer, A; Dolznig, H; Lobmayr, L; Infante, A A; Beug, H; Müllner, E W

    1999-12-15

    In immortalized cells of the erythroid lineage, the iron-regulatory protein (IRP) has been suggested to coregulate biosynthesis of the iron storage protein ferritin and the erythroid delta-aminolevulinate synthase (eALAS), a key enzyme in heme production. Under iron scarcity, IRP binds to an iron-responsive element (IRE) located in ferritin and eALAS mRNA leaders, causing a block of translation. In contrast, IRP-IRE interaction is reduced under high iron conditions, allowing efficient translation. We show here that primary chicken erythroblasts (ebls) proliferating or differentiating in culture use a drastically different regulation of iron metabolism. Independently of iron administration, ferritin H (ferH) chain mRNA translation was massively decreased, whereas eALAS transcripts remained constitutively associated with polyribosomes, indicating efficient translation. Variations in iron supply had minor but significant effects on eALAS mRNA polysome recruitment but failed to modulate IRP-affinity to the ferH-IRE in vitro. However, leukemic ebls transformed by the v-ErbA/v-ErbB-expressing avian erythroblastosis virus showed an iron-dependent reduction of IRP mRNA-binding activity, resulting in mobilization of ferH mRNA into polysomes. Hence, we analyzed a panel of ebls overexpressing v-ErbA and/or v-ErbB oncoproteins as well as the respective normal cellular homologues (c-ErbA/TRalpha, c-ErbB/EGFR). It turned out that v-ErbA, a mutated class II nuclear hormone receptor that arrests erythroid differentiation, caused the change in ferH mRNA translation. Accordingly, inhibition of v-ErbA function in these leukemic ebls led to a switch from iron-responsive to iron-independent ferH expression. PMID:10590077

  7. A high concentration of triiodothyronine attenuates the stimulatory effect on hemin-induced erythroid differentiation of human erythroleukemia K562 cells.

    PubMed

    Shiraishi, Mieno; Yamamoto, Yoritsuna; Hirooka, Nobutaka; Obuchi, Yasuhiro; Tachibana, Shoichi; Makishima, Makoto; Tanaka, Yuji

    2015-01-01

    Although thyroid hormone is a known stimulator of erythropoietic differentiation, severe anemia is sometimes observed in patients with hyperthyroidism and this mechanism is not fully understood. The aim of this study was to investigate the effect of triiodothyronine (T3) on hemin-induced erythropoiesis. Human erythroleukemia K562 cells were used as an erythroid differentiation model. Cell differentiation was induced by hemin and the effect of pre-incubation with T3 (0.1 to 100 nM) was analyzed by measuring the benzidine-positive rate, hemoglobin content, CD71 expression (transferrin receptor), and mRNA expression for transcription factors related to erythropoiesis and thyroid hormone receptors (TRs). Hemin, a promoter of erythroid differentiation, increased the levels of mRNAs for TRα, TRβ, and retinoid X receptor α (RXRα), as well as those for nuclear factor-erythroid 2 (NFE2), GATA-binding protein 1 (GATA1) and GATA-binding protein 2 (GATA2). Lower concentrations of T3 had a stimulatory effect on hemin-induced hemoglobin production (1 and 10 nM), CD71 expression (0.1 nM), and α-globin mRNA expression (1 nM), while a higher concentration of T3 (100 nM) abrogated the stimulatory effect on these parameters. T3 at 100 nM did not affect cell viability and proliferation, suggesting that the abrogation of erythropoiesis enhancement was not due to toxicity. T3 at 100 nM also significantly inhibited expression of GATA2 and RXRα mRNA, compared to 1 nM T3. We conclude that a high concentration of T3 attenuates the classical stimulatory effect on erythropoiesis exerted by a low concentration of T3 in hemin-induced K562 cells. PMID:25787723

  8. AUF-1 and YB-1 independently regulate β-globin mRNA in developing erythroid cells through interactions with poly(A)-binding protein

    PubMed Central

    van Zalen, Sebastiaan; Lombardi, Alyssa A.; Jeschke, Grace R.; Hexner, Elizabeth O.; Russell, J. Eric

    2015-01-01

    The normal expression of β-globin protein in mature erythrocytes is critically dependent on post-transcriptional events in erythroid progenitors that ensure the high stability of β-globin mRNA. Previous work has revealed that these regulatory processes require AUF-1 and YB-1, two RNA-binding proteins that assemble an mRNP β-complex on the β-globin 3′UTR. Here, we demonstrate that the β-complex organizes during the erythropoietic interval when both β-globin mRNA and protein accumulate rapidly, implicating the importance of this regulatory mRNP to normal erythroid differentiation. Subsequent functional analyses link β-complex assembly to the half-life of β-globin mRNA in vivo, providing a mechanistic basis for this regulatory activity. AUF-1 and YB-1 appear to serve a redundant post-transcriptional function, as both β-complex assembly and β-globin mRNA levels are reduced by coordinate depletion of the two factors, and can be restored by independent rescue with either factor alone. Additional studies demonstrate that the β-complex assembles more efficiently on polyadenylated transcripts, implicating a model in which the β-complex enhances the binding of PABPC1 to the poly(A) tail, inhibiting mRNA deadenylation and consequently effecting the high half-life of β-globin transcripts in erythroid progenitors. These data specify a post-transcriptional mechanism through which AUF1 and YB1 contribute to the normal development of erythropoietic cells, as well as to non-hematopoietic tissues in which AUF1-and YB1-based regulatory mRNPs have been observed to assemble on heterologous mRNAs. PMID:25720531

  9. Hydroxyl X2Pi pure rotational transitions

    NASA Technical Reports Server (NTRS)

    Goorvitch, D.; Goldman, A.; Dothe, Hoang; Tipping, R. H.; Chackerian, C., Jr.

    1992-01-01

    We present a list of frequencies, term values, Einstein A values, and assignments for the pure rotational transitions of the X2Pi state of the OH molecule. This list includes transitions from 3 to 2015/cm for Delta-v = 0, v-double-prime = 0-4, and J-double-prime = 0.5-49.5. The A values were computed using recent advances in calculating wave functions for a coupled system and an experimentally derived electric dipole moment function (Nelson et al., 1990) which exhibits curvature.

  10. Critical speeding up in pure fluids

    NASA Technical Reports Server (NTRS)

    Boukari, Hacene; Shaumeyer, J. N.; Briggs, Matthew E.; Gammon, Robert W.

    1990-01-01

    The extreme compressibility of a pure fluid near its critical point significantly affects its bulk dynamic response to temperature changes through adiabatic processes. Equations that describe the dynamics in the absence of gravity are developed, and the magnitude of the effect is illustrated with numerical solutions in one dimension. The results are remarkable: 5 mm of critical xenon, quenched from 20 to 10 mK above its critical temperature, cools by over 99 percent in less than 5 s. Moreover, adiabatic cooling is faster when the fluid is closer to the critical point.

  11. Pure type I supergravity and DE 10

    NASA Astrophysics Data System (ADS)

    Hillmann, Christian; Kleinschmidt, Axel

    2006-12-01

    We establish a dynamical equivalence between the bosonic part of pure type I supergravity in D = 10 and a D = 1 non-linear σ-model on the Kac Moody coset space DE 10/K(DE 10) if both theories are suitably truncated. To this end we make use of a decomposition of DE 10 under its regular SO(9,9) subgroup. Our analysis also deals partly with the fermionic fields of the supergravity theory and we define corresponding representations of the generalised spatial Lorentz group K(DE 10).

  12. Cold-Sprayed Nanostructured Pure Cobalt Coatings

    NASA Astrophysics Data System (ADS)

    Cavaliere, P.; Perrone, A.; Silvello, A.

    2016-08-01

    Cold-sprayed pure cobalt coatings were deposited on carbon-steel substrate. Submicrometer particles for spraying were produced via cryomilling. Deposits were produced using different processing conditions (gas temperature and pressure, nozzle-to-substrate distance) to evaluate the resulting variations in grain size dimension, microhardness, adhesion strength, and porosity. The coating mechanical properties improved greatly with higher temperature and carrying-gas pressure. The coating microstructure was analyzed as a function of spraying condition by transmission electron microscopy (TEM) observations, revealing many different microstructural features for coatings experiencing low or high strain rates during deposition.

  13. Are all maximally entangled states pure?

    NASA Astrophysics Data System (ADS)

    Cavalcanti, D.; Brandão, F. G. S. L.; Terra Cunha, M. O.

    2005-10-01

    We study if all maximally entangled states are pure through several entanglement monotones. In the bipartite case, we find that the same conditions which lead to the uniqueness of the entropy of entanglement as a measure of entanglement exclude the existence of maximally mixed entangled states. In the multipartite scenario, our conclusions allow us to generalize the idea of the monogamy of entanglement: we establish the polygamy of entanglement, expressing that if a general state is maximally entangled with respect to some kind of multipartite entanglement, then it is necessarily factorized of any other system.

  14. Are all maximally entangled states pure?

    SciTech Connect

    Cavalcanti, D.; Brandao, F.G.S.L.; Terra Cunha, M.O.

    2005-10-15

    We study if all maximally entangled states are pure through several entanglement monotones. In the bipartite case, we find that the same conditions which lead to the uniqueness of the entropy of entanglement as a measure of entanglement exclude the existence of maximally mixed entangled states. In the multipartite scenario, our conclusions allow us to generalize the idea of the monogamy of entanglement: we establish the polygamy of entanglement, expressing that if a general state is maximally entangled with respect to some kind of multipartite entanglement, then it is necessarily factorized of any other system.

  15. Electrostatic Precipitation in Nearly Pure Gaseous Nitrogen

    NASA Technical Reports Server (NTRS)

    Buhler, Charles; Calle, Carlos; Clements, Sid; Cox, Bobby; Ritz, Mindy

    2008-01-01

    Electrostatic precipitation was performed in a nearly pure gaseous nitrogen system as a possible remedy for black dust contaminant from high pressure 6000 psi lines at the NASA Kennedy Space Center. The results of a prototype electrostatic precipitator that was built and tested using nitrogen gas at standard atmospheric pressures is presented. High voltage pulsed waveforms are generated using a rotating spark gap system at 30 Hz. A unique dust delivery system utilizing the Venturi effect was devised that supplies a given amount of dust per unit time for testing purposes.

  16. Femtosecond pulses propagation through pure water

    NASA Astrophysics Data System (ADS)

    Naveira, Lucas; Sokolov, Alexei; Byeon, Joong-Hyeok; Kattawar, George

    2007-10-01

    Recently, considerable attention has been dedicated to the field of optical precursors, which can possibly be applied to long-distance underwater communications. Input beam intensities have been carefully adjusted to keep experiments in the linear regime, and some experiments have shown violation of the Beer-Lambert law. We are presently carrying out experiments using femtosecond laser pulses propagating through pure water strictly in the linear regime to study this interesting and important behavior. We are also employing several new and innovative schemes to more clearly define the phenomena.

  17. Synthesis of highly phase pure BSCCO superconductors

    DOEpatents

    Dorris, Stephen E.; Poeppel, Roger B.; Prorok, Barton C.; Lanagan, Michael T.; Maroni, Victor A.

    1995-01-01

    An article and method of manufacture of (Bi, Pb)-Sr-Ca-Cu-O superconductor. The superconductor is manufactured by preparing a first powdered mixture of bismuth oxide, lead oxide, strontium carbonate, calcium carbonate and copper oxide. A second powdered mixture is then prepared of strontium carbonate, calcium carbonate and copper oxide. The mixtures are calcined separately with the two mixtures then combined. The resulting combined mixture is then subjected to a powder in tube deformation and thermal processing to produce a substantially phase pure (Bi, Pb)-Sr-Ca-Cu-O superconductor.

  18. Synthesis of highly phase pure BSCCO superconductors

    DOEpatents

    Dorris, S.E.; Poeppel, R.B.; Prorok, B.C.; Lanagan, M.T.; Maroni, V.A.

    1995-11-21

    An article and method of manufacture (Bi, Pb)-Sr-Ca-Cu-O superconductor are disclosed. The superconductor is manufactured by preparing a first powdered mixture of bismuth oxide, lead oxide, strontium carbonate, calcium carbonate and copper oxide. A second powdered mixture is then prepared of strontium carbonate, calcium carbonate and copper oxide. The mixtures are calcined separately with the two mixtures then combined. The resulting combined mixture is then subjected to a powder in tube deformation and thermal processing to produce a substantially phase pure (Bi, Pb)-Sr-Ca-Cu-O superconductor. 5 figs.

  19. Purely cubic action for string field theory

    NASA Technical Reports Server (NTRS)

    Horowitz, G. T.; Lykken, J.; Rohm, R.; Strominger, A.

    1986-01-01

    It is shown that Witten's (1986) open-bosonic-string field-theory action and a closed-string analog can be written as a purely cubic interaction term. The conventional form of the action arises by expansion around particular solutions of the classical equations of motion. The explicit background dependence of the conventional action via the Becchi-Rouet-Stora-Tyutin operator is eliminated in the cubic formulation. A closed-form expression is found for the full nonlinear gauge-transformation law.

  20. Multiple pure tone noise generation and control.

    NASA Technical Reports Server (NTRS)

    Benzakein, M. J.; Kazin, S. B.; Savell, C. T.

    1973-01-01

    The generation of multiple pure tones in supersonic fans is discussed. The theoretical results of Kurasaka are reviewed and compared with experimental data obtained on a 36-in. diameter, 1550 ft/sec, 1.6 pressure ratio fan. Detailed measurements on bow shock locations taken with pressure transducers indicate that blade to blade discrepancies are the source of MPT generation. The paper presents some experimental results on an attempt to reduce the shock strength, and subsequently the MPT's, through blade modifications. Other attempts at reducing the MPT's through wall treatment, high inlet flow Mach number, acoustically treated splitters - are discussed. Experimental data is presented on the validity of these noise reduction methods.

  1. Pure phase decoherence in a ring geometry

    SciTech Connect

    Zhu, Z.; Aharony, A.; Entin-Wohlman, O.; Stamp, P. C. E.

    2010-06-15

    We study the dynamics of pure phase decoherence for a particle hopping around an N-site ring, coupled both to a spin bath and to an Aharonov-Bohm flux which threads the ring. Analytic results are found for the dynamics of the influence functional and of the reduced density matrix of the particle, both for initial single wave-packet states, and for states split initially into two separate wave packets moving at different velocities. We also give results for the dynamics of the current as a function of time.

  2. Pure motor monoparesis: solitary cysticercus granuloma.

    PubMed

    Giri, Prithvi; Shukla, Rakesh; Patil, Tushar B; Mehta, Vinod

    2013-01-01

    Solitary cysticercus granuloma (SCG) is the most common form of neurocysticercosis in India and usually presents with seizures. Pure motor monoparesis (PMM) due to cerebral cysticercus lesions has been rarely reported and it has not been seen with SCG. We describe a young girl with SCG who presented with PMM without any other neurological manifestations. The lesion was located in the Penfield homunculus area of the opposite leg. The patient was treated with steroids and antihelminthic drugs. She responded well to the treatment. PMID:24343804

  3. Explicit BCJ numerators from pure spinors

    NASA Astrophysics Data System (ADS)

    Mafra, Carlos R.; Schlotterer, Oliver; Stieberger, Stephan

    2011-07-01

    We derive local kinematic numerators for gauge theory tree amplitudes which manifestly satisfy Jacobi identities analogous to color factors. They naturally emerge from the low energy limit of superstring amplitudes computed with the pure spinor formalism. The manifestation of the color-kinematics duality is a consequence of the superstring computation involving no more than ( n - 2)! kinematic factors for the full color dressed n point amplitude. The bosonic part of these results describe gluon scattering independent on the number of supersymmetries and captures any N k MHV helicity configuration after dimensional reduction to D = 4 dimensions.

  4. MYB controls erythroid versus megakaryocyte lineage fate decision through the miR-486-3p-mediated downregulation of MAF

    PubMed Central

    Bianchi, E; Bulgarelli, J; Ruberti, S; Rontauroli, S; Sacchi, G; Norfo, R; Pennucci, V; Zini, R; Salati, S; Prudente, Z; Ferrari, S; Manfredini, R

    2015-01-01

    The transcription factor MYB has a key role in hematopoietic progenitor cells (HPCs) lineage choice, by enhancing erythropoiesis at the expense of megakaryopoiesis. We previously demonstrated that MYB controls erythroid versus megakaryocyte lineage decision by transactivating KLF1 and LMO2 expression. To further unravel the molecular mechanisms through which MYB affects lineage fate decision, we performed the integrative analysis of miRNA and mRNA changes in MYB-silenced human primary CD34+ HPCs. Among the miRNAs with the highest number of predicted targets, we focused our studies on hsa-miR-486-3p by demonstrating that MYB controls miR-486-3p expression through the transactivation of its host gene, ankyrin-1 (ANK1) and that miR-486-3p affects HPCs commitment. Indeed, overexpression and knockdown experiments demonstrated that miR-486-3p supports the erythropoiesis while restraining the megakaryopoiesis. Of note, miR-486-3p also favors granulocyte differentiation while repressing the macrophage differentiation. To shed some light on the molecular mechanisms through which miR-486-3p affects HPCs lineage commitment, we profiled the gene expression changes upon miR-486-3p overexpression in CD34+ cells. Among the genes downregulated in miR-486-3p-overexpressing HPCs and computationally predicted to be miR-486-3p targets, we identified MAF as a miR-486-3p target by 3′UTR luciferase reporter assay. Noteworthy, MAF overexpression was able to partially reverse the effects of miR-486-3p overexpression on erythroid versus megakaryocyte lineage choice. Moreover, the MYB/MAF co-silencing constrained the skewing of erythroid versus megakaryocyte lineage commitment in MYB-silenced CD34+ cells, by restraining the expansion of megakaryocyte lineage while partially rescuing the impairment of erythropoiesis. Therefore, our data collectively demonstrate that MYB favors erythropoiesis and restrains megakaryopoiesis through the transactivation of miR-486-3p expression and the

  5. Biased, non-equivalent gene-proximal and -distal binding motifs of orphan nuclear receptor TR4 in primary human erythroid cells.

    PubMed

    Shi, Lihong; Sierant, M C; Gurdziel, Katherine; Zhu, Fan; Cui, Shuaiying; Kolodziej, Katarzyna E; Strouboulis, John; Guan, Yuanfang; Tanabe, Osamu; Lim, Kim-Chew; Engel, James Douglas

    2014-05-01

    We previously reported that TR2 and TR4 orphan nuclear receptors bind to direct repeat (DR) elements in the ε- and γ-globin promoters, and act as molecular anchors for the recruitment of epigenetic corepressors of the multifaceted DRED complex, thereby leading to ε- and γ-globin transcriptional repression during definitive erythropoiesis. Other than the ε- and γ-globin and the GATA1 genes, TR4-regulated target genes in human erythroid cells remain unknown. Here, we identified TR4 binding sites genome-wide using chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-seq) as human primary CD34(+) hematopoietic progenitors differentiated progressively to late erythroid precursors. We also performed whole transcriptome analyses by RNA-seq to identify TR4 downstream targets after lentiviral-mediated TR4 shRNA knockdown in erythroid cells. Analyses from combined ChIP-seq and RNA-seq datasets indicate that DR1 motifs are more prevalent in the proximal promoters of TR4 direct target genes, which are involved in basic biological functions (e.g., mRNA processing, ribosomal assembly, RNA splicing and primary metabolic processes). In contrast, other non-DR1 repeat motifs (DR4, ER6 and IR1) are more prevalent at gene-distal TR4 binding sites. Of these, approximately 50% are also marked with epigenetic chromatin signatures (such as P300, H3K27ac, H3K4me1 and H3K27me3) associated with enhancer function. Thus, we hypothesize that TR4 regulates gene transcription via gene-proximal DR1 sites as TR4/TR2 heterodimers, while it can associate with novel nuclear receptor partners (such as RXR) to bind to distant non-DR1 consensus sites. In summary, this study reveals that the TR4 regulatory network is far more complex than previously appreciated and that TR4 regulates basic, essential biological processes during the terminal differentiation of human erythroid cells. PMID:24811540

  6. The role of mnemonic processes in pure-target and pure-foil recognition memory.

    PubMed

    Koop, Gregory J; Criss, Amy H; Malmberg, Kenneth J

    2015-04-01

    Surprisingly, response patterns in a recognition memory test are very similar regardless of whether the test list contains both targets and foils or just one class of items. To better understand these effects, we evaluate performance over the course of testing. Output interference (OI) is the decrease in performance across test trials due to an increase in noise caused by encoded test items. Critically, OI is predicted on pure lists if the mnemonic evidence for each test item is evaluated. In two experiments, participants received accurate feedback, no feedback, or random feedback that was unrelated to the response on each test trial and pure or standard test lists. When no feedback was provided, performance was nearly identical for standard and pure test lists, replicating previous findings. Only in the presence of accurate feedback were participants able to successfully adapt to pure list environments and improve their accuracy. Critically, OI was observed, demonstrating that participants continued to evaluate mnemonic evidence even in pure list conditions. We discuss the implication of these data for models of memory. PMID:25117090

  7. A nearly pure monoclinic nanocrystalline zirconia

    SciTech Connect

    Guo Gongyi . E-mail: guo_gongyi@hotmail.com; Chen Yuli

    2005-05-15

    Generally, monoclinic zirconia is considered to be much more difficult to prepare at low temperatures and particularly in a pure state. The present work is the first example that shows that the hydrous zirconia formed by precipitation can yield a nearly pure nanocrystalline monoclinic zirconia at a temperature as low as 320 deg. C. The crystallite size of the monoclinic zirconia produced in the present work is around 15nm, and it does not change appreciably as calcination temperature is increased from 320 to or above 400 deg. C. Such a small monoclinic crystallite arises from some of the chemical and physical factors built into the solution-gelation-xerogel process such as acidic preparation-pH, rapid precipitation, and moderate aging time and drying temperature, which result in a structure different from those of the existing zirconium hydroxides. In addition, the hydrous zirconia exhibits a unique thermal behavior in two respects: first, a sudden weight drop in the region of exothermic peak of the thermogravimetric curve is seen, suggesting that the main decomposition of the hydrous zirconia occurs in this region; second, there is an endothermic peak at high temperature in the differential thermal analysis curve, indicating the presence of coordinated water in the hydrous zirconia.

  8. Laser Induced Birefringence in Pure Liquids

    NASA Astrophysics Data System (ADS)

    Harrison, Neil J.

    1991-01-01

    Available from UMI in association with The British Library. Laser induced birefringence or the Optical Kerr effect is a subject that has undergone much research over previous years and is an established technique for the study of many classes of materials. To date the measurements on various media have been characterized by the substantial time required to obtain results and the generally poor sensitivity of the apparatus used. This work describes the development of a new apparatus which is the first in the field to automate the signal capture and analysis utilizing a 1 Gigasample/second digitizing oscilloscope connected to a microcomputer to provide fast, accurate transient analysis. Careful design of the apparatus enabled operation at two inducing wavelengths of 532nm and 1064nm. The sensitivity and accuracy of the apparatus coupled with the rapid transient evaluation was tested on a number of well characterized samples including benzene, nitrobenzene, toluene and benzoyl chloride and was found to give excellent agreement with other workers. The apparatus was used to investigate the properties of the organic pure liquid series the n-alkanes before making the first measurements on the 1-alkenes, 1-alkynes, alcohols, carboxylic acids and three alkdienes. Results from these experiments were used to evaluate the contributions of sigma and pi bonds to the Optical Kerr effect in simple organic molecules. A review of all previously published Optical Kerr effect results for pure liquids was also carried out and the first comprehensive table of results complied.

  9. Nanoporous Au: an unsupported pure gold catalyst?

    SciTech Connect

    Wittstock, A; Neumann, B; Schaefer, A; Dumbuya, K; Kuebel, C; Biener, M; Zielasek, V; Steinrueck, H; Gottfried, M; Biener, J; Hamza, A; B?umer, M

    2008-09-04

    The unique properties of gold especially in low temperature CO oxidation have been ascribed to a combination of various effects. In particular, particle sizes below a few nm and specific particle-support interactions have been shown to play important roles. On the contrary, recent reports revealed that monolithic nanoporous gold (npAu) prepared by leaching a less noble metal, such as Ag, out of the corresponding alloy can also exhibit remarkably high catalytic activity for CO oxidation, even though no support is present. Therefore, it was claimed to be a pure and unsupported gold catalyst. We investigated npAu with respect to its morphology, surface composition and catalytic properties. In particular, we studied the reaction kinetics for low temperature CO oxidation in detail taking mass transport limitation due to the porous structure of the material into account. Our results reveal that Ag, even if removed almost completely from the bulk, segregates to the surface resulting in surface concentrations of up to 10 at%. Our data suggest that this Ag plays a significant role in activation of molecular oxygen. Therefore, npAu should be considered as a bimetallic catalyst rather than a pure Au catalyst.

  10. Time Evolution of Pure Gravitational Waves

    NASA Astrophysics Data System (ADS)

    Miyama, S. M.

    1981-03-01

    Numerical solutions to the Einstein equations in the case of pure gravitational waves are given. The system is assumed to be axially symmetric and non-rotating. The time symmetric initial data and the conformally flat initial data are obtained by solving the constraint equations at t=0. The time evolution of these initial data depends strongly on the initial amplitude of the gravitational waves. In the case of the low initial amplitude, waves only disperse to null infinity. By comparing the initial gravitational energy with the total energy loss through an r=constant surface, it is concluded that the Newman-Penrose method and the Gibbon-Hawking method are the most desirable for measuring the energy flux of gravitational radiation numerically. In the case that the initial ratio of the spatial extent of the gravitational waves to the Schwarzschild radius (M/2) is smaller than about 300, the waves collapse by themselves, leading to formation of a black hole. The analytic solutions of the linearized Einstein equations for the pure gravitational waves are also shown.

  11. Electrokinetics of pure clay minerals revisited

    SciTech Connect

    Sondi, I.; Biscan, J.; Pravdic, V.

    1996-03-25

    Clay minerals have long attracted the attention of colloid scientists. This paper considers, specifically, their important role in the transport of various contaminants from land to sea, e.g., metal ions and organic detrital and man-made material in watercourses. Advance in experimental techniques have enabled precise characterization of clays and then electrokinetic experiments at high electrolyte concentrations, such as in seawater. Three of the most important clay minerals encountered in suspended matter in natural waters, montmorillonite, illite, and chlorite, were prepared in a very pure state. Electrokinetic experiments were done in pure aqueous single and complex electrolyte solutions and in solutions in which natural organic matter was simulated using a humic substance, fulvic acid, of defined provenance and properties, typical of riverine waters. An isoelectric point was found at pH 5.0 {+-} 0.2 for chlorite; none were found for illite and montmorillonite. Only Ca{sup 2+} showed a charging effect on chlorite, indeed a reversal of sign from negative to positive at 1 {times} 10{sup {minus}3} mol dm{sup {minus}3}. Addition of fulvic acid affected only chlorite, illite less, and Na montmorillonite not at all.

  12. Underwater loudness for pure tones: Duration effects

    NASA Astrophysics Data System (ADS)

    Cudahy, Edward A.; Schwaller, Derek; Fothergill, David; Wolgemuth, Keith

    2003-04-01

    The loudness of underwater pure tones was measured by loudness matching for pure tones from 100 to 16,000 Hz. The standard was a one second tone at 1000 Hz. The signal duration was varied from 20 milliseconds to 5 seconds. Subjects were instructed to match the loudness of the comparison tone at one of the test frequencies to the loudness of the standard tone. Loudness was measured at the threshold, the most comfortable loudness, and the maximum tolerable loudness. The intensity of the standard was varied randomly across the test series. The subjects were bareheaded U.S. Navy divers tested at a depth of 3 meters. All subjects had normal in-air hearing. Tones were presented to the right side of the subject from an array of underwater sound projectors. The sound pressure level was calibrated at the location of the subject's head with the subject absent. Loudness increased and threshold decreased as duration increased. The effect was greatest at the lowest and highest frequencies. The shape of the loudness contours across frequency and duration derived from these measurements are different from in-air measurements. [Research supported by ONR.

  13. Cross-spectrally pure light, cross-spectrally pure fields and statistical similarity in electromagnetic fields

    NASA Astrophysics Data System (ADS)

    Chen, Jingjing; Lu, RongSheng; Chen, Feinan; Li, Jia

    2014-08-01

    This paper describes the concept of cross-spectrally pure light, implications of statistical similarity of an optical field on its cross-spectral purity and cross-spectrally pure fields. First, the concept of cross-spectral purity of light is analysed in the space-frequency domain by taking into account the vectorial nature of the radiation, and the conditions and reduction formula are obtained. Then, by utilizing statistical similarity, the relationship between cross-spectral purity and spatial coherence is explored in the electromagnetic field. Last, the conditions for cross-spectrally pure fields are discussed, the polychromatic plane wave and the far field produced by a planar, secondary, stochastic electromagnetic source are studied as examples, and moreover, the relationship between cross-spectral purity and spatial coherence, which we have drawn, is verified during the study.

  14. Nonhematopoietic Nrf2 dominantly impedes adult progression of sickle cell anemia in mice

    PubMed Central

    Ghosh, Samit; Ihunnah, Chibueze A.; Hazra, Rimi; Walker, Aisha L.; Hansen, Jason M.; Archer, David R.; Owusu-Ansah, Amma T.; Ofori-Acquah, Solomon F.

    2016-01-01

    The prevention of organ damage and early death in young adults is a major clinical concern in sickle cell disease (SCD). However, mechanisms that control adult progression of SCD during the transition from adolescence are poorly defined with no cognate prophylaxis. Here, we demonstrate in a longitudinal cohort of homozygous SCD (SS) mice a link between intravascular hemolysis, vascular inflammation, lung injury, and early death. Prophylactic Nrf2 activation in young SS mice stabilized intravascular hemolysis, reversed vascular inflammation, and attenuated lung edema in adulthood. Enhanced Nrf2 activation in endothelial cells in vitro concurred with the dramatic effect on vascular inflammation in the mice. BM chimeric SS mice lacking Nrf2 expression in nonhematopoietic tissues were created to dissect the role of nonerythroid Nrf2 in SCD progression. The SS chimeras developed severe intravascular hemolysis despite having erythroid Nrf2. In addition, they developed premature vascular inflammation and pulmonary edema and died younger than donor littermates with intact nonhematopoietic Nrf2. Our results reveal a dominant protective role for nonhematopoietic Nrf2 against tissue damage in both erythroid and nonerythroid tissues in SCD. Furthermore, we show that prophylactic augmentation of Nrf2-coordinated cytoprotection effectively impedes onset of the severe adult phenotype of SCD in mice. PMID:27158670

  15. Reflections on Remaining Obstacles in a Primary-Care Oriented Pure PBL Curriculum after Twelve Years of Implementation

    ERIC Educational Resources Information Center

    D'Ottavio, Alberto Enrique; Bassan, Norberto David

    2014-01-01

    A pioneer primary-care oriented pure PBL curriculum, based on constructivism and adult learning theories combined with Morin's complex thinking, was implemented in our medical school since 2002. Regardless of warnings opportunely made because the basic requirements for its successful implementation could not be fully fulfilled in practice, the…

  16. Entanglement purification protocol for a mixture of a pure entangled state and a pure product state

    SciTech Connect

    Czechlewski, Mikolaj; Wojcik, Antoni; Grudka, Andrzej; Ishizaka, Satoshi

    2009-07-15

    We present an entanglement purification protocol for a mixture of a pure entangled state and a pure product state, which are orthogonal to each other. The protocol is a combination of bisection method and one-way hashing protocol. We give recursive formula for the rate of the protocol for different states, i.e., the number of maximally entangled two-qubit pairs obtained with the protocol per a single copy of the initial state. We also calculate numerically the rate for some states.

  17. The evolution of pure alexia: a longitudinal study of recovery.

    PubMed

    Behrmann, M; Black, S E; Bub, D

    1990-10-01

    This case report documents the partial recovery, over a 12-month period, of pure alexia in an adult female following a left occipital infarction. Measures of speed and accuracy were obtained on an oral reading and a lexical decision task immediately postonset and then on 10 subsequent occasions. Explicit letter-by-letter reading was observed only during the first week poststroke but a significant effect of word length was seen in all testing sessions. Reading accuracy was relatively good at all stages and reading latency showed a remarkable decrease over time but did not reach normal reading rates. The inability to use higher-order orthographic knowledge, as manifest in the absence of a word superiority effect, was still noted at one year postonset. We therefore concluded that the change in behavior was attributable to increased proficiency in the use of the adaptive letter-by-letter procedure rather than to the resolution of the underlying deficit. It is suggested that longitudinal neurobehavioral studies add to our understanding of the alexic deficit and provide insight into the recovery process. PMID:2285860

  18. Pure Rotational Spectroscopy of Vinyl Mercaptan

    NASA Astrophysics Data System (ADS)

    Martin-Drumel, Marie-Aline; Zingsheim, Oliver; Thorwirth, Sven; Müller, Holger S. P.; Lewen, Frank; Schlemmer, Stephan

    2014-06-01

    Vinyl mercaptan (ethenethiol, CH_2=CHSH) exists in the gas phase in two distinct rotameric forms, syn (planar) and anti (quasi-planar in the ground vibrational state). The microwave spectra of these two isomers were investigated previously, however not exceeding frequencies of about 65 GHz. In the present investigation, the pure rotational spectra of both species have been investigated at millimeter wavelengths. Vinyl mercaptan was produced in a radiofrequency discharge through a constant flow of ethanedithiol at low pressure. Both syn and anti rotamers were observed and new extensive sets of molecular parameters were obtained. Owing to its close structural relationship to vinyl alcohol and the astronomical abundance of complex sulfur-bearing molecules, vinyl mercaptan is a plausible candidate for future radio astronomical searches. M. Tanimoto et al. J. Mol. Spectrosc. 78, 95--105 & 106--119 (1979)

  19. Pure White Cell Aplasia and Necrotizing Myositis

    PubMed Central

    Kim, Peter Geon; Suh, Joome; Adelman, Max W.; Oduro, Kwadwo; Williams, Erik; Brunner, Andrew M.; Kuter, David J.

    2016-01-01

    Pure white cell aplasia (PWCA) is a rare hematologic disorder characterized by the absence of neutrophil lineages in the bone marrow with intact megakaryopoiesis and erythropoiesis. PWCA has been associated with autoimmune, drug-induced, and viral exposures. Here, we report a case of a 74-year-old female who presented with severe proximal weakness without pain and was found to have PWCA with nonspecific inflammatory necrotizing myositis and acute liver injury on biopsies. These findings were associated with a recent course of azithromycin and her daily use of a statin. Myositis improved on prednisone but PWCA persisted. With intravenous immunoglobulin and granulocyte-colony stimulating factor therapies, her symptoms and neutrophil counts improved and were sustained for months. PMID:27073704

  20. Hologram of a pure state black hole

    NASA Astrophysics Data System (ADS)

    Roy, Shubho R.; Sarkar, Debajyoti

    2015-12-01

    In this paper, we extend the Hamilton-Kabat-Lifschytz-Lowe (HKLL) holographic smearing function method to reconstruct (quasi)local anti-de Sitter bulk scalar observables in the background of a large anti-de Sitter black hole formed by null shell collapse (a "pure state" black hole), from the dual conformal field theory which is undergoing a sudden quench. In particular, we probe the near horizon and subhorizon bulk locality. First, we construct local bulk operators from the conformal field theory in the leading semiclassical limit, N →∞ . Then, we look at effects due to the finiteness of N , where we propose a suitable coarse-graining prescription involving early and late time cutoffs to define semiclassical bulk observables which are approximately local, their departure from locality being nonperturbatively small in N . Our results have important implications on the black hole information problem.

  1. Black holes in pure Lovelock gravities

    SciTech Connect

    Cai Ronggen; Ohta, Nobuyoshi

    2006-09-15

    Lovelock gravity is a fascinating extension of general relativity, whose action consists of dimensionally extended Euler densities. Compared to other higher order derivative gravity theories, Lovelock gravity is attractive since it has a lot of remarkable features such as the fact that there are no more than second order derivatives with respect to the metric in its equations of motion, and that the theory is free of ghosts. Recently, in the study of black strings and black branes in Lovelock gravity, a special class of Lovelock gravity is considered, which is named pure Lovelock gravity, where only one Euler density term exists. In this paper we study black hole solutions in the special class of Lovelock gravity and associated thermodynamic properties. Some interesting features are found, which are quite different from the corresponding ones in general relativity.

  2. Pure Varus Injury to the Knee Joint.

    PubMed

    Yoo, Jae Ho; Lee, Jung Ha; Chang, Chong Bum

    2015-06-01

    A 30-year-old male was involved in a car accident. Radiographs revealed a depressed marginal fracture of the medial tibial plateau and an avulsion fracture of the fibular head. Magnetic resonance imaging showed avulsion fracture of Gerdy's tubercle, injury to the posterior cruciate ligament (PCL), posterior horn of the medial meniscus, and the attachments of the lateral collateral ligament and the biceps femoris tendon. The depressed fracture of the medial tibial plateau was elevated and stabilized using a cannulated screw and washer. The injured lateral and posterolateral corner (PLC) structures were repaired and augmented by PLC reconstruction. However, the avulsion fracture of Gerdy's tubercle was not fixed because it was minimally displaced and the torn PCL was also not repaired or reconstructed. We present a unique case of pure varus injury to the knee joint. This case contributes to our understanding of the mechanism of knee injury and provides insight regarding appropriate treatment plans for this type of injury. PMID:26217477

  3. Synaptic devices based on purely electronic memristors

    NASA Astrophysics Data System (ADS)

    Pan, Ruobing; Li, Jun; Zhuge, Fei; Zhu, Liqiang; Liang, Lingyan; Zhang, Hongliang; Gao, Junhua; Cao, Hongtao; Fu, Bing; Li, Kang

    2016-01-01

    Memristive devices have been widely employed to emulate biological synaptic behavior. In these cases, the memristive switching generally originates from electrical field induced ion migration or Joule heating induced phase change. In this letter, the Ti/ZnO/Pt structure was found to show memristive switching ascribed to a carrier trapping/detrapping of the trap sites (e.g., oxygen vacancies or zinc interstitials) in ZnO. The carrier trapping/detrapping level can be controllably adjusted by regulating the current compliance level or voltage amplitude. Multi-level conductance states can, therefore, be realized in such memristive device. The spike-timing-dependent plasticity, an important Hebbian learning rule, has been implemented in this type of synaptic device. Compared with filamentary-type memristive devices, purely electronic memristors have potential to reduce their energy consumption and work more stably and reliably, since no structural distortion occurs.

  4. Entanglement entropy of multipartite pure states

    SciTech Connect

    Bravyi, Sergei

    2003-01-01

    Consider a system consisting of n d-dimensional quantum particles and an arbitrary pure state vertical bar {psi}> of the whole system. Suppose we simultaneously perform complete von Neumann measurements on each particle. The Shannon entropy of the outcomes' joint probability distribution is a functional of the state vertical bar {psi}> and of n measurements chosen for each particle. Denote S[{psi}] the minimum of this entropy over all choices of the measurements. We show that S[{psi}] coincides with the entropy of entanglement for bipartite states. We compute S[{psi}] for some special multipartite states: the hexacode state vertical bar H> (n=6, d=2) and the determinant states vertical bar Det{sub n}> (d=n). The computation yields S[H]=4 log 2 and S[Det{sub n}]=log(n{exclamation_point}). Counterparts of the determinant state defined for d

  5. Fock expansion of multimode pure Gaussian states

    SciTech Connect

    Cariolaro, Gianfranco; Pierobon, Gianfranco

    2015-12-15

    The Fock expansion of multimode pure Gaussian states is derived starting from their representation as displaced and squeezed multimode vacuum states. The approach is new and appears to be simpler and more general than previous ones starting from the phase-space representation given by the characteristic or Wigner function. Fock expansion is performed in terms of easily evaluable two-variable Hermite–Kampé de Fériet polynomials. A relatively simple and compact expression for the joint statistical distribution of the photon numbers in the different modes is obtained. In particular, this result enables one to give a simple characterization of separable and entangled states, as shown for two-mode and three-mode Gaussian states.

  6. Parametric separation of symmetric pure quantum states

    NASA Astrophysics Data System (ADS)

    Solís-Prosser, M. A.; Delgado, A.; Jiménez, O.; Neves, L.

    2016-01-01

    Quantum state separation is a probabilistic map that transforms a given set of pure states into another set of more distinguishable ones. Here we investigate such a map acting onto uniparametric families of symmetric linearly dependent or independent quantum states. We obtained analytical solutions for the success probability of the maps—which is shown to be optimal—as well as explicit constructions in terms of positive operator valued measures. Our results can be used for state discrimination strategies interpolating continuously between minimum-error and unambiguous (or maximum-confidence) discrimination, which, in turn, have many applications in quantum information protocols. As an example, we show that quantum teleportation through a nonmaximally entangled quantum channel can be accomplished with higher probability than the one provided by unambiguous (or maximum-confidence) discrimination and with higher fidelity than the one achievable by minimum-error discrimination. Finally, an optical network is proposed for implementing parametric state separation.

  7. In utero and in vitro effects of benzene and its metabolites on erythroid differentiation and the role of reactive oxygen species

    SciTech Connect

    Badham, Helen J.; Winn, Louise M.

    2010-05-01

    Benzene is a ubiquitous occupational and environmental toxicant. Exposures to benzene both prenatally and during adulthood are associated with the development of disorders such as aplastic anemia and leukemia. Mechanisms of benzene toxicity are unknown; however, generation of reactive oxygen species (ROS) by benzene metabolites may play a role. Little is known regarding the effects of benzene metabolites on erythropoiesis. Therefore, to determine the effects of in utero exposure to benzene on the growth and differentiation of fetal erythroid progenitor cells (CFU-E), pregnant CD-1 mice were exposed to benzene and CFU-E numbers were assessed in fetal liver (hematopoietic) tissue. In addition, to determine the effect of benzene metabolite-induced ROS generation on erythropoiesis, HD3 chicken erythroblast cells were exposed to benzene, phenol, or hydroquinone followed by stimulation of erythrocyte differentiation. Our results show that in utero exposure to benzene caused significant alterations in female offspring CFU-E numbers. In addition, exposure to hydroquinone, but not benzene or phenol, significantly reduced the percentage of differentiated HD3 cells, which was associated with an increase in ROS. Pretreatment of HD3 cells with polyethylene glycol-conjugated superoxide dismutase (PEG-SOD) prevented hydroquinone-induced inhibition of erythropoiesis, supporting the hypothesis that ROS generation is involved in the development of benzene erythrotoxicity. In conclusion, this study provided evidence that ROS generated as a result of benzene metabolism may significantly alter erythroid differentiation, potentially leading to the development of Blood Disorders.

  8. Thalidomide is more efficient than sodium butyrate in enhancing GATA-1 and EKLF gene expression in erythroid progenitors derived from HSCs with β-globin gene mutation

    PubMed Central

    Jalali Far, Mohammad Ali; Dehghani Fard, Ali; Hajizamani, Saiedeh; Mossahebi-Mohammadi, Majid; Yaghooti, Hamid; Saki, Najmaldin

    2016-01-01

    Background: Efficient induction of fetal hemoglobin (HbF) is considered as an effective therapeutic approach in beta thalassemia. HbF inducer agents can induce the expression of γ-globin gene and produce high levels of HbF via different epigenetic and molecular mechanisms. Thalidomide and sodium butyrate are known as HbF inducer drugs. Material and methods: CD133+ stem cells were isolated from umbilical cord blood of a newborn with minor β-thalassemia in order to evaluate the effects of these two drugs on the in vitro expression of GATA-1 and EKLF genes as erythroid transcription factors. CD133+ stem cells were expanded and differentiated into erythroid lineage and then treated with thalidomide and sodium butyrate and finally analyzed by quantitative real-time PCR. Statistical analysis was performed using student’s t-test by SPSS software. Results: Thalidomide and sodium butyrate increased GATA-1 and EKLF gene expression, compared to the non-treated control (P<0.05). Conclusion: Thalidomide was more efficient than sodium butyrate in augmenting expression of GATA-1 and EKLF genes. It seems that GATA-1 and EKLF have crucial roles in the efficient induction of HbF by thalidomide. PMID:27047649

  9. The major human erythroid DNA-binding protein (GF-1): Primary sequence and localization of the gene to the X chromosome

    SciTech Connect

    Zon, L.I.; Tsai, S.F.; Burgess, S.; Orkin, S.H. Howard Hughes Medical Institute, Boston, MA ); Matsudaira, P. ); Bruns, G.A.P. )

    1990-01-01

    Genes expressed in erythroid cells contain binding sites for a cell-specific nuclear factor, GF-1 (NF-E1, Eryf 1), believed to be an important transcriptional regulator. Previously the authors characterized murine GF-1 as a 413-amino acid polypeptide containing two cysteine-cysteine regions reminiscent of zinc-finger DNA-binding domains. By cross-hybridization to the finger domain of murine GF-1 they have isolated cDNA encoding the human homolog. Peptide sequencing of purified human GF-1 confirmed the authenticity of the human cDNA. The predicted primary sequence of human GF-1 is highly similar to that of murine GF-1, particularly in the DNA-binding region. Although the DNA-binding domains of human, murine, and chicken proteins are remarkably conserved, the mammalian polypeptides are strikingly divergent from the avian counterpart in other regions, most likely those responsible for transcriptional activation. By hybridization to panels of human-rodent DNAs they have assigned the human GF-1 locus to Xp21-11. The localization of the gene to the X chromosome has important implications for hereditary persistence of fetal hemoglobin syndromes unlinked to the {beta}-globin cluster and for genetic experiments designed to test the role of the factor in erythroid cell gene expression.

  10. PLC-beta 1 regulates the expression of miR-210 during mithramycin-mediated erythroid differentiation in K562 cells

    PubMed Central

    Fiume, Roberta; Blalock, William; Matteucci, Alessandro; Ramazzotti, Giulia; McCubrey, James A.; Cocco, Lucio; Faenza, Irene

    2014-01-01

    PLC-beta 1 (PLCβ1) inhibits in human K562 cells erythroid differentiation induced by mithramycin (MTH) by targeting miR-210 expression. Inhibition of miR-210 affects the erythroid differentiation pathway and it occurs to a greater extent in MTH-treated cells. Overexpression of PLCβ1 suppresses the differentiation of K562 elicited by MTH as demonstrated by the absence of γ-globin expression. Inhibition of PLCβ1 expression is capable to promote the differentiation process leading to a recovery of γ-globin gene even in the absence of MTH. Our experimental evidences suggest that PLCβ1 signaling regulates erythropoiesis through miR-210. Indeed overexpression of PLCβ1 leads to a decrease of miR-210 expression after MTH treatment. Moreover miR-210 is up-regulated when PLCβ1 expression is down-regulated. When we silenced PKCα by RNAi technique, we found a decrease in miR-210 and γ-globin expression levels, which led to a severe slowdown of cell differentiation in K562 cells and these effects were the same encountered in cells overexpressing PLCβ1. Therefore we suggest a novel role for PLCβ1 in regulating miR-210 and our data hint at the fact that, in human K562 erythroleukemia cells, the modulation of PLCβ1 expression is able to exert an impairment of normal erythropoiesis as assessed by γ-globin expression. PMID:24962066

  11. Intrinsic defects in erythroid cells from familial hemophagocytic lymphohistiocytosis type 5 patients identify a role for STXBP2/Munc18-2 in erythropoiesis and phospholipid scrambling.

    PubMed

    Kostova, Elena B; Beuger, Boukje M; Veldthuis, Martijn; van der Werff Ten Bosch, Jutte; Kühnle, Ingrid; van den Akker, Emile; van den Berg, Timo K; van Zwieten, Rob; van Bruggen, Robin

    2015-12-01

    Familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) is a rare genetic disorder caused by mutations in STXBP2/Munc18-2. Munc18-2 plays a role in the degranulation machinery of natural killer cells and cytotoxic T lymphocytes. Mutations in STXBP2/Munc18-2 lead to impaired killing of target cells by natural killer cells and cytotoxic T lymphocytes, which in turn results in elevated levels of the inflammatory cytokine interferon γ, macrophage activation, and hemophagocytosis. Even though patients with FHL-5 present with anemia and hemolysis, no link between the disease and the erythroid lineage has been established. Here we report that red blood cells express Munc18-2 and that erythroid cells from patients with FHL-5 exhibit intrinsic defects caused by STXBP2/Munc18-2 mutations. Red blood cells from patients with FHL-5 expose less phosphatidylserine on their surface upon Ca(2+) ionophore ionomycin treatment. Furthermore, cultured erythroblasts from patients with FHL-5 display defective erythropoiesis characterized by decreased CD235a expression and aberrant cell morphology. PMID:26320718

  12. Transcriptional Activity of Erythroid Kruppel-like Factor (EKLF/KLF1) Modulated by PIAS3 (Protein Inhibitor of Activated STAT3)*

    PubMed Central

    Siatecka, Miroslawa; Soni, Shefali; Planutis, Antanas; Bieker, James J.

    2015-01-01

    Erythroid Kruppel-like factor (EKLF or KLF1) is a transcription factor crucial for red cell development that is directly involved in regulation of a large number of erythroid genes. EKLF serves mostly as an activator of expression of these genes; however, it can act also as a repressor. Here, we present evidence that EKLF interacts with proteins from the PIAS (protein inhibitor of activated STAT) family that convey repressive activity to EKLF in the absence of sumoylation. Our studies identify PIAS3 as a transcriptional corepressor of EKLF for at least a subset of its target genes during erythropoiesis (e.g. β-globin, α-hemoglobin stabilizing protein). We demonstrate an interaction between EKLF and PIAS proteins confirmed by in vivo coimmunoprecipitation assays with both exogenous and endogenous proteins. We identified an LXXLL signature motif located near the N terminus of PIAS proteins that, although not involved in the EKLF-PIAS3 interaction, is required for the transrepression activity. Knockdown of endogenous PIAS3 accelerates differentiation of both murine erythroleukemia cells, as well as fetal liver cells, whereas an increase in PIAS3 levels inhibits this increase. Using chromatin immunoprecipitation assays, we show that PIAS3 preferentially occupies the β-globin promoter in undifferentiated murine erythroleukemia cells. Together these results demonstrate that an interaction between EKLF and PIAS3 provides a novel mode of regulation of EKLF activity in the absence of sumolylation and furthermore shows an important involvement of PIAS proteins in erythropoiesis. PMID:25713074

  13. Cis-vaccenic acid induces differentiation and up-regulates gamma globin synthesis in K562, JK1 and transgenic mice erythroid progenitor stem cells.

    PubMed

    Aimola, Idowu A; Inuwa, Hajiya M; Nok, Andrew J; Mamman, Aisha I; Bieker, James J

    2016-04-01

    Gamma globin induction remains a promising pharmacological therapeutic treatment mode for sickle cell anemia and beta thalassemia, however Hydroxyurea remains the only FDA approved drug which works via this mechanism. In this regard, we assayed the γ-globin inducing capacity of Cis-vaccenic acid (CVA). CVA induced differentiation of K562, JK1 and transgenic mice primary bone marrow hematopoietic progenitor stem cells. CVA also significantly up-regulated γ-globin gene expression in JK-1 and transgenic mice bone marrow erythroid progenitor stem cells (TMbmEPSCs) but not K562 cells without altering cell viability. Increased γ-globin expression was accompanied by KLF1 suppression in CVA induced JK-1 cells. Erythropoietin induced differentiation of JK-1 cells 24h before CVA induction did not significantly alter CVA induced differentiation and γ-globin expression in JK-1 cells. Inhibition of JK-1 and Transgenic mice bone marrow erythroid progenitor stem cells Fatty acid elongase 5 (Elovl5) and Δ(9) desaturase suppressed the γ-globin inductive effects of CVA. CVA treatment failed to rescue γ-globin expression in Elovl5 and Δ(9)-desaturase inhibited cells 48 h post inhibition in JK-1 cells. The data suggests that CVA directly modulates differentiation of JK-1 and TMbmEPSCs, and indirectly modulates γ-globin gene expression in these cells. Our findings provide important clues for further evaluations of CVA as a potential fetal hemoglobin therapeutic inducer. PMID:26879870

  14. Overactivation of the nuclear factor (erythroid-derived 2)-like 2-antioxidant response element pathway in hepatocytes decreases hepatic ischemia/reperfusion injury in mice.

    PubMed

    Lee, Lung-Yi; Harberg, Calvin; Matkowskyj, Kristina A; Cook, Shelly; Roenneburg, Drew; Werner, Sabine; Johnson, Jeffrey; Foley, David P

    2016-01-01

    Hepatic ischemia/reperfusion injury (IRI) is a critical component of hepatic surgery. Oxidative stress has long been implicated as a key player in IRI. In this study, we examine the cell-specific role of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-antioxidant response element pathway in warm hepatic IRI. Nrf2 knockout (KO) and wild-type (WT) animals and novel transgenic mice expressing a constitutively active nuclear factor (erythroid-derived 2)-like 2 (caNrf2) mutant in hepatocytes (AlbCre+/caNrf2+) and their littermate controls underwent partial hepatic ischemia or sham surgery. The animals were killed 6 hours after reperfusion, and their serum and tissue were collected for analysis. As compared to WT animals after ischemia/reperfusion (IR), Nrf2 KO mice had increased hepatocellular injury with increased serum alanine aminotransferase and aspartate aminotransferase, Suzuki score, apoptosis, an increased inflammatory infiltrate, and enhanced inflammatory cytokine expression. On the other hand, AlbCre+/caNrf2+ that underwent IR had significantly reduced serum transaminases, less necrosis on histology, and a less pronounced inflammatory infiltrate and inflammatory cytokine expression as compared to the littermate controls. However, there were no differences in apoptosis. Taken together, Nrf2 plays a critical role in our murine model of warm hepatic IRI, with Nrf2 deficiency exacerbating hepatic IRI and hepatocyte-specific Nrf2 overactivation providing protection against warm hepatic IRI. PMID:26285140

  15. Social cognition in "pure" delusional disorder.

    PubMed

    Bömmer, Isabel; Brüne, Martin

    2006-09-01

    Introduction. Delusional disorders are characterised by monothematic, "encapsulated" and incorrigible false beliefs and misinterpretations of social signals. Due to the rarity of cases with "pure" delusional disorder (DD) in clinical settings most studies of social cognition in delusional patients have focused on patients with paranoid schizophrenia. In the present study we sought to examine emotion recognition, theory of mind abilities, and pragmatic language comprehension in patients with delusional disorder. Methods. Social cognition was assessed in 21 patients recruited over a 3-year period who were diagnosed with delusional disorder, paranoid, erotomanic, or jealous type. In addition to an emotion recognition and theory of mind test battery, we included a novel German Proverb Test, which has been found indicative of subtle theory of mind deficits in schizophrenic patients. Executive functioning was assessed using the Wisconsin Card Sorting Test (WCST). Psychopathology was measured using the Positive and Negative Symptoms Scale (PANSS). Patients' task performance was compared to a group of 22 healthy control persons paralleled for verbal intelligence, education, and age. Results. Patients with DD made significantly more perseverative errors in the WCST, they performed more poorly on the theory of mind tasks and the proverb test, but were unimpaired in basic emotion recognition abilities relative to controls. When executive functioning was co-varied out, the group differences in theory of mind disappeared, whereas the greater propensity of patients with DD to interpret proverbs literally remained significant. Conclusions. In "pure" DD the basic social cognitive abilities appear to be preserved. Difficulties in metaphorical speech comprehension and executive functioning could, however, indicate more subtle social cognitive deficits in these patients. PMID:17354084

  16. ThermoData Engine Database - Pure Compounds and Binary Mixtures

    National Institute of Standards and Technology Data Gateway

    SRD 103b NIST ThermoData Engine Version 6.0 - Pure CompoThermoData Engine Database - Pure Compounds and Binary Mixtures (PC database for purchase)   This database contains property data for more than 21,000 pure compounds, 37,500 binary mixtures, 10,000 ternary mixtures, and 6,000 chemical reactions.

  17. In-house pureed food production in long-term care: perspectives of dietary staff and implications for improvement.

    PubMed

    Ilhamto, Nila; Anciado, Katrina; Keller, Heather H; Duizer, Lisa M

    2014-01-01

    Texture modification of foods to a pureed consistency is a common management approach for older adults with dysphagia. Long-term care (LTC) facilities commonly produce some pureed food in-house. This study investigated challenges and preferred practices associated with the production of pureed food in LTC facilities. Nutrition Managers (n = 27) and cooks (n = 26) from 25 Ontario LTC facilities were recruited for one-on-one, semistructured interviews. Interviews were digitally recorded, transcribed, and analyzed using inductive thematic analysis. Four themes arose from the data to exemplify challenges in production, including (a) difficulty in using standardized recipes, (b) varied interpretation of governmental guidelines, (c) lack of consistency in terminology and texture, and (d) wanting to improve the visual appeal. These challenges were reported to reduce the quality of in-house produced pureed food. Preferred practices to overcome these challenges were also provided by participants, such as involving cooks in pureed recipe improvements and tailoring to the specific needs of residents. Incorporation of these practices into pureed food production may help to shape and improve future practice and pureed food products. PMID:25105716

  18. Adult Compacts.

    ERIC Educational Resources Information Center

    Further Education Unit, London (England).

    This bulletin focuses on adult compacts, three-way agreements among employers, potential employees, and trainers to provide the right kind of quality training to meet the employers' requirements. Part 1 is an executive summary of a report of the Adult Compacts Project, which studied three adult compacts in Birmingham and Loughborough, England, and…

  19. AgraPure Mississippi Biomass Project

    SciTech Connect

    Blackwell,D.A; Broadhead, L.W.; Harrell, W.J.

    2006-03-31

    The AgraPure Mississippi Biomass project was a congressionally directed project, initiated to study the utilization of Mississippi agricultural byproducts and waste products in the production of bio-energy and to determine the feasibility of commercialization of these agricultural byproducts and waste products as feedstocks in the production of energy. The final products from this project were two business plans; one for a Thermal plant, and one for a Biodiesel/Ethanol plant. Agricultural waste fired steam and electrical generating plants and biodiesel plants were deemed the best prospects for developing commercially viable industries. Additionally, oil extraction methods were studied, both traditional and two novel techniques, and incorporated into the development plans. Mississippi produced crop and animal waste biomasses were analyzed for use as raw materials for both industries. The relevant factors, availability, costs, transportation, storage, location, and energetic value criteria were considered. Since feedstock accounts for more than 70 percent of the total cost of producing biodiesel, any local advantages are considered extremely important in developing this particular industry. The same factors must be evaluated in assessing the prospects of commercial operation of a steam and electrical generation plant. Additionally, the access to the markets for electricity is more limited, regulated and tightly controlled than the liquid fuel markets. Domestically produced biofuels, both biodiesel and ethanol, are gaining more attention and popularity with the consuming public as prices rise and supplies of foreign crude become less secure. Biodiesel requires no major modifications to existing diesel engines or supply chain and offers significant environmental benefits. Currently the biodiesel industry requires Federal and State incentives to allow the industry to develop and become self-sustaining. Mississippi has available the necessary feedstocks and is

  20. Accelerating degradation rate of pure iron by zinc ion implantation.

    PubMed

    Huang, Tao; Zheng, Yufeng; Han, Yong

    2016-12-01

    Pure iron has been considered as a promising candidate for biodegradable implant applications. However, a faster degradation rate of pure iron is needed to meet the clinical requirement. In this work, metal vapor vacuum arc technology was adopted to implant zinc ions into the surface of pure iron. Results showed that the implantation depth of zinc ions was about 60 nm. The degradation rate of pure iron was found to be accelerated after zinc ion implantation. The cytotoxicity tests revealed that the implanted zinc ions brought a slight increase on cytotoxicity of the tested cells. In terms of hemocompatibility, the hemolysis of zinc ion implanted pure iron was lower than 2%. However, zinc ions might induce more adhered and activated platelets on the surface of pure iron. Overall, zinc ion implantation can be a feasible way to accelerate the degradation rate of pure iron for biodegradable applications. PMID:27482462

  1. Accelerating degradation rate of pure iron by zinc ion implantation

    PubMed Central

    Huang, Tao; Zheng, Yufeng; Han, Yong

    2016-01-01

    Pure iron has been considered as a promising candidate for biodegradable implant applications. However, a faster degradation rate of pure iron is needed to meet the clinical requirement. In this work, metal vapor vacuum arc technology was adopted to implant zinc ions into the surface of pure iron. Results showed that the implantation depth of zinc ions was about 60 nm. The degradation rate of pure iron was found to be accelerated after zinc ion implantation. The cytotoxicity tests revealed that the implanted zinc ions brought a slight increase on cytotoxicity of the tested cells. In terms of hemocompatibility, the hemolysis of zinc ion implanted pure iron was lower than 2%. However, zinc ions might induce more adhered and activated platelets on the surface of pure iron. Overall, zinc ion implantation can be a feasible way to accelerate the degradation rate of pure iron for biodegradable applications. PMID:27482462

  2. PURE NIOBIUM AS A PRESSURE VESSEL MATERIAL

    SciTech Connect

    Peterson, T. J.; Carter, H. F.; Foley, M. H.; Klebaner, A. L.; Nicol, T. H.; Page, T. M.; Theilacker, J. C.; Wands, R. H.; Wong-Squires, M. L.; Wu, G.

    2010-04-09

    Physics laboratories around the world are developing niobium superconducting radio frequency (SRF) cavities for use in particle accelerators. These SRF cavities are typically cooled to low temperatures by direct contact with a liquid helium bath, resulting in at least part of the helium container being made from pure niobium. In the U.S., the Code of Federal Regulations allows national laboratories to follow national consensus pressure vessel rules or use of alternative rules which provide a level of safety greater than or equal to that afforded by ASME Boiler and Pressure Vessel Code. Thus, while used for its superconducting properties, niobium ends up also being treated as a material for pressure vessels. This report summarizes what we have learned about the use of niobium as a pressure vessel material, with a focus on issues for compliance with pressure vessel codes. We present results of a literature search for mechanical properties and tests results, as well as a review of ASME pressure vessel code requirements and issues.

  3. Pure electron plasmas in asymmetric traps*

    NASA Astrophysics Data System (ADS)

    Chu, R.; Wurtele, J. S.; Notte, J.; Peurrung, A. J.; Fajans, J.

    1993-07-01

    Pure electron plasmas are routinely confined within cylindrically symmetric Penning traps. In this paper the static and dynamic properties of plasmas confined in traps with applied electric field asymmetries are investigated. Simple analytical theories are derived and used to predict the shapes of the stable noncircular plasma equilibria observed in experiments. Both analytical and experimental results agree with those of a vortex-in-cell simulation. For an l=1 diocotron mode in a cylindrically symmetric trap, the plasma rotates as a rigid column in a circular orbit. In contrast, plasmas in systems with electric field asymmetries are shown to have an analog to the l=1 mode in which the shape of the plasma changes as it rotates in a noncircular orbit. These bulk plasma features are studied with a Hamiltonian model. It is seen that, for a small plasma, the area enclosed by the orbit of the center of charge is an invariant when electric field perturbations are applied adiabatically. This invariant has been observed experimentally. The breaking of the invariant is also studied. The dynamic Hamiltonian model is also used to predict the shape and frequency of the large amplitude l=1 and l=2 diocotron modes in symmetric traps.

  4. Pure inorganic separator for lithium ion batteries.

    PubMed

    He, Meinan; Zhang, Xinjie; Jiang, Kuiyang; Wang, Joe; Wang, Yan

    2015-01-14

    Battery safety is critical for many applications including portable electronics, hybrid and electric vehicles, and grid storage. For lithium ion batteries, the conventional polymer based separator is unstable at 120 °C and above. In this research, we have developed a pure aluminum oxide nanowire based separator; this separator does not contain any polymer additives or binders; additionally, it is a bendable ceramic. The physical and electrochemical properties of the separator are investigated. The separator has a pore size of about 100 nm, and it shows excellent electrochemical properties under both room and high temperatures. At room temperature, the ceramic separator shows a higher rate capability compared to the conventional Celgard 2500 separator and life cycle performance does not show any degradation. At 120 °C, the cell with the ceramic separator showed a much better cycle performance than the conventional Celgard 2500 separator. Therefore, we believe that this research is really an exciting scientific breakthrough for ceramic separators and lithium ion batteries and could be potentially used in the next generation lithium ion batteries requiring high safety and reliability. PMID:25459154

  5. Photoionization Dynamics in Pure Helium Droplets

    SciTech Connect

    Peterka, Darcy S.; Kim, Jeong Hyun; Wang, Chia C.; Poisson,Lionel; Neumark, Daniel M.

    2007-02-04

    The photoionization and photoelectron spectroscopy of pure He droplets are investigated at photon energies between 24.6 eV (the ionization energy of He) and 28 eV. Time-of-flight mass spectra and photoelectron images were obtained at a series of molecular beam source temperatures and pressures to assess the effect of droplet size on the photoionization dynamics. At source temperatures below 16 K, the photoelectron images are dominated by fast electrons produced via direct ionization of He atoms, with a small contribution from very slow electrons with kinetic energies below 1 meV arising from an indirect mechanism. The fast photoelectrons have as much as 0.5 eV more kinetic energy than those from atomic He at the same photon energy. This result is interpreted and simulated within the context of a 'dimer model', in which one assumes vertical ionization from two nearest neighbor He atoms to the attractive region of the He2+ potential energy curve. Possible mechanism for the slow electrons, which were also seen at energies below IE(He), are discussed, including vibrational autoionizaton of Rydberg states comprising an electron weakly bound to the surface of a large HeN+ core.

  6. Shifting from preconceptions to pure wonderment.

    PubMed

    Porr, Caroline

    2005-07-01

    The author reflects upon her role as a public health nurse striving to attain practice authenticity. Client assessment and nursing interventions were seemingly sufficient until she became curious about 'Who is this person sitting across from me?' and 'What are her experiences in the world as a lone parent living in poverty at the margins of society?' The author begins to think that she could shift from mere client investigation to pure wonderment about the Other by imagining herself as a researcher, an explorer of another's life world. Ultimately this process enables her to enhance the 'caring' in her practice with the knowledge gained of the perceptions and meanings impoverished clients assigned to their everyday lives. Jurgen Habermas' theory of communicative competence serves as the reference map guiding exploration. The author uses Habermas' theoretical principles of intersubjective mutuality--the validity claims of comprehensibility, truth, sincerity, and legitimacy. Comprehensibility embodies understanding, an attitude of unconditional acceptance, and care respect of another's individual person and self-defined reality. Intersubjective mutuality also requires that one dwell in the moment with the Other, satisfied that communication is founded on truth. Sincerity implies fostering the Other's expression of authentic self apart from oppressive distracters. Lastly, legitimacy reconciles the author's altruistic pursuit to know the Other's ontological truth with the reality of the present world. PMID:15935084

  7. Localization of aerial pure tones by pinnipeds

    NASA Astrophysics Data System (ADS)

    Holt, Marla M.; Schusterman, Ronald J.; Kastak, David; Southall, Brandon L.

    2005-12-01

    In this study, minimum audible angles (MAAs) of aerial pure tones were measured in and compared between a northern elephant seal (Mirounga angustirostris), a harbor seal (Phoca vitulina), and a California sea lion (Zalophus californianus). Testing was conducted between 0.8 and 16 kHz in the elephant seal and 0.8 and 20 kHz in the harbor seal and sea lion in a hemi-anechoic chamber using a left/right psychophysical procedure. Performance for the same frequencies was also quantified for discrete speaker separation of 5° from the mid-line. For all subjects, MAAs ranged from approximately 3° to 15° and were generally equal to or larger than those previously measured in the same subjects with a broadband signal. Performance at 5° ranged from chance to 97% correct, depending on frequency and subject. Poorest performance in the sea lion and harbor seal occurred at intermediate frequencies, which is consistent with the duplex theory of sound localization. In contrast, the elephant seal's poorest performance occurred at higher frequencies. The elephant seal's result suggests an inferior ability to utilize interaural level differences and is perhaps related to best hearing sensitivity shifted toward lower frequencies in this species relative to other pinnipeds.

  8. Calibration of sound velocimeter in pure water

    NASA Astrophysics Data System (ADS)

    Li, Zhiwei; Zhang, Baofeng; Li, Tao; Zhu, Junchao; Xie, Ziming

    2016-01-01

    Accurate measurement of sound speed is important to calibrate a sound velocity profiler which provides real-time sound velocity to the sonar equipment in oceanographic survey. The sound velocity profiler calculates the sound speed by measuring the time-of-flight of a 1 MHz single acoustic pulse to travel over about 300 mm path. A standard sound velocimeter instrument was invited to calibrate the sound velocity profiler in pure water at temperatures of 278,283, 288, 293, 298, 303 and 308K in a thermostatic vessel at one atmosphere. The sound velocity profiler was deployed in the thermostatic vessel alongside the standard sound velocimeter instrument and two platinum resistance thermometers (PRT) which were calibrated to 0.002k by comparison with a standard PRT. Time of flight circuit board was used to measure the time-of-flight to 22 picosecond precision. The sound speed which was measured by the sound velocity profiler was compared to the standard sound speed calculated by UNESCO to give the laboratory calibration coefficients and was demonstrated agreement with CTD-derived sound speed using Del Grosso's seawater equation after removing a bias.

  9. Memory for pure tone sequences without contour.

    PubMed

    Lefebvre, Christine; Jolicœur, Pierre

    2016-06-01

    We presented pure tones interspersed with white noise sounds to disrupt contour perception in an acoustic short-term memory (ASTM) experiment during which we recorded the electroencephalogram. The memory set consisted of seven stimuli, 0, 1, 2, 3, or 4 of which were to-be-remembered tones. We estimated each participant׳s capacity, K, for each set size and measured the amplitude of the SAN (sustained anterior negativity, an ERP related to acoustic short-term memory). We correlated their K slopes with their SAN amplitude slopes as a function of set size, and found a significant link between performance and the SAN: a larger increase in SAN amplitude was linked with a larger number of stimuli maintained in ASTM. The SAN decreased in amplitude in the later portion of the silent retention interval, but the correlation between the SAN and capacity remained strong. These results show the SAN is not an index of contour but rather an index of the maintenance of individual objects in STM. This article is part of a Special Issue entitled SI: Auditory working memory. PMID:26903419

  10. Pure Niobium as a Pressure Vessel Material

    NASA Astrophysics Data System (ADS)

    Peterson, T. J.; Carter, H. F.; Foley, M. H.; Klebaner, A. L.; Nicol, T. H.; Page, T. M.; Theilacker, J. C.; Wands, R. H.; Wong-Squires, M. L.; Wu, G.

    2010-04-01

    Physics laboratories around the world are developing niobium superconducting radio frequency (SRF) cavities for use in particle accelerators. These SRF cavities are typically cooled to low temperatures by direct contact with a liquid helium bath, resulting in at least part of the helium container being made from pure niobium. In the U.S., the Code of Federal Regulations allows national laboratories to follow national consensus pressure vessel rules or use of alternative rules which provide a level of safety greater than or equal to that afforded by ASME Boiler and Pressure Vessel Code. Thus, while used for its superconducting properties, niobium ends up also being treated as a material for pressure vessels. This report summarizes what we have learned about the use of niobium as a pressure vessel material, with a focus on issues for compliance with pressure vessel codes. We present results of a literature search for mechanical properties and tests results, as well as a review of ASME pressure vessel code requirements and issues.

  11. Electron Acoustic Waves in Pure Ion Plasmas

    NASA Astrophysics Data System (ADS)

    Anderegg, F.; Affolter, M.; Driscoll, C. F.; O'Neil, T. M.; Valentini, F.

    2012-10-01

    Electron Acoustic Waves (EAWs) are the low-frequency branch of near-linear Langmuir (plasma) waves: the frequency is such that the complex dielectric function (Dr, Di) has Dr= 0; and ``flattening'' of f(v) near the wave phase velocity vph gives Di=0 and eliminates Landau damping. Here, we observe standing axisymmetric EAWs in a pure ion column.footnotetextF. Anderegg, et al., Phys. Rev. Lett. 102, 095001 (2009). At low excitation amplitudes, the EAWs have vph˜1.4 v, in close agreement with near-linear theory. At moderate excitation strengths, EAW waves are observed over a range of frequencies, with 1.3 v < vph< 2.1 v. Here, the final wave frequency may differ from the excitation frequency since the excitation modifies f (v); and recent theory analyzes frequency shifts from ``corners'' of a plateau at vph.footnotetextF. Valentini et al., arXiv:1206.3500v1. Large amplitude EAWs have strong phase-locked harmonic content, and experiments will be compared to same-geometry simulations, and to simulations of KEENfootnotetextB. Afeyan et al., Proc. Inertial Fusion Sci. and Applications 2003, A.N.S. Monterey (2004), p. 213. waves in HEDLP geometries.

  12. Reexamination of pure qubit work extraction

    NASA Astrophysics Data System (ADS)

    Frenzel, Max F.; Jennings, David; Rudolph, Terry

    2014-11-01

    Many work extraction or information erasure processes in the literature involve the raising and lowering of energy levels via external fields. But even if the actual system is treated quantum mechanically, the field is assumed to be classical and of infinite strength, hence not developing any correlations with the system or experiencing back-actions. We extend these considerations to a fully quantum mechanical treatment by studying a spin-1/2 particle coupled to a finite-sized directional quantum reference frame, a spin-l system, which models an external field. With this concrete model together with a bosonic thermal bath, we analyze the back-action a finite-size field suffers during a quantum-mechanical work extraction process and the effect this has on the extractable work and highlight a range of assumptions commonly made when considering such processes. The well-known semiclassical treatment of work extraction from a pure qubit predicts a maximum extractable work W =k T log2 for a quasistatic process, which holds as a strict upper bound in the fully quantum mechanical case and is attained only in the classical limit. We also address the problem of emergent local time dependence in a joint system with a globally fixed Hamiltonian.

  13. Foaming of mixtures of pure hydrocarbons

    NASA Technical Reports Server (NTRS)

    Robinson, J. V.; Woods, W. W.

    1950-01-01

    Mixtures of pure liquid hydrocarbons are capable of foaming. Nine hydrocarbons were mixed in pairs, in all possible combinations, and four proportions of each combination. These mixtures were sealed in glass tubes, and the foaming was tested by shaking. Mixtures of aliphatic with other aliphatic hydrocarbons, or of alkyl benzenes with other alkyl benzenes, did not foam. Mixtures of aliphatic hydrocarbons with alkyl benzenes did foam. The proportions of the mixtures greatly affected the foaming, the maximum foaming of 12 of 20 pairs being at the composition 20 percent aliphatic hydrocarbon, 80 percent alkyl benzene. Six seconds was the maximum foam lifetime of any of these mixtures. Aeroshell 120 lubricating oil was fractionated into 52 fractions and a residue by extraction with acetone in a fractionating extractor. The index of refraction, foam lifetime, color, and viscosity of these fractions were measured. Low viscosity and high index fractions were extracted first. The viscosity of the fractions extracted rose and the index decreased as fractionation proceeded. Foam lifetimes and color were lowest in the middle fractions. Significance is attached to the observation that none of the foam lifetimes of the fractions or residue is as high as the foam lifetime of the original Aeroshell, indicating that the foaming is not due to a particular foaming constituent, but rather to the entire mixture.

  14. Transcriptional up-regulation of the mouse cytosolic glutathione peroxidase gene in erythroid cells is due to a tissue-specific 3' enhancer containing functionally important CACC/GT motifs and binding sites for GATA and Ets transcription factors.

    PubMed Central

    O'Prey, J; Ramsay, S; Chambers, I; Harrison, P R

    1993-01-01

    Nuclear run-on experiments have shown that the high level of expression of the mouse cytosolic glutathione peroxidase mRNA in erythroid cells is due to up-regulation of the gene at the transcriptional level. Studies of the chromatin structure around the cytosolic glutathione peroxidase gene have revealed a series of DNase I hypersensitive sites (DHSS) in the 3' flanking region of the gene in erythroid and other high-expression tissues that are lacking in low-expression cells, in addition to a DHSS over the promoter region in both high- and low-expression tissues. Functional transfection experiments have demonstrated that one of the 3' DHSS regions functions as an enhancer in erythroid cells but not in a low-expression epithelial cell line; and site-directed mutagenesis and footprinting experiments reveal that the activity of the erythroid cell-specific enhancer requires a cluster of binding sites for the CACC/GT box factors and the GATA and Ets families of transcription factors. Images PMID:8413228

  15. Partial Loss of Rpl11 in Adult Mice Recapitulates Diamond-Blackfan Anemia and Promotes Lymphomagenesis.

    PubMed

    Morgado-Palacin, Lucia; Varetti, Gianluca; Llanos, Susana; Gómez-López, Gonzalo; Martinez, Dolores; Serrano, Manuel

    2015-10-27

    Diamond-Blackfan anemia (DBA) is characterized by anemia and cancer susceptibility and is caused by mutations in ribosomal genes, including RPL11. Here, we report that Rpl11-heterozygous mouse embryos are not viable and that Rpl11 homozygous deletion in adult mice results in death within a few weeks, accompanied by bone marrow aplasia and intestinal atrophy. Importantly, Rpl11 heterozygous deletion in adult mice results in anemia associated with decreased erythroid progenitors and defective erythroid maturation. These defects are also present in mice transplanted with inducible heterozygous Rpl11 bone marrow and, therefore, are intrinsic to the hematopoietic system. Additionally, heterozygous Rpl11 mice present increased susceptibility to radiation-induced lymphomagenesis. In this regard, total or partial deletion of Rpl11 compromises p53 activation upon ribosomal stress or DNA damage in fibroblasts. Moreover, fibroblasts and hematopoietic tissues from heterozygous Rpl11 mice present higher basal cMYC levels. We conclude that Rpl11-deficient mice recapitulate DBA disorder, including cancer predisposition. PMID:26489471

  16. Forced chromatin looping raises fetal hemoglobin in adult sickle cells to higher levels than pharmacologic inducers.

    PubMed

    Breda, Laura; Motta, Irene; Lourenco, Silvia; Gemmo, Chiara; Deng, Wulan; Rupon, Jeremy W; Abdulmalik, Osheiza Y; Manwani, Deepa; Blobel, Gerd A; Rivella, Stefano

    2016-08-25

    Overcoming the silencing of the fetal γ-globin gene has been a long-standing goal in the treatment of sickle cell disease (SCD). The major transcriptional enhancer of the β-globin locus, called the locus control region (LCR), dynamically interacts with the developmental stage-appropriate β-type globin genes via chromatin looping, a process requiring the protein Ldb1. In adult erythroid cells, the LCR can be redirected from the adult β- to the fetal γ-globin promoter by tethering Ldb1 to the human γ-globin promoter with custom-designed zinc finger (ZF) proteins (ZF-Ldb1), leading to reactivation of γ-globin gene expression. To compare this approach to pharmacologic reactivation of fetal hemoglobin (HbF), hematopoietic cells from patients with SCD were treated with a lentivirus expressing the ZF-Ldb1 or with chemical HbF inducers. The HbF increase in cells treated with ZF-Ldb1 was more than double that observed with decitabine and pomalidomide; butyrate had an intermediate effect whereas tranylcypromine and hydroxyurea showed relatively low HbF reactivation. ZF-Ldb1 showed comparatively little toxicity, and reduced sickle hemoglobin (HbS) synthesis as well as sickling of SCD erythroid cells under hypoxic conditions. The efficacy and low cytotoxicity of lentiviral-mediated ZF-Ldb1 gene transfer compared with the drug regimens support its therapeutic potential for the treatment of SCD. PMID:27405777

  17. Pure-phase and pure-amplitude hologram design using the method of generalized projections

    NASA Astrophysics Data System (ADS)

    Catino, William Charles

    The overall contribution of the research presented in this dissertation is a systematic procedure for designing computer-generated holograms subject to far-field image constraints. The method of generalized projections is used to design pure-phase and pure-amplitude diffraction holograms that generate prescribed gray-scale images in the Fourier frequency plane. Performance is demonstrated with objective measures (error, efficiency, and variance), as well as with subjective comparison of images. Test images include a photographic quality image of Lena, a uniform intensity spot array, and a binary amplitude block text image. Projection algorithms are derived for pure-phase holograms with both continuous and quantized phase characteristics from a prescribed far-field magnitude constraint. The performance of the pure-phase hologram designs, as measured in the far-field image, is always very good for the continuous phase case and for the quantized phase case with a large number of phase quantization levels. However, as the number of quantization levels decreases, the performance typically degrades. Performance is significantly improved by constraining the energy in mutually exclusive cliques, that is, groups of image plane (far-field) pixels, instead of constraining the intensity of each individual pixel. Even for the binary phase case, acceptable images are generated with the clique energy algorithm. The method of generalized projections is also used to design pure-amplitude diffraction holograms using a prescribed image intensity constraint. Two algorithms are derived: the direct method, which nonlinearly constrains the hologram transmittance to the range of real values in (0,1); and the indirect method, which constrains the transmittance values to the real axis, and linearly transforms the resulting values to the range (0,1). Digital amplitude holograms are simulated by quantizing the amplitude holograms resulting from the indirect method. The indirect method

  18. Pure Java-based streaming MPEG player

    NASA Astrophysics Data System (ADS)

    Tolba, Osama; Briceno, Hector; McMillan, Leonard

    1999-01-01

    We present a pure Java-based streaming MPEG-1 video player. By implementing the player entirely in Java, we guarantee its functionality across platforms within any Java-enabled web browsers, without the need for native libraries. This allows greater sue of MPEG video sequences, because the users will no longer need to pre-install any software to display video, beyond Java compatibility. This player features a novel forward-mapping IDCT algorithm that allows it to play locally stored, CIF-sized video sequences at 11 frames per second, when run on a personal computer with Java 'just-in-time' compiler. The IDCT algorithm can run with greater speed when the sequence is viewed at reduced size; e.g., performing approximately 1/4 the amount of computation when the user resizes the sequence to 1/2 its original width and height. We are able to play video streams stored anywhere on the Internet with acceptable performance using a proxy server, eliminating the need for large-capacity auxiliary storage. Thus, the player is well suited to small devices, such as digital TV set-top decoders, requiring little more memory than is required for three video frames. Because of our modular design, it is possible to assemble multiple video streams from remote sources and present them simultaneously to the viewers, subject to network and local performance limitations. The same modular system can further provide viewers with their own customized view of each sessions; e.g., moving and resizing the video display window dynamically, and selecting their preferred set of video controls.

  19. Predictions of pure liquid shock Hugoniots

    SciTech Connect

    Hobbs, M.L.; Baer, M.R.

    1998-06-01

    Determination of product species and associated equations-of-state (EOS) for energetic materials such as pyrotechnics with complex elemental compositions remains a major unsolved problem. Although, empirical EOS models may be calibrated to replicate detonation conditions within experimental variability (5--10%), different states, e.g. expansion, may produce significant discrepancy with data if the basic form of the EOS model is incorrect. A more physically realistic EOS model based on intermolecular potentials, such as the Jacobs Cowperthwaite Zwisler (JCZ3) EOS, is needed to predict detonation states as well as expanded states. Predictive capability for any EOS requires a large species data base composed of a wide variety of elements. Unfortunately, only 20 species have known exponential 6 (EXP 6) molecular force constants which are used in the JCZ3-EOS. Of these 20 species, only 10 have been adequately compared to experimental data such as molecular scattering or shock Hugoniot data. Since data in the strongly repulsive region of the molecular potential is limited, alternative methods must be found to deduce force constants for a larger number of species. The objective of the present study is to determine JCZ3 product species force constants using corresponding state theory. Intermolecular potential parameters were obtained for a variety of gas species using a simple corresponding states technique with critical volume and critical temperature. A more complex, four parameter corresponding state method with shape and polarity corrections was also used to obtain intermolecular potential parameters. Both corresponding state methods were used to predict shock Hugoniot data obtained from pure liquids. The simple corresponding state method is shown to give adequate agreement with shock Hugoniot data.

  20. High expression levels of the "erythroid/brain" type glucose transporter (GLUT1) in the basal cells of human eye conjunctiva and oral mucosa reconstituted in culture.

    PubMed

    Gherzi, R; Melioli, G; De Luca, M; D'Agostino, A; Guastella, M; Traverso, C E; D'Anna, F; Franzi, A T; Cancedda, R

    1991-07-01

    The expression of the "erythroid/brain" type glucose transporter (GLUT1) seems to be a feature of "barrier" tissues, at least in humans. Recently, we reported that GLUT1 is highly expressed in the basal layers of either "authentic" human epidermis or human epidermis reconstituted in culture and that its expression seems to be related to keratinocyte differentiation. In this paper we demonstrate that GLUT1 is selectively expressed in the basal layers of either eye conjunctiva epithelia or oral mucosa, reconstituted in culture starting from 1-2 mm2 bioptic specimens of normal human tissue. GLUT1 mRNA and protein levels are very high in conjunctiva and oral mucosa, 2-3 times higher than in epidermis reconstituted in culture. Taking into account its localization at the border of tissues not directly vascularized, but metabolically active, GLUT1 could play an important role in controlling the entry of glucose into these firmly guarded tissues. PMID:2055270

  1. Whole-body response to pure lateral impact.

    PubMed

    Lessley, David; Shaw, Greg; Parent, Daniel; Arregui-Dalmases, Carlos; Kindig, Matthew; Riley, Patrick; Purtsezov, Sergey; Sochor, Mark; Gochenour, Thomas; Bolton, James; Subit, Damien; Crandall, Jeff; Takayama, Shinichi; Ono, Koshiro; Kamiji, Koichi; Yasuki, Tsuyoshi

    2010-11-01

    The objective of the current study was to provide a comprehensive characterization of human biomechanical response to whole-body, lateral impact. Three approximately 50th-percentile adult male PMHS were subjected to right-side pure lateral impacts at 4.3 ± 0.1 m/s using a rigid wall mounted to a rail-mounted sled. Each subject was positioned on a rigid seat and held stationary by a system of tethers until immediately prior to being impacted by the moving wall with 100 mm pelvic offset. Displacement data were obtained using an optoelectronic stereophotogrammetric system that was used to track the 3D motions of the impacting wall sled; seat sled, and reflective targets secured to the head, spine, extremities, ribcage, and shoulder complex of each subject. Kinematic data were also recorded using 3-axis accelerometer cubes secured to the head, pelvis, and spine at the levels of T1, T6, T11, and L3. Chest deformation in the transverse plane was recorded using a single chestband. Following the impact the subject was captured in an energy-absorbing net that provided a controlled non-injurious deceleration. The wall maintained nearly constant velocity throughout the impact event. One of the tested subjects sustained 16 rib fractures as well as injury to the struck shoulder while the other two tested subjects sustained no injuries. The collected response data suggest that the shoulder injury may have contributed to the rib fractures in the injured subject. The results suggest that the shoulder presents a substantial load path and may play an important role in transmitting lateral forces to the spine, shielding and protecting the ribcage. This characterization of whole-body, lateral impact response provides quantified subject responses and boundary condition interactions that are currently unavailable for whole-body, lateral impacts at impact speeds less than 6.7 m/s. PMID:21512913

  2. Cryogenic acoustic loss of pure and alloyed titanium

    NASA Astrophysics Data System (ADS)

    Matacz, A. L.; Veitch, P. J.; Blair, D. G.

    Low acoustic loss, high yield strength cryogenic materials are required for various high precision experiments, resonant-bar gravitational radiation antennae in particular. We report here acoustic loss measurements of commerically pure and alloyed titanium samples between 4.2 and 300 K. It is shown that machining damage of the surface significantly increased the acoustic loss of pure titanium, particularly below 100 K, and that the high strength alloy Ti-6AI-4V had significantly greater acoustic loss than pure titanium.

  3. Entanglement bound for multipartite pure states based on local measurements

    SciTech Connect

    Jiang Lizhen; Chen Xiaoyu; Ye Tianyu

    2011-10-15

    An entanglement bound based on local measurements is introduced for multipartite pure states. It is the upper bound of the geometric measure and the relative entropy of entanglement. It is the lower bound of the minimal-measurement entropy. For pure bipartite states, the bound is equal to the entanglement entropy. The bound is applied to pure tripartite qubit states and the exact tripartite relative entropy of entanglement is obtained for a wide class of states.

  4. Simvastatin and t-butylhydroquinone suppress KLF1 and BCL11A gene expression and additively increase fetal hemoglobin in primary human erythroid cells

    PubMed Central

    Macari, Elizabeth R.; Schaeffer, Emily K.; West, Rachel J.

    2013-01-01

    Although increased fetal hemoglobin (HbF) levels have proven benefit for people with β-hemoglobinopathies, all current HbF-inducing agents have limitations. We previously reported that drugs that activate the NRF2 antioxidant response signaling pathway increase HbF in primary human erythroid cells. In an attempt to increase HbF levels achieved with NRF2 activators, in the present study, we investigated potential complementary activity between these agents and HMG-CoA reductase inhibitors (statins) based on their ability to induce KLF2 protein levels. Experiments in K562 cells showed that simvastatin increased KLF2 mRNA and protein and KLF2 binding to HS2 of the β-globin locus control region and enhanced γ-globin mRNA production by the NRF2 activator Tert-butylhydroquinone (tBHQ). When tested in differentiating primary human erythroid cells, simvastatin induced HbF alone and additively with tBHQ, but it did not increase KLF2 mRNA or locus control region binding above levels seen with normal differentiation. Investigating alternative mechanisms of action, we found that both simvastatin and tBHQ suppress β-globin mRNA and KLF1 and BCL11A mRNA and protein, similar to what is seen in people with an HPFH phenotype because of KLF1 haploinsufficiency. These findings identify statins as a potential class of HbF-inducing agents and suggest a novel mechanism of action based on pharmacologic suppression of KLF1 and BCL11A gene expression. PMID:23223429

  5. Cell-specific overactivation of nuclear erythroid 2 p45-related factor 2-mediated gene expression in myeloid cells decreases hepatic ischemia/reperfusion injury.

    PubMed

    Lee, Lung-Yi; Harberg, Calvin; Matkowskyj, Kristina A; Cook, Shelly; Roenneburg, Drew; Werner, Sabine; Johnson, Delinda A; Johnson, Jeffrey A; Foley, David P

    2016-08-01

    Hepatic ischemia/reperfusion injury (IRI) is an unavoidable consequence of liver transplantation that can lead to postoperative hepatic dysfunction. Myeloid cells that include Kupffer cells, monocytes, and neutrophils contribute to the inflammatory response and cellular injury observed during hepatic IRI. We hypothesize that overactivation of the nuclear erythroid 2 p45-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway in myeloid cells leads to decreased cellular damage after hepatic IRI. We constructed transgenic mice with constitutively active nuclear erythroid 2 p45-related factor 2 (caNrf2) that over activates the Nrf2-ARE pathway in myeloid cells (lysozyme M cre recombinase [LysMcre]+/caNrf2+, n = 9), and their littermate controls lacking transgene expression (LysMcre+/caNrf2-, n = 11). The mice underwent either sham or partial hepatic ischemia surgery, with 60 minutes of ischemia followed by 6 hours of reperfusion. After IRI, LysMcre+/caNrf2+ mice demonstrated significantly decreased serum alanine aminotransferase and decreased areas of necrosis. Immunohistochemistry and immunoblot of caspase 3 showed a significantly decreased cleaved to full-length caspase 3 ratio in LysMcre+/caNrf2+ animals. Lymphocyte antigen 6 complex locus G and CD68 staining demonstrated reduced inflammatory cell infiltration. LysMcre+/caNrf2+ animals also had significantly decreased gene expression of proinflammatory cytokines, including interleukin (IL) 1β, IL6, tumor necrosis factor α, chemokine (C-C motif) ligand 2, and chemokine (C-X-C motif) ligand 10, and significantly decreased levels of 8-isoprostanes. In our model, Nrf2 overactivation in myeloid cells leads to decreased hepatocellular damage, necrosis, apoptosis, inflammation, and oxidative stress. Pharmacologic targeting of the Nrf2-ARE pathway in myeloid cells may be a novel strategy to mitigate hepatic IRI. Liver Transplantation 22 1115-1128 2016 AASLD. PMID:27113842

  6. Kit transduced signals counteract erythroid maturation by MAPK-dependent modulation of erythropoietin signaling and apoptosis induction in mouse fetal liver.

    PubMed

    Haas, N; Riedt, T; Labbaf, Z; Baßler, K; Gergis, D; Fröhlich, H; Gütgemann, I; Janzen, V; Schorle, H

    2015-05-01

    Signaling by the stem cell factor receptor Kit in hematopoietic stem and progenitor cells is functionally associated with the regulation of cellular proliferation, differentiation and survival. Expression of the receptor is downregulated upon terminal differentiation in most lineages, including red blood cell terminal maturation, suggesting that omission of Kit transduced signals is a prerequisite for the differentiation process to occur. However, the molecular mechanisms by which Kit signaling preserves the undifferentiated state of progenitor cells are not yet characterized in detail. In this study, we generated a mouse model for inducible expression of a Kit receptor carrying an activating mutation and studied its effects on fetal liver hematopoiesis. We found that sustained Kit signaling leads to expansion of erythroid precursors and interferes with terminal maturation beyond the erythroblast stage. Primary KIT(D816V) erythroblasts stimulated to differentiate fail to exit cell cycle and show elevated rates of apoptosis because of insufficient induction of survival factors. They further retain expression of progenitor cell associated factors c-Myc, c-Myb and GATA-2 and inefficiently upregulate erythroid transcription factors GATA-1, Klf1 and Tal1. In KIT(D816V) erythroblasts we found constitutive activation of the mitogen-activated protein kinase (MAPK) pathway, elevated expression of the src kinase family member Lyn and impaired Akt activation in response to erythropoietin. We demonstrate that the block in differentiation is partially rescued by MAPK inhibition, and completely rescued by the multikinase inhibitor Dasatinib. These results show that a crosstalk between Kit and erythropoietin receptor signaling cascades exists and that continuous Kit signaling, partly mediated by the MAPK pathway, interferes with this crosstalk. PMID:25323585

  7. Recombinant adeno-associated virus (rAAV)-mediated expression of a human gamma-globin gene in human progenitor-derived erythroid cells.

    PubMed Central

    Miller, J L; Donahue, R E; Sellers, S E; Samulski, R J; Young, N S; Nienhuis, A W

    1994-01-01

    Effective gene therapy for the severe hemoglobin (Hb) disorders, sickle-cell anemia and thalassemia, will require an efficient method to transfer, integrate, and express a globin gene in primary erythroid cells. To evaluate recombinant adeno-associated virus (rAAV) for this purpose, we constructed a rAAV vector encoding a human gamma-globin gene (pJM24/vHS432A gamma). Its 4725-nucleotide genome consists of two 180-bp AAV inverted terminal repeats flanking the core elements of hypersensitive sites 2, 3, and 4 from the locus control region of the beta-globin gene cluster, linked to a mutationally marked A gamma-globin gene (A gamma) containing native promoter and RNA processing signals. CD34+ human hematopoietic cells were exposed to rAAV particles at a multiplicity of infection of 500-1000 and cultured in semisolid medium containing several cytokines. A reverse transcriptase polymerase chain reaction assay distinguished mRNA signals derived from transduced and endogenous human gamma-globin genes. Twenty to 40% of human erythroid burst-forming unit-derived colonies expressed the rAAV-transduced A gamma-globin gene at levels 4-71% that of the endogenous gamma-globin genes. The HbF content of pooled control colonies was 26%, whereas HbF was 40% of the total in pooled colonies derived from rAAV transduced progenitors. These data establish that rAAV containing elements from the locus control region linked to a gamma-globin gene are capable of transferring and expressing that gene in primary human hematopoietic cells resulting in a substantial increase in HbF content. Images PMID:7524085

  8. Erythroid progenitor cells (CFU-E*) from Friend virus-infected mice undergo VVFe suicide in vitro in the absence of added erythropoietin

    SciTech Connect

    Del Rizzo, D.F.; Axelrad, A.A.

    1985-11-01

    The authors have investigated the effect of VVFe on the survival in suspension of erythropoietin (epo)-independent erythroid progenitor cells (CFU-E*) induced by Friend polycythemia virus (FV). Spleen cells from C3Hf/Bi mice previously infected with FV were exposed to carrier-free VVFe, and the survival of CFU-E* as a function of time in liquid medium was determined from the number of erythroid colonies that developed from these cells seeded in plasma cultures without added epo. The results showed that spleen CFU-E* were highly vulnerable to VVFe. Marrow CFU-E* behaved in a similar manner. The VVFe responsible for their suicide had been presented to the progenitor cells only during the 4-h period of incubation, after which they were washed and plated in excess nonradioactive iron. They therefore conclude that CFU-E* themselves, and not only their progeny, are capable of actively incorporating iron. Under the same conditions in the absence of added epo, the effect of VVFe on the survival of normal spleen or marrow CFU-E could not be assessed because two few normal CFU-E survived the incubation period. Normal bone marrow cells incubated in complete medium containing epo retained their capacity for erythrocytic colony formation, and CFU-E could then be shown to be vulnerable to VVFe. Thus, either the iron-incorporating system of normal CFU-E was inducible by epo, or else epo permitted survival of the CFU-E so that the activity of a constitutive iron-incorporating system could be recognized.

  9. Efficacy of Rapamycin as Inducer of Hb F in Primary Erythroid Cultures from Sickle Cell Disease and β-Thalassemia Patients.

    PubMed

    Pecoraro, Alice; Troia, Antonio; Calzolari, Roberta; Scazzone, Concetta; Rigano, Paolo; Martorana, Adriana; Sacco, Massimiliano; Maggio, Aurelio; Di Marzo, Rosalba

    2015-01-01

    Phenotypic improvement of hemoglobinopathies such as sickle cell disease and β-thalassemia (β-thal) has been shown in patients with high levels of Hb F. Among the drugs proposed to increase Hb F production, hydroxyurea (HU) is currently the only one proven to improve the clinical course of these diseases. However, Hb F increase and patient's response are highly variable, indicating that new pharmacological agents could be useful for patients not responding to HU or showing a reduction of response during long-term therapy. In this study we evaluated the efficacy of rapamycin, a lypophilic macrolide used for the prevention of acute rejection in renal transplant recipients, as an inducer of Hb F production. The analyses were performed in cultured erythroid progenitors from 25 sickle cell disease and 25 β-thal intermedia (β-TI) patients. The use of a quantitative Real-Time-polymerase chain reaction ReTi-PCR technique and high performance liquid chromatography (HPLC) allowed us to determine the increase in γ-globin mRNA expression and Hb F production in human erythroid cells treated with rapamycin. The results of our study demonstrated an increase in vitro of γ-globin mRNA expression in 15 sickle cell disease and 14 β-TI patients and a corresponding Hb F increase. The induction by rapamycin, even if lower or similar in most of samples analyzed, in some cases was higher than HU. These data suggest that rapamycin could be a good candidate to be used in vivo for the treatment of hemoglobinopathies. PMID:26016899

  10. Disruption of nuclear factor (erythroid-derived-2)-like 2 antioxidant signaling: a mechanism for impaired activation of stem cells and delayed regeneration of skeletal muscle.

    PubMed

    Shelar, Sandeep Balu; Narasimhan, Madhusudhanan; Shanmugam, Gobinath; Litovsky, Silvio Hector; Gounder, Sellamuthu S; Karan, Goutam; Arulvasu, Cinnasamy; Kensler, Thomas W; Hoidal, John R; Darley-Usmar, Victor M; Rajasekaran, Namakkal S

    2016-05-01

    Recently we have reported that age-dependent decline in antioxidant levels accelerated apoptosis and skeletal muscle degeneration. Here, we demonstrate genetic ablation of the master cytoprotective transcription factor, nuclear factor (erythroid-derived-2)-like 2 (Nrf2), aggravates cardiotoxin (CTX)-induced tibialis anterior (TA) muscle damage. Disruption of Nrf2 signaling sustained the CTX-induced burden of reactive oxygen species together with compromised expression of antioxidant genes and proteins. Transcript/protein expression of phenotypic markers of muscle differentiation, namely paired box 7 (satellite cell) and early myogenic differentiation and terminal differentiation (myogenin and myosin heavy chain 2) were increased on d 2 and 4 postinjury but later returned to baseline levels on d 8 and 15 in wild-type (WT) mice. In contrast, these responses were persistently augmented in Nrf2-null mice suggesting that regulation of the regeneration-related signaling mechanisms require Nrf2 for normal functioning. Furthermore, Nrf2-null mice displayed slower regeneration marked by dysregulation of embryonic myosin heavy chain temporal expression. Histologic observations illustrated that Nrf2-null mice displayed smaller, immature TA muscle fibers compared with WT counterparts on d 15 after CTX injury. Improvement in TA muscle morphology and gain in muscle mass evident in the WT mice was not noticeable in the Nrf2-null animals. Taken together these data show that the satellite cell activation, proliferation, and differentiation requires a functional Nrf2 system for effective healing following injury.-Shelar, S. B., Narasimhan, M., Shanmugam, G., Litovsky, S. H., Gounder, S. S., Karan, G., Arulvasu, C., Kensler, T. W., Hoidal, J. R., Darley-Usmar, V. M., Rajasekaran, N. S. Disruption of nuclear factor (erythroid-derived-2)-like 2 antioxidant signaling: a mechanism for impaired activation of stem cells and delayed regeneration of skeletal muscle. PMID:26839378

  11. Kit transduced signals counteract erythroid maturation by MAPK-dependent modulation of erythropoietin signaling and apoptosis induction in mouse fetal liver

    PubMed Central

    Haas, N; Riedt, T; Labbaf, Z; Baßler, K; Gergis, D; Fröhlich, H; Gütgemann, I; Janzen, V; Schorle, H

    2015-01-01

    Signaling by the stem cell factor receptor Kit in hematopoietic stem and progenitor cells is functionally associated with the regulation of cellular proliferation, differentiation and survival. Expression of the receptor is downregulated upon terminal differentiation in most lineages, including red blood cell terminal maturation, suggesting that omission of Kit transduced signals is a prerequisite for the differentiation process to occur. However, the molecular mechanisms by which Kit signaling preserves the undifferentiated state of progenitor cells are not yet characterized in detail. In this study, we generated a mouse model for inducible expression of a Kit receptor carrying an activating mutation and studied its effects on fetal liver hematopoiesis. We found that sustained Kit signaling leads to expansion of erythroid precursors and interferes with terminal maturation beyond the erythroblast stage. Primary KITD816V erythroblasts stimulated to differentiate fail to exit cell cycle and show elevated rates of apoptosis because of insufficient induction of survival factors. They further retain expression of progenitor cell associated factors c-Myc, c-Myb and GATA-2 and inefficiently upregulate erythroid transcription factors GATA-1, Klf1 and Tal1. In KITD816V erythroblasts we found constitutive activation of the mitogen-activated protein kinase (MAPK) pathway, elevated expression of the src kinase family member Lyn and impaired Akt activation in response to erythropoietin. We demonstrate that the block in differentiation is partially rescued by MAPK inhibition, and completely rescued by the multikinase inhibitor Dasatinib. These results show that a crosstalk between Kit and erythropoietin receptor signaling cascades exists and that continuous Kit signaling, partly mediated by the MAPK pathway, interferes with this crosstalk. PMID:25323585

  12. Pure Culture Fermentation of Green Olives1

    PubMed Central

    Etchells, J. L.; Borg, A. F.; Kittel, I. D.; Bell, T. A.; Fleming, H. P.

    1966-01-01

    The method previously developed by us for the pure-culture fermentation of brined cucumbers and other vegetables has been applied successfully to Manzanillo variety olives. Field-run grade fruit was processed first by conventional procedures to remove most of the bitterness. Then the relative abilities of Lactobacillus plantarum, L. brevis, Pediococcus cerevisiae, and Leuconostoc mesenteroides to become established and produce acid in both heat-shocked (74 C for 3 min) and unheated olives, brined at 4.7 to 5.9% NaCl (w/v basis), were evaluated. The heat-shock treatment not only proved effective in ridding the fruit of naturally occurring, interfering, and competitive microbial groups prior to brining and inoculation, but also made the olives highly fermentable with respect to growth and acid production by the introduced culture, particularly L. plantarum. Of the four species used as inocula, L. plantarum was by far the most vigorous in fermentation ability. It consistently produced the highest levels of brine acidity (1.0 to 1.2% calculated as lactic acid) and the lowest pH values (3.8 to 3.9) during the fermentation of heat-shocked olives. Also, L. plantarum completely dominated fermentations when used in two-species (with P. cerevisiae) and three-species (with P. cerevisiae and L. brevis) combinations as inocula. In contrast, when L. plantarum was inoculated into the brines of unheated olives it failed to become properly established; the same was true for the other species tested, but even to a more pronounced degree. L. brevis was the only species used that failed to develop in brines of both heat-shocked and unheated olives. Modification of the curing brine by the addition of lactic acid at the outset, either with or without dextrose, led to a much earlier onset of fermentation with accompanying acid development, as compared to treatments with dextrose alone or nonadditive controls. Reasons for the marked improvement of the fermentability of Manzanillo olives

  13. Urinary tract infection - adults

    MedlinePlus

    Bladder infection - adults; UTI - adults; Cystitis - bacterial - adults; Pyelonephritis - adults; Kidney infection - adults ... to the hospital if you: Are an older adult Have kidney stones or changes in the anatomy ...

  14. Efficient decomposition of cosmic microwave background polarization maps into pure E, pure B, and ambiguous components

    SciTech Connect

    Bunn, Emory F.

    2011-04-15

    Separation of the B component of a cosmic microwave background (CMB) polarization map from the much larger E component is an essential step in CMB polarimetry. For a map with incomplete sky coverage, this separation is necessarily hampered by the presence of ambiguous modes which could be either E or B modes. I present an efficient pixel-space algorithm for removing the ambiguous modes and separating the map into pure E and B components. The method, which works for arbitrary geometries, does not involve generating a complete basis of such modes and scales the cube of the number of pixels on the boundary of the map.

  15. Physical and Spiritual Education within the Framework of Pure Life

    ERIC Educational Resources Information Center

    Bagheri Noaparast, Khosrow

    2013-01-01

    This paper aims at showing the dimensions of spirituality in childhood education by suggesting a new analysis of the concept of "pure life" used in the Qur'an. Putting spirituality in the framework of the pure life provides us with a rich framework in dealing with spirituality as the latter will be extended to all dimensions of a life. In the…

  16. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... applying the respective tolerances to the germination plus the hard seed and the pure seed. ... 7 Agriculture 3 2013-01-01 2013-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED...

  17. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... applying the respective tolerances to the germination plus the hard seed and the pure seed. ... 7 Agriculture 3 2010-01-01 2010-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED...

  18. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... applying the respective tolerances to the germination plus the hard seed and the pure seed. ... 7 Agriculture 3 2014-01-01 2014-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED...

  19. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... applying the respective tolerances to the germination plus the hard seed and the pure seed. ... 7 Agriculture 3 2011-01-01 2011-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED...

  20. 7 CFR 201.64 - Pure live seed.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... applying the respective tolerances to the germination plus the hard seed and the pure seed. ... 7 Agriculture 3 2012-01-01 2012-01-01 false Pure live seed. 201.64 Section 201.64 Agriculture..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) FEDERAL SEED ACT FEDERAL SEED...

  1. 1. SOUTH AND WEST ELEVATION OF ILLINOIS PURE ALUMINUM (IPA) ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. SOUTH AND WEST ELEVATION OF ILLINOIS PURE ALUMINUM (IPA) COMPANY FACTORY; SOUTH ELEVATION FACING ILLINOIS CENTRAL GULF RAILROAD TRACKS AND MAIN STREET. THE ONE-STORY BRICK BUILDING TO THE LEFT IS AN ABANDONED COMMONWEALTH EDISON COMPANY ELECTRICAL SUBSTATION. - Illinois Pure Aluminum Company, 109 Holmes Street, Lemont, Cook County, IL

  2. Auditory Repetition Priming Is Impaired in Pure Alexic Patients

    ERIC Educational Resources Information Center

    Swick, Diane; Miller, Kimberly M.; Larsen, Jary

    2004-01-01

    Alexia without agraphia, or ''pure'' alexia, is an acquired impairment in reading that leaves writing skills intact. Repetition priming for visually presented words is diminished in pure alexia. However, it is not possible to verify whether this priming deficit is modality-specific or modality independent because reading abilities are compromised.…

  3. Adult Strabismus

    MedlinePlus

    ... will likely improve the double vision and depth perception. Also, strabismus affects adults in emotional, social, and ... muscle surgery is usually not severe. Headache, pulling sensation with eye movement and foreign body sensation in ...

  4. Pure-state informationally complete and 'really' complete measurements

    SciTech Connect

    Finkelstein, J.

    2004-11-01

    I construct a positive-operator-valued measure (POVM) which has 2d rank-1 elements and which is informationally complete for generic pure states in d dimensions, thus confirming a conjecture made by Flammia, Silberfarb, and Caves (e-print quant-ph/0404137). I show that if a rank-1 POVM is required to be informationally complete for all pure states in d dimensions, it must have at least 3d-2 elements. I also show that, in a POVM which is informationally complete for all pure states in d dimensions, for any vector there must be at least 2d-1 POVM elements which do not annihilate that vector.

  5. Shunting arc plasma source for pure carbon ion beam.

    PubMed

    Koguchi, H; Sakakita, H; Kiyama, S; Shimada, T; Sato, Y; Hirano, Y

    2012-02-01

    A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA∕mm(2) at the peak of the pulse. PMID:22380206

  6. Shunting arc plasma source for pure carbon ion beama)

    NASA Astrophysics Data System (ADS)

    Koguchi, H.; Sakakita, H.; Kiyama, S.; Shimada, T.; Sato, Y.; Hirano, Y.

    2012-02-01

    A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA/mm2 at the peak of the pulse.

  7. Hyperfine-structure-induced purely long-range molecules.

    PubMed

    Enomoto, Katsunari; Kitagawa, Masaaki; Tojo, Satoshi; Takahashi, Yoshiro

    2008-03-28

    We have experimentally observed and theoretically identified a novel class of purely long-range molecules. This novel purely long-range state is formed due to a very weak hyperfine interaction that is usually treated only as a small perturbation in molecular spectra. Photoassociation spectroscopy of ultracold ytterbium (171Yb) atoms with the 1S0-3P1 intercombination transition presents clear identification of molecular states and the shallowest molecular potential depth of about 750 MHz among the purely long-range molecules ever observed. PMID:18517858

  8. Effect of humidity on fretting wear of several pure metals

    NASA Technical Reports Server (NTRS)

    Goto, H.; Buckley, D. H.

    1984-01-01

    Fretting wear experiments with several pure metals were conducted in air at various relative humidity levels. The materials used were iron, aluminum, copper, silver, chromium, titanium, and nickel. Each pure metal had a maximum fretting wear volume at a specific humidity level RH sub max that was not dependent on mechanical factors such as contact load, fretting amplitude, and frequency in the ranges studied. The weight loss due to fretting wear at RH sub max for each pure metal decreased with increasing heat of oxygen adsorption on the metal, indicating that adhesive wear dominated at RH sub max.

  9. Obstructive sleep apnea - adults

    MedlinePlus

    Sleep apnea - obstructive - adults; Apnea - obstructive sleep apnea syndrome - adults; Sleep-disordered breathing - adults; OSA - adults ... the upper airway for obstructive sleep apnea in adults. Sleep . 2010;33:1408-1413. PMID: 21061864 www. ...

  10. Differential effect of pure isoflavones and soymilk on estrogen receptor activity in mice

    SciTech Connect

    Rando, Gianpaolo; Ramachandran, Balaji; Rebecchi, Monica; Ciana, Paolo; Maggi, Adriana

    2009-06-15

    Background: Because of the complexity of estrogen receptor (ER) physiological activity, the interaction of pure isoflavones or soy-based diets on ER needs to be clearly demonstrated. Objectives: To investigate the effects of the administration of isoflavones as a pure compound or as a component of diet on the ER transcriptional activity in adult mice. Methods: Effects of acute (6 h) and chronic (21 days) oral administration of soy milk, pure genistein and a mix of genistein and daidzein was studied in living ERE-Luc mice. In this animal model, the synthesis of luciferase is under the state of ER transcriptional activity. Luciferase activity was measured in living mice by daily bioluminescence imaging sessions and in tissue extracts by enzymatic assay. Results: Acute, oral administration of genistein or soymilk caused a significant increase of ER activity in liver. In a 20 day long treatment, soymilk was more potent than genistein in liver and appeared to extend its influence on ER transcriptional activity in other tissues, such as the digestive tract. A mixture of pure genistein and daidzein at the same concentration as in soymilk failed to induce significant changes during acute and chronic studies suggesting an important, uncharacterized role of the soymilk matrix. Consistent with this observation, synergistic effects of the matrix plus isoflavones were observed in MCF-7 cells stably transfected with the ERE-luc construct. Conclusions: This study underlines the limitations of the analysis of single food components in the evaluation of their effects on estrogen receptor activity and advocates the necessity to use complex organisms for the full comprehension of the effects of compounds altering the endocrine balance.

  11. Melding Technology and Pure Science in the Bronx

    ERIC Educational Resources Information Center

    Edgecombe, Wallace

    1977-01-01

    Describes the science education improvement project at Hostos Community College (New York). The curriculum consists of a melding of technology and pure science, based on the premise that "science-poor" societies should give priority to applied science education. (JDS)

  12. Pure gonadal dysgenesis (46 XX type) with a familial pattern.

    PubMed

    Kohmanaee, Shahin; Dalili, Setila; Rad, Afagh Hassanzadeh

    2015-01-01

    46, XX gonadal dysgenesis without the phenotype of Turner's syndrome is described as "pure". Although, previous investigations obtained that commonly gonadal dysgenesis did not cause breast development as a result of low levels of circulating estradiol. However, in this study, we aimed to report a familial pure gonadal dysgenesis with and without normal secondary sexual characteristics. In this study, we reported three siblings with pure gonadal dysgenesis with and without normal secondary sexual characteristics. The elder two sisters had a normal female phenotype and the youngest had amenorrhea with no breast development (B1) and pubic hair. In addition, it seems that the absence of pubic hair occurred due to delayed constitutional puberty. According to results, it seems that clinicians should consider different presentations for pure gonadal dysgenesis with familial pattern. PMID:26430655

  13. Typical pure nonequilibrium steady states and irreversibility for quantum transport.

    PubMed

    Monnai, Takaaki; Yuasa, Kazuya

    2016-07-01

    It is known that each single typical pure state in an energy shell of a large isolated quantum system well represents a thermal equilibrium state of the system. We show that such typicality holds also for nonequilibrium steady states (NESS's). We consider a small quantum system coupled to multiple infinite reservoirs. In the long run, the total system reaches a unique NESS. We identify a large Hilbert space from which pure states of the system are to be sampled randomly and show that the typical pure states well describe the NESS. We also point out that the irreversible relaxation to the unique NESS is important to the typicality of the pure NESS's. PMID:27575115

  14. Single-electron coherence: Finite temperature versus pure dephasing

    NASA Astrophysics Data System (ADS)

    Moskalets, Michael; Haack, Géraldine

    2016-01-01

    We analyze a coherent injection of single electrons on top of the Fermi sea in two situations, at finite-temperature and in the presence of pure dephasing. Both finite-temperature and pure dephasing change the property of the injected quantum states from pure to mixed. However, we show that the temperature-induced mixedness does not alter the coherence properties of these single-electron states. In particular two such mixed states exhibit perfect antibunching while colliding at an electronic wave splitter. This is in striking difference with the dephasing-induced mixedness which suppresses antibunching. On the contrary, a single-particle shot noise is suppressed at finite temperatures but is not affected by pure dephasing. This work therefore extends the investigation of the coherence properties of single-electron states to the case of mixed states and clarifies the difference between different types of mixedness.

  15. The theoretical polarization of pure scattering axisymmetric circumstellar envelopes

    NASA Technical Reports Server (NTRS)

    Fox, G. K.

    1994-01-01

    The Sobolev approach to the scattering of starlight through a pure scattering circumstellar envelope is developed. The theoretical polarization due to electron scattering in Be star envelopes is calculated for two geometries (an equatorially enhanced envelope and a spheroidal envelope). Only the disk-type envelope is found to yield a maximum polarization consistent with the observed range for Be stars. A lower limit, analytical approximation to the theoretical polarization from a pure scattering envelope is obtained.

  16. Newborn's Motor Response to Pure-Tone Stimulation.

    ERIC Educational Resources Information Center

    Olsho, Lynne Werner; Gillenwater, Jay M.

    The effects of pure tone stimulation on ongoing motor activity of infants 1 to 4 days of age were studied using a passive, contactless monitoring device. Stimuli were pure tone bursts of 0.5, 1, and 4 kHz presented free field at an approximate level of 70 dB A. Signal trials consisted of 500 ms tone bursts, with rise/fall time equal to 10 ms, and…

  17. Physics of pure and non-pure positron emitters for PET: a review and a discussion.

    PubMed

    Conti, Maurizio; Eriksson, Lars

    2016-12-01

    With the increased interest in new PET tracers, gene-targeted therapy, immunoPET, and theranostics, other radioisotopes will be increasingly used in clinical PET scanners, in addition to (18)F. Some of the most interesting radioisotopes with prospective use in the new fields are not pure short-range β(+) emitters but can be associated with gamma emissions in coincidence with the annihilation radiation (prompt gamma), gamma-gamma cascades, intense Bremsstrahlung radiation, high-energy positrons that may escape out of the patient skin, and high-energy gamma rays that result in some e (+)/e (-) pair production. The high level of sophistication in data correction and excellent quantitative accuracy that has been reached for (18)F in recent years can be questioned by these effects. In this work, we review the physics and the scientific literature and evaluate the effect of these additional phenomena on the PET data for each of a series of radioisotopes: (11)C, (13)N, (15)O, (18)F, (64)Cu, (68)Ga, (76)Br, (82)Rb, (86)Y, (89)Zr, (90)Y, and (124)I. In particular, we discuss the present complications arising from the prompt gammas, and we review the scientific literature on prompt gamma correction. For some of the radioisotopes considered in this work, prompt gamma correction is definitely needed to assure acceptable image quality, and several approaches have been proposed in recent years. Bremsstrahlung photons and (176)Lu background were also evaluated. PMID:27271304

  18. Pure-tone birdsong by resonance filtering of harmonic overtones

    PubMed Central

    Beckers, Gabriël J. L.; Suthers, Roderick A.; Cate, Carel ten

    2003-01-01

    Pure-tone song is a common and widespread phenomenon in birds. The mechanistic origin of this type of phonation has been the subject of long-standing discussion. Currently, there are three hypotheses. (i) A vibrating valve in the avian vocal organ, the syrinx, generates a multifrequency harmonic source sound, which is filtered to a pure tone by a vocal tract filter (“source-filter” model, analogous to human speech production). (ii) Vocal tract resonances couple with a vibrating valve source, suppressing the normal production of harmonic overtones at this source (“soprano” model, analogous to human soprano singing). (iii) Pure-tone sound is produced as such by a sound-generating mechanism that is fundamentally different from a vibrating valve. Here we present direct evidence of a source-filter mechanism in the production of pure-tone birdsong. Using tracheal thermistors and air sac pressure cannulae, we recorded sound signals close to the syringeal sound source during spontaneous, pure-tone vocalizations of two species of turtledove. The results show that pure-tone dove vocalizations originate through filtering of a multifrequency harmonic sound source. PMID:12764226

  19. Chromosome 12p abnormalities and IMP3 expression in prepubertal pure testicular teratomas.

    PubMed

    Cornejo, Kristine M; Cheng, Liang; Church, Alanna; Wang, Mingsheng; Jiang, Zhong

    2016-03-01

    Although the histologic appearance of pure testicular teratomas (PTTs) is similar in children and adults, the prognosis is dramatically different. Prepubertal PTTs are rare, with a benign clinical course, whereas the adult cases typically have malignant outcomes. Chromosome 12p abnormalities are seen in most adult testicular germ cell tumors but have not been found in prepubertal PTTs. IMP3 is an oncofetal protein that is highly expressed in many malignancies. Recently, we demonstrated IMP3 is expressed in adult mature testicular teratomas but not in mature ovarian teratomas. The aim of this study was to evaluate prepubertal PTTs for chromosome 12p abnormalities and expression of IMP3. A total of 11 cases (excision, n=1; orchiectomy, n=10) were obtained from the surgical pathology archives of 2 large medical centers (1957-2013). All 11 cases were investigated for isochromosome 12p and 12p copy number gain using interphase fluorescence in situ hybridization analysis and were examined by immunohistochemistry for IMP3 expression. Patients ranged in age from 0.9 to 7.0 (mean, 2.4) years. A positive immunohistochemical stain for IMP3 (cytoplasmic staining) was identified in 5 (46%) of 11 cases. Isochromosome 12p was detected in 2 cases (18%) that also expressed IMP3. Somatic copy number alterations of 12p were not observed (0%). We are the first to describe 12p abnormalities and IMP3 expression in prepubertal PTTs. Our data demonstrate a small subset of PTTs harbor typical molecular alterations observed in adult testicular germ cell tumors. Although prepubertal PTTs are considered to be benign neoplasms, it may be a heterogeneous group. PMID:26826410

  20. Integrative genomic analysis in K562 chronic myelogenous leukemia cells reveals that proximal NCOR1 binding positively regulates genes that govern erythroid differentiation and Imatinib sensitivity

    PubMed Central

    Long, Mark D.; van den Berg, Patrick R.; Russell, James L.; Singh, Prashant K.; Battaglia, Sebastiano; Campbell, Moray J.

    2015-01-01

    To define the functions of NCOR1 we developed an integrative analysis that combined ENCODE and NCI-60 data, followed by in vitro validation. NCOR1 and H3K9me3 ChIP-Seq, FAIRE-seq and DNA CpG methylation interactions were related to gene expression using bootstrapping approaches. Most NCOR1 combinations (24/44) were associated with significantly elevated level expression of protein coding genes and only very few combinations related to gene repression. DAVID's biological process annotation revealed that elevated gene expression was uniquely associated with acetylation and ETS binding. A matrix of gene and drug interactions built on NCI-60 data identified that Imatinib significantly targeted the NCOR1 governed transcriptome. Stable knockdown of NCOR1 in K562 cells slowed growth and significantly repressed genes associated with NCOR1 cistrome, again, with the GO terms acetylation and ETS binding, and significantly dampened sensitivity to Imatinib-induced erythroid differentiation. Mining public microarray data revealed that NCOR1-targeted genes were significantly enriched in Imatinib response gene signatures in cell lines and chronic myelogenous leukemia (CML) patients. These approaches integrated cistrome, transcriptome and drug sensitivity relationships to reveal that NCOR1 function is surprisingly most associated with elevated gene expression, and that these targets, both in CML cell lines and patients, associate with sensitivity to Imatinib. PMID:26117541

  1. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    PubMed Central

    Chico, Lucia; Borgia, Loredana; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  2. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    PubMed

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  3. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    PubMed Central

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients. PMID:27274779

  4. Disruption of a novel regulatory element in the erythroid-specific promoter of the human PKLR gene causes severe pyruvate kinase deficiency.

    PubMed

    van Wijk, Richard; van Solinge, Wouter W; Nerlov, Claus; Beutler, Ernest; Gelbart, Terri; Rijksen, Gert; Nielsen, Finn C

    2003-02-15

    We established the molecular basis for pyruvate kinase (PK) deficiency in a white male patient with severe nonspherocytic hemolytic anemia. The paternal allele exhibited the common PKLR cDNA sequence (c.) 1529G>A mutation, known to be associated with PK deficiency. On the maternal allele, 3 in cis mutations were identified in the erythroid-specific promoter region of the gene: one deletion of thymine -248 and 2 single nucleotide substitutions, nucleotide (nt) -324T>A and nt -83G>C. Analysis of the patient's RNA demonstrated the presence of only the 1529A allele, indicating severely reduced transcription from the allele linked to the mutated promoter region. Transfection of promoter constructs into erythroleukemic K562 cells showed that the most upstream -324T>A and -248delT mutations were nonfunctional polymorphisms. In contrast, the -83G>C mutation strongly reduced promoter activity. Site-directed mutagenesis of the promoter region revealed the presence of a putative regulatory element (PKR-RE1) whose core binding motif, CTCTG, is located between nt -87 and nt -83. Electrophoretic mobility shift assay using K562 nuclear extracts indicated binding of an as-yet-unidentified trans-acting factor. This novel element mediates the effects of factors necessary for regulation of pyruvate kinase gene expression during red cell differentiation and maturation. PMID:12393511

  5. Suppression of nuclear factor erythroid 2-related factor 2 via extracellular signal-regulated kinase contributes to bleomycin-induced oxidative stress and fibrogenesis.

    PubMed

    Liu, Rui; Chen, Hongli; Bai, Hua; Zhang, Wei; Wang, Xin; Qin, Xujun; Zhang, Xiaodi; Li, Wenli; Liang, Xin; Hai, Chunxu

    2013-06-20

    Pulmonary fibrosis is a serious and irreversible lung injury with obscure etiologic mechanisms and no effective treatment to date. This study explored a crucial link between oxidative stress and pulmonary fibrogenesis, focusing on nuclear factor erythroid 2-related factor 2 (Nrf2), a core transcription factor in antioxidative regulation systems. Treatment of C57 BL/6 mice with bleomycin increased fibroblast viability and collagen production and significantly downregulated Nrf2. In addition, prominent oxidative stress was indicated by changes in superoxide dismutase, catalase activity, and glutathione and thiobarbituric acid-reactive substance levels. In a cell-based model, bleomycin suppressed Nrf2 activation via extracellular signal-related kinase phosphorylation, enhancing intracellular reactive oxygen species in lung fibroblasts and stimulating abnormal cell proliferation and collagen secretion. To confirm this novel mechanism of bleomycin-induced fibrogenesis, we attempted to upregulate Nrf2 and related antioxidant proteins in bleomycin-treated fibroblasts using a putative Nrf2 activator, caffeic acid phenethyl ester, and the results showed that bleomycin-induced fibroblast proliferation and collagen content were attenuated through improved redox balance. Collectively, these results disclose a potential regulatory mechanism in pulmonary fibrosis that will aid the development of new therapies. PMID:23570914

  6. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds.

    PubMed

    Denzer, Isabel; Münch, Gerald; Friedland, Kristina

    2016-01-01

    Oxidative stress and mitochondrial dysfunction are early events in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Mitochondria are important key players in cellular function based on mitochondrial energy production and their major role in cell physiology. Since neurons are highly depending on mitochondrial energy production due to their high energy demand and their reduced glycolytic capacity mitochondrial dysfunction has fatal consequences for neuronal function and survival. The transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2) is the major regulator of cellular response to oxidative stress. Activation of Nrf2 induces the transcriptional regulation of antioxidant response element (ARE)-dependent expression of a battery of cytoprotective and antioxidant enzymes and proteins. Moreover, activation of Nrf2 protects mitochondria from dysfunction and promotes mitochondrial biogenesis. Therefore, the Nrf2/ARE pathway has become an attractive target for the prevention and treatment of oxidative stress-related neurodegenerative diseases. Small food-derived inducers of the Nrf2/ARE pathway including l-sulforaphane from broccoli and isoliquiritigenin from licorice displayed promising protection of mitochondrial function in models of oxidative stress and neurodegenerative diseases and represent a novel approach to prevent and treat aging-associated neurodegenerative diseases. PMID:26626189

  7. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  8. Immunohistochemical expression of nuclear factor erythroid-2-related factor 2 and heme oxygenase 1 in normal bovine lung and bovine lung infected with Mannheimia haemolytica

    PubMed Central

    Moussa, Amira Talaat; Singh, Baljit; Al-Dissi, Ahmad N.

    2015-01-01

    Mannheimia haemolytica is an important cause of pneumonia in feedlot cattle. Nuclear factor erythroid-2-related factor 2 (Nrf2) is a redox-sensitive transcription factor responsible for the induction of antioxidant enzymes, such as heme oxygenase 1 (HO-1), within the lung. The expression of Nrf2 and HO-1 was immunohistochemically evaluated in 4 calves 24 h after experimental infection with M. haemolytica. Calves receiving normal saline served as controls. In the infected lungs, cytoplasmic Nrf2 expression was high in macrophages and bronchioles and low in alveolar epithelium, whereas nuclear expression was high in endothelial cells, macrophages, and bronchioles and lowest in alveolar epithelium. Normal lung samples displayed only faint Nrf2 cytoplasmic staining within bronchiolar epithelium. Expression of HO-1 was detected within the cytoplasm of macrophages and bronchiolar epithelial cells in all infected lung samples, whereas normal lungs displayed only weak cytoplasmic staining in bronchiolar epithelial cells. These findings suggest that bronchiolar epithelial cells and macrophages up-regulate Nrf2 expression early in the course of infection, which results in increased expression of HO-1 within these cells. PMID:25852222

  9. A small single-"finger" peptide from the erythroid transcription factor GATA-1 binds specifically to DNA as a zinc or iron complex.

    PubMed

    Omichinski, J G; Trainor, C; Evans, T; Gronenborn, A M; Clore, G M; Felsenfeld, G

    1993-03-01

    Sequence-specific DNA binding has been demonstrated for a synthetic peptide comprising only one of the two "finger"-like domains of the erythroid transcription factor GATA-1 (also termed Eryf-1, NF-E1, or GF-1). Quantitative analysis of gel-retardation assays yields a specific association constant of 1.2 x 10(8) M, compared with values of about 10(9) M for the full-length natural GATA-1 protein. By the use of peptides of various lengths, it was possible to delineate the smallest region necessary for specific binding. A single C-terminal finger of the double-finger motif is necessary but not sufficient for sequence-specific interaction. Basic amino acids located C-terminal to the finger (some more than 20 amino acids away) are also essential for tight binding. In addition to demonstrating that zinc is important for the formation of an active binding complex, we show that other ions, notably Fe2+, can fulfill this role. Our results make it clear that the GATA-1 metal binding motif is quite distinct from that found in the steroid hormone family and that GATA-1 is a member of a separate class of DNA binding proteins. PMID:8446581

  10. Nuclear Factor Erythroid 2-Related Factor 2 Drives Podocyte-Specific Expression of Peroxisome Proliferator-Activated Receptor γ Essential for Resistance to Crescentic GN.

    PubMed

    Henique, Carole; Bollee, Guillaume; Lenoir, Olivia; Dhaun, Neeraj; Camus, Marine; Chipont, Anna; Flosseau, Kathleen; Mandet, Chantal; Yamamoto, Masayuki; Karras, Alexandre; Thervet, Eric; Bruneval, Patrick; Nochy, Dominique; Mesnard, Laurent; Tharaux, Pierre-Louis

    2016-01-01

    Necrotizing and crescentic rapidly progressive GN (RPGN) is a life-threatening syndrome characterized by a rapid loss of renal function. Evidence suggests that podocyte expression of the transcription factor peroxisome proliferator-activated receptor γ (PPARγ) may prevent podocyte injury, but the function of glomerular PPARγ in acute, severe inflammatory GN is unknown. Here, we observed marked loss of PPARγ abundance and transcriptional activity in glomerular podocytes in experimental RPGN. Blunted expression of PPARγ in podocyte nuclei was also found in kidneys from patients diagnosed with crescentic GN. Podocyte-specific Pparγ gene targeting accentuated glomerular damage, with increased urinary loss of albumin and severe kidney failure. Furthermore, a PPARγ gain-of-function approach achieved by systemic administration of thiazolidinedione (TZD) failed to prevent severe RPGN in mice with podocyte-specific Pparγ gene deficiency. In nuclear factor erythroid 2-related factor 2 (NRF2)-deficient mice, loss of podocyte PPARγ was observed at baseline. NRF2 deficiency markedly aggravated the course of RPGN, an effect that was partially prevented by TZD administration. Furthermore, delayed administration of TZD, initiated after the onset of RPGN, still alleviated the severity of experimental RPGN. These findings establish a requirement for the NRF2-PPARγ cascade in podocytes, and we suggest that these transcription factors have a role in augmenting the tolerance of glomeruli to severe immune-complex mediated injury. The NRF2-PPARγ pathway may be a therapeutic target for RPGN. PMID:25999406

  11. Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder.

    PubMed

    Tepakhan, Wanicha; Yamsri, Supawadee; Sanchaisuriya, Kanokwan; Fucharoen, Goonnapa; Xu, Xiangmin; Fucharoen, Supan

    2016-07-01

    Hemoglobin E is the most common Hb variant found in South East Asia. Variation of Hb F expression in Hb E syndrome is associated with several genetic modifiers. We report several single nucleotide polymorphisms (SNPs), including nine known and five novel mutations of the Krüppel-like factor 1 (KLF1; an erythroid specific transcription factor) gene and determine their associations with phenotypic expression of Hb F in Hb E disorders. KLF1 mutations were examined using high resolution melting (HRM) assay and DNA sequencing in 575 homozygous Hb E, 278 heterozygous Hb E and 100 normal subjects. Fourteen mutations were mostly observed in subjects with elevated Hb F, including nine known mutations (G176AfsX179, T334R, R238H, -154 (C>T), A298P, S270W, R301H, -148 (G>A) and G335R and five novel mutations (Q217X, Q223X, Y290_S293del, K307N, and M358I). None of them, but the -148 (G>A), were observed in normal controls to have Hb F <1%. Combined KLF1 mutations with other SNPs including (G)γ-XmnI, BCL11A and HBS1L-MYB were associated with higher Hb F levels. KLF1 is therefore an important genetic factor associated with increased Hb F and in combination with other modifying factors could explain the phenotypic variation of Hb F expression in this common hemoglobinopathy. PMID:27282573

  12. Nuclear Factor Erythroid 2-Related Factor 2 Down-Regulation in Oral Neutrophils Is Associated with Periodontal Oxidative Damage and Severe Chronic Periodontitis.

    PubMed

    Sima, Corneliu; Aboodi, Guy M; Lakschevitz, Flavia S; Sun, Chunxiang; Goldberg, Michael B; Glogauer, Michael

    2016-06-01

    The balance between reactive oxygen species and antioxidants plays an important role in periodontal health. We previously demonstrated that high reactive oxygen species production by oral polymorphonuclear neutrophils (oPMNs) in chronic periodontitis (CP) refractory to conventional therapy is associated with severe destruction of periodontium. Herein, we show that inhibition of antioxidant production through down-regulation of nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in oPMN, despite enhanced recruitment in the oral cavity, is associated with severe CP. Twenty-four genes in the Nrf2-mediated oxidative stress response pathway were down-regulated in PMNs of diseased patients. Downstream of Nrf2, levels of oPMN superoxide dismutase 1 and catalase were decreased in severe CP, despite increased recruitment. Nrf2(-/-) mice had more severe loss of periodontium in response to periodontitis-inducing subgingival ligatures compared with wild-types. Levels of 8-hydroxy-deoxyguanosine were increased in periodontal lesions of Nrf2(-/-) mice, indicating high oxidative damage. We report, for the first time, Nrf2 pathway down-regulation in oPMNs of patients with severe CP. PMNs of CP patients may be primed for low antioxidant response in the context of high recruitment in the oral cavity, resulting in increased oxidative tissue damage. PMID:27070823

  13. Adult Play.

    ERIC Educational Resources Information Center

    Charles, John M.

    In its broadest context, play can be interpreted as any pleasurable use of discretionary time. Playfulness is an intrinsic feature of being human, and should be viewed in the light of a total lifestyle, not as an occurrence in an isolated time of life. Adult play appears to be an indefinable and controversial concept. A holistic approach should be…

  14. CPR: Adult

    MedlinePlus Videos and Cool Tools

    Refresher Center Home FIRST AID, CPR and AED LIFEGUARDING Refresher Putting It All Together: CPR—Adult (2:03) Refresher videos only utilize this player QUICK LINKS Home RedCross.org Purchase Course Materials Shop Our Store ...

  15. Redefining dermatomyositis: a description of new diagnostic criteria that differentiate pure dermatomyositis from overlap myositis with dermatomyositis features.

    PubMed

    Troyanov, Yves; Targoff, Ira N; Payette, Marie-Pier; Raynauld, Jean-Pierre; Chartier, Suzanne; Goulet, Jean-Richard; Bourré-Tessier, Josiane; Rich, Eric; Grodzicky, Tamara; Fritzler, Marvin J; Joyal, France; Koenig, Martial; Senécal, Jean-Luc

    2014-11-01

    Dermatomyositis (DM) is a major clinical subset of autoimmune myositis (AIM). The characteristic DM rash (Gottron papules, heliotrope rash) and perifascicular atrophy at skeletal muscle biopsy are regarded as specific features for this diagnosis. However, new concepts are challenging the current definition of DM. A modified Bohan and Peter classification of AIM was proposed in which the core concept was the inclusion of the diagnostic significance of overlap connective tissue disease features. In this clinical classification, a DM rash in association with myositis in the absence of overlap features indicates a diagnosis of pure DM. However, overlap features in association with myositis allow a diagnosis of overlap myositis (OM), irrespective of the presence or absence of the DM rash. Perifascicular atrophy may be present in both pure DM and OM. Recently, the presence of perifascicular atrophy in myositis without a DM rash was proposed as diagnostic of a novel entity, adermatopathic DM. We conducted the present study to evaluate these new concepts to further differentiate pure DM from OM.Using the modified Bohan and Peter classification, we performed a follow-up study of a longitudinal cohort of 100 consecutive adult French Canadian patients with AIM, including 44 patients with a DM phenotype, defined as a DM rash, and/or DM-type calcinosis, and/or the presence of perifascicular atrophy on muscle biopsy. A detailed evaluation was performed for overlap features, the extent and natural history of the DM rash, adermatopathic DM, DM-specific and overlap autoantibodies by protein A immunoprecipitation on coded serum samples, and associations with cancer and survival.Two distinct subsets were identified in patients with a DM phenotype: pure DM (n = 24) and OM with DM features, or OMDM (n = 20). In pure DM, the DM rash was a dominant finding. It was the first disease manifestation, was always present at the time of myositis diagnosis, and was associated with a high

  16. Pure Oats as Part of the Canadian Gluten-Free Diet in Celiac Disease: The Need to Revisit the Issue

    PubMed Central

    de Souza, M. Cristina P.; Deschênes, Marie-Eve; Laurencelle, Suzanne; Godet, Patrick; Roy, Claude C.; Djilali-Saiah, Idriss

    2016-01-01

    The question about recommending pure, noncontaminated oats as part of the gluten-free diet of patients with celiac disease remains controversial. This might be due to gluten cross contamination and to the possible immunogenicity of some oat cultivars. In view of this controversy, a review of the scientific literature was conducted to highlight the latest findings published between 2008 and 2014 to examine the current knowledge on oats safety and celiac disease in Europe and North America. Results showed that regular oats consumed in Canada are largely contaminated. Overall, the consumption of pure oats has been generally considered to be safe for adults and children. However, it appears that some oat cultivars may trigger an immune response in sensitive individuals. Therefore, further long-term studies on the impact of consumption of oats identifying the cultivar(s) constitute an important step forward for drawing final recommendations. Furthermore, a closer and more accurate monitoring of the dietary intake of noncontaminated oats would be paramount to better determine what its actual contribution in the gluten-free diet of adults and children with celiac disease are in order to draw sound recommendations on the safety of pure oats as part of the gluten-free diet. PMID:27446824

  17. Pure Oats as Part of the Canadian Gluten-Free Diet in Celiac Disease: The Need to Revisit the Issue.

    PubMed

    de Souza, M Cristina P; Deschênes, Marie-Eve; Laurencelle, Suzanne; Godet, Patrick; Roy, Claude C; Djilali-Saiah, Idriss

    2016-01-01

    The question about recommending pure, noncontaminated oats as part of the gluten-free diet of patients with celiac disease remains controversial. This might be due to gluten cross contamination and to the possible immunogenicity of some oat cultivars. In view of this controversy, a review of the scientific literature was conducted to highlight the latest findings published between 2008 and 2014 to examine the current knowledge on oats safety and celiac disease in Europe and North America. Results showed that regular oats consumed in Canada are largely contaminated. Overall, the consumption of pure oats has been generally considered to be safe for adults and children. However, it appears that some oat cultivars may trigger an immune response in sensitive individuals. Therefore, further long-term studies on the impact of consumption of oats identifying the cultivar(s) constitute an important step forward for drawing final recommendations. Furthermore, a closer and more accurate monitoring of the dietary intake of noncontaminated oats would be paramount to better determine what its actual contribution in the gluten-free diet of adults and children with celiac disease are in order to draw sound recommendations on the safety of pure oats as part of the gluten-free diet. PMID:27446824

  18. ADULT EDUCATION OF MIGRANT ADULTS.

    ERIC Educational Resources Information Center

    BEAL, CATHERINE; AND OTHERS

    UNITS ON MIGRANT ADULT EDUCATION, AND A UNIT ON ORGANIZING INFORMAL GROUPS OF MIGRANT WOMEN TO DISCUSS MAINTAINING AND IMPROVING THEIR TEMPORARY HOMES, ARE PRESENTED. THE GOALS OF THE UNIT ON EDUCATION FOR MIGRANT MEN ARE ECONOMIC INDEPENDENCE, BETTER HEALTH AND WELL-BEING, AND BETTER HANDLING OF RESPONSIBILITIES. THE MAIN DIVISIONS OF THE…

  19. Fisher-Symmetric Informationally Complete Measurements for Pure States

    NASA Astrophysics Data System (ADS)

    Li, Nan; Ferrie, Christopher; Gross, Jonathan A.; Kalev, Amir; Caves, Carlton M.

    2016-05-01

    We introduce a new kind of quantum measurement that is defined to be symmetric in the sense of uniform Fisher information across a set of parameters that uniquely represent pure quantum states in the neighborhood of a fiducial pure state. The measurement is locally informationally complete—i.e., it uniquely determines these parameters, as opposed to distinguishing two arbitrary quantum states—and it is maximal in the sense of a multiparameter quantum Cramér-Rao bound. For a d -dimensional quantum system, requiring only local informational completeness allows us to reduce the number of outcomes of the measurement from a minimum close to but below 4 d -3 , for the usual notion of global pure-state informational completeness, to 2 d -1 .

  20. Excitation of coherent propagating spin waves by pure spin currents

    NASA Astrophysics Data System (ADS)

    Demidov, Vladislav E.; Urazhdin, Sergei; Liu, Ronghua; Divinskiy, Boris; Telegin, Andrey; Demokritov, Sergej O.

    2016-01-01

    Utilization of pure spin currents not accompanied by the flow of electrical charge provides unprecedented opportunities for the emerging technologies based on the electron's spin degree of freedom, such as spintronics and magnonics. It was recently shown that pure spin currents can be used to excite coherent magnetization dynamics in magnetic nanostructures. However, because of the intrinsic nonlinear self-localization effects, magnetic auto-oscillations in the demonstrated devices were spatially confined, preventing their applications as sources of propagating spin waves in magnonic circuits using these waves as signal carriers. Here, we experimentally demonstrate efficient excitation and directional propagation of coherent spin waves generated by pure spin current. We show that this can be achieved by using the nonlocal spin injection mechanism, which enables flexible design of magnetic nanosystems and allows one to efficiently control their dynamic characteristics.

  1. Excitation of coherent propagating spin waves by pure spin currents.

    PubMed

    Demidov, Vladislav E; Urazhdin, Sergei; Liu, Ronghua; Divinskiy, Boris; Telegin, Andrey; Demokritov, Sergej O

    2016-01-01

    Utilization of pure spin currents not accompanied by the flow of electrical charge provides unprecedented opportunities for the emerging technologies based on the electron's spin degree of freedom, such as spintronics and magnonics. It was recently shown that pure spin currents can be used to excite coherent magnetization dynamics in magnetic nanostructures. However, because of the intrinsic nonlinear self-localization effects, magnetic auto-oscillations in the demonstrated devices were spatially confined, preventing their applications as sources of propagating spin waves in magnonic circuits using these waves as signal carriers. Here, we experimentally demonstrate efficient excitation and directional propagation of coherent spin waves generated by pure spin current. We show that this can be achieved by using the nonlocal spin injection mechanism, which enables flexible design of magnetic nanosystems and allows one to efficiently control their dynamic characteristics. PMID:26818232

  2. Pure gonadal dysgenesis (46 XX type) with a familial pattern

    PubMed Central

    Kohmanaee, Shahin; Dalili, Setila; Rad, Afagh Hassanzadeh

    2015-01-01

    46, XX gonadal dysgenesis without the phenotype of Turner's syndrome is described as “pure”. Although, previous investigations obtained that commonly gonadal dysgenesis did not cause breast development as a result of low levels of circulating estradiol. However, in this study, we aimed to report a familial pure gonadal dysgenesis with and without normal secondary sexual characteristics. In this study, we reported three siblings with pure gonadal dysgenesis with and without normal secondary sexual characteristics. The elder two sisters had a normal female phenotype and the youngest had amenorrhea with no breast development (B1) and pubic hair. In addition, it seems that the absence of pubic hair occurred due to delayed constitutional puberty. According to results, it seems that clinicians should consider different presentations for pure gonadal dysgenesis with familial pattern. PMID:26430655

  3. Fisher-Symmetric Informationally Complete Measurements for Pure States.

    PubMed

    Li, Nan; Ferrie, Christopher; Gross, Jonathan A; Kalev, Amir; Caves, Carlton M

    2016-05-01

    We introduce a new kind of quantum measurement that is defined to be symmetric in the sense of uniform Fisher information across a set of parameters that uniquely represent pure quantum states in the neighborhood of a fiducial pure state. The measurement is locally informationally complete-i.e., it uniquely determines these parameters, as opposed to distinguishing two arbitrary quantum states-and it is maximal in the sense of a multiparameter quantum Cramér-Rao bound. For a d-dimensional quantum system, requiring only local informational completeness allows us to reduce the number of outcomes of the measurement from a minimum close to but below 4d-3, for the usual notion of global pure-state informational completeness, to 2d-1. PMID:27203310

  4. Single biphoton ququarts as either pure or mixed states

    SciTech Connect

    Fedorov, M. V.; Volkov, P. A.; Mikhailova, J. M.

    2011-09-15

    We analyze features of mixed biphoton polarization states, which arise from pure states of polarization-frequency biphoton ququarts after averaging over frequencies of photons. For mixed states, we find their concurrence C, Schmidt parameter K, degree of polarization P, as well as the von Neumann mutual information I. In some simple cases, we also find the relative entropy S{sub rel} and the degree of classical correlations C{sub cl}. In mixed states, the Schmidt parameter does not characterize the degree of entanglement anymore, as it does in pure states. Nevertheless, the Schmidt parameter remains useful even in the case of mixed states because it remains directly related to the degree of polarization. We compare results occurring in the cases of full pure polarization-frequency states of ququarts and mixed states (averaged over frequencies). Differences between these results can be seen in experiments with and without frequency filters in front of a detector.

  5. The neuroanatomy of pure apraxia of speech in stroke

    PubMed Central

    Graff-Radford, Jonathan; Jones, David T.; Strand, Edythe A.; Rabinstein, Alejandro A.; Duffy, Joseph R.; Josephs, Keith A.

    2014-01-01

    The left insula or Broca’s area have been proposed as the neuroanatomical correlate for apraxia of speech (AOS) based on studies of patients with both AOS and aphasia due to stroke. Studies of neurodegenerative AOS suggest the premotor area and the supplementary motor areas as the anatomical correlates. The study objective was to determine the common infarction area in patients with pure AOS due to stroke. Patients with AOS and no or equivocal aphasia due to ischemic stroke were identified through a pre-existing database. Seven subjects were identified. Five had pure AOS, and two had equivocal aphasia. MRI lesion analysis revealed maximal overlap spanning the left premotor and motor cortices. While both neurodegenerative AOS and stroke induced pure AOS involve the premotor cortex, further studies are needed to establish whether stroke-induced AOS and neurodegenerative AOS share a common anatomic substrate. PMID:24556336

  6. Violations of Bell inequalities from random pure states

    NASA Astrophysics Data System (ADS)

    Atkin, Max R.; Zohren, Stefan

    2015-07-01

    We consider the expected violations of Bell inequalities from random pure states. More precisely, we focus on a slightly generalized version of the Collins-Gisin-Linden-Massar-Popescu inequality, which concerns Bell experiments of two parties, two measurement options, and N outcomes, and analyze their expected quantum violations from random pure states for varying N , assuming the conjectured optimal measurement operators. It is seen that for small N the Bell inequality is not violated on average, while for larger N it is. Both ensembles of unstructured as well as structured random pure states are considered. Using techniques from random matrix theory this is obtained analytically for small and large N and numerically for intermediate N . The results show a beautiful interplay of different aspects of random matrix theory, ranging from the Marchenko-Pastur distribution and fixed-trace ensembles to the O (n ) model.

  7. Faithful Transfer Arbitrary Pure States with Mixed Resources

    NASA Astrophysics Data System (ADS)

    Luo, Ming-Xing; Li, Lin; Ma, Song-Ya; Chen, Xiu-Bo; Yang, Yi-Xian

    2013-09-01

    In this paper, we show that some special mixed quantum resource experience the same property of pure entanglement such as Bell state for quantum teleportation. It is shown that one mixed state and three bits of classical communication cost can be used to teleport one unknown qubit compared with two bits via pure resources. The schemes are easily implement with model physical techniques. Moreover, these resources are also optimal and typical for faithfully remotely prepare an arbitrary qubit, two-qubit and three-qubit states with mixed quantum resources. Our schemes are completed as same as those with pure quantum entanglement resources except only 1 bit additional classical communication cost required. The success probability is independent of the form of the mixed resources.

  8. Excitation of coherent propagating spin waves by pure spin currents

    PubMed Central

    Demidov, Vladislav E.; Urazhdin, Sergei; Liu, Ronghua; Divinskiy, Boris; Telegin, Andrey; Demokritov, Sergej O.

    2016-01-01

    Utilization of pure spin currents not accompanied by the flow of electrical charge provides unprecedented opportunities for the emerging technologies based on the electron's spin degree of freedom, such as spintronics and magnonics. It was recently shown that pure spin currents can be used to excite coherent magnetization dynamics in magnetic nanostructures. However, because of the intrinsic nonlinear self-localization effects, magnetic auto-oscillations in the demonstrated devices were spatially confined, preventing their applications as sources of propagating spin waves in magnonic circuits using these waves as signal carriers. Here, we experimentally demonstrate efficient excitation and directional propagation of coherent spin waves generated by pure spin current. We show that this can be achieved by using the nonlocal spin injection mechanism, which enables flexible design of magnetic nanosystems and allows one to efficiently control their dynamic characteristics. PMID:26818232

  9. Pure gravities via color-kinematics duality for fundamental matter

    NASA Astrophysics Data System (ADS)

    Johansson, Henrik; Ochirov, Alexander

    2015-11-01

    We give a prescription for the computation of loop-level scattering amplitudes in pure Einstein gravity, and four-dimensional pure supergravities, using the color-kinematics duality. Amplitudes are constructed using double copies of pure (super-)Yang-Mills parts and additional contributions from double copies of fundamental matter, which are treated as ghosts. The opposite-statistics states cancel the unwanted dilaton and axion in the bosonic theory, as well as the extra matter supermultiplets in the supergravity theories. As a spinoff, we obtain a prescription for obtaining amplitudes in supergravities with arbitrary non-self-interacting matter. As a prerequisite, we extend the color-kinematics duality from the adjoint to the fundamental representation of the gauge group. We explain the numerator relations that the fundamental kinematic Lie algebra should satisfy. We give nontrivial evidence supporting our construction using explicit tree and loop amplitudes, as well as more general arguments.

  10. [Adult twins].

    PubMed

    Charlemaine, Christiane

    2006-12-31

    This paper explores the deep roots of closeness that twins share in their youngest age and their effect on their destiny at the adult age. Psychologists believe the bond between twins begins in utero and develops throughout the twins' lives. The four patterns of twinship described show that the twin bond is determined by the quality of parenting that twins receive in their infancy and early childhood. Common problems of adult twins bring about difficulties to adapt in a non-twin world. The nature versus nurture controversy has taken on new life focusing on inter-twin differences and the importance of parent-child interaction as fundamental to the growth and development of personality. PMID:17352324

  11. Obstructive sleep apnea - adults

    MedlinePlus

    Sleep apnea - obstructive - adults; Apnea - obstructive sleep apnea syndrome - adults; Sleep-disordered breathing - adults; OSA - adults ... When you sleep, all of the muscles in your body become more relaxed. This includes the muscles that help keep your ...

  12. Entanglement convertibility for infinite-dimensional pure bipartite states

    SciTech Connect

    Owari, Masaki; Matsumoto, Keiji; Murao, Mio

    2004-11-01

    It is shown that the order property of pure bipartite states under stochastic local operations and classical communications (SLOCC) changes radically when dimensionality shifts from finite to infinite. In contrast to finite-dimensional systems where there is no pure incomparable state, the existence of infinitely many mutually SLOCC incomparable states is shown for infinite-dimensional systems even under the bounded energy and finite information exchange condition. These results show that the effect of the infinite dimensionality of Hilbert space, the 'infinite workspace' property, remains even in physically relevant infinite-dimensional systems.

  13. Propagation of laser beam parameters through pure phase transmittances

    NASA Astrophysics Data System (ADS)

    Piquero, G.; Mejías, P. M.; Martínez-Herrero, R.

    1996-02-01

    The propagation laws of the intensity moments of a laser beam through ABCD optical systems are generalized to include pure phase transmittances. This is done by representing the behaviour of such transmittances by means of a 4 × 4 matrix, M, which can be handled, to some extent, as the ABCD-matrices associated with ordinary first-order optical systems. This formalism enables the application of ABCD propagation formulae to cascaded optical systems containing pure phase transmittances. Matrix M is used to determine the intensity moments at the output of two special quartic phase transmittances, namely, a circular spherically aberrated lens and a pair of orthogonal cylindrical (also aberrated) lenses.

  14. Pure Choriocarcinoma of the Ovary in Silver-Russell Syndrome.

    PubMed

    Haruma, Tomoko; Ogawa, Chikako; Nishida, Takeshi; Kusumoto, Tomoyuki; Nakamura, Keiichiro; Seki, Noriko; Katayama, Takaaki; Hiramatsu, Yuji

    2015-01-01

    Pure ovarian choriocarcinoma is an extremely rare malignancy that can be gestational or non-gestational in origin. Silver-Russell syndrome (SRS) is a rare congenital developmental disorder characterized by pre- and postnatal growth failure, relative macrocephaly, a triangular face, hemihypotrophy, and fifth-finger clinodactyly. We report a rare case of pure ovarian choriocarcinoma occurring in a 19-year-old woman with SRS. Following surgery, multiple chemotherapy courses were effective and she was free of disease at the 10-month follow-up. PMID:26101195

  15. Quasimonoenergetic electron beams from laser wakefield acceleration in pure nitrogen

    SciTech Connect

    Mo, M. Z.; Ali, A.; Fedosejevs, R.; Fourmaux, S.; Lassonde, P.; Kieffer, J. C.

    2012-02-13

    Quasimonoenergetic electron beams with maximum energy >0.5 GeV and 2 mrad divergence have been generated in pure nitrogen gas via wakefield acceleration with 80 TW, 30 fs laser pulses. Long low energy tail features were typically observed due to continuous ionization injection. The measured peak electron energy decreased with the plasma density, agreeing with the predicted scaling for electrons. The experiments showed a threshold electron density of 3x10{sup 18}cm{sup -3} for self-trapping. Our experiments suggest that pure Nitrogen is a potential candidate gas to achieve GeV monoenergetic electrons using the ionization induced injection scheme for laser wakefield acceleration.

  16. Six open string disk amplitude in pure spinor superspace

    NASA Astrophysics Data System (ADS)

    Mafra, Carlos R.; Schlotterer, Oliver; Stieberger, Stephan; Tsimpis, Dimitrios

    2011-05-01

    The tree-level amplitude of six massless open strings is computed using the pure spinor formalism. The OPE poles among integrated and unintegrated vertices can be efficiently organized according to the cohomology of pure spinor superspace. The identification and use of these BRST structures and their interplay with the system of equations fulfilled by the generalized Euler integrals allow the full supersymmetric six-point amplitude to be written in compact form. Furthermore, the complete set of extended Bern-Carrasco-Johansson relations are derived from the monodromy properties of the disk world-sheet and explicitly verified for the supersymmetric numerator factors.

  17. Pure intramedullary spinal cord metastasis secondary to gastric cancer.

    PubMed

    Gazzeri, Roberto; Galarza, Marcelo; Faiola, Andrea; Gazzeri, Giovanni

    2006-04-01

    Pure intramedullary spinal-cord metastases (ISCM) are a rare manifestation of cancer. We report a case of ISCM from gastric cancer. A 68-year-old man, treated with total gastrectomy for a gastric cancer, presented 9 months later with paresis of the left arm, pain and dissociated sensory loss. Magnetic resonance imaging revealed a pure intramedullary lesion at the C3-C5 level. After surgical resection, pathological findings revealed an undifferentiated adenocarcinoma of gastric origin. To our knowledge, this is only the second report of ISCM from gastric cancer in the literature. PMID:16465555

  18. Downregulation of Nuclear Factor Erythroid 2-Related Factor and Associated Antioxidant Genes Contributes to Redox-Sensitive Vascular Dysfunction in Hypertension.

    PubMed

    Lopes, Rhéure A; Neves, Karla B; Tostes, Rita C; Montezano, Augusto C; Touyz, Rhian M

    2015-12-01

    Oxidative stress is implicated in vascular dysfunction in hypertension. Although mechanisms regulating vascular pro-oxidants are emerging, there is a paucity of information on antioxidant systems, particularly nuclear factor erythroid 2-related factor (Nrf2), a master regulator of antioxidants enzymes. We evaluated the vascular regulatory role of Nrf2 in hypertension and examined molecular mechanisms, whereby Nrf2 influences redox signaling in small arteries and vascular smooth muscle cells from Wistar Kyoto (WKY) and stroke-prone spontaneously hypertensive rats (SHRSP). Cells were stimulated with angiotensin II in the absence/presence of Nrf2 activators (bardoxolone/L-sulforaphane). Increased vascular reactive oxygen species production (chemiluminescence and amplex red) was associated with reduced Nrf2 activity in arteries (18%) and vascular smooth muscle cells (48%) in SHRSP (P<0.05 versus WKY). Expression of antioxidant enzymes, including superoxide dismutase-1 (64%), catalase (60%), peroxiredoxin 1 (75%), and glutathione peroxidase (54%), was reduced in SHRSP. L-sulforaphane reversed these effects. Angiotensin II increased nuclear accumulation of Nrf2 in vascular smooth muscle cells from WKY (197% versus vehicle), with blunted effects in SHRSP (44% versus vehicle). These responses were associated with increased antioxidant expression (superoxide dismutase-1, 32%; catalase, 42%; thioredoxin, 71%; peroxiredoxin, 1%-90%; quinone oxidoreductase, 84%; P<0.05 versus vehicle) and increased activity of superoxide dismutase-1, catalase, and thioredoxin in WKY but not in SHRSP, which exhibited increased Bach1 expression. Nrf2 activators blocked angiotensin II-induced reactive oxygen species generation. Vascular function demonstrated increased contractility (Emax WKY 113.4±5.6 versus SHRSP 159.0±8.3) and decreased endothelial-dependent relaxation (Emax WKY 88.6±3.1 versus SHRSP 74.6±3.2, P<0.05) in SHRSP, effects corrected by L-sulforaphane. Our findings suggest that

  19. Zinc protects against diabetes-induced pathogenic changes in the aorta: roles of metallothionein and nuclear factor (erythroid-derived 2)-like 2

    PubMed Central

    2013-01-01

    Background Cardiovascular diseases remain a leading cause of the mortality world-wide, which is related to several risks, including the life style change and the increased diabetes prevalence. The present study was to explore the preventive effect of zinc on the pathogenic changes in the aorta. Methods A genetic type 1 diabetic OVE26 mouse model was used with/without zinc supplementation for 3 months. To determine gender difference either for pathogenic changes in the aorta of diabetic mice or for zinc protective effects on diabetes-induced pathogenic changes, both males and females were investigated in parallel by histopathological and immunohistochemical examinations, in combination of real-time PCR assay. Results Diabetes induced significant increases in aortic oxidative damage, inflammation, and remodeling (increased fibrosis and wall thickness) without significant difference between genders. Zinc treatment of these diabetic mice for three months completely prevented the above pathogenic changes in the aorta, and also significantly up-regulated the expression and function of nuclear factor (erythroid-derived 2)-like 2 (Nrf2), a pivotal regulator of anti-oxidative mechanism, and the expression of metallothionein (MT), a potent antioxidant. There was gender difference for the protective effect of zinc against diabetes-induced pathogenic changes and the up-regulated levels of Nrf2 and MT in the aorta. Conclusions These results suggest that zinc supplementation provides a significant protection against diabetes-induced pathogenic changes in the aorta without gender difference in the type 1 diabetic mouse model. The aortic protection by zinc against diabetes-induced pathogenic changes is associated with the up-regulation of both MT and Nrf2 expression. PMID:23536959

  20. Antioxidative effects of the spice cardamom against non-melanoma skin cancer by modulating nuclear factor erythroid-2-related factor 2 and NF-κB signalling pathways.

    PubMed

    Das, Ila; Acharya, Asha; Berry, Deborah L; Sen, Supti; Williams, Elizabeth; Permaul, Eva; Sengupta, Archana; Bhattacharya, Sudin; Saha, Tapas

    2012-09-28

    The role of dietary factors in inhibiting or delaying the development of non-melanoma skin cancer (NMSC) has been investigated for many years. Cardamom, which is a dietary phytoproduct, has been commonly used in cuisines for flavour and has numerous health benefits, such as improving digestion and stimulating metabolism and having antitumorigenic effects. We have investigated the efficacy of dietary cardamom against 7,12-dimethylbenz[a]anthracene (DMBA)-induced skin papillomatogenesis in Swiss albino mice that closely resembles human NMSC. Mice were grouped into normal wild type (untreated), vehicle-treated (acetone), carcinogen-treated (DMBA), and DMBA and cardamom-treated (DMBA+CARD) to delineate the role of cardamom against DMBA-induced papillomatogenesis. Oral administration of cardamom to DMBA-treated mice up-regulated the phase II detoxification enzymes, such as glutathione-S-transferase and glutathione peroxidase, probably via activation of nuclear factor erythroid-2-related factor 2 transcription factor in 'DMBA+CARD' mice. Furthermore, reduced glutathione, glutathione reductase, superoxide dismutase and catalase were also up-regulated by cardamom in the same 'DMBA+CARD' group of mice compared with DMBA-treated mice. Cardamom ingestion in DMBA-treated mice blocked NF-κB activation and down-regulated cyclo-oxygenase-2 expression. As a consequence, both the size and the number of skin papillomas generated on the skin due to the DMBA treatment were reduced in the 'DMBA+CARD' group. Thus, the results from the present study suggest that cardamom has a potential to become a pivotal chemopreventive agent to prevent papillomagenesis on the skin. PMID:22182368