Science.gov

Sample records for advanced multi-physics amp

  1. Integration of Advanced Probabilistic Analysis Techniques with Multi-Physics Models

    SciTech Connect

    Cetiner, Mustafa Sacit; none,; Flanagan, George F.; Poore III, Willis P.; Muhlheim, Michael David

    2014-07-30

    An integrated simulation platform that couples probabilistic analysis-based tools with model-based simulation tools can provide valuable insights for reactive and proactive responses to plant operating conditions. The objective of this work is to demonstrate the benefits of a partial implementation of the Small Modular Reactor (SMR) Probabilistic Risk Assessment (PRA) Detailed Framework Specification through the coupling of advanced PRA capabilities and accurate multi-physics plant models. Coupling a probabilistic model with a multi-physics model will aid in design, operations, and safety by providing a more accurate understanding of plant behavior. This represents the first attempt at actually integrating these two types of analyses for a control system used for operations, on a faster than real-time basis. This report documents the development of the basic communication capability to exchange data with the probabilistic model using Reliability Workbench (RWB) and the multi-physics model using Dymola. The communication pathways from injecting a fault (i.e., failing a component) to the probabilistic and multi-physics models were successfully completed. This first version was tested with prototypic models represented in both RWB and Modelica. First, a simple event tree/fault tree (ET/FT) model was created to develop the software code to implement the communication capabilities between the dynamic-link library (dll) and RWB. A program, written in C#, successfully communicates faults to the probabilistic model through the dll. A systems model of the Advanced Liquid-Metal Reactor–Power Reactor Inherently Safe Module (ALMR-PRISM) design developed under another DOE project was upgraded using Dymola to include proper interfaces to allow data exchange with the control application (ConApp). A program, written in C+, successfully communicates faults to the multi-physics model. The results of the example simulation were successfully plotted.

  2. Multi-physics nuclear reactor simulator for advanced nuclear engineering education

    SciTech Connect

    Yamamoto, A.

    2012-07-01

    Multi-physics nuclear reactor simulator, which aims to utilize for advanced nuclear engineering education, is being introduced to Nagoya Univ.. The simulator consists of the 'macroscopic' physics simulator and the 'microscopic' physics simulator. The former performs real time simulation of a whole nuclear power plant. The latter is responsible to more detail numerical simulations based on the sophisticated and precise numerical models, while taking into account the plant conditions obtained in the macroscopic physics simulator. Steady-state and kinetics core analyses, fuel mechanical analysis, fluid dynamics analysis, and sub-channel analysis can be carried out in the microscopic physics simulator. Simulation calculations are carried out through dedicated graphical user interface and the simulation results, i.e., spatial and temporal behaviors of major plant parameters are graphically shown. The simulator will provide a bridge between the 'theories' studied with textbooks and the 'physical behaviors' of actual nuclear power plants. (authors)

  3. Advanced Mesh-Enabled Monte carlo capability for Multi-Physics Reactor Analysis

    SciTech Connect

    Wilson, Paul; Evans, Thomas; Tautges, Tim

    2012-12-24

    This project will accumulate high-precision fluxes throughout reactor geometry on a non- orthogonal grid of cells to support multi-physics coupling, in order to more accurately calculate parameters such as reactivity coefficients and to generate multi-group cross sections. This work will be based upon recent developments to incorporate advanced geometry and mesh capability in a modular Monte Carlo toolkit with computational science technology that is in use in related reactor simulation software development. Coupling this capability with production-scale Monte Carlo radiation transport codes can provide advanced and extensible test-beds for these developments. Continuous energy Monte Carlo methods are generally considered to be the most accurate computational tool for simulating radiation transport in complex geometries, particularly neutron transport in reactors. Nevertheless, there are several limitations for their use in reactor analysis. Most significantly, there is a trade-off between the fidelity of results in phase space, statistical accuracy, and the amount of computer time required for simulation. Consequently, to achieve an acceptable level of statistical convergence in high-fidelity results required for modern coupled multi-physics analysis, the required computer time makes Monte Carlo methods prohibitive for design iterations and detailed whole-core analysis. More subtly, the statistical uncertainty is typically not uniform throughout the domain, and the simulation quality is limited by the regions with the largest statistical uncertainty. In addition, the formulation of neutron scattering laws in continuous energy Monte Carlo methods makes it difficult to calculate adjoint neutron fluxes required to properly determine important reactivity parameters. Finally, most Monte Carlo codes available for reactor analysis have relied on orthogonal hexahedral grids for tallies that do not conform to the geometric boundaries and are thus generally not well

  4. Specification of the Advanced Burner Test Reactor Multi-Physics Coupling Demonstration Problem

    SciTech Connect

    Shemon, E. R.; Grudzinski, J. J.; Lee, C. H.; Thomas, J. W.; Yu, Y. Q.

    2015-12-21

    This document specifies the multi-physics nuclear reactor demonstration problem using the SHARP software package developed by NEAMS. The SHARP toolset simulates the key coupled physics phenomena inside a nuclear reactor. The PROTEUS neutronics code models the neutron transport within the system, the Nek5000 computational fluid dynamics code models the fluid flow and heat transfer, and the DIABLO structural mechanics code models structural and mechanical deformation. The three codes are coupled to the MOAB mesh framework which allows feedback from neutronics, fluid mechanics, and mechanical deformation in a compatible format.

  5. Advanced computations of multi-physics, multi-scale effects in beam dynamics

    SciTech Connect

    Amundson, J.F.; Macridin, A.; Spentzouris, P.; Stern, E.G.; /Fermilab

    2009-01-01

    Current state-of-the-art beam dynamics simulations include multiple physical effects and multiple physical length and/or time scales. We present recent developments in Synergia2, an accelerator modeling framework designed for multi-physics, multi-scale simulations. We summarize recent several recent results in multi-physics beam dynamics, including simulations of three Fermilab accelerators: the Tevatron, the Main Injector and the Debuncher. Early accelerator simulations focused on single-particle dynamics. To a first approximation, the forces on the particles in an accelerator beam are dominated by the external fields due to magnets, RF cavities, etc., so the single-particle dynamics are the leading physical effects. Detailed simulations of accelerators must include collective effects such as the space-charge repulsion of the beam particles, the effects of wake fields in the beam pipe walls and beam-beam interactions in colliders. These simulations require the sort of massively parallel computers that have only become available in recent times. We give an overview of the accelerator framework Synergia2, which was designed to take advantage of the capabilities of modern computational resources and enable simulations of multiple physical effects. We also summarize some recent results utilizing Synergia2 and BeamBeam3d, a tool specialized for beam-beam simulations.

  6. Keeping it Together: Advanced algorithms and software for magma dynamics (and other coupled multi-physics problems)

    NASA Astrophysics Data System (ADS)

    Spiegelman, M.; Wilson, C. R.

    2011-12-01

    A quantitative theory of magma production and transport is essential for understanding the dynamics of magmatic plate boundaries, intra-plate volcanism and the geochemical evolution of the planet. It also provides one of the most challenging computational problems in solid Earth science, as it requires consistent coupling of fluid and solid mechanics together with the thermodynamics of melting and reactive flows. Considerable work on these problems over the past two decades shows that small changes in assumptions of coupling (e.g. the relationship between melt fraction and solid rheology), can have profound changes on the behavior of these systems which in turn affects critical computational choices such as discretizations, solvers and preconditioners. To make progress in exploring and understanding this physically rich system requires a computational framework that allows more flexible, high-level description of multi-physics problems as well as increased flexibility in composing efficient algorithms for solution of the full non-linear coupled system. Fortunately, recent advances in available computational libraries and algorithms provide a platform for implementing such a framework. We present results from a new model building system that leverages functionality from both the FEniCS project (www.fenicsproject.org) and PETSc libraries (www.mcs.anl.gov/petsc) along with a model independent options system and gui, Spud (amcg.ese.ic.ac.uk/Spud). Key features from FEniCS include fully unstructured FEM with a wide range of elements; a high-level language (ufl) and code generation compiler (FFC) for describing the weak forms of residuals and automatic differentiation for calculation of exact and approximate jacobians. The overall strategy is to monitor/calculate residuals and jacobians for the entire non-linear system of equations within a global non-linear solve based on PETSc's SNES routines. PETSc already provides a wide range of solvers and preconditioners, from

  7. Scalable Methods for Uncertainty Quantification, Data Assimilation and Target Accuracy Assessment for Multi-Physics Advanced Simulation of Light Water Reactors

    NASA Astrophysics Data System (ADS)

    Khuwaileh, Bassam

    High fidelity simulation of nuclear reactors entails large scale applications characterized with high dimensionality and tremendous complexity where various physics models are integrated in the form of coupled models (e.g. neutronic with thermal-hydraulic feedback). Each of the coupled modules represents a high fidelity formulation of the first principles governing the physics of interest. Therefore, new developments in high fidelity multi-physics simulation and the corresponding sensitivity/uncertainty quantification analysis are paramount to the development and competitiveness of reactors achieved through enhanced understanding of the design and safety margins. Accordingly, this dissertation introduces efficient and scalable algorithms for performing efficient Uncertainty Quantification (UQ), Data Assimilation (DA) and Target Accuracy Assessment (TAA) for large scale, multi-physics reactor design and safety problems. This dissertation builds upon previous efforts for adaptive core simulation and reduced order modeling algorithms and extends these efforts towards coupled multi-physics models with feedback. The core idea is to recast the reactor physics analysis in terms of reduced order models. This can be achieved via identifying the important/influential degrees of freedom (DoF) via the subspace analysis, such that the required analysis can be recast by considering the important DoF only. In this dissertation, efficient algorithms for lower dimensional subspace construction have been developed for single physics and multi-physics applications with feedback. Then the reduced subspace is used to solve realistic, large scale forward (UQ) and inverse problems (DA and TAA). Once the elite set of DoF is determined, the uncertainty/sensitivity/target accuracy assessment and data assimilation analysis can be performed accurately and efficiently for large scale, high dimensional multi-physics nuclear engineering applications. Hence, in this work a Karhunen-Loeve (KL

  8. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  9. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  10. Science based integrated approach to advanced nuclear fuel development - integrated multi-scale multi-physics hierarchical modeling and simulation framework Part III: cladding

    SciTech Connect

    Tome, Carlos N; Caro, J A; Lebensohn, R A; Unal, Cetin; Arsenlis, A; Marian, J; Pasamehmetoglu, K

    2010-01-01

    Advancing the performance of Light Water Reactors, Advanced Nuclear Fuel Cycles, and Advanced Reactors, such as the Next Generation Nuclear Power Plants, requires enhancing our fundamental understanding of fuel and materials behavior under irradiation. The capability to accurately model the nuclear fuel systems to develop predictive tools is critical. Not only are fabrication and performance models needed to understand specific aspects of the nuclear fuel, fully coupled fuel simulation codes are required to achieve licensing of specific nuclear fuel designs for operation. The backbone of these codes, models, and simulations is a fundamental understanding and predictive capability for simulating the phase and microstructural behavior of the nuclear fuel system materials and matrices. In this paper we review the current status of the advanced modeling and simulation of nuclear reactor cladding, with emphasis on what is available and what is to be developed in each scale of the project, how we propose to pass information from one scale to the next, and what experimental information is required for benchmarking and advancing the modeling at each scale level.

  11. One-Way Coupling of an Advanced CFD Multi-Physics Model to FEA for Predicting Stress-Strain in the Solidifying Shell during Continuous Casting of Steel

    NASA Astrophysics Data System (ADS)

    Svensson, Johan; Ramírez López, Pavel E.; Jalali, Pooria N.; Cervantes, Michel

    2015-06-01

    One of the main targets for Continuous Casting (CC) modelling is the actual prediction of defects during transient events. However, the majority of CC models are based on a statistical approach towards flow and powder performance, which is unable to capture the subtleties of small variations in casting conditions during real industrial operation or the combined effects of such changes leading eventually to defects. An advanced Computational Fluid Dynamics (CFD) model; which accounts for transient changes on lubrication during casting due to turbulent flow dynamics and mould oscillation has been presented on MCWASP XIV (Austria) to address these issues. The model has been successfully applied to the industrial environment to tackle typical problems such as lack of lubrication or unstable flows. However, a direct application to cracking had proven elusive. The present paper describes how results from this advanced CFD-CC model have been successfully coupled to structural Finite Element Analysis (FEA) for prediction of stress-strains as a function of irregular lubrication conditions in the mould. The main challenge for coupling was the extraction of the solidified shell from CFD calculations (carried out with a hybrid structured mesh) and creating a geometry by using iso-surfaces, re-meshing and mapping loads (e.g. temperature, pressure and external body forces), which served as input to mechanical stress-strain calculations. Preliminary results for CC of slabs show that the temperature distribution within the shell causes shrinkage and thermal deformation; which are in turn, the main source of stress. Results also show reasonable stress levels of 10-20 MPa in regions, where the shell is thin and exposed to large temperature gradients. Finally, predictions are in good agreement with prior works where stresses indicate compression at the slab surface, while tension is observed at the interior; generating a characteristic stress-strain state during solidification in CC.

  12. Computation of Thermodynamic Equilibria Pertinent to Nuclear Materials in Multi-Physics Codes

    NASA Astrophysics Data System (ADS)

    Piro, Markus Hans Alexander

    components at each iterative step, and the objective is to minimize the residuals of the mass balance equations. Several numerical advantages are achieved through this simplification. In particular, computational expense is reduced and the rate of convergence is enhanced. Furthermore, the software has demonstrated the ability to solve systems involving as many as 118 component elements. An early version of the code has already been integrated into the Advanced Multi-Physics (AMP) code under development by the Oak Ridge National Laboratory, Los Alamos National Laboratory, Idaho National Laboratory and Argonne National Laboratory. Keywords: Engineering, Nuclear -- 0552, Engineering, Material Science -- 0794, Chemistry, Mathematics -- 0405, Computer Science -- 0984

  13. Multi-physical Simulation of Laser Welding

    NASA Astrophysics Data System (ADS)

    Vázquez, Rodrigo Gómez; Koch, Holger M.; Otto, Andreas

    Laser welding is a highly demanded technology for manufacturing of body parts in the automotive industry. Application of powerful multi-physical simulation models permits detailed investigation of the laser process avoiding intricate experimental setups and procedures. Features like the degree of power coupling, keyhole evolution or currents inside the melt pool can be analyzed easily. The implementation of complex physical phenomena, like multi-reflection absorption provides insight into process characteristics under selectable conditions and yields essential information concerning the driving mechanisms. The implementation of additional physical models e. g. for diffusion discloses new potential for investigating welding of dissimilar materials. In this paper we present a computational study of laser welding for different conditions. Applied to a real case model predictions show good agreement with experimental results. Initial tests including species diffusion during welding of dissimilar materials are also presented.

  14. Advanced Mitigation Process (AMP) for Improving Laser Damage Threshold of Fused Silica Optics.

    PubMed

    Ye, Xin; Huang, Jin; Liu, Hongjie; Geng, Feng; Sun, Laixi; Jiang, Xiaodong; Wu, Weidong; Qiao, Liang; Zu, Xiaotao; Zheng, Wanguo

    2016-01-01

    The laser damage precursors in subsurface of fused silica (e.g. photosensitive impurities, scratches and redeposited silica compounds) were mitigated by mineral acid leaching and HF etching with multi-frequency ultrasonic agitation, respectively. The comparison of scratches morphology after static etching and high-frequency ultrasonic agitation etching was devoted in our case. And comparison of laser induce damage resistance of scratched and non-scratched fused silica surfaces after HF etching with high-frequency ultrasonic agitation were also investigated in this study. The global laser induce damage resistance was increased significantly after the laser damage precursors were mitigated in this case. The redeposition of reaction produce was avoided by involving multi-frequency ultrasonic and chemical leaching process. These methods made the increase of laser damage threshold more stable. In addition, there is no scratch related damage initiations found on the samples which were treated by Advanced Mitigation Process. PMID:27484188

  15. Advanced Mitigation Process (AMP) for Improving Laser Damage Threshold of Fused Silica Optics

    PubMed Central

    Ye, Xin; Huang, Jin; Liu, Hongjie; Geng, Feng; Sun, Laixi; Jiang, Xiaodong; Wu, Weidong; Qiao, Liang; Zu, Xiaotao; Zheng, Wanguo

    2016-01-01

    The laser damage precursors in subsurface of fused silica (e.g. photosensitive impurities, scratches and redeposited silica compounds) were mitigated by mineral acid leaching and HF etching with multi-frequency ultrasonic agitation, respectively. The comparison of scratches morphology after static etching and high-frequency ultrasonic agitation etching was devoted in our case. And comparison of laser induce damage resistance of scratched and non-scratched fused silica surfaces after HF etching with high-frequency ultrasonic agitation were also investigated in this study. The global laser induce damage resistance was increased significantly after the laser damage precursors were mitigated in this case. The redeposition of reaction produce was avoided by involving multi-frequency ultrasonic and chemical leaching process. These methods made the increase of laser damage threshold more stable. In addition, there is no scratch related damage initiations found on the samples which were treated by Advanced Mitigation Process. PMID:27484188

  16. Advanced Mitigation Process (AMP) for Improving Laser Damage Threshold of Fused Silica Optics

    NASA Astrophysics Data System (ADS)

    Ye, Xin; Huang, Jin; Liu, Hongjie; Geng, Feng; Sun, Laixi; Jiang, Xiaodong; Wu, Weidong; Qiao, Liang; Zu, Xiaotao; Zheng, Wanguo

    2016-08-01

    The laser damage precursors in subsurface of fused silica (e.g. photosensitive impurities, scratches and redeposited silica compounds) were mitigated by mineral acid leaching and HF etching with multi-frequency ultrasonic agitation, respectively. The comparison of scratches morphology after static etching and high-frequency ultrasonic agitation etching was devoted in our case. And comparison of laser induce damage resistance of scratched and non-scratched fused silica surfaces after HF etching with high-frequency ultrasonic agitation were also investigated in this study. The global laser induce damage resistance was increased significantly after the laser damage precursors were mitigated in this case. The redeposition of reaction produce was avoided by involving multi-frequency ultrasonic and chemical leaching process. These methods made the increase of laser damage threshold more stable. In addition, there is no scratch related damage initiations found on the samples which were treated by Advanced Mitigation Process.

  17. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2014-04-02

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  18. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  19. Multi-Physics Demonstration Problem with the SHARP Reactor Simulation Toolkit

    SciTech Connect

    Merzari, E.; Shemon, E. R.; Yu, Y. Q.; Thomas, J. W.; Obabko, A.; Jain, Rajeev; Mahadevan, Vijay; Tautges, Timothy; Solberg, Jerome; Ferencz, Robert Mark; Whitesides, R.

    2015-12-21

    This report describes to employ SHARP to perform a first-of-a-kind analysis of the core radial expansion phenomenon in an SFR. This effort required significant advances in the framework Multi-Physics Demonstration Problem with the SHARP Reactor Simulation Toolkit used to drive the coupled simulations, manipulate the mesh in response to the deformation of the geometry, and generate the necessary modified mesh files. Furthermore, the model geometry is fairly complex, and consistent mesh generation for the three physics modules required significant effort. Fully-integrated simulations of a 7-assembly mini-core test problem have been performed, and the results are presented here. Physics models of a full-core model of the Advanced Burner Test Reactor have also been developed for each of the three physics modules. Standalone results of each of the three physics modules for the ABTR are presented here, which provides a demonstration of the feasibility of the fully-integrated simulation.

  20. Multi-Physics Analysis of the Fermilab Booster RF Cavity

    SciTech Connect

    Awida, M.; Reid, J.; Yakovlev, V.; Lebedev, V.; Khabiboulline, T.; Champion, M.; /Fermilab

    2012-05-14

    After about 40 years of operation the RF accelerating cavities in Fermilab Booster need an upgrade to improve their reliability and to increase the repetition rate in order to support a future experimental program. An increase in the repetition rate from 7 to 15 Hz entails increasing the power dissipation in the RF cavities, their ferrite loaded tuners, and HOM dampers. The increased duty factor requires careful modelling for the RF heating effects in the cavity. A multi-physic analysis investigating both the RF and thermal properties of Booster cavity under various operating conditions is presented in this paper.

  1. Fracture Characterization through Multi-Physics Joint Inversion

    NASA Astrophysics Data System (ADS)

    Finsterle, S.; Edmiston, J. K.; Zhang, Y.

    2014-12-01

    Natural and man-made fractures tend to significantly impact the behavior of a subsurface system - with both desirable and undesirable consequences. Thus, the description, characterization, and prediction of fractured systems requires careful conceptualization and a defensible modeling approach that is tailored to the objectives of a specific application. We review some of these approaches and the related data needs, and discuss the use of multi-physics joint inversion techniques to identify and characterize the relevant features of the fracture system. In particular, we demonstrate the potential use of a non-isothermal, multiphase flow simulator coupled to a thermo-poro-elastic model for the calculation of observable deformations during injection-production operations. This model is integrated into a joint inversion framework for the estimation of geometrical, hydrogeological, rockmechanical, thermal, and statistical parameters representing the fractured porous medium.

  2. Solid Oxide Fuel Cell - Multi-Physics and GUI

    SciTech Connect

    2013-10-10

    SOFC-MP is a simulation tool developed at PNNL to evaluate the tightly coupled multi-physical phenomena in SOFCs. The purpose of the tool is to allow SOFC manufacturers to numerically test changes in planar stack design to meet DOE technical targets. The SOFC-MP 2D module is designed for computational efficiency to enable rapid engineering evaluations for operation of tall symmetric stacks. It can quickly compute distributions for the current density, voltage, temperature, and species composition in tall stacks with co-flow or counter-flow orientations. The 3D module computes distributions in entire 3D domain and handles all planner configurations: co-flow, counter-flow, and cross-flow. The detailed data from 3D simulation can be used as input for structural analysis. SOFC-MP GUI integrates both 2D and 3D modules, and it provides user friendly pre-processing and post-processing capabilities.

  3. A Global Sensitivity Analysis Methodology for Multi-physics Applications

    SciTech Connect

    Tong, C H; Graziani, F R

    2007-02-02

    Experiments are conducted to draw inferences about an entire ensemble based on a selected number of observations. This applies to both physical experiments as well as computer experiments, the latter of which are performed by running the simulation models at different input configurations and analyzing the output responses. Computer experiments are instrumental in enabling model analyses such as uncertainty quantification and sensitivity analysis. This report focuses on a global sensitivity analysis methodology that relies on a divide-and-conquer strategy and uses intelligent computer experiments. The objective is to assess qualitatively and/or quantitatively how the variabilities of simulation output responses can be accounted for by input variabilities. We address global sensitivity analysis in three aspects: methodology, sampling/analysis strategies, and an implementation framework. The methodology consists of three major steps: (1) construct credible input ranges; (2) perform a parameter screening study; and (3) perform a quantitative sensitivity analysis on a reduced set of parameters. Once identified, research effort should be directed to the most sensitive parameters to reduce their uncertainty bounds. This process is repeated with tightened uncertainty bounds for the sensitive parameters until the output uncertainties become acceptable. To accommodate the needs of multi-physics application, this methodology should be recursively applied to individual physics modules. The methodology is also distinguished by an efficient technique for computing parameter interactions. Details for each step will be given using simple examples. Numerical results on large scale multi-physics applications will be available in another report. Computational techniques targeted for this methodology have been implemented in a software package called PSUADE.

  4. Lithium-Ion Battery Safety Study Using Multi-Physics Internal Short-Circuit Model (Presentation)

    SciTech Connect

    Kim, G-.H.; Smith, K.; Pesaran, A.

    2009-06-01

    This presentation outlines NREL's multi-physics simulation study to characterize an internal short by linking and integrating electrochemical cell, electro-thermal, and abuse reaction kinetics models.

  5. A theory manual for multi-physics code coupling in LIME.

    SciTech Connect

    Belcourt, Noel; Bartlett, Roscoe Ainsworth; Pawlowski, Roger Patrick; Schmidt, Rodney Cannon; Hooper, Russell Warren

    2011-03-01

    The Lightweight Integrating Multi-physics Environment (LIME) is a software package for creating multi-physics simulation codes. Its primary application space is when computer codes are currently available to solve different parts of a multi-physics problem and now need to be coupled with other such codes. In this report we define a common domain language for discussing multi-physics coupling and describe the basic theory associated with multiphysics coupling algorithms that are to be supported in LIME. We provide an assessment of coupling techniques for both steady-state and time dependent coupled systems. Example couplings are also demonstrated.

  6. Solid Oxide Fuel Cell - Multi-Physics and GUI

    2013-10-10

    SOFC-MP is a simulation tool developed at PNNL to evaluate the tightly coupled multi-physical phenomena in SOFCs. The purpose of the tool is to allow SOFC manufacturers to numerically test changes in planar stack design to meet DOE technical targets. The SOFC-MP 2D module is designed for computational efficiency to enable rapid engineering evaluations for operation of tall symmetric stacks. It can quickly compute distributions for the current density, voltage, temperature, and species composition inmore » tall stacks with co-flow or counter-flow orientations. The 3D module computes distributions in entire 3D domain and handles all planner configurations: co-flow, counter-flow, and cross-flow. The detailed data from 3D simulation can be used as input for structural analysis. SOFC-MP GUI integrates both 2D and 3D modules, and it provides user friendly pre-processing and post-processing capabilities.« less

  7. Modelling transport phenomena in a multi-physics context

    NASA Astrophysics Data System (ADS)

    Marra, Francesco

    2015-01-01

    Innovative heating research on cooking, pasteurization/sterilization, defrosting, thawing and drying, often focuses on areas which include the assessment of processing time, evaluation of heating uniformity, studying the impact on quality attributes of the final product as well as considering the energy efficiency of these heating processes. During the last twenty years, so-called electro-heating-processes (radio-frequency - RF, microwaves - MW and ohmic - OH) gained a wide interest in industrial food processing and many applications using the above mentioned technologies have been developed with the aim of reducing processing time, improving process efficiency and, in many cases, the heating uniformity. In the area of innovative heating, electro-heating accounts for a considerable portion of both the scientific literature and commercial applications, which can be subdivided into either direct electro-heating (as in the case of OH heating) where electrical current is applied directly to the food or indirect electro-heating (e.g. MW and RF heating) where the electrical energy is firstly converted to electromagnetic radiation which subsequently generates heat within a product. New software packages, which make easier solution of PDEs based mathematical models, and new computers, capable of larger RAM and more efficient CPU performances, allowed an increasing interest about modelling transport phenomena in systems and processes - as the ones encountered in food processing - that can be complex in terms of geometry, composition, boundary conditions but also - as in the case of electro-heating assisted applications - in terms of interaction with other physical phenomena such as displacement of electric or magnetic field. This paper deals with the description of approaches used in modelling transport phenomena in a multi-physics context such as RF, MW and OH assisted heating.

  8. Modelling transport phenomena in a multi-physics context

    SciTech Connect

    Marra, Francesco

    2015-01-22

    Innovative heating research on cooking, pasteurization/sterilization, defrosting, thawing and drying, often focuses on areas which include the assessment of processing time, evaluation of heating uniformity, studying the impact on quality attributes of the final product as well as considering the energy efficiency of these heating processes. During the last twenty years, so-called electro-heating-processes (radio-frequency - RF, microwaves - MW and ohmic - OH) gained a wide interest in industrial food processing and many applications using the above mentioned technologies have been developed with the aim of reducing processing time, improving process efficiency and, in many cases, the heating uniformity. In the area of innovative heating, electro-heating accounts for a considerable portion of both the scientific literature and commercial applications, which can be subdivided into either direct electro-heating (as in the case of OH heating) where electrical current is applied directly to the food or indirect electro-heating (e.g. MW and RF heating) where the electrical energy is firstly converted to electromagnetic radiation which subsequently generates heat within a product. New software packages, which make easier solution of PDEs based mathematical models, and new computers, capable of larger RAM and more efficient CPU performances, allowed an increasing interest about modelling transport phenomena in systems and processes - as the ones encountered in food processing - that can be complex in terms of geometry, composition, boundary conditions but also - as in the case of electro-heating assisted applications - in terms of interaction with other physical phenomena such as displacement of electric or magnetic field. This paper deals with the description of approaches used in modelling transport phenomena in a multi-physics context such as RF, MW and OH assisted heating.

  9. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  10. COMPUTATIONAL CHALLENGES IN BUILDING MULTI-SCALE AND MULTI-PHYSICS MODELS OF CARDIAC ELECTRO-MECHANICS

    PubMed Central

    Plank, G; Prassl, AJ; Augustin, C

    2014-01-01

    Despite the evident multiphysics nature of the heart – it is an electrically controlled mechanical pump – most modeling studies considered electrophysiology and mechanics in isolation. In no small part, this is due to the formidable modeling challenges involved in building strongly coupled anatomically accurate and biophyically detailed multi-scale multi-physics models of cardiac electro-mechanics. Among the main challenges are the selection of model components and their adjustments to achieve integration into a consistent organ-scale model, dealing with technical difficulties such as the exchange of data between electro-physiological and mechanical model, particularly when using different spatio-temporal grids for discretization, and, finally, the implementation of advanced numerical techniques to deal with the substantial computational. In this study we report on progress made in developing a novel modeling framework suited to tackle these challenges. PMID:24043050

  11. Multi-scale/multi-physical modeling in head/disk interface of magnetic data storage

    NASA Astrophysics Data System (ADS)

    Chung, Pil Seung; Smith, Robert; Vemuri, Sesha Hari; Jhon, Young In; Tak, Kyungjae; Moon, Il; Biegler, Lorenz T.; Jhon, Myung S.

    2012-04-01

    The model integration of the head-disk interface (HDI) in the hard disk drive system, which includes the hierarchy of highly interactive layers (magnetic layer, carbon overcoat (COC), lubricant, and air bearing system (ABS)), has recently been focused upon to resolve technical barriers and enhance reliability. Heat-assisted magnetic recording especially demands that the model simultaneously incorporates thermal and mechanical phenomena by considering the enormous combinatorial cases of materials and multi-scale/multi-physical phenomena. In this paper, we explore multi-scale/multi-physical simulation methods for HDI, which will holistically integrate magnetic layers, COC, lubricants, and ABS in non-isothermal conditions.

  12. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  13. Multi-physics design and analyses of long life reactors for lunar outposts

    NASA Astrophysics Data System (ADS)

    Schriener, Timothy M.

    event of a launch abort accident. Increasing the amount of fuel in the reactor core, and hence its operational life, would be possible by launching the reactor unfueled and fueling it on the Moon. Such a reactor would, thus, not be subject to launch criticality safety requirements. However, loading the reactor with fuel on the Moon presents a challenge, requiring special designs of the core and the fuel elements, which lend themselves to fueling on the lunar surface. This research investigates examples of both a solid core reactor that would be fueled at launch as well as an advanced concept which could be fueled on the Moon. Increasing the operational life of a reactor fueled at launch is exercised for the NaK-78 cooled Sectored Compact Reactor (SCoRe). A multi-physics design and analyses methodology is developed which iteratively couples together detailed Monte Carlo neutronics simulations with 3-D Computational Fluid Dynamics (CFD) and thermal-hydraulics analyses. Using this methodology the operational life of this compact, fast spectrum reactor is increased by reconfiguring the core geometry to reduce neutron leakage and parasitic absorption, for the same amount of HEU in the core, and meeting launch safety requirements. The multi-physics analyses determine the impacts of the various design changes on the reactor's neutronics and thermal-hydraulics performance. The option of increasing the operational life of a reactor by loading it on the Moon is exercised for the Pellet Bed Reactor (PeBR). The PeBR uses spherical fuel pellets and is cooled by He-Xe gas, allowing the reactor core to be loaded with fuel pellets and charged with working fluid on the lunar surface. The performed neutronics analyses ensure the PeBR design achieves a long operational life, and develops safe launch canister designs to transport the spherical fuel pellets to the lunar surface. The research also investigates loading the PeBR core with fuel pellets on the Moon using a transient Discrete

  14. Multi-physics design and analyses of long life reactors for lunar outposts

    NASA Astrophysics Data System (ADS)

    Schriener, Timothy M.

    event of a launch abort accident. Increasing the amount of fuel in the reactor core, and hence its operational life, would be possible by launching the reactor unfueled and fueling it on the Moon. Such a reactor would, thus, not be subject to launch criticality safety requirements. However, loading the reactor with fuel on the Moon presents a challenge, requiring special designs of the core and the fuel elements, which lend themselves to fueling on the lunar surface. This research investigates examples of both a solid core reactor that would be fueled at launch as well as an advanced concept which could be fueled on the Moon. Increasing the operational life of a reactor fueled at launch is exercised for the NaK-78 cooled Sectored Compact Reactor (SCoRe). A multi-physics design and analyses methodology is developed which iteratively couples together detailed Monte Carlo neutronics simulations with 3-D Computational Fluid Dynamics (CFD) and thermal-hydraulics analyses. Using this methodology the operational life of this compact, fast spectrum reactor is increased by reconfiguring the core geometry to reduce neutron leakage and parasitic absorption, for the same amount of HEU in the core, and meeting launch safety requirements. The multi-physics analyses determine the impacts of the various design changes on the reactor's neutronics and thermal-hydraulics performance. The option of increasing the operational life of a reactor by loading it on the Moon is exercised for the Pellet Bed Reactor (PeBR). The PeBR uses spherical fuel pellets and is cooled by He-Xe gas, allowing the reactor core to be loaded with fuel pellets and charged with working fluid on the lunar surface. The performed neutronics analyses ensure the PeBR design achieves a long operational life, and develops safe launch canister designs to transport the spherical fuel pellets to the lunar surface. The research also investigates loading the PeBR core with fuel pellets on the Moon using a transient Discrete

  15. Numerical Stability and Accuracy of Temporally Coupled Multi-Physics Modules in Wind-Turbine CAE Tools

    SciTech Connect

    Gasmi, A.; Sprague, M. A.; Jonkman, J. M.; Jones, W. B.

    2013-02-01

    In this paper we examine the stability and accuracy of numerical algorithms for coupling time-dependent multi-physics modules relevant to computer-aided engineering (CAE) of wind turbines. This work is motivated by an in-progress major revision of FAST, the National Renewable Energy Laboratory's (NREL's) premier aero-elastic CAE simulation tool. We employ two simple examples as test systems, while algorithm descriptions are kept general. Coupled-system governing equations are framed in monolithic and partitioned representations as differential-algebraic equations. Explicit and implicit loose partition coupling is examined. In explicit coupling, partitions are advanced in time from known information. In implicit coupling, there is dependence on other-partition data at the next time step; coupling is accomplished through a predictor-corrector (PC) approach. Numerical time integration of coupled ordinary-differential equations (ODEs) is accomplished with one of three, fourth-order fixed-time-increment methods: Runge-Kutta (RK), Adams-Bashforth (AB), and Adams-Bashforth-Moulton (ABM). Through numerical experiments it is shown that explicit coupling can be dramatically less stable and less accurate than simulations performed with the monolithic system. However, PC implicit coupling restored stability and fourth-order accuracy for ABM; only second-order accuracy was achieved with RK integration. For systems without constraints, explicit time integration with AB and explicit loose coupling exhibited desired accuracy and stability.

  16. TerraFERMA: The Transparent Finite Element Rapid Model Assembler for multi-physics problems in the solid Earth sciences

    NASA Astrophysics Data System (ADS)

    Spiegelman, M. W.; Wilson, C. R.; Van Keken, P. E.

    2013-12-01

    We announce the release of a new software infrastructure, TerraFERMA, the Transparent Finite Element Rapid Model Assembler for the exploration and solution of coupled multi-physics problems. The design of TerraFERMA is driven by two overarching computational needs in Earth sciences. The first is the need for increased flexibility in both problem description and solution strategies for coupled problems where small changes in model assumptions can often lead to dramatic changes in physical behavior. The second is the need for software and models that are more transparent so that results can be verified, reproduced and modified in a manner such that the best ideas in computation and earth science can be more easily shared and reused. TerraFERMA leverages three advanced open-source libraries for scientific computation that provide high level problem description (FEniCS), composable solvers for coupled multi-physics problems (PETSc) and a science neutral options handling system (SPuD) that allows the hierarchical management of all model options. TerraFERMA integrates these libraries into an easier to use interface that organizes the scientific and computational choices required in a model into a single options file, from which a custom compiled application is generated and run. Because all models share the same infrastructure, models become more reusable and reproducible. TerraFERMA inherits much of its functionality from the underlying libraries. It currently solves partial differential equations (PDE) using finite element methods on simplicial meshes of triangles (2D) and tetrahedra (3D). The software is particularly well suited for non-linear problems with complex coupling between components. We demonstrate the design and utility of TerraFERMA through examples of thermal convection and magma dynamics. TerraFERMA has been tested successfully against over 45 benchmark problems from 7 publications in incompressible and compressible convection, magmatic solitary waves

  17. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish.

    PubMed

    Lundegaard, Pia R; Anastasaki, Corina; Grant, Nicola J; Sillito, Rowland R; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J Douglas; Porteous, David J; Patton, E Elizabeth

    2015-10-22

    Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  18. Wind-Turbine Gear-Box Roller-Bearing Premature-Failure Caused by Grain-Boundary Hydrogen Embrittlement: A Multi-physics Computational Investigation

    NASA Astrophysics Data System (ADS)

    Grujicic, M.; Chenna, V.; Galgalikar, R.; Snipes, J. S.; Ramaswami, S.; Yavari, R.

    2014-11-01

    To help overcome the problem of horizontal-axis wind-turbine (HAWT) gear-box roller-bearing premature-failure, the root causes of this failure are currently being investigated using mainly laboratory and field-test experimental approaches. In the present work, an attempt is made to develop complementary computational methods and tools which can provide additional insight into the problem at hand (and do so with a substantially shorter turn-around time). Toward that end, a multi-physics computational framework has been developed which combines: (a) quantum-mechanical calculations of the grain-boundary hydrogen-embrittlement phenomenon and hydrogen bulk/grain-boundary diffusion (the two phenomena currently believed to be the main contributors to the roller-bearing premature-failure); (b) atomic-scale kinetic Monte Carlo-based calculations of the hydrogen-induced embrittling effect ahead of the advancing crack-tip; and (c) a finite-element analysis of the damage progression in, and the final failure of a prototypical HAWT gear-box roller-bearing inner raceway. Within this approach, the key quantities which must be calculated using each computational methodology are identified, as well as the quantities which must be exchanged between different computational analyses. The work demonstrates that the application of the present multi-physics computational framework enables prediction of the expected life of the most failure-prone HAWT gear-box bearing elements.

  19. A novel phenomenological multi-physics model of Li-ion battery cells

    NASA Astrophysics Data System (ADS)

    Oh, Ki-Yong; Samad, Nassim A.; Kim, Youngki; Siegel, Jason B.; Stefanopoulou, Anna G.; Epureanu, Bogdan I.

    2016-09-01

    A novel phenomenological multi-physics model of Lithium-ion battery cells is developed for control and state estimation purposes. The model can capture electrical, thermal, and mechanical behaviors of battery cells under constrained conditions, e.g., battery pack conditions. Specifically, the proposed model predicts the core and surface temperatures and reaction force induced from the volume change of battery cells because of electrochemically- and thermally-induced swelling. Moreover, the model incorporates the influences of changes in preload and ambient temperature on the force considering severe environmental conditions electrified vehicles face. Intensive experimental validation demonstrates that the proposed multi-physics model accurately predicts the surface temperature and reaction force for a wide operational range of preload and ambient temperature. This high fidelity model can be useful for more accurate and robust state of charge estimation considering the complex dynamic behaviors of the battery cell. Furthermore, the inherent simplicity of the mechanical measurements offers distinct advantages to improve the existing power and thermal management strategies for battery management.

  20. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  1. Module-based Hybrid Uncertainty Quantification for Multi-physics Applications: Theory and Software

    SciTech Connect

    Tong, Charles; Chen, Xiao; Iaccarino, Gianluca; Mittal, Akshay

    2013-10-08

    In this project we proposed to develop an innovative uncertainty quantification methodology that captures the best of the two competing approaches in UQ, namely, intrusive and non-intrusive approaches. The idea is to develop the mathematics and the associated computational framework and algorithms to facilitate the use of intrusive or non-intrusive UQ methods in different modules of a multi-physics multi-module simulation model in a way that physics code developers for different modules are shielded (as much as possible) from the chores of accounting for the uncertain ties introduced by the other modules. As the result of our research and development, we have produced a number of publications, conference presentations, and a software product.

  2. Multi-Physics Markov Chain Monte Carlo Methods for Subsurface Flows

    NASA Astrophysics Data System (ADS)

    Rigelo, J.; Ginting, V.; Rahunanthan, A.; Pereira, F.

    2014-12-01

    For CO2 sequestration in deep saline aquifers, contaminant transport in subsurface, and oil or gas recovery, we often need to forecast flow patterns. Subsurface characterization is a critical and challenging step in flow forecasting. To characterize subsurface properties we establish a statistical description of the subsurface properties that are conditioned to existing dynamic and static data. A Markov Chain Monte Carlo (MCMC) algorithm is used in a Bayesian statistical description to reconstruct the spatial distribution of rock permeability and porosity. The MCMC algorithm requires repeatedly solving a set of nonlinear partial differential equations describing displacement of fluids in porous media for different values of permeability and porosity. The time needed for the generation of a reliable MCMC chain using the algorithm can be too long to be practical for flow forecasting. In this work we develop fast and effective computational methods for generating MCMC chains in the Bayesian framework for the subsurface characterization. Our strategy consists of constructing a family of computationally inexpensive preconditioners based on simpler physics as well as on surrogate models such that the number of fine-grid simulations is drastically reduced in the generated MCMC chains. In particular, we introduce a huff-puff technique as screening step in a three-stage multi-physics MCMC algorithm to reduce the number of expensive final stage simulations. The huff-puff technique in the algorithm enables a better characterization of subsurface near wells. We assess the quality of the proposed multi-physics MCMC methods by considering Monte Carlo simulations for forecasting oil production in an oil reservoir.

  3. Optimization and Parallelization of the Thermal-Hydraulic Sub-channel Code CTF for High-Fidelity Multi-physics Applications

    SciTech Connect

    Salko, Robert K; Schmidt, Rodney; Avramova, Maria N

    2014-01-01

    This paper describes major improvements to the computational infrastructure of the CTF sub-channel code so that full-core sub-channel-resolved simulations can now be performed in much shorter run-times, either in stand-alone mode or as part of coupled-code multi-physics calculations. These improvements support the goals of the Department Of Energy (DOE) Consortium for Advanced Simulations of Light Water (CASL) Energy Innovation Hub to develop high fidelity multi-physics simulation tools for nuclear energy design and analysis. A set of serial code optimizations--including fixing computational inefficiencies, optimizing the numerical approach, and making smarter data storage choices--are first described and shown to reduce both execution time and memory usage by about a factor of ten. Next, a Single Program Multiple Data (SPMD) parallelization strategy targeting distributed memory Multiple Instruction Multiple Data (MIMD) platforms and utilizing domain-decomposition is presented. In this approach, data communication between processors is accomplished by inserting standard MPI calls at strategic points in the code. The domain decomposition approach implemented assigns one MPI process to each fuel assembly, with each domain being represented by its own CTF input file. The creation of CTF input files, both for serial and parallel runs, is also fully automated through use of a pre-processor utility that takes a greatly reduced set of user input over the traditional CTF input file. To run CTF in parallel, two additional libraries are currently needed; MPI, for inter-processor message passing, and the Parallel Extensible Toolkit for Scientific Computation (PETSc), which is leveraged to solve the global pressure matrix in parallel. Results presented include a set of testing and verification calculations and performance tests assessing parallel scaling characteristics up to a full core, sub-channel-resolved model of Watts Bar Unit 1 under hot full-power conditions (193 17x17

  4. Coupling between a multi-physics workflow engine and an optimization framework

    NASA Astrophysics Data System (ADS)

    Di Gallo, L.; Reux, C.; Imbeaux, F.; Artaud, J.-F.; Owsiak, M.; Saoutic, B.; Aiello, G.; Bernardi, P.; Ciraolo, G.; Bucalossi, J.; Duchateau, J.-L.; Fausser, C.; Galassi, D.; Hertout, P.; Jaboulay, J.-C.; Li-Puma, A.; Zani, L.

    2016-03-01

    A generic coupling method between a multi-physics workflow engine and an optimization framework is presented in this paper. The coupling architecture has been developed in order to preserve the integrity of the two frameworks. The objective is to provide the possibility to replace a framework, a workflow or an optimizer by another one without changing the whole coupling procedure or modifying the main content in each framework. The coupling is achieved by using a socket-based communication library for exchanging data between the two frameworks. Among a number of algorithms provided by optimization frameworks, Genetic Algorithms (GAs) have demonstrated their efficiency on single and multiple criteria optimization. Additionally to their robustness, GAs can handle non-valid data which may appear during the optimization. Consequently GAs work on most general cases. A parallelized framework has been developed to reduce the time spent for optimizations and evaluation of large samples. A test has shown a good scaling efficiency of this parallelized framework. This coupling method has been applied to the case of SYCOMORE (SYstem COde for MOdeling tokamak REactor) which is a system code developed in form of a modular workflow for designing magnetic fusion reactors. The coupling of SYCOMORE with the optimization platform URANIE enables design optimization along various figures of merit and constraints.

  5. Multi-physics model of a thermo-magnetic energy harvester

    NASA Astrophysics Data System (ADS)

    Joshi, Keyur B.; Priya, Shashank

    2013-05-01

    Harvesting small thermal gradients effectively to generate electricity still remains a challenge. Ujihara et al (2007 Appl. Phys. Lett. 91 093508) have recently proposed a thermo-magnetic energy harvester that incorporates a combination of hard and soft magnets on a vibrating beam structure and two opposing heat transfer surfaces. This design has many advantages and could present an optimum solution to harvest energy in low temperature gradient conditions. In this paper, we describe a multi-physics numerical model for this harvester configuration that incorporates all the relevant parameters, including heat transfer, magnetic force, beam vibration, contact surface and piezoelectricity. The model was used to simulate the complete transient behavior of the system. Results are presented for the evolution of the magnetic force, changes in the internal temperature of the soft magnet (gadolinium (Gd)), thermal contact conductance, contact pressure and heat transfer over a complete cycle. Variation of the vibration frequency with contact stiffness and gap distance was also modeled. Limit cycle behavior and its bifurcations are illustrated as a function of device parameters. The model was extended to include a piezoelectric energy harvesting mechanism and, using a piezoelectric bimorph as spring material, a maximum power of 318 μW was predicted across a 100 kΩ external load.

  6. Final report on LDRD project : coupling strategies for multi-physics applications.

    SciTech Connect

    Hopkins, Matthew Morgan; Moffat, Harry K.; Carnes, Brian; Hooper, Russell Warren; Pawlowski, Roger P.

    2007-11-01

    Many current and future modeling applications at Sandia including ASC milestones will critically depend on the simultaneous solution of vastly different physical phenomena. Issues due to code coupling are often not addressed, understood, or even recognized. The objectives of the LDRD has been both in theory and in code development. We will show that we have provided a fundamental analysis of coupling, i.e., when strong coupling vs. a successive substitution strategy is needed. We have enabled the implementation of tighter coupling strategies through additions to the NOX and Sierra code suites to make coupling strategies available now. We have leveraged existing functionality to do this. Specifically, we have built into NOX the capability to handle fully coupled simulations from multiple codes, and we have also built into NOX the capability to handle Jacobi Free Newton Krylov simulations that link multiple applications. We show how this capability may be accessed from within the Sierra Framework as well as from outside of Sierra. The critical impact from this LDRD is that we have shown how and have delivered strategies for enabling strong Newton-based coupling while respecting the modularity of existing codes. This will facilitate the use of these codes in a coupled manner to solve multi-physic applications.

  7. Validation of a 3D multi-physics model for unidirectional silicon solidification

    NASA Astrophysics Data System (ADS)

    Simons, Philip; Lankhorst, Adriaan; Habraken, Andries; Faber, Anne-Jans; Tiuleanu, Dumitru; Pingel, Roger

    2012-02-01

    A model for transient movements of solidification fronts has been added to X-stream, an existing multi-physics simulation program for high temperature processes with flow and chemical reactions. The implementation uses an enthalpy formulation and works on fixed grids. First we show the results of a 2D tin solidification benchmark case, which allows a comparison of X-stream to two other codes and to measurements. Second, a complete 3D solar silicon Heat Exchange Method (HEM) furnace, as built by PVA TePla is modeled. Here, it was necessary to model the complete geometry including the quartz crucible, radiative heaters, bottom cooling, inert flushing gas, etc. For one specific recipe of the transient heater power steering, PVA TePla conducted dip-rod measurements of the silicon solidification front position as function of time. This yields a validation of the model when applied to a real life industrial crystallization process. The results indicate that melt convection does influence the energy distribution up to the start of crystallization at the crucible bottom. But from that point on, the release of latent heat seems to dominate the solidification process, and convection in the melt does not significantly influence the transient front shape.

  8. A novel medical image data-based multi-physics simulation platform for computational life sciences

    PubMed Central

    Neufeld, Esra; Szczerba, Dominik; Chavannes, Nicolas; Kuster, Niels

    2013-01-01

    Simulating and modelling complex biological systems in computational life sciences requires specialized software tools that can perform medical image data-based modelling, jointly visualize the data and computational results, and handle large, complex, realistic and often noisy anatomical models. The required novel solvers must provide the power to model the physics, biology and physiology of living tissue within the full complexity of the human anatomy (e.g. neuronal activity, perfusion and ultrasound propagation). A multi-physics simulation platform satisfying these requirements has been developed for applications including device development and optimization, safety assessment, basic research, and treatment planning. This simulation platform consists of detailed, parametrized anatomical models, a segmentation and meshing tool, a wide range of solvers and optimizers, a framework for the rapid development of specialized and parallelized finite element method solvers, a visualization toolkit-based visualization engine, a Python scripting interface for customized applications, a coupling framework, and more. Core components are cross-platform compatible and use open formats. Several examples of applications are presented: hyperthermia cancer treatment planning, tumour growth modelling, evaluating the magneto-haemodynamic effect as a biomarker and physics-based morphing of anatomical models. PMID:24427518

  9. An RCM multi-physics ensemble over Europe: multi-variable evaluation to avoid error compensation

    NASA Astrophysics Data System (ADS)

    García-Díez, Markel; Fernández, Jesús; Vautard, Robert

    2015-12-01

    Regional Climate Models are widely used tools to add detail to the coarse resolution of global simulations. However, these are known to be affected by biases. Usually, published model evaluations use a reduced number of variables, frequently precipitation and temperature. Due to the complexity of the models, this may not be enough to assess their physical realism (e.g. to enable a fair comparison when weighting ensemble members). Furthermore, looking at only a few variables makes difficult to trace model errors. Thus, in many previous studies, these biases are described but their underlying causes and mechanisms are often left unknown. In this work the ability of a multi-physics ensemble in reproducing the observed climatologies of many variables over Europe is analysed. These are temperature, precipitation, cloud cover, radiative fluxes and total soil moisture content. It is found that, during winter, the model suffers a significant cold bias over snow covered regions. This is shown to be related with a poor representation of the snow-atmosphere interaction, and is amplified by an albedo feedback. It is shown how two members of the ensemble are able to alleviate this bias, but by generating a too large cloud cover. During summer, a large sensitivity to the cumulus parameterization is found, related to large differences in the cloud cover and short wave radiation flux. Results also show that small errors in one variable are sometimes a result of error compensation, so the high dimensionality of the model evaluation problem cannot be disregarded.

  10. DAG Software Architectures for Multi-Scale Multi-Physics Problems at Petascale and Beyond

    NASA Astrophysics Data System (ADS)

    Berzins, Martin

    2015-03-01

    The challenge of computations at Petascale and beyond is to ensure how to make possible efficient calculations on possibly hundreds of thousands for cores or on large numbers of GPUs or Intel Xeon Phis. An important methodology for achieving this is at present thought to be that of asynchronous task-based parallelism. The success of this approach will be demonstrated using the Uintah software framework for the solution of coupled fluid-structure interaction problems with chemical reactions. The layered approach of this software makes it possible for the user to specify the physical problems without parallel code, for that specification to be translated into a parallel set of tasks. These tasks are executed using a runtime system that executes tasks asynchronously and sometimes out-of-order. The scalability and portability of this approach will be demonstrated using examples from large scale combustion problems, industrial detonations and multi-scale, multi-physics models. The challenges of scaling such calculations to the next generations of leadership class computers (with more than a hundred petaflops) will be discussed. Thanks to NSF, XSEDE, DOE NNSA, DOE NETL, DOE ALCC and DOE INCITE.

  11. Research on Structural Safety of the Stratospheric Airship Based on Multi-Physics Coupling Calculation

    NASA Astrophysics Data System (ADS)

    Ma, Z.; Hou, Z.; Zang, X.

    2015-09-01

    As a large-scale flexible inflatable structure by a huge inner lifting gas volume of several hundred thousand cubic meters, the stratospheric airship's thermal characteristic of inner gas plays an important role in its structural performance. During the floating flight, the day-night variation of the combined thermal condition leads to the fluctuation of the flow field inside the airship, which will remarkably affect the pressure acted on the skin and the structural safety of the stratospheric airship. According to the multi-physics coupling mechanism mentioned above, a numerical procedure of structural safety analysis of stratospheric airships is developed and the thermal model, CFD model, finite element code and criterion of structural strength are integrated. Based on the computation models, the distributions of the deformations and stresses of the skin are calculated with the variation of day-night time. The effects of loads conditions and structural configurations on the structural safety of stratospheric airships in the floating condition are evaluated. The numerical results can be referenced for the structural design of stratospheric airships.

  12. Data-driven prognosis: a multi-physics approach verified via balloon burst experiment

    PubMed Central

    Chandra, Abhijit; Kar, Oliva

    2015-01-01

    A multi-physics formulation for data-driven prognosis (DDP) is developed. Unlike traditional predictive strategies that require controlled offline measurements or ‘training’ for determination of constitutive parameters to derive the transitional statistics, the proposed DDP algorithm relies solely on in situ measurements. It uses a deterministic mechanics framework, but the stochastic nature of the solution arises naturally from the underlying assumptions regarding the order of the conservation potential as well as the number of dimensions involved. The proposed DDP scheme is capable of predicting onset of instabilities. Because the need for offline testing (or training) is obviated, it can be easily implemented for systems where such a priori testing is difficult or even impossible to conduct. The prognosis capability is demonstrated here via a balloon burst experiment where the instability is predicted using only online visual observations. The DDP scheme never failed to predict the incipient failure, and no false-positives were issued. The DDP algorithm is applicable to other types of datasets. Time horizons of DDP predictions can be adjusted by using memory over different time windows. Thus, a big dataset can be parsed in time to make a range of predictions over varying time horizons.

  13. A novel medical image data-based multi-physics simulation platform for computational life sciences.

    PubMed

    Neufeld, Esra; Szczerba, Dominik; Chavannes, Nicolas; Kuster, Niels

    2013-04-01

    Simulating and modelling complex biological systems in computational life sciences requires specialized software tools that can perform medical image data-based modelling, jointly visualize the data and computational results, and handle large, complex, realistic and often noisy anatomical models. The required novel solvers must provide the power to model the physics, biology and physiology of living tissue within the full complexity of the human anatomy (e.g. neuronal activity, perfusion and ultrasound propagation). A multi-physics simulation platform satisfying these requirements has been developed for applications including device development and optimization, safety assessment, basic research, and treatment planning. This simulation platform consists of detailed, parametrized anatomical models, a segmentation and meshing tool, a wide range of solvers and optimizers, a framework for the rapid development of specialized and parallelized finite element method solvers, a visualization toolkit-based visualization engine, a Python scripting interface for customized applications, a coupling framework, and more. Core components are cross-platform compatible and use open formats. Several examples of applications are presented: hyperthermia cancer treatment planning, tumour growth modelling, evaluating the magneto-haemodynamic effect as a biomarker and physics-based morphing of anatomical models. PMID:24427518

  14. Multi-physical model of cation and water transport in ionic polymer-metal composite sensors

    NASA Astrophysics Data System (ADS)

    Zhu, Zicai; Chang, Longfei; Horiuchi, Tetsuya; Takagi, Kentaro; Aabloo, Alvo; Asaka, Kinji

    2016-03-01

    Ion-migration based electrical potential widely exists not only in natural systems but also in ionic polymer materials. We presented a multi-physical model and investigated the transport process of cation and water of ionic polymer-metal composites based on our thorough understanding on the ionic sensing mechanisms in this paper. The whole transport process was depicted by transport equations concerning convection flux under the total pressure gradient, electrical migration by the built-in electrical field, and the inter-coupling effect between cation and water. With numerical analysis, the influence of critical material parameters, the elastic modulus Ewet, the hydraulic permeability coefficient K, the diffusion coefficient of cation dII and water dWW, and the drag coefficient of water ndW, on the distribution of cation and water was investigated. It was obtained how these parameters correlate to the voltage characteristics (both magnitude and response speed) under a step bending. Additionally, it was found that the effective relative dielectric constant ɛr has little influence on the voltage but is positively correlated to the current. With a series of optimized parameters, the predicted voltage agreed with the experimental results well, which validated our model. Based on our physical model, it was suggested that an ionic polymer sensor can benefit from a higher modulus Ewet, a higher coefficient K and a lower coefficient dII, and a higher constant ɛr.

  15. Partitioned coupling strategies for multi-physically coupled radiative heat transfer problems

    NASA Astrophysics Data System (ADS)

    Wendt, Gunnar; Erbts, Patrick; Düster, Alexander

    2015-11-01

    This article aims to propose new aspects concerning a partitioned solution strategy for multi-physically coupled fields including the physics of thermal radiation. Particularly, we focus on the partitioned treatment of electro-thermo-mechanical problems with an additional fourth thermal radiation field. One of the main goals is to take advantage of the flexibility of the partitioned approach to enable combinations of different simulation software and solvers. Within the frame of this article, we limit ourselves to the case of nonlinear thermoelasticity at finite strains, using temperature-dependent material parameters. For the thermal radiation field, diffuse radiating surfaces and gray participating media are assumed. Moreover, we present a robust and fast partitioned coupling strategy for the fourth field problem. Stability and efficiency of the implicit coupling algorithm are improved drawing on several methods to stabilize and to accelerate the convergence. To conclude and to review the effectiveness and the advantages of the additional thermal radiation field several numerical examples are considered to study the proposed algorithm. In particular we focus on an industrial application, namely the electro-thermo-mechanical modeling of the field-assisted sintering technology.

  16. Variability of West African monsoon patterns generated by a WRF multi-physics ensemble

    NASA Astrophysics Data System (ADS)

    Klein, Cornelia; Heinzeller, Dominikus; Bliefernicht, Jan; Kunstmann, Harald

    2015-11-01

    The credibility of regional climate simulations over West Africa stands and falls with the ability to reproduce the West African monsoon (WAM) whose precipitation plays a pivotal role for people's livelihood. In this study, we simulate the WAM for the wet year 1999 with a 27-member multi-physics ensemble of the Weather Research and Forecasting (WRF) model. We investigate the inter-member differences in a process-based manner in order to extract generalizable information on the behavior of the tested cumulus (CU), microphysics (MP), and planetary boundary layer (PBL) schemes. Precipitation, temperature and atmospheric dynamics are analyzed in comparison to the Tropical Rainfall Measuring Mission (TRMM) rainfall estimates, the Global Precipitation Climatology Centre (GPCC) gridded gauge-analysis, the Global Historical Climatology Network (GHCN) gridded temperature product and the forcing data (ERA-Interim) to explore interdependencies of processes leading to a certain WAM regime. We find that MP and PBL schemes contribute most to the ensemble spread (147 mm month-1) for monsoon precipitation over the study region. Furthermore, PBL schemes have a strong influence on the movement of the WAM rainband because of their impact on the cloud fraction, that ranges from 8 to 20 % at 600 hPa during August. More low- and mid-level clouds result in less incoming radiation and a weaker monsoon. Ultimately, we identify the differing intensities of the moist Hadley-type meridional circulation that connects the monsoon winds to the Tropical Easterly Jet as the main source for inter-member differences. The ensemble spread of Sahel precipitation and associated dynamics for August 1999 is comparable to the observed inter-annual spread (1979-2010) between dry and wet years, emphasizing the strong potential impact of regional processes and the need for a careful selection of model parameterizations.

  17. Towards a multi-physics modelling framework for thrombolysis under the influence of blood flow

    PubMed Central

    Piebalgs, Andris

    2015-01-01

    Thrombolytic therapy is an effective means of treating thromboembolic diseases but can also give rise to life-threatening side effects. The infusion of a high drug concentration can provoke internal bleeding while an insufficient dose can lead to artery reocclusion. It is hoped that mathematical modelling of the process of clot lysis can lead to a better understanding and improvement of thrombolytic therapy. To this end, a multi-physics continuum model has been developed to simulate the dissolution of clot over time upon the addition of tissue plasminogen activator (tPA). The transport of tPA and other lytic proteins is modelled by a set of reaction–diffusion–convection equations, while blood flow is described by volume-averaged continuity and momentum equations. The clot is modelled as a fibrous porous medium with its properties being determined as a function of the fibrin fibre radius and voidage of the clot. A unique feature of the model is that it is capable of simulating the entire lytic process from the initial phase of lysis of an occlusive thrombus (diffusion-limited transport), the process of recanalization, to post-canalization thrombolysis under the influence of convective blood flow. The model has been used to examine the dissolution of a fully occluding clot in a simplified artery at different pressure drops. Our predicted lytic front velocities during the initial stage of lysis agree well with experimental and computational results reported by others. Following canalization, clot lysis patterns are strongly influenced by local flow patterns, which are symmetric at low pressure drops, but asymmetric at higher pressure drops, which give rise to larger recirculation regions and extended areas of intense drug accumulation. PMID:26655469

  18. Osiris: A Modern, High-Performance, Coupled, Multi-Physics Code For Nuclear Reactor Core Analysis

    SciTech Connect

    Procassini, R J; Chand, K K; Clouse, C J; Ferencz, R M; Grandy, J M; Henshaw, W D; Kramer, K J; Parsons, I D

    2007-02-26

    To meet the simulation needs of the GNEP program, LLNL is leveraging a suite of high-performance codes to be used in the development of a multi-physics tool for modeling nuclear reactor cores. The Osiris code project, which began last summer, is employing modern computational science techniques in the development of the individual physics modules and the coupling framework. Initial development is focused on coupling thermal-hydraulics and neutral-particle transport, while later phases of the project will add thermal-structural mechanics and isotope depletion. Osiris will be applicable to the design of existing and future reactor systems through the use of first-principles, coupled physics models with fine-scale spatial resolution in three dimensions and fine-scale particle-energy resolution. Our intent is to replace an existing set of legacy, serial codes which require significant approximations and assumptions, with an integrated, coupled code that permits the design of a reactor core using a first-principles physics approach on a wide range of computing platforms, including the world's most powerful parallel computers. A key research activity of this effort deals with the efficient and scalable coupling of physics modules which utilize rather disparate mesh topologies. Our approach allows each code module to use a mesh topology and resolution that is optimal for the physics being solved, and employs a mesh-mapping and data-transfer module to effect the coupling. Additional research is planned in the area of scalable, parallel thermal-hydraulics, high-spatial-accuracy depletion and coupled-physics simulation using Monte Carlo transport.

  19. Design and Analysis of a New Hair Sensor for Multi-Physical Signal Measurement

    PubMed Central

    Yang, Bo; Hu, Di; Wu, Lei

    2016-01-01

    A new hair sensor for multi-physical signal measurements, including acceleration, angular velocity and air flow, is presented in this paper. The entire structure consists of a hair post, a torsional frame and a resonant signal transducer. The hair post is utilized to sense and deliver the physical signals of the acceleration and the air flow rate. The physical signals are converted into frequency signals by the resonant transducer. The structure is optimized through finite element analysis. The simulation results demonstrate that the hair sensor has a frequency of 240 Hz in the first mode for the acceleration or the air flow sense, 3115 Hz in the third and fourth modes for the resonant conversion, and 3467 Hz in the fifth and sixth modes for the angular velocity transformation, respectively. All the above frequencies present in a reasonable modal distribution and are separated from interference modes. The input-output analysis of the new hair sensor demonstrates that the scale factor of the acceleration is 12.35 Hz/g, the scale factor of the angular velocity is 0.404 nm/deg/s and the sensitivity of the air flow is 1.075 Hz/(m/s)2, which verifies the multifunction sensitive characteristics of the hair sensor. Besides, the structural optimization of the hair post is used to improve the sensitivity of the air flow rate and the acceleration. The analysis results illustrate that the hollow circular hair post can increase the sensitivity of the air flow and the II-shape hair post can increase the sensitivity of the acceleration. Moreover, the thermal analysis confirms the scheme of the frequency difference for the resonant transducer can prominently eliminate the temperature influences on the measurement accuracy. The air flow analysis indicates that the surface area increase of hair post is significantly beneficial for the efficiency improvement of the signal transmission. In summary, the structure of the new hair sensor is proved to be feasible by comprehensive

  20. Design and Analysis of a New Hair Sensor for Multi-Physical Signal Measurement.

    PubMed

    Yang, Bo; Hu, Di; Wu, Lei

    2016-01-01

    A new hair sensor for multi-physical signal measurements, including acceleration, angular velocity and air flow, is presented in this paper. The entire structure consists of a hair post, a torsional frame and a resonant signal transducer. The hair post is utilized to sense and deliver the physical signals of the acceleration and the air flow rate. The physical signals are converted into frequency signals by the resonant transducer. The structure is optimized through finite element analysis. The simulation results demonstrate that the hair sensor has a frequency of 240 Hz in the first mode for the acceleration or the air flow sense, 3115 Hz in the third and fourth modes for the resonant conversion, and 3467 Hz in the fifth and sixth modes for the angular velocity transformation, respectively. All the above frequencies present in a reasonable modal distribution and are separated from interference modes. The input-output analysis of the new hair sensor demonstrates that the scale factor of the acceleration is 12.35 Hz/g, the scale factor of the angular velocity is 0.404 nm/deg/s and the sensitivity of the air flow is 1.075 Hz/(m/s)², which verifies the multifunction sensitive characteristics of the hair sensor. Besides, the structural optimization of the hair post is used to improve the sensitivity of the air flow rate and the acceleration. The analysis results illustrate that the hollow circular hair post can increase the sensitivity of the air flow and the II-shape hair post can increase the sensitivity of the acceleration. Moreover, the thermal analysis confirms the scheme of the frequency difference for the resonant transducer can prominently eliminate the temperature influences on the measurement accuracy. The air flow analysis indicates that the surface area increase of hair post is significantly beneficial for the efficiency improvement of the signal transmission. In summary, the structure of the new hair sensor is proved to be feasible by comprehensive

  1. Supercomputing with TOUGH2 family codes for coupled multi-physics simulations of geologic carbon sequestration

    NASA Astrophysics Data System (ADS)

    Yamamoto, H.; Nakajima, K.; Zhang, K.; Nanai, S.

    2015-12-01

    scalabilities showing almost linear speedup against number of processors up to over ten thousand cores. Generally this allows us to perform coupled multi-physics (THC) simulations on high resolution geologic models with multi-million grid in a practical time (e.g., less than a second per time step).

  2. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  3. Multi-physics and multi-scale characterization of shale anisotropy

    NASA Astrophysics Data System (ADS)

    Sarout, J.; Nadri, D.; Delle Piane, C.; Esteban, L.; Dewhurst, D.; Clennell, M. B.

    2012-12-01

    Shales are the most abundant sedimentary rock type in the Earth's shallow crust. In the past decade or so, they have attracted increased attention from the petroleum industry as reservoirs, as well as more traditionally for their sealing capacity for hydrocarbon/CO2 traps or underground waste repositories. The effectiveness of both fundamental and applied shale research is currently limited by (i) the extreme variability of physical, mechanical and chemical properties observed for these rocks, and by (ii) the scarce data currently available. The variability in observed properties is poorly understood due to many factors that are often irrelevant for other sedimentary rocks. The relationships between these properties and the petrophysical measurements performed at the field and laboratory scales are not straightforward, translating to a scale dependency typical of shale behaviour. In addition, the complex and often anisotropic micro-/meso-structures of shales give rise to a directional dependency of some of the measured physical properties that are tensorial by nature such as permeability or elastic stiffness. Currently, fundamental understanding of the parameters controlling the directional and scale dependency of shale properties is far from complete. Selected results of a multi-physics laboratory investigation of the directional and scale dependency of some critical shale properties are reported. In particular, anisotropic features of shale micro-/meso-structures are related to the directional-dependency of elastic and fluid transport properties: - Micro-/meso-structure (μm to cm scale) characterization by electron microscopy and X-ray tomography; - Estimation of elastic anisotropy parameters on a single specimen using elastic wave propagation (cm scale); - Estimation of the permeability tensor using the steady-state method on orthogonal specimens (cm scale); - Estimation of the low-frequency diffusivity tensor using NMR method on orthogonal specimens (<

  4. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  5. Multi-physics computational grains (MPCGs) for direct numerical simulation (DNS) of piezoelectric composite/porous materials and structures

    NASA Astrophysics Data System (ADS)

    Bishay, Peter L.; Dong, Leiting; Atluri, Satya N.

    2014-11-01

    Conceptually simple and computationally most efficient polygonal computational grains with voids/inclusions are proposed for the direct numerical simulation of the micromechanics of piezoelectric composite/porous materials with non-symmetrical arrangement of voids/inclusions. These are named "Multi-Physics Computational Grains" (MPCGs) because each "mathematical grain" is geometrically similar to the irregular shapes of the physical grains of the material in the micro-scale. So each MPCG element represents a grain of the matrix of the composite and can include a pore or an inclusion. MPCG is based on assuming independent displacements and electric-potentials in each cell. The trial solutions in each MPCG do not need to satisfy the governing differential equations, however, they are still complete, and can efficiently model concentration of electric and mechanical fields. MPCG can be used to model any generally anisotropic material as well as nonlinear problems. The essential idea can also be easily applied to accurately solve other multi-physical problems, such as complex thermal-electro-magnetic-mechanical materials modeling. Several examples are presented to show the capabilities of the proposed MPCGs and their accuracy.

  6. Transient multi-physics analysis of a magnetorheological shock absorber with the inverse Jiles-Atherton hysteresis model

    NASA Astrophysics Data System (ADS)

    Zheng, Jiajia; Li, Yancheng; Li, Zhaochun; Wang, Jiong

    2015-10-01

    This paper presents multi-physics modeling of an MR absorber considering the magnetic hysteresis to capture the nonlinear relationship between the applied current and the generated force under impact loading. The magnetic field, temperature field, and fluid dynamics are represented by the Maxwell equations, conjugate heat transfer equations, and Navier-Stokes equations. These fields are coupled through the apparent viscosity and the magnetic force, both of which in turn depend on the magnetic flux density and the temperature. Based on a parametric study, an inverse Jiles-Atherton hysteresis model is used and implemented for the magnetic field simulation. The temperature rise of the MR fluid in the annular gap caused by core loss (i.e. eddy current loss and hysteresis loss) and fluid motion is computed to investigate the current-force behavior. A group of impulsive tests was performed for the manufactured MR absorber with step exciting currents. The numerical and experimental results showed good agreement, which validates the effectiveness of the proposed multi-physics FEA model.

  7. Development of a multi-physics calculation platform dedicated to irradiation devices in a material testing reactor

    SciTech Connect

    Bonaccorsi, T.; Di Salvo, J.; Aggery, A.; D'Aletto, C.; Doederlein, C.; Sireta, P.; Willermoz, G.; Daniel, M.

    2006-07-01

    The physical phenomena involved in irradiation devices within material testing reactors are complex (neutron and photon interactions, nuclear heating, thermal hydraulics, ...). However, the simulation of these phenomena requires a high precision in order to control the condition of the experiment and the development of predictive models. Until now, physicists use different tools with several approximations at each interface. The aim of this work is to develop a calculation platform dedicated to numerical multi-physics simulations of irradiation devices in the future European Jules Horowitz Reactor [1], This platform is based on a multi-physics data model which describes geometries, materials and state parameters associated with a sequence of thematic (neutronics, thermal hydraulics...) computations of these devices. Once the computation is carried out, the results can be returned to the data model (DM). The DM is encapsulated in a dedicated module of the SALOME platform [2] and exchanges data with SALOME native modules. This method allows a parametric description of a study, independent of the code used to perform the simulation. The application proposed in this paper concerns neutronic calculation of a fuel irradiation device with the new method of characteristics implemented in the APOLLO2 code [3]. The device is located at the periphery of the OSIRIS core. This choice is motivated by the possibility to compare the calculation with experimental results, which cannot be done for the Jules Horowitz Reactor, currently in design study phase. (authors)

  8. A full-spectrum analysis of high-speed train interior noise under multi-physical-field coupling excitations

    NASA Astrophysics Data System (ADS)

    Zheng, Xu; Hao, Zhiyong; Wang, Xu; Mao, Jie

    2016-06-01

    High-speed-railway-train interior noise at low, medium, and high frequencies could be simulated by finite element analysis (FEA) or boundary element analysis (BEA), hybrid finite element analysis-statistical energy analysis (FEA-SEA) and statistical energy analysis (SEA), respectively. First, a new method named statistical acoustic energy flow (SAEF) is proposed, which can be applied to the full-spectrum HST interior noise simulation (including low, medium, and high frequencies) with only one model. In an SAEF model, the corresponding multi-physical-field coupling excitations are firstly fully considered and coupled to excite the interior noise. The interior noise attenuated by sound insulation panels of carriage is simulated through modeling the inflow acoustic energy from the exterior excitations into the interior acoustic cavities. Rigid multi-body dynamics, fast multi-pole BEA, and large-eddy simulation with indirect boundary element analysis are first employed to extract the multi-physical-field excitations, which include the wheel-rail interaction forces/secondary suspension forces, the wheel-rail rolling noise, and aerodynamic noise, respectively. All the peak values and their frequency bands of the simulated acoustic excitations are validated with those from the noise source identification test. Besides, the measured equipment noise inside equipment compartment is used as one of the excitation sources which contribute to the interior noise. Second, a full-trimmed FE carriage model is firstly constructed, and the simulated modal shapes and frequencies agree well with the measured ones, which has validated the global FE carriage model as well as the local FE models of the aluminum alloy-trim composite panel. Thus, the sound transmission loss model of any composite panel has indirectly been validated. Finally, the SAEF model of the carriage is constructed based on the accurate FE model and stimulated by the multi-physical-field excitations. The results show

  9. A mathematical model for predicting photo-induced voltage and photostriction of PLZT with coupled multi-physics fields and its application

    NASA Astrophysics Data System (ADS)

    Huang, J. H.; Wang, X. J.; Wang, J.

    2016-02-01

    The primary purpose of this paper is to propose a mathematical model of PLZT ceramic with coupled multi-physics fields, e.g. thermal, electric, mechanical and light field. To this end, the coupling relationships of multi-physics fields and the mechanism of some effects resulting in the photostrictive effect are analyzed theoretically, based on which a mathematical model considering coupled multi-physics fields is established. According to the analysis and experimental results, the mathematical model can explain the hysteresis phenomenon and the variation trend of the photo-induced voltage very well and is in agreement with the experimental curves. In addition, the PLZT bimorph is applied as an energy transducer for a photovoltaic-electrostatic hybrid actuated micromirror, and the relation of the rotation angle and the photo-induced voltage is discussed based on the novel photostrictive mathematical model.

  10. Analysis of Thermal Field on Integrated LED Light Source Based on COMSOL Multi-physics Finite Element Simulation

    NASA Astrophysics Data System (ADS)

    Li, Jingsong; Yang, Qingxin; Niu, Pingjuan; Jin, Liang; Meng, Bo; Li, Yang; Xiao, Zhaoxia; Zhang, Xian

    This paper obtained the average integrated heat transfer coefficient for the thermal resistance of a classic of integrated LED light source and its cooling fin-root on the basis of thermal circuit method. Simulation analysis on its steady-state temperature field distribution using COMSOL Multi-physics finite element method was carried out. This method has high precision and intuitive simulation results. The iteration method of the Numerical Analysis is introduced into method for the first time. The results have significant promotion on the LED cast light structure optimization and the affection of reduced heat coupling on the light temperature distribution. The comparison between thermocouple experimental data and calculation results proved the correctness and validity of the proposed method. This experimental study plays a guiding role to thermal analysis and design of other integrated lights.

  11. Investigation on Multi-Physics Simulation-Based Virtual Machining System for Vibratory Finishing of Integrally Bladed Rotors (IBRS)

    NASA Astrophysics Data System (ADS)

    Achiamah-Ampomah, N.; Cheng, Kai

    2016-02-01

    An investigation was carried out to improve the slow surface finishing times of integrally bladed rotors (IBRs) in the aerospace industry. Traditionally they are finished by hand, or more currently by abrasive flow machining. The use of a vibratory finishing technique to improve process times has been suggested; however as a largely empirical process, very few studies have been done to improve and optimize the cycle times, showing that critical and ongoing research is still needed in this area. An extensive review of the literature was carried out, and the findings used to identify the key parameters and model equations which govern the vibratory process. Recommendations were made towards a multi-physics-based simulation model, as well as projections made for the future of vibratory finishing and optimization of surface finishes and cycle times.

  12. Modulators of cyclic AMP systems.

    PubMed

    Hess, S M; Chasin, M; Free, C A; Harris, D N

    1975-01-01

    On the basis of the data reported here, one may conclude that although many agents that act in the central nervous system are modulators of the action of cyclic AMP, it is difficult to establish a direct connection between the pharmacologic activity and the levels of cyclic AMP in the brain. This lack of interrelation applies to the benzodiazepines as well as to the pyrazolopyridines. The data for members of the latter group are somewhat frustrating in this regard, since an excellent correlation has been shown to exist between the potency of inhibition of PDE and activity in the antianxiety test. In measurements of steroidogenesis in the isolated adrenal cell, the correlation between activity in vito and the conflict assay is even better. The data presented here and reported elsewhere (Shimizu et al., 1974; Kelly et al., 1974; Mayer and King, 1974; King and Mayer, 1974) provide evidence that agents that act as inhibitors of PDE in cell-free systems exert their influence on cyclic AMP in tissue slices of the brain of guinea pigs by mechanisms that seem not to be related to an effect on PDE. Papaverine, and possibly chlordiazepoxide, may act by releasing agonists that, in turn, stimulate the accumulation of cyclic AMP. This activity is blocked bo other inhibitors of PDE, such as theophyline. Results obtained by the use of platelets are refreshingly clear. Inhibition of aggregation has been shown to occur when the level of cyclic AMP is raised, and a suggestive exists that the most potent inhibitors of platelet PDE are the best potentiators of the action of PGE1 in blocking aggregation. The study utilizing drugs collected from a large number of therapeutic classes makes clear that it is difficult to attribute the mechanism of action for any of the classes studied to modulation of cyclic AMP. An unexpected finding of this study, however, was the fact that pharmacologic agents include an unusually large number of inhibitors of PDE as compared with agents chosen at

  13. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  14. Multi-physics damage sensing in nano-engineered structural composites

    NASA Astrophysics Data System (ADS)

    Guzmán de Villoria, Roberto; Yamamoto, Namiko; Miravete, Antonio; Wardle, Brian L.

    2011-05-01

    Non-destructive evaluation techniques can offer viable diagnostic and prognostic routes to mitigating failures in engineered structures such as bridges, buildings and vehicles. However, existing techniques have significant drawbacks, including poor spatial resolution and limited in situ capabilities. We report here a novel approach where structural advanced composites containing electrically conductive aligned carbon nanotubes (CNTs) are ohmically heated via simple electrical contacts, and damage is visualized via thermographic imaging. Damage, in the form of cracks and other discontinuities, usefully increases resistance to both electrical and thermal transport in these materials, which enables tomographic full-field damage assessment in many cases. Characteristics of the technique include the ability for real-time measurement of the damage state during loading, low-power operation (e.g. 15 °C rise at 1 W), and beyond state-of-the-art spatial resolution for sensing damage in composites. The enhanced thermographic technique is a novel and practical approach for in situ monitoring to ascertain structural health and to prevent structural failures in engineered structures such as aerospace and automotive vehicles and wind turbine blades, among others.

  15. Multi-physics damage sensing in nano-engineered structural composites.

    PubMed

    de Villoria, Roberto Guzmán; Yamamoto, Namiko; Miravete, Antonio; Wardle, Brian L

    2011-05-01

    Non-destructive evaluation techniques can offer viable diagnostic and prognostic routes to mitigating failures in engineered structures such as bridges, buildings and vehicles. However, existing techniques have significant drawbacks, including poor spatial resolution and limited in situ capabilities. We report here a novel approach where structural advanced composites containing electrically conductive aligned carbon nanotubes (CNTs) are ohmically heated via simple electrical contacts, and damage is visualized via thermographic imaging. Damage, in the form of cracks and other discontinuities, usefully increases resistance to both electrical and thermal transport in these materials, which enables tomographic full-field damage assessment in many cases. Characteristics of the technique include the ability for real-time measurement of the damage state during loading, low-power operation (e.g. 15 °C rise at 1 W), and beyond state-of-the-art spatial resolution for sensing damage in composites. The enhanced thermographic technique is a novel and practical approach for in situ monitoring to ascertain structural health and to prevent structural failures in engineered structures such as aerospace and automotive vehicles and wind turbine blades, among others. PMID:21427475

  16. Pseudomonas aeruginosa β-lactamase induction requires two permeases, AmpG and AmpP

    PubMed Central

    2010-01-01

    Background In Enterobacteriaceae, β-lactam antibiotic resistance involves murein recycling intermediates. Murein recycling is a complex process with discrete steps taking place in the periplasm and the cytoplasm. The AmpG permease is critical to this process as it transports N-acetylglucosamine anhydrous N-acetylmuramyl peptides across the inner membrane. In Pseudomonadaceae, this intrinsic mechanism remains to be elucidated. Since the mechanism involves two cellular compartments, the characterization of transporters is crucial to establish the link. Results Pseudomonas aeruginosa PAO1 has two ampG paralogs, PA4218 (ampP) and PA4393 (ampG). Topology analysis using β-galactosidase and alkaline phosphatase fusions indicates ampP and ampG encode proteins which possess 10 and 14 transmembrane helices, respectively, that could potentially transport substrates. Both ampP and ampG are required for maximum expression of β-lactamase, but complementation and kinetic experiments suggest they act independently to play different roles. Mutation of ampG affects resistance to a subset of β-lactam antibiotics. Low-levels of β-lactamase induction occur independently of either ampP or ampG. Both ampG and ampP are the second members of two independent two-gene operons. Analysis of the ampG and ampP operon expression using β-galactosidase transcriptional fusions showed that in PAO1, ampG operon expression is β-lactam and ampR-independent, while ampP operon expression is β-lactam and ampR-dependent. β-lactam-dependent expression of the ampP operon and independent expression of the ampG operon is also dependent upon ampP. Conclusions In P. aeruginosa, β-lactamase induction occurs in at least three ways, induction at low β-lactam concentrations by an as yet uncharacterized pathway, at intermediate concentrations by an ampP and ampG dependent pathway, and at high concentrations where although both ampP and ampG play a role, ampG may be of greater importance. Both ampP and amp

  17. Modeling and simulation of multi-physics multi-scale transport phenomenain bio-medical applications

    NASA Astrophysics Data System (ADS)

    Kenjereš, Saša

    2014-08-01

    We present a short overview of some of our most recent work that combines the mathematical modeling, advanced computer simulations and state-of-the-art experimental techniques of physical transport phenomena in various bio-medical applications. In the first example, we tackle predictions of complex blood flow patterns in the patient-specific vascular system (carotid artery bifurcation) and transfer of the so-called "bad" cholesterol (low-density lipoprotein, LDL) within the multi-layered artery wall. This two-way coupling between the blood flow and corresponding mass transfer of LDL within the artery wall is essential for predictions of regions where atherosclerosis can develop. It is demonstrated that a recently developed mathematical model, which takes into account the complex multi-layer arterial-wall structure, produced LDL profiles within the artery wall in good agreement with in-vivo experiments in rabbits, and it can be used for predictions of locations where the initial stage of development of atherosclerosis may take place. The second example includes a combination of pulsating blood flow and medical drug delivery and deposition controlled by external magnetic field gradients in the patient specific carotid artery bifurcation. The results of numerical simulations are compared with own PIV (Particle Image Velocimetry) and MRI (Magnetic Resonance Imaging) in the PDMS (silicon-based organic polymer) phantom. A very good agreement between simulations and experiments is obtained for different stages of the pulsating cycle. Application of the magnetic drug targeting resulted in an increase of up to ten fold in the efficiency of local deposition of the medical drug at desired locations. Finally, the LES (Large Eddy Simulation) of the aerosol distribution within the human respiratory system that includes up to eight bronchial generations is performed. A very good agreement between simulations and MRV (Magnetic Resonance Velocimetry) measurements is obtained

  18. The atmospheric component of the Mediterranean Sea water budget in a WRF multi-physics ensemble and observations

    NASA Astrophysics Data System (ADS)

    Di Luca, Alejandro; Flaounas, Emmanouil; Drobinski, Philippe; Brossier, Cindy Lebeaupin

    2014-11-01

    The use of high resolution atmosphere-ocean coupled regional climate models to study possible future climate changes in the Mediterranean Sea requires an accurate simulation of the atmospheric component of the water budget (i.e., evaporation, precipitation and runoff). A specific configuration of the version 3.1 of the weather research and forecasting (WRF) regional climate model was shown to systematically overestimate the Mediterranean Sea water budget mainly due to an excess of evaporation (~1,450 mm yr-1) compared with observed estimations (~1,150 mm yr-1). In this article, a 70-member multi-physics ensemble is used to try to understand the relative importance of various sub-grid scale processes in the Mediterranean Sea water budget and to evaluate its representation by comparing simulated results with observed-based estimates. The physics ensemble was constructed by performing 70 1-year long simulations using version 3.3 of the WRF model by combining six cumulus, four surface/planetary boundary layer and three radiation schemes. Results show that evaporation variability across the multi-physics ensemble (˜10 % of the mean evaporation) is dominated by the choice of the surface layer scheme that explains more than ˜70 % of the total variance and that the overestimation of evaporation in WRF simulations is generally related with an overestimation of surface exchange coefficients due to too large values of the surface roughness parameter and/or the simulation of too unstable surface conditions. Although the influence of radiation schemes on evaporation variability is small (˜13 % of the total variance), radiation schemes strongly influence exchange coefficients and vertical humidity gradients near the surface due to modifications of temperature lapse rates. The precipitation variability across the physics ensemble (˜35 % of the mean precipitation) is dominated by the choice of both cumulus (˜55 % of the total variance) and planetary boundary layer (˜32 % of

  19. Multi-Physics Modeling of Molten Salt Transport in Solid Oxide Membrane (SOM) Electrolysis and Recycling of Magnesium

    SciTech Connect

    Powell, Adam; Pati, Soobhankar

    2012-03-11

    Solid Oxide Membrane (SOM) Electrolysis is a new energy-efficient zero-emissions process for producing high-purity magnesium and high-purity oxygen directly from industrial-grade MgO. SOM Recycling combines SOM electrolysis with electrorefining, continuously and efficiently producing high-purity magnesium from low-purity partially oxidized scrap. In both processes, electrolysis and/or electrorefining take place in the crucible, where raw material is continuously fed into the molten salt electrolyte, producing magnesium vapor at the cathode and oxygen at the inert anode inside the SOM. This paper describes a three-dimensional multi-physics finite-element model of ionic current, fluid flow driven by argon bubbling and thermal buoyancy, and heat and mass transport in the crucible. The model predicts the effects of stirring on the anode boundary layer and its time scale of formation, and the effect of natural convection at the outer wall. MOxST has developed this model as a tool for scale-up design of these closely-related processes.

  20. Uncertainties propagation in the framework of a Rod Ejection Accident modeling based on a multi-physics approach

    SciTech Connect

    Le Pallec, J. C.; Crouzet, N.; Bergeaud, V.; Delavaud, C.

    2012-07-01

    The control of uncertainties in the field of reactor physics and their propagation in best-estimate modeling are a major issue in safety analysis. In this framework, the CEA develops a methodology to perform multi-physics simulations including uncertainties analysis. The present paper aims to present and apply this methodology for the analysis of an accidental situation such as REA (Rod Ejection Accident). This accident is characterized by a strong interaction between the different areas of the reactor physics (neutronic, fuel thermal and thermal hydraulic). The modeling is performed with CRONOS2 code. The uncertainties analysis has been conducted with the URANIE platform developed by the CEA: For each identified response from the modeling (output) and considering a set of key parameters with their uncertainties (input), a surrogate model in the form of a neural network has been produced. The set of neural networks is then used to carry out a sensitivity analysis which consists on a global variance analysis with the determination of the Sobol indices for all responses. The sensitivity indices are obtained for the input parameters by an approach based on the use of polynomial chaos. The present exercise helped to develop a methodological flow scheme, to consolidate the use of URANIE tool in the framework of parallel calculations. Finally, the use of polynomial chaos allowed computing high order sensitivity indices and thus highlighting and classifying the influence of identified uncertainties on each response of the analysis (single and interaction effects). (authors)

  1. Parallel Monte Carlo transport modeling in the context of a time-dependent, three-dimensional multi-physics code

    SciTech Connect

    Procassini, R.J.

    1997-12-31

    The fine-scale, multi-space resolution that is envisioned for accurate simulations of complex weapons systems in three spatial dimensions implies flop-rate and memory-storage requirements that will only be obtained in the near future through the use of parallel computational techniques. Since the Monte Carlo transport models in these simulations usually stress both of these computational resources, they are prime candidates for parallelization. The MONACO Monte Carlo transport package, which is currently under development at LLNL, will utilize two types of parallelism within the context of a multi-physics design code: decomposition of the spatial domain across processors (spatial parallelism) and distribution of particles in a given spatial subdomain across additional processors (particle parallelism). This implementation of the package will utilize explicit data communication between domains (message passing). Such a parallel implementation of a Monte Carlo transport model will result in non-deterministic communication patterns. The communication of particles between subdomains during a Monte Carlo time step may require a significant level of effort to achieve a high parallel efficiency.

  2. Numerical simulation and experimental validation of biofilm in a multi-physics framework using an SPH based method

    NASA Astrophysics Data System (ADS)

    Soleimani, Meisam; Wriggers, Peter; Rath, Henryke; Stiesch, Meike

    2016-06-01

    In this paper, a 3D computational model has been developed to investigate biofilms in a multi-physics framework using smoothed particle hydrodynamics (SPH) based on a continuum approach. Biofilm formation is a complex process in the sense that several physical phenomena are coupled and consequently different time-scales are involved. On one hand, biofilm growth is driven by biological reaction and nutrient diffusion and on the other hand, it is influenced by fluid flow causing biofilm deformation and interface erosion in the context of fluid and deformable solid interaction. The geometrical and numerical complexity arising from these phenomena poses serious complications and challenges in grid-based techniques such as finite element. Here the solution is based on SPH as one of the powerful meshless methods. SPH based computational modeling is quite new in the biological community and the method is uniquely robust in capturing the interface-related processes of biofilm formation such as erosion. The obtained results show a good agreement with experimental and published data which demonstrates that the model is capable of simulating and predicting overall spatial and temporal evolution of biofilm.

  3. 8-Chloro-cAMP induces apoptotic cell death in a human mammary carcinoma cell (MCF-7) line.

    PubMed Central

    Bøe, R.; Gjertsen, B. T.; Døskeland, S. O.; Vintermyr, O. K.

    1995-01-01

    8-Cl-cAMP and 8-NH2-cAMP induced MCF-7 cell death. The type(s) of cell death were studied in more detail and compared with the cell death type (apoptosis) induced by okadaic acid, an inhibitor of serine/threonine phosphatases. By morphological criteria dying cells showed loss of cell-cell interactions and microvilli, condensation of nuclear chromatin and segregation of cytoplasmic organelles. By in situ nick end-labelling, using digoxigenin-conjugated dUTP as probe, a large fraction of 8-Cl-cAMP, 8-NH2-cAMP and 8-Cl-adenosine-exposed cells stained positively in the advanced stages of death. In the early phase of chromatin condensation the cells stained negatively. Specific (internucleosomal) DNA fragmentation was not observed. The MCF-7 cell death induced by 8-Cl-cAMP and 8-NH2-cAMP was not mediated by activation of the cAMP kinase since more stable cAMP analogues (8-CPT-cAMP and N6-benzoyl-cAMP) or forskolin failed to induce death. Furthermore, 8-Cl-cAMP action was counteracted by adenosine deaminase and 3-isobutyl-1-methylxanthine, and mimicked by 8-Cl-adenosine, a major metabolite of 8-Cl-cAMP. It is concluded that 8-Cl- and 8-NH2-cAMP can induce morphological and biochemical effects resembling apoptotic cell death in MCF-7 cells through their conversion into potent cytotoxic metabolite(s). Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7577461

  4. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  5. Effects of glucagon-like peptide-1 on advanced glycation endproduct-induced aortic endothelial dysfunction in streptozotocin-induced diabetic rats: possible roles of Rho kinase- and AMP kinase-mediated nuclear factor κB signaling pathways.

    PubMed

    Tang, Song-Tao; Zhang, Qiu; Tang, Hai-Qin; Wang, Chang-Jiang; Su, Huan; Zhou, Qing; Wei, Wei; Zhu, Hua-Qing; Wang, Yuan

    2016-07-01

    Interaction between advanced glycation endproducts (AGEs) and receptor for AGEs (RAGE) as well as downstream pathways leads to vascular endothelial dysfunction in diabetes. Glucagon-like peptide-1 (GLP-1) has been reported to attenuate endothelial dysfunction in the models of atherosclerosis. However, whether GLP-1 exerts protective effects on aortic endothelium in diabetic animal model and the underlying mechanisms are still not well defined. Experimental diabetes was induced through administration with combination of high-fat diet and intraperitoneal injection of streptozotocin. Rats were randomly divided into four groups, including controls, diabetes, diabetes + sitagliptin (30 mg/kg/day), diabetes + exenatide (3 μg/kg/12 h). Eventually, endothelial damage, markers of inflammation and oxidative stress, were measured. After 12 weeks administration, diabetic rats received sitagliptin and exenatide showed significant elevation of serum NO level and reduction of ET-1 as well as inflammatory cytokines levels. Moreover, sitagliptin and exenatide significantly inhibited aortic oxidative stress level and improved aortic endothelial function in diabetic rats. Importantly, these drugs inhibited the protein expression level in AGE/RAGE-induced RhoA/ROCK/NF-κB/IκBα signaling pathways and activated AMPK in diabetic aorta. Finally, the target proteins of p-eNOS, iNOS, and ET-1, which reflect endothelial function, were also changed by these drugs. Our present study indicates that sitagliptin and exenatide administrations can improve endothelial function in diabetic aorta. Of note, RAGE/RhoA/ROCK and AMPK mediated NF-κB signaling pathways may be the intervention targets of these drugs to protect aortic endothelium. PMID:26758998

  6. Multi-Scale Multi-physics Methods Development for the Calculation of Hot-Spots in the NGNP

    SciTech Connect

    Downar, Thomas; Seker, Volkan

    2013-04-30

    Radioactive gaseous fission products are released out of the fuel element at a significantly higher rate when the fuel temperature exceeds 1600°C in high-temperature gas-cooled reactors (HTGRs). Therefore, it is of paramount importance to accurately predict the peak fuel temperature during all operational and design-basis accident conditions. The current methods used to predict the peak fuel temperature in HTGRs, such as the Next-Generation Nuclear Plant (NGNP), estimate the average fuel temperature in a computational mesh modeling hundreds of fuel pebbles or a fuel assembly in a pebble-bed reactor (PBR) or prismatic block type reactor (PMR), respectively. Experiments conducted in operating HTGRs indicate considerable uncertainty in the current methods and correlations used to predict actual temperatures. The objective of this project is to improve the accuracy in the prediction of local "hot" spots by developing multi-scale, multi-physics methods and implementing them within the framework of established codes used for NGNP analysis.The multi-scale approach which this project will implement begins with defining suitable scales for a physical and mathematical model and then deriving and applying the appropriate boundary conditions between scales. The macro scale is the greatest length that describes the entire reactor, whereas the meso scale models only a fuel block in a prismatic reactor and ten to hundreds of pebbles in a pebble bed reactor. The smallest scale is the micro scale--the level of a fuel kernel of the pebble in a PBR and fuel compact in a PMR--which needs to be resolved in order to calculate the peak temperature in a fuel kernel.

  7. Analysis of scheme interrelationships for model calibration and improvement using the Noah land surface model with multi-physics options

    NASA Astrophysics Data System (ADS)

    Hong, S.; Park, S. K.; Choi, Y.; Myoung, B.

    2013-12-01

    As the importance of the land surface models (LSMs) has been increasingly magnified due to their pivotal role in the complete Earth environmental system, linking the atmosphere, hydrosphere, and biosphere, modeling accuracy at regional scales has been important to ensure better representations of increased land surface heterogeneities with the increase of spatial resolutions. However, every model has its own weaknesses induced by such problems as the reality of physical schemes by uncertain parameterizing methods and even structural unreality by simplified model designs. One of the major uncertainties is Interrelationships between implemented physical schemes and their impact on simulation accuracy. Using the new version of Noah land surface model with multi-physics option (Noah-MP) that enables to create various scheme combinations, we examined how each scheme in different scheme combinations contributes to better simulations and how their interrelationships vary with uncertain parameter changes. Targeting long term (5 year) monthly surface hydrology of Han River watershed in South Korea, we mainly explored the simulation accuracy of runoff and evapotranspiration, and additionally that of leaf area index in order to see the vegetation impact on surface water partitioning. The result indicates that the primary contributor for simulation accuracies were the schemes of surface heat exchange coefficient. These schemes are very sensitive to vegetation amount due to their different treatment of heat transfer between on bare and vegetated surface. Showing that further improvement through uncertain parameter calibration, this study also demonstrated that the combination of analyses of scheme interrelationships and parameter calibration promises improved model calibration. In addition, revealing remained uncertainty about the vegetation effect on surface energy and water partitioning, this study also showed that the scheme interrelationship analyses is useful for model

  8. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  9. The dependence of Escherichia coli asparaginase II formation on cyclic AMP and cyclic AMP receptor protein.

    PubMed

    Russell, L; Yamazaki, H

    1978-05-01

    The amount of asparaginase II in an Escherichia coli wild-type strain (cya+, crp+) markedly increased upon a shift from aerobic to anaerobic growth. However, no such increase occurred in a mutant (cya) lacking cyclic AMP synthesis unless supplemented with exogenous cyclic AMP. Since a mutant (crp) deficient in cyclic AMP receptor protein also did not support the anaerobic formation of this enzyme, it is concluded that the formation of E. coli asparaginase II depends on both cyclic AMP and cyclic AMP receptor protein. PMID:207402

  10. Cyclic di-AMP mediates biofilm formation.

    PubMed

    Peng, Xian; Zhang, Yang; Bai, Guangchun; Zhou, Xuedong; Wu, Hui

    2016-03-01

    Cyclic di-AMP (c-di-AMP) is an emerging second messenger in bacteria. It has been shown to play important roles in bacterial fitness and virulence. However, transduction of c-di-AMP signaling in bacteria and the role of c-di-AMP in biofilm formation are not well understood. The level of c-di-AMP is modulated by activity of di-adenylyl cyclase that produces c-di-AMP and phosphodiesterase (PDE) that degrades c-di-AMP. In this study, we determined that increased c-di-AMP levels by deletion of the pdeA gene coding for a PDE promoted biofilm formation in Streptococcus mutans. Deletion of pdeA upregulated expression of gtfB, the gene coding for a major glucan producing enzyme. Inactivation of gtfB blocked the increased biofilm by the pdeA mutant. Two c-di-AMP binding proteins including CabPA (SMU_1562) and CabPB (SMU_1708) were identified. Interestingly, only CabPA deficiency inhibited both the increased biofilm formation and the upregulated expression of GtfB observed in the pdeA mutant. In addition, CabPA but not CabPB interacted with VicR, a known transcriptional factor that regulates expression of gtfB, suggesting that a signaling link between CabPA and GtfB through VicR. Increased biofilm by the pdeA deficiency also enhanced bacterial colonization of Drosophila in vivo. Taken together, our studies reveal a new role of c-di-AMP in mediating biofilm formation through a CabPA/VicR/GtfB signaling network in S. mutans. PMID:26564551

  11. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  12. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  13. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  14. Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation

    PubMed Central

    Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.

    2013-01-01

    An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367

  15. Analysis of the PDFs of temperature from a multi-physics ensemble of climate change projections over the Iberian Peninsula

    NASA Astrophysics Data System (ADS)

    Jerez, Sonia; Montavez, Juan P.; Gomez-Navarro, Juan J.; Jimenez-Guerrero, Pedro; Lorente, Raquel; Garcia-Valero, Juan A.; Jimenez, Pedro A.; Gonzalez-Rouco, Jose F.; Zorita, Eduardo

    2010-05-01

    Regional climate change projections are affected by several sources of uncertainty. Some of them come from Global Circulation Models and scenarios.; others come from the downscaling process. In the case of dynamical downscaling, mainly using Regional Climate Models (RCM), the sources of uncertainty may involve nesting strategies, related to the domain position and resolution, soil characterization, internal variability, methods of solving the equations, and the configuration of model physics. Therefore, a probabilistic approach seems to be recommendable when projecting regional climate change. This problem is usually faced by performing an ensemble of simulations. The aim of this study is to evaluate the range of uncertainty in regional climate projections associated to changing the physical configuration in a RCM (MM5) as well as the capability when reproducing the observed climate. This study is performed over the Iberian Peninsula and focuses on the reproduction of the Probability Density Functions (PDFs) of daily mean temperature. The experiments consist on a multi-physics ensemble of high resolution climate simulations (30 km over the target region) for the periods 1970-1999 (present) and 2070-2099 (future). Two sets of simulations for the present have been performed using ERA40 (MM5-ERA40) and ECHAM5-3CM run1 (MM5-E5-PR) as boundary conditions. The future the experiments are driven by ECHAM5-A2-run1 (MM5-E5-A2). The ensemble has a total of eight members, as the result of combining the schemes for PBL (MRF and ETA), cumulus (GRELL and Kain-Fritch) and microphysics (Simple-Ice and Mixed phase). In a previous work this multi-physics ensemble has been analyzed focusing on the seasonal mean values of both temperature and precipitation. The main results indicate that those physics configurations that better reproduce the observed climate project the most dramatic changes for the future (i.e, the largest temperature increase and precipitation decrease). Among the

  16. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  17. AmpC β-Lactamases

    PubMed Central

    Jacoby, George A.

    2009-01-01

    Summary: AmpC β-lactamases are clinically important cephalosporinases encoded on the chromosomes of many of the Enterobacteriaceae and a few other organisms, where they mediate resistance to cephalothin, cefazolin, cefoxitin, most penicillins, and β-lactamase inhibitor-β-lactam combinations. In many bacteria, AmpC enzymes are inducible and can be expressed at high levels by mutation. Overexpression confers resistance to broad-spectrum cephalosporins including cefotaxime, ceftazidime, and ceftriaxone and is a problem especially in infections due to Enterobacter aerogenes and Enterobacter cloacae, where an isolate initially susceptible to these agents may become resistant upon therapy. Transmissible plasmids have acquired genes for AmpC enzymes, which consequently can now appear in bacteria lacking or poorly expressing a chromosomal blaAmpC gene, such as Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis. Resistance due to plasmid-mediated AmpC enzymes is less common than extended-spectrum β-lactamase production in most parts of the world but may be both harder to detect and broader in spectrum. AmpC enzymes encoded by both chromosomal and plasmid genes are also evolving to hydrolyze broad-spectrum cephalosporins more efficiently. Techniques to identify AmpC β-lactamase-producing isolates are available but are still evolving and are not yet optimized for the clinical laboratory, which probably now underestimates this resistance mechanism. Carbapenems can usually be used to treat infections due to AmpC-producing bacteria, but carbapenem resistance can arise in some organisms by mutations that reduce influx (outer membrane porin loss) or enhance efflux (efflux pump activation). PMID:19136439

  18. Inducing coproporphyria in rat hepatocyte cultures using cyclic AMP and cyclic AMP-releasing agents.

    PubMed

    De Matteis, Francesco; Harvey, Carolyn

    2005-07-01

    Cyclic AMP (c-AMP), added on its own to rat hepatocyte cultures, caused a marked accumulation of coproporphyrin III. The results obtained by comparing the effect of c-AMP to that of exogenous 5-aminolevulinate (ALA), and from adding c-AMP and ALA together, indicated that the coproporphyrinogen III metabolism was blocked, even though no inhibition of the relevant enzyme, coproporphyrinogen oxidase, could be demonstrated. Preferential accumulation of coproporphyrin could also be produced in cultures of rat hepatocytes by agents that raise the cellular levels of cyclic AMP, such as glucagon. The effect of supplementing the culture medium with triiodothyronine (T3) on the response of rat hepatocytes to c-AMP was also investigated. T3, which is known to stimulate mitochondrial respiration, uncoupling O2 consumption from ATP synthesis, produced a c-AMP-like effect when given on its own and potentiated the effect of c-AMP, with an apparent increase in the severity of the metabolic block. It is suggested that an oxidative mechanism may be activated in c-AMP and T3-induced coproporphyria, preferentially involving the mitochondrial compartment, leading to oxidation of porphyrinogen intermediates of haem biosynthesis, especially coproporphyrinogen. Coproporphyin, the fully oxidized aromatic derivative produced, cannot be metabolized and will therefore accumulate. PMID:15902420

  19. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  20. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein.

    PubMed

    Underwood, Adam J; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-12-01

    Cyclic di-AMP (c-di-AMP) is a recently recognized bacterial signaling molecule. In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed using a novel pneumococcal c-di-AMP binding protein (CabP). With this method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. PMID:25239824

  1. AMPS/PC - AUTOMATIC MANUFACTURING PROGRAMMING SYSTEM

    NASA Technical Reports Server (NTRS)

    Schroer, B. J.

    1994-01-01

    The AMPS/PC system is a simulation tool designed to aid the user in defining the specifications of a manufacturing environment and then automatically writing code for the target simulation language, GPSS/PC. The domain of problems that AMPS/PC can simulate are manufacturing assembly lines with subassembly lines and manufacturing cells. The user defines the problem domain by responding to the questions from the interface program. Based on the responses, the interface program creates an internal problem specification file. This file includes the manufacturing process network flow and the attributes for all stations, cells, and stock points. AMPS then uses the problem specification file as input for the automatic code generator program to produce a simulation program in the target language GPSS. The output of the generator program is the source code of the corresponding GPSS/PC simulation program. The system runs entirely on an IBM PC running PC DOS Version 2.0 or higher and is written in Turbo Pascal Version 4 requiring 640K memory and one 360K disk drive. To execute the GPSS program, the PC must have resident the GPSS/PC System Version 2.0 from Minuteman Software. The AMPS/PC program was developed in 1988.

  2. Multi-Physics Feedback Simulations with Realistic Initial Conditions of the Formation of Star Clusters: From Large Scale Magnetized Clouds to Turbulent Clumps to Cores to Stars

    NASA Astrophysics Data System (ADS)

    Klein, R. I.; Li, P.; McKee, C. F.

    2015-10-01

    Multi-physics zoom-in adaptive mesh refinement simulations with feedback and realistic initial conditions, starting from large scale turbulent molecular clouds through the formation of clumps and cores to the formation os stellar clusters are presented. I give a summary of results at the different scales undergoing gravitational collapse from cloud to core to cluster formation. Detailed comparisons with observations are made at each stage of the simulations. In particular, properties of the magnetized clumps are compared with recent observations of Crutcher et al. 2010 and Crutcher 2012 and the magnetic field orientation in cloud clumps relative to the global mean field of the inter-cloud medium (Li et al. 2009). The Initial Mass Function (IMF) obtained is compared with the Chabrier IMF and the protostellar mass function of the cluster is compared with different theories.

  3. Integration of the DRAGON5/DONJON5 codes in the SALOME platform for performing multi-physics calculations in nuclear engineering

    NASA Astrophysics Data System (ADS)

    Hébert, Alain

    2014-06-01

    We are presenting the computer science techniques involved in the integration of codes DRAGON5 and DONJON5 in the SALOME platform. This integration brings new capabilities in designing multi-physics computational schemes, with the possibility to couple our reactor physics codes with thermal-hydraulics or thermo-mechanics codes from other organizations. A demonstration is presented where two code components are coupled using the YACS module of SALOME, based on the CORBA protocol. The first component is a full-core 3D steady-state neuronic calculation in a PWR performed using DONJON5. The second component implement a set of 1D thermal-hydraulics calculations, each performed over a single assembly.

  4. Multi-physics simulation and fabrication of a compact 128 × 128 micro-electro-mechanical system Fabry-Perot cavity tunable filter array for infrared hyperspectral imager.

    PubMed

    Meng, Qinghua; Chen, Sihai; Lai, Jianjun; Huang, Ying; Sun, Zhenjun

    2015-08-01

    This paper demonstrates the design and fabrication of a 128×128 micro-electro-mechanical systems Fabry-Perot (F-P) cavity filter array, which can be applied for the hyperspectral imager. To obtain better mechanical performance of the filters, F-P cavity supporting structures are analyzed by multi-physics finite element modeling. The simulation results indicate that Z-arm is the key component of the structure. The F-P cavity array with Z-arm structures was also fabricated. The experimental results show excellent parallelism of the bridge deck, which agree with the simulation results. A conclusion is drawn that Z-arm supporting structures are important to hyperspectral imaging system, which can achieve a large tuning range and high fill factor compared to straight arm structures. The filter arrays have the potential to replace the traditional dispersive element. PMID:26368101

  5. cAMP phosphodiesterase and activator protein of mammalian cAMP phosphodiesterase from Trypanosoma cruzi.

    PubMed

    Gonçalves, M F; Zingales, B; Colli, W

    1980-04-01

    Epimastigote forms of Trypanosoma cruzi contain a soluble cAMP phosphodiesterase. Optimal activity was found at pH 8.0 and in the presence of 5 mM Mn2+. Other cations were less efficient and did not give rise to an additional stimulation when added in the presence of optimal concentrations of Mn2+. The enzyme is not Ca2+ dependent. The apparent Km of the enzyme for the substrate is 40 microM and no kinetic evidence for the existence of two enzymes has been found. Theophylline and caffein did not inhibit the T. cruzi cAMP phosphodiesterase. The enzyme activity does not change during cell growth suggesting that the fluctuation observed in the levels of cAMP are largely a response to variations in adenylyl cyclase activity. The intracellular concentrations of cAMP ranged between 0.04--0.15 microM. No evidence that the T. cruzi cAMP phosphodiesterase is regulated by an endogenous activator could be found. However, T. cruzi contains a heat-stable, low molecular weight, non-dialysable protein that activates mammalian cAMP phosphodiesterase in the presence of Ca2+. The properties so far studied of such an activator suggest that it might be equivalent to other Ca2+-dependent regulators described in vertebrate and invertebrate species. PMID:6255327

  6. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  7. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  8. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  9. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  10. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  11. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  12. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  13. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  14. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  15. Cyclic AMP Receptor Protein-Aequorin Molecular Switch for Cyclic AMP

    PubMed Central

    Scott, Daniel; Hamorsky, Krystal Teasley; Ensor, C. Mark; Anderson, Kimberly W.; Daunert, Sylvia

    2011-01-01

    Molecular switches are designer molecules that combine the functionality of two individual proteins into one, capable of manifesting an “on/off” signal in response to a stimulus. These switches have unique properties and functionalities and thus, can be employed as nanosensors in a variety of applications. To that end, we have developed a bioluminescent molecular switch for cyclic AMP. Bioluminescence offers many advantages over fluorescence and other detection methods including the fact that there is essentially zero background signal in physiological fluids, allowing for more sensitive detection and monitoring. The switch was created by combining the properties of the cyclic AMP receptor protein (CRP), a transcriptional regulatory protein from E. coli that binds selectively to cAMP with those of aequorin, a bioluminescent photoprotein native of the jellyfish Aequorea victoria. Genetic manipulation to split the genetic coding sequence of aequorin in two and genetically attach the fragments to the N and C termini of CRP, resulted in a hybrid protein molecular switch. The conformational change experienced by CRP upon the binding of cyclic AMP is suspected to result in the observed loss of bioluminescent signal from aequorin. The “on/off” bioluminescence can be modulated by cyclic AMP over a range of several orders of magnitude in a linear fashion in addition to the capacity to detect changes in cellular cyclic AMP of intact cells exposed to different external stimuli without the need to lyse the cells. We envision that the molecular switch could find applications in vitro as well as in vivo cyclic AMP detection and/or imaging. PMID:21329338

  16. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  17. Copper regulates cyclic-AMP-dependent lipolysis.

    PubMed

    Krishnamoorthy, Lakshmi; Cotruvo, Joseph A; Chan, Jefferson; Kaluarachchi, Harini; Muchenditsi, Abigael; Pendyala, Venkata S; Jia, Shang; Aron, Allegra T; Ackerman, Cheri M; Wal, Mark N Vander; Guan, Timothy; Smaga, Lukas P; Farhi, Samouil L; New, Elizabeth J; Lutsenko, Svetlana; Chang, Christopher J

    2016-08-01

    Cell signaling relies extensively on dynamic pools of redox-inactive metal ions such as sodium, potassium, calcium and zinc, but their redox-active transition metal counterparts such as copper and iron have been studied primarily as static enzyme cofactors. Here we report that copper is an endogenous regulator of lipolysis, the breakdown of fat, which is an essential process in maintaining body weight and energy stores. Using a mouse model of genetic copper misregulation, in combination with pharmacological alterations in copper status and imaging studies in a 3T3-L1 white adipocyte model, we found that copper regulates lipolysis at the level of the second messenger, cyclic AMP (cAMP), by altering the activity of the cAMP-degrading phosphodiesterase PDE3B. Biochemical studies of the copper-PDE3B interaction establish copper-dependent inhibition of enzyme activity and identify a key conserved cysteine residue in a PDE3-specific loop that is essential for the observed copper-dependent lipolytic phenotype. PMID:27272565

  18. The Cyclic AMP Phenotype of Fragile X and Autism

    PubMed Central

    Kelley, Daniel J; Bhattacharyya, Anita; Lahvis, Garet P; Yin, Jerry CP; Malter, Jim; Davidson, Richard J

    2008-01-01

    Cyclic AMP (cAMP) is a second messenger involved in many processes including mnemonic processing and anxiety. Memory deficits and anxiety are noted in the phenotype of fragile X (FX), the most common heritable cause of mental retardation and autism. Here we review reported observations of altered cAMP cascade function in FX and autism. Cyclic AMP is a potentially useful biochemical marker to distinguish autism comorbid with FX from autism per se and the cAMP cascade may be a viable therapeutic target for both FX and autism. PMID:18601949

  19. The cyclic AMP pathway is a sex-specific modifier of glioma risk in type I neurofibromatosis patients.

    PubMed

    Warrington, Nicole M; Sun, Tao; Luo, Jingqin; McKinstry, Robert C; Parkin, Patricia C; Ganzhorn, Sara; Spoljaric, Debra; Albers, Anne C; Merkelson, Amanda; Stewart, Douglas R; Stevenson, David A; Viskochil, David; Druley, Todd E; Forys, Jason T; Reilly, Karlyne M; Fisher, Michael J; Tabori, Uri; Allen, Jeffrey C; Schiffman, Joshua D; Gutmann, David H; Rubin, Joshua B

    2015-01-01

    Identifying modifiers of glioma risk in patients with type I neurofibromatosis (NF1) could help support personalized tumor surveillance, advance understanding of gliomagenesis, and potentially identify novel therapeutic targets. Here, we report genetic polymorphisms in the human adenylate cyclase gene adenylate cyclase 8 (ADCY8) that correlate with glioma risk in NF1 in a sex-specific manner, elevating risk in females while reducing risk in males. This finding extends earlier evidence of a role for cAMP in gliomagenesis based on results in a genetically engineered mouse model (Nf1 GEM). Thus, sexually dimorphic cAMP signaling might render males and females differentially sensitive to variation in cAMP levels. Using male and female Nf1 GEM, we found significant sex differences exist in cAMP regulation and in the growth-promoting effects of cAMP suppression. Overall, our results establish a sex-specific role for cAMP regulation in human gliomagenesis, specifically identifying ADCY8 as a modifier of glioma risk in NF1. PMID:25381154

  20. TerraFERMA: Harnessing Advanced Computational Libraries in Earth Science

    NASA Astrophysics Data System (ADS)

    Wilson, C. R.; Spiegelman, M.; van Keken, P.

    2012-12-01

    Many important problems in Earth sciences can be described by non-linear coupled systems of partial differential equations. These "multi-physics" problems include thermo-chemical convection in Earth and planetary interiors, interactions of fluids and magmas with the Earth's mantle and crust and coupled flow of water and ice. These problems are of interest to a large community of researchers but are complicated to model and understand. Much of this complexity stems from the nature of multi-physics where small changes in the coupling between variables or constitutive relations can lead to radical changes in behavior, which in turn affect critical computational choices such as discretizations, solvers and preconditioners. To make progress in understanding such coupled systems requires a computational framework where multi-physics problems can be described at a high-level while maintaining the flexibility to easily modify the solution algorithm. Fortunately, recent advances in computational science provide a basis for implementing such a framework. Here we present the Transparent Finite Element Rapid Model Assembler (TerraFERMA), which leverages several advanced open-source libraries for core functionality. FEniCS (fenicsproject.org) provides a high level language for describing the weak forms of coupled systems of equations, and an automatic code generator that produces finite element assembly code. PETSc (www.mcs.anl.gov/petsc) provides a wide range of scalable linear and non-linear solvers that can be composed into effective multi-physics preconditioners. SPuD (amcg.ese.ic.ac.uk/Spud) is an application neutral options system that provides both human and machine-readable interfaces based on a single xml schema. Our software integrates these libraries and provides the user with a framework for exploring multi-physics problems. A single options file fully describes the problem, including all equations, coefficients and solver options. Custom compiled applications are

  1. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP. PMID:26378231

  2. Cyclic AMP phosphodiesterase in Salmonella typhimurium: characteristics and physiological function.

    PubMed

    Botsford, J L

    1984-11-01

    The physiological function of cyclic AMP (cAMP) phosphodiesterase in Salmonella typhimurium was investigated with strains which were isogenic except for the cpd locus. In crude broken-cell extracts the properties of the enzyme were found to be similar to those reported for Escherichia coli. The specific activity in the mutant was less than 1% that in the wild type. Rates of cAMP production in the mutant were as much as twice those observed in the wild type. The amount of cAMP accumulated when cells grew overnight with limiting glucose was 4.5-fold greater in the mutant than in the wild type. The intracellular concentration of cAMP in the two strains was measured directly, using four different techniques to wash the cells to remove extracellular cAMP. The cAMP level in the cpd strain was only 25% greater than in the wild type. The functional concentration of the cAMP receptor protein-cAMP complex was estimated indirectly from the specific activity of beta-galactosidase in the two strains after introducing F'lac. When cells were grown with carbon sources permitting synthesis of different levels of cAMP, the specific activity of the enzyme was at most 25% greater in the cpd strain. The cpd strain was more sensitive to the effects of exogenous cAMP. Exogenous cAMP relieved both permanent and transient catabolite repression of the lac operon at lower concentrations in the cpd strain than in the wild type. When cells grew with glucose, glycerol, or ribose, exogenous cAMP inhibited growth of the mutant strain more than the wild type. PMID:6094495

  3. Cyclic Di-AMP Impairs Potassium Uptake Mediated by a Cyclic Di-AMP Binding Protein in Streptococcus pneumoniae

    PubMed Central

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M.; Zhang, Yang; Metzger, Dennis W.

    2014-01-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  4. Cyclic di-AMP impairs potassium uptake mediated by a cyclic di-AMP binding protein in Streptococcus pneumoniae.

    PubMed

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-02-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  5. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response. PMID:26276689

  6. Internal gastargets in AmPS

    NASA Astrophysics Data System (ADS)

    Kaan, A. P.; Postma, O.; van den Brand, J. F. J.; van Leeuwen, E.; Doets, M.; Kraan, M.

    1997-05-01

    Internal gas targets in AmPS A.P. Kaan, O. Postma, J.F.J. van den Brand, E. van Leeuwen, M. Doets, M. Kra= an National Institute for Nuclear Physics and High Energy Physics; Kruislaan 409; 1098 SJ Amsterdam; Holland In the Amsterdam Puls Stretcher/storage ring AmPS(1 GeV electrons), we designed a set-up in order to accommodate a gas target with a density of 1016 mol/cm2. The storage cell needed for this purpose is a aluminium tube with a length of 40 cm, a diameter of 15 mm and a wall thickness of 25 =B5m. Three sets of conductance limiters on both sides of the target, combined with dry turbopumps are designed to be used as differential pumping stations. These limiters cause discontinuities in the beam path and must therefor be retractable and radio frequency compatible in both positions. Low =B5 materials must be used because of the depolarisation effects of changing magnetic fields. The calculations show that the flow resistance's are sufficient to reduce the load of the getter pumps to a level with which the lifetime of the pump elements remain acceptable. The design of the mechanics and the vacuum system will be explained. Recent results from the measurements after installation in combination with the influence on the lifetime on the beam will be presented

  7. Oscillations of cAMP with the cardiac cycle.

    PubMed

    Wikman-Coffelt, J; Sievers, R; Coffelt, R J; Parmley, W W

    1983-03-16

    Oscillations of cAMP with the cardiac cycle were demonstrated in the rat heart using a stimulator-triggered rapid freeze-clamp to decrease the temperature of the heart from 37 degrees C to -80 degrees C in 5 msec (20,000 degrees/sec) at a predetermined phase of the cardiac cycle. The nucleotide, cAMP, oscillated 60% with the cardiac cycle during normal working conditions, the higher cAMP value occurring during systole. PMID:6301471

  8. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  9. Cardiac cAMP: production, hydrolysis, modulation and detection.

    PubMed

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3',5'-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  10. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  11. Detection of amp C in Enterobacter cloacae in China.

    PubMed

    Zhang, Y L; Li, J T; Zhao, M W

    2001-10-01

    PCR amplification of 55 strains of Enterobacter cloacae indicated 51 of them had amp C structural gene verified by DNA sequence and Southern blotting. All PCR products were cleaved into 666- and 328-bp fragments by Kpn1 restriction enzyme. Imipenem was the most potent inducer for mRNA expression of amp C gene and beta-lactamase activity. The beta-Lactamase inhibitor R0481220 strongly inhibited Amp C beta-lactamases; 96.4% (53/55) of Enterobacter cloacae producing Amp C enzyme were susceptible to cefepime. PMID:11691570

  12. Mechanisms Restricting Diffusion of Intracellular cAMP

    PubMed Central

    Agarwal, Shailesh R.; Clancy, Colleen E.; Harvey, Robert D.

    2016-01-01

    Although numerous receptors stimulate cAMP production in a wide array of cells, many elicit distinct, highly localized responses, implying that the subcellular distribution of cAMP is not uniform. One often used explanation is that phosphodiesterases, which breakdown cAMP, act as functional barriers limiting diffusion. However, several studies refute the notion that this is sufficient, suggesting that phosphodiesterase-independent movement of cAMP must occur at rates slower than free diffusion. But, until now this has never been demonstrated. Using Raster Image Correlation Spectroscopy (RICS), we measured the diffusion coefficient of a fluorescently-labeled cAMP derivative (φ450-cAMP) as well as other fluorescent molecules in order to investigate the role that molecular size, cell morphology, and buffering by protein kinase A (PKA) play in restricting cAMP mobility in different cell types. Our results demonstrate that cytosolic movement of cAMP is indeed much slower than the rate of free diffusion and that interactions with PKA, especially type II PKA associated with mitochondria, play a significant role. These findings have important implications with respect to cAMP signaling in all cells. PMID:26795432

  13. The cAMP-binding proteins of Leishmania are not the regulatory subunits of cAMP-dependent protein kinase.

    PubMed

    Banerjee, C; Sarkar, D

    2001-09-01

    The most commonly used method to determine the cAMP binding activity in cytosolic extracts of promastigotes of Leishmania spp. underestimated by approximately 11.5-fold the total amount of [(3)H]cAMP bound, when compared with results obtained by the modified Millipore filter technique. Three cAMP-binding proteins (BPI, BPII and BPIII) were partially purified and characterized. The native molecular masses of BPI, BPII and BPIII were estimated to be 105, 155 and 145 kDa, respectively. The binding of [(3)H]cAMP to these proteins was affected to different extents by several cAMP analogues. Antibodies directed against the types I and II regulatory subunits of PKA did not cross-react with the leishmanial extract. Photoaffinity labeling of the cytosolic extracts with 8-N(3)-[(32)P]cAMP specifically labeled a band of M(r) 116000 and a band of M(r) 80000 partially saturable by cAMP. From these results, it is concluded that the leishmanial cAMP-binding proteins appear to belong to a different class distinct from the regulatory subunits of cAMP-dependent protein kinases. PMID:11544092

  14. Multi-initial-conditions and Multi-physics Ensembles in the Weather Research and Forecasting Model to Improve Coastal Stratocumulus Forecasts for Solar Power Integration

    NASA Astrophysics Data System (ADS)

    Yang, H.

    2015-12-01

    used to create a multi-parameter and multi-physics ensemble. The ensemble forecast system is implemented operationally for San Diego Gas & Electric Company to improve system operations.

  15. Counteracting Roles of AMP Deaminase and AMP Kinase in the Development of Fatty Liver

    PubMed Central

    Lanaspa, Miguel A.; Cicerchi, Christina; Garcia, Gabriela; Li, Nanxing; Roncal-Jimenez, Carlos A.; Rivard, Christopher J.; Hunter, Brandi; Andrés-Hernando, Ana; Ishimoto, Takuji; Sánchez-Lozada, Laura G.; Thomas, Jeffrey; Hodges, Robert S.; Mant, Colin T.; Johnson, Richard J.

    2012-01-01

    Fatty liver (hepatic steatosis) is associated with nucleotide turnover, loss of ATP and generation of adenosine monophosphate (AMP). It is well known that in fatty liver, activity of the AMP-activated kinase (AMPK) is reduced and that its stimulation can prevent hepatic steatosis by both enhancing fat oxidation and reducing lipogenesis. Here we show that another AMP dependent enzyme, AMPD2, has opposing effects on fatty acid oxidation when compared to AMPK. In human hepatocytres, AMPD2 activation –either by overexpression or by lowering intracellular phosphate levels with fructose- is associated with a significant reduction in AMPK activity. Likewise, silencing of AMPK spontaneously increases AMPD activity, demonstrating that these enzymes counter-regulate each other. Furthermore, we show that a downstream product of AMP metabolism through AMPD2, uric acid, can inhibit AMPK activity in human hepatocytes. Finally, we show that fructose-induced fat accumulation in hepatocytes is due to a dominant stimulation of AMPD2 despite stimulating AMPK. In this regard, AMPD2-deficient hepatocytes demonstrate a further activation of AMPK after fructose exposure in association with increased fatty acid oxidation, and conversely silencing AMPK enhances AMPD-dependent fat accumulation. In vivo, we show that sucrose fed rats also develop fatty liver that is blocked by metformin in association with both a reduction in AMPD activity and an increase in AMPK activity. In summary, AMPD and AMPK are both important in hepatic fat accumulation and counter-regulate each other. We present the novel finding that uric acid inhibits AMPK kinase activity in fructose-fed hepatocytes thus providing new insights into the pathogenesis of fatty liver. PMID:23152807

  16. Beam optics of the AmPS extraction line

    NASA Astrophysics Data System (ADS)

    Hoekstra, R.

    1991-01-01

    The beam optics of the AmPS (Amsterdam Pulse Stretcher) are described. Definitions are outlined, and the beam elements and parameters are given. Developments relating to the electrostatic septum, chicane, beam transformer and bending through 90 degrees are described. The performance of the AmPS and beam diagnostics are discussed.

  17. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  18. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  19. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  20. Activated cAMP receptors switch encystation into sporulation

    PubMed Central

    Kawabe, Yoshinori; Morio, Takahiro; James, John L.; Prescott, Alan R.; Tanaka, Yoshimasa; Schaap, Pauline

    2009-01-01

    Metazoan embryogenesis is controlled by a limited number of signaling modules that are used repetitively at successive developmental stages. The development of social amoebas shows similar reiterated use of cAMP-mediated signaling. In the model Dictyostelium discoideum, secreted cAMP acting on 4 cAMP receptors (cARs1-4) coordinates cell movement during aggregation and fruiting body formation, and induces the expression of aggregation and sporulation genes at consecutive developmental stages. To identify hierarchy in the multiple roles of cAMP, we investigated cAR heterogeneity and function across the social amoeba phylogeny. The gene duplications that yielded cARs 2-4 occurred late in evolution. Many species have only a cAR1 ortholog that duplicated independently in the Polysphondylids and Acytostelids. Disruption of both cAR genes of Polysphondylium pallidum (Ppal) did not affect aggregation, but caused complete collapse of fruiting body morphogenesis. The stunted structures contained disorganized stalk cells, which supported a mass of cysts instead of spores; cAMP triggered spore gene expression in Ppal, but not in the cAR null mutant, explaining its sporulation defect. Encystation is the survival strategy of solitary amoebas, and lower taxa, like Ppal, can still encyst as single cells. Recent findings showed that intracellular cAMP accumulation suffices to trigger encystation, whereas it is a complementary requirement for sporulation. Combined, the data suggest that cAMP signaling in social amoebas evolved from cAMP-mediated encystation in solitary amoebas; cAMP secretion in aggregates prompted the starving cells to form spores and not cysts, and additionally organized fruiting body morphogenesis. cAMP-mediated aggregation was the most recent innovation. PMID:19369200

  1. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 3, book 2: AMPS equipment to Spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The interfaces between AMPS Payload No.(TBD) and Spacelab are described. The interfaces specified cover the AMPS physical, electrical, and thermal interfaces that are established to prescribe the standard Spacelab configuration required to perform the mission. If the configuration definition changes due to change of Spacelab equipment model, or serial numbers, then reidentification of the Labcraft payload may be required.

  2. It's the parameters, stupid! Moving beyond multi-model and multi-physics approaches to characterize and reduce predictive uncertainty in process-based hydrological models

    NASA Astrophysics Data System (ADS)

    Clark, Martyn; Samaniego, Luis; Freer, Jim

    2014-05-01

    Multi-model and multi-physics approaches are a popular tool in environmental modelling, with many studies focusing on optimally combining output from multiple model simulations to reduce predictive errors and better characterize predictive uncertainty. However, a careful and systematic analysis of different hydrological models reveals that individual models are simply small permutations of a master modeling template, and inter-model differences are overwhelmed by uncertainty in the choice of the parameter values in the model equations. Furthermore, inter-model differences do not explicitly represent the uncertainty in modeling a given process, leading to many situations where different models provide the wrong results for the same reasons. In other cases, the available morphological data does not support the very fine spatial discretization of the landscape that typifies many modern applications of process-based models. To make the uncertainty characterization problem worse, the uncertain parameter values in process-based models are often fixed (hard-coded), and the models lack the agility necessary to represent the tremendous heterogeneity in natural systems. This presentation summarizes results from a systematic analysis of uncertainty in process-based hydrological models, where we explicitly analyze the myriad of subjective decisions made throughout both the model development and parameter estimation process. Results show that much of the uncertainty is aleatory in nature - given a "complete" representation of dominant hydrologic processes, uncertainty in process parameterizations can be represented using an ensemble of model parameters. Epistemic uncertainty associated with process interactions and scaling behavior is still important, and these uncertainties can be represented using an ensemble of different spatial configurations. Finally, uncertainty in forcing data can be represented using ensemble methods for spatial meteorological analysis. Our systematic

  3. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  4. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  5. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  6. cAMP-induced Mitochondrial Compartment Biogenesis

    PubMed Central

    Yoboue, Edgar D.; Augier, Eric; Galinier, Anne; Blancard, Corinne; Pinson, Benoît; Casteilla, Louis; Rigoulet, Michel; Devin, Anne

    2012-01-01

    Cell fate and proliferation are tightly linked to the regulation of the mitochondrial energy metabolism. Hence, mitochondrial biogenesis regulation, a complex process that requires a tight coordination in the expression of the nuclear and mitochondrial genomes, has a major impact on cell fate and is of high importance. Here, we studied the molecular mechanisms involved in the regulation of mitochondrial biogenesis through a nutrient-sensing pathway, the Ras-cAMP pathway. Activation of this pathway induces a decrease in the cellular phosphate potential that alleviates the redox pressure on the mitochondrial respiratory chain. One of the cellular consequences of this modulation of cellular phosphate potential is an increase in the cellular glutathione redox state. The redox state of the glutathione disulfide-glutathione couple is a well known important indicator of the cellular redox environment, which is itself tightly linked to mitochondrial activity, mitochondria being the main cellular producer of reactive oxygen species. The master regulator of mitochondrial biogenesis in yeast (i.e. the transcriptional co-activator Hap4p) is positively regulated by the cellular glutathione redox state. Using a strain that is unable to modulate its glutathione redox state (Δglr1), we pinpoint a positive feedback loop between this redox state and the control of mitochondrial biogenesis. This is the first time that control of mitochondrial biogenesis through glutathione redox state has been shown. PMID:22396541

  7. AMP-18 Targets p21 to Maintain Epithelial Homeostasis

    PubMed Central

    Chen, Peili; Li, Yan Chun; Toback, F. Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD. PMID:25919700

  8. Imaging cytoplasmic cAMP in mouse brainstem neurons

    PubMed Central

    Mironov, SL; Skorova, E; Taschenberger, G; Hartelt, N; Nikolaev, VO; Lohse, MJ; Kügler, S

    2009-01-01

    Background cAMP is an ubiquitous second messenger mediating various neuronal functions, often as a consequence of increased intracellular Ca2+ levels. While imaging of calcium is commonly used in neuroscience applications, probing for cAMP levels has not yet been performed in living vertebrate neuronal tissue before. Results Using a strictly neuron-restricted promoter we virally transduced neurons in the organotypic brainstem slices which contained pre-Bötzinger complex, constituting the rhythm-generating part of the respiratory network. Fluorescent cAMP sensor Epac1-camps was expressed both in neuronal cell bodies and neurites, allowing us to measure intracellular distribution of cAMP, its absolute levels and time-dependent changes in response to physiological stimuli. We recorded [cAMP]i changes in the micromolar range after modulation of adenylate cyclase, inhibition of phosphodiesterase and activation of G-protein-coupled metabotropic receptors. [cAMP]i levels increased after membrane depolarisation and release of Ca2+ from internal stores. The effects developed slowly and reached their maximum after transient [Ca2+]i elevations subsided. Ca2+-dependent [cAMP]i transients were suppressed after blockade of adenylate cyclase with 0.1 mM adenylate cyclase inhibitor 2'5'-dideoxyadenosine and potentiated after inhibiting phosphodiesterase with isobutylmethylxanthine and rolipram. During paired stimulations, the second depolarisation and Ca2+ release evoked bigger cAMP responses. These effects were abolished after inhibition of protein kinase A with H-89 pointing to the important role of phosphorylation of calcium channels in the potentiation of [cAMP]i transients. Conclusion We constructed and characterized a neuron-specific cAMP probe based on Epac1-camps. Using viral gene transfer we showed its efficient expression in organotypic brainstem preparations. Strong fluorescence, resistance to photobleaching and possibility of direct estimation of [cAMP] levels using

  9. FRET measurements of intracellular cAMP concentrations and cAMP analog permeability in intact cells.

    PubMed

    Börner, Sebastian; Schwede, Frank; Schlipp, Angela; Berisha, Filip; Calebiro, Davide; Lohse, Martin J; Nikolaev, Viacheslav O

    2011-04-01

    Real-time measurements of second messengers in living cells, such as cAMP, are usually performed by ratiometric fluorescence resonance energy transfer (FRET) imaging. However, correct calibration of FRET ratios, accurate calculations of absolute cAMP levels and actual permeabilities of different cAMP analogs have been challenging. Here we present a protocol that allows precise measurements of cAMP concentrations and kinetics by expressing FRET-based cAMP sensors in cells and modulating them with an inhibitor of adenylyl cyclase activity and a cell-permeable cAMP analog that fully inhibits and activates the sensors, respectively. Using this protocol, we observed different basal cAMP levels in primary mouse cardiomyocytes, thyroid cells and in 293A cells. The protocol can be generally applied for calibration of second messenger or metabolite concentrations measured by FRET, and for studying kinetics and pharmacological properties of their membrane-permeable analogs. The complete procedure, including cell preparation and FRET measurements, takes 3-6 d. PMID:21412271

  10. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  11. Cyclic di-AMP: another second messenger enters the fray.

    PubMed

    Corrigan, Rebecca M; Gründling, Angelika

    2013-08-01

    Nucleotide signalling molecules contribute to the regulation of cellular pathways in all forms of life. In recent years, the discovery of new signalling molecules in bacteria and archaea, as well as the elucidation of the pathways they regulate, has brought insights into signalling mechanisms not only in bacterial and archaeal cells but also in eukaryotic host cells. Here, we provide an overview of the synthesis and regulation of cyclic di-AMP (c-di-AMP), one of the latest cyclic nucleotide second messengers to be discovered in bacteria. We also discuss the currently known receptor proteins and pathways that are directly or indirectly controlled by c-di-AMP, the domain structure of the enzymes involved in its production and degradation, and the recognition of c-di-AMP by the eukaryotic host. PMID:23812326

  12. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  13. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  14. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  15. Allostery and conformational dynamics in cAMP-binding acyltransferases.

    PubMed

    Podobnik, Marjetka; Siddiqui, Nida; Rebolj, Katja; Nambi, Subhalaxmi; Merzel, Franci; Visweswariah, Sandhya S

    2014-06-01

    Mycobacteria harbor unique proteins that regulate protein lysine acylation in a cAMP-regulated manner. These lysine acyltransferases from Mycobacterium smegmatis (KATms) and Mycobacterium tuberculosis (KATmt) show distinctive biochemical properties in terms of cAMP binding affinity to the N-terminal cyclic nucleotide binding domain and allosteric activation of the C-terminal acyltransferase domain. Here we provide evidence for structural features in KATms that account for high affinity cAMP binding and elevated acyltransferase activity in the absence of cAMP. Structure-guided mutational analysis converted KATms from a cAMP-regulated to a cAMP-dependent acyltransferase and identified a unique asparagine residue in the acyltransferase domain of KATms that assists in the enzymatic reaction in the absence of a highly conserved glutamate residue seen in Gcn5-related N-acetyltransferase-like acyltransferases. Thus, we have identified mechanisms by which properties of similar proteins have diverged in two species of mycobacteria by modifications in amino acid sequence, which can dramatically alter the abundance of conformational states adopted by a protein. PMID:24748621

  16. Regulation of cAMP by Phosphodiesterases in Erythrocytes

    PubMed Central

    Adderley, Shaquria P.; Sprague, Randy S.; Stephenson, Alan H.; Hanson, Madelyn S.

    2010-01-01

    The erythrocyte, a cell responsible for carrying and delivering oxygen in the body, has often been regarded as simply a vehicle for the circulation of hemoglobin. However, it has become evident that this cell also participates in the regulation of vascular caliber in the microcirculation via release of the potent vasodilator, adenosine triphosphate (ATP). The regulated release of ATP from erythrocytes occurs via a defined signaling pathway and requires increases in cyclic 3’ 5’ adenosine monophosphate (cAMP). It is well recognized that cAMP is a critical second messenger in diverse signaling pathways. In all cells increases in cAMP are localized and regulated by the activity of phosphodiesterases (PDEs). In erythrocytes activation of either β adrenergic receptors (β 2AR) or the prostacyclin receptor (IPR) results in increases in cAMP and ATP release. Receptor-mediated increases in cAMP are tightly regulated by distinct PDEs associated with each signaling pathway as shown by the finding that selective inhibitors of the PDEs localized to each pathway potentiate both increases in cAMP and ATP release. Here we review the profile of PDEs identified in erythrocytes, their association with specific signaling pathways and their role in the regulation of ATP release from these cells. Understanding the contribution of PDEs to the control of ATP release from erythrocytes identifies this cell as a potential target for the development of drugs for the treatment of vascular disease. PMID:20631411

  17. Dibutyryl cyclic AMP reduces the radiosensitivity of cultured endothelial cells

    SciTech Connect

    Ward, W.; Molteni, A.; Ts'ao, C.; Hinz, J. )

    1991-03-11

    The purpose of this study was to determine whether dibutyryl cyclic AMP modifies the radiosensitivity of confluent monolayers of bovine aortic endothelial cells (BAEC). Three indices of BAEC function were monitored from 4-24 hrs after exposure to 1-10 Gy of {sup 60}Co gamma rays: the release of {sup 51}Cr from prelabeled cells, and release of lactate dehydrogenase (LDH) and plasminogen activator (PLA) into the culture medium. There was a time- and radiation dose-dependent increase in {sup 51}Cr, LDH and PLA release from the BAEC, detectable within 12 hrs after 5 Gy or higher, and by 24 hrs after 1 Gy or higher. This increased release was accompanied by a radiation dose-dependent decrease in {sup 51}Cr and LDH, and an increase in PLA activity in the lysate of cells adherent to the monolayer at 24 hrs. The continuous presence of cAMP from 1 hr before to 24 hrs after irradiation reduced all of these radiation reactions, although mM concentrations of cAMP were required for significant sparing. The presence of cAMP from 1 hr before to 10 min after irradiation had no effect on BAEC sensitivity, whereas cAMP added 10 min after irradiation was fully as effective as continuously administered drug. Thus, cultured BAEC exhibit membrane dysfunction within 24 hrs after clinically relevant radiation doses, and this dysfunction is ameliorated by cAMP present after irradiation.

  18. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  19. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 2: AMPS payload to spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The AMPS to Spacelab Interface Control Document which is to be used as a guide for format and information content in generating specific AMPS Mission ICDs is presented. This document is meant to supplement the Spacelab Payload Accommodations Handbook in that it only defines interfaces which are not discussed in the handbook to the level required for design purposes. The AMPS Top Level Requirements Tree, illustrates this ICD by a shaded area and its relationship to the other AMPS technical documents. Other interface documents shown are the Level II, AMPS to Space Shuttle Vehicle ICD and the Level III, AMPS to Instruments ICD.

  20. Foundational development of an advanced nuclear reactor integrated safety code.

    SciTech Connect

    Clarno, Kevin; Lorber, Alfred Abraham; Pryor, Richard J.; Spotz, William F.; Schmidt, Rodney Cannon; Belcourt, Kenneth; Hooper, Russell Warren; Humphries, Larry LaRon

    2010-02-01

    This report describes the activities and results of a Sandia LDRD project whose objective was to develop and demonstrate foundational aspects of a next-generation nuclear reactor safety code that leverages advanced computational technology. The project scope was directed towards the systems-level modeling and simulation of an advanced, sodium cooled fast reactor, but the approach developed has a more general applicability. The major accomplishments of the LDRD are centered around the following two activities. (1) The development and testing of LIME, a Lightweight Integrating Multi-physics Environment for coupling codes that is designed to enable both 'legacy' and 'new' physics codes to be combined and strongly coupled using advanced nonlinear solution methods. (2) The development and initial demonstration of BRISC, a prototype next-generation nuclear reactor integrated safety code. BRISC leverages LIME to tightly couple the physics models in several different codes (written in a variety of languages) into one integrated package for simulating accident scenarios in a liquid sodium cooled 'burner' nuclear reactor. Other activities and accomplishments of the LDRD include (a) further development, application and demonstration of the 'non-linear elimination' strategy to enable physics codes that do not provide residuals to be incorporated into LIME, (b) significant extensions of the RIO CFD code capabilities, (c) complex 3D solid modeling and meshing of major fast reactor components and regions, and (d) an approach for multi-physics coupling across non-conformal mesh interfaces.

  1. Insulin alters cAMP-activated lipolysis but not cAMP-inhibited glycogen synthase in permeabilized adipocytes

    SciTech Connect

    Mooney, R.A.; Wisniewski, J.L.

    1986-05-01

    Lipolysis and, to a lesser extent, glycogen synthase activity are regulated in adipocytes by cellular cAMP and counter-regulated by insulin. These activities were measured in situ in digitonin (20 ..mu..g/ml) permeabilized rat adipocytes. Incorporation of /sup 3/H UDP-glucose into endogenous glycogen in the presence of KF, EDTA and 10mM glucose-6-phosphate was the basis of the G.S. assay. Cellular GS activity determined by this technique was 1.4 +/- 0.2 fold greater than that of matched homogenates. Insulin treatment of intact cells prior to permeabilization increased GS activity ratio (-/+ G-6-P) 2.5 fold when subsequently measured by the in situ assay. Following digitonin permeabilization, addition of cAMP to the suspension medium increased lipolysis 7 fold and decreased GS activity ratio to 0.38 +/- 0.01 from a basal value of 0.44 +/- 0.06. ATP had a negligible effect on lipolysis but decreased GS to 0.16 +/- 0.04. ATP plus cAMP was only slightly more effective on GS than ATP alone. Insulin at 10/sup -9/M inhibited cAMP-dependent lipolysis by 27% but had no effect on the cAMP- or ATP-dependent decrease in GS. These results suggest that insulin's counter-regulatory mechanisms on these two cAMP-dependent processes may be different.

  2. In vitro and in vivo characterization of the Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodiesterase CpdA, required for cAMP homeostasis and virulence factor regulation.

    PubMed

    Fuchs, Erin L; Brutinel, Evan D; Klem, Erich R; Fehr, Anthony R; Yahr, Timothy L; Wolfgang, Matthew C

    2010-06-01

    Cyclic AMP (cAMP) is an important second messenger signaling molecule that controls a wide variety of eukaryotic and prokaryotic responses to extracellular cues. For cAMP-dependent signaling pathways to be effective, the intracellular cAMP concentration is tightly controlled at the level of synthesis and degradation. In the opportunistic human pathogen Pseudomonas aeruginosa, cAMP is a key regulator of virulence gene expression. To better understand the role of cAMP homeostasis in this organism, we identified and characterized the enzyme CpdA, a putative cAMP phosphodiesterase. We demonstrate that CpdA possesses 3',5'-cAMP phosphodiesterase activity in vitro and that it utilizes an iron-dependent catalytic mechanism. Deletion of cpdA results in the accumulation of intracellular cAMP and altered regulation of P. aeruginosa virulence traits. Further, we demonstrate that the cAMP-dependent transcription factor Vfr directly regulates cpdA expression in response to intracellular cAMP accumulation, thus providing a feedback mechanism for controlling cAMP levels and fine-tuning virulence factor expression. PMID:20348254

  3. [cAMP cascade in regulation of protein glycosylation].

    PubMed

    Surman, Magdalena; Janik, Marcelina

    2014-01-01

    O- and N-glycosylation are the most common and complex of the post-translational modifications. Both are enzymatic processes and it was suggested that both could be regulated by cAMP cascade at the early stages. N-glycosylation starts with the formation of lipid-linked oligosaccharides and this process is catalysed by crucial glycosyltransferase - dolichol phosphate mannose synthase. The results of several studies strongly suggest that the cAMP acting through a cAMP-dependent protein kinase A-mediated protein phosphorylation/dephosphorylation cycle may modulate activation of this enzyme. It was shown that cAMP can also up regulate another enzyme involved in phosphodolichole synthesis - cis-prenyltransferase. The mechanism acting here is the alteration of the rate of its gene expression. cAMP cascade is also involved in regulation of O-glycosylation since phosphorylation of human glutamine:fructose-6-phosphate amidotransferase results in depletion of O-GlcNAc structure formation. These observation suggested an important role of GPCRs and their ligand in regulation of N- and O-glycan synthesis. PMID:26263760

  4. Cyclic AMP Regulates Social Behavior in African Trypanosomes

    PubMed Central

    Oberholzer, Michael; Saada, Edwin A.

    2015-01-01

    ABSTRACT The protozoan parasite Trypanosoma brucei engages in surface-induced social behavior, termed social motility, characterized by single cells assembling into multicellular groups that coordinate their movements in response to extracellular signals. Social motility requires sensing and responding to extracellular signals, but the underlying mechanisms are unknown. Here we report that T. brucei social motility depends on cyclic AMP (cAMP) signaling systems in the parasite’s flagellum (synonymous with cilium). Pharmacological inhibition of cAMP-specific phosphodiesterase (PDE) completely blocks social motility without impacting the viability or motility of individual cells. Using a fluorescence resonance energy transfer (FRET)-based sensor to monitor cAMP dynamics in live cells, we demonstrate that this block in social motility correlates with an increase in intracellular cAMP levels. RNA interference (RNAi) knockdown of the flagellar PDEB1 phenocopies pharmacological PDE inhibition, demonstrating that PDEB1 is required for social motility. Using parasites expressing distinct fluorescent proteins to monitor individuals in a genetically heterogeneous community, we found that the social motility defect of PDEB1 knockdowns is complemented by wild-type parasites in trans. Therefore, PDEB1 knockdown cells are competent for social motility but appear to lack a necessary factor that can be provided by wild-type cells. The combined data demonstrate that the role of cyclic nucleotides in regulating microbial social behavior extends to African trypanosomes and provide an example of transcomplementation in parasitic protozoa. PMID:25922395

  5. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  6. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  7. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  8. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  9. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  10. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  11. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  12. Formation of dAMP-glycerol and dAMP-Tris Derivatives by Thermococcus kodakaraensis DNA Primase*

    PubMed Central

    Chemnitz Galal, Wiebke; Pan, Miao; Giulian, Gary; Yuan, Wei; Li, Shuwei; Edwards, James L.; Marino, John P.; Kelman, Zvi; Hurwitz, Jerard

    2012-01-01

    In the presence of dATP, glycerol, and Tris buffer, the DNA primase isolated from Thermococcus kodakaraensis catalyzed the formation of dAMP and two products that were identified as dAMP-glycerol and dAMP-Tris. These products were formed by the T. kodakaraensis p41 catalytic subunit alone and the T. kodakaraensis p41-p46 complex in the absence of a DNA template. They were not formed with preparations containing the catalytically inactive p41 subunit. Similar glycerol and Tris derivatives as well as dNMPs were also formed with dGTP, dCTP, or dTTP. The mechanism contributing to the formation of these products and its implications in the initiation reaction catalyzed by the T. kodakaraensis primase are discussed. PMID:22427647

  13. Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios

    PubMed Central

    Wu, Rui; Zhao, Meng; Li, Jing; Gao, He; Kan, Biao; Liang, Weili

    2015-01-01

    TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoXVC was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoXVCpromoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoXVF in V. fluvialis was determined, and −10/−35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar −10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios. PMID:26442598

  14. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  15. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  16. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  17. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  18. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  19. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  20. cAMP signaling in cortisol-producing adrenal adenoma.

    PubMed

    Calebiro, Davide; Di Dalmazi, Guido; Bathon, Kerstin; Ronchi, Cristina L; Beuschlein, Felix

    2015-10-01

    The cAMP signaling pathway is one of the major players in the regulation of growth and hormonal secretion in adrenocortical cells. Although its role in the pathogenesis of adrenocortical hyperplasia associated with Cushing's syndrome has been clarified, a clear involvement of the cAMP signaling pathway and of one of its major downstream effectors, the protein kinase A (PKA), in sporadic adrenocortical adenomas remained elusive until recently. During the last year, a report by our group and three additional independent groups showed that somatic mutations of PRKACA, the gene coding for the catalytic subunit α of PKA, are a common genetic alteration in patients with Cushing's syndrome due to adrenal adenomas, occurring in 35-65% of the patients. In vitro studies revealed that those mutations are able to disrupt the association between catalytic and regulatory subunits of PKA, leading to a cAMP-independent activity of the enzyme. Despite somatic PRKACA mutations being a common finding in patients with clinically manifest Cushing's syndrome, the pathogenesis of adrenocortical adenomas associated with subclinical hypercortisolism seems to rely on a different molecular background. In this review, the role of cAMP/PKA signaling in the regulation of adrenocortical cell function and its alterations in cortisol-producing adrenocortical adenomas will be summarized, with particular focus on recent developments. PMID:26139209

  1. Characteristics of cyclic AMP transport by marine bacteria

    SciTech Connect

    Ammerman, J.W.; Azam, F.

    1987-12-01

    Uptake and autoradiography experiments with natural populations of marine bacteria, sea water cultures, and cultured isolates showed that the high-affinity cyclic AMP transport system in marine bacteria has stringent structural requirements, is found in a minority of cells in mixed bacterial assemblages, and appears to be related to the culture growth state.

  2. Metabolic benefits of inhibiting cAMP-PDEs with resveratrol.

    PubMed

    Chung, Jay H

    2012-10-01

    Calorie restriction (CR) extends lifespan in species ranging from yeast to mammals. There is evidence that CR also protects against aging-related diseases in non-human primates. This has led to an intense interest in the development of CR-mimetics to harness the beneficial effects of CR to treat aging-related diseases. One CR-mimetic that has received a great deal of attention is resveratrol. Resveratrol extends the lifespan of obese mice and protects against obesity-related diseases such as type 2 diabetes. The specific mechanism of resveratrol action has been difficult to elucidate because resveratrol has a promiscuous target profile. A recent finding indicates that the metabolic effects of resveratrol may result from competitive inhibition of cAMP-degrading phosphodiesterases (PDEs), which increases cAMP levels. The cAMP-dependent pathways activate AMP-activated protein kinase (AMPK), which is essential for the metabolic effects of resveratrol. Inhibiting PDE4 with rolipram reproduces all of the metabolic benefits of resveratrol, including protection against diet-induced obesity and an increase in mitochondrial function, physical stamina and glucose tolerance in mice. This discovery suggests that PDE inhibitors may be useful for treating metabolic diseases associated with aging. PMID:23700542

  3. High Precision Thermal, Structural and Optical Analysis of an External Occulter Using a Common Model and the General Purpose Multi-Physics Analysis Tool Cielo

    NASA Technical Reports Server (NTRS)

    Hoff, Claus; Cady, Eric; Chainyk, Mike; Kissil, Andrew; Levine, Marie; Moore, Greg

    2011-01-01

    The efficient simulation of multidisciplinary thermo-opto-mechanical effects in precision deployable systems has for years been limited by numerical toolsets that do not necessarily share the same finite element basis, level of mesh discretization, data formats, or compute platforms. Cielo, a general purpose integrated modeling tool funded by the Jet Propulsion Laboratory and the Exoplanet Exploration Program, addresses shortcomings in the current state of the art via features that enable the use of a single, common model for thermal, structural and optical aberration analysis, producing results of greater accuracy, without the need for results interpolation or mapping. This paper will highlight some of these advances, and will demonstrate them within the context of detailed external occulter analyses, focusing on in-plane deformations of the petal edges for both steady-state and transient conditions, with subsequent optical performance metrics including intensity distributions at the pupil and image plane.

  4. Multi-physics modelling contributions to investigate the atmospheric cosmic rays on the single event upset sensitivity along the scaling trend of CMOS technologies.

    PubMed

    Hubert, G; Regis, D; Cheminet, A; Gatti, M; Lacoste, V

    2014-10-01

    Particles originating from primary cosmic radiation, which hit the Earth's atmosphere give rise to a complex field of secondary particles. These particles include neutrons, protons, muons, pions, etc. Since the 1980s it has been known that terrestrial cosmic rays can penetrate the natural shielding of buildings, equipment and circuit package and induce soft errors in integrated circuits. Recently, research has shown that commercial static random access memories are now so small and sufficiently sensitive that single event upsets (SEUs) may be induced from the electronic stopping of a proton. With continued advancements in process size, this downward trend in sensitivity is expected to continue. Then, muon soft errors have been predicted for nano-electronics. This paper describes the effects in the specific cases such as neutron-, proton- and muon-induced SEU observed in complementary metal-oxide semiconductor. The results will allow investigating the technology node sensitivity along the scaling trend. PMID:24500239

  5. Operational, hyper-resolution hydrologic modeling over the contiguous U.S. using themulti-scale, multi-physics WRF-Hydro Modeling and Data Assimilation System.

    NASA Astrophysics Data System (ADS)

    Gochis, D. J.; Cosgrove, B.; Yu, W.; Clark, E. P.; Yates, D. N.; Dugger, A. L.; McCreight, J. L.; Pan, L.; Zhang, Y.; rafeei-Nasab, A.; Karsten, L. R.; Cline, D. W.; Sampson, K. M.; Newman, A. J.; Wood, A.; Win-Gildenmeister, M.

    2015-12-01

    Operational flood, flash flood and water supply forecasting is typically conducted using a host of different observational and modeling tools that range widely in process complexity, spatial resolution andobservational data sources. While such tailored approaches can provide significant skill in specific water forecasting applications, the lack of a more coordinated general approach can result in inconsistency between various forecast products and can inhibit transfer of information, methodologies between forecast systems. With the aim of improving the timeliness, consistency and spatial fidelity hydrologic prediction products, the U.S. National Weather Service has initiated an effort to provide street-level, water prediction services for the nation. This effort seeks to incorporate advances in hydrometeorological observing capabilities, new hydrologic data assimilation methodologies, improvements in hydrographic and geospatial information and advances in the ulitizion of high performance computers for process-based hydrologic modeling. This talk will summarize the proposed Initial Operating Capability (IOC) for national water prediction using the community WRF-Hydro modeling system, scheduled for operational execution during late spring of 2016. Four different configurations of the WRF-Hydro system are planned including an Analysis and Data Assimilation configuration, Short Range (0-2 day) and Medium Range (0-10 day) deterministic configurations and a Long Range (0-30 day) enesmble configuration. Streamflow analyses and forecasts from each model configurations will be produced on 2.7 million river reaches of the NHDPlusv2 hydrographic dataset. This presentation summarizes results from a number of different model development and benchmarking activities conducted as part of the IOC effort. Results from prototype real-time forecasting activities conducted during the 2015 National Flood Interoperability Experiment (NFIE) will be presented as will retrospective

  6. The cAMP/protein kinase A signaling pathway in pathogenic basidiomycete fungi: Connections with iron homeostasis

    PubMed Central

    Choi, Jaehyuk; Jung, Won Hee; Kronstad, James W.

    2015-01-01

    A number of pathogenic species of basidiomycete fungi are either life-threatening pathogens of humans or major economic pests for crop production. Sensing the host is a key aspect of pathogen proliferation during disease, and signal transduction pathways are critically important for detecting environmental conditions and facilitating adaptation. This review focuses on the contributions of the cAMP/protein kinase A (PKA) signaling pathway in Cryptococcus neoformans, a species that causes meningitis in humans, and Ustilago maydis, a model phytopathogen that causes a smut disease on maize. Environmental sensing by the cAMP/PKA pathway regulates the production of key virulence traits in C. neoformans including the polysaccharide capsule and melanin. For U. maydis, the pathway controls the dimorphic transition from budding growth to the filamentous cell type required for proliferation in plant tissue. We discuss recent advances in identifying new components of the cAMP/PKA pathway in these pathogens and highlight an emerging theme that pathway signaling influences iron acquisition. PMID:26231374

  7. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System

    PubMed Central

    Zahid, M. Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M.; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  8. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  9. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  10. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  11. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  12. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  13. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  14. Stimulators of AMP-activated kinase (AMPK) inhibit seawater- but not cAMP-induced oocyte maturation in a marine worm: Implications for interactions between cAMP and AMPK signaling.

    PubMed

    Stricker, Stephen A; Swiderek, Lee; Nguyen, Thanh

    2010-06-01

    Previous studies have shown that elevations in intraoocytic cAMP prevent mammalian oocytes from maturing, whereas cAMP degradation allows these oocytes to begin maturation, as evidenced by the onset of oocyte nuclear disassembly (="germinal vesicle breakdown", GVBD). Moreover, such cAMP degradation not only reduces cAMP levels but also generates AMP, which in turn can stimulate AMP-activated kinase (AMPK), a well-documented inducer of GVBD in mice. Alternatively, in some marine invertebrates, intraoocytic cAMP triggers, rather than blocks, GVBD, and whether AMPK up- or downregulates maturation in these species has not been tested. Thus, AMPK was monitored in the nemertean worm Cerebratulus during GVBD stimulated by seawater (SW) or cAMP elevators. In oocytes lacking surrounding follicle cells, AMPK activity was initially elevated in immature oocytes but subsequently reduced during SW- or cAMP-induced GVBD, given that the catalytic alpha-subunit of AMPK in maturing oocytes displayed a decreased stimulatory phosphorylation at T172 and an increased inhibitory phosphorylation at S485/491. Accordingly, AMPK-mediated phosphorylation of acetyl-CoA carboxylase, a known target of active AMPK, also declined during maturation. Moreover, treatments with either ice-cold calcium-free seawater (CaFSW) or AMPK agonists dissolved in SW maintained AMPK activity and inhibited GVBD. Conversely, adding cAMP elevators to CaFSW- or SW-solutions of AMPK activators restored GVBD while promoting S485/491 phosphorylation and AMPK deactivation. Collectively, such findings not only demonstrate for the first time that intraoocytic AMPK can block GVBD in the absence of surrounding follicle cells, but these results also provide evidence for a novel GVBD-regulating mechanism involving AMPK deactivation by cAMP-mediated S485/491 phosphorylation. PMID:20336704

  15. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity. PMID:26607336

  16. Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.

    PubMed

    Passner, J M; Schultz, S C; Steitz, T A

    2000-12-15

    After an allosteric transition produced by the binding of cyclic AMP (cAMP), the Escherichia coli catabolite gene activator protein (CAP) binds DNA specifically and activates transcription. The three-dimensional crystal structure of the CAP-cAMP complex has been refined at 2.1 A resolution, thus enabling a better evaluation of the structural basis for CAP phenotypes, the interactions of cAMP with CAP and the roles played by water structure. A review of mutational analysis of CAP together with the additional structural information presented here suggests a possible mechanism for the cAMP-induced allostery required for DNA binding and transcriptional activation. We hypothesize that cAMP binding may reorient the coiled-coil C-helices, which provide most of the dimer interface, thereby altering the relative positions of the DNA-binding domains of the CAP dimer. Additionally, cAMP binding may cause a further rearrangement of the DNA-binding and cAMP-binding domains of CAP via a flap consisting of beta-strands 4 and 5 which lies over the cAMP. PMID:11124031

  17. Purification of the surface cAMP receptor in Dictyostelium

    SciTech Connect

    Klein, P.; Knox, B.; Borleis, J.; Devreotes, P.

    1987-01-05

    We have previously identified and demonstrated reversible ligand-induced modification of the major cell surface cAMP receptor in Dictyostelium discoideum. The receptor, or a subunit of it, has been purified to homogeneity by hydroxylapatite chromatography followed by two-dimensional preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purification was monitored by following /sup 32/Pi incorporated by photoaffinity labeling with 8-azido-(/sup 32/P)cAMP or by in vivo labeling with /sup 32/Pi. Two interconvertible forms of the receptor, designated R (Mr 40,000) and D (Mr 43,000), co-purified. Two-dimensional peptide maps of independently purified and /sup 125/I-iodinated R and D forms of the receptor were nearly identical but did have several distinct peptides. The estimated 6000-fold purification required is consistent with the number of cell surface binding sites assuming there are not multiple binding sites/polypeptide. In the accompanying article we report the generation of a monospecific polyclonal antiserum which has helped to further elucidate the physical properties and developmental regulation of the cAMP receptor.

  18. Sustained cyclic AMP production by parathyroid hormone receptor endocytosis

    PubMed Central

    Ferrandon, Sébastien; Feinstein, Timothy N; Castro, Marian; Wang, Bin; Bouley, Richard; Potts, John T; Gardella, Thomas J; Vilardaga, Jean-Pierre

    2011-01-01

    Cell signaling mediated by the G protein-coupled parathyroid hormone receptor type 1 (PTHR) is fundamental to bone and kidney physiology. It has been unclear how the two ligand systems—PTH, endocrine and homeostatic, and PTH-related peptide (PTHrP), paracrine—can effectively operate with only one receptor and trigger different durations of the cAMP responses. Here we analyze the ligand response by measuring the kinetics of activation and deactivation for each individual reaction step along the PTHR signaling cascade. We found that during the time frame of G protein coupling and cAMP production, PTHrP1–36 action was restricted to the cell surface, whereas PTH1–34 had moved to internalized compartments where it remained associated with the PTHR and Gαs, potentially as a persistent and active ternary complex. Such marked differences suggest a mechanism by which PTH and PTHrP induce differential responses, and these results indicate that the central tenet that cAMP production originates exclusively at the cell membrane must be revised. PMID:19701185

  19. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  20. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  1. Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

    PubMed Central

    Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

    2013-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and

  2. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  3. THE ABC TRANSPORTER, AbcB3, MEDIATES cAMP EXPORT IN D. DISCOIDEUM DEVELOPMENT

    PubMed Central

    Miranda, Edward Roshan; Nam, Edward A.; Kuspa, Adam; Shaulsky, Gad

    2014-01-01

    Extracellular cAMP functions as a primary ligand for cell surface cAMP receptors throughout Dictyostelium discoideum development, controlling chemotaxis and morphogenesis. The developmental consequences of cAMP signaling and the metabolism of cAMP have been studied in great detail, but it has been unclear how cells export cAMP across the plasma membrane. Here we show pharmacologically and genetically that ABC transporters mediate cAMP export. Using an evolutionary-developmental biology approach, we identified several candidate abc genes and characterized one of them, abcB3, in more detail. Genetic and biochemical evidence suggest that AbcB3 is a component of the cAMP export mechanism in D. discoideum development. PMID:25448698

  4. Cyclic Amp phosphodiesterase activity in normal and inflamed human dental pulp.

    PubMed

    Spoto, G; Menna, V; Serra, E; Santoleri, F; Perfetti, G; Ciavarelli, L; Trentini, P

    2004-01-01

    Cyclic AMP phosphodiesterase (cAMP PDE) seems to be important in pulp tissues. High levels of cAMP PDE have been demonstrated to be in dental pulp cells. In the present study cAMP PDE activity was analyzed in normal healthy human dental pulps, in reversible pulpitis and in irreversible pulpitis. Enzymatic cAMP PDE control values for normal healthy pulps were 12.14 +/- 3.74 nmols/mg of proteins. In reversible pulpitis the cAMP PDE activity increased almost 2.5 times. In irreversible pulpitis specimens the values increased 4.5 times compared with normal healthy pulps activity. The differences between the groups (control vs. reversible pulpitis and vs. irreversible pulpitis) were statistically significant. These results could point to a role of cAMP PDE in the initial pulp response after injury. PMID:16857100

  5. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  6. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells.

    PubMed

    Breit, Andreas; Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas

    2016-07-01

    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction. PMID:27144291

  7. Exchange protein directly activated by cAMP (epac): a multidomain cAMP mediator in the regulation of diverse biological functions.

    PubMed

    Schmidt, Martina; Dekker, Frank J; Maarsingh, Harm

    2013-04-01

    Since the discovery nearly 60 years ago, cAMP is envisioned as one of the most universal and versatile second messengers. The tremendous feature of cAMP to tightly control highly diverse physiologic processes, including calcium homeostasis, metabolism, secretion, muscle contraction, cell fate, and gene transcription, is reflected by the award of five Nobel prizes. The discovery of Epac (exchange protein directly activated by cAMP) has ignited a new surge of cAMP-related research and has depicted novel cAMP properties independent of protein kinase A and cyclic nucleotide-gated channels. The multidomain architecture of Epac determines its activity state and allows cell-type specific protein-protein and protein-lipid interactions that control fine-tuning of pivotal biologic responses through the "old" second messenger cAMP. Compartmentalization of cAMP in space and time, maintained by A-kinase anchoring proteins, phosphodiesterases, and β-arrestins, contributes to the Epac signalosome of small GTPases, phospholipases, mitogen- and lipid-activated kinases, and transcription factors. These novel cAMP sensors seem to implement certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Agonists and antagonists selective for Epac are developed and will support further studies on the biologic net outcome of the activation of Epac. This will increase our current knowledge on the pathophysiology of devastating diseases, such as diabetes, cognitive impairment, renal and heart failure, (pulmonary) hypertension, asthma, and chronic obstructive pulmonary disease. Further insights into the cAMP dynamics executed by the Epac signalosome will help to optimize the pharmacological treatment of these diseases. PMID:23447132

  8. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  9. Cardiac myocyte–secreted cAMP exerts paracrine action via adenosine receptor activation

    PubMed Central

    Sassi, Yassine; Ahles, Andrea; Truong, Dong-Jiunn Jeffery; Baqi, Younis; Lee, Sang-Yong; Husse, Britta; Hulot, Jean-Sébastien; Foinquinos, Ariana; Thum, Thomas; Müller, Christa E.; Dendorfer, Andreas; Laggerbauer, Bernhard; Engelhardt, Stefan

    2014-01-01

    Acute stimulation of cardiac β-adrenoceptors is crucial to increasing cardiac function under stress; however, sustained β-adrenergic stimulation has been implicated in pathological myocardial remodeling and heart failure. Here, we have demonstrated that export of cAMP from cardiac myocytes is an intrinsic cardioprotective mechanism in response to cardiac stress. We report that infusion of cAMP into mice averted myocardial hypertrophy and fibrosis in a disease model of cardiac pressure overload. The protective effect of exogenous cAMP required adenosine receptor signaling. This observation led to the identification of a potent paracrine mechanism that is dependent on secreted cAMP. Specifically, FRET-based imaging of cAMP formation in primary cells and in myocardial tissue from murine hearts revealed that cardiomyocytes depend on the transporter ABCC4 to export cAMP as an extracellular signal. Extracellular cAMP, through its metabolite adenosine, reduced cardiomyocyte cAMP formation and hypertrophy by activating A1 adenosine receptors while delivering an antifibrotic signal to cardiac fibroblasts by A2 adenosine receptor activation. Together, our data reveal a paracrine role for secreted cAMP in intercellular signaling in the myocardium, and we postulate that secreted cAMP may also constitute an important signal in other tissues. PMID:25401477

  10. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  11. A novel biosensor to study cAMP dynamics in cilia and flagella.

    PubMed

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca(2+), basal SACY activity is suppressed by Ca(2+). Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. PMID:27003291

  12. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  13. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  14. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  15. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  16. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  17. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  18. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  19. cAMP and Ca2+ signaling in secretory epithelia: Crosstalk and Synergism

    PubMed Central

    Ahuja, Malini; Jha, Archana; Maléth, Jozsef; Park, Seonghee; Muallem, Shmuel

    2014-01-01

    The Ca2+ and cAMP/PKA pathways are the primary signaling systems in secretory epithelia that control virtually all secretory gland functions. Interaction and crosstalk in Ca2+ and cAMP signaling occur at multiple levels to control and tune the activity of each other. Physiologically, Ca2+ and cAMP signaling operate at 5–10% of maximal strength, but synergize to generate the maximal response. Although synergistic action of the Ca2+ and cAMP signaling is the common mode of signaling and has been known for many years, we know very little of the molecular mechanism and mediators of the synergism. In this review, we discuss crosstalk between the Ca2+ and cAMP signaling and the function of IRBIT (IP3 receptors binding protein release with IP3) as a third messenger that mediates the synergistic action of the Ca2+ and cAMP signaling. PMID:24613710

  20. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  1. Electrostatic steering enhances the rate of cAMP binding to phosphodiesterase: Brownian dynamics modeling.

    PubMed

    Huang, Yu-ming M; Huber, Gary; McCammon, J Andrew

    2015-11-01

    Signaling in cells often involves co-localization of the signaling molecules. Most experimental evidence has shown that intracellular compartmentalization restricts the range of action of the second messenger, 3'-5'-cyclic adenosine monophosphate (cAMP), which is degraded by phosphodiesterases (PDEs). The objective of this study is to understand the details of molecular encounter that may play a role in efficient operation of the cAMP signaling apparatus. The results from electrostatic potential calculations and Brownian dynamics simulations suggest that positive potential of the active site from PDE enhances capture of diffusing cAMP molecules. This electrostatic steering between cAMP and the active site of a PDE plays a major role in the enzyme-substrate encounter, an effect that may be of significance in sequestering cAMP released from a nearby binding site or in attracting more freely diffusing cAMP molecules. PMID:26346301

  2. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  3. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  4. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  5. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  6. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  7. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  8. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  9. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  10. Role of site-selective cAMP analogs in the control and reversal of malignancy.

    PubMed

    Cho-Chung, Y S; Clair, T; Tortora, G; Yokozaki, H

    1991-01-01

    Two isoforms of cAMP receptor protein, RI and RII, the regulatory subunits of cAMP-dependent protein kinase, transduce opposite signals, the RI being stimulatory and the RII being inhibitory of cell proliferation. In normal cells RI and RII exist at a specific physiological ratio whereas in cancer cells such physiological balance of these receptor proteins is disrupted. Reversal and suppression of malignancy can be achieved when the physiologic ratio of these intracellular signal transducers of cAMP is restored as shown by the use of site-selective cAMP analogs, antisense oligodeoxynucleotides or gene transfer, suggesting new approaches to cancer control. PMID:1653961

  11. Active site coupling in PDE:PKA complexes promotes resetting of mammalian cAMP signaling.

    PubMed

    Krishnamurthy, Srinath; Moorthy, Balakrishnan Shenbaga; Xin Xiang, Lim; Xin Shan, Lim; Bharatham, Kavitha; Tulsian, Nikhil Kumar; Mihalek, Ivana; Anand, Ganesh S

    2014-09-16

    Cyclic 3'5' adenosine monophosphate (cAMP)-dependent-protein kinase (PKA) signaling is a fundamental regulatory pathway for mediating cellular responses to hormonal stimuli. The pathway is activated by high-affinity association of cAMP with the regulatory subunit of PKA and signal termination is achieved upon cAMP dissociation from PKA. Although steps in the activation phase are well understood, little is known on how signal termination/resetting occurs. Due to the high affinity of cAMP to PKA (KD ∼ low nM), bound cAMP does not readily dissociate from PKA, thus begging the question of how tightly bound cAMP is released from PKA to reset its signaling state to respond to subsequent stimuli. It has been recently shown that phosphodiesterases (PDEs) can catalyze dissociation of bound cAMP and thereby play an active role in cAMP signal desensitization/termination. This is achieved through direct interactions with the regulatory subunit of PKA, thereby facilitating cAMP dissociation and hydrolysis. In this study, we have mapped direct interactions between a specific cyclic nucleotide phosphodiesterase (PDE8A) and a PKA regulatory subunit (RIα isoform) in mammalian cAMP signaling, by a combination of amide hydrogen/deuterium exchange mass spectrometry, peptide array, and computational docking. The interaction interface of the PDE8A:RIα complex, probed by peptide array and hydrogen/deuterium exchange mass spectrometry, brings together regions spanning the phosphodiesterase active site and cAMP-binding sites of RIα. Computational docking combined with amide hydrogen/deuterium exchange mass spectrometry provided a model for parallel dissociation of bound cAMP from the two tandem cAMP-binding domains of RIα. Active site coupling suggests a role for substrate channeling in the PDE-dependent dissociation and hydrolysis of cAMP bound to PKA. This is the first instance, to our knowledge, of PDEs directly interacting with a cAMP-receptor protein in a mammalian system, and

  12. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  13. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  14. A Universal Stress Protein (USP) in Mycobacteria Binds cAMP

    PubMed Central

    Banerjee, Arka; Adolph, Ramona S.; Gopalakrishnapai, Jayashree; Kleinboelting, Silke; Emmerich, Christiane; Steegborn, Clemens; Visweswariah, Sandhya S.

    2015-01-01

    Mycobacteria are endowed with rich and diverse machinery for the synthesis, utilization, and degradation of cAMP. The actions of cyclic nucleotides are generally mediated by binding of cAMP to conserved and well characterized cyclic nucleotide binding domains or structurally distinct cGMP-specific and -regulated cyclic nucleotide phosphodiesterase, adenylyl cyclase, and E. coli transcription factor FhlA (GAF) domain-containing proteins. Proteins with cyclic nucleotide binding and GAF domains can be identified in the genome of mycobacterial species, and some of them have been characterized. Here, we show that a significant fraction of intracellular cAMP is bound to protein in mycobacterial species, and by using affinity chromatography techniques, we identify specific universal stress proteins (USP) as abundantly expressed cAMP-binding proteins in slow growing as well as fast growing mycobacteria. We have characterized the biochemical and thermodynamic parameters for binding of cAMP, and we show that these USPs bind cAMP with a higher affinity than ATP, an established ligand for other USPs. We determined the structure of the USP MSMEG_3811 bound to cAMP, and we confirmed through structure-guided mutagenesis, the residues important for cAMP binding. This family of USPs is conserved in all mycobacteria, and we suggest that they serve as “sinks” for cAMP, making this second messenger available for downstream effectors as and when ATP levels are altered in the cell. PMID:25802331

  15. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  16. Structural and functional characterization of Pseudomonas aeruginosa global regulator AmpR.

    PubMed

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen; Mathee, Kalai

    2014-11-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5' rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ(54) and σ(70) consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  17. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  18. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  19. Advance directives

    PubMed Central

    O’Sullivan, Rory; Mailo, Kevin; Angeles, Ricardo; Agarwal, Gina

    2015-01-01

    Abstract Objective To establish the prevalence of patients with advance directives in a family practice, and to describe patients’ perspectives on a family doctor’s role in initiating discussions about advance directives. Design A self-administered patient questionnaire. Setting A busy urban family medicine teaching clinic in Hamilton, Ont. Participants A convenience sample of adult patients attending the clinic over the course of a typical business week. Main outcome measures The prevalence of advance directives in the patient population was determined, and the patients’ expectations regarding the role of their family doctors were elucidated. Results The survey population consisted of 800 participants (a response rate of 72.5%) well distributed across age groups; 19.7% had written advance directives and 43.8% had previously discussed the topic of advance directives, but only 4.3% of these discussions had occurred with family doctors. In 5.7% of cases, a family physician had raised the issue; 72.3% of respondents believed patients should initiate the discussion. Patients who considered advance directives extremely important were significantly more likely to want their family doctors to start the conversation (odds ratio 3.98; P < .05). Conclusion Advance directives were not routinely addressed in the family practice. Most patients preferred to initiate the discussion of advance directives. However, patients who considered the subject extremely important wanted their family doctors to initiate the discussion. PMID:25873704

  20. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  1. Role of Membrane Microdomains in Compartmentation of cAMP Signaling

    PubMed Central

    Agarwal, Shailesh R.; Yang, Pei-Chi; Rice, Monica; Singer, Cherie A.; Nikolaev, Viacheslav O.; Lohse, Martin J.; Clancy, Colleen E.; Harvey, Robert D.

    2014-01-01

    Spatially restricting cAMP production to discrete subcellular locations permits selective regulation of specific functional responses. But exactly where and how cAMP signaling is confined is not fully understood. Different receptors and adenylyl cyclase isoforms responsible for cAMP production are not uniformly distributed between lipid raft and non-lipid raft domains of the plasma membrane. We sought to determine the role that these membrane domains play in organizing cAMP responses in HEK293 cells. The freely diffusible FRET-based biosensor Epac2-camps was used to measure global cAMP responses, while versions of the probe targeted to lipid raft (Epac2-MyrPalm) and non-raft (Epac2-CAAX) domains were used to monitor local cAMP production near the plasma membrane. Disruption of lipid rafts by cholesterol depletion selectively altered cAMP responses produced by raft-associated receptors. The results indicate that receptors associated with lipid raft as well as non-lipid raft domains can contribute to global cAMP responses. In addition, basal cAMP activity was found to be significantly higher in non-raft domains. This was supported by the fact that pharmacologic inhibition of adenylyl cyclase activity reduced basal cAMP activity detected by Epac2-CAAX but not Epac2-MyrPalm or Epac2-camps. Responses detected by Epac2-CAAX were also more sensitive to direct stimulation of adenylyl cyclase activity, but less sensitive to inhibition of phosphodiesterase activity. Quantitative modeling was used to demonstrate that differences in adenylyl cyclase and phosphodiesterase activities are necessary but not sufficient to explain compartmentation of cAMP associated with different microdomains of the plasma membrane. PMID:24752595

  2. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  3. cAMP signaling prevents podocyte apoptosis via activation of protein kinase A and mitochondrial fusion.

    PubMed

    Li, Xiaoying; Tao, Hua; Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  4. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  5. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 1: AMPS payload to shuttle ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    Physical, functional, and operational interfaces between the space shuttle orbiter and the AMPS payload are described for the ground handling and test phases, prelaunch, launch and ascent, operational, stowage, and reentry and landing activities.

  6. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  7. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    SciTech Connect

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil Lee, Zang Hee

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  8. AMP-activated Protein Kinase As a Target For Pathogens: Friends Or Foes?

    PubMed

    Moreira, Diana; Silvestre, Ricardo; Cordeiro-da-Silva, Anabela; Estaquier, Jérôme; Foretz, Marc; Viollet, Benoit

    2016-01-01

    Intracellular pathogens are known to manipulate host cell regulatory pathways to establish an optimal environment for their growth and survival. Pathogens employ active mechanisms to hijack host cell metabolism and acquire existing nutrient and energy store. The role of the cellular energy sensor AMP-activated protein kinase (AMPK) in the regulation of cellular energy homeostasis is well documented. Here, we highlight recent advances showing the importance of AMPK signaling in pathogen-host interactions. Pathogens interact with AMPK by a variety of mechanisms aimed at reprogramming host cell metabolism to their own benefit. Stimulation of AMPK activity provides an efficient process to rapidly adapt pathogen metabolism to the major nutritional changes often encountered during the different phases of infection. However, inhibition of AMPK is also used by pathogens to manipulate innate host response, indicating that AMPK appears relevant to restriction of pathogen infection. We also document the effects of pharmacological AMPK modulators on pathogen proliferation and survival. This review illustrates intricate pathogen-AMPK interactions that may be exploited to the development of novel anti-pathogen therapies. PMID:25882224

  9. Differential effects on cAMP on the MAP kinase cascade: evidence for a cAMP-insensitive step that can bypass Raf-1.

    PubMed Central

    Faure, M; Bourne, H R

    1995-01-01

    Because cAMP exerts opposite effects on cell proliferation in different cell types, we undertook to study its effect on the mitogen-activated protein kinase (MAPK) pathway in three cell lines (Rat-1, Swiss-3T3, and COS-7) chosen for their different mitogenic responses to cAMP. We measured the effect of cAMP on MAPK, MEK, and Raf-1 activities after stimulation by agonists acting through a tyrosine kinase receptor (epidermal growth factor) or a G protein-coupled receptor (lysophosphatidic acid). In Rat-1 cells we found that cAMP strongly inhibited all three activities (MAPK, MEK, and Raf-1), in good agreement with its effect on cell proliferation in these cells. In Swiss-3T3 and COS-7 cells, on the contrary, cAMP did not inhibit epidermal growth factor- and lysophosphatidic acid-induced stimulation of MAPK and MEK activities, and even stimulated MAPK activity slightly on its own. Again these results are in good agreement with the proliferative effect of cAMP in Swiss-3T3 cells. Raf-1 activity on the hand, was inhibited by cAMP in Swiss-3T3 and COS-7 as it was in Rat-1 cells. This result indicates that signaling pathways in Swiss-3T3 and COS-7 cells can activate MEK and MAPK in a Raf-1-independent and cAMP-insensitive manner. Our results add to growing evidence for the existence of Ras- and/or Raf-1-independent pathways leading to MEK and MAPK activation. Images PMID:7579705

  10. CCR-08-0827 Version 2 Targeted inhibition of cyclic AMP phosphodiesterase-4 promotes brain tumor regression

    PubMed Central

    Goldhoff, Patricia; Warrington, Nicole; Limbrick, David D.; Hope, Andrew; Woerner, B. Mark; Jackson, Erin; Perry, Arie; Piwnica-Worms, David; Rubin, Joshua B.

    2008-01-01

    Statement of Clinical Relevance Therapies that can overcome the resistance of malignant brain tumors would be a major clinical advance. Here, we investigate the role of cAMP Phosphodiesterase-4 in stimulating brain tumor growth and the therapeutic utility of cAMP Phosphodiesterase-4 inhibition in the treatment of malignant brain tumors. Cyclic AMP Phosphodiesterase-4 was widely expressed in human brain tumors of glial and neuronal lineage, and forced expression of PDE4A1 accelerated intracranial glioblastoma and medulloblastoma xenograft growth. Moreover, targeted inhibition of PDE4, in combination with standard radiation and chemotherapy, induced a unique regression of established intracranial glioblastoma xenografts. These findings identify PDE4 as a novel molecular target for brain tumor therapy and indicate that PDE4 inhibition should be evaluated in clinical trials for malignant brain tumors. Purpose As favorable outcomes from malignant brain tumors remain limited by poor survival and treatment-related toxicity, novel approaches to cure are essential. Previously, we identified the cyclic AMP phosphodiesterase-4 (PDE4) inhibitor Rolipram as a potent anti-tumor agent. Here, we investigate the role of PDE4 in brain tumors and examine the utility of PDE4 as a therapeutic target. Experimental Design Immunohistochemistry was used to evaluate the expression pattern of a subfamily of PDE4, PDE4A, in multiple brain tumor types. To evaluate the effect of PDE4A on growth, a brain-specific isoform, PDE4A1 was overexpressed in xenografts of Daoy medulloblastoma and U87 glioblastoma cells. To determine therapeutic potential of PDE4 inhibition, Rolipram, temozolomide, and radiation were tested alone and in combination on mice bearing intracranial U87 xenografts. Results We found that PDE4A is expressed in medulloblastoma, glioblastoma, oligodendroglioma, ependymoma and meningioma. Moreover, when PDE4A1 was overexpressed in Daoy medulloblastoma and U87 glioblastoma cells, in

  11. The possible role of cyclic AMP in the neurotrophic control of skeletal muscle.

    PubMed Central

    Carlsen, R C

    1975-01-01

    1. Motoneurones provide trophic control of some of the functional characteristics of skeletal muscle fibres. This study has been designed to test whether the adenylate cyclase: cyclic AMP system may offer one potential mechanism for the mediation of neurotrophic regulation. 2. The concentration of cyclic AMP was measured at various intervals after muscle denervation. Muscle cyclic AMP concentration increases for the first 2 days after nerve section. It reaches a maximum value at 48 h and subsequently returns to the control value at 7 days. 3. Cyclic AMP concentration is unchanged by muscle disuse for the first 3 days following limb immobilization. Four days after immobilization, however, cyclic AMP increases in both the disused and contralateral control muscles. This phenomenon has been tentatively ascribed to some aspect of the inflammatory response. 4. Changing the level of nerve section, and therefore the length of the residual nerve stump, changes the temporal pattern of the increase in muscle cyclic AMP concentration. 5. Reinnervation of a denervated muscle produces a decrease in muscle cyclic AMP concentration. 6. It is concluded from the results that some aspect of nerve function provides trophic regulation of the muscle adenylate cyclase: cyclic AMP system. The mechanisms by which this regulation may be applied are considered in the Discussion. PMID:168354

  12. A Model Based on Receptor Desensitization for Cyclic AMP Signaling in Dictyostelium Cells

    PubMed Central

    Martiel, Jean-Louis; Goldbeter, Albert

    1987-01-01

    We analyze a model based on receptor modification for the cAMP signaling system that controls aggregation of the slime mold Dictyostelium discoideum after starvation. The model takes into account both the desensitization of the cAMP receptor by reversible phosphorylation and the activation of adenylate cyclase that follows binding of extracellular cAMP to the unmodified receptor. The dynamics of the signaling system is studied in terms of three variables, namely, intracellular and extracellular cAMP, and the fraction of receptor in active state. Using parameter values collected from experimental studies on cAMP signaling and receptor phosphorylation, we show that the model accounts qualitatively and, in a large measure, quantitatively for the various modes of dynamic behavior observed in the experiments: (a) autonomous oscillations of cAMP, (b) relay of suprathreshold cAMP pulses, i.e., excitability, characterized by both an absolute and a relative refractory period, and (c) adaptation to constant cAMP stimuli. A two-variable version of the model is used to demonstrate the link between excitability and oscillations by phase plane analysis. The response of the model to repetitive stimulation allows comprehension, in terms of receptor desensitization, of the role of periodic signaling in Dictyostelium and, more generally, the function of pulsatile patterns of hormone secretion. PMID:19431710

  13. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  14. cAMP biosensors applied in molecular pharmacological studies of G protein-coupled receptors.

    PubMed

    Mathiesen, Jesper Mosolff; Vedel, Line; Bräuner-Osborne, Hans

    2013-01-01

    Cyclic adenosine monophosphate (cAMP) is a common second messenger that mediates numerous biological responses. Intracellular cAMP levels are increased by activation of G(s)-coupled G protein-coupled receptors (GPCRs) and decreased by activation of G(i)-coupled GPCRs via the adenylyl cyclase. Many end-point assays for quantifying GPCR-mediated changes in intracellular cAMP levels exist. More recently, fluorescence resonance energy transfer (FRET)-based cAMP biosensors that can quantify intracellular cAMP levels in real time have been developed. These FRET-based cAMP biosensors have been used primarily in single cell FRET microscopy to monitor and visualize changes in cAMP upon GPCR activation. Here, a similar cAMP biosensor with a more efficient mCerulean/mCitrine FRET pair is described for use in the 384-well plate format. After cloning and expression in HEK293 cells, the biosensor is characterized in the 384-well plate format and used for measuring the signaling of the G(s)-coupled β(2)-adrenergic receptor. The procedures described may be applied for other FRET-based biosensors in terms of characterization and conversion to the 384-well plate format. PMID:23374187

  15. 78 FR 1264 - CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative Determination Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... Employment and Training Administration CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative... workers of the subject firm (TA-W-80,399A; CalAmp Wireless Networks Corporation, Waseca, Minnesota... Wireless Networks Corporation, Waseca, Minnesota to apply for TAA, the Department determines that...

  16. Prostaglandin E2 inhibits apoptosis in human neutrophilic polymorphonuclear leukocytes: role of intracellular cyclic AMP levels.

    PubMed

    Ottonello, L; Gonella, R; Dapino, P; Sacchetti, C; Dallegri, F

    1998-08-01

    Human neutrophilic polymorphonuclear leukocytes (neutrophils) are terminally differentiated cells that die by undergoing apoptosis. At present, the intracellular pathways governing this process are only partially known. In particular, although the adenylate cyclase-dependent generation of cyclic AMP (cAMP) has been implicated in the triggering of apoptosis in lymphoid cells, the role of the intracellular cAMP pathway in neutrophil apoptosis remains controversial. In the present study, we found that two cAMP-elevating agents, prostaglandin E2 (PGE2) and the phosphodiesterase type IV inhibitor RO 20-1724, inhibit neutrophil apoptosis without inducing cell necrosis. When administered in combination, PGE2 and RO 20-1724 displayed additive effects. Moreover, neutrophil apoptosis was inhibited by a membrane-permeable analog of cAMP, dibutyryl-cAMP, in a dose-dependent manner. Finally, treatment of neutrophils with the protein kinase A inhibitor H-89 prevented PGE2- and RO 20-1724-induced inhibition of cell apoptosis. In conclusion, taking into account that PGE2 and other cAMP-elevating agents are well known downregulators of neutrophil functions, our results suggest that conditions favoring a state of functional rest, such as intracellular cAMP elevation, prolong the life span of neutrophils by delaying apoptosis. PMID:9694511

  17. Comparative biology of cAMP-induced germinal vesicle breakdown in marine invertebrate oocytes.

    PubMed

    Deguchi, Ryusaku; Takeda, Noriyo; Stricker, Stephen A

    2011-01-01

    During maturation, oocytes must undergo a process of nuclear disassembly, or "germinal vesicle breakdown" (GVBD), that is regulated by signaling pathways involving cyclic AMP (cAMP). In vertebrate and starfish oocytes, cAMP elevation typically prevents GVBD. Alternatively, increased concentrations of intra-oocytic cAMP trigger, rather than inhibit, GVBD in several groups of marine invertebrates. To integrate what is known about the stimulation of GVBD by intra-oocytic cAMP, this article reviews published data for ascidian, bivalve, brittle star, jellyfish, and nemertean oocytes. The bulk of the review concentrates on the three most intensively analyzed groups known to display cAMP-induced GVBD-nemerteans, ascidians, and jellyfish. In addition, this synopsis also presents some previously unpublished findings regarding the stimulatory effects of intra-oocytic cAMP on GVBD in jellyfish and the annelid worm Pseudopotamilla occelata. Finally, factors that may account for the currently known distribution of cAMP-induced GVBD across animal groups are discussed. PMID:21774023

  18. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration

    PubMed Central

    Siddiq, Mustafa M.; Hannila, Sari S.

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  19. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  20. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  1. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration.

    PubMed

    Siddiq, Mustafa M; Hannila, Sari S

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  2. Subcelluar compartmentalization of cAMP-dependent protein kinase regulatory subunits during palate ontogeny

    SciTech Connect

    Linask, K.K.; Greene, R.M. )

    1989-01-01

    Mammalian palatal ontogeny involves epithelial-mesenchymal interactions, cell differentiation, and cell movement. These events occur on days 12, 13, and 14 of gestation in the C57BL/6J mouse embryo. During this period intracellular cAMP levels and cAMP-dependent protein kinase (cAMP-dPK) levels in the palate transiently elevate. Cyclic AMP activates cAMP-dPK by binding primarily to two types of regulatory subunits of this enzyme, designated as R{sub I} and R{sub II}. To assess whether differential compartmentalization of the regulatory subunits occurs during palatal ontogeny, cytosolic, nuclear, and particulate fractions were prepared from day 12, 13, and 14 embryonic maxillary and palatal tissue. After photo-affinity labeling of each fraction with 8-azido ({sup 32}P) cAMP, SDS-PAGE, and autoradiography, autoradiograms were analyzed densitometrically. The R{sub I} isoform predominated in the nuclear and particulate fractions on all three developmental days; whereas R{sub II} predominated in the cytosolic fractions. Thus, differential compartmentalization of cAMP-dPK may be a means by which cAMP dependent responses are regulated during palatogenesis.

  3. Global and local missions of cAMP signaling in neural plasticity, learning, and memory

    PubMed Central

    Lee, Daewoo

    2015-01-01

    The fruit fly Drosophila melanogaster has been a popular model to study cAMP signaling and resultant behaviors due to its powerful genetic approaches. All molecular components (AC, PDE, PKA, CREB, etc) essential for cAMP signaling have been identified in the fly. Among them, adenylyl cyclase (AC) gene rutabaga and phosphodiesterase (PDE) gene dunce have been intensively studied to understand the role of cAMP signaling. Interestingly, these two mutant genes were originally identified on the basis of associative learning deficits. This commentary summarizes findings on the role of cAMP in Drosophila neuronal excitability, synaptic plasticity and memory. It mainly focuses on two distinct mechanisms (global versus local) regulating excitatory and inhibitory synaptic plasticity related to cAMP homeostasis. This dual regulatory role of cAMP is to increase the strength of excitatory neural circuits on one hand, but to act locally on postsynaptic GABA receptors to decrease inhibitory synaptic plasticity on the other. Thus the action of cAMP could result in a global increase in the neural circuit excitability and memory. Implications of this cAMP signaling related to drug discovery for neural diseases are also described. PMID:26300775

  4. Expression of AMP-activated protein kinase subunits during chicken embryonic and post-hatch development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is a highly conserved serine/threonine protein kinase that senses cellular energy status (AMP/ATP ratio) and acts to maintain energy homeostasis by regulating the activities of energy-consuming and energy-generating metabolic pathways. AMPK is a heterotrimeric en...

  5. Reciprocal regulation of insulin and plasma 5'-AMP in glucose homeostasis in mice.

    PubMed

    Xia, Lin; Wang, Zhongqiu; Zhang, Ying; Yang, Xiao; Zhan, Yibei; Cheng, Rui; Wang, Shiming; Zhang, Jianfa

    2015-03-01

    A previous investigation has demonstrated that plasma 5'-AMP (pAMP) exacerbates and causes hyperglycemia in diabetic mice. However, the crosstalk between pAMP and insulin signaling to regulate glucose homeostasis has not been investigated in depth. In this study, we showed that the blood glucose level was more dependent on the ratio of insulin to pAMP than on the absolute level of these two factors. Administration of 5'-AMP significantly attenuated the insulin-stimulated insulin receptor (IR) autophosphorylation in the liver and muscle tissues, resulting in the inhibition of downstream AKT phosphorylation. A docking analysis indicated that adenosine was a potential inhibitor of IR tyrosine kinase. Moreover, the 5'-AMP treatment elevated the ATP level in the pancreas and in the isolated islets, stimulating insulin secretion and increasing the plasma level of insulin. The insulin administration decreased the 5'-AMP-induced hyper-adenosine level by the up-regulation of adenosine kinase activities. Our results indicate that blood glucose homeostasis is reciprocally regulated by pAMP and insulin. PMID:25512345

  6. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  7. Regulation of ciliary motility by membrane potential in Paramecium: a role for cyclic AMP.

    PubMed

    Bonini, N M; Gustin, M C; Nelson, D L

    1986-01-01

    The membrane potential of Paramecium controls the frequency and direction of the ciliary beat, thus determining the cell's swimming behavior. Stimuli that hyperpolarize the membrane potential increase the ciliary beat frequency and therefore increase forward swimming speed. We have observed that 1) drugs that elevate intracellular cyclic AMP increased swimming speed 2-3-fold, 2) hyperpolarizing the membrane potential by manipulation of extracellular cations (e.g., K+) induced both a transient increase in, and a higher sustained level of cyclic AMP compared to the control, and 3) the swimming speed of detergent-permeabilized cells in MgATP was stimulated 2-fold by the addition of cyclic AMP. Our results suggest that the membrane potential can regulate intracellular cAMP in Paramecium and that control of swimming speed by membrane potential may in part be mediated by cAMP. PMID:2427226

  8. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  9. Occurrence of cyclic AMP and related enzymes during germination of Pinus pinea seeds.

    PubMed

    Martelli, P; Lusini, P; Bovalini, L; Bartali, R; Franchi, G G; Cinci, G

    1987-01-01

    The occurrence of cAMP, adenylate cyclase and cAMP phosphodiesterase has been tested in Pinus pinea seed during germination. The study has been carried out on dormant and imbibed seeds, seedlings, endospermic residues, roots and cotyledons. cAMP has been detected by the protein binding method and its occurrence has been verified by HPLC detections. cAMP phosphodiesterase shows a very high activity at acidic pH, while being completely inactive at pH 7.4. At this pH value, well detectable levels of adenylate cyclase have been observed. Therefore, the classical pathway of synthesis and breakdown of cAMP, already accepted for animal and bacterial cells, seems to be operating in Pinus pinea plant too. PMID:3038780

  10. cAMP stimulates the ubiquitin/proteasome pathway in rat spinal cord neurons.

    PubMed

    Myeku, Natura; Wang, Hu; Figueiredo-Pereira, Maria E

    2012-10-11

    Proteasome impairment and accumulation of ubiquitinated proteins are implicated in neurodegeneration associated with different forms of spinal cord injury. We show herein that elevating cAMP in rat spinal cord neurons increases 26S proteasome activity in a protein kinase A-dependent manner. Treating spinal cord neurons with dibutyryl-cAMP (db-cAMP) also raised the levels of various components of the UPP including proteasome subunits Rpt6 and β5, polyubiquitin shuttling factor p62/sequestosome1, E3 ligase CHIP, AAA-ATPase p97 and the ubiquitin gene ubB. Finally, db-cAMP reduced the accumulation of ubiquitinated proteins, proteasome inhibition, and neurotoxicity triggered by the endogenous product of inflammation prostaglandin J2. We propose that optimizing the effects of cAMP/PKA-signaling on the UPP could offer an effective therapeutic approach to prevent UPP-related proteotoxicity in spinal cord neurons. PMID:22982149

  11. AMPed Up immunity: how antimicrobial peptides have multiple roles in immune defense

    PubMed Central

    Lai, Yuping; Gallo, Richard L.

    2009-01-01

    Antimicrobial peptides (AMPs) are widely expressed and rapidly induced at epithelial surfaces to repel assault from diverse infectious agents including bacteria, viruses, fungi and parasites. Much information suggests that AMPs act by mechanisms that extend beyond their capacity to serve as gene-encoded antibiotics. For example, some AMPs alter the properties of the mammalian membrane or interact with its receptors to influence diverse cellular processes including cytokine release, chemotaxis, antigen presentation, angiogenesis and wound healing. These functions complement their antimicrobial action and favor resolution of infection and repair of damaged epithelia. Opposing this, some microbes have evolved mechanisms to inactivate or avoid AMPs and subsequently become pathogens. Thus, AMPs are multifunctional molecules that have a central role in infection and Inflammation. PMID:19217824

  12. Cell-to-cell coordination for the spontaneous cAMP oscillation in Dictyostelium

    NASA Astrophysics Data System (ADS)

    Nagano, Seido; Sakurai, Shunsuke

    2013-12-01

    We propose a new cellular dynamics scheme for the spontaneous cAMP oscillations in Dictyostelium discoideum. Our scheme seamlessly integrates both receptor dynamics and G-protein dynamics into our previously developed cellular dynamics scheme. Extensive computer simulation studies based on our new cellular dynamics scheme were conducted in mutant cells to evaluate the molecular network. The validity of our proposed molecular network as well as the controversial PKA-dependent negative feedback mechanism was supported by our simulation studies. Spontaneous cAMP oscillations were not observed in a single mutant cell. However, multicellular states of various mutant cells consistently initiated spontaneous cAMP oscillations. Therefore, cell-to-cell coordination via the cAMP receptor is essential for the robust initiation of spontaneous cAMP oscillations.

  13. Advanced Microsensors

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This video looks at a spinoff application of the technology from advanced microsensors -- those that monitor and determine conditions of spacecraft like the Space Shuttle. The application featured is concerned with the monitoring of the health of premature babies.

  14. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  15. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    PubMed Central

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying; Billiar, Timothy R.

    2013-01-01

    Tumor necrosis factor α (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found that cAMP exerts its affect at the proximal level of TNF signaling by inhibiting the formation of the DISC complex upon the binding of TNF to TNFR1. In conclusion, our study shows that cAMP prevents TNF + ActD-induced apoptosis in rat hepatocytes by inhibiting DISC complex formation. PMID:22634003

  16. cAMP/PKA signaling inhibits osteogenic differentiation and bone formation in rodent models.

    PubMed

    Siddappa, Ramakrishnaiah; Mulder, Winfried; Steeghs, Ilse; van de Klundert, Christine; Fernandes, Hugo; Liu, Jun; Arends, Roel; van Blitterswijk, Clemens; de Boer, Jan

    2009-08-01

    We previously demonstrated that cAMP-mediated protein kinase A (PKA) activation induces in vitro osteogenesis and in vivo bone formation by human mesenchymal stem cells (hMSCs). To analyze the species-specific response of this phenomenon and to translate our findings into a clinical trial, suitable animal models and cell lines are desirable. In this report, we assessed whether PKA plays a similar proosteogenic role played by two commonly used PKA activators-N6,2'-O-dibutyryl-cAMP (db-cAMP) and 8-bromo cAMP (8b-cAMP)-in a number of model systems. To this end, we treated MC3T3-E1 cells, mouse calvarial osteoblasts, mouse MSCs, and rat MSCs with cAMP. We demonstrate that cAMP inhibits osteogenesis in rodent cell types, evidenced by inhibition of osteogenic markers such as alkaline phosphatase (ALP), osteocalcin (BGLAP), and collagen type 1 (COL1A1). In support of this, ex vivo-cultured mouse calvaria exposed to db-cAMP showed a reduction in bone volume. Interestingly, cAMP even stimulated adipogenic differentiation in rat MSCs. Taken together, our data demonstrate that cAMP inhibits osteogenesis in vitro and bone formation ex vivo in rodent models in contrast to our earlier findings in hMSCs. The species discrepancy in response to various osteogenic signals is a critical need to be tested in clinically relevant models to translate the fundamental findings in lower species level to clinical applications. PMID:19231969

  17. Differential regulation by AMP and ADP of AMPK complexes containing different γ subunit isoforms

    PubMed Central

    Ross, Fiona A.; Jensen, Thomas E.; Hardie, D. Grahame

    2015-01-01

    The γ subunits of heterotrimeric AMPK complexes contain the binding sites for the regulatory adenine nucleotides AMP, ADP and ATP. We addressed whether complexes containing different γ isoforms display different responses to adenine nucleotides by generating cells stably expressing FLAG-tagged versions of the γ1, γ2 or γ3 isoform. When assayed at a physiological ATP concentration (5 mM), γ1- and γ2-containing complexes were allosterically activated almost 10-fold by AMP, with EC50 values one to two orders of magnitude lower than the ATP concentration. By contrast, γ3 complexes were barely activated by AMP under these conditions, although we did observe some activation at lower ATP concentrations. Despite this, all three complexes were activated, due to increased Thr172 phosphorylation, when cells were incubated with mitochondrial inhibitors that increase cellular AMP. With γ1 complexes, activation and Thr172 phosphorylation induced by the upstream kinase LKB1 [liver kinase B1; but not calmodulin-dependent kinase kinase (CaMKKβ)] in cell-free assays was markedly promoted by AMP and, to a smaller extent and less potently, by ADP. However, effects of AMP or ADP on activation and phosphorylation of the γ2 and γ3 complexes were small or insignificant. Binding of AMP or ADP protected all three γ subunit complexes against inactivation by Thr172 dephosphorylation; with γ2 complexes, ADP had similar potency to AMP, but with γ1 and γ3 complexes, ADP was less potent than AMP. Thus, AMPK complexes containing different γ subunit isoforms respond differently to changes in AMP, ADP or ATP. These differences may tune the responses of the isoforms to fit their differing physiological roles. PMID:26542978

  18. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  19. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  20. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  1. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  2. Cyclic AMP can promote APL progression and protect myeloid leukemia cells against anthracycline-induced apoptosis

    PubMed Central

    Gausdal, G; Wergeland, A; Skavland, J; Nguyen, E; Pendino, F; Rouhee, N; McCormack, E; Herfindal, L; Kleppe, R; Havemann, U; Schwede, F; Bruserud, Ø; Gjertsen, B T; Lanotte, M; Ségal-Bendirdjian, E; Døskeland, S O

    2013-01-01

    We show that cyclic AMP (cAMP) elevating agents protect blasts from patients with acute promyelocytic leukemia (APL) against death induced by first-line anti-leukemic anthracyclines like daunorubicin (DNR). The cAMP effect was reproduced in NB4 APL cells, and shown to depend on activation of the generally cytoplasmic cAMP-kinase type I (PKA-I) rather than the perinuclear PKA-II. The protection of both NB4 cells and APL blasts was associated with (inactivating) phosphorylation of PKA site Ser118 of pro-apoptotic Bad and (activating) phosphorylation of PKA site Ser133 of the AML oncogene CREB. Either event would be expected to protect broadly against cell death, and we found cAMP elevation to protect also against 2-deoxyglucose, rotenone, proteasome inhibitor and a BH3-only mimetic. The in vitro findings were mirrored by the findings in NSG mice with orthotopic NB4 cell leukemia. The mice showed more rapid disease progression when given cAMP-increasing agents (prostaglandin E2 analog and theophylline), both with and without DNR chemotherapy. The all-trans retinoic acid (ATRA)-induced terminal APL cell differentiation is a cornerstone in current APL treatment and is enhanced by cAMP. We show also that ATRA-resistant APL cells, believed to be responsible for treatment failure with current ATRA-based treatment protocols, were protected by cAMP against death. This suggests that the beneficial pro-differentiating and non-beneficial pro-survival APL cell effects of cAMP should be weighed against each other. The results suggest also general awareness toward drugs that can affect bone marrow cAMP levels in leukemia patients. PMID:23449452

  3. Elevated cAMP increases aquaporin-3 plasma membrane diffusion.

    PubMed

    Marlar, Saw; Arnspang, Eva C; Koffman, Jennifer S; Løcke, Else-Merete; Christensen, Birgitte M; Nejsum, Lene N

    2014-03-15

    Regulated urine concentration takes place in the renal collecting duct upon arginine vasopressin (AVP) stimulation, where subapical vesicles containing aquaporin-2 (AQP2) are inserted into the apical membrane instantly increasing water reabsorption and urine concentration. The reabsorped water exits via basolateral AQP3 and AQP4. Upon long-term stimulation with AVP or during thirst, expression levels of both AQP2 and AQP3 are increased; however, there is so far no evidence for short-term AVP regulation of AQP3 or AQP4. To facilitate the increase in transepithelial water transport, AQP3 may be short-term regulated via changes in protein-protein interactions, incorporation into lipid rafts, and/or changes in steady-state turnover, which could result in changes in the diffusion behavior of AQP3. Thus we measured AQP3 diffusion coefficients upon stimulation with the AVP mimic forskolin to reveal if AQP3 could be short-term regulated by AVP. k-Space image correlation spectroscopy (kICS) analysis of time-lapse image sequences of basolateral enhanced green fluorescent protein-tagged AQP3 (AQP3-EGFP) revealed that the forskolin-mediated elevation of cAMP increased the diffusion coefficient by 58% from 0.0147 ± 0.0082 μm(2)/s (control) to 0.0232 ± 0.0085 μm(2)/s (forskolin, P < 0.05). Quantum dot-conjugated antibody labeling also revealed a significant increase in AQP3 diffusion upon forskolin treatment by 44% [0.0104 ± 0.0040 μm(2)/s (control) vs. 0.0150 ± 0.0016 μm(2)/s (forskolin, P < 0.05)]. Immunoelectron microscopy showed no obvious difference in AQP3-EGFP expression levels or localization in the plasma membrane upon forskolin stimulation. Thus AQP3-EGFP diffusion is altered upon increased cAMP, which may correspond to basolateral adaptations in response to the increased apical water readsorption. PMID:24452376

  4. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  5. Developing a Comprehensive Software Suite for Advanced Reactor Performance and Safety Analysis

    SciTech Connect

    Pointer, William David; Bradley, Keith S; Fischer, Paul F; Smith, Micheal A; Tautges, Timothy J; Ferencz, Robert M; Martineau, Richard C; Jain, Rajeev; Obabko, Aleksandr; Billings, Jay Jay

    2013-01-01

    This paper provides an introduction to the reactor analysis capabilities of the nuclear power reactor simulation tools that are being developed as part of the U.S. Department of Energy s Nuclear Energy Advanced Modeling and Simulation (NEAMS) Toolkit. The NEAMS Toolkit is an integrated suite of multi-physics simulation tools that leverage high-performance computing to reduce uncertainty in the prediction of performance and safety of advanced reactor and fuel designs. The Toolkit effort is comprised of two major components, the Fuels Product Line (FPL), which provides tools for fuel performance analysis, and the Reactor Product Line (RPL), which provides tools for reactor performance and safety analysis. This paper provides an overview of the NEAMS RPL development effort.

  6. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  7. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  8. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation

    PubMed Central

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  9. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation.

    PubMed

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  10. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  11. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  12. Sustained exposure to catecholamines affects cAMP/PKA compartmentalised signalling in adult rat ventricular myocytes.

    PubMed

    Fields, Laura A; Koschinski, Andreas; Zaccolo, Manuela

    2016-07-01

    In the heart compartmentalisation of cAMP/protein kinase A (PKA) signalling is necessary to achieve a specific functional outcome in response to different hormonal stimuli. Chronic exposure to catecholamines is known to be detrimental to the heart and disrupted compartmentalisation of cAMP signalling has been associated to heart disease. However, in most cases it remains unclear whether altered local cAMP signalling is an adaptive response, a consequence of the disease or whether it contributes to the pathogenetic process. We have previously demonstrated that isoforms of PKA expressed in cardiac myocytes, PKA-I and PKA-II, localise to different subcellular compartments and are selectively activated by spatially confined pools of cAMP, resulting in phosphorylation of distinct downstream targets. Here we investigate cAMP signalling in an in vitro model of hypertrophy in primary adult rat ventricular myocytes. By using a real time imaging approach and targeted reporters we find that that sustained exposure to catecholamines can directly affect cAMP/PKA compartmentalisation. This appears to involve a complex mechanism including both changes in the subcellular localisation of individual phosphodiesterase (PDE) isoforms as well as the relocalisation of PKA isoforms. As a result, the preferential coupling of PKA subsets with different PDEs is altered resulting in a significant difference in the level of cAMP the kinase is exposed to, with potential impact on phosphorylation of downstream targets. PMID:26475678

  13. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  14. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA

    PubMed Central

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-01-01

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  15. Detection of plasmid-mediated AmpC β-lactamase in Escherichia coli

    PubMed Central

    LIU, XIANGQUN; LIU, YONGRUI

    2016-01-01

    Escherichia coli (E. coli) is a common opportunistic pathogen for nosocomial infection. The aim of the study was to examine the phenotype, genotype and epidemiology of plasmid-mediated AmpC β-lactamases in E. coli. In total, 96 clinical isolates of repeated E. coli were collected from different hospitals between August and October 2012. Using a cefoxitin disk diffusion method to identify the phenotype of AmpC β-lactamases in E. coli, the plasmid was extracted, and multiplex polymerase chain reaction (PCR) was used to determine the amp gene. The PCR products were purified and sequenced. Of the 96 isolates strains, 43 strains were cefoxitin-resistant. Twelve (12.5%) isolates were detected to produce AmpC β-lactamases with multiplex PCR, 11 strains carried DHA type ampC-resistant genes, and one strain carried ACC type ampC-resistant genes. In conclusion, the incidence of producing a plasmid-mediated AmpC enzyme of E. coli strains was relatively high. Therefore, antibiotics such as imipenem, a carbapenem, potentially serve as the treatment of choice for the infection. PMID:27284407

  16. Osteoblast differentiation is functionally associated with decreased AMP kinase activity.

    PubMed

    Kasai, Takayuki; Bandow, Kenjiro; Suzuki, Hiraku; Chiba, Norika; Kakimoto, Kyoko; Ohnishi, Tomokazu; Kawamoto, Shin-ichiro; Nagaoka, Eiichi; Matsuguchi, Tetsuya

    2009-12-01

    Osteoblasts, originating from mesenchymal stem cells, play a pivotal role in bone formation and mineralization. Several transcription factors including runt-related transcription factor 2 (Runx2) have been reported to be essential for osteoblast differentiation, whereas the cytoplasmic signal transduction pathways controlling the differentiation process have not been fully elucidated. AMP-activated protein kinase (AMPK) is a serine-threonine kinase generally regarded as a key regulator of cellular energy homeostasis, polarity, and division. Recent lines of evidence have indicated that the activity of the catalytic alpha subunit of AMPK is regulated through its phosphorylation by upstream AMPK kinases (AMPKKs) including LKB1. Here, we explored the role of AMPK in osteoblast differentiation using in vitro culture models. Phosphorylation of AMPKalpha was significantly decreased during osteoblastic differentiation in both primary osteoblasts and MC3T3-E1, a mouse osteoblastic cell line. Conversely, the terminal differentiation of primary osteoblasts and MC3T3-E1 cells, represented by matrix mineralization, was significantly inhibited by glucose restriction and stimulation with metformin, both of which are known activators of AMPK. Matrix mineralization of MC3T3-E1 cells was also inhibited by the forced expression of a constitutively active form of AMPKalpha. Metformin significantly inhibited gene expression of Runx2 along with osteoblast differentiation markers including osteocalcin (Ocn), bone sialo protein (Bsp), and osteopontin (Opn). Thus, our present data indicate that differentiation of osteoblasts is functionally associated with decreased AMPK activity. PMID:19725053

  17. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  18. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  19. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  20. Rethinking the roles of CRP, cAMP, and sugar-mediated global regulation in the Vibrionaceae.

    PubMed

    Colton, Deanna M; Stabb, Eric V

    2016-02-01

    Many proteobacteria modulate a suite of catabolic genes using the second messenger cyclic 3', 5'-AMP (cAMP) and the cAMP receptor protein (CRP). Together, the cAMP-CRP complex regulates target promoters, usually by activating transcription. In the canonical model, the phosphotransferase system (PTS), and in particular the EIIA(Glc) component for glucose uptake, provides a mechanistic link that modulates cAMP levels depending on glucose availability, resulting in more cAMP and activation of alternative catabolic pathways when glucose is unavailable. Within the Vibrionaceae, cAMP-CRP appears to play the classical role in modulating metabolic pathways; however, it also controls functions involved in natural competence, bioluminescence, pheromone signaling, and colonization of animal hosts. For this group of marine bacteria, chitin is an ecologically relevant resource, and chitin's monomeric sugar N-acetylglucosamine (NAG) supports robust growth while also triggering regulatory responses. Recent studies with Vibrio fischeri indicate that NAG and glucose uptake share EIIA(Glc), yet the responses of cAMP-CRP to these two carbon sources are starkly different. Moreover, control of cAMP levels appears to be more dominantly controlled by export and degradation. Perhaps more surprisingly, although CRP may require cAMP, its activity can be controlled in response to glucose by a mechanism independent of cAMP levels. Future studies in this area promise to shed new light on the role of cAMP and CRP. PMID:26215147

  1. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  2. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  3. Phosphodiesterase inhibition by a gastroprotective agent irsogladine: preferential blockade of cAMP hydrolysis.

    PubMed

    Kyoi, Takashi; Oka, Michiko; Noda, Kumiko; Ukai, Yojiro

    2004-08-27

    The effect of irsogladine [2,4-diamino-6-(2,5-dichlorophenyl)-s-triazine maleate], an antiulcer drug, on contents of cyclic nucleotides including cAMP and cGMP was investigated in rat stomachs. Irsogladine concentration-dependently increased cAMP content in rat glandula stomach. However, irsogladine at higher concentration (10(-5) M) was unable to further increase cAMP level in the presence of non-selective phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine, although 3-isobutyl-1-methylxanthine by itself increased cAMP level. On the other hand, irsogladine had no effect on the glandula cGMP content. Subsequently, the effect of irsogladine on the cyclic nucleotide degradation by purified bovine brain and heart PDEs was investigated. The cAMP degradation by purified bovine brain PDE was partially suppressed by PDE1 inhibitor vinpocetin, PDE2 inhibitor erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride and PDE4 inhibitor rolipram but not by PDE3 inhibitor cilostamide, and completely inhibited by 3-isobutyl-1-methylxanthine, suggesting that is attributed almost exclusively to PDE1, PDE2 and PDE4. Meanwhile, cGMP degradation by purified bovine brain PDE was partially suppressed by erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride. Irsogladine preferentially inhibited the response to cAMP degradation compared with cGMP degradation by this brain PDE. The cAMP degradation by bovine heart PDE was almost completely inhibited by the combination with vinpocetine and cilostamide, indicating that is mediated almost exclusively by PDE1 and PDE3. Irsogladine suppressed this cAMP degradation measured in the presence of vinpocetine to almost the same extent as that determined in the presence of cilostamide. These results indicate that irsogladine produces the increase of intracellular cAMP content via non-selective inhibition of PDE isozymes, which may be a key mechanism involved in its gastroprotective actions. PMID:15302227

  4. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  5. Autophosphorylation and rapid dephosphorylation of the cAMP-dependent protein kinase from Blastocladiella emersonii zoospores.

    PubMed

    Gomes, S L; Juliani, M H; da Costa Maia, J C; Rangel-Aldao, R

    1983-06-10

    The photoaffinity label 8-azido[32P]adenosine 3':5'-monophosphate and affinity chromatography on N6-(2-aminoethyl)-cAMP-Sepharose were used to analyze the cAMP-binding proteins present in cell-free extracts of Blastocladiella emersonii zoospores. In the presence of a mixture of protease inhibitors, 8-azido[32P]cAMP was specifically and quantitatively incorporated into a major protein band of Mr = 58,000, and three minor protein bands of Mr = 50,000, Mr = 43,000, and Mr = 36,000 respectively, after autoradiography following sodium dodecyl sulfate-polyacryl-amide gel electrophoresis. In the absence of the protease inhibitors, the Mr = 58,000 protein band was converted into the lower molecular weight cAMP-binding proteins, indicating a high sensitivity of the intact Mr = 58,000 protein band to endogenous proteases. The Mr = 58,000 protein corresponded to the regulatory subunit (R), of the cAMP-dependent protein kinase of zoospores, as shown by their identical behavior on DEAE-cellulose chromatography. The partially purified protein kinase incorporated 32P from [gamma-32P] ATP . Mg2+ into R as demonstrated by the specific adsorption of the 32P-labeled protein with N6-(2-aminoethyl)-cAMP-Sepharose. The incorporated 32P group was rapidly removed by endogenous phosphoprotein phosphatases in the presence of cAMP, as shown by pulse-chase experiments with [gamma-32P]ATP. Dephosphorylation of R-cAMP and rapid proteolysis may indicate two other mechanisms, in addition to cAMP, for the control of this protein kinase in vivo. PMID:6304069

  6. Long-range signaling in growing neurons after local elevation of cyclic AMP-dependent activity

    PubMed Central

    1994-01-01

    Cyclic AMP-dependent activity at the growth cone or the soma of cultured Xenopus spinal neurons was elevated by local extracellular perfusion of the neuron with culture medium containing 8-bromoadenosine 3',5'-cyclic monophosphate (8-br-cAMP) or forskolin. During local perfusion of one of the growth cones of multipolar neurons with these drugs, the perfused growth cone showed further extension, while the distant, unperfused growth cones were inhibited in their growth. Local perfusion of the growth cone with culture medium or local perfusion with 8-br-cAMP at a cell-free region 100 microns away from the growth cone did not produce any effect on the extension of the growth cone. Reduced extension of all growth cones was observed when the perfusion with 8-br-cAMP was restricted to the soma. The distant inhibitory effect does not depend on the growth of the perfused growth cone since local coperfusion of the growth cone with 8-br-cAMP and colchicine inhibited growth on both perfused and unperfused growth cones, while local perfusion with colchicine alone inhibited only the perfused growth cone. The distant inhibitory effect was abolished when the perfusion of 8-br-cAMP was carried out together with kinase inhibitor H- 8, suggesting the involvement of cAMP-dependent protein kinase and/or its downstream factors in the long-range inhibitory signaling. Uniform exposure of the entire neuron to bath-applied 8-br-cAMP, however, led to enhanced growth activity at all growth cones. Thus, local elevation of cAMP-dependent activity produces long-range and opposite effects on distant parts of the neuron, and a cytosolic gradient of second messengers may produce effects distinctly different from those following uniform global elevation of the messenger, leading to differential growth regulation at different regions of the same neuron. PMID:7798321

  7. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  8. Compartmentation of cAMP signalling in cardiomyocytes in health and disease.

    PubMed

    Perera, R K; Nikolaev, V O

    2013-04-01

    3',5'-cyclic adenosine monophosphate (cAMP) is a ubiquitous second messenger critically involved in the regulation of heart function. It has been shown to act in discrete subcellular signalling compartments formed by differentially localized receptors, phosphodiesterases and protein kinases. Cardiac diseases such as hypertrophy or heart failure are associated with structural and functional remodelling of these microdomains which leads to changes in cAMP compartmentation. In this review, we will discuss recent key findings which provided new insights into cAMP compartmentation in cardiomyocytes with a particular focus on its alterations in heart disease. PMID:23383621

  9. Cyclic AMP induces maturation of trout sperm axoneme to initiate motility

    NASA Astrophysics Data System (ADS)

    Morisawa, Masaaki

    1982-02-01

    Cyclic AMP has long been implicated as an activator of sperm motility1-5. From more recent experiments using demembranated mammalian and sea urchin spermatozoa6,7, it was concluded that cyclic AMP only increases the motility of the axoneme after it has been initiated by MgATP2-. We have now carried out similar experiments using spermatozoa collected from the rainbow trout and demembranated by treatment with the detergent Triton X-100. Our results suggest that in this species, cyclic AMP is required before MgATP2- to trigger maturation of the nonmotile axoneme. Subsequent addition of an energy source then induces motility.

  10. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  11. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  12. Technological Advancements

    ERIC Educational Resources Information Center

    Kennedy, Mike

    2010-01-01

    The influx of technology has brought significant improvements to school facilities. Many of those advancements can be found in classrooms, but when students head down the hall to use the washrooms, they are likely to find a host of technological innovations that have improved conditions in that part of the building. This article describes modern…

  13. Research Advances

    ERIC Educational Resources Information Center

    King, Angela G.

    2004-01-01

    Research advances, a new feature in Journal of Chemical Engineering that brings information about innovations in current areas of research to high school and college science faculty with an intent to provide educators with timely descriptions of latest progress in research that can be integrated into existing courses to update course content and…

  14. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. PMID:27137358

  15. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  16. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  17. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  18. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed Central

    Pinkney, M; Hoggett, J G

    1988-01-01

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  19. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed

    Pinkney, M; Hoggett, J G

    1988-03-15

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  20. DOE/NEAMS AMP CAMP I 2010 - multi species transport in metal fuels

    SciTech Connect

    Dilts, Gary A

    2011-01-21

    Essential aspects from the literature of metal nuclear fuel alloys and modeling the transport of constituents therein are discussed. The essential mathematical problem is described along with relevant issues for implementation of solution algorithms in the AMP nuclear fuel code.

  1. c-di-AMP recognition by Staphylococcus aureus PstA.

    PubMed

    Müller, Martina; Hopfner, Karl-Peter; Witte, Gregor

    2015-01-01

    Cyclic-di-AMP (c-di-AMP) is a bacterial secondary messenger involved in various processes, including sensing of DNA-integrity, cell wall metabolism and potassium transport. A number of c-di-AMP receptor proteins have recently been identified in Staphylococcus aureus. One of them - PstA - possesses a ferredoxin-like fold and is structurally related to the class of PII signal-transduction proteins. PII proteins are involved in a large number of pathways, most of them associated with nitrogen metabolism. In this study we describe the mode of c-di-AMP binding and subsequent structural changes of S. aureus PstA. An altered architecture in PstA compared to canonical PII proteins results in differences in ligand coordination. PMID:25435171

  2. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  3. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  4. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  5. AMP: a science-driven web-based application for the TeraGrid

    NASA Astrophysics Data System (ADS)

    Woitaszek, M.; Metcalfe, T.; Shorrock, I.

    The Asteroseismic Modeling Portal (AMP) provides a web-based interface for astronomers to run and view simulations that derive the properties of Sun-like stars from observations of their pulsation frequencies. In this paper, we describe the architecture and implementation of AMP, highlighting the lightweight design principles and tools used to produce a functional fully-custom web-based science application in less than a year. Targeted as a TeraGrid science gateway, AMP's architecture and implementation are intended to simplify its orchestration of TeraGrid computational resources. AMP's web-based interface was developed as a traditional standalone database-backed web application using the Python-based Django web development framework, allowing us to leverage the Django framework's capabilities while cleanly separating the user interface development from the grid interface development. We have found this combination of tools flexible and effective for rapid gateway development and deployment.

  6. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  7. A QM/MM study of the 5‧-AMP DNA hydrolysis of aprataxin

    NASA Astrophysics Data System (ADS)

    Hanaoka, Kyohei; Tanaka, Wataru; Kayanuma, Megumi; Shoji, Mitsuo

    2015-07-01

    Aprataxin is a DNA repair enzyme that hydrolyzes the abnormal 5‧-AMP termini of broken DNAs. Based on quantum mechanical/molecular mechanical (QM/MM) calculations, we found that the catalytic reaction proceeds in three steps; substrate protonation, DNA deadenylation and histidine-AMP intermediate hydrolysis. The calculated activation energies for the second and third reactions are 19.0 and 10.5 kcal mol-1, which can be attributed to a penta-coordinated AMP-phosphoryl formation and closing of a water molecule, respectively. We also found that a histidine-AMP intermediate is hydrolyzed easily in the third step when a water molecule closes within 3 Å to the phosphorus nucleus.

  8. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  9. I - Prostaglandin hyperalgesia, a cAMP/Ca2+ dependent process.

    PubMed

    Ferreira, S H; Nakamura, M

    1979-08-01

    Prostaglandins stimulate cAMP increase in several biological systems including CNS. The possible participation of a cAMP/Ca2+ related mechanism in prostaglandin induced hyperalgesia in the rat paw, as measured by a modification of the Randall-Selitto method was investigated. A serie of agents was administered in the paw in an attempt to change either Ca2+ or cyclic AMP concentration at the nociceptive terminations. PGE2, dibutyryl cyclic AMP, isoprenaline, noradrenaline, adrenaline, Ca2+ionophore (A23187), BaCl2 caused a dose dependent hyperalgesia. The hyperalgesic effect of these substances was enhanced by methyl-xanthines. Cyclic GMP as well as agents which interfere with Ca2+ influx (verapamil and lanthanum) were local analgesics in normal and hyperalgesic paws. PMID:230542

  10. The genetically encoded tool set for investigating cAMP: more than the sum of its parts

    PubMed Central

    Patel, Neha; Gold, Matthew G.

    2015-01-01

    Intracellular fluctuations of the second messenger cyclic AMP (cAMP) are regulated with spatial and temporal precision. This regulation is supported by the sophisticated arrangement of cyclases, phosphodiesterases, anchoring proteins, and receptors for cAMP. Discovery of these nuances to cAMP signaling has been facilitated by the development of genetically encodable tools for monitoring and manipulating cAMP and the proteins that support cAMP signaling. In this review, we discuss the state-of-the-art in development of different genetically encoded tools for sensing cAMP and the activity of its primary intracellular receptor protein kinase A (PKA). We introduce sequences for encoding adenylyl cyclases that enable cAMP levels to be artificially elevated within cells. We chart the evolution of sequences for selectively modifying protein–protein interactions that support cAMP signaling, and for driving cAMP sensors and manipulators to different subcellular locations. Importantly, these different genetically encoded tools can be applied synergistically, and we highlight notable instances that take advantage of this property. Finally, we consider prospects for extending the utility of the tool set to support further insights into the role of cAMP in health and disease. PMID:26300778

  11. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal

  12. Reduction of endothelial permeability in vitro by cAMP and cGMP

    SciTech Connect

    Kreienberg, P.B.; DeMichele, M.A.; Kowalczyk, P.; Minnear, F.L. )

    1990-02-26

    The cAMP enhancing-vasodilator isoproterenol has been shown previously to decrease endothelial permeability in vitro. This effect may not be unique to cAMP-enhancing agents. The authors have shown that thrombin at a concentration of 2 pM, a level which relaxes aortic vessel strips in association with increased levels of cGMP, reduces endothelial permeability. In this study, the permeability effect of cAMP and cGMP analogues were assessed by measuring the clearance of {sup 125}I-albumin across bovine pulmonary artery endothelial cell monolayers. The experiments were divided into baseline and experimental periods so that each monolayer served as its own control. The cAMP and cGMP analogues, 8-bromo-cAMP (1 mM) and 8-bromo-cGMP (1 mM), decreased clearance form a vehicle control value of 1.3{+-}0.2 (mean {+-}SD of experimental/baseline clearance, n=15 cell monolayers) to 0.7{+-}0.2 and 1.0{+-}0.2, respectively, although cGMP did not decrease clearance from its own baseline value. Coincubation of these analogues with thrombin (0.1 uM) also decreased the thrombin-induced increase in albumin clearance from 2.2{+-}0.5 to 0.8{+-}0.2 (cAMP) and 1.5{+-}0.2 (cGMP). The data indicate that in vitro both cAMP and cGMP-enhancing vasodilators would reduce endothelial permeability and that cAMP-enhancing agents would be more effective.

  13. Studying the regulation of endosomal cAMP production in GPCR signaling

    PubMed Central

    Gidon, Alexandre; Feinstein, Timothy N.; Xiao, Kunhong; Vilardaga, Jean-Pierre

    2016-01-01

    We describe methods based on live cell fluorescent microscopy and mass spectrometry to characterize the mechanism of endosomal cAMP production and its regulation using the parathyroid hormone (PTH) type 1 receptor as a prime example. These methods permit to measure rapid changes of cAMP levels in response to PTH, kinetics of endosomal ligand–receptor interaction, pH changes associated with receptor trafficking, and to identify the endosomal receptor interactome. PMID:26928541

  14. Cooperation between cAMP signalling and sulfonylurea in insulin secretion.

    PubMed

    Shibasaki, T; Takahashi, T; Takahashi, H; Seino, S

    2014-09-01

    Although glucose is physiologically the most important regulator of insulin secretion, glucose-induced insulin secretion is modulated by hormonal and neural inputs to pancreatic β-cells. Most of the hormones and neurotransmitters evoke intracellular signals such as cAMP, Ca²⁺ , and phospholipid-derived molecules by activating G protein-coupled receptors (GPCRs). In particular, cAMP is a key second messenger that amplifies insulin secretion in a glucose concentration-dependent manner. The action of cAMP on insulin secretion is mediated by both protein kinase A (PKA)-dependent and Epac2A-dependent mechanisms. Many of the proteins expressed in β-cells are phosphorylated by PKA in vitro, but only a few proteins in which PKA phosphorylation directly affects insulin secretion have been identified. On the other hand, Epac2A activates the Ras-like small G protein Rap in a cAMP-dependent manner. Epac2A is also directly activated by various sulfonylureas, except for gliclazide. 8-pCPT-2'-O-Me-cAMP, an Epac-selective cAMP analogue, and glibenclamide, a sulfonylurea, synergistically activate Epac2A and Rap1, whereas adrenaline, which suppresses cAMP production in pancreatic β-cells, blocks activation of Epac2A and Rap1 by glibenclamide. Thus, cAMP signalling and sulfonylurea cooperatively activate Epac2A and Rap1. This interaction could account, at least in part, for the synergistic effects of incretin-related drugs and sulfonylureas in insulin secretion. Accordingly, clarification of the mechanism of Epac2A activation may provide therapeutic strategies to improve insulin secretion in diabetes. PMID:25200305

  15. Cyclic AMP-modulated phosphorylation of intermediate filament proteins in cultured avian myogenic cells.

    PubMed Central

    Gard, D L; Lazarides, E

    1982-01-01

    The intermediate filament proteins desmin and vimentin and the muscle tropomyosins were the major protein phosphate acceptors in 8-day-old myotubes incubated for 4 h in medium containing radiolabeled phosphate. The addition of isoproterenol or 8-bromo-cyclic AMP (BrcAMP) resulted in a two- to threefold increase in incorporation of 32PO4 into both desmin and vimentin, whereas no changes in the incorporation of 32PO4 into tropomyosin or other cellular proteins were observed. The BrcAMP- or hormonally induced increase in 32PO4 incorporation into desmin and vimentin was independent of protein synthesis and was not caused by stimulation of protein phosphate turnover. In addition, BrcAMP did not induce significant changes in the specific activity of the cellular ATP pool. These data suggest that the observed increase in 32PO4 incorporation represented an actual increase in phosphorylation of the intermediate filament proteins desmin and vimentin. Two-dimensional tryptic analysis of desmin from 8-day-old myotubes revealed five phosphopeptides of which two showed a 7- to 10-fold increase in 32PO4 incorporation in BrcAMP-treated myotubes. Four of the phosphopeptides identified in desmin labeled in vivo were also observed in desmin phosphorylated in vitro by bovine heart cAMP-dependent protein kinase. Although phosphorylation of desmin and vimentin was apparent in myogenic cells at all stages of differentiation, BrcAMP- and isoproterenol-induced increases in phosphorylation of these proteins were restricted to mature myotubes. These data strongly suggest that in vivo phosphorylation of the intermediate filament proteins desmin and vimentin is catalyzed by the cAMP-dependent protein kinases and that such phosphorylation may be regulated during muscle differentiation. Images PMID:6294504

  16. AmpC-BETA Lactamases among Enterobacteriaceae Isolated at a Tertiary Hospital, South Western Uganda

    PubMed Central

    Nakaye, Martha; Bwanga, Freddie; Itabangi, Herbert; Stanley, Iramiot J.; Bashir, Mwambi; Bazira, Joel

    2015-01-01

    Aim To characterize AmpC-beta lactamases among Enterobacteriaceae isolates from clinical samples at Mbarara Regional Referral Hospital. Study Design Laboratory-based descriptive cross-sectional study Place and Duration of Study Microbiology Department, Mbarara Regional Referral Hospital and MBN clinical Laboratories, between May to September 2013. Methodology This study included 293 Enterobacteriaceae isolates recovered from clinical specimens that included blood, urine, stool and aspirates. AmpC Beta lactamase production was determined using disc placement method for cefoxitin at a break point of <18mm. Common AmpC plasmid mediated genes were EBC, ACC, FOX, DHA, CIT and MOX were; was determined by Multiplex PCR as described by Hanson and Perez-Perez. Results Plasmid mediated AmpC phenotype was confirmed in 107 of the 293 (36.5%) cefoxitin resistant isolates with 30 isolates having more than one gene coding for resistance. The commonest source that harbored AmpC beta lactamases was urine and E. coli was the most common AmpC producer (59.5%). The genotypes detected in this study, included EBC (n=36), FOX (n=18), ACC (n=11), CIT (n=10), DHA (n=07) and MOX (n=1). Conclusion Our findings showed that prevalence of AmpC beta-lactamase at MRRH was high (39.6), with EBC as the commonest genotype among Enterobacteriaceae Urine and E. coli were the commonest source and organism respectively that harbored AmpC beta-lactamases. There‘s rational antimicrobial therapy and antibiotic susceptibility tests should be requested by health workers especially patients presenting with urinary tract infections and bacteraemias. PMID:26078920

  17. Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

    1998-01-01

    The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

  18. The ever unfolding story of cAMP signaling in trypanosomatids: vive la difference!

    PubMed Central

    Tagoe, Daniel N. A.; Kalejaiye, Titilola D.; de Koning, Harry P.

    2015-01-01

    Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi), sleeping sickness (Trypanosoma brucei spp.), and leishmaniasis (Leishmania spp). Although cAMP is produced during the life cycle stages of these parasites, its signaling pathways are very different from those of mammals. The absence of G-protein-coupled receptors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D), which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well conserved genes for catalytic and regulatory domains of protein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signaling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs) whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signaling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signaling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics. PMID:26441645

  19. Detection of ESBL- and AmpC-producing E. coli isolates from urinary tract infections

    PubMed Central

    Shayan, Sara; Bokaeian, Mohammad

    2015-01-01

    Background: Extended-spectrum β-lactamases (ESBLs) and AmpC enzymes have been observed in virtually all species of the family Enterobacteriaceae. The β-lactamase producing bacteria cause many serious infections, including urinary tract infections. These enzymes are predominantly plasmid mediated. There are no recommended guidelines for detection of this resistance mechanism and there is a need to address this issue as much as the detection of ESBLs. This study was undertaken to characterize ESBL and AmpC producers among Escherichia coli by polymerase chain reaction (PCR), which were initially screened by phenotypic method. Materials and Methods: A total of 90 isolates of E. coli were recovered from the urinary tract during a 7-month period, and were screened for ESBLs and AmpC production by disk diffusion test using cefoxitin (30 μg) disks and confirmed by combined disk diffusion test using phenyl boronic acid. The presence of genes encoding CIT, FOX, and TEM was detected by PCR. Results: On disk diffusion test, 59 of 90 isolates were resistant to third generation of cephalosporins; of these 37 (62.7%) and 3 (5%) were ESBL and AmpC producers, respectively. PCR showed that 29 (49.1%) and 3 (5%) were positive for blaTEM and blaCMY-2, respectively. Conclusion: ESBL- and AmpC-producing E. coli isolates cause significant resistance to cephalosporin. There is a need for a correct and reliable phenotypic test to identify AmpC β-lactamases and to discriminate between AmpC and ESBL producers. This work showed that boronic acid can differentiate ESBL enzymes from AmpC enzymes. PMID:26605249

  20. Advanced Combustion

    SciTech Connect

    Holcomb, Gordon R.

    2013-03-11

    The activity reported in this presentation is to provide the mechanical and physical property information needed to allow rational design, development and/or choice of alloys, manufacturing approaches, and environmental exposure and component life models to enable oxy-fuel combustion boilers to operate at Ultra-Supercritical (up to 650{degrees}C & between 22-30 MPa) and/or Advanced Ultra-Supercritical conditions (760{degrees}C & 35 MPa).

  1. Advanced computing

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Advanced concepts in hardware, software and algorithms are being pursued for application in next generation space computers and for ground based analysis of space data. The research program focuses on massively parallel computation and neural networks, as well as optical processing and optical networking which are discussed under photonics. Also included are theoretical programs in neural and nonlinear science, and device development for magnetic and ferroelectric memories.

  2. Advanced Nanoemulsions

    NASA Astrophysics Data System (ADS)

    Fryd, Michael M.; Mason, Thomas G.

    2012-05-01

    Recent advances in the growing field of nanoemulsions are opening up new applications in many areas such as pharmaceuticals, foods, and cosmetics. Moreover, highly controlled nanoemulsions can also serve as excellent model systems for investigating basic scientific questions about soft matter. Here, we highlight some of the most recent developments in nanoemulsions, focusing on methods of formation, surface modification, material properties, and characterization. These developments provide insight into the substantial advantages that nanoemulsions can offer over their microscale emulsion counterparts.

  3. Structural insights into recognition of c-di-AMP by the ydaO riboswitch.

    PubMed

    Gao, Ang; Serganov, Alexander

    2014-09-01

    Bacterial second messenger cyclic di-AMP (c-di-AMP) is implicated in signaling DNA damage and cell wall stress through interactions with several protein receptors and a widespread ydaO-type riboswitch. We report the crystal structures of c-di-AMP riboswitches from Thermoanaerobacter pseudethanolicus and Thermovirga lienii determined at ∼3.0-Å resolution. In both species, the RNA adopts an unforeseen 'square'-shaped pseudosymmetrical architecture that features two three-way junctions, a turn and a pseudoknot, positioned in the square corners. Uncharacteristically for riboswitches, the structure is stapled by two ligand molecules that span the interior of the structure and employ similar noncanonical interactions for RNA recognition. Mutations in either ligand-binding site negatively affect c-di-AMP binding, suggesting that the riboswitch-triggered genetic response requires contribution of both ligands. Our data provide what are to our knowledge the first insights into specific sensing of c-di-AMP and a molecular mechanism underlying the common c-di-AMP-dependent control of essential cellular processes in bacteria. PMID:25086507

  4. Identification of Novel Genes Responsible for Overexpression of ampC in Pseudomonas aeruginosa PAO1

    PubMed Central

    Tsutsumi, Yuko; Tomita, Haruyoshi

    2013-01-01

    The development of resistance to antipseudomonal penicillins and cephalosporins mediated by the chromosomal ampC gene in Pseudomonas aeruginosa is of clinical importance. We isolated piperacillin-resistant mutants derived from P. aeruginosa PAO1 and analyzed two mutants that had an insertion in mpl and nuoN. One mutant, YT1677, was resistant to piperacillin and ceftazidime and had an insertion in mpl, which encodes UDP-N-acetylmuramate:l-alanyl-γ-d-glutamyl-meso-diaminopimelate ligase. The other mutant, YT7988, showed increased MICs of piperacillin, ceftazidime, cefepime, and cefoperazone, and the insertion was mapped to nuoN, which encodes NADH dehydrogenase I chain N. Complementation experiments demonstrated that these mutations resulted in higher levels of resistance to β-lactams. The expression of genes reported to be involved in β-lactam resistance was examined by real-time PCR in YT1677 and YT7988 mutants. Overexpression was observed for only ampC, and other genes were expressed normally. Deletion of the ampR gene in YT1677 and YT7988 resulted in decreased expression of ampC, indicating that the mutations in YT1677 and YT7988 affected the expression of ampC through the function of AmpR. PMID:24041903

  5. Odor-induced cAMP production in Drosophila melanogaster olfactory sensory neurons.

    PubMed

    Miazzi, Fabio; Hansson, Bill S; Wicher, Dieter

    2016-06-15

    Insect odorant receptors are seven transmembrane domain proteins that form cation channels, whose functional properties such as receptor sensitivity are subject to regulation by intracellular signaling cascades. Here, we used the cAMP fluorescent indicator Epac1-camps to investigate the occurrence of odor-induced cAMP production in olfactory sensory neurons (OSNs) of Drosophila melanogaster We show that stimulation of the receptor complex with an odor mixture or with the synthetic agonist VUAA1 induces a cAMP response. Moreover, we show that while the intracellular Ca(2+) concentration influences cAMP production, the OSN-specific receptor OrX is necessary to elicit cAMP responses in Ca(2+)-free conditions. These results provide direct evidence of a relationship between odorant receptor stimulation and cAMP production in olfactory sensory neurons in the fruit fly antenna and show that this method can be used to further investigate the role that this second messenger plays in insect olfaction. PMID:27045092

  6. cAMP and cGMP Play an Essential Role in Galvanotaxis of Cell Fragments.

    PubMed

    Zhu, Kan; Sun, Yaohui; Miu, Anh; Yen, Michael; Liu, Bowei; Zeng, Qunli; Mogilner, Alex; Zhao, Min

    2016-06-01

    Cell fragments devoid of the nucleus and major organelles are found in physiology and pathology, for example platelets derived from megakaryocytes, and cell fragments from white blood cells and glioma cells. Platelets exhibit active chemotaxis. Fragments from white blood cells display chemotaxis, phagocytosis, and bactericidal functions. Signaling mechanisms underlying migration of cell fragments are poorly understood. Here we used fish keratocyte fragments and demonstrated striking differences in signal transduction in migration of cell fragments and parental cells in a weak electric field. cAMP or cGMP agonists completely abolished directional migration of fragments, but had no effect on parental cells. The inhibition effects were prevented by pre-incubating with cAMP and cGMP antagonists. Blocking cAMP and cGMP downstream signaling by inhibition of PKA and PKG also recovered fragment galvanotaxis. Both perturbations confirmed that the inhibitory effect was mediated by cAMP or cGMP signaling. Inhibition of cathode signaling with PI3K inhibitor LY294002 also prevented the effects of cAMP or cGMP agonists. Our results suggest that cAMP and cGMP are essential for galvanotaxis of cell fragments, in contrast to the signaling mechanisms in parental cells. PMID:26517849

  7. A Novel Conditional Genetic System Reveals That Increasing Neuronal cAMP Enhances Memory and Retrieval

    PubMed Central

    Isiegas, Carolina; McDonough, Conor; Huang, Ted; Havekes, Robbert; Fabian, Sara; Wu, Long-Jun; Xu, Hui; Zhao, Ming-Gao; Kim, Jae-Ick; Lee, Yong-Seok; Lee, Hye-Ryeon; Ko, Hyoung-Gon; Lee, Nuribalhae; Choi, Sun-Lim; Lee, Jeong-Sik; Son, Hyeon; Zhuo, Min; Kaang, Bong-Kiun; Abel, Ted

    2010-01-01

    Consistent evidence from pharmacological and genetic studies shows that cAMP is a critical modulator of synaptic plasticity and memory formation. However, the potential of the cAMP signaling pathway as a target for memory enhancement remains unclear because of contradictory findings from pharmacological and genetic approaches. To address these issues, we have developed a novel conditional genetic system in mice based on the heterologous expression of an Aplysia octopamine receptor, a G-protein-coupled receptor whose activation by its natural ligand octopamine leads to rapid and transient increases in cAMP. We find that activation of this receptor transgenically expressed in mouse forebrain neurons induces a rapid elevation of hippocampal cAMP levels, facilitates hippocampus synaptic plasticity, and enhances the consolidation and retrieval of fear memory. Our findings clearly demonstrate that acute increases in cAMP levels selectively in neurons facilitate synaptic plasticity and memory, and illustrate the potential of this heterologous system to study cAMP-mediated processes in mammalian systems. PMID:18550764

  8. Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

    PubMed Central

    Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

    2015-01-01

    During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

  9. Multidrug resistant AmpC β-lactamase producing Escherichia coli isolated from a paediatric hospital

    PubMed Central

    Jameel, Noor-ul-Ain; Ejaz, Hasan; Zafar, Aizza; Amin, Hafsa

    2014-01-01

    Objective : The objective of the study was to observe the antimicrobial resistance of AmpC β-lactamase producing E. coli. Methods: Six hundred and seventy E. coli were isolated from 20,257 various pathological samples collected from The Children’s Hospital and Institute of Child Health, Lahore, Pakistan. The isolates showed resistance to ceftazidime which were further examined for AmpC β-lactamase activity by Disc Potentiation method. Results: There were 670 isolates of E. coli out of which 85 (12.6%) were AmpC β-lactamase producers. Risk factors like intravenous line (76.5%), endotracheal tube (22.4%), surgery (12.9%) and urinary catheters (7.1%) were found to be associated with infection caused by AmpC β-lactamase producing E. coli. Antimicrobial resistance pattern revealed that AmpC producing E. coli were highly resistant to co-amoxiclav, ceftazidime, cefotaxime, cefuroxime, cefixime, ceftriaxone and cefoxitin (100% each). Least resistance was observed against sulbactam-cefoperazone (14.1%), cefepime (7.1%), piperacillin-tazobactam (5.9%) and none of the isolates were resistant to imipenem and meropenem. Conclusion: The minimum use of invasive devices and strict antibiotic policies can reduce the spread of AmpC β-lactamase producing E. coli. PMID:24639857

  10. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  11. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 3: AMPS payload to instruments ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    General physical, functional, and operational interface control requirements for instruments on the first AMPS payload are presented. Interface specifications are included to satisfy ground handling, prelaunch, launch, stowage, operation, and landing activities. Applicable supporting documentation to implement the information is also given.

  12. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells

    PubMed Central

    Poole, Jill A.; Nordgren, Tara M.; DeVasure, Jane M.; Heires, Art J.; Bailey, Kristina L.; Romberger, Debra J.

    2014-01-01

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  13. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells.

    PubMed

    Wyatt, Todd A; Poole, Jill A; Nordgren, Tara M; DeVasure, Jane M; Heires, Art J; Bailey, Kristina L; Romberger, Debra J

    2014-10-15

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  14. cAMP-mediated regulation of cholesterol accumulation in cystic fibrosis and Niemann-Pick type C cells

    PubMed Central

    Manson, Mary E.; Corey, Deborah A.; White, Nicole M.; Kelley, Thomas J.

    2008-01-01

    The goal of this study was to identify a mechanism regulating cholesterol accumulation in cystic fibrosis (CF) cells. Both CFTR activation and expression are regulated by the cAMP pathway, and it is hypothesized that a feedback response involving this pathway may be involved in the phenotype of cholesterol accumulation. To examine the role of the cAMP pathway in cholesterol accumulation, we treated two CF model cell lines with the Rp diastereomer of adenosine 3′,5′-cyclic monophosphorothioate (Rp-cAMPS) and visualized by filipin staining. Rp-cAMPS treatment eliminated cholesterol accumulation in CF cells, whereas 8-bromo-cAMP treatment led to cholesterol accumulation in wild-type cells. To confirm these findings in an independent model system, we also examined the role of cAMP in modulating cholesterol accumulation in Niemann-Pick type C (NPC) fibroblasts. Expression of the protein related to NPC, NPC1, is also directly regulated by cAMP; therefore, it is postulated that NPC cells exhibit the same cAMP-mediated control of cholesterol accumulation. Cholesterol accumulation in NPC cells also was reduced by the presence of Rp-cAMPS. Expression of β-arrestin-2 (βarr2), a marker of cellular response to cAMP signaling, was significantly elevated in CF model cells, Cftr−/− MNE, primary tissue obtained by nasal scrapes from CF subjects, and in NPC fibroblasts compared with respective controls. PMID:18790990

  15. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.

    1985-01-01

    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  16. Interplay of Ca2+ and cAMP signaling in the insulin-secreting MIN6 beta-cell line.

    PubMed

    Landa, Luis R; Harbeck, Mark; Kaihara, Kelly; Chepurny, Oleg; Kitiphongspattana, Kajorn; Graf, Oliver; Nikolaev, Viacheslav O; Lohse, Martin J; Holz, George G; Roe, Michael W

    2005-09-01

    Ca2+ and cAMP are important second messengers that regulate multiple cellular processes. Although previous studies have suggested direct interactions between Ca2+ and cAMP signaling pathways, the underlying mechanisms remain unresolved. In particular, direct evidence for Ca2+-regulated cAMP production in living cells is incomplete. Genetically encoded fluorescence resonance energy transfer-based biosensors have made possible real-time imaging of spatial and temporal gradients of intracellular cAMP concentration in single living cells. Here, we used confocal microscopy, fluorescence resonance energy transfer, and insulin-secreting MIN6 cells expressing Epac1-camps, a biosynthetic unimolecular cAMP indicator, to better understand the role of intracellular Ca2+ in cAMP production. We report that depolarization with high external K+, tolbutamide, or glucose caused a rapid increase in cAMP that was dependent on extracellular Ca2+ and inhibited by nitrendipine, a Ca2+ channel blocker, or 2',5'-dideoxyadenosine, a P-site antagonist of transmembrane adenylate cyclases. Stimulation of MIN6 cells with glucose in the presence of tetraethylammonium chloride generated concomitant Ca2+ and cAMP oscillations that were abolished in the absence of extracellular Ca2+ and blocked by 2',5'-dideoxyadenosine or 3-isobutyl-1-methylxanthine, an inhibitor of phosphodiesterase. Simultaneous measurements of Ca2+ and cAMP concentrations with Fura-2 and Epac1-camps, respectively, revealed a close temporal and causal interrelationship between the increases in cytoplasmic Ca2+ and cAMP levels following membrane depolarization. These findings indicate highly coordinated interplay between Ca2+ and cAMP signaling in electrically excitable endocrine cells and suggest that Ca2+-dependent cAMP oscillations are derived from an increase in adenylate cyclase activity and periodic activation and inactivation of cAMP-hydrolyzing phosphodiesterase. PMID:15987680

  17. Genotoxicity assessment of the antiepileptic drug AMP397, an Ames-positive aromatic nitro compound.

    PubMed

    Suter, Willi; Hartmann, Andreas; Poetter, Franziska; Sagelsdorff, Peter; Hoffmann, Peter; Martus, Hans-Jörg

    2002-07-25

    AMP397 is a novel antiepileptic agent and the first competitive AMPA antagonist with high receptor affinity, good in vivo potency, and oral activity. AMP397 has a structural alert (aromatic nitro group) and was mutagenic in Salmonella typhimurium strains TA97a, TA98 and TA100 without S9, but negative in the nitroreductase-deficient strains TA98NR and TA100NR. The amino derivative of AMP397 was negative in wild-type strains TA98 and TA100. AMP397 was negative in a mouse lymphoma tk assay, which included a 24h treatment without S9. A weak micronucleus induction in vitro was found at the highest concentrations tested in V79 cells with S9. AMP397 was negative in the following in vivo studies, which included the maximum tolerated doses of 320mg/kg in mice and 2000mg/kg in rats: MutaMouse assay in colon and liver (5x320mg/kg) at three sampling times (3, 7 and 31 days after the last administration); DNA binding study in the liver of mice and rats after a single treatment with [14C]-AMP397; comet assay (1x2000mg/kg) in jejunum and liver of rats, sampling times 3 and 24h after administration; micronucleus test (2x320mg/kg) in the bone marrow of mice, sampling 24h after the second administration. Based on these results, it was concluded that AMP397 has no genotoxic potential in vivo. In particular, no genotoxic metabolite is formed in mammalian cells, and, if formed by intestinal bacteria, is unable to exert any genotoxic activity in the adjacent intestinal tissue. These data were considered to provide sufficient safety to initiate clinical development of the compound. PMID:12113769

  18. Ser364 of connexin43 and the upregulation of gap junction assembly by cAMP

    PubMed Central

    TenBroek, Erica M.; Lampe, Paul D.; Solan, Joell L.; Reynhout, James K.; Johnson, Ross G.

    2001-01-01

    The assembly of gap junctions (GJs) is a process coordinated by growth factors, kinases, and other signaling molecules. GJ assembly can be enhanced via the elevation of cAMP and subsequent stimulation of connexon trafficking to the plasma membrane. To study the positive regulation of GJ assembly, fibroblasts derived from connexin (Cx)43 knockout (KO) and wild-type (WT) mice were transfected with WT Cx43 (WTCx43) or mutant Cx43. GJ assembly between untransfected WT fibroblasts or stably transfected WTCx43/KO fibroblasts was increased two- to fivefold by 8Br-cAMP, and this increase could be blocked by inhibition of cAMP-dependent protein kinase (PKA) or truncation of the Cx43 COOH terminus (CT). Although serine 364 (S364) of the Cx43 CT was determined to be a major site of phosphorylation, the molar ratio of Cx43 phosphorylation was not increased by 8Br-cAMP. Importantly, GJ assembly between either S364ECx43/KO or S364ECx43/WT fibroblasts was stimulated by 8Br-cAMP, but that between S364ACx43/KO or S364PCx43/KO fibroblasts was not stimulated, indicating that phosphorylation or a negative charge at S364 is required for enhancement of GJ assembly by cAMP. Furthermore, GJ assembly between S364ACx43/WT fibroblasts could be stimulated by 8Br-cAMP, but could not be between S364PCx43/WT fibroblasts. Thus, S364PCx43 interferes with enhanced GJ assembly when coexpressed with WTCx43. PMID:11756479

  19. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  20. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli.

    PubMed

    Al-Agamy, Mohamed H; El Mahdy, Taghrid S; Shibl, Atef M

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried bla CTX-M-15, and two isolates carried bla CTX-M-14 gene. Two CTX-M-positive E. coli isolates carried bla CMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  1. Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

    PubMed Central

    Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

    2016-01-01

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

  2. Capsaicinoids regulate airway anion transporters through Rho kinase- and cyclic AMP-dependent mechanisms.

    PubMed

    Hibino, Yoshitaka; Morise, Masahiro; Ito, Yasushi; Mizutani, Takefumi; Matsuno, Tadakatsu; Ito, Satoru; Hashimoto, Naozumi; Sato, Mitsuo; Kondo, Masashi; Imaizumi, Kazuyoshi; Hasegawa, Yoshinori

    2011-10-01

    To investigate the effects of capsaicinoids on airway anion transporters, we recorded and analyzed transepithelial currents in human airway epithelial Calu-3 cells. Application of capsaicin (100 μM) attenuated vectorial anion transport, estimated as short-circuit currents (I(SC)), before and after stimulation by forskolin (10 μM) with concomitant reduction of cytosolic cyclic AMP (cAMP) levels. The capsaicin-induced inhibition of I(SC) was also observed in the response to 8-bromo-cAMP (1 mM, a cell-permeable cAMP analog) and 3-isobutyl-1-methylxanthine (1 mM, an inhibitor of phosphodiesterases). The capsaicin-induced inhibition of I(SC) was attributed to suppression of bumetanide (an inhibitor of the basolateral Na(+)-K(+)-2 Cl(-) cotransporter 1)- and 4,4'-dinitrostilbene-2,2'-disulfonic acid (an inhibitor of basolateral HCO(3)(-)-dependent anion transporters)-sensitive components, which reflect anion uptake via basolateral cAMP-dependent anion transporters. In contrast, capsaicin potentiated apical Cl(-) conductance, which reflects conductivity through the cystic fibrosis transmembrane conductance regulator, a cAMP-regulated Cl(-) channel. All these paradoxical effects of capsaicin were mimicked by capsazepine. Forskolin application also increased phosphorylated myosin phosphatase target subunit 1, and the phosphorylation was prevented by capsaicin and capsazepine, suggesting that these capsaicinoids assume aspects of Rho kinase inhibitors. We also found that the increments in apical Cl(-) conductance were caused by conventional Rho kinase inhibitors, Y-27632 (20 μM) and HA-1077 (20 μM), with selective inhibition of basolateral Na(+)-K(+)-2 Cl(-) cotransporter 1. Collectively, capsaicinoids inhibit cAMP-mediated anion transport through down-regulation of basolateral anion uptake, paradoxically accompanied by up-regulation of apical cystic fibrosis transmembrane conductance regulator-mediated anion conductance. The latter is mediated by inhibition of Rho

  3. Cholesterol ester hydrolase in pig liver is activated by cyclic AMP-dependent protein kinase

    SciTech Connect

    Chen, J.J.S.; Dubin, E.; Margolis, S.

    1986-05-01

    To examine whether hepatic neutral cholesterol ester hydrolase (CEH) is regulated by phosphorylation, the authors have assayed CEH activity from pig liver cytosol by measuring /sup 14/C-oleate release from labeled cholesteryl oleate at pH 7.4. When pig liver cytosol was incubated with 2 mM Mg and 0.5 mM ATP, CEH activity was increased (141 +/- 8% of control, mean +/- SEM). Addition of 25..mu..M cyclic AMP (cAMP) further activated CEH activity (164 +/- 4% of control) as compared to incubation with Mg and ATP (p < 0.02). In the presence of 5 mM EDTA or in the absence of either Mg or ATP, no activation of CEH was observed. The activation was completely abolished by further incubation of activated cytosol with E. coli alkaline phosphatase. Activation of CEH activity was partially prevented by the addition of protein kinase inhibitor (p < 0.02) and this effect was completely reversed in the presence of exogenous cAMP-dependent protein kinase (p < 0.05). To examine further the role of the cAMP-dependent protein kinase, CEH activity was purified 240-fold by 35% (NH/sub 4/)/sub 2/SO/sub 4/ precipitation and Sepharose 4B chromatography. Incubation of partially purified CEH fractions with Mg, ATP and cAMP did not increase CEH activity. Addition of exogenous cAMP-dependent protein kinase activated CEH activity of partially purified fractions. The authors observations indicate that pig liver CEH is activated by phosphorylation mediated by cAMP-dependent protein kinase.

  4. Caveolin-3 regulates compartmentation of cardiomyocyte beta2-adrenergic receptor-mediated cAMP signaling.

    PubMed

    Wright, Peter T; Nikolaev, Viacheslav O; O'Hara, Thomas; Diakonov, Ivan; Bhargava, Anamika; Tokar, Sergiy; Schobesberger, Sophie; Shevchuk, Andrew I; Sikkel, Markus B; Wilkinson, Ross; Trayanova, Natalia A; Lyon, Alexander R; Harding, Sian E; Gorelik, Julia

    2014-02-01

    The purpose of this study was to investigate whether caveolin-3 (Cav3) regulates localization of β2-adrenergic receptor (β2AR) and its cAMP signaling in healthy or failing cardiomyocytes. We co-expressed wildtype Cav3 or its dominant-negative mutant (Cav3DN) together with the Förster resonance energy transfer (FRET)-based cAMP sensor Epac2-camps in adult rat ventricular myocytes (ARVMs). FRET and scanning ion conductance microscopy were used to locally stimulate β2AR and to measure cytosolic cAMP. Cav3 overexpression increased the number of caveolae and decreased the magnitude of β2AR-cAMP signal. Conversely, Cav3DN expression resulted in an increased β2AR-cAMP response without altering the whole-cell L-type calcium current. Following local stimulation of Cav3DN-expressing ARVMs, β2AR response could only be generated in T-tubules. However, the normally compartmentalized β2AR-cAMP signal became diffuse, similar to the situation observed in heart failure. Finally, overexpression of Cav3 in failing myocytes led to partial β2AR redistribution back into the T-tubules. In conclusion, Cav3 plays a crucial role for the localization of β2AR and compartmentation of β2AR-cAMP signaling to the T-tubules of healthy ARVMs, and overexpression of Cav3 in failing myocytes can partially restore the disrupted localization of these receptors. PMID:24345421

  5. Control of heart rate by cAMP sensitivity of HCN channels

    PubMed Central

    Alig, Jacqueline; Marger, Laurine; Mesirca, Pietro; Ehmke, Heimo; Mangoni, Matteo E.; Isbrandt, Dirk

    2009-01-01

    “Pacemaker” f-channels mediating the hyperpolarization-activated nonselective cation current If are directly regulated by cAMP. Accordingly, the activity of f-channels increases when cellular cAMP levels are elevated (e.g., during sympathetic stimulation) and decreases when they are reduced (e.g., during vagal stimulation). Although these biophysical properties seem to make f-channels ideal molecular targets for heart rate regulation by the autonomic nervous system, the exact contribution of the major If-mediating cardiac isoforms HCN2 and HCN4 to sinoatrial node (SAN) function remains highly controversial. To directly investigate the role of cAMP-dependent regulation of hyperpolarization activated cyclic nucleotide activated (HCN) channels in SAN activity, we generated mice with heart-specific and inducible expression of a human HCN4 mutation (573X) that abolishes the cAMP-dependent regulation of HCN channels. We found that hHCN4–573X expression causes elimination of the cAMP sensitivity of If and decreases the maximum firing rates of SAN pacemaker cells. In conscious mice, hHCN4–573X expression leads to a marked reduction in heart rate at rest and during exercise. Despite the complete loss of cAMP sensitivity of If, the relative extent of SAN cell frequency and heart rate regulation are preserved. Our data demonstrate that cAMP-mediated regulation of If determines basal and maximal heart rates but does not play an indispensable role in heart rate adaptation during physical activity. Our data also reveal the pathophysiologic mechanism of hHCN4–573X–linked SAN dysfunction in humans. PMID:19570998

  6. Nuclease-Resistant c-di-AMP Derivatives That Differentially Recognize RNA and Protein Receptors.

    PubMed

    Meehan, Robert E; Torgerson, Chad D; Gaffney, Barbara L; Jones, Roger A; Strobel, Scott A

    2016-02-16

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3'-5'-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activates specific pathways and mediates phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogues, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position more than a carbonyl at the C6 position. We also identified phosphate-modified analogues that bind both the ydaO RNA and GdpP protein with high affinity, whereas symmetrically modified ribose analogues exhibited a substantial decrease in ydaO affinity but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogues could be useful as chemical tools to specifically target subsections of second-messenger signaling pathways. PMID:26789423

  7. Caveolin-3 regulates compartmentation of cardiomyocyte beta2-adrenergic receptor-mediated cAMP signaling

    PubMed Central

    Wright, Peter T.; Nikolaev, Viacheslav O.; O’Hara, Thomas; Diakonov, Ivan; Bhargava, Anamika; Tokar, Sergiy; Schobesberger, Sophie; Shevchuk, Andrew I.; Sikkel, Markus B.; Wilkinson, Ross; Trayanova, Natalia A.; Lyon, Alexander R.; Harding, Sian E.; Gorelik, Julia

    2014-01-01

    The purpose of this study was to investigate whether caveolin-3 (Cav3) regulates localization of β2-adrenergic receptor (β2AR) and its cAMP signaling in healthy or failing cardiomyocytes. We co-expressed wildtype Cav3 or its dominant-negative mutant (Cav3DN) together with the Förster resonance energy transfer (FRET)-based cAMP sensor Epac2-camps in adult rat ventricular myocytes (ARVMs). FRET and scanning ion conductance microscopy were used to locally stimulate β2AR and to measure cytosolic cAMP. Cav3 overexpression increased the number of caveolae and decreased the magnitude of β2AR-cAMP signal. Conversely, Cav3DN expression resulted in an increased β2AR-cAMP response without altering the whole-cell L-type calcium current. Following local stimulation of Cav3DN-expressing ARVMs, β2AR response could only be generated in T-tubules. However, the normally compartmentalized β2AR-cAMP signal became diffuse, similar to the situation observed in heart failure. Finally, overexpression of Cav3 in failing myocytes led to partial β2AR redistribution back into the T-tubules. In conclusion, Cav3 plays a crucial role for the localization of β2AR and compartmentation of β2AR-cAMP signaling to the T-tubules of healthy ARVMs, and overexpression of Cav3 in failing myocytes can partially restore the disrupted localization of these receptors. PMID:24345421

  8. Dibutyryl cyclic AMP does not influence glomerular collagen or basement membrane production in vitro.

    PubMed

    Uw, V Y; Cohen, M P

    1980-02-01

    Glomeruli isolated from normal rat renal cortex were incubated for 3 hr with radiolabeled proline in the presence or absence of dibutyryl cyclic AMP. Following incubation, glomerular basement membranes were purified with osmotic lysis followed by selective solubilization of the cell membranes and intracellular proteins with detergents. This technique permitted quantitative recovery of radiolabeled membranes synthesized under different incubational conditions. Dibutyryl cyclic AMP did not affect the incorporation of radioactive precursor glomerular basement membrane (control = 14.72 +/- 1.08 cpm/microgram of membrane protein; cyclic AMP = 14.43 +/- 1.13). Nondialyzable [14C]protein and hydroxy[14C]proline were also measured in the media and in the various glomerular cell fractions obtained during isolation of the basement membranes. Protein ([14C]proline) and collagen (OH[14C]proline) secretion into the media in incubations with cyclic AMP did not differ from that in control incubations. OH[14C]proline content was greatest (congruent to 23% in the water-soluble fraction recovered after osmotic lysis, but significant amounts of OH[14C]proline were also associated with the detergent-solubilized cell fractions. Dibutyryl cyclic AMP had no effect on either glomerular protein or collagen synthesis in these experiments. The results suggest that total glomerular basement membrane production in mixed cell populations is not modulated via a cyclic AMP--coordinated mechanism but do not exclude the possibility that cyclic AMP modulates the amount or kind of collagen synthesis by individual glomerular cell types. PMID:6243687

  9. Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

    SciTech Connect

    Kasai, Ayumi; Yao, Jian; Yamauchi, Kozue; Hiramatsu, Nobuhiko; Hayakawa, Kunihiro; Meng, Yiman; Maeda, Shuichiro; Kitamura, Masanori . E-mail: masanori@yamanashi.ac.jp

    2006-02-15

    In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE{sup cyp}) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR{sup MMTV}) to improve sensitivity of assays. We found that DRE{sup cyp}-LTR{sup MMTV} responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE{sup cyp}-LTR{sup MMTV} and not involved in this process. In contrast to the effect of dioxin, the activation of DRE{sup cyp}-LTR{sup MMTV} by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE{sup cyp}, LTR{sup MMTV} nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE{sup cyp} with LTR{sup MMTV} causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE{sup cyp}-LTR{sup MMTV}-based bioassays for detection and quantification of dioxins and dioxin-like compounds.

  10. Advanced LIGO

    NASA Astrophysics Data System (ADS)

    LIGO Scientific Collaboration; Aasi, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V.; Affeldt, C.; Aggarwal, N.; Aguiar, O. D.; Ain, A.; Ajith, P.; Alemic, A.; Allen, B.; Amariutei, D.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C.; Areeda, J. S.; Ashton, G.; Ast, S.; Aston, S. M.; Aufmuth, P.; Aulbert, C.; Aylott, B. E.; Babak, S.; Baker, P. T.; Ballmer, S. W.; Barayoga, J. C.; Barbet, M.; Barclay, S.; Barish, B. C.; Barker, D.; Barr, B.; Barsotti, L.; Bartlett, J.; Barton, M. A.; Bartos, I.; Bassiri, R.; Batch, J. C.; Baune, C.; Behnke, B.; Bell, A. S.; Bell, C.; Benacquista, M.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Biscans, S.; Biwer, C.; Blackburn, J. K.; Blackburn, L.; Blair, C. D.; Blair, D.; Bock, O.; Bodiya, T. P.; Bojtos, P.; Bond, C.; Bork, R.; Born, M.; Bose, Sukanta; Brady, P. R.; Braginsky, V. B.; Brau, J. E.; Bridges, D. O.; Brinkmann, M.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Buchman, S.; Buikema, A.; Buonanno, A.; Cadonati, L.; Calderón Bustillo, J.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Caride, S.; Caudill, S.; Cavaglià, M.; Cepeda, C.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chao, S.; Charlton, P.; Chen, Y.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Collette, C.; Cominsky, L.; Constancio, M., Jr.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Costa, C. A.; Coughlin, M. W.; Countryman, S.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Cutler, C.; Dahl, K.; Dal Canton, T.; Damjanic, M.; Danilishin, S. L.; Danzmann, K.; Dartez, L.; Dave, I.; Daveloza, H.; Davies, G. S.; Daw, E. J.; DeBra, D.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; DeRosa, R. T.; DeSalvo, R.; Dhurandhar, S.; D´ıaz, M.; Di Palma, I.; Dojcinoski, G.; Dominguez, E.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Driggers, J. C.; Du, Z.; Dwyer, S.; Eberle, T.; Edo, T.; Edwards, M.; Edwards, M.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Essick, R.; Etzel, T.; Evans, M.; Evans, T.; Factourovich, M.; Fairhurst, S.; Fan, X.; Fang, Q.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Feldbaum, D.; Ferreira, E. C.; Fisher, R. P.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fuentes-Tapia, S.; Fulda, P.; Fyffe, M.; Gair, J. R.; Gaonkar, S.; Gehrels, N.; Gergely, L. Á.; Giaime, J. A.; Giardina, K. D.; Gleason, J.; Goetz, E.; Goetz, R.; Gondan, L.; González, G.; Gordon, N.; Gorodetsky, M. L.; Gossan, S.; Goßler, S.; Gräf, C.; Graff, P. B.; Grant, A.; Gras, S.; Gray, C.; Greenhalgh, R. J. S.; Gretarsson, A. M.; Grote, H.; Grunewald, S.; Guido, C. J.; Guo, X.; Gushwa, K.; Gustafson, E. K.; Gustafson, R.; Hacker, J.; Hall, E. D.; Hammond, G.; Hanke, M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harry, G. M.; Harry, I. W.; Hart, M.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Hee, S.; Heintze, M.; Heinzel, G.; Hendry, M.; Heng, I. S.; Heptonstall, A. W.; Heurs, M.; Hewitson, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hollitt, S. E.; Holt, K.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E.; Howell, E. J.; Hu, Y. M.; Huerta, E.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh, M.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Islas, G.; Isler, J. C.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacobson, M.; Jang, H.; Jawahar, S.; Ji, Y.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Ju, L.; Haris, K.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Katsavounidis, E.; Katzman, W.; Kaufer, H.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Keiser, G. M.; Keitel, D.; Kelley, D. B.; Kells, W.; Keppel, D. G.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khazanov, E. A.; Kim, C.; Kim, K.; Kim, N. G.; Kim, N.; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Klimenko, S.; Kline, J.; Koehlenbeck, S.; Kokeyama, K.; Kondrashov, V.; Korobko, M.; Korth, W. Z.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krueger, C.; Kuehn, G.; Kumar, A.; Kumar, P.; Kuo, L.; Landry, M.; Lantz, B.; Larson, S.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Le, J.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Leong, J. R.; Levin, Y.; Levine, B.; Lewis, J.; Li, T. G. F.; Libbrecht, K.; Libson, A.; Lin, A. C.; Littenberg, T. B.; Lockerbie, N. A.; Lockett, V.; Logue, J.; Lombardi, A. L.; Lormand, M.; Lough, J.; Lubinski, M. J.; Lück, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macarthur, J.; MacDonald, T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña-Sandoval, F.; Magee, R.; Mageswaran, M.; Maglione, C.; Mailand, K.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Márka, S.; Márka, Z.; Markosyan, A.; Maros, E.; Martin, I. W.; Martin, R. M.; Martynov, D.; Marx, J. N.; Mason, K.; Massinger, T. J.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McLin, K.; McWilliams, S.; Meadors, G. D.; Meinders, M.; Melatos, A.; Mendell, G.; Mercer, R. A.; Meshkov, S.; Messenger, C.; Meyers, P. M.; Miao, H.; Middleton, H.; Mikhailov, E. E.; Miller, A.; Miller, J.; Millhouse, M.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moe, B.; Mohanty, S. D.; Mohapatra, S. R. P.; Moore, B.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D.; Murray, P. G.; Mytidis, A.; Nash, T.; Nayak, R. K.; Necula, V.; Nedkova, K.; Newton, G.; Nguyen, T.; Nielsen, A. B.; Nissanke, S.; Nitz, A. H.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oppermann, P.; Oram, R.; O'Reilly, B.; Ortega, W.; O'Shaughnessy, R.; Osthelder, C.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Padilla, C.; Pai, A.; Pai, S.; Palashov, O.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Papa, M. A.; Paris, H.; Patrick, Z.; Pedraza, M.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Pierro, V.; Pinto, I. M.; Pitkin, M.; Poeld, J.; Post, A.; Poteomkin, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S.; Prestegard, T.; Price, L. R.; Principe, M.; Privitera, S.; Prix, R.; Prokhorov, L.; Puncken, O.; Pürrer, M.; Qin, J.; Quetschke, V.; Quintero, E.; Quiroga, G.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajalakshmi, G.; Rakhmanov, M.; Ramirez, K.; Raymond, V.; Reed, C. M.; Reid, S.; Reitze, D. H.; Reula, O.; Riles, K.; Robertson, N. A.; Robie, R.; Rollins, J. G.; Roma, V.; Romano, J. D.; Romanov, G.; Romie, J. H.; Rowan, S.; Rüdiger, A.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Sammut, L.; Sandberg, V.; Sanders, J. R.; Sannibale, V.; Santiago-Prieto, I.; Sathyaprakash, B. S.; Saulson, P. R.; Savage, R.; Sawadsky, A.; Scheuer, J.; Schilling, R.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sergeev, A.; Serna, G.; Sevigny, A.; Shaddock, D. A.; Shahriar, M. S.; Shaltev, M.; Shao, Z.; Shapiro, B.; Shawhan, P.; Shoemaker, D. H.; Sidery, T. L.; Siemens, X.; Sigg, D.; Silva, A. D.; Simakov, D.; Singer, A.; Singer, L.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, J. R.; Smith, M. R.; Smith, R. J. E.; Smith-Lefebvre, N. D.; Son, E. J.; Sorazu, B.; Souradeep, T.; Staley, A.; Stebbins, J.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Steplewski, S.; Stevenson, S.; Stone, R.; Strain, K. A.; Strigin, S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sutton, P. J.; Szczepanczyk, M.; Szeifert, G.; Talukder, D.; Tanner, D. B.; Tápai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, R.; Tellez, G.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, V.; Tomlinson, C.; Torres, C. V.; Torrie, C. I.; Traylor, G.; Tse, M.; Tshilumba, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Veggel, A. A.; Vass, S.; Vaulin, R.; Vecchio, A.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Vincent-Finley, R.; Vitale, S.; Vo, T.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, H.; Wang, M.; Wang, X.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; White, D. J.; Whiting, B. F.; Wilkinson, C.; Williams, L.; Williams, R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Xie, S.; Yablon, J.; Yakushin, I.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yang, Q.; Zanolin, M.; Zhang, Fan; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhu, X. J.; Zucker, M. E.; Zuraw, S.; Zweizig, J.

    2015-04-01

    The Advanced LIGO gravitational wave detectors are second-generation instruments designed and built for the two LIGO observatories in Hanford, WA and Livingston, LA, USA. The two instruments are identical in design, and are specialized versions of a Michelson interferometer with 4 km long arms. As in Initial LIGO, Fabry-Perot cavities are used in the arms to increase the interaction time with a gravitational wave, and power recycling is used to increase the effective laser power. Signal recycling has been added in Advanced LIGO to improve the frequency response. In the most sensitive frequency region around 100 Hz, the design strain sensitivity is a factor of 10 better than Initial LIGO. In addition, the low frequency end of the sensitivity band is moved from 40 Hz down to 10 Hz. All interferometer components have been replaced with improved technologies to achieve this sensitivity gain. Much better seismic isolation and test mass suspensions are responsible for the gains at lower frequencies. Higher laser power, larger test masses and improved mirror coatings lead to the improved sensitivity at mid and high frequencies. Data collecting runs with these new instruments are planned to begin in mid-2015.

  11. Communication of cAMP by connexin43 gap junctions regulates osteoblast signaling and gene expression.

    PubMed

    Gupta, Aditi; Anderson, Hidayah; Buo, Atum M; Moorer, Megan C; Ren, Margaret; Stains, Joseph P

    2016-08-01

    Connexin43 (Cx43) containing gap junctions play an important role in bone homeostasis, yet little is known about the second messengers communicated by Cx43 among bone cells. Here, we used MC3T3-E1 pre-osteoblasts and UMR106 rat osteosarcoma cells to test the hypothesis that cAMP is a second messenger communicated by bone cells through Cx43 containing gap junctions in a manner that is sufficient to impact osteoblast function. Overexpression of Cx43 markedly enhanced the activity of a cAMP-response element driven transcriptional luciferase reporter (CRE-luc) and increased phospho-CREB and phospho-ERK1/2 levels following expression of a constitutively active Gsα or by treatment with prostaglandin E2 (PGE2), 3-Isobutyl-1-methyl xanthine (IBMX) or forskolin. The Cx43-dependent potentiation of signaling in PGE2 treated cells was not accompanied by a further increase in cAMP levels, suggesting that the cAMP was shared between cells rather than Cx43 enhancing cAMP production. To support this, we developed a novel assay in which one set of cells expressing constitutively active Gsα (donor cells) were co-cultured with a second set of cells expressing a CRE-luc reporter (acceptor cells). Using this assay, activation of a CRE-luc reporter in the acceptor cells was both Cx43- and cell contact-dependent, indicating communication of cAMP among cells. Finally, we showed that Cx43 increased the cAMP-dependent mRNA expression of receptor activator of nuclear factor kappa B ligand (RANKL) and enhanced the repression of the sclerostin mRNA, implying a potential mechanism for the modulation of tissue remodeling. In total, these data demonstrate that Cx43 can communicate cAMP between cells and, more importantly, that the communicated cAMP is sufficient to impact signal transduction cascades and the expression of key bone effector molecules between interconnected cells. PMID:27156839

  12. PKA RIα Homodimer Structure Reveals an Intermolecular Interface with Implications for Cooperative cAMP Binding and Carney Complex Disease

    PubMed Central

    Bruystens, Jessica G.H.; Wu, Jian; Fortezzo, Audrey; Kornev, Alexandr P.; Blumenthal, Donald K.; Taylor, Susan S.

    2014-01-01

    Summary The regulatory (R) subunit is the cAMP receptor of protein kinase A. Following cAMP binding, the inactive PKA holoenzyme complex separates into two active catalytic (C) subunits and a cAMP-bound R dimer. Thus far, only monomeric R structures have been solved, which fell short in explaining differences of cAMP binding for the full-length protein as compared to the truncated R subunits. Here we solved a full-length R-dimer structure that reflects the biologically relevant conformation, and this structure agrees well with small angle X-ray scattering. An isoform-specific interface is revealed between the protomers. This interface acts as an intermolecular sensor for cAMP and explains the cooperative character of cAMP binding to the RIα dimer. Mutagenesis of residues on this interface not only leads to structural and biochemical changes, but is also linked to Carney complex disease. PMID:24316401

  13. Advanced Pacemaker

    NASA Technical Reports Server (NTRS)

    1990-01-01

    Synchrony, developed by St. Jude Medical's Cardiac Rhythm Management Division (formerly known as Pacesetter Systems, Inc.) is an advanced state-of-the-art implantable pacemaker that closely matches the natural rhythm of the heart. The companion element of the Synchrony Pacemaker System is the Programmer Analyzer APS-II which allows a doctor to reprogram and fine tune the pacemaker to each user's special requirements without surgery. The two-way communications capability that allows the physician to instruct and query the pacemaker is accomplished by bidirectional telemetry. APS-II features 28 pacing functions and thousands of programming combinations to accommodate diverse lifestyles. Microprocessor unit also records and stores pertinent patient data up to a year.

  14. Ultrasonic and densimetric characterization of the association of cyclic AMP with the cAMP-binding domain of the exchange protein EPAC1.

    PubMed

    Son, Ikbae; Selvaratnam, Rajeevan; Dubins, David N; Melacini, Giuseppe; Chalikian, Tigran V

    2013-09-19

    We employed a combination of densimetric and ultrasonic velocimetric techniques to characterize the volumetric properties of the association of the cAMP-binding domain (CBD) of EPAC1 with cAMP at 25 °C in a pH 7.6 buffer. The binding of cAMP to the CBD of EPAC1 is accompanied by changes in volume, ΔV, and adiabatic compressibility, ΔKS, of -59 ± 4 cm(3) mol(-1) and (34 ± 9) × 10(-4) cm(3) mol(-1) bar(-1), respectively. We use these volumetric results in conjunction with the structural data to estimate a change in hydration, Δnh, accompanying the binding. We calculate that approximately 103 water molecules are released to the bulk from the associating surfaces of the protein and the ligand. This number is ∼30% larger than the number of water molecules in direct contact with the associating surfaces while also being within the error of our Δnh determination. Therefore, we conclude that cAMP binding to EPAC1 may involve, in addition to the waters from within the first coordination sphere, also some waters from the second coordination sphere of the protein and cAMP. Our analysis of the compressibility data reveals that the protein becomes more rigid and less dynamic upon the cAMP binding as reflected in a 4 ± 0.5% decrease in its intrinsic coefficient of adiabatic compressibility. Finally, we estimate the hydration, ΔShyd, and configurational, ΔSconf, contributions to the binding entropy, ΔSb. We find that the binding entropy is determined by the fine balance between the ΔShyd and ΔSconf terms. In general, we discuss insights that are derived from a combination of volumetric and structural properties, in particular, emphasizing how measured changes in volume and compressibility can be interpreted in terms of hydration and dynamic properties of EPAC1 in its apo- and holo-forms. PMID:23968295

  15. Adenylate Kinase and AMP Signaling Networks: Metabolic Monitoring, Signal Communication and Body Energy Sensing

    PubMed Central

    Dzeja, Petras; Terzic, Andre

    2009-01-01

    Adenylate kinase and downstream AMP signaling is an integrated metabolic monitoring system which reads the cellular energy state in order to tune and report signals to metabolic sensors. A network of adenylate kinase isoforms (AK1-AK7) are distributed throughout intracellular compartments, interstitial space and body fluids to regulate energetic and metabolic signaling circuits, securing efficient cell energy economy, signal communication and stress response. The dynamics of adenylate kinase-catalyzed phosphotransfer regulates multiple intracellular and extracellular energy-dependent and nucleotide signaling processes, including excitation-contraction coupling, hormone secretion, cell and ciliary motility, nuclear transport, energetics of cell cycle, DNA synthesis and repair, and developmental programming. Metabolomic analyses indicate that cellular, interstitial and blood AMP levels are potential metabolic signals associated with vital functions including body energy sensing, sleep, hibernation and food intake. Either low or excess AMP signaling has been linked to human disease such as diabetes, obesity and hypertrophic cardiomyopathy. Recent studies indicate that derangements in adenylate kinase-mediated energetic signaling due to mutations in AK1, AK2 or AK7 isoforms are associated with hemolytic anemia, reticular dysgenesis and ciliary dyskinesia. Moreover, hormonal, food and antidiabetic drug actions are frequently coupled to alterations of cellular AMP levels and associated signaling. Thus, by monitoring energy state and generating and distributing AMP metabolic signals adenylate kinase represents a unique hub within the cellular homeostatic network. PMID:19468337

  16. Senescent-induced dysregulation of cAMP/CREB signaling and correlations with cognitive decline.

    PubMed

    Hansen, Rolf T; Zhang, Han-Ting

    2013-06-21

    It is well known that alongside senescence there is a gradual decline in cognitive ability, most noticeably certain kinds of memory such as working, episodic, spatial, and long term memory. However, until recently, not much has been known regarding the specific mechanisms responsible for the decline in cognitive ability with age. Over the past decades, researchers have become more interested in cAMP signaling, and its downstream transcription factor cAMP response element binding protein (CREB) in the context of senescence. However, there is still a lack of understanding on what ultimately causes the cognitive deficits observed with senescence. This review will focus on the changes in intracellular signaling in the brain, more specifically, alterations in cAMP/CREB signaling in aging. In addition, the downstream effects of altered cAMP signaling on cognitive ability with age will be further discussed. Overall, understanding the senescent-related changes that occur in cAMP/CREB signaling could be important for the development of novel drug targets for both healthy aging, and pathological aging such as Alzheimer's disease. PMID:23623816

  17. cAMP signaling in skeletal muscle adaptation: hypertrophy, metabolism, and regeneration

    PubMed Central

    Stewart, Randi

    2012-01-01

    Among organ systems, skeletal muscle is perhaps the most structurally specialized. The remarkable subcellular architecture of this tissue allows it to empower movement with instructions from motor neurons. Despite this high degree of specialization, skeletal muscle also has intrinsic signaling mechanisms that allow adaptation to long-term changes in demand and regeneration after acute damage. The second messenger adenosine 3′,5′-monophosphate (cAMP) not only elicits acute changes within myofibers during exercise but also contributes to myofiber size and metabolic phenotype in the long term. Strikingly, sustained activation of cAMP signaling leads to pronounced hypertrophic responses in skeletal myofibers through largely elusive molecular mechanisms. These pathways can promote hypertrophy and combat atrophy in animal models of disorders including muscular dystrophy, age-related atrophy, denervation injury, disuse atrophy, cancer cachexia, and sepsis. cAMP also participates in muscle development and regeneration mediated by muscle precursor cells; thus, downstream signaling pathways may potentially be harnessed to promote muscle regeneration in patients with acute damage or muscular dystrophy. In this review, we summarize studies implicating cAMP signaling in skeletal muscle adaptation. We also highlight ligands that induce cAMP signaling and downstream effectors that are promising pharmacological targets. PMID:22354781

  18. Diatom acclimation to elevated CO2 via cAMP signalling and coordinated gene expression

    NASA Astrophysics Data System (ADS)

    Hennon, Gwenn M. M.; Ashworth, Justin; Groussman, Ryan D.; Berthiaume, Chris; Morales, Rhonda L.; Baliga, Nitin S.; Orellana, Mónica V.; Armbrust, E. V.

    2015-08-01

    Diatoms are responsible for ~40% of marine primary productivity, fuelling the oceanic carbon cycle and contributing to natural carbon sequestration in the deep ocean. Diatoms rely on energetically expensive carbon concentrating mechanisms (CCMs) to fix carbon efficiently at modern levels of CO2 (refs , , ). How diatoms may respond over the short and long term to rising atmospheric CO2 remains an open question. Here we use nitrate-limited chemostats to show that the model diatom Thalassiosira pseudonana rapidly responds to increasing CO2 by differentially expressing gene clusters that regulate transcription and chromosome folding, and subsequently reduces transcription of photosynthesis and respiration gene clusters under steady-state elevated CO2. These results suggest that exposure to elevated CO2 first causes a shift in regulation, and then a metabolic rearrangement. Genes in one CO2-responsive cluster included CCM and photorespiration genes that share a putative cAMP-responsive cis-regulatory sequence, implying these genes are co-regulated in response to CO2, with cAMP as an intermediate messenger. We verified cAMP-induced downregulation of CCM gene δ-CA3 in nutrient-replete diatom cultures by inhibiting the hydrolysis of cAMP. These results indicate an important role for cAMP in downregulating CCM and photorespiration genes under elevated CO2 and provide insights into mechanisms of diatom acclimation in response to climate change.

  19. An antimicrobial peptide Ar-AMP from amaranth (Amaranthus retroflexus L.) seeds.

    PubMed

    Lipkin, Aleksey; Anisimova, Veronika; Nikonorova, Aleksandra; Babakov, Aleksey; Krause, Eberhardt; Bienert, Mikhael; Grishin, Eugene; Egorov, Tsezi

    2005-10-01

    A 30-residue antimicrobial peptide Ar-AMP was isolated from the seeds of amaranth Amaranthus retroflexus L. essentially by a single step procedure using reversed-phase HPLC, and its in vitro biological activities were studied. The complete amino acid sequence of Ar-AMP was determined by Edman degradation in combination with mass spectrometric methods. In addition, the cDNA encoding Ar-AMP was obtained and sequenced. The cDNA encodes a precursor protein consisting of the N-terminal putative signal sequence of 25 amino acids, a mature peptide of 30 amino acids and a 34-residue long C-terminal region cleaved during post-translational processing. According to sequence similarity the Ar-AMP belongs to the hevein-like family of antimicrobial peptides with six cysteine residues. In spite of the fact that seeds were collected in 1967 and lost their germination capacity, Ar-AMP retained its biological activities. It effectively inhibited the growth of different fungi tested: Fusarium culmorium (Smith) Sacc., Helminthosporium sativum Pammel., King et Bakke, Alternaria consortiale Fr., and Botrytis cinerea Pers., caused morphological changes in Rhizoctonia solani Kühn at micromolar concentrations and protected barley seedlings from H. sativum infection. PMID:16126239

  20. Molecular and kinetic alterations of muscle AMP deaminase during chronic creatine depletion.

    PubMed

    Rush, J W; Tullson, P C; Terjung, R L

    1998-02-01

    We examined a possible mechanism to account for the maintenance of peak AMP deamination rate in fast-twitch muscle of rats fed the creatine analog beta-guanidinopropionic acid (beta-GPA), in spite of reduced abundance of the enzyme AMP deaminase (AMPD). AMPD enzymatic capacity (determined at saturating AMP concentration) and AMPD protein abundance (Western blot) were coordinately reduced approximately 80% in fast-twitch white gastrocnemius muscle by beta-GPA feeding over 7 wk. Kinetic analysis of AMPD in the soluble cell fraction demonstrated a single Michaelis-Menten constant (Km; approximately 1.5 mM) in control muscle extracts. An additional high-affinity Km (approximately 0.03 mM) was revealed at low AMP concentrations in extracts of beta-GPA-treated muscle. The kinetic alteration in AMPD reflects increased molecular activity at low AMP concentrations; this could account for high rates of deamination in beta-GPA-treated muscle in situ, despite the loss of AMPD enzyme protein. The elimination of this kinetic effect by treatment of beta-GPA-treated muscle extracts with acid phosphatase in vitro suggests that phosphorylation is involved in the kinetic control of skeletal muscle AMPD in vivo. PMID:9486137

  1. Pseudomonas aeruginosa AmpR: an acute–chronic switch regulator

    PubMed Central

    Balasubramanian, Deepak; Kumari, Hansi; Mathee, Kalai

    2015-01-01

    Pseudomonas aeruginosa is one of the most intractable human pathogens that pose serious clinical challenge due to extensive prevalence of multidrug-resistant clinical isolates. Armed with abundant virulence and antibiotic resistance mechanisms, it is a major etiologic agent in a number of acute and chronic infections. A complex and intricate network of regulators dictates the expression of pathogenicity factors in P. aeruginosa. Some proteins within the network play key roles and control multiple pathways. This review discusses the role of one such protein, AmpR, which was initially recognized for its role in antibiotic resistance by regulating AmpC β-lactamase. Recent genomic, proteomic and phenotypic analyses demonstrate that AmpR regulates expression of hundreds of genes that are involved in diverse pathways such as β-lactam and non-β-lactam resistance, quorum sensing and associated virulence phenotypes, protein phosphorylation, and physiological processes. Finally, ampR mutations in clinical isolates are reviewed to shed light on important residues required for its function in antibiotic resistance. The prevalence and evolutionary implications of AmpR in pathogenic and nonpathogenic proteobacteria are also discussed. A comprehensive understanding of proteins at nodal positions in the P. aeruginosa regulatory network is crucial in understanding, and ultimately targeting, the pathogenic stratagems of this organism. PMID:25066236

  2. Intercellular Redistribution of cAMP Underlies Selective Suppression of Cancer Cell Growth by Connexin26

    PubMed Central

    Polusani, Srikanth R.; Mathis, Sandra A.; Zucker, Shoshanna N.; Nicholson, Bruce J.

    2013-01-01

    Connexins (Cx), which constitute gap junction intercellular channels in vertebrates, have been shown to suppress transformed cell growth and tumorigenesis, but the mechanism(s) still remain largely speculative. Here, we define the molecular basis by which Cx26, but less frequently Cx43 or Cx32, selectively confer growth suppression on cancer cells. Functional intercellular coupling is shown to be required, producing partial blocks of the cell cycle due to prolonged activation of several mitogenic kinases. PKA is both necessary and sufficient for the Cx26 induced growth inhibition in low serum and the absence of anchorage. Activation of PKA was not associated with elevated cAMP levels, but appeared to result from a redistribution of cAMP throughout the cell population, eliminating the cell cycle oscillations in cAMP required for efficient cell cycle progression. Cx43 and Cx32 fail to mediate this redistribution as, unlike Cx26, these channels are closed during the G2/M phase of the cell cycle when cAMP levels peak. Comparisons of tumor cell lines indicate that this is a general pattern, with growth suppression by connexins occurring whenever cAMP oscillates with the cell cycle, and the gap junction remain open throughout the cell cycle. Thus, gap junctional coupling, in the absence of any external signals, provides a general means to limit the mitotic rate of cell populations. PMID:24312655

  3. Renal Epithelial Cyst Formation and Enlargement in vitro: Dependence on cAMP

    NASA Astrophysics Data System (ADS)

    Mangoo-Karim, Roberto; Uchic, Marie; Lechene, Claude; Grantham, Jared J.

    1989-08-01

    Cysts, a common abnormality of kidneys, are collections of urine-like fluid enclosed by a continuous layer of epithelial cells. Renal cysts derive from nephrons and collecting ducts and progressively enlarge as a consequence of epithelial proliferation and transepithelial fluid secretion. The initiation of cyst formation and the factors that control cyst enlargement are unknown. We used an in vitro model of renal cysts to explore the role of the cAMP signal transduction system in the formation and expansion of cysts. MDCK cells, cultured in hydrated-collagen gel, produced polarized monolayered epithelial cysts when intracellular cAMP was increased by prostaglandin E1, arginine vasopressin, cholera toxin, forskolin, or 8-bromoadenosine 3',5'-cyclic monophosphate. All agonists were potentiated by 3-isobutyl-1-methylxanthine, a nucleotide phosphodiesterase inhibitor. The cell proliferation component of cyst enlargement was accelerated by cAMP agonists, as shown by the increased growth of MDCK cells in subconfluent monolayers. The fluid secretion component, reflected by the transepithelial movement of fluid across polarized monolayers of MDCK cells grown on permeable supports, was stimulated by cAMP agonists in the basolateral medium. Chloride levels were higher in the cyst fluid and the secreted fluid than in the bathing medium. We conclude that the development of MDCK cysts is dependent on cAMP. This signal transduction system may be an important modulator of epithelial cell proliferation and transepithelial fluid secretion in the kidney.

  4. Persistent cAMP Signaling by Internalized LH Receptors in Ovarian Follicles.

    PubMed

    Lyga, Sandra; Volpe, Silvia; Werthmann, Ruth C; Götz, Konrad; Sungkaworn, Titiwat; Lohse, Martin J; Calebiro, Davide

    2016-04-01

    A crucial event in female reproduction occurs at midcycle, when a LH peak induces the final maturation of ovarian follicles. LH signals via a G protein-coupled receptor selectively expressed in the outermost follicular cell layers. However, how LH signals are relayed inside these cells and finally to the oocyte is incompletely understood. Here, we monitored LH signaling in intact ovarian follicles of transgenic mice expressing a fluorescent cAMP sensor. We found that LH stimulation induces 2 phases of cAMP signaling in all cell layers surrounding the oocyte. Interfering with LH receptor internalization abolished the second, persistent cAMP phase and partially inhibited oocyte meiosis resumption. These data suggest that persistent cAMP signals from internalized LH receptors contribute to transmitting LH effects inside follicle cells and ultimately to the oocyte. Thus, this study indicates that the recently proposed paradigm of cAMP signaling by internalized G protein-coupled receptors is implicated in receptor function and is physiologically relevant. PMID:26828746

  5. Cyclic AMP-receptor protein activates aerobactin receptor IutA expression in Vibrio vulnificus.

    PubMed

    Kim, Choon-Mee; Kim, Seong-Jung; Shin, Sung-Heui

    2012-04-01

    The ferrophilic bacterium Vibrio vulnificus can utilize the siderophore aerobactin of Escherichia coli for iron acquisition via its specific receptor IutA. This siderophore piracy by V. vulnificus may contribute to its survival and proliferation, especially in mixed bacterial environments. In this study, we examined the effects of glucose, cyclic AMP (cAMP), and cAMP-receptor protein (Crp) on iutA expression in V. vulnificus. Glucose dose-dependently repressed iutA expression. A mutation in cya encoding adenylate cyclase required for cAMP synthesis severely repressed iutA expression, and this change was recovered by in trans complementing cya or the addition of exogenous cAMP. Furthermore, a mutation in crp encoding Crp severely repressed iutA expression, and this change was recovered by complementing crp. Accordingly, glucose deprivation under iron-limited conditions is an environmental signal for iutA expression, and Crp functions as an activator that regulates iutA expression in response to glucose availability. PMID:22538662

  6. Role of cyclic AMP in the maturation of Ciona intestinalis oocytes.

    PubMed

    Silvestre, Francesco; Gallo, Alessandra; Cuomo, Annunziata; Covino, Tiziana; Tosti, Elisabetta

    2011-11-01

    Immature oocytes are arrested at prophase I of the meiotic process and maturation onset is indicated by oocyte nuclear disassembly (germinal vesicle breakdown or GVBD). Signaling pathways that elevate intracellular cyclic AMP (cAMP) may either prevent or induce oocyte maturation depending on the species. In some marine invertebrates and, in particular, in ascidian oocytes, cAMP triggers GVBD rather than blocking it. In this paper, we tested different cAMP elevators in fully grown oocytes at the germinal vesicle stage (GV) of the ascidian Ciona intestinalis. We demonstrated that through the activation of adenylate cyclase or the inhibition and phosphodiesterases the oocyte remained at the GV stage. This effect was reversible as the GV-arrested oocytes, rinsed and incubated in sea water, are able to undergo spontaneous maturation and extrusion of follicle cells. In addition, oocytes acquire the ability to be fertilized and start early development. However, morphology of follicle cells, embryos and larvae from in vitro matured oocytes showed different morphology from those derived from in vivo mature oocytes. The role and the transduction mechanism of cAMP in the regulation of oocyte maturation were discussed. Finally, we indicated a variation of biological mechanisms present in the ascidian species; moreover, we sustain evidence proving that tunicates share some biological mechanisms with vertebrates. This information provided new hints on the importance of ascidians in the evolution of chordates. PMID:20810008

  7. Cyclic AMP concentrations in dendritic cells induce and regulate Th2 immunity and allergic asthma

    PubMed Central

    Lee, Jihyung; Kim, Tae Hoon; Murray, Fiona; Li, Xiangli; Choi, Sara S.; Broide, David H.; Corr, Maripat; Lee, Jongdae; Webster, Nicholas J. G.; Insel, Paul A.; Raz, Eyal

    2015-01-01

    The inductive role of dendritic cells (DC) in Th2 differentiation has not been fully defined. We addressed this gap in knowledge by focusing on signaling events mediated by the heterotrimeric GTP binding proteins Gαs, and Gαi, which respectively stimulate and inhibit the activation of adenylyl cyclases and the synthesis of cAMP. We show here that deletion of Gnas, the gene that encodes Gαs in mouse CD11c+ cells (GnasΔCD11c mice), and the accompanying decrease in cAMP provoke Th2 polarization and yields a prominent allergic phenotype, whereas increases in cAMP inhibit these responses. The effects of cAMP on DC can be demonstrated in vitro and in vivo and are mediated via PKA. Certain gene products made by GnasΔCD11c DC affect the Th2 bias. These findings imply that G protein-coupled receptors, the physiological regulators of Gαs and Gαi activation and cAMP formation, act via PKA to regulate Th bias in DC and in turn, Th2-mediated immunopathologies. PMID:25605931

  8. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  9. The role of ventral striatal cAMP signaling in stress-induced behaviors

    PubMed Central

    Plattner, Florian; Hayashi, Kanehiro; Hernandez, Adan; Benavides, David R.; Tassin, Tara C.; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W.; Yuen, Eunice Y.; Yan, Zhen; Goldberg, Matthew S.; Nairn, Angus C.; Greengard, Paul; Nestler, Eric J.; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D.; Bibb, James A.

    2015-01-01

    The cAMP/PKA signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitates cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targets the regulation of PDE4 by Cdk5, all produced analogical effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  10. Role of insulin during exercise-induced glycogenesis in muscle: effect on cyclic AMP.

    PubMed

    Ivy, J L

    1977-12-01

    Skeletal muscle cyclic AMP (cAMP) content and glycogen synthesis were investigated in male rats subjected to exhaustive exercise, alloxan diabetes, and combinations of these conditions. After an exhaustive swim or control treatment of wading, randomly selected animals were administered 500 mg glucose via stomach tube. Two hours after glucose administration, gastrocnemius glycogen levels rose from 1.31 to 10.67 mg/g wet wt in fatigued nondiabetics (FND), producing a 94% supercompensation above control values. Glycogen of fatigued diabetics (FD) increased from 0.88 to 4.21 mg/g wet wt during the first 2 hr after glucose administration and did not reach control values for 24 h. In conjunction with these glycogen changes, cAMP increased from 1.23 to 2.59 and 1.47 to 2.81 pmol/mg wet wt for FND and FD, respectively (P less than 0.05). No difference in cAMP levels between diabetics and nondiabetics was found. These in vivo data suggest that insulin may not be essential for muscle glycogen synthesis, but that after glycogen depletion it plays a prominent role in supercompensation. Also, this hormone's mechanism of action in skeletal muscle does not appear to be mediated through alteration in the tissue cAMP concentration. PMID:202169

  11. Intercellular redistribution of cAMP underlies selective suppression of cancer cell growth by connexin26.

    PubMed

    Chandrasekhar, Anjana; Kalmykov, Edward A; Polusani, Srikanth R; Mathis, Sandra A; Zucker, Shoshanna N; Nicholson, Bruce J

    2013-01-01

    Connexins (Cx), which constitute gap junction intercellular channels in vertebrates, have been shown to suppress transformed cell growth and tumorigenesis, but the mechanism(s) still remain largely speculative. Here, we define the molecular basis by which Cx26, but less frequently Cx43 or Cx32, selectively confer growth suppression on cancer cells. Functional intercellular coupling is shown to be required, producing partial blocks of the cell cycle due to prolonged activation of several mitogenic kinases. PKA is both necessary and sufficient for the Cx26 induced growth inhibition in low serum and the absence of anchorage. Activation of PKA was not associated with elevated cAMP levels, but appeared to result from a redistribution of cAMP throughout the cell population, eliminating the cell cycle oscillations in cAMP required for efficient cell cycle progression. Cx43 and Cx32 fail to mediate this redistribution as, unlike Cx26, these channels are closed during the G2/M phase of the cell cycle when cAMP levels peak. Comparisons of tumor cell lines indicate that this is a general pattern, with growth suppression by connexins occurring whenever cAMP oscillates with the cell cycle, and the gap junction remain open throughout the cell cycle. Thus, gap junctional coupling, in the absence of any external signals, provides a general means to limit the mitotic rate of cell populations. PMID:24312655

  12. cAMP signalling in mushroom bodies modulates temperature preference behaviour in Drosophila.

    PubMed

    Hong, Sung-Tae; Bang, Sunhoe; Hyun, Seogang; Kang, Jongkyun; Jeong, Kyunghwa; Paik, Donggi; Chung, Jongkyeong; Kim, Jaeseob

    2008-08-01

    Homoiotherms, for example mammals, regulate their body temperature with physiological responses such as a change of metabolic rate and sweating. In contrast, the body temperature of poikilotherms, for example Drosophila, is the result of heat exchange with the surrounding environment as a result of the large ratio of surface area to volume of their bodies. Accordingly, these animals must instinctively move to places with an environmental temperature as close as possible to their genetically determined desired temperature. The temperature that Drosophila instinctively prefers has a function equivalent to the 'set point' temperature in mammals. Although various temperature-gated TRP channels have been discovered, molecular and cellular components in Drosophila brain responsible for determining the desired temperature remain unknown. We identified these components by performing a large-scale genetic screen of temperature preference behaviour (TPB) in Drosophila. In parallel, we mapped areas of the Drosophila brain controlling TPB by targeted inactivation of neurons with tetanus toxin and a potassium channel (Kir2.1) driven with various brain-specific GAL4s. Here we show that mushroom bodies (MBs) and the cyclic AMP-cAMP-dependent protein kinase A (cAMP-PKA) pathway are essential for controlling TPB. Furthermore, targeted expression of cAMP-PKA pathway components in only the MB was sufficient to rescue abnormal TPB of the corresponding mutants. Preferred temperatures were affected by the level of cAMP and PKA activity in the MBs in various PKA pathway mutants. PMID:18594510

  13. A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP.

    PubMed

    Commichau, Fabian M; Dickmanns, Achim; Gundlach, Jan; Ficner, Ralf; Stülke, Jörg

    2015-07-01

    Second messengers are key components of many signal transduction pathways. In addition to cyclic AMP, ppGpp and cyclic di-GMP, many bacteria use also cyclic di-AMP as a second messenger. This molecule is synthesized by distinct classes of diadenylate cyclases and degraded by phosphodiesterases. The control of the intracellular c-di-AMP pool is very important since both a lack of this molecule and its accumulation can inhibit growth of the bacteria. In many firmicutes, c-di-AMP is essential, making it the only known essential second messenger. Cyclic di-AMP is implicated in a variety of functions in the cell, including cell wall metabolism, potassium homeostasis, DNA repair and the control of gene expression. To understand the molecular mechanisms behind these functions, targets of c-di-AMP have been identified and characterized. Interestingly, c-di-AMP can bind both proteins and RNA molecules. Several proteins that interact with c-di-AMP are required to control the intracellular potassium concentration. In Bacillus subtilis, c-di-AMP also binds a riboswitch that controls the expression of a potassium transporter. Thus, c-di-AMP is the only known second messenger that controls a biological process by interacting with both a protein and the riboswitch that regulates its expression. Moreover, in Listeria monocytogenes c-di-AMP controls the activity of pyruvate carboxylase, an enzyme that is required to replenish the citric acid cycle. Here, we review the components of the c-di-AMP signaling system. PMID:25869574

  14. DhhP, a cyclic di-AMP phosphodiesterase of Borrelia burgdorferi, is essential for cell growth and virulence.

    PubMed

    Ye, Meiping; Zhang, Jun-Jie; Fang, Xin; Lawlis, Gavin B; Troxell, Bryan; Zhou, Yan; Gomelsky, Mark; Lou, Yongliang; Yang, X Frank

    2014-05-01

    Cyclic di-AMP (c-di-AMP) is a recently discovered second messenger in bacteria. Most of work on c-di-AMP signaling has been done in Gram-positive bacteria, firmicutes, and actinobacteria, where c-di-AMP signaling pathways affect potassium transport, cell wall structure, and antibiotic resistance. Little is known about c-di-AMP signaling in other bacteria. Borrelia burgdorferi, the causative agent of Lyme disease, is a spirochete that has a Gram-negative dual membrane. In this study, we demonstrated that B. burgdorferi BB0619, a DHH-DHHA1 domain protein (herein designated DhhP), functions as c-di-AMP phosphodiesterase. Recombinant DhhP hydrolyzed c-di-AMP to pApA in a Mn(2+)- or Mg(2+)-dependent manner. In contrast to c-di-AMP phosphodiesterases reported thus far, DhhP appears to be essential for B. burgdorferi growth both in vitro and in the mammalian host. Inactivation of the chromosomal dhhP gene could be achieved only in the presence of a plasmid-encoded inducible dhhP gene. The conditional dhhP mutant had a dramatic increase in intracellular c-di-AMP level in comparison to the isogenic wild-type strain. Unlike what has been observed in Gram-positive bacteria, elevated cellular c-di-AMP in B. burgdorferi did not result in an increased resistance to β-lactamase antibiotics, suggesting that c-di-AMP's functions in spirochetes differ from those in Gram-positive bacteria. In addition, the dhhP mutant was defective in induction of the σ(S) factor, RpoS, and the RpoS-dependent outer membrane virulence factor OspC, which uncovers an important role of c-di-AMP in B. burgdorferi virulence. PMID:24566626

  15. DhhP, a Cyclic di-AMP Phosphodiesterase of Borrelia burgdorferi, Is Essential for Cell Growth and Virulence

    PubMed Central

    Ye, Meiping; Zhang, Jun-Jie; Fang, Xin; Lawlis, Gavin B.; Troxell, Bryan; Zhou, Yan; Gomelsky, Mark

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a recently discovered second messenger in bacteria. Most of work on c-di-AMP signaling has been done in Gram-positive bacteria, firmicutes, and actinobacteria, where c-di-AMP signaling pathways affect potassium transport, cell wall structure, and antibiotic resistance. Little is known about c-di-AMP signaling in other bacteria. Borrelia burgdorferi, the causative agent of Lyme disease, is a spirochete that has a Gram-negative dual membrane. In this study, we demonstrated that B. burgdorferi BB0619, a DHH-DHHA1 domain protein (herein designated DhhP), functions as c-di-AMP phosphodiesterase. Recombinant DhhP hydrolyzed c-di-AMP to pApA in a Mn2+- or Mg2+-dependent manner. In contrast to c-di-AMP phosphodiesterases reported thus far, DhhP appears to be essential for B. burgdorferi growth both in vitro and in the mammalian host. Inactivation of the chromosomal dhhP gene could be achieved only in the presence of a plasmid-encoded inducible dhhP gene. The conditional dhhP mutant had a dramatic increase in intracellular c-di-AMP level in comparison to the isogenic wild-type strain. Unlike what has been observed in Gram-positive bacteria, elevated cellular c-di-AMP in B. burgdorferi did not result in an increased resistance to β-lactamase antibiotics, suggesting that c-di-AMP's functions in spirochetes differ from those in Gram-positive bacteria. In addition, the dhhP mutant was defective in induction of the σS factor, RpoS, and the RpoS-dependent outer membrane virulence factor OspC, which uncovers an important role of c-di-AMP in B. burgdorferi virulence. PMID:24566626

  16. Effects of granulocyte-macrophage colony-stimulating factor and cyclic AMP interaction on human neutrophil apoptosis.

    PubMed Central

    Tortorella, C; Piazzolla, G; Spaccavento, F; Antonaci, S

    1998-01-01

    The current study was undertaken to evaluate the effects of granulocyte-macrophage colony-stimulating factor (GM-CSF) and cyclic AMP (cAMP) signaling interaction on human neutrophil apoptosis, either occurring spontaneously or induced by Fas antigen activation. Results show that GM-CSF, dibutyryl cAMP (a cAMP analog) and forskolin (an adenylate cyclase activator) are all able to suppress spontaneous neutrophil cell death. Of note however, when GM-CSF is used in combination with cAMP-elevating agents, an additive effect on neutrophil survival is observed with dibutyryl cAMP only, whereas supplementation of cell cultures with GM-CSF and forskolin results in a progressive reduction of antiapoptotic effects exerted by the single compounds. Moreover, although dibutyryl cAMP and forskolin do not affect Fas-triggered apoptotic events, they are still able to modulate the GM-CSF capacity to prolong neutrophil survival following anti-Fas IgM cell challenge, with effects similar to those respectively exerted on spontaneous neutrophil apoptosis. The data indicate that GM-CSF may negatively modulate the cAMP-mediated antiapoptotic pathway in human neutrophils, likely via the inhibition of adenylate cyclase activity. This would prevent an abnormal neutrophil survival as a result of cAMP signaling stimulation, which provides a novel insight into the role of GM-CSF as a physiological regulator of myeloid cell turnover. PMID:9927231

  17. Modeling and simulation challenges pursued by the Consortium for Advanced Simulation of Light Water Reactors (CASL)

    NASA Astrophysics Data System (ADS)

    Turinsky, Paul J.; Kothe, Douglas B.

    2016-05-01

    The Consortium for the Advanced Simulation of Light Water Reactors (CASL), the first Energy Innovation Hub of the Department of Energy, was established in 2010 with the goal of providing modeling and simulation (M&S) capabilities that support and accelerate the improvement of nuclear energy's economic competitiveness and the reduction of spent nuclear fuel volume per unit energy, and all while assuring nuclear safety. To accomplish this requires advances in M&S capabilities in radiation transport, thermal-hydraulics, fuel performance and corrosion chemistry. To focus CASL's R&D, industry challenge problems have been defined, which equate with long standing issues of the nuclear power industry that M&S can assist in addressing. To date CASL has developed a multi-physics "core simulator" based upon pin-resolved radiation transport and subchannel (within fuel assembly) thermal-hydraulics, capitalizing on the capabilities of high performance computing. CASL's fuel performance M&S capability can also be optionally integrated into the core simulator, yielding a coupled multi-physics capability with untapped predictive potential. Material models have been developed to enhance predictive capabilities of fuel clad creep and growth, along with deeper understanding of zirconium alloy clad oxidation and hydrogen pickup. Understanding of corrosion chemistry (e.g., CRUD formation) has evolved at all scales: micro, meso and macro. CFD R&D has focused on improvement in closure models for subcooled boiling and bubbly flow, and the formulation of robust numerical solution algorithms. For multiphysics integration, several iterative acceleration methods have been assessed, illuminating areas where further research is needed. Finally, uncertainty quantification and data assimilation techniques, based upon sampling approaches, have been made more feasible for practicing nuclear engineers via R&D on dimensional reduction and biased sampling. Industry adoption of CASL's evolving M

  18. Improved Synthesis of Biotinol-5′-AMP: Implications for Antibacterial Discovery

    PubMed Central

    2014-01-01

    An improved synthesis of biotinol-5′-AMP, an acyl-AMP mimic of the natural reaction intermediate of biotin protein ligase (BPL), is reported. This compound was shown to be a pan inhibitor of BPLs from a series of clinically important bacteria, particularly Staphylococcus aureus and Mycobacterium tuberculosis, and kinetic analysis revealed it to be competitive against the substrate biotin. Biotinol-5′-AMP also exhibits antibacterial activity against a panel of clinical isolates of S. aureus and M. tuberculosis with MIC values of 1–8 and 0.5–2.5 μg/mL, respectively, while being devoid of cytotoxicity to human HepG2 cells. PMID:25699152

  19. Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

    NASA Astrophysics Data System (ADS)

    Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

    1996-06-01

    cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

  20. Modulation of adhesion-dependent cAMP signaling by echistatin and alendronate

    NASA Technical Reports Server (NTRS)

    Fong, J. H.; Ingber, D. E.

    1996-01-01

    We measured intracellular cAMP levels in cells during attachment and spreading on different extracellular matrix (ECM) proteins. Increases in cAMP were observed within minutes when cells attached to fibronectin, vitronectin, and a synthetic RGD-containing fibronectin peptide (Petite 2000), but not when they adhered to another integrin alpha nu beta 3 ligand, echistatin. Because echistatin also inhibits bone resorption, we measured the effects of adding another osteoporosis inhibitor, alendronate, in this system. Alendronate inhibited the cAMP increase induced by ligands that primarily utilize integrin alpha nu beta 3 (vitronectin, Peptite 2000), but not by fibronectin which can also use integrin alpha 5 beta 1. These results show that cell adhesion to ECM can increase intracellular cAPM levels and raise the possibility that inhibitors of osteoporosis may act, in part, by preventing activation of this pathway by integrins.

  1. Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection

    PubMed Central

    Hurt, K. Joseph; Sezen, Sena F.; Lagoda, Gwen F.; Musicki, Biljana; Rameau, Gerald A.; Snyder, Solomon H.; Burnett, Arthur L.

    2012-01-01

    Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor l-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction. PMID:23012472

  2. Differential regulation of Paramecium ciliary motility by cAMP and cGMP.

    PubMed

    Bonini, N M; Nelson, D L

    1988-05-01

    cAMP and cGMP had distinct effects on the regulation of ciliary motility in Paramecium. Using detergent-permeabilized cells reactivated to swim with MgATP, we observed effects of cyclic nucleotides and interactions with Ca2+ on the swimming speed and direction of reactivated cells. Both cAMP and cGMP increased forward swimming speed two- to threefold with similar half-maximal concentrations near 0.5 microM. The two cyclic nucleotides, however, had different effects in antagonism with the Ca2+ response of backward swimming and on the handedness of the helical swimming paths of reactivated cells. These results suggest that cAMP and cGMP differentially regulate the direction of the ciliary power stroke. PMID:2836435

  3. Effect of leaving group on the oligomerization of 5'-AMP on montmorillonite. [Abstract only

    NASA Technical Reports Server (NTRS)

    Prabahar, K. Joseph; Ferris, James P.

    1994-01-01

    The oligomerization of imidazole derivative of 5'-AMP (ImpA) in the presence of montmorillonite clay yields oligomers containing up to 10 monomer units. In these reactions, the heterocyclic base, imidazole is the leaving group. In our present study, we synthesized a series of activated nucleotides of 5'AMP using other leaving groups such as pyrazole, 1,2,4-triazole, piperidine, morpholine, 4-aminopyridine, 4-methylaminopyridine, 4-dimethylaminopyridine, 2-aminobenzimidazole etc. to determine the effect of amine leaving group on the products of the oligomerization reaction. Earlier results from our laboratory showed that the presence AppA in the clay reaction of ImpA enhances the oligomerization reaction to yield higher oligomers. We also studied the effect of AppA in the clay mediated oligomerization reaction of the activated nucleotides. Oligomerization of 2-amino-benzimidazole derivative of 5'-AMP gave higher oligomers containing up to nine monomer units in the presence of AppA.

  4. Generation of cAMP-Activated Chloride Currents by Expression of CFTR

    NASA Astrophysics Data System (ADS)

    Anderson, Matthew P.; Rich, Devra P.; Gregory, Richard J.; Smith, Alan E.; Welsh, Michael J.

    1991-02-01

    Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis. In order to evaluate its function, CFTR was expressed in HeLa, Chinese hamster ovary (CHO), and NIH 3T3 fibroblast cells, and anion permeability was assessed with a fluorescence microscopic assay and the whole-cell patch-clamp technique. Adenosine 3',5'-monophosphate (cAMP) increased anion permeability and chloride currents in cells expressing CFTR, but not in cells expressing a mutant CFTR (ΔF508) or in nontransfected cells. The simplest interpretation of these observations is that CFTR is itself a cAMP-activated chloride channel. The alternative interpretation, that CFTR directly or indirectly regulates chloride channels, requires that these cells have endogenous cryptic, chloride channels that are stimulated by cAMP only in the presence of CFTR.

  5. Involvement of the second messenger cAMP in gravity-signal transduction in physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Rabien, H.; Ivanova, K.

    The aim of the investigation was to clarify, whether cellular signal processing following graviperception involves second messenger pathways. The test object was a most gravisensitive free-living ameboid cell, the myxomycete (acellular slime mold) Physarum polycephalum. It was demonstrated that the motor response is related to acceleration-dependent changes in the levels of the cellular second messenger cyclic adenosine monophosphate (cAMP). Rotating Physarum plasmodia in the gravity field of the Earth about a horizontal axis increased their cAMP concentration. Depriving the cells for a few days of the acceleration stimulus (near weightlessness in a space experiment on STS-69) slightly lowered plasmodial cAMP levels. Thus, the results provide first indications that the acceleration-stimulus signal transduction chain of Physarum uses an ubiquitous second messenger pathway.

  6. The cyclic AMP signaling pathway: Exploring targets for successful drug discovery (Review)

    PubMed Central

    YAN, KUO; GAO, LI-NA; CUI, YUAN-LU; ZHANG, YI; ZHOU, XIN

    2016-01-01

    During development of disease, complex intracellular signaling pathways regulate an intricate series of events, including resistance to external toxins, the secretion of cytokines and the production of pathological phenomena. Adenosine 3′,5′-cyclic monophosphate (cAMP) is a nucleotide that acts as a key second messenger in numerous signal transduction pathways. cAMP regulates various cellular functions, including cell growth and differentiation, gene transcription and protein expression. This review aimed to provide an understanding of the effects of the cAMP signaling pathway and the associated factors on disease occurrence and development by examining the information from a new perspective. These novel insights aimed to promote the development of novel therapeutic approaches and aid in the development of new drugs. PMID:27035868

  7. Effects of ethanol on cAMP production in murine embryonic palate mesenchymal cells

    SciTech Connect

    Weston, W.M.; Greene, R.M. )

    1991-01-01

    Ethanol affected the ability of murine embryonic palate mesenchymal (MEPM) cells to produce cAMP in response to hormone treatment. Acute exposure to ethanol resulted in an increase in hormone-stimulated cAMP levels, while chronic ethanol treatment led to decreased sensitivity to hormone. Forskolin-stimulated cAMP levels were decreased by both acute and chronic ethanol treatment, while the cells' response to cholera toxin was unchanged by ethanol treatment. The lack of sensitivity of the cholera toxin response to ethanol suggests that,in contrast to what has been observed in other systems, ethanol does not affect the production or activity of G{alpha}s in MEPM cells. These results suggest a possible explanation for the molecular basis for the craniofacial abnormalities observed in the fetal alcohol syndrome.

  8. Autoregulation of PhoP/PhoQ and positive regulation of the cyclic AMP receptor protein-cyclic AMP complex by PhoP in Yersinia pestis.

    PubMed

    Zhang, Yiquan; Wang, Li; Han, Yanping; Yan, Yanfeng; Tan, Yafang; Zhou, Lei; Cui, Yujun; Du, Zongmin; Wang, Xiaoyi; Bi, Yujing; Yang, Huiying; Song, Yajun; Zhang, Pingping; Zhou, Dongsheng; Yang, Ruifu

    2013-03-01

    Yersinia pestis is one of the most dangerous bacterial pathogens. PhoP and cyclic AMP receptor protein (CRP) are global regulators of Y. pestis, and they control two distinct regulons that contain multiple virulence-related genes. The PhoP regulator and its cognate sensor PhoQ constitute a two-component regulatory system. The regulatory activity of CRP is triggered only by binding to its cofactor cAMP, which is synthesized from ATP by adenylyl cyclase (encoded by cyaA). However, the association between the two regulatory systems PhoP/PhoQ and CRP-cAMP is still not understood for Y. pestis. In the present work, the four consecutive genes YPO1635, phoP, phoQ, and YPO1632 were found to constitute an operon, YPO1635-phoPQ-YPO1632, transcribed as a single primary RNA, whereas the last three genes comprised another operon, phoPQ-YPO1632, transcribed with two adjacent transcriptional starts. Through direct PhoP-target promoter association, the transcription of these two operons was stimulated and repressed by PhoP, respectively; thus, both positive autoregulation and negative autoregulation of PhoP/PhoQ were detected. In addition, PhoP acted as a direct transcriptional activator of crp and cyaA. The translational/transcriptional start sites, promoter -10 and -35 elements, PhoP sites, and PhoP box-like sequences were determined for these PhoP-dependent genes, providing a map of the PhoP-target promoter interaction. The CRP and PhoP regulons have evolved to merge into a single regulatory cascade in Y. pestis because of the direct regulatory association between PhoP/PhoQ and CRP-cAMP. PMID:23264579

  9. Xanthine effects on renal proximal tubular function and cyclic AMP metabolism.

    PubMed

    Coulson, R; Scheinman, S J

    1989-02-01

    We evaluated the renal effects of xanthines using two in vitro models: the isolated perfused rat kidney (IPRK) and cultured opossum kidney (OK) cells, a continuous cell line that resembles proximal tubule and responds to parathyroid hormone (PTH). 1,3-Diethyl-8-phenylxanthine (DPX) a potent adenosine receptor antagonist, increased urine volume, glomerular filtration rate, vascular resistance and the fractional excretions of Na, K, Ca and Pi in the IPRK. DPX lowered the Na-dependent uptake of Pi by OK cells. By comparison enprofylline, 3-propylxanthine (ENP), a weak adenosine receptor antagonist, produced a slight elevation in glomerular filtration rate but no changes in electrolyte excretion by IPRK or Pi uptake by OK cells. Both DPX and ENP produced negligible elevations in basal IPRK cAMP. A 1-nM bolus of PTH elevated urinary and perfusate cAMP 50- and 10-fold, respectively. PTH-elevated urinary and perfusate cAMP were augmented further 4- to 7-fold with DPX and 3- to 4-fold with ENP (All IPRK experiments used 50 microM xanthine). OK cells produced a 2-fold cAMP response to 10 nM PTH alone. OK cells treated with 50 microM DPX exhibited no increase in basal but a 13-fold increase in PTH-stimulated cell cAMP. The rank order of potency at 50 microM to augment OK cell cAMP with 10 nM PTH was DPX greater than 1,3-dipropyl-8-cyclopentylxanthine (DPC) greater than 1-methyl-3-isobutylxanthine greater than theobromine greater than theophylline greater than caffeine greater than ENP = no effect.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2537403

  10. Cyclic AMP Stimulates Neurite Outgrowth of Lamprey Reticulospinal Neurons without Substantially Altering Their Biophysical Properties

    PubMed Central

    Pale, Timothée; Frisch, Emily B.; McClellan, Andrew D.

    2013-01-01

    Reticulospinal (RS) neurons are critical for initiation of locomotor behavior, and following spinal cord injury (SCI) in the lamprey, the axons of these neurons regenerate and restore locomotor behavior within a few weeks. For lamprey RS neurons in culture, experimental induction of calcium influx, either in the growth cone or cell body, is inhibitory for neurite outgrowth. Following SCI, these neurons partially downregulate calcium channel expression, which would be expected to reduce calcium influx and possibly provide supportive conditions for axonal regeneration. In the present study, it was tested whether activation of second messenger signaling pathways stimulates neurite outgrowth of lamprey RS neurons without altering their electrical properties (e.g. spike broadening) so as to possibly increase calcium influx and compromise axonal growth. First, activation of cAMP pathways with forskolin or dbcAMP stimulated neurite outgrowth of RS neurons in culture in a PKA-dependent manner, while activation of cGMP signaling pathways with dbcGMP inhibited outgrowth. Second, neurophysiological recordings from uninjured RS neurons in isolated lamprey brain-spinal cord preparations indicated that dbcAMP or dbcGMP did not significantly affect any of the measured electrical properties. In contrast, for uninjured RS neurons, forskolin increased action potential duration, which might have increased calcium influx, but did not significantly affect most other electrical properties. Importantly, for injured RS neurons during the period of axonal regeneration, forskolin did not significantly alter their electrical properties. Taken together, these results suggest that activation of cAMP signaling by dbcAMP stimulates neurite outgrowth, but does not alter the electrical properties of lamprey RS neurons in such a way that would be expected to induce calcium influx. In conclusion, our results suggest that activation of cAMP pathways alone, without compensation for possible

  11. Structural Basis for the cAMP-dependent Gating in the Human HCN4 Channel

    SciTech Connect

    X Xu; Z Vysotskaya; Q Liu; L Zhou

    2011-12-31

    Hyperpolarization-activated cAMP-regulated (HCN) channels play important physiological roles in both cardiovascular and central nervous systems. Among the four HCN isoforms, HCN2 and HCN4 show high expression levels in the human heart, with HCN4 being the major cardiac isoform. The previously published crystal structure of the mouse HCN2 (mHCN2) C-terminal fragment, including the C-linker and the cyclic-nucleotide binding domain (CNBD), has provided many insights into cAMP-dependent gating in HCN channels. However, structures of other mammalian HCN channel isoforms have been lacking. Here we used a combination of approaches including structural biology, biochemistry, and electrophysiology to study cAMP-dependent gating in HCN4 channel. First we solved the crystal structure of the C-terminal fragment of human HCN4 (hHCN4) channel at 2.4 {angstrom}. Overall we observed a high similarity between mHCN2 and hHCN4 crystal structures. Functional comparison between two isoforms revealed that compared with mHCN2, the hHCN4 protein exhibited marked different contributions to channel function, such as a {approx}3-fold reduction in the response to cAMP. Guided by structural differences in the loop region between {beta}4 and {beta}5 strands, we identified residues that could partially account for the differences in response to cAMP between mHCN2 and hHCN4 proteins. Moreover, upon cAMP binding, the hHCN4 C-terminal protein exerts a much prolonged effect in channel deactivation that could have significant physiological contributions.

  12. Activation of AMP-Activated Protein Kinase by Interleukin-6 in Rat Skeletal Muscle

    PubMed Central

    Kelly, Meghan; Gauthier, Marie-Soleil; Saha, Asish K.; Ruderman, Neil B.

    2009-01-01

    OBJECTIVE Interleukin-6 (IL-6) directly activates AMP-activated protein kinase (AMPK) in vivo and in vitro; however, the mechanism by which it does so is unknown. RESEARCH DESIGN AND METHODS We examined this question in skeletal muscle using an incubated rat extensor digitorum longus (EDL) muscle preparation as a tool. RESULTS AMPK activation by IL-6 coincided temporally with a nearly threefold increase in the AMP:ATP ratio in the EDL. The effects of IL-6 on both AMPK activity and energy state were inhibited by coincubation with propranolol, suggesting involvement of β-adrenergic signaling. In keeping with this notion, IL-6 concurrently induced a transient increase in cAMP, and its ability to activate AMPK was blocked by the adenyl cyclase inhibitor 2′5′-dideoxyadenosine. In addition, like other β-adrenergic stimuli, IL-6 increased glycogen breakdown and lipolysis in the EDL. Similar effects of IL-6 on AMPK, energy state, and cAMP content were observed in C2C12 myotubes and gastrocnemius muscle in vivo, indicating that they were not unique to the incubated EDL. CONCLUSIONS These studies demonstrate that IL-6 activates AMPK in skeletal muscle by increasing the concentration of cAMP and, secondarily, the AMP:ATP ratio. They also suggest that substantial increases in IL-6 concentrations, such as those that can result from its synthesis by muscles during exercise, may play a role in the mobilization of fuel stores within skeletal muscle as an added means of restoring energy balance. PMID:19502419

  13. Effects of cholesterol depletion on compartmentalized cAMP responses in adult cardiac myocytes

    PubMed Central

    Agarwal, Shailesh R.; MacDougall, David A.; Tyser, Richard; Pugh, Sara D.; Calaghan, Sarah C.; Harvey, Robert D.

    2011-01-01

    β1-Adrenergic receptors (β1ARs) and E-type prostaglandin receptors (EPRs) both produce compartmentalized cAMP responses in cardiac myocytes. The role of cholesterol-dependent lipid rafts in producing these compartmentalized responses was investigated in adult rat ventricular myocytes. β1ARs were found in lipid raft and non-lipid raft containing membrane fractions, while EPRs were only found in non-lipid raft fractions. Furthermore, β1AR activation enhanced the L-type Ca2+ current, intracellular Ca2+ transient, and myocyte shortening, while EPR activation had no effect, consistent with the idea that these functional responses are regulated by cAMP produced by receptors found in lipid raft domains. Using methyl-β-cyclodextrin to disrupt lipid rafts by depleting membrane cholesterol did not eliminate compartmentalized behavior, but it did selectively alter specific receptor-mediated responses. Cholesterol depletion enhanced the sensitivity of functional responses produced by β1ARs without having any effect on EPR activation. Changes in cAMP activity were also measured in intact cells using two different FRET-based biosensors: a type II PKA-based probe to monitor cAMP in subcellular compartments that include microdomains associated with caveolar lipid rafts and a freely diffusible Epac2-based probe to monitor total cytosolic cAMP. β1AR and EPR activation elicited responses detected by both FRET probes. However, cholesterol depletion only affected β1AR responses detected by the PKA probe. These results indicate that lipid rafts alone are not sufficient to explain the difference between β1AR and EPR responses. They also suggest that β1AR regulation of myocyte contraction involves the local production of cAMP by a subpopulation of receptors associated with caveolar lipid rafts. PMID:21115018

  14. Alterations of cAMP-dependent signaling in dystrophic skeletal muscle

    PubMed Central

    Rudolf, Rüdiger; Khan, Muzamil M.; Lustrino, Danilo; Labeit, Siegfried; Kettelhut, Ísis C.; Navegantes, Luiz C. C.

    2013-01-01

    Autonomic regulation processes in striated muscles are largely mediated by cAMP/PKA-signaling. In order to achieve specificity of signaling its spatial-temporal compartmentation plays a critical role. We discuss here how specificity of cAMP/PKA-signaling can be achieved in skeletal muscle by spatio-temporal compartmentation. While a microdomain containing PKA type I in the region of the neuromuscular junction (NMJ) is important for postsynaptic, activity-dependent stabilization of the nicotinic acetylcholine receptor (AChR), PKA type I and II microdomains in the sarcomeric part of skeletal muscle are likely to play different roles, including the regulation of muscle homeostasis. These microdomains are due to specific A-kinase anchoring proteins, like rapsyn and myospryn. Importantly, recent evidence indicates that compartmentation of the cAMP/PKA-dependent signaling pathway and pharmacological activation of cAMP production are aberrant in different skeletal muscles disorders. Thus, we discuss here their potential as targets for palliative treatment of certain forms of dystrophy and myasthenia. Under physiological conditions, the neuropeptide, α-calcitonin-related peptide, as well as catecholamines are the most-mentioned natural triggers for activating cAMP/PKA signaling in skeletal muscle. While the precise domains and functions of these first messengers are still under investigation, agonists of β2-adrenoceptors clearly exhibit anabolic activity under normal conditions and reduce protein degradation during atrophic periods. Past and recent studies suggest direct sympathetic innervation of skeletal muscle fibers. In summary, the organization and roles of cAMP-dependent signaling in skeletal muscle are increasingly understood, revealing crucial functions in processes like nerve-muscle interaction and muscle trophicity. PMID:24146652

  15. Cyclic AMP-receptor proteins in heart muscle of rats flown on Cosmos 1887.

    PubMed

    Mednieks, M I; Popova, I A; Grindeland, R E

    1991-10-01

    A frequent cellular response to organismal stress is the increase in ligand binding by beta-adrenergic receptors. The extracellular signal is amplified by intracellular increases in cyclic AMP and the ensuing activation of cyclic AMP-dependent protein kinase (cAPK). The molecular mechanisms involve the binding of cyclic AMP to regulatory (R) subunits of cAPK, thus freeing the catalytic subunit for protein phosphorylation. This study was carried out to determine the cellular compartmentalization of the cyclic AMP-receptor proteins in heart ventricular tissue obtained from rats flown on the Cosmos 1887 mission. Photoaffinity labeling of soluble and particulate cell fractions with an [32P]-8-azido analog of cyclic AMP was followed by electrophoretic separation of the proteins and by autoradiographic identification of the labeled isoforms of cAPK R subunits. The results showed that RII in the particulate subcellular fraction was significantly decreased in heart cells from rats in the flight group when compared to controls. Protein banding patterns in both the cytoplasmic fraction and in a fraction enriched in chromatin-bound proteins showed some variability in tissues of individual animals, but exhibited no changes that could be directly attributed to flight conditions. No significant change was apparent in the distribution of RI or RII cyclic AMP binding in the soluble fractions. These findings indicate that the cardiac cell integrity or its protein content is not compromised under flight conditions. There is, however, what appears to be an adaptive molecular response which can be detected using microanalytical methods, indicating that a major hormone regulated mechanism may be affected during some phase of travel in space. PMID:1662483

  16. Regulation of chloride self exchange by cAMP in cortical collecting tubule

    SciTech Connect

    Tago, K.; Schuster, V.L.; Stokes, J.B.

    1986-07-01

    The hormonal control of Cl transport was examined in rabbit cortical collecting tubules using the lumen-to-bath /sup 36/Cl tracer rate coefficient (K/sub Cl/, nm/s). Tracer movement via Sl-HCO/sub 3/ exchange was minimized by using HCO/sub 3/-CO/sub 2/-free solutions. The electrical driving force was minimized by treating with amiloride. Under these conditions, net Cl transport was zero, yet there was a large K/sub Cl/ that fell 88% on removing bath (trans) Cl. These results are consistent with the mechanism of tracer flux being predominantly Cl self exchange. K/sub Cl/ fell spontaneously with time in vitro; after this decline K/sub Cl/ could be stimulated with 8-bromo-cAMP. cAMP present from the onset of perfusion prevented the time-dependent fall in K/sub Cl/. When tracer movement was restricted to diffusion by eliminating Cl self exchange (0 Cl bath), cAMP had no effect on K/sub Cl/. Although both isoproterenol and vasopressin are known to stimulate adenylate cyclase in this epithelium, only isoproterenol mimicked the cAMP effect on K/sub Cl/. The isoproterenol effect was blocked by either propranolol or prostaglandin E/sub 2/. Lumen addition of the disulfonic stilbene DIDS had no effect on K/sub Cl/. Lumen addition of furosemide or trichloromethiazide had minimal or no effect. Taken together, these results indicate that Cl self exchange is regulated by ..beta..-adrenergic agents acting via cAMP. The lack of an effect of vasopressin suggests cellular heterogeneity in this response to cAMP.

  17. Regulation of cAMP Intracellular Levels in Human Platelets Stimulated by 2-Arachidonoylglycerol.

    PubMed

    Signorello, Maria Grazia; Leoncini, Giuliana

    2016-05-01

    We demonstrated that in human platelets the endocannabinoid 2-arachidonoylglycerol (2-AG) decreased dose- and time-dependently cAMP intracellular levels. No effect on cAMP decrease induced by 2-AG was observed in the presence of the adenylate cyclase inhibitor SQ22536 as well in platelets pretreated with the thromboxane A2 receptor antagonist, SQ29548 or with aspirin, inhibitor of arachidonic acid metabolism through the cyclooxygenase pathway. An almost complete recovering of cAMP level was measured in platelets pretreated with the specific inhibitor of phosphodiesterase (PDE) 3A, milrinone. In platelets pretreated with LY294002 or MK2206, inhibitors of PI3K/AKT pathway, and with U73122, inhibitor of phospholipase C pathway, only a partial prevention was shown. cAMP intracellular level depends on synthesis by adenylate cyclase and hydrolysis by PDEs. In 2-AG-stimulated platelets adenylate cyclase activity seems to be unchanged. In contrast PDEs appear to be involved. In particular PDE3A was specifically activated, as milrinone reversed cAMP reduction by 2-AG. 2-AG enhanced PDE3A activity through its phosphorylation. The PI3K/AKT pathway and PKC participate to this PDE3A phosphorylation/activation mechanism as it was greatly inhibited by platelet pretreatment with LY294002, MK2206, U73122, or the PKC specific inhibitor GF109203X. Taken together these data suggest that 2-AG potentiates its power of platelet agonist reducing cAMP intracellular level. J. Cell. Biochem. 117: 1240-1249, 2016. © 2015 Wiley Periodicals, Inc. PMID:26460717

  18. Isolation of novel ribozymes that ligate AMP-activated RNA substrates

    NASA Technical Reports Server (NTRS)

    Hager, A. J.; Szostak, J. W.

    1997-01-01

    BACKGROUND: The protein enzymes RNA ligase and DNA ligase catalyze the ligation of nucleic acids via an adenosine-5'-5'-pyrophosphate 'capped' RNA or DNA intermediate. The activation of nucleic acid substrates by adenosine 5'-monophosphate (AMP) may be a vestige of 'RNA world' catalysis. AMP-activated ligation seems ideally suited for catalysis by ribozymes (RNA enzymes), because an RNA motif capable of tightly and specifically binding AMP has previously been isolated. RESULTS: We used in vitro selection and directed evolution to explore the ability of ribozymes to catalyze the template-directed ligation of AMP-activated RNAs. We subjected a pool of 10(15) RNA molecules, each consisting of long random sequences flanking a mutagenized adenosine triphosphate (ATP) aptamer, to ten rounds of in vitro selection, including three rounds involving mutagenic polymerase chain reaction. Selection was for the ligation of an oligonucleotide to the 5'-capped active pool RNA species. Many different ligase ribozymes were isolated; these ribozymes had rates of reaction up to 0.4 ligations per hour, corresponding to rate accelerations of approximately 5 x10(5) over the templated, but otherwise uncatalyzed, background reaction rate. Three characterized ribozymes catalyzed the formation of 3'-5'-phosphodiester bonds and were highly specific for activation by AMP at the ligation site. CONCLUSIONS: The existence of a new class of ligase ribozymes is consistent with the hypothesis that the unusual mechanism of the biological ligases resulted from a conservation of mechanism during an evolutionary replacement of a primordial ribozyme ligase by a more modern protein enzyme. The newly isolated ligase ribozymes may also provide a starting point for the isolation of ribozymes that catalyze the polymerization of AMP-activated oligonucleotides or mononucleotides, which might have been the prebiotic analogs of nucleoside triphosphates.

  19. Coronin 1 Regulates Cognition and Behavior through Modulation of cAMP/Protein Kinase A Signaling

    PubMed Central

    Zhang, Chun-Lei; Moshous, Despina; Studer, Vera; Schneider, Jacques; Genoud, Christel; Fossoud, Catherine; Gambino, Frédéric; Khelfaoui, Malik; Müller, Christian; Bartholdi, Deborah; Rossez, Helene; Stiess, Michael; Houbaert, Xander; Jaussi, Rolf; Frey, Daniel; Kammerer, Richard A.; Deupi, Xavier; de Villartay, Jean-Pierre; Lüthi, Andreas; Humeau, Yann; Pieters, Jean

    2014-01-01

    Cognitive and behavioral disorders are thought to be a result of neuronal dysfunction, but the underlying molecular defects remain largely unknown. An important signaling pathway involved in the regulation of neuronal function is the cyclic AMP/Protein kinase A pathway. We here show an essential role for coronin 1, which is encoded in a genomic region associated with neurobehavioral dysfunction, in the modulation of cyclic AMP/PKA signaling. We found that coronin 1 is specifically expressed in excitatory but not inhibitory neurons and that coronin 1 deficiency results in loss of excitatory synapses and severe neurobehavioral disabilities, including reduced anxiety, social deficits, increased aggression, and learning defects. Electrophysiological analysis of excitatory synaptic transmission in amygdala revealed that coronin 1 was essential for cyclic–AMP–protein kinase A–dependent presynaptic plasticity. We further show that upon cell surface stimulation, coronin 1 interacted with the G protein subtype Gαs to stimulate the cAMP/PKA pathway. The absence of coronin 1 or expression of coronin 1 mutants unable to interact with Gαs resulted in a marked reduction in cAMP signaling. Strikingly, synaptic plasticity and behavioral defects of coronin 1–deficient mice were restored by in vivo infusion of a membrane-permeable cAMP analogue. Together these results identify coronin 1 as being important for cognition and behavior through its activity in promoting cAMP/PKA-dependent synaptic plasticity and may open novel avenues for the dissection of signal transduction pathways involved in neurobehavioral processes. PMID:24667537

  20. Rolipram stimulates angiogenesis and attenuates neuronal apoptosis through the cAMP/cAMP-responsive element binding protein pathway following ischemic stroke in rats

    PubMed Central

    HU, SHOUYE; CAO, QINGWEN; XU, PENG; JI, WENCHEN; WANG, GANG; ZHANG, YUELIN

    2016-01-01

    Rolipram, a phosphodiesterase-4 inhibitor, can activate the cyclic adenosine monophosphate (cAMP)/cAMP-responsive element binding protein (CREB) pathway to facilitate functional recovery following ischemic stroke. However, to date, the effects of rolipram on angiogenesis and cerebral ischemia-induced neuronal apoptosis are yet to be fully elucidated. In this study, the aim was to reveal the effect of rolipram on the angiogenesis and neuronal apoptosis following brain cerebral ischemia. Rat models of ischemic stroke were established following transient middle cerebral artery occlusion and rolipram was administered for three, seven and 14 days. The results were examined using behavioral tests, triphenyl tetrazolium chloride staining, immunostaining and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) to evaluate the effects of rolipram therapy on functional outcome, angiogenesis and apoptosis. Western blot analysis was used to show the phosphorylated- (p-)CREB protein level in the ischemic hemisphere. The rolipram treatment group exhibited a marked reduction in infarct size and modified neurological severity score compared with the vehicle group, and rolipram treatment significantly promoted the microvessel density in the ischemic boundary region and increased p-CREB protein levels in the ischemic hemisphere. Furthermore, a significant reduction in the number of TUNEL-positive cells was observed in the rolipram group compared with the vehicle group. These findings suggest that rolipram has the ability to attenuate cerebral ischemic injury, stimulate angiogenesis and reduce neuronal apoptosis though the cAMP/CREB pathway. PMID:26998028

  1. Performance of the load-in-the-loop single Op-Amp voltage Controlled current source from the Op-Amp Parameters

    NASA Astrophysics Data System (ADS)

    Macías, R.; Seoane, F.; Bragós, R.

    2010-04-01

    In recent years, Electrical Bioimpedance (EBI) methods have gained importance. These methods are often based on obtaining impedance spectrum in the range of β-dispersion, i.e. from a few kHz up to some MHz. To measure EBI a constant current is often injected and the voltage across the tissue under study is recorded. Due to the performance of the current source influences the performance of the entire system, in terms of frequency range, several designs have been implemented and studied. In this paper the basic structure of a Voltage-Controlled Current Source based on a single Op-Amp in inverter configuration with a floating load, known as load-in-the-loop current source, is revisited and studied deeply. We focus on the dependence of the output impedance with the circuit parameters, i.e. the feedback resistor and the inverter-input resistor, and the Op-Amp main parameters, i.e. open loop gain, CMRR and input impedance. After obtaining the experimental results, using modern Op-Amps, and comparing to the theoretical and simulated ones, they confirm the design under study can be a good solution for multi-frequency wideband EBI applications because of higher values of the output impedance than 100kΩ at 1MHz are obtained. Furthermore, an enhancement of the basic design, using a current conveyor as a first stage, is proposed, studied and implemented.

  2. Advanced capacitors

    NASA Astrophysics Data System (ADS)

    Parker, R. D.; Buritz, R. S.; Taylor, A. R.; Bullwinkel, E. P.

    1982-11-01

    An experimental development program was conducted to develop and test advanced dielectric materials for capacitors for airborne power systems. High rep rate and low rate capacitors for use in pulse-forming networks, high voltage filter capacitors, and high frequency ac capacitors for series resonant inverters were considered. The initial goal was to develop an improved polysulfone film. Initially, low breakdown strength was thought to be related to inclusions of conductive particles. The effect of filtration of the casting solution was investigated. These experiments showed that more filtration was not the entire solution to low breakdown. The film samples were found to contain dissolved ionic impurities that move through the dielectric when voltage is applied and cause enhancement of the electric field. These contaminants enter the film via the resin and solvent, and can be partially removed. However, these treatments did not significantly improve the breakdown characteristics. A new material, Ultem, was proposed for use in high energy density capacitors. This new polyetherimide resin has properties similar to polysulfone and polyimide, with improvement in breakdown characteristics and temperature capability. The technique of casting films on a roughened drum was demonstrated, and found useful in preparing textured films. this is the first step toward a replacement for kraft paper.

  3. Advanced capacitors

    NASA Astrophysics Data System (ADS)

    Ennis, J. B.; Buritz, R. S.

    1984-10-01

    This report describes an experimental program to develop and test advanced dielectric materials for capacitors for airborne power systems. Five classes of capacitors were considered: high rep rate and low rep rate pulse capacitors for use in pulse-forming networks, high voltage filter capacitors, high frequency AC capacitors for series resonant inverters, and AC filter capacitors. To meet these requirements, existing dielectric materials were modified, and new materials were developed. The initial goal was to develop an improved polysulfone film with fewer imperfections that could operate at significantly higher electrical stresses. It was shown that contaminants enter the film via the resin and solvent, and that they can be partially removed. As far as developed, however, these treatments did not significantly improved the breakdown characteristics. The technique of casting films on a roughened drum was demonstrated, and found useful in preparing textured films -- the first step toward a replacement for Kraft paper. A new material, Ultem, was proposed for use in high energy density capacitors. This new polyetherimide resin has properties similar to polysulfone and polyimide, with improvement in breakdown characteristics and temperature capability. This material was selected for further study in model capacitor designs.

  4. Future advances.

    PubMed

    Celesia, Gastone G; Hickok, Gregory

    2015-01-01

    Future advances in the auditory systems are difficult to predict, and only educated guesses are possible. It is expected that innovative technologies in the field of neuroscience will be applied to the auditory system. Optogenetics, Brainbow, and CLARITY will improve our knowledge of the working of neural auditory networks and the relationship between sound and language, providing a dynamic picture of the brain in action. CLARITY makes brain tissue transparent and offers a three-dimensional view of neural networks, which, combined with genetically labeling neurons with multiple, distinct colors (Optogenetics), will provide detailed information of the complex brain system. Molecular functional magnetic resonance imaging (MRI) will allow the study of neurotransmitters detectable by MRI and their function in the auditory pathways. The Human Connectome project will study the patterns of distributed brain activity that underlie virtually all aspects of cognition and behavior and determine if abnormalities in the distributed patterns of activity may result in hearing and behavior disorders. Similarly, the programs of Big Brain and ENIGMA will improve our understanding of auditory disorders. New stem-cell therapy and gene therapies therapy may bring about a partial restoration of hearing for impaired patients by inducing regeneration of cochlear hair cells. PMID:25726297

  5. Amp-hour counting charge control for photovoltaic hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-10-01

    An amp-hour counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based photovoltaic hybrid charge controller. This work included extensive laboratory and field testing of the charge algorithm on vented lead-antimony and valve regulated lead-acid batteries. The test results have shown that with proper setup amp-hour counting charge control is more effective than conventional voltage regulated sub-array shedding in returning the lead-acid battery to a high state of charge.

  6. Catalytic roles of the AMP at the 3' end of tRNAs

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1994-01-01

    Recent reports suggest that the ribosome retains considerable peptidyl transferase activity even when much of the protein of the ribosome is removed and further suggests that rRNA may be the peptidyl transferase. The work here suggests that the AMP residue at the 3' terminus of each tRNA has some catalytic activity both in the esterification reaction and in forming a pseudopeptide, AcGly, and further suggests that whatever peptidyl transferase is, it finds a cooperative substrate in the aminoacyl-AMP at the 3' terminus of tRNA.

  7. Identification of a cAMP-dependent protein kinase in bovine and human follicular fluids.

    PubMed

    Yang, L S; Kadam, A L; Koide, S S

    1993-11-01

    A soluble protein kinase (PK) was purified from bovine and human follicular fluids (FF) by ultrafiltration through a PM-10 membrane followed by chromatography on heparin-agarose, DEAE-cellulose and cellulose phosphate columns. The PK phosphorylated calf thymus histones and endogenous FF proteins having estimated Mrs of 40, 62, 128 and 180 KD. cAMP enhanced PK activity; whereas protein kinase A (PKA)-inhibitor peptide blocked the activity. The present findings suggest that the enzyme is a cAMP-dependent PK. PMID:8118427

  8. The cAMP pathway and the control of adrenocortical development and growth

    PubMed Central

    de Joussineau, Cyrille; Sahut-Barnola, Isabelle; Levy, Isaac; Saloustros, Emmanouil; Val, Pierre; Stratakis, Constantine A.; Martinez, Antoine

    2013-01-01

    In the last 10 years, extensive studies showed that the cAMP pathway is deregulated in patients suffering from adrenocortical tumours, and particularly in primary pigmented nodular adrenocortical disease (PPNAD). Here we describe how evidence arising from the analysis of patients’ data, mouse models and in vitro experiments, have shed light on the cAMP pathway as a central player in adrenal physiopathology. We also show how novel data generated from mouse models may point to new targets for potential therapies. PMID:22019902

  9. Positive genetic feedback governs cAMP spiral wave formation in Dictyostelium.

    PubMed Central

    Levine, H; Aranson, I; Tsimring, L; Truong, T V

    1996-01-01

    The aggregation stage of the life cycle of Dictyostelium discoideum is governed by the chemotactic response of individual amoebae to excitable waves of cAMP. We modeled this process through a recently introduced hybrid automata-continuum scheme and used computer simulation to unravel the role of specific components of this complex developmental process. Our results indicated an essential role for positive feedback between the cAMP signaling and the expression of the genes encoding the signal transduction and response machinery. PMID:8692824

  10. Biophysical techniques for detection of cAMP and cGMP in living cells.

    PubMed

    Sprenger, Julia U; Nikolaev, Viacheslav O

    2013-01-01

    Cyclic nucleotides cAMP and cGMP are ubiquitous second messengers which regulate myriads of functions in virtually all eukaryotic cells. Their intracellular effects are often mediated via discrete subcellular signaling microdomains. In this review, we will discuss state-of-the-art techniques to measure cAMP and cGMP in biological samples with a particular focus on live cell imaging approaches, which allow their detection with high temporal and spatial resolution in living cells and tissues. Finally, we will describe how these techniques can be applied to the analysis of second messenger dynamics in subcellular signaling microdomains. PMID:23584022

  11. YC-1 potentiates cAMP-induced CREB activation and nitric oxide production in alveolar macrophages

    SciTech Connect

    Hwang, Tsong-Long; Tang, Ming-Chi; Kuo, Liang-Mou; Chang, Wen-De; Chung, Pei-Jen; Chang, Ya-Wen; Fang, Yao-Ching

    2012-04-15

    Alveolar macrophages play significant roles in the pathogenesis of several inflammatory lung diseases. Increases in exhaled nitric oxide (NO) are well documented to reflect disease severity in the airway. In this study, we investigated the effect of 3-(5′-hydroxymethyl-2′-furyl)-1-benzyl indazole (YC-1), a known activator of soluble guanylyl cyclase, on prostaglandin (PG)E{sub 1} (a stable PGE{sub 2} analogue) and forskolin (a adenylate cyclase activator) induced NO production and inducible NO synthase (iNOS) expression in rat alveolar macrophages (NR8383). YC-1 did not directly cause NO production or iNOS expression, but drastically potentiated PGE{sub 1}- or forskolin-induced NO production and iNOS expression in NR8383 alveolar macrophages. Combination treatment with YC-1 and PGE{sub 1} significantly increased phosphorylation of the cAMP response element-binding protein (CREB), but not nuclear factor (NF)-κB activation. The combined effect on NO production, iNOS expression, and CREB phosphorylation was reversed by a protein kinase (PK)A inhibitor (H89), suggesting that the potentiating functions were mediated through a cAMP/PKA signaling pathway. Consistent with this, cAMP analogues, but not the cGMP analogue, caused NO release, iNOS expression, and CREB activation. YC-1 treatment induced an increase in PGE{sub 1}-induced cAMP formation, which occurred through the inhibition of cAMP-specific phosphodiesterase (PDE) activity. Furthermore, the combination of rolipram (an inhibitor of PDE4), but not milronone (an inhibitor of PDE3), and PGE{sub 1} also triggered NO production and iNOS expression. In summary, YC-1 potentiates PGE{sub 1}-induced NO production and iNOS expression in alveolar macrophages through inhibition of cAMP PDE activity and activation of the cAMP/PKA/CREB signaling pathway. Highlights: ► YC-1 potentiated PGE1-induced iNOS expression in alveolar macrophages. ► The combination of YC-1 and PGE1 increased CREB but not NFκB activation.

  12. The 80 kV electrostatic wire septum for AmPS

    NASA Astrophysics Data System (ADS)

    Vanderlinden, A.; Bijleveld, J. H. M.; Rookhuizen, H. Boer; Bruinsma, P. J. T.; Heine, E.; Lassing, P.; Prins, E.

    The characteristics of the wire septum for the Amsterdam Pulse Stretcher (AmPS) are summarized. In the extraction process of the AmPS the extracted beam is intercepted from the circulating beam by the 1 m long electrostatic wire septum. For a bending angle of 4.4 mrad, the maximum anode voltage is 80 kV. The system developed consists of a wire spacing of 0.65 mm between tungsten wires of 50 micrometers diameter. Stainless steel spring wires, bent in a half cylindrical carrier, stretch the septum wires two by two. Prototype tests were successful up to an anode voltage of 120 kV.

  13. Advanced Light Source elliptical wiggler

    SciTech Connect

    Hoyer, E.; Akre, J.; Humphries, D.; Marks, S.; Minamihara, Y.; Pipersky, P.

    1994-07-01

    A 3.5m long elliptical wiggler, optimized to produce elliptically polarized light in the 50 eV to 10 keV range, is currently under design and construction at the Advanced Light Source (ALS) at Lawrence Berkeley Laboratory. Calculations of spectral performance show that the flux of circularly polarized photons exceeds 10{sup 13} photons/sec over the 50 eV to 10 keV operating range for current of 0.4 amps and 1.5 GeV electron energy. This device features vertical and horizontal magnetic structures of 14 and 14{1/2} periods respectively. The period length is 20.0 cm. The vertical structure is a hybrid permanent magnet design with tapered pole tips that produce a peak field of 2.0 T. The horizontal structure is an iron core electromagnetic design, shifted longitudinally {1/4} period, that is tucked between the upper and lower vertical magnetic structure sections. A maximum peak oscillating field of 0.095 T at a frequency up to 1 Hz will be achieved by excitation of the horizontal poles with a trapezoidal current waveform. The vacuum chamber is an unconventional design that is removable from the magnetic structure, after magnetic measurements, for UHV processing. The chamber is fabricated from non-magnetic stainless steel to minimize the effects of eddy currents. Device design is presented.

  14. Effects of nicorandil on the cAMP-dependent Cl- current in guinea-pig ventricular cells.

    PubMed

    Nishimura, Nami; Reien, Yoshie; Matsumoto, Akio; Ogura, Takehiko; Miyata, Yuuichi; Suzuki, Kazumasa; Nakazato, Yuji; Daida, Hiroyuki; Nakaya, Haruaki

    2010-01-01

    In guinea-pig cardiomyocytes, a cAMP-dependent Cl(-) current (I(Cl,cAMP)) flows through a cardiac isoform of the cystic fibrosis transmembrane conductance regulator (CFTR), which belongs to a family of the ATP-binding cassette (ABC) proteins. Although several K(+)-channel openers and sulfonylurea ATP-sensitive K(+) (K(ATP))-channel blockers reportedly inhibit I(Cl,cAMP), effects of nicorandil on the Cl(-) current have not been evaluated. This study was conducted to examine the effects of nicorandil on I(Cl,cAMP) in isolated guinea-pig ventricular cells using patch clamp techniques. Nicorandil in concentrations higher than 300 microM enhanced the I(Cl,cAMP) preactivated by 0.1 microM isoproterenol. The isoproterenol-induced I(Cl,cAMP) was inhibited by 100 microM glibenclamide, but not by 100 microM pinacidil. SNAP (S-nitroso-N-acetyl-D,L-penicillamine, 10 microM), a nitric oxide (NO) donor, similarly enhanced the isoproterenol-induced I(Cl,cAMP). However, SG-86, a denitrated metabolite possessing K(+ )channel-opening action, failed to enhance the Cl(-) current. When the I(Cl,cAMP) was activated by 3-isobutyl-1-methylxanthine (IBMX, 30 microM), either nicorandil or SNAP failed to enhance the isoproterenol-induced I(Cl,cAMP). Thus, nicorandil enhances I(Cl,cAMP) in guinea-pig cardiomyocytes through an increase in intracellular cGMP, although direct modulation of I(Cl,cAMP) by NO cannot be completely excluded. PMID:20308804

  15. An HD-domain phosphodiesterase mediates cooperative hydrolysis of c-di-AMP to affect bacterial growth and virulence

    PubMed Central

    Huynh, TuAnh Ngoc; Luo, Shukun; Pensinger, Daniel; Sauer, John-Demian; Tong, Liang; Woodward, Joshua J.

    2015-01-01

    The nucleotide cyclic di-3′,5′- adenosine monophosphate (c-di-AMP) was recently identified as an essential and widespread second messenger in bacterial signaling. Among c-di-AMP–producing bacteria, altered nucleotide levels result in several physiological defects and attenuated virulence. Thus, a detailed molecular understanding of c-di-AMP metabolism is of both fundamental and practical interest. Currently, c-di-AMP degradation is recognized solely among DHH-DHHA1 domain-containing phosphodiesterases. Using chemical proteomics, we identified the Listeria monocytogenes protein PgpH as a molecular target of c-di-AMP. Biochemical and structural studies revealed that the PgpH His-Asp (HD) domain bound c-di-AMP with high affinity and specifically hydrolyzed this nucleotide to 5′-pApA. PgpH hydrolysis activity was inhibited by ppGpp, indicating a cross-talk between c-di-AMP signaling and the stringent response. Genetic analyses supported coordinated regulation of c-di-AMP levels in and out of the host. Intriguingly, a L. monocytogenes mutant that lacks c-di-AMP phosphodiesterases exhibited elevated c-di-AMP levels, hyperinduced a host type-I IFN response, and was significantly attenuated for infection. Furthermore, PgpH homologs, which belong to the 7TMR-HD family, are widespread among hundreds of c-di-AMP synthesizing microorganisms. Thus, PgpH represents a broadly conserved class of c-di-AMP phosphodiesterase with possibly other physiological functions in this crucial signaling network. PMID:25583510

  16. Intracellular signaling in the regulation of renal Na-K-ATPase. I. Role of cyclic AMP and phospholipase A2.

    PubMed Central

    Satoh, T; Cohen, H T; Katz, A I

    1992-01-01

    We have reported that dopamine (DA) inhibits Na-K-ATPase activity in the cortical collecting duct (CCD) by stimulating the DA1 receptor, and the present study was designed to evaluate the mechanism of this effect. Short-term exposure (15-30 min) of microdissected rat CCD to DA, a DA1 agonist (fenoldopam), vasopressin (AVP), forskolin, or dibutyryl cAMP (dBcAMP), which increase cAMP content by different mechanisms, strongly (approximately 60%) inhibited Na-K-ATPase activity. 2',5'-dideoxyadenosine, an inhibitor of adenylate cyclase, completely blocked Na-K-ATPase inhibition by DA or fenoldopam, and IP20, an inhibitor peptide of cAMP-dependent protein kinase A (PKA), abolished the Na:K pump effect of all the cAMP agonists listed above. To verify whether the mechanism of pump inhibition by agents that increase cell cAMP involves phospholipase A2 (PLA2), we used mepacrine, a PLA2 inhibitor, which also abolished Na-K-ATPase inhibition by DA or fenoldopam, as well as by AVP, forskolin, or dBcAMP. Arachidonic acid (10(-7) - 10(-4) M) inhibited Na-K-ATPase activity in dose-dependent fashion. Corticosterone, which induces lipomodulin, a PLA2 inhibitor protein inactivated by PKA, equally abolished the pump effects of DA, fenoldopam, forskolin, and dBcAMP, suggesting that lipomodulin might act between PKA and PLA2 in cAMP-dependent pump regulation. We conclude that dopamine inhibits Na-K-ATPase activity in the CCD through a DA1 receptor-mediated cAMP-PKA pathway that involves the stimulation of PLA2 and arachidonic acid release, possibly mediated by inactivation of lipomodulin. This pathway is shared by other agonists that increase cell cAMP and thus stimulate PKA activity. PMID:1349027

  17. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.

    PubMed

    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D

    1994-09-01

    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  18. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  19. Crystallization and preliminary X-ray diffraction of the DEAD-box protein Mss116p complexed with an RNA oligonucleotide and AMP-PNP

    PubMed Central

    Del Campo, Mark; Lambowitz, Alan M.

    2009-01-01

    The Saccharomyces cerevisiae DEAD-box protein Mss116p is a general RNA chaperone which functions in mitochondrial group I and group II intron splicing, translation and RNA-end processing. For crystallization trials, full-length Mss116p and a C-terminally truncated protein (Mss116p/Δ598–664) were overproduced in Escherichia coli and purified to homogeneity. Mss116p exhibited low solubility in standard solutions (≤1 mg ml−1), but its solubility could be increased by adding 50 mM l-arginine plus 50 mM l-glutamate and 50% glycerol to achieve concentrations of ∼10 mg ml−1. Initial crystals were obtained by the microbatch method in the presence of a U10 RNA oligonucleotide and the ATP analog AMP-PNP and were then improved by using seeding and sitting-drop vapor diffusion. A cryocooled crystal of Mss116p/Δ598–664 in complex with AMP-PNP and U10 belonged to space group P21212, with unit-cell parameters a = 88.54, b = 126.52, c = 55.52 Å, and diffracted X-rays to beyond 1.9 Å resolution using synchrotron radiation from sector 21 at the Advanced Photon Source. PMID:19652352

  20. Crystallization and preliminary X-ray diffraction of the DEAD-box protein Mss116p complexed with an RNA oligonucleotide and AMP-PNP

    SciTech Connect

    Del Campo, Mark; Lambowitz, Alan M.

    2009-09-02

    The Saccharomyces cerevisiae DEAD-box protein Mss116p is a general RNA chaperone which functions in mitochondrial group I and group II intron splicing, translation and RNA-end processing. For crystallization trials, full-length Mss116p and a C-terminally truncated protein (Mss116p/{Delta}598-664) were overproduced in Escherichia coli and purified to homogeneity. Mss116p exhibited low solubility in standard solutions ({le}1 mg ml{sup -1}), but its solubility could be increased by adding 50 mM L-arginine plus 50 mM L-glutamate and 50% glycerol to achieve concentrations of {approx}10 mg ml{sup -1}. Initial crystals were obtained by the microbatch method in the presence of a U{sub 10} RNA oligonucleotide and the ATP analog AMP-PNP and were then improved by using seeding and sitting-drop vapor diffusion. A cryocooled crystal of Mss116p/{Delta}598-664 in complex with AMP-PNP and U{sub 10} belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 88.54, b = 126.52, c = 55.52 {angstrom}, and diffracted X-rays to beyond 1.9 {angstrom} resolution using synchrotron radiation from sector 21 at the Advanced Photon Source.

  1. New perspectives in signaling mediated by receptors coupled to stimulatory G protein: the emerging significance of cAMP efflux and extracellular cAMP-adenosine pathway

    PubMed Central

    Godinho, Rosely O.; Duarte, Thiago; Pacini, Enio S. A.

    2015-01-01

    G protein-coupled receptors (GPCRs) linked to stimulatory G (Gs) proteins (GsPCRs) mediate increases in intracellular cyclic AMP as consequence of activation of nine adenylyl cyclases , which differ considerably in their cellular distribution and activation mechanisms. Once produced, cyclic AMP may act via distinct intracellular signaling effectors such as protein kinase A and the exchange proteins activated by cAMP (Epacs). More recently, attention has been focused on the efflux of cAMP through a specific transport system named multidrug resistance proteins that belongs to the ATP-binding cassette transporter superfamily. Outside the cell, cAMP is metabolized into adenosine, which is able to activate four distinct subtypes of adenosine receptors, members of the GPCR family: A1, A2A, A2B, and A3. Taking into account that this phenomenon occurs in numerous cell types, as consequence of GsPCR activation and increment in intracellular cAMP levels, in this review, we will discuss the impact of cAMP efflux and the extracellular cAMP-adenosine pathway on the regulation of GsPCR-induced cell response. PMID:25859216

  2. Application of AirCell Cellular AMPS Network and Iridium Satellite System Dual Mode Service to Air Traffic Management

    NASA Technical Reports Server (NTRS)

    Shamma, Mohammed A.

    2004-01-01

    The AirCell/Iridium dual mode service is evaluated for potential applications to Air Traffic Management (ATM) communication needs. The AirCell system which is largely based on the Advanced Mobile Phone System (AMPS) technology, and the Iridium FDMA/TDMA system largely based on the Global System for Mobile Communications(GSM) technology, can both provide communication relief for existing or future aeronautical communication links. Both have a potential to serve as experimental platforms for future technologies via a cost effective approach. The two systems are well established in the entire CONUS and globally hence making it feasible to utilize in all regions, for all altitudes, and all classes of aircraft. Both systems have been certified for air usage. The paper summarizes the specifications of the AirCell/Iridium system, as well as the ATM current and future links, and application specifications. the paper highlights the scenarios, applications, and conditions under which the AirCell/Iridium technology can be suited for ATM Communication.

  3. Expression and activity of the 5'-AMP-activated protein kinase pathway in selected tissues during chicken embryonic development.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 5’-AMP-activated protein kinase (AMPK) is a highly conserved serine/threonine protein kinase and a key part of a kinase signaling cascade that senses cellular energy status (AMP/ATP ratio) and acts to maintain energy homeostasis by coordinately regulating energy-consuming and energy-generating m...

  4. AMP-activated Protein Kinase Is Activated as a Consequence of Lipolysis in the Adipocyte

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is activated in adipocytes during exercise and other states in which lipolysis is stimulated. However, the mechanism(s) responsible for this effect and its physiological relevance are unclear. To examine these questions, 3T3-L1 adipocytes were treated with agents...

  5. Amp C beta-lactamase-producing Escherichia coli in neonatal meningitis: diagnostic and therapeutic challenge.

    PubMed

    Fakioglu, E; Queenan, A M; Bush, K; Jenkins, S G; Herold, B C

    2006-08-01

    Antibiotic resistance is a global health priority. Major defenses for Gram-negative bacteria are beta-lactamase enzymes, which have co-evolved with the development and increasing utilization of new antibiotics. Bacteria harboring the plasmid-mediated AmpC enzymes are increasingly prevalent among adult patients, but have not previously been reported in neonates. Early-onset neonatal meningitis caused by an AmpC beta-lactamase-producing Escherichia coli is described for the first time; the plasmid was identified as a transferable CMY-2 family beta-lactamase. Limited experience with newer antibiotics and pharmacokinetics in neonates presents a therapeutic challenge. Currently, there are no Clinical Laboratory Standards Institute (CLSI) recommendations for detecting AmpC nor is the optimal treatment for AmpC-producing organisms known. Thus, it is imperative that clinicians have a high index of suspicion when antimicrobial susceptibility patterns are inconsistent. Development of better microbiology screening tests to rapidly detect resistance is essential. Additionally, pharmacokinetic studies with newer antibiotics in neonates are warranted. PMID:16871223

  6. A Method for Mouse Pancreatic Islet Isolation and Intracellular cAMP Determination

    PubMed Central

    Neuman, Joshua C.; Truchan, Nathan A.; Joseph, Jamie W.; Kimple, Michelle E.

    2014-01-01

    Uncontrolled glycemia is a hallmark of diabetes mellitus and promotes morbidities like neuropathy, nephropathy, and retinopathy. With the increasing prevalence of diabetes, both immune-mediated type 1 and obesity-linked type 2, studies aimed at delineating diabetes pathophysiology and therapeutic mechanisms are of critical importance. The β-cells of the pancreatic islets of Langerhans are responsible for appropriately secreting insulin in response to elevated blood glucose concentrations. In addition to glucose and other nutrients, the β-cells are also stimulated by specific hormones, termed incretins, which are secreted from the gut in response to a meal and act on β-cell receptors that increase the production of intracellular cyclic adenosine monophosphate (cAMP). Decreased β-cell function, mass, and incretin responsiveness are well-understood to contribute to the pathophysiology of type 2 diabetes, and are also being increasingly linked with type 1 diabetes. The present mouse islet isolation and cAMP determination protocol can be a tool to help delineate mechanisms promoting disease progression and therapeutic interventions, particularly those that are mediated by the incretin receptors or related receptors that act through modulation of intracellular cAMP production. While only cAMP measurements will be described, the described islet isolation protocol creates a clean preparation that also allows for many other downstream applications, including glucose stimulated insulin secretion, [3H]-thymidine incorporation, protein abundance, and mRNA expression. PMID:24998772

  7. A method for mouse pancreatic islet isolation and intracellular cAMP determination.

    PubMed

    Neuman, Joshua C; Truchan, Nathan A; Joseph, Jamie W; Kimple, Michelle E

    2014-01-01

    Uncontrolled glycemia is a hallmark of diabetes mellitus and promotes morbidities like neuropathy, nephropathy, and retinopathy. With the increasing prevalence of diabetes, both immune-mediated type 1 and obesity-linked type 2, studies aimed at delineating diabetes pathophysiology and therapeutic mechanisms are of critical importance. The β-cells of the pancreatic islets of Langerhans are responsible for appropriately secreting insulin in response to elevated blood glucose concentrations. In addition to glucose and other nutrients, the β-cells are also stimulated by specific hormones, termed incretins, which are secreted from the gut in response to a meal and act on β-cell receptors that increase the production of intracellular cyclic adenosine monophosphate (cAMP). Decreased β-cell function, mass, and incretin responsiveness are well-understood to contribute to the pathophysiology of type 2 diabetes, and are also being increasingly linked with type 1 diabetes. The present mouse islet isolation and cAMP determination protocol can be a tool to help delineate mechanisms promoting disease progression and therapeutic interventions, particularly those that are mediated by the incretin receptors or related receptors that act through modulation of intracellular cAMP production. While only cAMP measurements will be described, the described islet isolation protocol creates a clean preparation that also allows for many other downstream applications, including glucose stimulated insulin secretion, [3(H)]-thymidine incorporation, protein abundance, and mRNA expression. PMID:24998772

  8. Effect of saucerneol D on melanin production in cAMP-elevated melanocytes.

    PubMed

    Yun, Ji Young; Roh, Eunmiri; Son, Jong-Keun; Lee, Seung Ho; Seo, Chang-Seob; Hwang, Bang Yeon; Han, Sang-Bae; Kim, Youngsoo

    2011-08-01

    Intracellular cAMP stimulates microphthalmia-associated transcription factor (MITF) induction in melanocytes through cAMP-responsive element binding protein (CREB), which plays a pivotal role in the gene expression of tyrosinase for melanin biosynthesis. In the present study, saucerneol D as a lignan constituent of Saururus chinensis (Saururaceae family) efficiently inhibited melanin production with IC(50) values of 188-297 nM in B16 melanoma cells stimulated with α-melanocyte stimulating hormone (α-MSH) or other cAMP elevators. Moreover, saucerneol D down-regulated α-MSH-induced gene expression of tyrosinase at the transcription level in B16 cells, but it did not directly inhibit the catalytic activity of cell-free tyrosinase. As to the molecular basis of hypopigmenting action, saucerneol D inhibited α-MSH-induced phosphorylation of CREB in the cells, and sequentially suppressed MITF induction. Taken together, this study provides saucerneol D down-regulated the gene expression of tyrosinase, resulting in the inhibition of cAMP-induced melanin biosynthesis, and suggests pharmacological potential of the lignan structure in skin hyperpigmentation. PMID:21910056

  9. STIMULATION OF MUSCLE PROTEIN SYNTHESIS BY GLUCOSE IN NEONATES IS AMP KINASE INDEPENDENT

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Muscle protein synthesis is elevated in the neonate, in part due to an elevated response to the rise in amino acids and insulin after a meal. Recent evidence suggests that glucose may also play a role in the regulation of protein synthesis. AMP kinase has been recognized as an energy sensor and a ...

  10. Multiple protein kinase A-regulated events are required for transcriptional induction by cAMP.

    PubMed Central

    Brindle, P; Nakajima, T; Montminy, M

    1995-01-01

    The second messenger cAMP stimulates the expression of numerous genes via the protein kinase A-mediated phosphorylation of the cAMP response element-binding protein (CREB) at Ser-133. Ser-133 phosphorylation, in turn, appears to induce target gene expression by promoting interaction between CREB and CBP, a 265-kDa nuclear phospho-CREB-binding protein. It is unclear, however, whether Ser-133 phosphorylation per se is sufficient for CREB-CBP complex formation and for target gene induction in vivo. Here we examine CREB activity in Jurkat T cells after stimulation of the T-cell receptor (TCR), an event that leads to calcium entry and diacylglycerol production. Triggering of the TCR stimulated Ser-133 phosphorylation of CREB with high stoichiometry, but TCR activation did not promote CREB-CBP complex formation or target gene induction unless suboptimal doses of cAMP agonist were provided as a costimulus. Our results demonstrate that, in addition to mediating Ser-133 phosphorylation of CREB, protein kinase A regulates additional proteins that are required for recruitment of the transcriptional apparatus to cAMP-responsive genes. Images Fig. 1 Fig. 2 Fig. 3 PMID:7479832

  11. Self-incompatibility involved in the level of acetylcholine and cAMP.

    PubMed

    Tezuka, Takafumi; Akita, Isamu; Yoshino, Natsuko

    2007-11-01

    Elongation of pollen tubes in pistils after self-pollination of Lilium longiflorum cv. Hinomoto exhibiting strong gametophytic self-incompatibility was promoted by cAMP and also promoted by some metabolic modulators, namely, activators (forskolin and cholera toxin) of adenylate cyclase and inhibitors (3-isobutyl-1-methylxanthine and pertussis) of cyclic nucleotide phosphodiesterase. Moreover, the elongation was promoted by acetylcholine (ACh) and other choline derivatives, such as acetylthiocholine, L-alpha-phosphatidylcholine and chlorocholinechloride [CCC; (2-chloroethyl) trimethyl ammonium chloride]. A potent inhibitor (neostigmine) of acetylcholinesterase (AChE) as well as acetylcholine also promoted the elongation. cAMP enhanced choline acetyltransferase (ChAT) activity and suppressed AChE activity in the pistils, suggesting that the results are closely correlated with self-incompatibility in L. longiflorum. In short, it came to light that cAMP modulates ChAT (acetylcholine-forming enzyme) and AChE (acetylchoine-decomposing enzyme) activities to enhance the level of ACh in the pistils of L. logiflorum after self-incompatible pollination. These results indicate that the self-incompatibility on self-pollination is caused by low levels of ACh and/or cAMP. PMID:19704589

  12. Comparison of Total Dose Effects on Micropower Op-Amps: Bipolar and CMOS

    NASA Technical Reports Server (NTRS)

    Lee, C.; Johnston, A.

    1998-01-01

    This paper compares low-paper op-amps, OPA241 (bipolar) and OPA336 (CMOS), from Burr-Brown, MAX473 (bipolar) and MAX409 (CMOS), characterizing their total dose response with a single 2.7V power supply voltage.

  13. Cyclic AMP-dependent Protein Lysine Acylation in Mycobacteria Regulates Fatty Acid and Propionate Metabolism*

    PubMed Central

    Nambi, Subhalaxmi; Gupta, Kallol; Bhattacharyya, Moitrayee; Ramakrishnan, Parvathy; Ravikumar, Vaishnavi; Siddiqui, Nida; Thomas, Ann Terene; Visweswariah, Sandhya S.

    2013-01-01

    Acetylation of lysine residues is a posttranslational modification that is used by both eukaryotes and prokaryotes to regulate a variety of biological processes. Here we identify multiple substrates for the cAMP-dependent protein lysine acetyltransferase from Mycobacterium tuberculosis (KATmt). We demonstrate that a catalytically important lysine residue in a number of FadD (fatty acyl CoA synthetase) enzymes is acetylated by KATmt in a cAMP-dependent manner and that acetylation inhibits the activity of FadD enzymes. A sirtuin-like enzyme can deacetylate multiple FadDs, thus completing the regulatory cycle. Using a strain deleted for the KATmt ortholog in Mycobacterium bovis Bacillus Calmette-Guérin (BCG), we show for the first time that acetylation is dependent on intracellular cAMP levels. KATmt can utilize propionyl CoA as a substrate and, therefore, plays a critical role in alleviating propionyl CoA toxicity in mycobacteria by inactivating acyl CoA synthetase (ACS). The precision by which mycobacteria can regulate the metabolism of fatty acids in a cAMP-dependent manner appears to be unparalleled in other biological organisms and is ideally suited to adapt to the complex environment that pathogenic mycobacteria experience in the host. PMID:23553634

  14. Control of phosphofructokinase from rat skeletal muscle. Effects of fructose diphosphate, AMP, ATP, and citrate.

    PubMed

    Tornheim, K; Lowenstein, J M

    1976-12-10

    Under conditions used previously for demonstrating glycolytic oscillations in muscle extracts (pH 6.65, 0.1 to 0.5 mM ATP), phosphofructokinase from rat skeletal muscle is strongly activated by micromolar concentrations of fructose diphosphate. The activation is dependent on the presence of AMP. Activation by fructose diphosphate and AMP, and inhibition by ATP, is primarily due to large changes in the apparent affinity of the enzyme for the substrate fructose 6-phosphate. These control properties can account for the generation of glycolytic oscillations. The enzyme was also studied under conditions approximating the metabolite contents of skeletal muscle in vivo (pH 7.0, 10mM ATP, 0.1 mM fructose 6-phosphate). Under these more inhibitory conditions, phosphofructokinase is strongly activated by low concentrations of fructose diphosphate, with half-maximal activation at about 10 muM. Citrate is a potent inhibitor at physiological concentrations, whereas AMP is a strong activator. Both AMP and citrate affect the maximum velocity and have little effect on affinity of the enzyme for fructose diphosphate. PMID:12161

  15. Dendritic geometry shapes neuronal cAMP signalling to the nucleus

    PubMed Central

    Li, Lu; Gervasi, Nicolas; Girault, Jean-Antoine

    2015-01-01

    Neurons have complex dendritic trees, receiving numerous inputs at various distances from the cell body. Yet the rules of molecular signal propagation from dendrites to nuclei are unknown. DARPP-32 is a phosphorylation-regulated signalling hub in striatal output neurons. We combine diffusion-reaction modelling and live imaging to investigate cAMP-activated DARPP-32 signalling to the nucleus. The model predicts maximal effects on the nucleus of cAMP production in secondary dendrites, due to segmental decrease of dendrite diameter. Variations in branching, perikaryon size or spines have less pronounced effects. Biosensor kinase activity measurement following cAMP or dopamine uncaging confirms these predictions. Histone 3 phosphorylation, regulated by this pathway, is best stimulated by cAMP released in secondary-like dendrites. Thus, unexpectedly, the efficacy of diffusion-based signalling from dendrites to nucleus is not inversely proportional to the distance. We suggest a general mechanism by which dendritic geometry counterbalances the effect of dendritic distance for signalling to the nucleus. PMID:25692798

  16. The relationship between cAMP, Ca(2)+, and transport of CFTR to the plasma membrane.

    PubMed

    Chen, P; Hwang, T C; Gillis, K D

    2001-08-01

    The mechanism whereby cAMP stimulates Cl(-) flux through CFTR ion channels in secretory epithelia remains controversial. It is generally accepted that phosphorylation by cAMP-dependent protein kinase increases the open probability of the CFTR channel. A more controversial hypothesis is that cAMP triggers the translocation of CFTR from an intracellular pool to the cell surface. We have monitored membrane turnover in Calu-3 cells, a cell line derived from human airway submucosal glands that expresses high levels of CFTR using membrane capacitance and FM1-43 fluorescence measurements. Using a conventional capacitance measurement technique, we observe an apparent increase in membrane capacitance in most cells that exhibit an increase in Cl(-) current. However, after we carefully correct our recordings for changes in membrane conductance, the apparent changes in capacitance are eliminated. Measurements using the fluorescent membrane marker FM1-43 also indicate that no changes in membrane turnover accompany the activation of CFTR. Robust membrane insertion can be triggered with photorelease of caged Ca(2)+ in Calu-3 cells. However, no increase in Cl(-) current accompanies Ca(2)+-evoked membrane fusion. We conclude that neither increases in cAMP or Ca(2)+ lead to transport of CFTR to the plasma membrane in Calu-3 cells. In addition, we conclude that membrane capacitance measurements must be interpreted with caution when large changes in membrane conductance occur. PMID:11479341

  17. Opiates inhibit ion conductances elicited by cell swelling and cAMP in cultured cells.

    PubMed

    Callaghan, R; Riordan, J R

    1995-10-15

    The effect of several opiate compounds on I- efflux was investigated in cultured cell lines. I- efflux was evoked by two distinct stimuli, namely cell swelling and elevation of cellular cAMP levels by prostaglandin E2. Cells expressing the multidrug resistance P-glycoprotein were found to have increased I- efflux in response to hypo-osmotic challenge. This increased I- efflux in P-glycoprotein containing cells was reduced to levels found in parental cells by the opiates morphine, pentazocine and naloxone. Addition of prostaglandin E2 to T84 cells resulted in elevated cellular cAMP levels and a significant I- efflux. This cAMP stimulated efflux was also inhibited by several opiates. None of the opiates was able to alter cAMP levels or protein kinase A mediated phosphorylation of immunoprecipitated cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel in T84 cells. The ability of opiates to alter ion conductances is discussed in relation to the anti-diarrheal effects of these compounds. PMID:8566169

  18. cAMP stimulation of HCO3- secretion across airway epithelia.

    PubMed

    Welsh, M J; Smith, J J

    2001-07-01

    To test for the presence of HCO(3)(-) transport across airway epithelia, we measured short-circuit current in primary cultures of canine and human airway epithelia bathed in a Cl(-)-free, HCO(3)(-)/CO(2)-buffered solution. cAMP agonists stimulated a secretory current that was likely carried by HCO(3)(-) because it was absent in HCO(3)(-)-free solutions. In addition, the cAMP-stimulated current was inhibited by the carbonic anhydrase inhibitor, acetazolamide, and by the apical addition of a blocker of cystic fibrosis transmembrane conductance regulator (CFTR), diphenylamine-2-carboxylate. The current was dependent on Na(+) because it was inhibited by removing Na(+) from the submucosal solution and by inhibition of the Na(+)-K(+)-ATPase with ouabain. The cAMP-stimulated current was absent in cystic fibrosis (CF) airway epithelia. These data suggest that cAMP agonists can stimulate HCO(3)(-) secretion across airway epithelia and that CFTR may provide a conductive pathway for HCO(3)(-) movement across the apical membrane. PMID:11875274

  19. Calcitonin Induces Expression of the Inducible cAMP Early Repressor in Osteoclasts

    PubMed Central

    Yang, Maobin; Kream, Barbara E.

    2010-01-01

    The cAMP response element modulator gene (Crem) encodes a variety of transcriptional regulators including the inducible cAMP early repressor, ICER. We previously showed that Crem knockout mice, which are deficient in CREM and ICER factors, display slightly increased long bone mass and decreased osteoclast number. These data are consistent with the notion that Crem regulates bone mass in part through an effect on osteoclast formation and/or function. Since ICER is strongly induced by cAMP, we asked whether the calcium-regulating hormone calcitonin, which stimulates cAMP production and inhibits osteoclastic bone resorption, could induce ICER in osteoclasts. The monocytic cell line RAW264.7 was treated with receptor activator of NF-κB ligand (RANKL) to induce osteoclast formation. Calcitonin caused a time- and dose-dependent induction of ICER mRNA and an increase in ICER protein abundance in RANKL-treated RAW264.7 cells. Calcitonin also induced ICER mRNA and protein in osteoclasts derived from primary mouse bone marrow cell cultures. Calcitonin-treated osteoclasts showed immunoreactivity with an anti-CREM antibody. Calcitonin decreased the activity of wild type and Crem knockout osteoclasts in vitro, and this inhibitory effect was greater in Crem knockout osteoclasts. Furthermore, calcitonin decreased calcitonin receptor mRNA expression in wild type osteoclasts but not in Crem knockout osteoclasts. These data suggest that calcitonin induction of ICER in osteoclasts might regulate osteoclast activity. PMID:19016003

  20. Engineering of a red-light–activated human cAMP/cGMP-specific phosphodiesterase

    PubMed Central

    Gasser, Carlos; Taiber, Sandra; Yeh, Chen-Min; Wittig, Charlotte Helene; Hegemann, Peter; Ryu, Soojin; Wunder, Frank; Möglich, Andreas

    2014-01-01

    Sensory photoreceptors elicit vital physiological adaptations in response to incident light. As light-regulated actuators, photoreceptors underpin optogenetics, which denotes the noninvasive, reversible, and spatiotemporally precise perturbation by light of living cells and organisms. Of particular versatility, naturally occurring photoactivated adenylate cyclases promote the synthesis of the second messenger cAMP under blue light. Here, we have engineered a light-activated phosphodiesterase (LAPD) with complementary light sensitivity and catalytic activity by recombining the photosensor module of Deinococcus radiodurans bacterial phytochrome with the effector module of Homo sapiens phosphodiesterase 2A. Upon red-light absorption, LAPD up-regulates hydrolysis of cAMP and cGMP by up to sixfold, whereas far-red light can be used to down-regulate activity. LAPD also mediates light-activated cAMP and cGMP hydrolysis in eukaryotic cell cultures and in zebrafish embryos; crucially, the biliverdin chromophore of LAPD is available endogenously and does not need to be provided exogenously. LAPD thus establishes a new optogenetic modality that permits light control over diverse cAMP/cGMP-mediated physiological processes. Because red light penetrates tissue more deeply than light of shorter wavelengths, LAPD appears particularly attractive for studies in living organisms. PMID:24889611

  1. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 5: Technical summary

    NASA Technical Reports Server (NTRS)

    1976-01-01

    Engineering and operational facets associated with the implementation of the first two AMPS flights are covered. The payload is described including all systems and subsystems and the mission planning and flight operations are described too. Payload integration, ground operations, and logistics are included along with key supporting analyses and mass properties.

  2. Ampère force exerted by geomagnetic Sq currents and thermospheric pressure difference

    NASA Astrophysics Data System (ADS)

    Takeda, Masahiko

    2015-05-01

    The Ampère force exerted by meridional Sq currents was estimated, and its relationship with a neutral pressure difference was examined. It was found that the annual Ampère force correlates very well with the difference between its maximum and minimum pressures integrated above 120 km for solar activity variation. Furthermore, these two values were almost the same around the Sq current vortex during the equinox. This means that the pressure difference balances with Ampère force, and thus, a neutral wind blows roughly in the opposite direction of the pressure gradient. As a result, the intensity of the resultant ionospheric dynamo current is controlled by the pressure difference, and thus, it is possible to infer the pressure difference from the geomagnetic field only at least the annual mean in equinox. At Kakioka, there was seasonal variation such that the pressure difference in the local summer and winter was smaller and larger than the Ampère force, respectively. This characteristic is likely due to the contribution of the interhemispheric field-aligned currents driven by the ionospheric dynamo to the Sq field.

  3. H2S induces vasoconstriction of rat cerebral arteries via cAMP/adenylyl cyclase pathway.

    PubMed

    Li, Sen; Ping, Na-Na; Cao, Lei; Mi, Yan-Ni; Cao, Yong-Xiao

    2015-12-15

    Hydrogen sulfide (H2S), traditionally known for its toxic effects, is now involved in regulating vascular tone. Here we investigated the vasoconstrictive effect of H2S on cerebral artery and the underlying mechanism. Sodium hydrosulfide (NaHS), a donor of H2S, concentration-dependently induced vasoconstriction on basilar artery, which was enhanced in the presence of isoprenaline, a β-adrenoceptor agonist or forskolin, an adenylyl cyclase activator. Administration of NaHS attenuated the vasorelaxant effects of isoprenaline or forskolin. Meanwhile, the NaHS-induced vasoconstriction was diminished in the presence of 8B-cAMP, an analog of cAMP, but was not affected by Bay K-8644, a selective L-type Ca(2+) channel agonist. These results could be explained by the revised effects of NaHS on isoprenaline-induced cAMP elevation and forskolin-stimulated adenylyl cyclase activity. Additionally, NaHS-induced vasoconstriction was enhanced by removing the endothelium or in the presence of L-NAME, an inhibitor of nitric oxide synthase. L-NAME only partially attenuated the effect of NaHS which was given together with forskolin on the pre-contracted artery. In conclusion, H2S induces vasoconstriction of cerebral artery via, at least in part, cAMP/adenylyl cyclase pathway. PMID:26524654

  4. Localized cyclic AMP-dependent protein kinase activity is required for myogenic cell fusion

    SciTech Connect

    Mukai, Atsushi; Hashimoto, Naohiro

    2008-01-15

    Multinucleated myotubes are formed by fusion of mononucleated myogenic progenitor cells (myoblasts) during terminal skeletal muscle differentiation. In addition, myoblasts fuse with myotubes, but terminally differentiated myotubes have not been shown to fuse with each other. We show here that an adenylate cyclase activator, forskolin, and other reagents that elevate intracellular cyclic AMP (cAMP) levels induced cell fusion between small bipolar myotubes in vitro. Then an extra-large myotube, designated a 'myosheet,' was produced by both primary and established mouse myogenic cells. Myotube-to-myotube fusion always occurred between the leading edge of lamellipodia at the polar end of one myotube and the lateral plasma membrane of the other. Forskolin enhanced the formation of lamellipodia where cAMP-dependent protein kinase (PKA) was accumulated. Blocking enzymatic activity or anchoring of PKA suppressed forskolin-enhanced lamellipodium formation and prevented fusion of multinucleated myotubes. Localized PKA activity was also required for fusion of mononucleated myoblasts. The present results suggest that localized PKA plays a pivotal role in the early steps of myogenic cell fusion, such as cell-to-cell contact/recognition through lamellipodium formation. Furthermore, the localized cAMP-PKA pathway might be involved in the specification of the fusion-competent areas of the plasma membrane in lamellipodia of myogenic cells.

  5. Cyclic AMP-and beta-agonist-activated chloride conductance of a toad skin epithelium.

    PubMed

    Willumsen, N J; Vestergaard, L; Larsen, E H

    1992-04-01

    1. The control by intracellular cyclic AMP and beta-adrenergic stimulation of chloride conductance was studied in toad skin epithelium mounted in a chamber on the stage of an upright microscope. Impalement of identified principal cells from the serosal side with single-barrelled conventional or double-barrelled Cl(-)-sensitive microelectrodes was performed at x500 magnification. For blocking the active sodium current 50 microM-amiloride was present in the mucosal bath. 2. When clamped at transepithelial potential difference V = 0 mV, the preparations generated clamping currents of 0.9 +/- 1 microA/cm2 (mean +/- S.E.M.; number of observations n = 55). The intracellular potential of principal cells (Vb) was -96 +/- 2 mV with a fractional resistance of the basolateral membrane (fRb) of 0.016 +/- 0.003 (n = 54), and an intracellular Cl- activity of 40 +/- 2 mM (n = 24). 3. At V = 0 mV, serosal application of a cyclic AMP analogue, dibutyryl cyclic AMP (500 microM) or a beta-adrenergic agonist, isoprenaline (5 microM) resulted in a sixfold increase in transepithelial Cl- conductance identified by standard 36Cl- tracer technique. 4. The clamping current at V = 0 mV was unaffected by cyclic AMP (short-circuit current Isc = 0.1 +/- 0.3 microA/cm2, n = 16) indicating that subepidermal Cl(-)-secreting glands are not functioning in our preparations obtained by collagenase treatment. 5. Cyclic AMP- or isoprenaline-induced chloride conductance (Gcl) activation (V = 0 mV) was not reflected in membrane potential and intracellular Cl- activity in principal cells. Intracellular chloride activity was constant at approximately 40 mM at membrane potentials between -90 and -100 mV. Therefore, it can be concluded that the principal cells are not contributing to activated Cl- currents. 6. At V = -100 mV where the voltage-dependent chloride conductance of mitochondria-rich (MR) cells was already fully activated, GCl was unaffected by cyclic AMP or isoprenaline. The major effect of these

  6. Forskolin and derivatives as tools for studying the role of cAMP.

    PubMed

    Alasbahi, R H; Melzig, M F

    2012-01-01

    Forskolin (7beta-acetoxy-1alpha,6beta,9alpha-trihydroxy-8,13-epoxy-labd-14-en-11-one) is the first main labdane diterpenoid isolated from the roots of the Indian Plectranthus barbatus ANDREWS and one of the most extensively studied constituents of this plant. The unique character of forskolin as a general direct, rapid and reversible activator of adenylyl cyclase not only underlies its wide range of pharmacological effects but also renders it as a valuable tool in the study of the role of cAMP. The purpose of this review is to provide data presenting the utility of forskolin--as a cAMP activator--for studying the function of cAMP from different biological viewpoints as follows: 1) Investigation on the role of cAMP in various cellular processes in different organs such as gastrointestinal tract, respiratory tract, reproductive organs, endocrine system, urinary system, olfactory system, nervous system, platelet aggregating system, skin, bones, eyes, and smooth muscles. 2) Studies on the role of cAMP activation and inhibition to understand the pathogenesis (e.g. thyroid autoimmune disorders, leukocyte signal transduction defect in depression, acute malaria infection, secretory dysfunction in inflammatory diseases) as well as its possibly beneficial role for curing diseases such as the regulation of coronary microvascular NO production after heart failure, the attenuation of the development or progression of fibrosis in the heart and lungs, the augmentation of myo-protective effects of ischemic preconditioning especially in the failing hearts after myocardial infarction, the stimulation of the regeneration of injured retinal ganglion cells, the curing of glaucoma and inflammatory diseases, the reducing of cyst formation early in the polycystic kidney disease, and the management of autoimmune disorders by enhancing Fas-mediated apoptosis. 3) Studies on the role of cAMP in the mechanism of actions of a number of drugs and substances such as the effect of the

  7. Astrocyte arachidonate and palmitate uptake and metabolism is differentially modulated by dibutyryl-cAMP treatment.

    PubMed

    Seeger, D R; Murphy, C C; Murphy, E J

    2016-07-01

    Astrocytes play a vital role in brain lipid metabolism; however the impact of the phenotypic shift in astrocytes to a reactive state on arachidonic acid metabolism is unknown. Therefore, we determined the impact of dibutyryl-cAMP (dBcAMP) treatment on radiolabeled arachidonic acid ([1-(14)C]20:4n-6) and palmitic acid ([1-(14)C]16:0) uptake and metabolism in primary cultured murine cortical astrocytes. In dBcAMP treated astrocytes, total [1-(14)C]20:4n-6 uptake was increased 1.9-fold compared to control, while total [1-(14)C]16:0 uptake was unaffected. Gene expression of long-chain acyl-CoA synthetases (Acsl), acyl-CoA hydrolase (Acot7), fatty acid binding protein(s) (Fabp) and alpha-synuclein (Snca) were determined using qRT-PCR. dBcAMP treatment increased expression of Acsl3 (4.8-fold) and Acsl4 (1.3-fold), which preferentially use [1-(14)C]20:4n-6 and are highly expressed in astrocytes, consistent with the increase in [1-(14)C]20:4n-6 uptake. However, expression of Fabp5 and Fabp7 were significantly reduced by 25% and 45%, respectively. Acot7 (20%) was also reduced, suggesting dBcAMP treatment favors acyl-CoA formation. dBcAMP treatment enhanced [1-(14)C]20:4n-6 (2.2-fold) and [1-(14)C]16:0 (1.6-fold) esterification into total phospholipids, but the greater esterification of [1-(14)C]20:4n-6 is consistent with the observed uptake through increased Acsl, but not Fabp expression. Although total [1-(14)C]16:0 uptake was not affected, there was a dramatic decrease in [1-(14)C]16:0 in the free fatty acid pool as esterification into the phospholipid pool was increased, which is consistent with the increase in Acsl3 and Acsl4 expression. In summary, our data demonstrates that dBcAMP treatment increases [1-(14)C]20:4n-6 uptake in astrocytes and this increase appears to be due to increased expression of Acsl3 and Acsl4 coupled with a reduction in Acot7 expression. PMID:27255639

  8. Structural Insights into the Mechanism of the Allosteric Transitions of Mycobacterium tuberculosis cAMP Receptor Protein

    SciTech Connect

    Reddy, Manchi C.M.; Palaninathan, Satheesh K.; Bruning, John B.; Thurman, Cory; Smith, Danielle; Sacchettini, James C.

    2010-02-11

    The cAMP receptor protein (CRP) from Mycobacterium tuberculosis is a cAMP-responsive global transcriptional regulator, responsible for the regulation of a multitude of diverse proteins. We have determined the crystal structures of the CRP {center_dot} cAMP and CRP {center_dot} N{sup 6}-cAMP derivative-bound forms of the enzyme to 2.2- and 2.3 {angstrom}-resolution, respectively, to investigate cAMP-mediated conformational and structural changes. The allosteric switch from the open, inactive conformation to the closed, active conformation begins with a number of changes in the ligand-binding cavity upon cAMP binding. These subtle structural changes and numerous non-bonding interactions between cAMP, the N-domain residues, and the C-domain helices demonstrate that the N-domain hairpin loop acts as a structural mediator of the allosteric switch. Based on the CRP {center_dot} N{sup 6}-cAMP crystal structure, binding of N{sup 6}-cAMP with a bulkier methylphenylethyl extension from the N{sup 6} atom stabilizes the cAMP-binding domain, N-domain hairpin, and C-terminal domain in a similar manner as that of the CRP {center_dot} cAMP structure, maintaining structural integrity within the subunits. However, the bulkier N{sup 6} extension of N{sup 6}-cAMP (in R conformation) is accommodated only in subunit A with minor changes, whereas in subunit B, the N{sup 6} extension is in the S conformation hindering the hinge region of the central helix. As a result, the entire N-domain and the C-domain of subunit B integrated by the cAMP portion of this ligand, together tilt away ({approx}7{sup o} tilt) from central helix C, positioning the helix-turn-helix motif in an unfavorable position for the DNA substrate, asymmetrically. Together, these crystal structures demonstrate the mechanism of action of the cAMP molecule and its role in integrating the active CRP structure.

  9. Structural insights into Cn-AMP1, a short disulfide-free multifunctional peptide from green coconut water.

    PubMed

    Santana, Mábio J; de Oliveira, Aline L; Queiroz Júnior, Luiz H K; Mandal, Santi M; Matos, Carolina O; Dias, Renata de O; Franco, Octavio L; Lião, Luciano M

    2015-02-27

    Multifunctional and promiscuous antimicrobial peptides (AMPs) can be used as an efficient strategy to control pathogens. However, little is known about the structural properties of plant promiscuous AMPs without disulfide bonds. CD and NMR were used to elucidate the structure of the promiscuous peptide Cn-AMP1, a disulfide-free peptide isolated from green coconut water. Data here reported shows that peptide structure is transitory and could be different according to the micro-environment. In this regard, Cn-AMP1 showed a random coil in a water environment and an α-helical structure in the presence of SDS-d25 micelles. Moreover, deuterium exchange experiments showed that Gly4, Arg5 and Met9 residues are less accessible to solvent, suggesting that flexibility and cationic charges seem to be essential for Cn-AMP1 multiple activities. PMID:25639464

  10. Characterization of ESBL- and AmpC-Producing Enterobacteriaceae from Diseased Companion Animals in Europe.

    PubMed

    Bogaerts, Pierre; Huang, Te-Din; Bouchahrouf, Warda; Bauraing, Caroline; Berhin, Catherine; El Garch, Farid; Glupczynski, Youri

    2015-12-01

    The study aimed to characterize beta-lactam resistance mechanisms of Enterobacteriaceae isolates recovered from diseased dogs and cats between 2008 and 2010 in a European surveillance program (ComPath I) for the antibiotic susceptibility of bacterial pathogens. A total of 608 non-duplicated Enterobacteriaceae isolates were obtained prior antibiotic treatment from diseased dogs (n=464) and cats (n=144). Among the 608 Enterobacteriaceae isolates, 22 presented a minimal inhibitory concentration against cefotaxime above EUCAST breakpoints of susceptibility. All the 22 isolates remained susceptible to carbapenems. Ten isolates were confirmed as extended-spectrum-beta-lactamase (ESBL) producers by PCR-sequencing of bla coding genes including 9 blaCTX-M (CTX-M-1, 14, 15, 32,…) and 1 blaTEM-52 and 12 were AmpC-producing isolates (10 plasmidic CMY-2 group and 2 isolates overexpressing their chromosomal AmpC). ESBLs and plasmid-mediated AmpC (pAmpC)-producing isolates were mainly recovered from dogs (n=17) suffering from urinary tract infections (n=13) and originated from eight different countries. ESBL-bearing plasmids were mostly associated with IncFII incompatibility groups while CMY-2 was predominantly associated with plasmid of the IncI1 group. ESBL/pAmpC-producing Escherichia coli belonged to phylogroup A (n=5), B2 (n=4), and D (n=5). Multilocus sequence typing analysis revealed that among three CTX-M-15-producing E. coli, two belong to sequence type (ST) 131 and one to ST405. The presence of CTX-M-15 including on IncFII plasmids in E. coli ST131-B2 has also been described in isolates of human origin. This suggests the possibility of exchanges of these isolates from humans to companion animals or vice-versa. PMID:26098354

  11. Muscarinic receptor stimulation and cyclic AMP-dependent effects in guinea-pig ventricular myocardium.

    PubMed Central

    Schmied, R.; Korth, M.

    1990-01-01

    1. The effect of carbachol on force of contraction, contraction duration, intracellular Na+ activity and cyclic AMP content was studied in papillary muscles of the guinea-pig exposed to isoprenaline or the phosphodiesterase inhibitor 3-isobutyl, 1-methyl xanthine (IBMX). The preparations were obtained from reserpine-pretreated animals and were electrically driven at a frequency of 0.2 Hz. 2. Isoprenaline (10 nM) and IBMX (100 microM) produced comparable positive inotropic effects of 9.8 and 9.7 mN, respectively. Carbachol (3 microM) attenuated the inotropic effects by 82% (isoprenaline) and by 79% (IBMX). The shortening of contraction duration which accompanied the positive inotropic effect of isoprenaline (by 14.9%) and of IBMX (by 22.4%) was not significantly affected by 3 microM carbachol. 3. The positive inotropic effect of 10 nM isoprenaline and of 100 microM IBMX was accompanied by an increase in cellular cyclic AMP content of 58 and 114%, respectively. Carbachol (3 microM) failed to reduce significantly the elevated cyclic AMP content of muscles exposed to either isoprenaline or IBMX. 4. In the quiescent papillary muscle, isoprenaline (10 nM) and IBMX (100 microM) reduced the intracellular Na+ activity by 28 and 17%, respectively. This decline was not influenced by the additional application of 3 microM carbachol. 5. The results demonstrate that muscarinic antagonism in guinea-pig ventricular myocardium exposed to cyclic AMP-elevating drugs is restricted to force of contraction. The underlying mechanism does not apparently involve the cytosolic signal molecule cyclic AMP. PMID:1691677

  12. Terrestrial exposure and effects of Headline AMP(®) Fungicide on amphibians.

    PubMed

    Cusaac, J Patrick W; Mimbs, William H; Belden, Jason B; Smith, Loren M; McMurry, Scott T

    2015-08-01

    Recent studies have demonstrated that a pyraclostrobin-containing fungicide (Headline(®) Fungicide--Headline(®) Fungicide and Headline AMP(®) Fungicide are registered trademarks of BASF) is toxic to amphibians at environmentally relevant concentrations. However, these studies were performed in a laboratory setting of a worst-case direct exposure in clean media. Interception of spray by the crop canopy and ground cover used by animals for security cover will influence exposure. Thus, risk to amphibians is unclear in an environmentally realistic field environment. We tested exposure and toxicity of Headline AMP(®) Fungicide to amphibians in multiple agricultural habitat scenarios (e.g., within treated crop vs. grassy areas adjacent to crop) and at two rates during routine aerial application. Specifically, we placed Woodhouse's toads (Bufo woodhousii) and Blanchard's cricket frogs (Acris blanchardi) in enclosures located within treated and untreated corn (VT stage, approximate height = 3 m), and in the potential drift area (adjacent to treated corn) during aerial application of Headline AMP Fungicide at either 731 or 1052 ml/ha (70 and 100 % the maximum application rate in corn, respectively). Mean concentrations of pyraclostrobin measured at ground level were ≤19 % of nominal application rate in all areas. Overall, mean mortality of recovered individuals of both species was ≤15 %, and mortality within Headline AMP Fungicide-treated corn (where risk was anticipated to be highest) was <10 %. It is important to understand that application timing, interception by the crop canopy (which varies both within and between crop systems), and timing of amphibian presence in the crop field influences risk of exposure and effects; however, our results demonstrate that amphibians inhabiting VT stage corn during routine aerial application of Headline AMP Fungicide are at low risk for acute mortality, matching existing laboratory results from acute toxicity studies of

  13. Emission of ESBL/AmpC-producing Escherichia coli from pig fattening farms to surrounding areas.

    PubMed

    von Salviati, Christina; Laube, Henriette; Guerra, Beatriz; Roesler, Uwe; Friese, Anika

    2015-01-30

    The presence of ESBL/AmpC-producing Escherichia coli in livestock such as pigs has been known for some time. However, to date there is little information about the transmission of these resistant bacteria between pig farms and their surroundings. Thus, the aim of this study was to explore this topic by investigating seven German pig fattening farms. Samples from outside (including ground surfaces, ambient air, slurry and digestate from biogas plants) and, in parallel, from inside the pig barns (including pig feces, dust, barn air, flies and mice feces) were examined for ESBL/AmpC-producing E. coli and selected isolates were compared by pulsed-field gel electrophoresis (PFGE) analysis. 14/17 (82.4%) slurry samples and three of four samples of digestate from biogas plants tested positive for ESBL/AmpC-producing E. coli. In the vicinity of the pig barns these resistant bacteria were detected in 14/87 (16.1%) boot swabs taken from various ground surfaces and in 2/36 (6%) ambient air samples. Inside the pig barns, 6/63 (9.5%) barn air samples and a small proportion of flies and mice feces samples were ESBL/AmpC-positive. PFGE analysis proved fecal emission as well as a possible spread via flies, as identical ESBL-E. coli isolates were detected in slurry and on fertilized fields, as well as in flies and pooled feces from inside the barn and slurry. Contaminated slurry presented the major emission source for ESBL/AmpC-producing E. coli in the pig fattening farms, but a spread via the airborne route or via different vectors also seems possible. PMID:25465658

  14. Cyclic AMP-induced K+ secretion occurs independently of Cl- secretion in rat distal colon.

    PubMed

    Sandle, Geoffrey I; Rajendran, Vazhaikkurichi M

    2012-08-01

    cAMP induces both active Cl(-) and active K(+) secretion in mammalian colon. It is generally assumed that a mechanism for K(+) exit is essential to maintain cells in the hyperpolarized state, thus favoring a sustained Cl(-) secretion. Both Kcnn4c and Kcnma1 channels are located in colon, and this study addressed the questions of whether Kcnn4c and/or Kcnma1 channels mediate cAMP-induced K(+) secretion and whether cAMP-induced K(+) secretion provides the driving force for Cl(-) secretion. Forskolin (FSK)-enhanced short-circuit current (indicator of net electrogenic ion transport) and K(+) fluxes were measured simultaneously in colonic mucosa under voltage-clamp conditions. Mucosal Na(+) orthovanadate (P-type ATPase inhibitor) inhibited active K(+) absorption normally present in rat distal colon. In the presence of mucosal Na(+) orthovanadate, serosal FSK induced both K(+) and Cl(-) secretion. FSK-induced K(+) secretion was 1) not inhibited by either mucosal or serosal 1-[(2-chlorophenyl) diphenylmethyl]-1H-pyrazole (TRAM-34; a Kcnn4 channel blocker), 2) inhibited (92%) by mucosal iberiotoxin (Kcnma1 channel blocker), and 3) not affected by mucosal cystic fibrosis transmembrane conductance regulator inhibitor (CFTR(inh)-172). By contrast, FSK-induced Cl(-) secretion was 1) completely inhibited by serosal TRAM-34, 2) not inhibited by either mucosal or serosal iberiotoxin, and 3) completely inhibited by mucosal CFTR(inh)-172. These results indicate that cAMP-induced colonic K(+) secretion is mediated via Kcnma1 channels located in the apical membrane and most likely contributes to stool K(+) losses in secretory diarrhea. On the other hand, cAMP-induced colonic Cl(-) secretion requires the activity of Kcnn4b channels located in the basolateral membrane and is not dependent on the concurrent activation of apical Kcnma1 channels. PMID:22648950

  15. Repurposing cAMP-Modulating Medications to Promote β-Cell Replication

    PubMed Central

    Zhao, Zhenshan; Low, Yen S.; Armstrong, Neali A.; Ryu, Jennifer Hyoje; Sun, Sara A.; Arvanites, Anthony C.; Hollister-Lock, Jennifer; Shah, Nigam H.; Weir, Gordon C.

    2014-01-01

    Loss of β-cell mass is a cardinal feature of diabetes. Consequently, developing medications to promote β-cell regeneration is a priority. cAMP is an intracellular second messenger that modulates β-cell replication. We investigated whether medications that increase cAMP stability or synthesis selectively stimulate β-cell growth. To identify cAMP-stabilizing medications that promote β-cell replication, we performed high-content screening of a phosphodiesterase (PDE) inhibitor library. PDE3, -4, and -10 inhibitors, including dipyridamole, were found to promote β-cell replication in an adenosine receptor-dependent manner. Dipyridamole's action is specific for β-cells and not α-cells. Next we demonstrated that norepinephrine (NE), a physiologic suppressor of cAMP synthesis in β-cells, impairs β-cell replication via activation of α2-adrenergic receptors. Accordingly, mirtazapine, an α2-adrenergic receptor antagonist and antidepressant, prevents NE-dependent suppression of β-cell replication. Interestingly, NE's growth-suppressive effect is modulated by endogenously expressed catecholamine-inactivating enzymes (catechol-O-methyltransferase and l-monoamine oxidase) and is dominant over the growth-promoting effects of PDE inhibitors. Treatment with dipyridamole and/or mirtazapine promote β-cell replication in mice, and treatment with dipyridamole is associated with reduced glucose levels in humans. This work provides new mechanistic insights into cAMP-dependent growth regulation of β-cells and highlights the potential of commonly prescribed medications to influence β-cell growth. PMID:25083741

  16. The Hippo pathway mediates inhibition of vascular smooth muscle cell proliferation by cAMP

    PubMed Central

    Kimura, Tomomi E.; Duggirala, Aparna; Smith, Madeleine C.; White, Stephen; Sala-Newby, Graciela B.; Newby, Andrew C.; Bond, Mark

    2016-01-01

    Aims Inhibition of vascular smooth muscle cell (VSMC) proliferation by intracellular cAMP prevents excessive neointima formation and hence angioplasty restenosis and vein-graft failure. These protective effects are mediated via actin-cytoskeleton remodelling and subsequent regulation of gene expression by mechanisms that are incompletely understood. Here we investigated the role of components of the growth-regulatory Hippo pathway, specifically the transcription factor TEAD and its co-factors YAP and TAZ in VSMC. Methods and results Elevation of cAMP using forskolin, dibutyryl-cAMP or the physiological agonists, Cicaprost or adenosine, significantly increased phosphorylation and nuclear export YAP and TAZ and inhibited TEAD-luciferase report gene activity. Similar effects were obtained by inhibiting RhoA activity with C3-transferase, its downstream kinase, ROCK, with Y27632, or actin-polymerisation with Latrunculin-B. Conversely, expression of constitutively-active RhoA reversed the inhibitory effects of forskolin on TEAD-luciferase. Forskolin significantly inhibited the mRNA expression of the pro-mitogenic genes, CCN1, CTGF, c-MYC and TGFB2 and this was reversed by expression of constitutively-active YAP or TAZ phospho-mutants. Inhibition of YAP and TAZ function with RNAi or Verteporfin significantly reduced VSMC proliferation. Furthermore, the anti-mitogenic effects of forskolin were reversed by overexpression of constitutively-active YAP or TAZ. Conclusion Taken together, these data demonstrate that cAMP-induced actin-cytoskeleton remodelling inhibits YAP/TAZ–TEAD dependent expression of pro-mitogenic genes in VSMC. This mechanism contributes novel insight into the anti-mitogenic effects of cAMP in VSMC and suggests a new target for intervention. PMID:26625714

  17. Inhibition of carbonic anhydrase by parathyroid hormone and cyclic AMP in rat renal cortex in vitro.

    PubMed Central

    Beck, N; Kim, K S; Wolak, M; Davis, B B

    1975-01-01

    It has been demonstrated that parathyroid hormone (PTH) inhibits the proximal tubular reabsorption of bicarbonate, and increases the urinary excretion of that ion. There is also a qualitative similarity between the alterations of the proximal tubular reabsorption of phosphate, sodium, and water after PTH administration and after acetazolamide administration. These findings suggest that the renal effect of PTH is possibly mediated through the inhibition of carbonic anhydrase in proximal tubules. Therefore, a possible inhibitory effect of PTH on carbonic anhydrase was evaluated in the homogenate of rat renal cortex by an indicator titration method. Incubation of cortical homogenates with PTH for 10 min at 37degreesC inhibited carbonic anhydrase activity. The inhibitory effect of PTH was ATP-, Mg++-, and K+-dependent and temperature-dependent; inactivation of PTH by heating at 100degreesC abolished the effect of PTH both to activate adenylate cyclase and to inhibit carbonic anhydrase. Calcium 5 mM also partially abolished effects of PTH to activate adenylate cyclase and to inhibit carbonic anhydrase. The inhibitory effect of PTH on carbonic anhydrase was specific to renal cortex. Cyclic AMP, the intracellular messenger substance for PTH, also inhibited carbonic anhydrase in renal cortex. The cyclic AMP-induced inhibition was also Mg++ dependent and temperature dependent, and required preincubation at 37degreesC. But 5'-AMP, a metabolic derivative of cyclic AMP without its biological effect, had no inhibitory effect on carbonic anhydrase. All the above results are consistent with the hypothesis that PTH inhibits proximal tubular reabsorption of bicarbonate and phosphate through the inhibition of carbonic anhydrase, and that inhibitory effect is mediated through the cyclic AMP system. PMID:233968

  18. ABCC5 is required for cAMP-mediated hindgut invagination in sea urchin embryos.

    PubMed

    Shipp, Lauren E; Hill, Rose Z; Moy, Gary W; Gökırmak, Tufan; Hamdoun, Amro

    2015-10-15

    ATP-binding cassette (ABC) transporters are evolutionarily conserved proteins that pump diverse substrates across membranes. Many are known to efflux signaling molecules and are extensively expressed during development. However, the role of transporters in moving extracellular signals that regulate embryogenesis is largely unexplored. Here, we show that a mesodermal ABCC (MRP) transporter is necessary for endodermal gut morphogenesis in sea urchin embryos. This transporter, Sp-ABCC5a (C5a), is expressed in pigment cells and their precursors, which are a subset of the non-skeletogenic mesoderm (NSM) cells. C5a expression depends on Delta/Notch signaling from skeletogenic mesoderm and is downstream of Gcm in the aboral NSM gene regulatory network. Long-term imaging of development reveals that C5a knockdown embryos gastrulate, but ∼90% develop a prolapse of the hindgut by the late prism stage (∼8 h after C5a protein expression normally peaks). Since C5a orthologs efflux cyclic nucleotides, and cAMP-dependent protein kinase (Sp-CAPK/PKA) is expressed in pigment cells, we examined whether C5a could be involved in gastrulation through cAMP transport. Consistent with this hypothesis, membrane-permeable pCPT-cAMP rescues the prolapse phenotype in C5a knockdown embryos, and causes archenteron hyper-invagination in control embryos. In addition, the cAMP-producing enzyme soluble adenylyl cyclase (sAC) is expressed in pigment cells, and its inhibition impairs gastrulation. Together, our data support a model in which C5a transports sAC-derived cAMP from pigment cells to control late invagination of the hindgut. Little is known about the ancestral functions of ABCC5/MRP5 transporters, and this study reveals a novel role for these proteins in mesoderm-endoderm signaling during embryogenesis. PMID:26395488

  19. Improved best estimate plus uncertainty methodology including advanced validation concepts to license evolving nuclear reactors

    SciTech Connect

    Unal, Cetin; Williams, Brian; Mc Clure, Patrick; Nelson, Ralph A

    2010-01-01

    Many evolving nuclear energy programs plan to use advanced predictive multi-scale multi-physics simulation and modeling capabilities to reduce cost and time from design through licensing. Historically, the role of experiments was primary tool for design and understanding of nuclear system behavior while modeling and simulation played the subordinate role of supporting experiments. In the new era of multi-scale multi-physics computational based technology development, the experiments will still be needed but they will be performed at different scales to calibrate and validate models leading predictive simulations. Cost saving goals of programs will require us to minimize the required number of validation experiments. Utilization of more multi-scale multi-physics models introduces complexities in the validation of predictive tools. Traditional methodologies will have to be modified to address these arising issues. This paper lays out the basic aspects of a methodology that can be potentially used to address these new challenges in design and licensing of evolving nuclear technology programs. The main components of the proposed methodology are verification, validation, calibration, and uncertainty quantification. An enhanced calibration concept is introduced and is accomplished through data assimilation. The goal is to enable best-estimate prediction of system behaviors in both normal and safety related environments. To achieve this goal requires the additional steps of estimating the domain of validation and quantification of uncertainties that allow for extension of results to areas of the validation domain that are not directly tested with experiments, which might include extension of the modeling and simulation (M&S) capabilities for application to full-scale systems. The new methodology suggests a formalism to quantify an adequate level of validation (predictive maturity) with respect to required selective data so that required testing can be minimized for cost

  20. "Store-operated" cAMP signaling contributes to Ca2+-activated Cl- secretion in T84 colonic cells.

    PubMed

    Nichols, Jonathan M; Maiellaro, Isabella; Abi-Jaoude, Joanne; Curci, Silvana; Hofer, Aldebaran M

    2015-10-15

    Apical cAMP-dependent CFTR Cl(-) channels are essential for efficient vectorial movement of ions and fluid into the lumen of the colon. It is well known that Ca(2+)-mobilizing agonists also stimulate colonic anion secretion. However, CFTR is apparently not activated directly by Ca(2+), and the existence of apical Ca(2+)-dependent Cl(-) channels in the native colonic epithelium is controversial, leaving the identity of the Ca(2+)-activated component unresolved. We recently showed that decreasing free Ca(2+) concentration ([Ca(2+)]) within the endoplasmic reticulum (ER) lumen elicits a rise in intracellular cAMP. This process, which we termed "store-operated cAMP signaling" (SOcAMPS), requires the luminal ER Ca(2+) sensor STIM1 and does not depend on changes in cytosolic Ca(2+). Here we assessed the degree to which SOcAMPS participates in Ca(2+)-activated Cl(-) transport as measured by transepithelial short-circuit current (Isc) in polarized T84 monolayers in parallel with imaging of cAMP and PKA activity using fluorescence resonance energy transfer (FRET)-based reporters in single cells. In Ca(2+)-free conditions, the Ca(2+)-releasing agonist carbachol and Ca(2+) ionophore increased Isc, cAMP, and PKA activity. These responses persisted in cells loaded with the Ca(2+) chelator BAPTA-AM. The effect on Isc was enhanced in the presence of the phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine (IBMX), inhibited by the CFTR inhibitor CFTRinh-172 and the PKA inhibitor H-89, and unaffected by Ba(2+) or flufenamic acid. We propose that a discrete component of the "Ca(2+)-dependent" secretory activity in the colon derives from cAMP generated through SOcAMPS. This alternative mode of cAMP production could contribute to the actions of diverse xenobiotic agents that disrupt ER Ca(2+) homeostasis, leading to diarrhea. PMID:26316590

  1. Increase in Cellular Cyclic AMP Concentrations Reverses the Profibrogenic Phenotype of Cardiac Myofibroblasts: A Novel Therapeutic Approach for Cardiac Fibrosis

    PubMed Central

    Lu, David; Aroonsakool, Nakon; Yokoyama, Utako; Patel, Hemal H.

    2013-01-01

    Tissue fibrosis is characterized by excessive production, deposition, and contraction of the extracellular matrix (ECM). The second messenger cAMP has antifibrotic effects in fibroblasts from several tissues, including cardiac fibroblasts (CFs). Increased cellular cAMP levels can prevent the transformation of CFs into profibrogenic myofibroblasts, a critical step that precedes increased ECM deposition and tissue fibrosis. Here we tested two hypotheses: 1) myofibroblasts have a decreased ability to accumulate cAMP in response to G protein–coupled receptor (GPCR) agonists, and 2) increasing cAMP will not only prevent, but also reverse, the myofibroblast phenotype. We found that myofibroblasts produce less cAMP in response to GPCR agonists or forskolin and have decreased expression of several adenylyl cyclase (AC) isoforms and increased expression of multiple cyclic nucleotide phosphodiesterases (PDEs). Furthermore, we found that forskolin-promoted increases in cAMP or N6-phenyladenosine-cAMP, a protein kinase A–selective analog, reverse the myofibroblast phenotype, as assessed by the expression of collagen Iα1, α–smooth muscle actin, plasminogen activator inhibitor–1, and cellular contractile abilities, all hallmarks of a fibrogenic state. These results indicate that: 1) altered expression of AC and PDE isoforms yield a decrease in cAMP concentrations of cardiac myofibroblasts (relative to CFs) that likely contributes to their profibrotic state, and 2) approaches to increase cAMP concentrations not only prevent fibroblast-to-myofibroblast transformation but also can reverse the profibrotic myofibroblastic phenotype. We conclude that therapeutic strategies designed to enhance cellular cAMP concentrations in CFs may provide a means to reverse excessive scar formation following injury and to treat cardiac fibrosis. PMID:24085841

  2. The signaling module cAMP/Epac/Rap1/PLCε/IP3 mobilizes acrosomal calcium during sperm exocytosis.

    PubMed

    Lucchesi, Ornella; Ruete, María C; Bustos, Matías A; Quevedo, María F; Tomes, Claudia N

    2016-04-01

    Exocytosis of the sperm's single secretory granule, or acrosome, is a regulated exocytosis triggered by components of the egg's investments. In addition to external calcium, sperm exocytosis (termed the acrosome reaction) requires cAMP synthesized endogenously and calcium mobilized from the acrosome through IP3-sensitive channels. The relevant cAMP target is Epac. In the first part of this paper, we present a novel tool (the TAT-cAMP sponge) to investigate cAMP-related signaling pathways in response to progesterone as acrosome reaction trigger. The TAT-cAMP sponge consists of the cAMP-binding sites of protein kinase A regulatory subunit RIβ fused to the protein transduction domain TAT of the human immunodeficiency virus-1. The sponge permeated into sperm, sequestered endogenous cAMP, and blocked exocytosis. Progesterone increased the population of sperm with Rap1-GTP, Rab3-GTP, and Rab27-GTP in the acrosomal region; pretreatment with the TAT-cAMP sponge prevented the activation of all three GTPases. In the second part of this manuscript, we show that phospholipase Cε (PLCε) is required for the acrosome reaction downstream of Rap1 and upstream of intra-acrosomal calcium mobilization. Last, we present direct evidence that cAMP, Epac, Rap1, and PLCε are necessary for calcium mobilization from sperm's secretory granule. In summary, we describe here a pathway that connects cAMP to calcium mobilization from the acrosome during sperm exocytosis. Never before had direct evidence for each step of the cascade been put together in the same study. PMID:26704387

  3. Detection of Plasmid-Mediated AmpC β-Lactamase Genes in Clinical Isolates by Using Multiplex PCR

    PubMed Central

    Pérez-Pérez, F. Javier; Hanson, Nancy D.

    2002-01-01

    Therapeutic options for infections caused by gram-negative organisms expressing plasmid-mediated AmpC β-lactamases are limited because these organisms are usually resistant to all the β-lactam antibiotics, except for cefepime, cefpirome, and the carbapenems. These organisms are a major concern in nosocomial infections and should therefore be monitored in surveillance studies. Six families of plasmid-mediated AmpC β-lactamases have been identified, but no phenotypic test can differentiate among them, a fact which creates problems for surveillance and epidemiology studies. This report describes the development of a multiplex PCR for the purpose of identifying family-specific AmpC β-lactamase genes within gram-negative pathogens. The PCR uses six sets of ampC-specific primers resulting in amplicons that range from 190 bp to 520 bp and that are easily distinguished by gel electrophoresis. ampC multiplex PCR differentiated the six plasmid-mediated ampC-specific families in organisms such as Klebsiella pneumoniae, Escherichia coli, Proteus mirabilis, and Salmonella enterica serovar Typhimurium. Family-specific primers did not amplify genes from the other families of ampC genes. Furthermore, this PCR-based assay differentiated multiple genes within one reaction. In addition, WAVE technology, a high-pressure liquid chromatography-based separation system, was used as a way of decreasing analysis time and increasing the sensitivity of multiple-gene assays. In conclusion, a multiplex PCR technique was developed for identifying family-specific ampC genes responsible for AmpC β-lactamase expression in organisms with or without a chromosomal AmpC β-lactamase gene. PMID:12037080

  4. Nucleoprotein structure influences the response of the mouse mammary tumor virus promoter to activation of the cyclic AMP signalling pathway.

    PubMed Central

    Pennie, W D; Hager, G L; Smith, C L

    1995-01-01

    Recent studies have provided evidence of crosstalk between steroid receptors and cyclic AMP (cAMP) signalling pathways in the regulation of gene expression. A synergism between intracellular phosphorylation inducers and either glucocorticoids or progestins has been shown to occur during activation of the mouse mammary tumor virus (MMTV) promoter. We have investigated the effect of 8-Br-cAMP and okadaic acid, modulators of cellular kinases and phosphatases, on the hormone-induced activation of the MMTV promoter in two forms: a transiently transfected template with a disorganized, accessible nucleoprotein structure and a stably replicating template with an ordered, inaccessible nucleoprotein structure. Both okadaic acid and 8-Br-cAMP synergize significantly with either glucocorticoids or progestins in activating the transiently transfected MMTV template. In contrast, 8-Br-cAMP, but not okadaic acid, is antagonistic to hormone-induced activation of the stably replicating MMTV template. Nuclear run-on experiments demonstrate that this inhibition is a transcriptional effect on both hormone-induced transcription and basal transcription. Surprisingly, 8-Br-cAMP does not inhibit glucocorticoid-induced changes in restriction enzyme access and nuclear factor 1 binding. However, association of a complex with the TATA box region is inhibited in the presence of 8-Br-cAMP. Thus, cAMP treatment interferes with the initiation process but does not inhibit interaction of the receptor with the template. Since the replicated, ordered MMTV templates and the transfected, disorganized templates show opposite responses to 8-Br-cAMP treatment, we conclude that chromatin structure can influence the response of a promoter to activation of the cAMP signalling pathway. PMID:7891707

  5. Distinct potentiation of L-type currents and secretion by cAMP in rat chromaffin cells.

    PubMed

    Carabelli, V; Giancippoli, A; Baldelli, P; Carbone, E; Artalejo, A R

    2003-08-01

    We have investigated the potentiating action of cAMP on L-currents of rat chromaffin cells and the corresponding increase of Ca(2+)-evoked secretory responses with the aim of separating the action of cAMP on Ca(2+) entry through L-channels and the downstream effects of cAMP/protein kinase A (PKA) on exocytosis. In omega-toxin-treated rat chromaffin cells, exposure to the permeable cAMP analog 8-(4-chlorophenylthio)-adenosine 3',5'-monophosphate (pCPT-cAMP; 1 mM, 30 min) caused a moderate increase of Ca(2+) charge carried through L-channels (19% in 10 mM Ca(2+) at +10 mV) and a drastic potentiation of secretion ( approximately 100%), measured as membrane capacitance increments (deltaC). The apparent Ca(2+) dependency of exocytosis increased with pCPT-cAMP and was accompanied by 83% enhancement of the readily releasable pool of vesicles with no significant change of the probability of release, as evaluated with paired-pulse stimulation protocols. pCPT-cAMP effects could be mimicked by stimulation of beta(1)-adrenoreceptors and reversed by the PKA inhibitor H89, suggesting strict PKA dependence. For short pulses to +10 mV (100 ms), potentiation of exocytosis by pCPT-cAMP was proportional to the quantity of charge entering the cell and occurred independently of whether L, N, or P/Q channels were blocked, suggesting that cAMP acts as a constant amplification factor for secretion regardless of the channel type carrying Ca(2+). Analysis of statistical variations among depolarization-induced capacitance increments indicates that pCPT-cAMP acts downstream of Ca(2+) entry by almost doubling the mean size of unitary exocytic events, most likely as a consequence of an increased granule-to-granule rather than a granule-to-membrane fusion. PMID:12885675

  6. Distinct Potentiation of L-Type Currents and Secretion by cAMP in Rat Chromaffin Cells

    PubMed Central

    Carabelli, V.; Giancippoli, A.; Baldelli, P.; Carbone, E.; Artalejo, A. R.

    2003-01-01

    We have investigated the potentiating action of cAMP on L-currents of rat chromaffin cells and the corresponding increase of Ca2+-evoked secretory responses with the aim of separating the action of cAMP on Ca2+ entry through L-channels and the downstream effects of cAMP/protein kinase A (PKA) on exocytosis. In ω-toxin-treated rat chromaffin cells, exposure to the permeable cAMP analog 8-(4-chlorophenylthio)-adenosine 3′,5′-monophosphate (pCPT-cAMP; 1 mM, 30 min) caused a moderate increase of Ca2+ charge carried through L-channels (19% in 10 mM Ca2+ at +10 mV) and a drastic potentiation of secretion (∼100%), measured as membrane capacitance increments (ΔC). The apparent Ca2+ dependency of exocytosis increased with pCPT-cAMP and was accompanied by 83% enhancement of the readily releasable pool of vesicles with no significant change of the probability of release, as evaluated with paired-pulse stimulation protocols. pCPT-cAMP effects could be mimicked by stimulation of β1-adrenoreceptors and reversed by the PKA inhibitor H89, suggesting strict PKA dependence. For short pulses to +10 mV (100 ms), potentiation of exocytosis by pCPT-cAMP was proportional to the quantity of charge entering the cell and occurred independently of whether L, N, or P/Q channels were blocked, suggesting that cAMP acts as a constant amplification factor for secretion regardless of the channel type carrying Ca2+. Analysis of statistical variations among depolarization-induced capacitance increments indicates that pCPT-cAMP acts downstream of Ca2+ entry by almost doubling the mean size of unitary exocytic events, most likely as a consequence of an increased granule-to-granule rather than a granule-to-membrane fusion. PMID:12885675

  7. The Small Molecule Hyperphyllin Enhances Leaf Formation Rate and Mimics Shoot Meristem Integrity Defects Associated with AMP1 Deficiency.

    PubMed

    Poretska, Olena; Yang, Saiqi; Pitorre, Delphine; Rozhon, Wilfried; Zwerger, Karin; Uribe, Marcos Castellanos; May, Sean; McCourt, Peter; Poppenberger, Brigitte; Sieberer, Tobias

    2016-06-01

    ALTERED MERISTEM PROGRAM1 (AMP1) is a member of the M28 family of carboxypeptidases with a pivotal role in plant development and stress adaptation. Its most prominent mutant defect is a unique hypertrophic shoot phenotype combining a strongly increased organ formation rate with enhanced meristem size and the formation of ectopic meristem poles. However, so far the role of AMP1 in shoot development could not be assigned to a specific molecular pathway nor is its biochemical function resolved. In this work we evaluated the level of functional conservation between AMP1 and its human homolog HsGCPII, a tumor marker of medical interest. We show that HsGCPII cannot substitute AMP1 in planta and that an HsGCPII-specific inhibitor does not evoke amp1-specific phenotypes. We used a chemical genetic approach to identify the drug hyperphyllin (HP), which specifically mimics the shoot defects of amp1, including plastochron reduction and enlargement and multiplication of the shoot meristem. We assessed the structural requirements of HP activity and excluded that it is a cytokinin analog. HP-treated wild-type plants showed amp1-related tissue-specific changes of various marker genes and a significant transcriptomic overlap with the mutant. HP was ineffective in amp1 and elevated the protein levels of PHAVOLUTA, consistent with the postulated role of AMP1 in miRNA-controlled translation, further supporting an AMP1-related mode of action. Our work suggests that plant and animal members of the M28 family of proteases adopted unrelated functions. With HP we provide a tool to characterize the plant-specific functions of this important class of proteins. PMID:27208298

  8. SCIENCE BRIEF: ADVANCED CONCEPTS

    EPA Science Inventory

    Research on advanced concepts will evaluate and demonstrate the application of innovative infrastructure designs, management procedures and operational approaches. Advanced concepts go beyond simple asset management. The infusion of these advanced concepts into established wastew...

  9. In-Water Hull Cleaning &amp; Filtration System

    NASA Astrophysics Data System (ADS)

    George, Dan

    2015-04-01

    through a multi stage filtration unit on the surface. Solids greater than 50 micron are separated through a 1st stage separator and deposited into a disposal bin. Filtrate is then pumped through a series of high flow, back-flushable filters that remove particulate material greater than 5 micron. After the 1st and 2nd stage filtration the filtrate is then disinfected by passing through an automated UV reactor where the treated water is then released back into the ocean. This advancement in hull cleaning technology will allow vessels to be cleaned in areas where dry docking is not possible or viable along with being a preventive measure to reduce Biofouling in the environment. The in-water hull cleaning system certainly has earned its place as being an innovative leader in improving efficiencies and reducing environmental impact. https://www.linkedin.com/groups?mostRecent=&gid=6724648&trk=my_groups-tile-flipgrp

  10. Advanced Modular Power Approach to Affordable, Supportable Space Systems

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard C.; Kimnach, Greg L.; Fincannon, James; Mckissock,, Barbara I.; Loyselle, Patricia L.; Wong, Edmond

    2013-01-01

    Recent studies of missions to the Moon, Mars and Near Earth Asteroids (NEA) indicate that these missions often involve several distinct separately launched vehicles that must ultimately be integrated together in-flight and operate as one unit. Therefore, it is important to see these vehicles as elements of a larger segmented spacecraft rather than separate spacecraft flying in formation. The evolution of large multi-vehicle exploration architecture creates the need (and opportunity) to establish a global power architecture that is common across all vehicles. The Advanced Exploration Systems (AES) Modular Power System (AMPS) project managed by NASA Glenn Research Center (GRC) is aimed at establishing the modular power system architecture that will enable power systems to be built from a common set of modular building blocks. The project is developing, demonstrating and evaluating key modular power technologies that are expected to minimize non-recurring development costs, reduce recurring integration costs, as well as, mission operational and support costs. Further, modular power is expected to enhance mission flexibility, vehicle reliability, scalability and overall mission supportability. The AMPS project not only supports multi-vehicle architectures but should enable multi-mission capability as well. The AMPS technology development involves near term demonstrations involving developmental prototype vehicles and field demonstrations. These operational demonstrations not only serve as a means of evaluating modular technology but also provide feedback to developers that assure that they progress toward truly flexible and operationally supportable modular power architecture.

  11. Enhanced killing effects of caffein post-treatment in ultraviolet-light irradiated mouse lymphoma cells: is cAMP a mediator of the effects?

    PubMed

    Kuwashima, Y; Miyachi, Y; Okada, S; Iio, M; Nakamura, N

    1983-01-01

    Effects of post-tre