Science.gov

Sample records for advanced multi-physics amp

  1. Integration of Advanced Probabilistic Analysis Techniques with Multi-Physics Models

    SciTech Connect

    Cetiner, Mustafa Sacit; none,; Flanagan, George F.; Poore III, Willis P.; Muhlheim, Michael David

    2014-07-30

    An integrated simulation platform that couples probabilistic analysis-based tools with model-based simulation tools can provide valuable insights for reactive and proactive responses to plant operating conditions. The objective of this work is to demonstrate the benefits of a partial implementation of the Small Modular Reactor (SMR) Probabilistic Risk Assessment (PRA) Detailed Framework Specification through the coupling of advanced PRA capabilities and accurate multi-physics plant models. Coupling a probabilistic model with a multi-physics model will aid in design, operations, and safety by providing a more accurate understanding of plant behavior. This represents the first attempt at actually integrating these two types of analyses for a control system used for operations, on a faster than real-time basis. This report documents the development of the basic communication capability to exchange data with the probabilistic model using Reliability Workbench (RWB) and the multi-physics model using Dymola. The communication pathways from injecting a fault (i.e., failing a component) to the probabilistic and multi-physics models were successfully completed. This first version was tested with prototypic models represented in both RWB and Modelica. First, a simple event tree/fault tree (ET/FT) model was created to develop the software code to implement the communication capabilities between the dynamic-link library (dll) and RWB. A program, written in C#, successfully communicates faults to the probabilistic model through the dll. A systems model of the Advanced Liquid-Metal Reactor–Power Reactor Inherently Safe Module (ALMR-PRISM) design developed under another DOE project was upgraded using Dymola to include proper interfaces to allow data exchange with the control application (ConApp). A program, written in C+, successfully communicates faults to the multi-physics model. The results of the example simulation were successfully plotted.

  2. Multi-physics nuclear reactor simulator for advanced nuclear engineering education

    SciTech Connect

    Yamamoto, A.

    2012-07-01

    Multi-physics nuclear reactor simulator, which aims to utilize for advanced nuclear engineering education, is being introduced to Nagoya Univ.. The simulator consists of the 'macroscopic' physics simulator and the 'microscopic' physics simulator. The former performs real time simulation of a whole nuclear power plant. The latter is responsible to more detail numerical simulations based on the sophisticated and precise numerical models, while taking into account the plant conditions obtained in the macroscopic physics simulator. Steady-state and kinetics core analyses, fuel mechanical analysis, fluid dynamics analysis, and sub-channel analysis can be carried out in the microscopic physics simulator. Simulation calculations are carried out through dedicated graphical user interface and the simulation results, i.e., spatial and temporal behaviors of major plant parameters are graphically shown. The simulator will provide a bridge between the 'theories' studied with textbooks and the 'physical behaviors' of actual nuclear power plants. (authors)

  3. Advanced Mesh-Enabled Monte carlo capability for Multi-Physics Reactor Analysis

    SciTech Connect

    Wilson, Paul; Evans, Thomas; Tautges, Tim

    2012-12-24

    This project will accumulate high-precision fluxes throughout reactor geometry on a non- orthogonal grid of cells to support multi-physics coupling, in order to more accurately calculate parameters such as reactivity coefficients and to generate multi-group cross sections. This work will be based upon recent developments to incorporate advanced geometry and mesh capability in a modular Monte Carlo toolkit with computational science technology that is in use in related reactor simulation software development. Coupling this capability with production-scale Monte Carlo radiation transport codes can provide advanced and extensible test-beds for these developments. Continuous energy Monte Carlo methods are generally considered to be the most accurate computational tool for simulating radiation transport in complex geometries, particularly neutron transport in reactors. Nevertheless, there are several limitations for their use in reactor analysis. Most significantly, there is a trade-off between the fidelity of results in phase space, statistical accuracy, and the amount of computer time required for simulation. Consequently, to achieve an acceptable level of statistical convergence in high-fidelity results required for modern coupled multi-physics analysis, the required computer time makes Monte Carlo methods prohibitive for design iterations and detailed whole-core analysis. More subtly, the statistical uncertainty is typically not uniform throughout the domain, and the simulation quality is limited by the regions with the largest statistical uncertainty. In addition, the formulation of neutron scattering laws in continuous energy Monte Carlo methods makes it difficult to calculate adjoint neutron fluxes required to properly determine important reactivity parameters. Finally, most Monte Carlo codes available for reactor analysis have relied on orthogonal hexahedral grids for tallies that do not conform to the geometric boundaries and are thus generally not well

  4. Specification of the Advanced Burner Test Reactor Multi-Physics Coupling Demonstration Problem

    SciTech Connect

    Shemon, E. R.; Grudzinski, J. J.; Lee, C. H.; Thomas, J. W.; Yu, Y. Q.

    2015-12-21

    This document specifies the multi-physics nuclear reactor demonstration problem using the SHARP software package developed by NEAMS. The SHARP toolset simulates the key coupled physics phenomena inside a nuclear reactor. The PROTEUS neutronics code models the neutron transport within the system, the Nek5000 computational fluid dynamics code models the fluid flow and heat transfer, and the DIABLO structural mechanics code models structural and mechanical deformation. The three codes are coupled to the MOAB mesh framework which allows feedback from neutronics, fluid mechanics, and mechanical deformation in a compatible format.

  5. Keeping it Together: Advanced algorithms and software for magma dynamics (and other coupled multi-physics problems)

    NASA Astrophysics Data System (ADS)

    Spiegelman, M.; Wilson, C. R.

    2011-12-01

    A quantitative theory of magma production and transport is essential for understanding the dynamics of magmatic plate boundaries, intra-plate volcanism and the geochemical evolution of the planet. It also provides one of the most challenging computational problems in solid Earth science, as it requires consistent coupling of fluid and solid mechanics together with the thermodynamics of melting and reactive flows. Considerable work on these problems over the past two decades shows that small changes in assumptions of coupling (e.g. the relationship between melt fraction and solid rheology), can have profound changes on the behavior of these systems which in turn affects critical computational choices such as discretizations, solvers and preconditioners. To make progress in exploring and understanding this physically rich system requires a computational framework that allows more flexible, high-level description of multi-physics problems as well as increased flexibility in composing efficient algorithms for solution of the full non-linear coupled system. Fortunately, recent advances in available computational libraries and algorithms provide a platform for implementing such a framework. We present results from a new model building system that leverages functionality from both the FEniCS project (www.fenicsproject.org) and PETSc libraries (www.mcs.anl.gov/petsc) along with a model independent options system and gui, Spud (amcg.ese.ic.ac.uk/Spud). Key features from FEniCS include fully unstructured FEM with a wide range of elements; a high-level language (ufl) and code generation compiler (FFC) for describing the weak forms of residuals and automatic differentiation for calculation of exact and approximate jacobians. The overall strategy is to monitor/calculate residuals and jacobians for the entire non-linear system of equations within a global non-linear solve based on PETSc's SNES routines. PETSc already provides a wide range of solvers and preconditioners, from

  6. Scalable Methods for Uncertainty Quantification, Data Assimilation and Target Accuracy Assessment for Multi-Physics Advanced Simulation of Light Water Reactors

    NASA Astrophysics Data System (ADS)

    Khuwaileh, Bassam

    High fidelity simulation of nuclear reactors entails large scale applications characterized with high dimensionality and tremendous complexity where various physics models are integrated in the form of coupled models (e.g. neutronic with thermal-hydraulic feedback). Each of the coupled modules represents a high fidelity formulation of the first principles governing the physics of interest. Therefore, new developments in high fidelity multi-physics simulation and the corresponding sensitivity/uncertainty quantification analysis are paramount to the development and competitiveness of reactors achieved through enhanced understanding of the design and safety margins. Accordingly, this dissertation introduces efficient and scalable algorithms for performing efficient Uncertainty Quantification (UQ), Data Assimilation (DA) and Target Accuracy Assessment (TAA) for large scale, multi-physics reactor design and safety problems. This dissertation builds upon previous efforts for adaptive core simulation and reduced order modeling algorithms and extends these efforts towards coupled multi-physics models with feedback. The core idea is to recast the reactor physics analysis in terms of reduced order models. This can be achieved via identifying the important/influential degrees of freedom (DoF) via the subspace analysis, such that the required analysis can be recast by considering the important DoF only. In this dissertation, efficient algorithms for lower dimensional subspace construction have been developed for single physics and multi-physics applications with feedback. Then the reduced subspace is used to solve realistic, large scale forward (UQ) and inverse problems (DA and TAA). Once the elite set of DoF is determined, the uncertainty/sensitivity/target accuracy assessment and data assimilation analysis can be performed accurately and efficiently for large scale, high dimensional multi-physics nuclear engineering applications. Hence, in this work a Karhunen-Loeve (KL

  7. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  8. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  9. Science based integrated approach to advanced nuclear fuel development - integrated multi-scale multi-physics hierarchical modeling and simulation framework Part III: cladding

    SciTech Connect

    Tome, Carlos N; Caro, J A; Lebensohn, R A; Unal, Cetin; Arsenlis, A; Marian, J; Pasamehmetoglu, K

    2010-01-01

    Advancing the performance of Light Water Reactors, Advanced Nuclear Fuel Cycles, and Advanced Reactors, such as the Next Generation Nuclear Power Plants, requires enhancing our fundamental understanding of fuel and materials behavior under irradiation. The capability to accurately model the nuclear fuel systems to develop predictive tools is critical. Not only are fabrication and performance models needed to understand specific aspects of the nuclear fuel, fully coupled fuel simulation codes are required to achieve licensing of specific nuclear fuel designs for operation. The backbone of these codes, models, and simulations is a fundamental understanding and predictive capability for simulating the phase and microstructural behavior of the nuclear fuel system materials and matrices. In this paper we review the current status of the advanced modeling and simulation of nuclear reactor cladding, with emphasis on what is available and what is to be developed in each scale of the project, how we propose to pass information from one scale to the next, and what experimental information is required for benchmarking and advancing the modeling at each scale level.

  10. One-Way Coupling of an Advanced CFD Multi-Physics Model to FEA for Predicting Stress-Strain in the Solidifying Shell during Continuous Casting of Steel

    NASA Astrophysics Data System (ADS)

    Svensson, Johan; Ramírez López, Pavel E.; Jalali, Pooria N.; Cervantes, Michel

    2015-06-01

    One of the main targets for Continuous Casting (CC) modelling is the actual prediction of defects during transient events. However, the majority of CC models are based on a statistical approach towards flow and powder performance, which is unable to capture the subtleties of small variations in casting conditions during real industrial operation or the combined effects of such changes leading eventually to defects. An advanced Computational Fluid Dynamics (CFD) model; which accounts for transient changes on lubrication during casting due to turbulent flow dynamics and mould oscillation has been presented on MCWASP XIV (Austria) to address these issues. The model has been successfully applied to the industrial environment to tackle typical problems such as lack of lubrication or unstable flows. However, a direct application to cracking had proven elusive. The present paper describes how results from this advanced CFD-CC model have been successfully coupled to structural Finite Element Analysis (FEA) for prediction of stress-strains as a function of irregular lubrication conditions in the mould. The main challenge for coupling was the extraction of the solidified shell from CFD calculations (carried out with a hybrid structured mesh) and creating a geometry by using iso-surfaces, re-meshing and mapping loads (e.g. temperature, pressure and external body forces), which served as input to mechanical stress-strain calculations. Preliminary results for CC of slabs show that the temperature distribution within the shell causes shrinkage and thermal deformation; which are in turn, the main source of stress. Results also show reasonable stress levels of 10-20 MPa in regions, where the shell is thin and exposed to large temperature gradients. Finally, predictions are in good agreement with prior works where stresses indicate compression at the slab surface, while tension is observed at the interior; generating a characteristic stress-strain state during solidification in CC.

  11. Recent Advances in the Discovery of Small Molecules Targeting Exchange Proteins Directly Activated by cAMP (EPAC)

    PubMed Central

    Chen, Haijun; Wild, Christopher; Zhou, Xiaobin; Ye, Na; Cheng, Xiaodong; Zhou, Jia

    2014-01-01

    cAMP is a pivotal second messenger that regulates numerous biological processes under physiological and pathological conditions, including cancer, diabetes, heart failure, inflammation and neurological disorders. In the past, all effects of cAMP were initially believed to be mediated by PKA and cyclic nucleotide-regulated ion channels. Since the discovery of EPAC proteins in 1998, accumulating evidence has demonstrated that the net cellular effects of cAMP are also regulated by EPAC. The pursuit of the biological functions of EPAC has benefited from the development and applications of a growing number of pharmacological probes targeting EPAC proteins. In this Perspective, we seek to provide a concise update on recent advances in the development of chemical entities including various membrane-permeable analogues of cAMP and newly discovered EPAC-specific ligands from high throughput assays and hit-to-lead optimizations. PMID:24256330

  12. Computation of Thermodynamic Equilibria Pertinent to Nuclear Materials in Multi-Physics Codes

    NASA Astrophysics Data System (ADS)

    Piro, Markus Hans Alexander

    components at each iterative step, and the objective is to minimize the residuals of the mass balance equations. Several numerical advantages are achieved through this simplification. In particular, computational expense is reduced and the rate of convergence is enhanced. Furthermore, the software has demonstrated the ability to solve systems involving as many as 118 component elements. An early version of the code has already been integrated into the Advanced Multi-Physics (AMP) code under development by the Oak Ridge National Laboratory, Los Alamos National Laboratory, Idaho National Laboratory and Argonne National Laboratory. Keywords: Engineering, Nuclear -- 0552, Engineering, Material Science -- 0794, Chemistry, Mathematics -- 0405, Computer Science -- 0984

  13. Advanced Mitigation Process (AMP) for Improving Laser Damage Threshold of Fused Silica Optics

    PubMed Central

    Ye, Xin; Huang, Jin; Liu, Hongjie; Geng, Feng; Sun, Laixi; Jiang, Xiaodong; Wu, Weidong; Qiao, Liang; Zu, Xiaotao; Zheng, Wanguo

    2016-01-01

    The laser damage precursors in subsurface of fused silica (e.g. photosensitive impurities, scratches and redeposited silica compounds) were mitigated by mineral acid leaching and HF etching with multi-frequency ultrasonic agitation, respectively. The comparison of scratches morphology after static etching and high-frequency ultrasonic agitation etching was devoted in our case. And comparison of laser induce damage resistance of scratched and non-scratched fused silica surfaces after HF etching with high-frequency ultrasonic agitation were also investigated in this study. The global laser induce damage resistance was increased significantly after the laser damage precursors were mitigated in this case. The redeposition of reaction produce was avoided by involving multi-frequency ultrasonic and chemical leaching process. These methods made the increase of laser damage threshold more stable. In addition, there is no scratch related damage initiations found on the samples which were treated by Advanced Mitigation Process. PMID:27484188

  14. Advanced Mitigation Process (AMP) for Improving Laser Damage Threshold of Fused Silica Optics

    NASA Astrophysics Data System (ADS)

    Ye, Xin; Huang, Jin; Liu, Hongjie; Geng, Feng; Sun, Laixi; Jiang, Xiaodong; Wu, Weidong; Qiao, Liang; Zu, Xiaotao; Zheng, Wanguo

    2016-08-01

    The laser damage precursors in subsurface of fused silica (e.g. photosensitive impurities, scratches and redeposited silica compounds) were mitigated by mineral acid leaching and HF etching with multi-frequency ultrasonic agitation, respectively. The comparison of scratches morphology after static etching and high-frequency ultrasonic agitation etching was devoted in our case. And comparison of laser induce damage resistance of scratched and non-scratched fused silica surfaces after HF etching with high-frequency ultrasonic agitation were also investigated in this study. The global laser induce damage resistance was increased significantly after the laser damage precursors were mitigated in this case. The redeposition of reaction produce was avoided by involving multi-frequency ultrasonic and chemical leaching process. These methods made the increase of laser damage threshold more stable. In addition, there is no scratch related damage initiations found on the samples which were treated by Advanced Mitigation Process.

  15. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2016-07-12

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  16. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  17. Multi-Physics Demonstration Problem with the SHARP Reactor Simulation Toolkit

    SciTech Connect

    Merzari, E.; Shemon, E. R.; Yu, Y. Q.; Thomas, J. W.; Obabko, A.; Jain, Rajeev; Mahadevan, Vijay; Tautges, Timothy; Solberg, Jerome; Ferencz, Robert Mark; Whitesides, R.

    2015-12-21

    This report describes to employ SHARP to perform a first-of-a-kind analysis of the core radial expansion phenomenon in an SFR. This effort required significant advances in the framework Multi-Physics Demonstration Problem with the SHARP Reactor Simulation Toolkit used to drive the coupled simulations, manipulate the mesh in response to the deformation of the geometry, and generate the necessary modified mesh files. Furthermore, the model geometry is fairly complex, and consistent mesh generation for the three physics modules required significant effort. Fully-integrated simulations of a 7-assembly mini-core test problem have been performed, and the results are presented here. Physics models of a full-core model of the Advanced Burner Test Reactor have also been developed for each of the three physics modules. Standalone results of each of the three physics modules for the ABTR are presented here, which provides a demonstration of the feasibility of the fully-integrated simulation.

  18. Multi-Physics Analysis of the Fermilab Booster RF Cavity

    SciTech Connect

    Awida, M.; Reid, J.; Yakovlev, V.; Lebedev, V.; Khabiboulline, T.; Champion, M.; /Fermilab

    2012-05-14

    After about 40 years of operation the RF accelerating cavities in Fermilab Booster need an upgrade to improve their reliability and to increase the repetition rate in order to support a future experimental program. An increase in the repetition rate from 7 to 15 Hz entails increasing the power dissipation in the RF cavities, their ferrite loaded tuners, and HOM dampers. The increased duty factor requires careful modelling for the RF heating effects in the cavity. A multi-physic analysis investigating both the RF and thermal properties of Booster cavity under various operating conditions is presented in this paper.

  19. Solid Oxide Fuel Cell - Multi-Physics and GUI

    SciTech Connect

    2013-10-10

    SOFC-MP is a simulation tool developed at PNNL to evaluate the tightly coupled multi-physical phenomena in SOFCs. The purpose of the tool is to allow SOFC manufacturers to numerically test changes in planar stack design to meet DOE technical targets. The SOFC-MP 2D module is designed for computational efficiency to enable rapid engineering evaluations for operation of tall symmetric stacks. It can quickly compute distributions for the current density, voltage, temperature, and species composition in tall stacks with co-flow or counter-flow orientations. The 3D module computes distributions in entire 3D domain and handles all planner configurations: co-flow, counter-flow, and cross-flow. The detailed data from 3D simulation can be used as input for structural analysis. SOFC-MP GUI integrates both 2D and 3D modules, and it provides user friendly pre-processing and post-processing capabilities.

  20. Increased expression of the RIα subunit of the cAMP-dependent protein kinase A is associated with advanced stage ovarian cancer

    PubMed Central

    McDaid, H M; Cairns, M T; Atkinson, R J; McAleer, S; Harkin, D P; Gilmore, P; Johnston, P G

    1999-01-01

    The primary element in the cAMP signal transduction pathway is the cAMP-dependent protein kinase (PKA). Expression of the RIα subunit of type I PKA is elevated in a variety of human tumours and cancer cell lines. The purpose of this study was to assess the prognostic importance of RIα expression in patients with ovarian cancer. We have evaluated the expression of RIα in a panel of human ovarian tumours (n= 40) and five human ovarian cancer cell lines using quantitative reverse transcription polymerase chain reaction (RT-PCR) and Western blot analysis. The human ovarian cell lines OAW42 and OTN14 express high endogenous levels of RIα mRNA and protein (at significantly higher mRNA levels than high tissue expressors, P< 0.05). The ovarian cell line A2780 expresses low endogenous levels of RIα mRNA and protein (also at higher mRNA levels than low tissue expressors, P< 0.05). Quantitative RT-PCR revealed no significant difference in RIα mRNA expression between different ovarian histological subtypes in this study. No associations were found between RIα mRNA expression and differentiation state. RIα mRNA expression was significantly associated with tumour stage (P= 0.0036), and this remained significant in univariate analysis (P= 0.0002). A trend emerged between RIα mRNA expression levels and overall survival in univariate analysis (P= 0.051), however, by multivariate analysis, stage remained the major determinant of overall survival (P= 0.0001). This study indicates that in ovarian epithelial tumours high RIα mRNA expression is associated with advanced stage disease. RIα expression may be of predictive value in ovarian cancer and may be associated with dysfunctional signalling pathways in this cancer type. 1999 Cancer Research Campaign PMID:10070893

  1. Lithium-Ion Battery Safety Study Using Multi-Physics Internal Short-Circuit Model (Presentation)

    SciTech Connect

    Kim, G-.H.; Smith, K.; Pesaran, A.

    2009-06-01

    This presentation outlines NREL's multi-physics simulation study to characterize an internal short by linking and integrating electrochemical cell, electro-thermal, and abuse reaction kinetics models.

  2. A theory manual for multi-physics code coupling in LIME.

    SciTech Connect

    Belcourt, Noel; Bartlett, Roscoe Ainsworth; Pawlowski, Roger Patrick; Schmidt, Rodney Cannon; Hooper, Russell Warren

    2011-03-01

    The Lightweight Integrating Multi-physics Environment (LIME) is a software package for creating multi-physics simulation codes. Its primary application space is when computer codes are currently available to solve different parts of a multi-physics problem and now need to be coupled with other such codes. In this report we define a common domain language for discussing multi-physics coupling and describe the basic theory associated with multiphysics coupling algorithms that are to be supported in LIME. We provide an assessment of coupling techniques for both steady-state and time dependent coupled systems. Example couplings are also demonstrated.

  3. Solid Oxide Fuel Cell - Multi-Physics and GUI

    2013-10-10

    SOFC-MP is a simulation tool developed at PNNL to evaluate the tightly coupled multi-physical phenomena in SOFCs. The purpose of the tool is to allow SOFC manufacturers to numerically test changes in planar stack design to meet DOE technical targets. The SOFC-MP 2D module is designed for computational efficiency to enable rapid engineering evaluations for operation of tall symmetric stacks. It can quickly compute distributions for the current density, voltage, temperature, and species composition inmore » tall stacks with co-flow or counter-flow orientations. The 3D module computes distributions in entire 3D domain and handles all planner configurations: co-flow, counter-flow, and cross-flow. The detailed data from 3D simulation can be used as input for structural analysis. SOFC-MP GUI integrates both 2D and 3D modules, and it provides user friendly pre-processing and post-processing capabilities.« less

  4. Modelling transport phenomena in a multi-physics context

    NASA Astrophysics Data System (ADS)

    Marra, Francesco

    2015-01-01

    Innovative heating research on cooking, pasteurization/sterilization, defrosting, thawing and drying, often focuses on areas which include the assessment of processing time, evaluation of heating uniformity, studying the impact on quality attributes of the final product as well as considering the energy efficiency of these heating processes. During the last twenty years, so-called electro-heating-processes (radio-frequency - RF, microwaves - MW and ohmic - OH) gained a wide interest in industrial food processing and many applications using the above mentioned technologies have been developed with the aim of reducing processing time, improving process efficiency and, in many cases, the heating uniformity. In the area of innovative heating, electro-heating accounts for a considerable portion of both the scientific literature and commercial applications, which can be subdivided into either direct electro-heating (as in the case of OH heating) where electrical current is applied directly to the food or indirect electro-heating (e.g. MW and RF heating) where the electrical energy is firstly converted to electromagnetic radiation which subsequently generates heat within a product. New software packages, which make easier solution of PDEs based mathematical models, and new computers, capable of larger RAM and more efficient CPU performances, allowed an increasing interest about modelling transport phenomena in systems and processes - as the ones encountered in food processing - that can be complex in terms of geometry, composition, boundary conditions but also - as in the case of electro-heating assisted applications - in terms of interaction with other physical phenomena such as displacement of electric or magnetic field. This paper deals with the description of approaches used in modelling transport phenomena in a multi-physics context such as RF, MW and OH assisted heating.

  5. Modelling transport phenomena in a multi-physics context

    SciTech Connect

    Marra, Francesco

    2015-01-22

    Innovative heating research on cooking, pasteurization/sterilization, defrosting, thawing and drying, often focuses on areas which include the assessment of processing time, evaluation of heating uniformity, studying the impact on quality attributes of the final product as well as considering the energy efficiency of these heating processes. During the last twenty years, so-called electro-heating-processes (radio-frequency - RF, microwaves - MW and ohmic - OH) gained a wide interest in industrial food processing and many applications using the above mentioned technologies have been developed with the aim of reducing processing time, improving process efficiency and, in many cases, the heating uniformity. In the area of innovative heating, electro-heating accounts for a considerable portion of both the scientific literature and commercial applications, which can be subdivided into either direct electro-heating (as in the case of OH heating) where electrical current is applied directly to the food or indirect electro-heating (e.g. MW and RF heating) where the electrical energy is firstly converted to electromagnetic radiation which subsequently generates heat within a product. New software packages, which make easier solution of PDEs based mathematical models, and new computers, capable of larger RAM and more efficient CPU performances, allowed an increasing interest about modelling transport phenomena in systems and processes - as the ones encountered in food processing - that can be complex in terms of geometry, composition, boundary conditions but also - as in the case of electro-heating assisted applications - in terms of interaction with other physical phenomena such as displacement of electric or magnetic field. This paper deals with the description of approaches used in modelling transport phenomena in a multi-physics context such as RF, MW and OH assisted heating.

  6. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  7. Development of a multi-physics simulation framework for semiconductor materials and devices

    NASA Astrophysics Data System (ADS)

    Almeida, Nuno Sucena

    Modern day semiconductor technology devices face the ever increasing issue of accounting for quantum mechanics effects on their modeling and performance assessment. The objective of this work is to create a user-friendly, extensible and powerful multi-physics simulation blackbox for nano-scale semiconductor devices. By using a graphical device modeller this work will provide a friendly environment were a user without deep knowledge of device physics can create a device, simulate it and extract optical and electrical characteristics deemed of interest to his engineering occupation. Resorting to advanced template C++ object-oriented design from the start, this work was able to implement algorithms to simulate 1,2 and 3D devices which along with scripting using the well known Python language enables the user to create batch simulations, to better optimize device performance. Higher-dimensional semiconductors, like wires and dots, require a huge computational cost. MPI parallel libraries enable the software to tackle complex geometries which otherwise would be unfeasible on a small single-CPU computer. Quantum mechanical phenomena is described by Schrodinger's equation which must be solved self-consistently with Poisson's equation for the electrostatic charge and, if required, make use of piezoelectric charge terms from elasticity constraints. Since the software implements a generic n-dimensional FEM engine, virtually any kind of Partial Differential Equation can be solved and in the future, other required solvers besides the ones already implemented will also be included for easy of use. In particular for the semiconductor device physics, we solve the quantum mechanics effective mass conduction-valence band k·p approximation to the Schrodinger-Poisson, in any crystal growth orientation (C,polar M,A and semi-polar planes or any user defined angle) and also include Piezoelectric effects caused by strain in lattice mismatched layers, where the implemented software

  8. Multi-scale/multi-physical modeling in head/disk interface of magnetic data storage

    NASA Astrophysics Data System (ADS)

    Chung, Pil Seung; Smith, Robert; Vemuri, Sesha Hari; Jhon, Young In; Tak, Kyungjae; Moon, Il; Biegler, Lorenz T.; Jhon, Myung S.

    2012-04-01

    The model integration of the head-disk interface (HDI) in the hard disk drive system, which includes the hierarchy of highly interactive layers (magnetic layer, carbon overcoat (COC), lubricant, and air bearing system (ABS)), has recently been focused upon to resolve technical barriers and enhance reliability. Heat-assisted magnetic recording especially demands that the model simultaneously incorporates thermal and mechanical phenomena by considering the enormous combinatorial cases of materials and multi-scale/multi-physical phenomena. In this paper, we explore multi-scale/multi-physical simulation methods for HDI, which will holistically integrate magnetic layers, COC, lubricants, and ABS in non-isothermal conditions.

  9. Scalable parallel solution coupling for multi-physics reactor simulation.

    SciTech Connect

    Tautges, T. J.; Caceres, A.; Mathematics and Computer Science

    2009-01-01

    Reactor simulation depends on the coupled solution of various physics types, including neutronics, thermal/hydraulics, and structural mechanics. This paper describes the formulation and implementation of a parallel solution coupling capability being developed for reactor simulation. The coupling process consists of mesh and coupler initialization, point location, field interpolation, and field normalization. We report here our test of this capability on an example problem, namely, a reflector assembly from an advanced burner test reactor. Performance of this coupler in parallel is reasonable for the chosen problem size and range of processor counts. The runtime is dominated by startup costs, which amortize over the entire coupled simulation. Future efforts will include adding more sophisticated interpolation and normalization methods, to accommodate different numerical solvers used in various physics modules and to obtain better conservation properties for certain field types.

  10. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  11. Multi-physics design and analyses of long life reactors for lunar outposts

    NASA Astrophysics Data System (ADS)

    Schriener, Timothy M.

    event of a launch abort accident. Increasing the amount of fuel in the reactor core, and hence its operational life, would be possible by launching the reactor unfueled and fueling it on the Moon. Such a reactor would, thus, not be subject to launch criticality safety requirements. However, loading the reactor with fuel on the Moon presents a challenge, requiring special designs of the core and the fuel elements, which lend themselves to fueling on the lunar surface. This research investigates examples of both a solid core reactor that would be fueled at launch as well as an advanced concept which could be fueled on the Moon. Increasing the operational life of a reactor fueled at launch is exercised for the NaK-78 cooled Sectored Compact Reactor (SCoRe). A multi-physics design and analyses methodology is developed which iteratively couples together detailed Monte Carlo neutronics simulations with 3-D Computational Fluid Dynamics (CFD) and thermal-hydraulics analyses. Using this methodology the operational life of this compact, fast spectrum reactor is increased by reconfiguring the core geometry to reduce neutron leakage and parasitic absorption, for the same amount of HEU in the core, and meeting launch safety requirements. The multi-physics analyses determine the impacts of the various design changes on the reactor's neutronics and thermal-hydraulics performance. The option of increasing the operational life of a reactor by loading it on the Moon is exercised for the Pellet Bed Reactor (PeBR). The PeBR uses spherical fuel pellets and is cooled by He-Xe gas, allowing the reactor core to be loaded with fuel pellets and charged with working fluid on the lunar surface. The performed neutronics analyses ensure the PeBR design achieves a long operational life, and develops safe launch canister designs to transport the spherical fuel pellets to the lunar surface. The research also investigates loading the PeBR core with fuel pellets on the Moon using a transient Discrete

  12. Multi-physics design and analyses of long life reactors for lunar outposts

    NASA Astrophysics Data System (ADS)

    Schriener, Timothy M.

    event of a launch abort accident. Increasing the amount of fuel in the reactor core, and hence its operational life, would be possible by launching the reactor unfueled and fueling it on the Moon. Such a reactor would, thus, not be subject to launch criticality safety requirements. However, loading the reactor with fuel on the Moon presents a challenge, requiring special designs of the core and the fuel elements, which lend themselves to fueling on the lunar surface. This research investigates examples of both a solid core reactor that would be fueled at launch as well as an advanced concept which could be fueled on the Moon. Increasing the operational life of a reactor fueled at launch is exercised for the NaK-78 cooled Sectored Compact Reactor (SCoRe). A multi-physics design and analyses methodology is developed which iteratively couples together detailed Monte Carlo neutronics simulations with 3-D Computational Fluid Dynamics (CFD) and thermal-hydraulics analyses. Using this methodology the operational life of this compact, fast spectrum reactor is increased by reconfiguring the core geometry to reduce neutron leakage and parasitic absorption, for the same amount of HEU in the core, and meeting launch safety requirements. The multi-physics analyses determine the impacts of the various design changes on the reactor's neutronics and thermal-hydraulics performance. The option of increasing the operational life of a reactor by loading it on the Moon is exercised for the Pellet Bed Reactor (PeBR). The PeBR uses spherical fuel pellets and is cooled by He-Xe gas, allowing the reactor core to be loaded with fuel pellets and charged with working fluid on the lunar surface. The performed neutronics analyses ensure the PeBR design achieves a long operational life, and develops safe launch canister designs to transport the spherical fuel pellets to the lunar surface. The research also investigates loading the PeBR core with fuel pellets on the Moon using a transient Discrete

  13. Numerical Stability and Accuracy of Temporally Coupled Multi-Physics Modules in Wind-Turbine CAE Tools

    SciTech Connect

    Gasmi, A.; Sprague, M. A.; Jonkman, J. M.; Jones, W. B.

    2013-02-01

    In this paper we examine the stability and accuracy of numerical algorithms for coupling time-dependent multi-physics modules relevant to computer-aided engineering (CAE) of wind turbines. This work is motivated by an in-progress major revision of FAST, the National Renewable Energy Laboratory's (NREL's) premier aero-elastic CAE simulation tool. We employ two simple examples as test systems, while algorithm descriptions are kept general. Coupled-system governing equations are framed in monolithic and partitioned representations as differential-algebraic equations. Explicit and implicit loose partition coupling is examined. In explicit coupling, partitions are advanced in time from known information. In implicit coupling, there is dependence on other-partition data at the next time step; coupling is accomplished through a predictor-corrector (PC) approach. Numerical time integration of coupled ordinary-differential equations (ODEs) is accomplished with one of three, fourth-order fixed-time-increment methods: Runge-Kutta (RK), Adams-Bashforth (AB), and Adams-Bashforth-Moulton (ABM). Through numerical experiments it is shown that explicit coupling can be dramatically less stable and less accurate than simulations performed with the monolithic system. However, PC implicit coupling restored stability and fourth-order accuracy for ABM; only second-order accuracy was achieved with RK integration. For systems without constraints, explicit time integration with AB and explicit loose coupling exhibited desired accuracy and stability.

  14. TerraFERMA: The Transparent Finite Element Rapid Model Assembler for multi-physics problems in the solid Earth sciences

    NASA Astrophysics Data System (ADS)

    Spiegelman, M. W.; Wilson, C. R.; Van Keken, P. E.

    2013-12-01

    We announce the release of a new software infrastructure, TerraFERMA, the Transparent Finite Element Rapid Model Assembler for the exploration and solution of coupled multi-physics problems. The design of TerraFERMA is driven by two overarching computational needs in Earth sciences. The first is the need for increased flexibility in both problem description and solution strategies for coupled problems where small changes in model assumptions can often lead to dramatic changes in physical behavior. The second is the need for software and models that are more transparent so that results can be verified, reproduced and modified in a manner such that the best ideas in computation and earth science can be more easily shared and reused. TerraFERMA leverages three advanced open-source libraries for scientific computation that provide high level problem description (FEniCS), composable solvers for coupled multi-physics problems (PETSc) and a science neutral options handling system (SPuD) that allows the hierarchical management of all model options. TerraFERMA integrates these libraries into an easier to use interface that organizes the scientific and computational choices required in a model into a single options file, from which a custom compiled application is generated and run. Because all models share the same infrastructure, models become more reusable and reproducible. TerraFERMA inherits much of its functionality from the underlying libraries. It currently solves partial differential equations (PDE) using finite element methods on simplicial meshes of triangles (2D) and tetrahedra (3D). The software is particularly well suited for non-linear problems with complex coupling between components. We demonstrate the design and utility of TerraFERMA through examples of thermal convection and magma dynamics. TerraFERMA has been tested successfully against over 45 benchmark problems from 7 publications in incompressible and compressible convection, magmatic solitary waves

  15. Wind-Turbine Gear-Box Roller-Bearing Premature-Failure Caused by Grain-Boundary Hydrogen Embrittlement: A Multi-physics Computational Investigation

    NASA Astrophysics Data System (ADS)

    Grujicic, M.; Chenna, V.; Galgalikar, R.; Snipes, J. S.; Ramaswami, S.; Yavari, R.

    2014-11-01

    To help overcome the problem of horizontal-axis wind-turbine (HAWT) gear-box roller-bearing premature-failure, the root causes of this failure are currently being investigated using mainly laboratory and field-test experimental approaches. In the present work, an attempt is made to develop complementary computational methods and tools which can provide additional insight into the problem at hand (and do so with a substantially shorter turn-around time). Toward that end, a multi-physics computational framework has been developed which combines: (a) quantum-mechanical calculations of the grain-boundary hydrogen-embrittlement phenomenon and hydrogen bulk/grain-boundary diffusion (the two phenomena currently believed to be the main contributors to the roller-bearing premature-failure); (b) atomic-scale kinetic Monte Carlo-based calculations of the hydrogen-induced embrittling effect ahead of the advancing crack-tip; and (c) a finite-element analysis of the damage progression in, and the final failure of a prototypical HAWT gear-box roller-bearing inner raceway. Within this approach, the key quantities which must be calculated using each computational methodology are identified, as well as the quantities which must be exchanged between different computational analyses. The work demonstrates that the application of the present multi-physics computational framework enables prediction of the expected life of the most failure-prone HAWT gear-box bearing elements.

  16. A novel phenomenological multi-physics model of Li-ion battery cells

    NASA Astrophysics Data System (ADS)

    Oh, Ki-Yong; Samad, Nassim A.; Kim, Youngki; Siegel, Jason B.; Stefanopoulou, Anna G.; Epureanu, Bogdan I.

    2016-09-01

    A novel phenomenological multi-physics model of Lithium-ion battery cells is developed for control and state estimation purposes. The model can capture electrical, thermal, and mechanical behaviors of battery cells under constrained conditions, e.g., battery pack conditions. Specifically, the proposed model predicts the core and surface temperatures and reaction force induced from the volume change of battery cells because of electrochemically- and thermally-induced swelling. Moreover, the model incorporates the influences of changes in preload and ambient temperature on the force considering severe environmental conditions electrified vehicles face. Intensive experimental validation demonstrates that the proposed multi-physics model accurately predicts the surface temperature and reaction force for a wide operational range of preload and ambient temperature. This high fidelity model can be useful for more accurate and robust state of charge estimation considering the complex dynamic behaviors of the battery cell. Furthermore, the inherent simplicity of the mechanical measurements offers distinct advantages to improve the existing power and thermal management strategies for battery management.

  17. A flexible uncertainty quantification method for linearly coupled multi-physics systems

    SciTech Connect

    Chen, Xiao Ng, Brenda; Sun, Yunwei; Tong, Charles

    2013-09-01

    Highlights: •We propose a “modularly hybrid” UQ methodology suitable for independent development of module-based multi-physics simulation. •Our algorithmic framework allows for each module to have its own UQ method (either intrusive or non-intrusive). •Information from each module is combined systematically to propagate “global uncertainty”. •Our proposed approach can allow for easy swapping of new methods for any modules without the need to address incompatibilities. •We demonstrate the proposed framework on a practical application involving a multi-species reactive transport model. -- Abstract: This paper presents a novel approach to building an integrated uncertainty quantification (UQ) methodology suitable for modern-day component-based approach for multi-physics simulation development. Our “hybrid” UQ methodology supports independent development of the most suitable UQ method, intrusive or non-intrusive, for each physics module by providing an algorithmic framework to couple these “stochastic” modules for propagating “global” uncertainties. We address algorithmic and computational issues associated with the construction of this hybrid framework. We demonstrate the utility of such a framework on a practical application involving a linearly coupled multi-species reactive transport model.

  18. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  19. Multi-physics optimization of three-dimensional microvascular polymeric components

    NASA Astrophysics Data System (ADS)

    Aragón, Alejandro M.; Saksena, Rajat; Kozola, Brian D.; Geubelle, Philippe H.; Christensen, Kenneth T.; White, Scott R.

    2013-01-01

    This work discusses the computational design of microvascular polymeric materials, which aim at mimicking the behavior found in some living organisms that contain a vascular system. The optimization of the topology of the embedded three-dimensional microvascular network is carried out by coupling a multi-objective constrained genetic algorithm with a finite-element based physics solver, the latter validated through experiments. The optimization is carried out on multiple conflicting objective functions, namely the void volume fraction left by the network, the energy required to drive the fluid through the network and the maximum temperature when the material is subjected to thermal loads. The methodology presented in this work results in a viable alternative for the multi-physics optimization of these materials for active-cooling applications.

  20. Module-based Hybrid Uncertainty Quantification for Multi-physics Applications: Theory and Software

    SciTech Connect

    Tong, Charles; Chen, Xiao; Iaccarino, Gianluca; Mittal, Akshay

    2013-10-08

    In this project we proposed to develop an innovative uncertainty quantification methodology that captures the best of the two competing approaches in UQ, namely, intrusive and non-intrusive approaches. The idea is to develop the mathematics and the associated computational framework and algorithms to facilitate the use of intrusive or non-intrusive UQ methods in different modules of a multi-physics multi-module simulation model in a way that physics code developers for different modules are shielded (as much as possible) from the chores of accounting for the uncertain ties introduced by the other modules. As the result of our research and development, we have produced a number of publications, conference presentations, and a software product.

  1. Multi-Physics Markov Chain Monte Carlo Methods for Subsurface Flows

    NASA Astrophysics Data System (ADS)

    Rigelo, J.; Ginting, V.; Rahunanthan, A.; Pereira, F.

    2014-12-01

    For CO2 sequestration in deep saline aquifers, contaminant transport in subsurface, and oil or gas recovery, we often need to forecast flow patterns. Subsurface characterization is a critical and challenging step in flow forecasting. To characterize subsurface properties we establish a statistical description of the subsurface properties that are conditioned to existing dynamic and static data. A Markov Chain Monte Carlo (MCMC) algorithm is used in a Bayesian statistical description to reconstruct the spatial distribution of rock permeability and porosity. The MCMC algorithm requires repeatedly solving a set of nonlinear partial differential equations describing displacement of fluids in porous media for different values of permeability and porosity. The time needed for the generation of a reliable MCMC chain using the algorithm can be too long to be practical for flow forecasting. In this work we develop fast and effective computational methods for generating MCMC chains in the Bayesian framework for the subsurface characterization. Our strategy consists of constructing a family of computationally inexpensive preconditioners based on simpler physics as well as on surrogate models such that the number of fine-grid simulations is drastically reduced in the generated MCMC chains. In particular, we introduce a huff-puff technique as screening step in a three-stage multi-physics MCMC algorithm to reduce the number of expensive final stage simulations. The huff-puff technique in the algorithm enables a better characterization of subsurface near wells. We assess the quality of the proposed multi-physics MCMC methods by considering Monte Carlo simulations for forecasting oil production in an oil reservoir.

  2. Optimization and Parallelization of the Thermal-Hydraulic Sub-channel Code CTF for High-Fidelity Multi-physics Applications

    SciTech Connect

    Salko, Robert K; Schmidt, Rodney; Avramova, Maria N

    2014-01-01

    This paper describes major improvements to the computational infrastructure of the CTF sub-channel code so that full-core sub-channel-resolved simulations can now be performed in much shorter run-times, either in stand-alone mode or as part of coupled-code multi-physics calculations. These improvements support the goals of the Department Of Energy (DOE) Consortium for Advanced Simulations of Light Water (CASL) Energy Innovation Hub to develop high fidelity multi-physics simulation tools for nuclear energy design and analysis. A set of serial code optimizations--including fixing computational inefficiencies, optimizing the numerical approach, and making smarter data storage choices--are first described and shown to reduce both execution time and memory usage by about a factor of ten. Next, a Single Program Multiple Data (SPMD) parallelization strategy targeting distributed memory Multiple Instruction Multiple Data (MIMD) platforms and utilizing domain-decomposition is presented. In this approach, data communication between processors is accomplished by inserting standard MPI calls at strategic points in the code. The domain decomposition approach implemented assigns one MPI process to each fuel assembly, with each domain being represented by its own CTF input file. The creation of CTF input files, both for serial and parallel runs, is also fully automated through use of a pre-processor utility that takes a greatly reduced set of user input over the traditional CTF input file. To run CTF in parallel, two additional libraries are currently needed; MPI, for inter-processor message passing, and the Parallel Extensible Toolkit for Scientific Computation (PETSc), which is leveraged to solve the global pressure matrix in parallel. Results presented include a set of testing and verification calculations and performance tests assessing parallel scaling characteristics up to a full core, sub-channel-resolved model of Watts Bar Unit 1 under hot full-power conditions (193 17x17

  3. Data-driven prognosis: a multi-physics approach verified via balloon burst experiment

    PubMed Central

    Chandra, Abhijit; Kar, Oliva

    2015-01-01

    A multi-physics formulation for data-driven prognosis (DDP) is developed. Unlike traditional predictive strategies that require controlled offline measurements or ‘training’ for determination of constitutive parameters to derive the transitional statistics, the proposed DDP algorithm relies solely on in situ measurements. It uses a deterministic mechanics framework, but the stochastic nature of the solution arises naturally from the underlying assumptions regarding the order of the conservation potential as well as the number of dimensions involved. The proposed DDP scheme is capable of predicting onset of instabilities. Because the need for offline testing (or training) is obviated, it can be easily implemented for systems where such a priori testing is difficult or even impossible to conduct. The prognosis capability is demonstrated here via a balloon burst experiment where the instability is predicted using only online visual observations. The DDP scheme never failed to predict the incipient failure, and no false-positives were issued. The DDP algorithm is applicable to other types of datasets. Time horizons of DDP predictions can be adjusted by using memory over different time windows. Thus, a big dataset can be parsed in time to make a range of predictions over varying time horizons. PMID:27547071

  4. Coupling between a multi-physics workflow engine and an optimization framework

    NASA Astrophysics Data System (ADS)

    Di Gallo, L.; Reux, C.; Imbeaux, F.; Artaud, J.-F.; Owsiak, M.; Saoutic, B.; Aiello, G.; Bernardi, P.; Ciraolo, G.; Bucalossi, J.; Duchateau, J.-L.; Fausser, C.; Galassi, D.; Hertout, P.; Jaboulay, J.-C.; Li-Puma, A.; Zani, L.

    2016-03-01

    A generic coupling method between a multi-physics workflow engine and an optimization framework is presented in this paper. The coupling architecture has been developed in order to preserve the integrity of the two frameworks. The objective is to provide the possibility to replace a framework, a workflow or an optimizer by another one without changing the whole coupling procedure or modifying the main content in each framework. The coupling is achieved by using a socket-based communication library for exchanging data between the two frameworks. Among a number of algorithms provided by optimization frameworks, Genetic Algorithms (GAs) have demonstrated their efficiency on single and multiple criteria optimization. Additionally to their robustness, GAs can handle non-valid data which may appear during the optimization. Consequently GAs work on most general cases. A parallelized framework has been developed to reduce the time spent for optimizations and evaluation of large samples. A test has shown a good scaling efficiency of this parallelized framework. This coupling method has been applied to the case of SYCOMORE (SYstem COde for MOdeling tokamak REactor) which is a system code developed in form of a modular workflow for designing magnetic fusion reactors. The coupling of SYCOMORE with the optimization platform URANIE enables design optimization along various figures of merit and constraints.

  5. Multi-physical model of cation and water transport in ionic polymer-metal composite sensors

    NASA Astrophysics Data System (ADS)

    Zhu, Zicai; Chang, Longfei; Horiuchi, Tetsuya; Takagi, Kentaro; Aabloo, Alvo; Asaka, Kinji

    2016-03-01

    Ion-migration based electrical potential widely exists not only in natural systems but also in ionic polymer materials. We presented a multi-physical model and investigated the transport process of cation and water of ionic polymer-metal composites based on our thorough understanding on the ionic sensing mechanisms in this paper. The whole transport process was depicted by transport equations concerning convection flux under the total pressure gradient, electrical migration by the built-in electrical field, and the inter-coupling effect between cation and water. With numerical analysis, the influence of critical material parameters, the elastic modulus Ewet, the hydraulic permeability coefficient K, the diffusion coefficient of cation dII and water dWW, and the drag coefficient of water ndW, on the distribution of cation and water was investigated. It was obtained how these parameters correlate to the voltage characteristics (both magnitude and response speed) under a step bending. Additionally, it was found that the effective relative dielectric constant ɛr has little influence on the voltage but is positively correlated to the current. With a series of optimized parameters, the predicted voltage agreed with the experimental results well, which validated our model. Based on our physical model, it was suggested that an ionic polymer sensor can benefit from a higher modulus Ewet, a higher coefficient K and a lower coefficient dII, and a higher constant ɛr.

  6. An RCM multi-physics ensemble over Europe: multi-variable evaluation to avoid error compensation

    NASA Astrophysics Data System (ADS)

    García-Díez, Markel; Fernández, Jesús; Vautard, Robert

    2015-12-01

    Regional Climate Models are widely used tools to add detail to the coarse resolution of global simulations. However, these are known to be affected by biases. Usually, published model evaluations use a reduced number of variables, frequently precipitation and temperature. Due to the complexity of the models, this may not be enough to assess their physical realism (e.g. to enable a fair comparison when weighting ensemble members). Furthermore, looking at only a few variables makes difficult to trace model errors. Thus, in many previous studies, these biases are described but their underlying causes and mechanisms are often left unknown. In this work the ability of a multi-physics ensemble in reproducing the observed climatologies of many variables over Europe is analysed. These are temperature, precipitation, cloud cover, radiative fluxes and total soil moisture content. It is found that, during winter, the model suffers a significant cold bias over snow covered regions. This is shown to be related with a poor representation of the snow-atmosphere interaction, and is amplified by an albedo feedback. It is shown how two members of the ensemble are able to alleviate this bias, but by generating a too large cloud cover. During summer, a large sensitivity to the cumulus parameterization is found, related to large differences in the cloud cover and short wave radiation flux. Results also show that small errors in one variable are sometimes a result of error compensation, so the high dimensionality of the model evaluation problem cannot be disregarded.

  7. Partitioned coupling strategies for multi-physically coupled radiative heat transfer problems

    NASA Astrophysics Data System (ADS)

    Wendt, Gunnar; Erbts, Patrick; Düster, Alexander

    2015-11-01

    This article aims to propose new aspects concerning a partitioned solution strategy for multi-physically coupled fields including the physics of thermal radiation. Particularly, we focus on the partitioned treatment of electro-thermo-mechanical problems with an additional fourth thermal radiation field. One of the main goals is to take advantage of the flexibility of the partitioned approach to enable combinations of different simulation software and solvers. Within the frame of this article, we limit ourselves to the case of nonlinear thermoelasticity at finite strains, using temperature-dependent material parameters. For the thermal radiation field, diffuse radiating surfaces and gray participating media are assumed. Moreover, we present a robust and fast partitioned coupling strategy for the fourth field problem. Stability and efficiency of the implicit coupling algorithm are improved drawing on several methods to stabilize and to accelerate the convergence. To conclude and to review the effectiveness and the advantages of the additional thermal radiation field several numerical examples are considered to study the proposed algorithm. In particular we focus on an industrial application, namely the electro-thermo-mechanical modeling of the field-assisted sintering technology.

  8. Multi-physics model of a thermo-magnetic energy harvester

    NASA Astrophysics Data System (ADS)

    Joshi, Keyur B.; Priya, Shashank

    2013-05-01

    Harvesting small thermal gradients effectively to generate electricity still remains a challenge. Ujihara et al (2007 Appl. Phys. Lett. 91 093508) have recently proposed a thermo-magnetic energy harvester that incorporates a combination of hard and soft magnets on a vibrating beam structure and two opposing heat transfer surfaces. This design has many advantages and could present an optimum solution to harvest energy in low temperature gradient conditions. In this paper, we describe a multi-physics numerical model for this harvester configuration that incorporates all the relevant parameters, including heat transfer, magnetic force, beam vibration, contact surface and piezoelectricity. The model was used to simulate the complete transient behavior of the system. Results are presented for the evolution of the magnetic force, changes in the internal temperature of the soft magnet (gadolinium (Gd)), thermal contact conductance, contact pressure and heat transfer over a complete cycle. Variation of the vibration frequency with contact stiffness and gap distance was also modeled. Limit cycle behavior and its bifurcations are illustrated as a function of device parameters. The model was extended to include a piezoelectric energy harvesting mechanism and, using a piezoelectric bimorph as spring material, a maximum power of 318 μW was predicted across a 100 kΩ external load.

  9. Research on Structural Safety of the Stratospheric Airship Based on Multi-Physics Coupling Calculation

    NASA Astrophysics Data System (ADS)

    Ma, Z.; Hou, Z.; Zang, X.

    2015-09-01

    As a large-scale flexible inflatable structure by a huge inner lifting gas volume of several hundred thousand cubic meters, the stratospheric airship's thermal characteristic of inner gas plays an important role in its structural performance. During the floating flight, the day-night variation of the combined thermal condition leads to the fluctuation of the flow field inside the airship, which will remarkably affect the pressure acted on the skin and the structural safety of the stratospheric airship. According to the multi-physics coupling mechanism mentioned above, a numerical procedure of structural safety analysis of stratospheric airships is developed and the thermal model, CFD model, finite element code and criterion of structural strength are integrated. Based on the computation models, the distributions of the deformations and stresses of the skin are calculated with the variation of day-night time. The effects of loads conditions and structural configurations on the structural safety of stratospheric airships in the floating condition are evaluated. The numerical results can be referenced for the structural design of stratospheric airships.

  10. Final report on LDRD project : coupling strategies for multi-physics applications.

    SciTech Connect

    Hopkins, Matthew Morgan; Moffat, Harry K.; Carnes, Brian; Hooper, Russell Warren; Pawlowski, Roger P.

    2007-11-01

    Many current and future modeling applications at Sandia including ASC milestones will critically depend on the simultaneous solution of vastly different physical phenomena. Issues due to code coupling are often not addressed, understood, or even recognized. The objectives of the LDRD has been both in theory and in code development. We will show that we have provided a fundamental analysis of coupling, i.e., when strong coupling vs. a successive substitution strategy is needed. We have enabled the implementation of tighter coupling strategies through additions to the NOX and Sierra code suites to make coupling strategies available now. We have leveraged existing functionality to do this. Specifically, we have built into NOX the capability to handle fully coupled simulations from multiple codes, and we have also built into NOX the capability to handle Jacobi Free Newton Krylov simulations that link multiple applications. We show how this capability may be accessed from within the Sierra Framework as well as from outside of Sierra. The critical impact from this LDRD is that we have shown how and have delivered strategies for enabling strong Newton-based coupling while respecting the modularity of existing codes. This will facilitate the use of these codes in a coupled manner to solve multi-physic applications.

  11. Osiris: A Modern, High-Performance, Coupled, Multi-Physics Code For Nuclear Reactor Core Analysis

    SciTech Connect

    Procassini, R J; Chand, K K; Clouse, C J; Ferencz, R M; Grandy, J M; Henshaw, W D; Kramer, K J; Parsons, I D

    2007-02-26

    To meet the simulation needs of the GNEP program, LLNL is leveraging a suite of high-performance codes to be used in the development of a multi-physics tool for modeling nuclear reactor cores. The Osiris code project, which began last summer, is employing modern computational science techniques in the development of the individual physics modules and the coupling framework. Initial development is focused on coupling thermal-hydraulics and neutral-particle transport, while later phases of the project will add thermal-structural mechanics and isotope depletion. Osiris will be applicable to the design of existing and future reactor systems through the use of first-principles, coupled physics models with fine-scale spatial resolution in three dimensions and fine-scale particle-energy resolution. Our intent is to replace an existing set of legacy, serial codes which require significant approximations and assumptions, with an integrated, coupled code that permits the design of a reactor core using a first-principles physics approach on a wide range of computing platforms, including the world's most powerful parallel computers. A key research activity of this effort deals with the efficient and scalable coupling of physics modules which utilize rather disparate mesh topologies. Our approach allows each code module to use a mesh topology and resolution that is optimal for the physics being solved, and employs a mesh-mapping and data-transfer module to effect the coupling. Additional research is planned in the area of scalable, parallel thermal-hydraulics, high-spatial-accuracy depletion and coupled-physics simulation using Monte Carlo transport.

  12. Towards a multi-physics modelling framework for thrombolysis under the influence of blood flow

    PubMed Central

    Piebalgs, Andris

    2015-01-01

    Thrombolytic therapy is an effective means of treating thromboembolic diseases but can also give rise to life-threatening side effects. The infusion of a high drug concentration can provoke internal bleeding while an insufficient dose can lead to artery reocclusion. It is hoped that mathematical modelling of the process of clot lysis can lead to a better understanding and improvement of thrombolytic therapy. To this end, a multi-physics continuum model has been developed to simulate the dissolution of clot over time upon the addition of tissue plasminogen activator (tPA). The transport of tPA and other lytic proteins is modelled by a set of reaction–diffusion–convection equations, while blood flow is described by volume-averaged continuity and momentum equations. The clot is modelled as a fibrous porous medium with its properties being determined as a function of the fibrin fibre radius and voidage of the clot. A unique feature of the model is that it is capable of simulating the entire lytic process from the initial phase of lysis of an occlusive thrombus (diffusion-limited transport), the process of recanalization, to post-canalization thrombolysis under the influence of convective blood flow. The model has been used to examine the dissolution of a fully occluding clot in a simplified artery at different pressure drops. Our predicted lytic front velocities during the initial stage of lysis agree well with experimental and computational results reported by others. Following canalization, clot lysis patterns are strongly influenced by local flow patterns, which are symmetric at low pressure drops, but asymmetric at higher pressure drops, which give rise to larger recirculation regions and extended areas of intense drug accumulation. PMID:26655469

  13. Variability of West African monsoon patterns generated by a WRF multi-physics ensemble

    NASA Astrophysics Data System (ADS)

    Klein, Cornelia; Heinzeller, Dominikus; Bliefernicht, Jan; Kunstmann, Harald

    2015-11-01

    The credibility of regional climate simulations over West Africa stands and falls with the ability to reproduce the West African monsoon (WAM) whose precipitation plays a pivotal role for people's livelihood. In this study, we simulate the WAM for the wet year 1999 with a 27-member multi-physics ensemble of the Weather Research and Forecasting (WRF) model. We investigate the inter-member differences in a process-based manner in order to extract generalizable information on the behavior of the tested cumulus (CU), microphysics (MP), and planetary boundary layer (PBL) schemes. Precipitation, temperature and atmospheric dynamics are analyzed in comparison to the Tropical Rainfall Measuring Mission (TRMM) rainfall estimates, the Global Precipitation Climatology Centre (GPCC) gridded gauge-analysis, the Global Historical Climatology Network (GHCN) gridded temperature product and the forcing data (ERA-Interim) to explore interdependencies of processes leading to a certain WAM regime. We find that MP and PBL schemes contribute most to the ensemble spread (147 mm month-1) for monsoon precipitation over the study region. Furthermore, PBL schemes have a strong influence on the movement of the WAM rainband because of their impact on the cloud fraction, that ranges from 8 to 20 % at 600 hPa during August. More low- and mid-level clouds result in less incoming radiation and a weaker monsoon. Ultimately, we identify the differing intensities of the moist Hadley-type meridional circulation that connects the monsoon winds to the Tropical Easterly Jet as the main source for inter-member differences. The ensemble spread of Sahel precipitation and associated dynamics for August 1999 is comparable to the observed inter-annual spread (1979-2010) between dry and wet years, emphasizing the strong potential impact of regional processes and the need for a careful selection of model parameterizations.

  14. Towards a multi-physics modelling framework for thrombolysis under the influence of blood flow.

    PubMed

    Piebalgs, Andris; Xu, X Yun

    2015-12-01

    Thrombolytic therapy is an effective means of treating thromboembolic diseases but can also give rise to life-threatening side effects. The infusion of a high drug concentration can provoke internal bleeding while an insufficient dose can lead to artery reocclusion. It is hoped that mathematical modelling of the process of clot lysis can lead to a better understanding and improvement of thrombolytic therapy. To this end, a multi-physics continuum model has been developed to simulate the dissolution of clot over time upon the addition of tissue plasminogen activator (tPA). The transport of tPA and other lytic proteins is modelled by a set of reaction-diffusion-convection equations, while blood flow is described by volume-averaged continuity and momentum equations. The clot is modelled as a fibrous porous medium with its properties being determined as a function of the fibrin fibre radius and voidage of the clot. A unique feature of the model is that it is capable of simulating the entire lytic process from the initial phase of lysis of an occlusive thrombus (diffusion-limited transport), the process of recanalization, to post-canalization thrombolysis under the influence of convective blood flow. The model has been used to examine the dissolution of a fully occluding clot in a simplified artery at different pressure drops. Our predicted lytic front velocities during the initial stage of lysis agree well with experimental and computational results reported by others. Following canalization, clot lysis patterns are strongly influenced by local flow patterns, which are symmetric at low pressure drops, but asymmetric at higher pressure drops, which give rise to larger recirculation regions and extended areas of intense drug accumulation.

  15. Design and Analysis of a New Hair Sensor for Multi-Physical Signal Measurement.

    PubMed

    Yang, Bo; Hu, Di; Wu, Lei

    2016-07-08

    A new hair sensor for multi-physical signal measurements, including acceleration, angular velocity and air flow, is presented in this paper. The entire structure consists of a hair post, a torsional frame and a resonant signal transducer. The hair post is utilized to sense and deliver the physical signals of the acceleration and the air flow rate. The physical signals are converted into frequency signals by the resonant transducer. The structure is optimized through finite element analysis. The simulation results demonstrate that the hair sensor has a frequency of 240 Hz in the first mode for the acceleration or the air flow sense, 3115 Hz in the third and fourth modes for the resonant conversion, and 3467 Hz in the fifth and sixth modes for the angular velocity transformation, respectively. All the above frequencies present in a reasonable modal distribution and are separated from interference modes. The input-output analysis of the new hair sensor demonstrates that the scale factor of the acceleration is 12.35 Hz/g, the scale factor of the angular velocity is 0.404 nm/deg/s and the sensitivity of the air flow is 1.075 Hz/(m/s)², which verifies the multifunction sensitive characteristics of the hair sensor. Besides, the structural optimization of the hair post is used to improve the sensitivity of the air flow rate and the acceleration. The analysis results illustrate that the hollow circular hair post can increase the sensitivity of the air flow and the II-shape hair post can increase the sensitivity of the acceleration. Moreover, the thermal analysis confirms the scheme of the frequency difference for the resonant transducer can prominently eliminate the temperature influences on the measurement accuracy. The air flow analysis indicates that the surface area increase of hair post is significantly beneficial for the efficiency improvement of the signal transmission. In summary, the structure of the new hair sensor is proved to be feasible by comprehensive

  16. Supercomputing with TOUGH2 family codes for coupled multi-physics simulations of geologic carbon sequestration

    NASA Astrophysics Data System (ADS)

    Yamamoto, H.; Nakajima, K.; Zhang, K.; Nanai, S.

    2015-12-01

    scalabilities showing almost linear speedup against number of processors up to over ten thousand cores. Generally this allows us to perform coupled multi-physics (THC) simulations on high resolution geologic models with multi-million grid in a practical time (e.g., less than a second per time step).

  17. Design and Analysis of a New Hair Sensor for Multi-Physical Signal Measurement.

    PubMed

    Yang, Bo; Hu, Di; Wu, Lei

    2016-01-01

    A new hair sensor for multi-physical signal measurements, including acceleration, angular velocity and air flow, is presented in this paper. The entire structure consists of a hair post, a torsional frame and a resonant signal transducer. The hair post is utilized to sense and deliver the physical signals of the acceleration and the air flow rate. The physical signals are converted into frequency signals by the resonant transducer. The structure is optimized through finite element analysis. The simulation results demonstrate that the hair sensor has a frequency of 240 Hz in the first mode for the acceleration or the air flow sense, 3115 Hz in the third and fourth modes for the resonant conversion, and 3467 Hz in the fifth and sixth modes for the angular velocity transformation, respectively. All the above frequencies present in a reasonable modal distribution and are separated from interference modes. The input-output analysis of the new hair sensor demonstrates that the scale factor of the acceleration is 12.35 Hz/g, the scale factor of the angular velocity is 0.404 nm/deg/s and the sensitivity of the air flow is 1.075 Hz/(m/s)², which verifies the multifunction sensitive characteristics of the hair sensor. Besides, the structural optimization of the hair post is used to improve the sensitivity of the air flow rate and the acceleration. The analysis results illustrate that the hollow circular hair post can increase the sensitivity of the air flow and the II-shape hair post can increase the sensitivity of the acceleration. Moreover, the thermal analysis confirms the scheme of the frequency difference for the resonant transducer can prominently eliminate the temperature influences on the measurement accuracy. The air flow analysis indicates that the surface area increase of hair post is significantly beneficial for the efficiency improvement of the signal transmission. In summary, the structure of the new hair sensor is proved to be feasible by comprehensive

  18. Design and Analysis of a New Hair Sensor for Multi-Physical Signal Measurement

    PubMed Central

    Yang, Bo; Hu, Di; Wu, Lei

    2016-01-01

    A new hair sensor for multi-physical signal measurements, including acceleration, angular velocity and air flow, is presented in this paper. The entire structure consists of a hair post, a torsional frame and a resonant signal transducer. The hair post is utilized to sense and deliver the physical signals of the acceleration and the air flow rate. The physical signals are converted into frequency signals by the resonant transducer. The structure is optimized through finite element analysis. The simulation results demonstrate that the hair sensor has a frequency of 240 Hz in the first mode for the acceleration or the air flow sense, 3115 Hz in the third and fourth modes for the resonant conversion, and 3467 Hz in the fifth and sixth modes for the angular velocity transformation, respectively. All the above frequencies present in a reasonable modal distribution and are separated from interference modes. The input-output analysis of the new hair sensor demonstrates that the scale factor of the acceleration is 12.35 Hz/g, the scale factor of the angular velocity is 0.404 nm/deg/s and the sensitivity of the air flow is 1.075 Hz/(m/s)2, which verifies the multifunction sensitive characteristics of the hair sensor. Besides, the structural optimization of the hair post is used to improve the sensitivity of the air flow rate and the acceleration. The analysis results illustrate that the hollow circular hair post can increase the sensitivity of the air flow and the II-shape hair post can increase the sensitivity of the acceleration. Moreover, the thermal analysis confirms the scheme of the frequency difference for the resonant transducer can prominently eliminate the temperature influences on the measurement accuracy. The air flow analysis indicates that the surface area increase of hair post is significantly beneficial for the efficiency improvement of the signal transmission. In summary, the structure of the new hair sensor is proved to be feasible by comprehensive

  19. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  20. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  1. Multi-physics and multi-scale characterization of shale anisotropy

    NASA Astrophysics Data System (ADS)

    Sarout, J.; Nadri, D.; Delle Piane, C.; Esteban, L.; Dewhurst, D.; Clennell, M. B.

    2012-12-01

    Shales are the most abundant sedimentary rock type in the Earth's shallow crust. In the past decade or so, they have attracted increased attention from the petroleum industry as reservoirs, as well as more traditionally for their sealing capacity for hydrocarbon/CO2 traps or underground waste repositories. The effectiveness of both fundamental and applied shale research is currently limited by (i) the extreme variability of physical, mechanical and chemical properties observed for these rocks, and by (ii) the scarce data currently available. The variability in observed properties is poorly understood due to many factors that are often irrelevant for other sedimentary rocks. The relationships between these properties and the petrophysical measurements performed at the field and laboratory scales are not straightforward, translating to a scale dependency typical of shale behaviour. In addition, the complex and often anisotropic micro-/meso-structures of shales give rise to a directional dependency of some of the measured physical properties that are tensorial by nature such as permeability or elastic stiffness. Currently, fundamental understanding of the parameters controlling the directional and scale dependency of shale properties is far from complete. Selected results of a multi-physics laboratory investigation of the directional and scale dependency of some critical shale properties are reported. In particular, anisotropic features of shale micro-/meso-structures are related to the directional-dependency of elastic and fluid transport properties: - Micro-/meso-structure (μm to cm scale) characterization by electron microscopy and X-ray tomography; - Estimation of elastic anisotropy parameters on a single specimen using elastic wave propagation (cm scale); - Estimation of the permeability tensor using the steady-state method on orthogonal specimens (cm scale); - Estimation of the low-frequency diffusivity tensor using NMR method on orthogonal specimens (<

  2. Development of a multi-physics calculation platform dedicated to irradiation devices in a material testing reactor

    SciTech Connect

    Bonaccorsi, T.; Di Salvo, J.; Aggery, A.; D'Aletto, C.; Doederlein, C.; Sireta, P.; Willermoz, G.; Daniel, M.

    2006-07-01

    The physical phenomena involved in irradiation devices within material testing reactors are complex (neutron and photon interactions, nuclear heating, thermal hydraulics, ...). However, the simulation of these phenomena requires a high precision in order to control the condition of the experiment and the development of predictive models. Until now, physicists use different tools with several approximations at each interface. The aim of this work is to develop a calculation platform dedicated to numerical multi-physics simulations of irradiation devices in the future European Jules Horowitz Reactor [1], This platform is based on a multi-physics data model which describes geometries, materials and state parameters associated with a sequence of thematic (neutronics, thermal hydraulics...) computations of these devices. Once the computation is carried out, the results can be returned to the data model (DM). The DM is encapsulated in a dedicated module of the SALOME platform [2] and exchanges data with SALOME native modules. This method allows a parametric description of a study, independent of the code used to perform the simulation. The application proposed in this paper concerns neutronic calculation of a fuel irradiation device with the new method of characteristics implemented in the APOLLO2 code [3]. The device is located at the periphery of the OSIRIS core. This choice is motivated by the possibility to compare the calculation with experimental results, which cannot be done for the Jules Horowitz Reactor, currently in design study phase. (authors)

  3. Multi-physics computational grains (MPCGs) for direct numerical simulation (DNS) of piezoelectric composite/porous materials and structures

    NASA Astrophysics Data System (ADS)

    Bishay, Peter L.; Dong, Leiting; Atluri, Satya N.

    2014-11-01

    Conceptually simple and computationally most efficient polygonal computational grains with voids/inclusions are proposed for the direct numerical simulation of the micromechanics of piezoelectric composite/porous materials with non-symmetrical arrangement of voids/inclusions. These are named "Multi-Physics Computational Grains" (MPCGs) because each "mathematical grain" is geometrically similar to the irregular shapes of the physical grains of the material in the micro-scale. So each MPCG element represents a grain of the matrix of the composite and can include a pore or an inclusion. MPCG is based on assuming independent displacements and electric-potentials in each cell. The trial solutions in each MPCG do not need to satisfy the governing differential equations, however, they are still complete, and can efficiently model concentration of electric and mechanical fields. MPCG can be used to model any generally anisotropic material as well as nonlinear problems. The essential idea can also be easily applied to accurately solve other multi-physical problems, such as complex thermal-electro-magnetic-mechanical materials modeling. Several examples are presented to show the capabilities of the proposed MPCGs and their accuracy.

  4. Schwann Cells Metabolize Extracellular 2',3'-cAMP to 2'-AMP.

    PubMed

    Verrier, Jonathan D; Kochanek, Patrick M; Jackson, Edwin K

    2015-08-01

    The 3',5'-cAMP-adenosine pathway (3',5'-cAMP→5'-AMP→adenosine) and the 2',3'-cAMP-adenosine pathway (2',3'-cAMP→2'-AMP/3'-AMP→adenosine) are active in the brain. Oligodendrocytes participate in the brain 2',3'-cAMP-adenosine pathway via their robust expression of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase; converts 2',3'-cAMP to 2'-AMP). Because Schwann cells also express CNPase, it is conceivable that the 2',3'-cAMP-adenosine pathway exists in the peripheral nervous system. To test this and to compare the 2',3'-cAMP-adenosine pathway to the 3',5'-cAMP-adenosine pathway in Schwann cells, we examined the metabolism of 2',3'-cAMP, 2'-AMP, 3'-AMP, 3',5'-cAMP, and 5'-AMP in primary rat Schwann cells in culture. Addition of 2',3'-cAMP (3, 10, and 30 µM) to Schwann cells increased levels of 2'-AMP in the medium from 0.006 ± 0.002 to 21 ± 2, 70 ± 3, and 187 ± 10 nM/µg protein, respectively; in contrast, Schwann cells had little ability to convert 2',3'-cAMP to 3'-AMP or 3',5'-cAMP to either 3'-AMP or 5'-AMP. Although Schwann cells slightly converted 2',3'-cAMP and 2'-AMP to adenosine, they did so at very modest rates (e.g., 5- and 3-fold, respectively, more slowly compared with our previously reported studies in oligodendrocytes). Using transected myelinated rat sciatic nerves in culture medium, we observed a time-related increase in endogenous intracellular 2',3'-cAMP and extracellular 2'-AMP. These findings indicate that Schwann cells do not have a robust 3',5'-cAMP-adenosine pathway but do have a 2',3'-cAMP-adenosine pathway; however, because the pathway mostly involves 2'-AMP formation rather than 3'-AMP, and because the conversion of 2'-AMP to adenosine is slow, metabolism of 2',3'-cAMP mostly results in the accumulation of 2'-AMP. Accumulation of 2'-AMP in peripheral nerves postinjury could have pathophysiological consequences. PMID:25998049

  5. Molt-inhibiting hormone stimulates vitellogenesis at advanced ovarian developmental stages in the female blue crab, Callinectes sapidus 2: novel specific binding sites in hepatopancreas and cAMP as a second messenger

    PubMed Central

    Zmora, Nilli; Sagi, Amir; Zohar, Yonathan; Chung, J Sook

    2009-01-01

    The finding that molt-inhibiting hormone (MIH) regulates vitellogenesis in the hepatopancreas of mature Callinectes sapidus females, raised the need for the characterization of its mode of action. Using classical radioligand binding assays, we located specific, saturable, and non-cooperative binding sites for MIH in the Y-organs of juveniles (J-YO) and in the hepatopancreas of vitellogenic adult females. MIH binding to the hepatopancreas membranes had an affinity 77 times lower than that of juvenile YO membranes (KD values: 3.22 × 10-8 and 4.19 × 10-10 M/mg protein, respectively). The number of maximum binding sites (BMAX) was approximately two times higher in the hepatopancreas than in the YO (BMAX values: 9.24 × 10-9 and 4.8 × 10-9 M/mg protein, respectively). Furthermore, MIH binding site number in the hepatopancreas was dependent on ovarian stage and was twice as high at stage 3 than at stages 2 and 1. SDS-PAGE separation of [125I] MIH or [125I] crustacean hyperglycemic hormone (CHH) crosslinked to the specific binding sites in the membranes of the J-YO and hepatopancreas suggests a molecular weight of ~51 kDa for a MIH receptor in both tissues and a molecular weight of ~61 kDa for a CHH receptor in the hepatopancreas. The use of an in vitro incubation of hepatopancreas fragments suggests that MIH probably utilizes cAMP as a second messenger in this tissue, as cAMP levels increased in response to MIH. Additionally, 8-Bromo-cAMP mimicked the effects of MIH on vitellogenin (VtG) mRNA and heterogeneous nuclear (hn) VtG RNA levels. The results imply that the functions of MIH in the regulation of molt and vitellogenesis are mediated through tissue specific receptors with different kinetics and signal transduction. MIH ability to regulate vitellogenesis is associated with the appearance of MIH specific membrane binding sites in the hepatopancreas upon pubertal/final molt. PMID:19583849

  6. A full-spectrum analysis of high-speed train interior noise under multi-physical-field coupling excitations

    NASA Astrophysics Data System (ADS)

    Zheng, Xu; Hao, Zhiyong; Wang, Xu; Mao, Jie

    2016-06-01

    High-speed-railway-train interior noise at low, medium, and high frequencies could be simulated by finite element analysis (FEA) or boundary element analysis (BEA), hybrid finite element analysis-statistical energy analysis (FEA-SEA) and statistical energy analysis (SEA), respectively. First, a new method named statistical acoustic energy flow (SAEF) is proposed, which can be applied to the full-spectrum HST interior noise simulation (including low, medium, and high frequencies) with only one model. In an SAEF model, the corresponding multi-physical-field coupling excitations are firstly fully considered and coupled to excite the interior noise. The interior noise attenuated by sound insulation panels of carriage is simulated through modeling the inflow acoustic energy from the exterior excitations into the interior acoustic cavities. Rigid multi-body dynamics, fast multi-pole BEA, and large-eddy simulation with indirect boundary element analysis are first employed to extract the multi-physical-field excitations, which include the wheel-rail interaction forces/secondary suspension forces, the wheel-rail rolling noise, and aerodynamic noise, respectively. All the peak values and their frequency bands of the simulated acoustic excitations are validated with those from the noise source identification test. Besides, the measured equipment noise inside equipment compartment is used as one of the excitation sources which contribute to the interior noise. Second, a full-trimmed FE carriage model is firstly constructed, and the simulated modal shapes and frequencies agree well with the measured ones, which has validated the global FE carriage model as well as the local FE models of the aluminum alloy-trim composite panel. Thus, the sound transmission loss model of any composite panel has indirectly been validated. Finally, the SAEF model of the carriage is constructed based on the accurate FE model and stimulated by the multi-physical-field excitations. The results show

  7. Evaluation of a transient, simultaneous, arbitrary Lagrange-Euler based multi-physics method for simulating the mitral heart valve.

    PubMed

    Espino, Daniel M; Shepherd, Duncan E T; Hukins, David W L

    2014-01-01

    A transient multi-physics model of the mitral heart valve has been developed, which allows simultaneous calculation of fluid flow and structural deformation. A recently developed contact method has been applied to enable simulation of systole (the stage when blood pressure is elevated within the heart to pump blood to the body). The geometry was simplified to represent the mitral valve within the heart walls in two dimensions. Only the mitral valve undergoes deformation. A moving arbitrary Lagrange-Euler mesh is used to allow true fluid-structure interaction (FSI). The FSI model requires blood flow to induce valve closure by inducing strains in the region of 10-20%. Model predictions were found to be consistent with existing literature and will undergo further development.

  8. Investigation on Multi-Physics Simulation-Based Virtual Machining System for Vibratory Finishing of Integrally Bladed Rotors (IBRS)

    NASA Astrophysics Data System (ADS)

    Achiamah-Ampomah, N.; Cheng, Kai

    2016-02-01

    An investigation was carried out to improve the slow surface finishing times of integrally bladed rotors (IBRs) in the aerospace industry. Traditionally they are finished by hand, or more currently by abrasive flow machining. The use of a vibratory finishing technique to improve process times has been suggested; however as a largely empirical process, very few studies have been done to improve and optimize the cycle times, showing that critical and ongoing research is still needed in this area. An extensive review of the literature was carried out, and the findings used to identify the key parameters and model equations which govern the vibratory process. Recommendations were made towards a multi-physics-based simulation model, as well as projections made for the future of vibratory finishing and optimization of surface finishes and cycle times.

  9. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  10. Multi-physics damage sensing in nano-engineered structural composites

    NASA Astrophysics Data System (ADS)

    Guzmán de Villoria, Roberto; Yamamoto, Namiko; Miravete, Antonio; Wardle, Brian L.

    2011-05-01

    Non-destructive evaluation techniques can offer viable diagnostic and prognostic routes to mitigating failures in engineered structures such as bridges, buildings and vehicles. However, existing techniques have significant drawbacks, including poor spatial resolution and limited in situ capabilities. We report here a novel approach where structural advanced composites containing electrically conductive aligned carbon nanotubes (CNTs) are ohmically heated via simple electrical contacts, and damage is visualized via thermographic imaging. Damage, in the form of cracks and other discontinuities, usefully increases resistance to both electrical and thermal transport in these materials, which enables tomographic full-field damage assessment in many cases. Characteristics of the technique include the ability for real-time measurement of the damage state during loading, low-power operation (e.g. 15 °C rise at 1 W), and beyond state-of-the-art spatial resolution for sensing damage in composites. The enhanced thermographic technique is a novel and practical approach for in situ monitoring to ascertain structural health and to prevent structural failures in engineered structures such as aerospace and automotive vehicles and wind turbine blades, among others.

  11. Multi-physics damage sensing in nano-engineered structural composites.

    PubMed

    de Villoria, Roberto Guzmán; Yamamoto, Namiko; Miravete, Antonio; Wardle, Brian L

    2011-05-01

    Non-destructive evaluation techniques can offer viable diagnostic and prognostic routes to mitigating failures in engineered structures such as bridges, buildings and vehicles. However, existing techniques have significant drawbacks, including poor spatial resolution and limited in situ capabilities. We report here a novel approach where structural advanced composites containing electrically conductive aligned carbon nanotubes (CNTs) are ohmically heated via simple electrical contacts, and damage is visualized via thermographic imaging. Damage, in the form of cracks and other discontinuities, usefully increases resistance to both electrical and thermal transport in these materials, which enables tomographic full-field damage assessment in many cases. Characteristics of the technique include the ability for real-time measurement of the damage state during loading, low-power operation (e.g. 15 °C rise at 1 W), and beyond state-of-the-art spatial resolution for sensing damage in composites. The enhanced thermographic technique is a novel and practical approach for in situ monitoring to ascertain structural health and to prevent structural failures in engineered structures such as aerospace and automotive vehicles and wind turbine blades, among others.

  12. Multi-physics damage sensing in nano-engineered structural composites.

    PubMed

    de Villoria, Roberto Guzmán; Yamamoto, Namiko; Miravete, Antonio; Wardle, Brian L

    2011-05-01

    Non-destructive evaluation techniques can offer viable diagnostic and prognostic routes to mitigating failures in engineered structures such as bridges, buildings and vehicles. However, existing techniques have significant drawbacks, including poor spatial resolution and limited in situ capabilities. We report here a novel approach where structural advanced composites containing electrically conductive aligned carbon nanotubes (CNTs) are ohmically heated via simple electrical contacts, and damage is visualized via thermographic imaging. Damage, in the form of cracks and other discontinuities, usefully increases resistance to both electrical and thermal transport in these materials, which enables tomographic full-field damage assessment in many cases. Characteristics of the technique include the ability for real-time measurement of the damage state during loading, low-power operation (e.g. 15 °C rise at 1 W), and beyond state-of-the-art spatial resolution for sensing damage in composites. The enhanced thermographic technique is a novel and practical approach for in situ monitoring to ascertain structural health and to prevent structural failures in engineered structures such as aerospace and automotive vehicles and wind turbine blades, among others. PMID:21427475

  13. Modeling and simulation of multi-physics multi-scale transport phenomenain bio-medical applications

    NASA Astrophysics Data System (ADS)

    Kenjereš, Saša

    2014-08-01

    We present a short overview of some of our most recent work that combines the mathematical modeling, advanced computer simulations and state-of-the-art experimental techniques of physical transport phenomena in various bio-medical applications. In the first example, we tackle predictions of complex blood flow patterns in the patient-specific vascular system (carotid artery bifurcation) and transfer of the so-called "bad" cholesterol (low-density lipoprotein, LDL) within the multi-layered artery wall. This two-way coupling between the blood flow and corresponding mass transfer of LDL within the artery wall is essential for predictions of regions where atherosclerosis can develop. It is demonstrated that a recently developed mathematical model, which takes into account the complex multi-layer arterial-wall structure, produced LDL profiles within the artery wall in good agreement with in-vivo experiments in rabbits, and it can be used for predictions of locations where the initial stage of development of atherosclerosis may take place. The second example includes a combination of pulsating blood flow and medical drug delivery and deposition controlled by external magnetic field gradients in the patient specific carotid artery bifurcation. The results of numerical simulations are compared with own PIV (Particle Image Velocimetry) and MRI (Magnetic Resonance Imaging) in the PDMS (silicon-based organic polymer) phantom. A very good agreement between simulations and experiments is obtained for different stages of the pulsating cycle. Application of the magnetic drug targeting resulted in an increase of up to ten fold in the efficiency of local deposition of the medical drug at desired locations. Finally, the LES (Large Eddy Simulation) of the aerosol distribution within the human respiratory system that includes up to eight bronchial generations is performed. A very good agreement between simulations and MRV (Magnetic Resonance Velocimetry) measurements is obtained

  14. The atmospheric component of the Mediterranean Sea water budget in a WRF multi-physics ensemble and observations

    NASA Astrophysics Data System (ADS)

    Di Luca, Alejandro; Flaounas, Emmanouil; Drobinski, Philippe; Brossier, Cindy Lebeaupin

    2014-11-01

    The use of high resolution atmosphere-ocean coupled regional climate models to study possible future climate changes in the Mediterranean Sea requires an accurate simulation of the atmospheric component of the water budget (i.e., evaporation, precipitation and runoff). A specific configuration of the version 3.1 of the weather research and forecasting (WRF) regional climate model was shown to systematically overestimate the Mediterranean Sea water budget mainly due to an excess of evaporation (~1,450 mm yr-1) compared with observed estimations (~1,150 mm yr-1). In this article, a 70-member multi-physics ensemble is used to try to understand the relative importance of various sub-grid scale processes in the Mediterranean Sea water budget and to evaluate its representation by comparing simulated results with observed-based estimates. The physics ensemble was constructed by performing 70 1-year long simulations using version 3.3 of the WRF model by combining six cumulus, four surface/planetary boundary layer and three radiation schemes. Results show that evaporation variability across the multi-physics ensemble (˜10 % of the mean evaporation) is dominated by the choice of the surface layer scheme that explains more than ˜70 % of the total variance and that the overestimation of evaporation in WRF simulations is generally related with an overestimation of surface exchange coefficients due to too large values of the surface roughness parameter and/or the simulation of too unstable surface conditions. Although the influence of radiation schemes on evaporation variability is small (˜13 % of the total variance), radiation schemes strongly influence exchange coefficients and vertical humidity gradients near the surface due to modifications of temperature lapse rates. The precipitation variability across the physics ensemble (˜35 % of the mean precipitation) is dominated by the choice of both cumulus (˜55 % of the total variance) and planetary boundary layer (˜32 % of

  15. Numerical simulation and experimental validation of biofilm in a multi-physics framework using an SPH based method

    NASA Astrophysics Data System (ADS)

    Soleimani, Meisam; Wriggers, Peter; Rath, Henryke; Stiesch, Meike

    2016-10-01

    In this paper, a 3D computational model has been developed to investigate biofilms in a multi-physics framework using smoothed particle hydrodynamics (SPH) based on a continuum approach. Biofilm formation is a complex process in the sense that several physical phenomena are coupled and consequently different time-scales are involved. On one hand, biofilm growth is driven by biological reaction and nutrient diffusion and on the other hand, it is influenced by fluid flow causing biofilm deformation and interface erosion in the context of fluid and deformable solid interaction. The geometrical and numerical complexity arising from these phenomena poses serious complications and challenges in grid-based techniques such as finite element. Here the solution is based on SPH as one of the powerful meshless methods. SPH based computational modeling is quite new in the biological community and the method is uniquely robust in capturing the interface-related processes of biofilm formation such as erosion. The obtained results show a good agreement with experimental and published data which demonstrates that the model is capable of simulating and predicting overall spatial and temporal evolution of biofilm.

  16. Uncertainties propagation in the framework of a Rod Ejection Accident modeling based on a multi-physics approach

    SciTech Connect

    Le Pallec, J. C.; Crouzet, N.; Bergeaud, V.; Delavaud, C.

    2012-07-01

    The control of uncertainties in the field of reactor physics and their propagation in best-estimate modeling are a major issue in safety analysis. In this framework, the CEA develops a methodology to perform multi-physics simulations including uncertainties analysis. The present paper aims to present and apply this methodology for the analysis of an accidental situation such as REA (Rod Ejection Accident). This accident is characterized by a strong interaction between the different areas of the reactor physics (neutronic, fuel thermal and thermal hydraulic). The modeling is performed with CRONOS2 code. The uncertainties analysis has been conducted with the URANIE platform developed by the CEA: For each identified response from the modeling (output) and considering a set of key parameters with their uncertainties (input), a surrogate model in the form of a neural network has been produced. The set of neural networks is then used to carry out a sensitivity analysis which consists on a global variance analysis with the determination of the Sobol indices for all responses. The sensitivity indices are obtained for the input parameters by an approach based on the use of polynomial chaos. The present exercise helped to develop a methodological flow scheme, to consolidate the use of URANIE tool in the framework of parallel calculations. Finally, the use of polynomial chaos allowed computing high order sensitivity indices and thus highlighting and classifying the influence of identified uncertainties on each response of the analysis (single and interaction effects). (authors)

  17. Multi-Physics Modeling of Molten Salt Transport in Solid Oxide Membrane (SOM) Electrolysis and Recycling of Magnesium

    SciTech Connect

    Powell, Adam; Pati, Soobhankar

    2012-03-11

    Solid Oxide Membrane (SOM) Electrolysis is a new energy-efficient zero-emissions process for producing high-purity magnesium and high-purity oxygen directly from industrial-grade MgO. SOM Recycling combines SOM electrolysis with electrorefining, continuously and efficiently producing high-purity magnesium from low-purity partially oxidized scrap. In both processes, electrolysis and/or electrorefining take place in the crucible, where raw material is continuously fed into the molten salt electrolyte, producing magnesium vapor at the cathode and oxygen at the inert anode inside the SOM. This paper describes a three-dimensional multi-physics finite-element model of ionic current, fluid flow driven by argon bubbling and thermal buoyancy, and heat and mass transport in the crucible. The model predicts the effects of stirring on the anode boundary layer and its time scale of formation, and the effect of natural convection at the outer wall. MOxST has developed this model as a tool for scale-up design of these closely-related processes.

  18. Numerical simulation and experimental validation of biofilm in a multi-physics framework using an SPH based method

    NASA Astrophysics Data System (ADS)

    Soleimani, Meisam; Wriggers, Peter; Rath, Henryke; Stiesch, Meike

    2016-06-01

    In this paper, a 3D computational model has been developed to investigate biofilms in a multi-physics framework using smoothed particle hydrodynamics (SPH) based on a continuum approach. Biofilm formation is a complex process in the sense that several physical phenomena are coupled and consequently different time-scales are involved. On one hand, biofilm growth is driven by biological reaction and nutrient diffusion and on the other hand, it is influenced by fluid flow causing biofilm deformation and interface erosion in the context of fluid and deformable solid interaction. The geometrical and numerical complexity arising from these phenomena poses serious complications and challenges in grid-based techniques such as finite element. Here the solution is based on SPH as one of the powerful meshless methods. SPH based computational modeling is quite new in the biological community and the method is uniquely robust in capturing the interface-related processes of biofilm formation such as erosion. The obtained results show a good agreement with experimental and published data which demonstrates that the model is capable of simulating and predicting overall spatial and temporal evolution of biofilm.

  19. Parallel Monte Carlo transport modeling in the context of a time-dependent, three-dimensional multi-physics code

    SciTech Connect

    Procassini, R.J.

    1997-12-31

    The fine-scale, multi-space resolution that is envisioned for accurate simulations of complex weapons systems in three spatial dimensions implies flop-rate and memory-storage requirements that will only be obtained in the near future through the use of parallel computational techniques. Since the Monte Carlo transport models in these simulations usually stress both of these computational resources, they are prime candidates for parallelization. The MONACO Monte Carlo transport package, which is currently under development at LLNL, will utilize two types of parallelism within the context of a multi-physics design code: decomposition of the spatial domain across processors (spatial parallelism) and distribution of particles in a given spatial subdomain across additional processors (particle parallelism). This implementation of the package will utilize explicit data communication between domains (message passing). Such a parallel implementation of a Monte Carlo transport model will result in non-deterministic communication patterns. The communication of particles between subdomains during a Monte Carlo time step may require a significant level of effort to achieve a high parallel efficiency.

  20. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  1. Effects of glucagon-like peptide-1 on advanced glycation endproduct-induced aortic endothelial dysfunction in streptozotocin-induced diabetic rats: possible roles of Rho kinase- and AMP kinase-mediated nuclear factor κB signaling pathways.

    PubMed

    Tang, Song-Tao; Zhang, Qiu; Tang, Hai-Qin; Wang, Chang-Jiang; Su, Huan; Zhou, Qing; Wei, Wei; Zhu, Hua-Qing; Wang, Yuan

    2016-07-01

    Interaction between advanced glycation endproducts (AGEs) and receptor for AGEs (RAGE) as well as downstream pathways leads to vascular endothelial dysfunction in diabetes. Glucagon-like peptide-1 (GLP-1) has been reported to attenuate endothelial dysfunction in the models of atherosclerosis. However, whether GLP-1 exerts protective effects on aortic endothelium in diabetic animal model and the underlying mechanisms are still not well defined. Experimental diabetes was induced through administration with combination of high-fat diet and intraperitoneal injection of streptozotocin. Rats were randomly divided into four groups, including controls, diabetes, diabetes + sitagliptin (30 mg/kg/day), diabetes + exenatide (3 μg/kg/12 h). Eventually, endothelial damage, markers of inflammation and oxidative stress, were measured. After 12 weeks administration, diabetic rats received sitagliptin and exenatide showed significant elevation of serum NO level and reduction of ET-1 as well as inflammatory cytokines levels. Moreover, sitagliptin and exenatide significantly inhibited aortic oxidative stress level and improved aortic endothelial function in diabetic rats. Importantly, these drugs inhibited the protein expression level in AGE/RAGE-induced RhoA/ROCK/NF-κB/IκBα signaling pathways and activated AMPK in diabetic aorta. Finally, the target proteins of p-eNOS, iNOS, and ET-1, which reflect endothelial function, were also changed by these drugs. Our present study indicates that sitagliptin and exenatide administrations can improve endothelial function in diabetic aorta. Of note, RAGE/RhoA/ROCK and AMPK mediated NF-κB signaling pathways may be the intervention targets of these drugs to protect aortic endothelium. PMID:26758998

  2. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  3. Multi-Scale Multi-physics Methods Development for the Calculation of Hot-Spots in the NGNP

    SciTech Connect

    Downar, Thomas; Seker, Volkan

    2013-04-30

    Radioactive gaseous fission products are released out of the fuel element at a significantly higher rate when the fuel temperature exceeds 1600°C in high-temperature gas-cooled reactors (HTGRs). Therefore, it is of paramount importance to accurately predict the peak fuel temperature during all operational and design-basis accident conditions. The current methods used to predict the peak fuel temperature in HTGRs, such as the Next-Generation Nuclear Plant (NGNP), estimate the average fuel temperature in a computational mesh modeling hundreds of fuel pebbles or a fuel assembly in a pebble-bed reactor (PBR) or prismatic block type reactor (PMR), respectively. Experiments conducted in operating HTGRs indicate considerable uncertainty in the current methods and correlations used to predict actual temperatures. The objective of this project is to improve the accuracy in the prediction of local "hot" spots by developing multi-scale, multi-physics methods and implementing them within the framework of established codes used for NGNP analysis.The multi-scale approach which this project will implement begins with defining suitable scales for a physical and mathematical model and then deriving and applying the appropriate boundary conditions between scales. The macro scale is the greatest length that describes the entire reactor, whereas the meso scale models only a fuel block in a prismatic reactor and ten to hundreds of pebbles in a pebble bed reactor. The smallest scale is the micro scale--the level of a fuel kernel of the pebble in a PBR and fuel compact in a PMR--which needs to be resolved in order to calculate the peak temperature in a fuel kernel.

  4. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  5. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  6. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  7. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  8. Changes in nephrogenous cyclic AMP excretion and plasma cyclic AMP following treatment of hyperthyroidism.

    PubMed

    Naafs, M A; van der Velden, P C; Fischer, H R; Koorevaar, G; van Duin, S; Hackeng, W H; Schopman, W; Silberbusch, J

    1984-08-01

    Plasma cyclic AMP (PcAMP) concentration and the excretion of cyclic AMP/dl GF were estimated in 11 thyrotoxic patients before and after medical treatment. PcAMP concentrations were significantly higher during hyperthyroidism (2.30 +/- 0.69 vs 1.88 +/- 0.71 nmol/dl; P less than 0.05), and total urinary cyclic AMP (TcAMP) excretion showed no significant changes (3.24 +/- 0.64 vs 3.44 +/- 1.77 nmol/dl GF). Nephrogenous (NcAMP) excretion rose significantly (1.00 +/- 0.82 vs 1.68 +/- 1.31 mmol/dl GF; P less than 0.025). The increase in NcAMP excretion correlated significantly with the decrease in serum T3 levels (r = -0.46; P less than 0.05). Serum iPTH levels showed no significant change. Both the serum Ca, corrected for serum total protein and TmPO4/GFR declined after treatment (respectively 2.44 +/- 0.13 vs 2.33 +/- 0.08 mmol/l; P less than 0.05 and 1.18 +/- 0.29 vs 1.05 +/- 0.22 mmol/l; P less than 0.05). It is concluded that the rise in NcAMP excretion corroborates the concept of increasing parathyroid activity following the treatment of hyperthyroidism. PMID:6206676

  9. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  10. cAMP signalling meets mitochondrial compartments.

    PubMed

    Lefkimmiatis, Konstantinos

    2014-04-01

    Mitochondria are highly dynamic organelles comprising at least three distinct areas, the OMM (outer mitochondrial membrane), the IMS (intermembrane space) and the mitochondrial matrix. Physical compartmentalization allows these organelles to host different functional domains and therefore participate in a variety of important cellular actions such as ATP synthesis and programmed cell death. In a surprising homology, it is now widely accepted that the ubiquitous second messenger cAMP uses the same stratagem, compartmentalization, in order to achieve the characteristic functional pleiotropy of its pathway. Accumulating evidence suggests that all the main mitochondrial compartments contain segregated cAMP cascades; however, the regulatory properties and functional significance of such domains are not fully understood and often remain controversial issues. The present mini-review discusses our current knowledge of how the marriage between mitochondrial and cAMP compartmentalization is achieved and its effects on the biology of the cell. PMID:24646228

  11. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-10-15

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate.

  12. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed Central

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-01-01

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate. PMID:11023814

  13. Integration of the DRAGON5/DONJON5 codes in the SALOME platform for performing multi-physics calculations in nuclear engineering

    NASA Astrophysics Data System (ADS)

    Hébert, Alain

    2014-06-01

    We are presenting the computer science techniques involved in the integration of codes DRAGON5 and DONJON5 in the SALOME platform. This integration brings new capabilities in designing multi-physics computational schemes, with the possibility to couple our reactor physics codes with thermal-hydraulics or thermo-mechanics codes from other organizations. A demonstration is presented where two code components are coupled using the YACS module of SALOME, based on the CORBA protocol. The first component is a full-core 3D steady-state neuronic calculation in a PWR performed using DONJON5. The second component implement a set of 1D thermal-hydraulics calculations, each performed over a single assembly.

  14. Multi-physics simulation and fabrication of a compact 128 × 128 micro-electro-mechanical system Fabry-Perot cavity tunable filter array for infrared hyperspectral imager.

    PubMed

    Meng, Qinghua; Chen, Sihai; Lai, Jianjun; Huang, Ying; Sun, Zhenjun

    2015-08-01

    This paper demonstrates the design and fabrication of a 128×128 micro-electro-mechanical systems Fabry-Perot (F-P) cavity filter array, which can be applied for the hyperspectral imager. To obtain better mechanical performance of the filters, F-P cavity supporting structures are analyzed by multi-physics finite element modeling. The simulation results indicate that Z-arm is the key component of the structure. The F-P cavity array with Z-arm structures was also fabricated. The experimental results show excellent parallelism of the bridge deck, which agree with the simulation results. A conclusion is drawn that Z-arm supporting structures are important to hyperspectral imaging system, which can achieve a large tuning range and high fill factor compared to straight arm structures. The filter arrays have the potential to replace the traditional dispersive element.

  15. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  16. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  17. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended...

  18. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  19. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  20. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  1. The cyclic AMP pathway is a sex-specific modifier of glioma risk in type I neurofibromatosis patients.

    PubMed

    Warrington, Nicole M; Sun, Tao; Luo, Jingqin; McKinstry, Robert C; Parkin, Patricia C; Ganzhorn, Sara; Spoljaric, Debra; Albers, Anne C; Merkelson, Amanda; Stewart, Douglas R; Stevenson, David A; Viskochil, David; Druley, Todd E; Forys, Jason T; Reilly, Karlyne M; Fisher, Michael J; Tabori, Uri; Allen, Jeffrey C; Schiffman, Joshua D; Gutmann, David H; Rubin, Joshua B

    2015-01-01

    Identifying modifiers of glioma risk in patients with type I neurofibromatosis (NF1) could help support personalized tumor surveillance, advance understanding of gliomagenesis, and potentially identify novel therapeutic targets. Here, we report genetic polymorphisms in the human adenylate cyclase gene adenylate cyclase 8 (ADCY8) that correlate with glioma risk in NF1 in a sex-specific manner, elevating risk in females while reducing risk in males. This finding extends earlier evidence of a role for cAMP in gliomagenesis based on results in a genetically engineered mouse model (Nf1 GEM). Thus, sexually dimorphic cAMP signaling might render males and females differentially sensitive to variation in cAMP levels. Using male and female Nf1 GEM, we found significant sex differences exist in cAMP regulation and in the growth-promoting effects of cAMP suppression. Overall, our results establish a sex-specific role for cAMP regulation in human gliomagenesis, specifically identifying ADCY8 as a modifier of glioma risk in NF1.

  2. Cyclic AMP efflux inhibitors as potential therapeutic agents for leukemia

    PubMed Central

    Perez, Dominique R.; Smagley, Yelena; Garcia, Matthew; Carter, Mark B.; Evangelisti, Annette; Matlawska-Wasowska, Ksenia; Winter, Stuart S.; Sklar, Larry A.; Chigaev, Alexandre

    2016-01-01

    Apoptotic evasion is a hallmark of cancer. We propose that some cancers may evade cell death by regulating 3′-5′-cyclic adenosine monophosphate (cAMP), which is associated with pro-apoptotic signaling. We hypothesize that leukemic cells possess mechanisms that efflux cAMP from the cytoplasm, thus protecting them from apoptosis. Accordingly, cAMP efflux inhibition should result in: cAMP accumulation, activation of cAMP-dependent downstream signaling, viability loss, and apoptosis. We developed a novel assay to assess cAMP efflux and performed screens to identify inhibitors. In an acute myeloid leukemia (AML) model, several identified compounds reduced cAMP efflux, appropriately modulated pathways that are responsive to cAMP elevation (cAMP-responsive element-binding protein phosphorylation, and deactivation of Very Late Antigen-4 integrin), and induced mitochondrial depolarization and caspase activation. Blocking adenylyl cyclase activity was sufficient to reduce effects of the most potent compounds. These compounds also decreased cAMP efflux and viability of B-lineage acute lymphoblastic leukemia (B-ALL) cell lines and primary patient samples, but not of normal primary peripheral blood mononuclear cells. Our data suggest that cAMP efflux is a functional feature that could be therapeutically targeted in leukemia. Furthermore, because some of the identified drugs are currently used for treating other illnesses, this work creates an opportunity for repurposing. PMID:27129155

  3. TerraFERMA: Harnessing Advanced Computational Libraries in Earth Science

    NASA Astrophysics Data System (ADS)

    Wilson, C. R.; Spiegelman, M.; van Keken, P.

    2012-12-01

    Many important problems in Earth sciences can be described by non-linear coupled systems of partial differential equations. These "multi-physics" problems include thermo-chemical convection in Earth and planetary interiors, interactions of fluids and magmas with the Earth's mantle and crust and coupled flow of water and ice. These problems are of interest to a large community of researchers but are complicated to model and understand. Much of this complexity stems from the nature of multi-physics where small changes in the coupling between variables or constitutive relations can lead to radical changes in behavior, which in turn affect critical computational choices such as discretizations, solvers and preconditioners. To make progress in understanding such coupled systems requires a computational framework where multi-physics problems can be described at a high-level while maintaining the flexibility to easily modify the solution algorithm. Fortunately, recent advances in computational science provide a basis for implementing such a framework. Here we present the Transparent Finite Element Rapid Model Assembler (TerraFERMA), which leverages several advanced open-source libraries for core functionality. FEniCS (fenicsproject.org) provides a high level language for describing the weak forms of coupled systems of equations, and an automatic code generator that produces finite element assembly code. PETSc (www.mcs.anl.gov/petsc) provides a wide range of scalable linear and non-linear solvers that can be composed into effective multi-physics preconditioners. SPuD (amcg.ese.ic.ac.uk/Spud) is an application neutral options system that provides both human and machine-readable interfaces based on a single xml schema. Our software integrates these libraries and provides the user with a framework for exploring multi-physics problems. A single options file fully describes the problem, including all equations, coefficients and solver options. Custom compiled applications are

  4. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP.

  5. The Regulatory Repertoire of Pseudomonas aeruginosa AmpC ß-Lactamase Regulator AmpR Includes Virulence Genes

    PubMed Central

    Balasubramanian, Deepak; Schneper, Lisa; Merighi, Massimo; Smith, Roger; Narasimhan, Giri; Lory, Stephen; Mathee, Kalai

    2012-01-01

    In Enterobacteriaceae, the transcriptional regulator AmpR, a member of the LysR family, regulates the expression of a chromosomal β-lactamase AmpC. The regulatory repertoire of AmpR is broader in Pseudomonas aeruginosa, an opportunistic pathogen responsible for numerous acute and chronic infections including cystic fibrosis. In addition to regulating ampC, P. aeruginosa AmpR regulates the sigma factor AlgT/U and production of some quorum sensing (QS)-regulated virulence factors. In order to better understand the ampR regulon, we compared the transcriptional profile generated using DNA microarrays of the prototypic P. aeruginosa PAO1 strain with its isogenic ampR deletion mutant, PAOΔampR. Transcriptome analysis demonstrates that the AmpR regulon is much more extensive than previously thought, with the deletion of ampR influencing the differential expression of over 500 genes. In addition to regulating resistance to β-lactam antibiotics via AmpC, AmpR also regulates non-β-lactam antibiotic resistance by modulating the MexEF-OprN efflux pump. Other virulence mechanisms including biofilm formation and QS-regulated acute virulence factors are AmpR-regulated. Real-time PCR and phenotypic assays confirmed the microarray data. Further, using a Caenorhabditis elegans model, we demonstrate that a functional AmpR is required for P. aeruginosa pathogenicity. AmpR, a member of the core genome, also regulates genes in the regions of genome plasticity that are acquired by horizontal gene transfer. Further, we show differential regulation of other transcriptional regulators and sigma factors by AmpR, accounting for the extensive AmpR regulon. The data demonstrates that AmpR functions as a global regulator in P. aeruginosa and is a positive regulator of acute virulence while negatively regulating biofilm formation, a chronic infection phenotype. Unraveling this complex regulatory circuit will provide a better understanding of the bacterial response to antibiotics and how the

  6. A multi-physics and multi-scale lumped parameter model of cardiac contraction of the left ventricle: a conceptual model from the protein to the organ scale.

    PubMed

    Bhattacharya-Ghosh, Benjamin; Schievano, Silvia; Díaz-Zuccarini, Vanessa

    2012-10-01

    In cardiovascular computational physiology the importance of understanding cardiac contraction as a multi-scale process is of paramount importance to understand causality across different scales. Within this study, a multi-scale and multi-physics model of the left ventricle that connects the process of cardiac excitation and contraction from the protein to the organ level is presented in a novel way. The model presented here includes the functional description of a cardiomyocyte (cellular scale), which explains the dynamic behaviour of the calcium concentration within the cell whilst an action potential develops. The cell domain is coupled to a domain that determines the kinetics of the sliding filament mechanism (protein level), which is at the basis of cardiac contraction. These processes are then linked to the generation of muscular force and from there to the generation of pressure inside the ventricle. This multi-scale model presents a coherent and unified way to describe cardiac contraction from the protein to the organ level.

  7. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response.

  8. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  9. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  10. Mechanical design philosophy and construction of the Amsterdam Pulse Stretcher ring AmPS

    NASA Astrophysics Data System (ADS)

    Kaan, A. P.; Heemskerk, J. A.; Touw, J.; Bijleveld, J.; Rookhuizen, H. Boer; Verlegh, W.; Langedijk, J.; Bron, G.; Arink, R.; Lassing, P.

    The design philosophy and the construction of the Amsterdam Pulse Stretcher (AmPS) are described with emphasis on the vacuum components as well as on the alignment system and on the supports for the magnets and the monitors. The AmPS ring is a 900 MeV electron pulse stretcher and storage ring with a circumference of 212 m. The ring was planned to start in Spring 1992. The vacuum chambers in the bending sections therefore are fabricated from stainless steel 316 LN with a very low cobalt content. An advanced welding and cleaning technique was developed to avoid the inclusion of impurities. The vacuum pump capacity and the pump distribution along the ring were optimized as function of local conductances and outgassing.

  11. Revisiting cAMP signaling in the carotid body

    PubMed Central

    Nunes, Ana R.; Holmes, Andrew P.; Conde, Sílvia V.; Gauda, Estelle B.; Monteiro, Emília C.

    2014-01-01

    Chronic carotid body (CB) activation is now recognized as being essential in the development of hypertension and promoting insulin resistance; thus, it is imperative to characterize the chemotransduction mechanisms of this organ in order to modulate its activity and improve patient outcomes. For several years, and although controversial, cyclic adenosine monophosphate (cAMP) was considered an important player in initiating the activation of the CB. However, its relevance was partially displaced in the 90s by the emerging role of the mitochondria and molecules such as AMP-activated protein kinase and O2-sensitive K+ channels. Neurotransmitters/neuromodulators binding to metabotropic receptors are essential to chemotransmission in the CB, and cAMP is central to this process. cAMP also contributes to raise intracellular Ca2+ levels, and is intimately related to the cellular energetic status (AMP/ATP ratio). Furthermore, cAMP signaling is a target of multiple current pharmacological agents used in clinical practice. This review (1) provides an outline on the classical view of the cAMP-signaling pathway in the CB that originally supported its role in the O2/CO2 sensing mechanism, (2) presents recent evidence on CB cAMP neuromodulation and (3) discusses how CB activity is affected by current clinical therapies that modify cAMP-signaling, namely dopaminergic drugs, caffeine (modulation of A2A/A2B receptors) and roflumilast (PDE4 inhibitors). cAMP is key to any process that involves metabotropic receptors and the intracellular pathways involved in CB disease states are likely to involve this classical second messenger. Research examining the potential modification of cAMP levels and/or interactions with molecules associated with CB hyperactivity is currently in its beginning and this review will open doors for future explorations. PMID:25389406

  12. Pre-Amp Box Platform Analysis

    SciTech Connect

    Kirby, K.; Kurita, C.; /Fermilab

    1989-01-17

    A platform to be used for the installation and repair of the high voltage pre-amp boxes on the CC cryostat has been designed to support a uniform load of 30 Ibs./sq. ft. However, according to the standards set by both the American National Standard and the Uniform Building Code, the minimum uniformly distributed design load for a structure used as an 'elevated platform or walkway' is 60 lbs./sq. ft. The existing platform was tested with a uniform load of 40 lbs./sq. ft. with no major problems occurring during the testing. Considering a 40 lbs./sq. ft. load to be the minimum acceptable value for 'residential' use, and the platform in hand to be better categorized as an 'elevated platform or walkway', the platform is carefully re-analyzed for a 60 lbs./sq. ft. uniformly distributed load.

  13. Multi-initial-conditions and Multi-physics Ensembles in the Weather Research and Forecasting Model to Improve Coastal Stratocumulus Forecasts for Solar Power Integration

    NASA Astrophysics Data System (ADS)

    Yang, H.

    2015-12-01

    used to create a multi-parameter and multi-physics ensemble. The ensemble forecast system is implemented operationally for San Diego Gas & Electric Company to improve system operations.

  14. Mutants of PC12 cells with altered cyclic AMP responses

    SciTech Connect

    Block, T.; Kon, C.; Breckenridge, B.M.

    1984-10-01

    PCl2 cells, derived from a rat pheochromocytoma, were mutagenized and selected in media containing agents known to elevate intracellular concentrations of cyclic AMP (cAMP). More than 40 clones were isolated by selection with cholera toxin or 2-chloroadenosine or both. The variants that were deficient in accumulating cAMP were obtained by using a protocol in which 1 ..mu..m 8-bromo-cAMP was included in addition to the agonist. Certain of these variants were partially characterized with respect to the site of altered cAMP metabolism. The profiles of adenylate cyclase activity responsiveness of certain variants to guanosine-5'-(BETA,..gamma..-imido) triphosphate and to forskolin resembled those of UNC and cyc phenotypes of S49 lymphoma cells, which are functionally deficient in the GTP-sensitive coupling protein, N/sub s/. Other variants were characterized by increased cyclic nucleotide phosphodiesterase activity at low substrate concentration. Diverse morphological traits were observed among the variants, but it was not possible to assign them to a particular cAMP phenotype. Two revertants of a PCl2 mutant were isolated and observed to have regained a cellular cAMP response to 2-chloroadenosine and to forskolin. It is hoped that these PCl2 mutants will have utility for defining cAMP-mediated functions, including any links to the action of nerve growth factor, in cells derived from the neural crest.

  15. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion

    PubMed Central

    Schwede, Frank; Chepurny, Oleg G.; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A.; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E.; MacDonald, Patrick E.; Genieser, Hans-G.; Herberg, Friedrich W.

    2015-01-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  16. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A

    1987-01-01

    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that

  17. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  18. Enzymatic characterization of AMP phosphorylase and ribose-1,5-bisphosphate isomerase functioning in an archaeal AMP metabolic pathway.

    PubMed

    Aono, Riku; Sato, Takaaki; Yano, Ayumu; Yoshida, Shosuke; Nishitani, Yuichi; Miki, Kunio; Imanaka, Tadayuki; Atomi, Haruyuki

    2012-12-01

    AMP phosphorylase (AMPpase), ribose-1,5-bisphosphate (R15P) isomerase, and type III ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) have been proposed to constitute a novel pathway involved in AMP metabolism in the Archaea. Here we performed a biochemical examination of AMPpase and R15P isomerase from Thermococcus kodakarensis. R15P isomerase was specific for the α-anomer of R15P and did not recognize other sugar compounds. We observed that activity was extremely low with the substrate R15P alone but was dramatically activated in the presence of AMP. Using AMP-activated R15P isomerase, we reevaluated the substrate specificity of AMPpase. AMPpase exhibited phosphorylase activity toward CMP and UMP in addition to AMP. The [S]-v plot (plot of velocity versus substrate concentration) of the enzyme toward AMP was sigmoidal, with an increase in activity observed at concentrations higher than approximately 3 mM. The behavior of the two enzymes toward AMP indicates that the pathway is intrinsically designed to prevent excess degradation of intracellular AMP. We further examined the formation of 3-phosphoglycerate from AMP, CMP, and UMP in T. kodakarensis cell extracts. 3-Phosphoglycerate generation was observed from AMP alone, and from CMP or UMP in the presence of dAMP, which also activates R15P isomerase. 3-Phosphoglycerate was not formed when 2-carboxyarabinitol 1,5-bisphosphate, a Rubisco inhibitor, was added. The results strongly suggest that these enzymes are actually involved in the conversion of nucleoside monophosphates to 3-phosphoglycerate in T. kodakarensis.

  19. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  20. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  1. 8-Chloro-cAMP-related changes on mice uteri.

    PubMed

    Actis, Andrea; Croci, Máximo; Levin, Emanuel; Bergoc, Rosa

    2002-05-22

    Histopathological effects of cAMP analog (8-Chloro-cAMP), tamoxifen, and medroxyprogesterone, alone or combined, upon BALB/c mice uteri are reported. 8-Chloro-cAMP diminished uterine weight, but did not modify its histopathology or estral cycle significantly. Tamoxifen diminished uterine weight showing cystic hyperplasia and an estral cycle arrested at diestrus. Medroxyprogesterone increased uterine weight, caused a swelling of the endometrium and a pseudopregnancy estrus. When combined with 8-Chloro-cAMP, tamoxifen or medroxyprogesterone always had a predominant effect. We concluded that the effects of 8-Chloro-cAMP on mice uteri did not cause significant changes on its histopathology, but diminished its weight.

  2. Control of bacterial exoelectrogenesis by c-AMP-GMP.

    PubMed

    Nelson, James W; Sudarsan, Narasimhan; Phillips, Grace E; Stav, Shira; Lünse, Christina E; McCown, Phillip J; Breaker, Ronald R

    2015-04-28

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes.

  3. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  4. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP.

    PubMed

    DiFrancesco, D; Tortora, P

    1991-05-01

    Cyclic AMP acts as a second messenger in the modulation of several ion channels that are typically controlled by a phosphorylation process. In cardiac pacemaker cells, adrenaline and acetylcholine regulate the hyperpolarization-activated current (if), but in opposite ways; this current is involved in the generation and modulation of pacemaker activity. These actions are mediated by cAMP and underlie control of spontaneous rate by neurotransmitters. Whether the cAMP modulation of if is mediated by channel phosphorylation is, however, still unknown. Here we investigate the action of cAMP on if in excised patches of cardiac pacemaker cells and find that cAMP activates if by a mechanism independent of phosphorylation, involving a direct interaction with the channels at their cytoplasmic side. Cyclic AMP activates if by shifting its activation curve to more positive voltages, in agreement with whole-cell results. This is the first evidence of an ion channel whose gating is dually regulated by voltage and direct cAMP binding.

  5. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  6. [cAMP as a regulator of the phototransduction cascade].

    PubMed

    Astakhova, L A; Kapitskiĭ, S V; Govardovskiĭ, V I; Firsov, M L

    2012-11-01

    Until recently, it has generally been believed that cyclic AMP plays an important role in supporting circadian cycles in the vertebrate retina, but does not directly control the photoreceptors' phototransduction cascade. However, the cAMP levels in photoreceptors oscillate during the day/night cycle, and the cAMP turnover in photoreceptors may be light-dependent. Thus it is natural to suggest that the cAMP-dependent protein phosphorylation may be a mechanism of tuning phototransduction to lighting conditions. In the present review, we summarize available information on the structure and operation of the retinal pacemaker, role(s) of cAMP in its functioning, and identified intracellular targets that could be controlled by cAMP. We discuss our recent results that show that cAMP changes do regulate the phototransduction cascade. This regulation may substantially extend the range of photoreceptor's adaptation by increasing its sensitivity at night, and reducing the sensitivity in bright light. PMID:23431758

  7. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  8. Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens.

    PubMed

    Kalivoda, Eric J; Stella, Nicholas A; Aston, Marissa A; Fender, James E; Thompson, Paul P; Kowalski, Regis P; Shanks, Robert M Q

    2010-03-01

    Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with mutations in genes involved in cAMP production (cyaA and crr) and in cAMP-dependent transcriptional signaling (crp). Multicopy expression of the Escherichia coli cAMP-phosphodiesterase gene, cpdA, also conferred a striking increase in prodigiosin production. Exogenous cAMP decreased both pigment production and pigA-lacZ transcription in the wild-type (WT) strain, and pigA-lacZ transcription was significantly increased in a crp mutant relative to WT. Suppressor and epistasis analysis indicate that the hyperpigment phenotype was dependent upon pigment biosynthetic genes (pigA, pigB, pigC, pigD and pigM). These experiments establish cAMP as a negative regulator of prodigiosin production in S. marcescens.

  9. AMP-18 Targets p21 to Maintain Epithelial Homeostasis.

    PubMed

    Chen, Peili; Li, Yan Chun; Toback, F Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21 WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD.

  10. Cyclic AMP inhibits secretion from electroporated human neutrophils.

    PubMed

    Smolen, J E; Stoehr, S J; Kuczynski, B

    1991-02-01

    It has long been known that intracellular cAMP inhibits and cGMP enhances intact neutrophil function. However, these effects are modest and require relatively high concentrations of the cyclic nucleotides. We decided to re-examine the effects of cyclic nucleotides on Ca2(+)-induced secretion by electroporated cells. This system allowed us to bypass normal cell surface receptor-ligand interactions as well as to directly expose the intracellular space to native cyclic nucleotides. We found that concentrations of cAMP as low as 3 microM inhibited Ca2(+)-induced secretion; 30-300 microM cAMP was maximally inhibitory. cAMP was actually slightly more potent than dibutyryl cAMP, a membrane-permeant derivative. In contrast, cGMP was only slightly stimulatory at 3 microM and modestly inhibitory at 300 microM; dibutyryl cGMP was ineffective. A more detailed investigation of the effects of cAMP showed that inhibition was only obtained in the presence of Mg2+. Half-maximal inhibition by cAMP occurred at 10-30 microM. Inhibition by cAMP was achieved by shifting the Ca2+ dose-response curve for secretion to the right; this was observed for the release of both specific granules (vitamin B12 binding protein) and azurophil granules (B-glucuronidase). We previously showed that ATP could enhance Ca2(+)-induced secretion in the presence of Mg2+, apparently by interacting with a cell surface purine receptor. However, increasing concentrations of ATP could not overcome inhibition by cAMP; this suggested that cAMP acted at some site other than the purine receptor. Inhibition by cAMP was also less apparent in the presence of the protein kinase C agonist phorbol myristate acetate (PMA), suggesting that the cyclic nucleotide did not produce systemic desensitization of the neutrophils. In summary, these results demonstrate that low, physiologically relevant concentrations of cAMP can modulate neutrophil responsiveness. PMID:1846904

  11. Multiple Facets of cAMP Signalling and Physiological Impact: cAMP Compartmentalization in the Lung

    PubMed Central

    Oldenburger, Anouk; Maarsingh, Harm; Schmidt, Martina

    2012-01-01

    Therapies involving elevation of the endogenous suppressor cyclic AMP (cAMP) are currently used in the treatment of several chronic inflammatory disorders, including chronic obstructive pulmonary disease (COPD). Characteristics of COPD are airway obstruction, airway inflammation and airway remodelling, processes encompassed by increased airway smooth muscle mass, epithelial changes, goblet cell and submucosal gland hyperplasia. In addition to inflammatory cells, airway smooth muscle cells and (myo)fibroblasts, epithelial cells underpin a variety of key responses in the airways such as inflammatory cytokine release, airway remodelling, mucus hypersecretion and airway barrier function. Cigarette smoke, being next to environmental pollution the main cause of COPD, is believed to cause epithelial hyperpermeability by disrupting the barrier function. Here we will focus on the most recent progress on compartmentalized signalling by cAMP. In addition to G protein-coupled receptors, adenylyl cyclases, cAMP-specific phospho-diesterases (PDEs) maintain compartmentalized cAMP signalling. Intriguingly, spatially discrete cAMP-sensing signalling complexes seem also to involve distinct members of the A-kinase anchoring (AKAP) superfamily and IQ motif containing GTPase activating protein (IQGAPs). In this review, we will highlight the interaction between cAMP and the epithelial barrier to retain proper lung function and to alleviate COPD symptoms and focus on the possible molecular mechanisms involved in this process. Future studies should include the development of cAMP-sensing multiprotein complex specific disruptors and/or stabilizers to orchestrate cellular functions. Compartmentalized cAMP signalling regulates important cellular processes in the lung and may serve as a therapeutic target. PMID:24281338

  12. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  13. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  14. ^amp;+^amp;-p Electroproduction Cross Sections off Protons in the Second Resonance Region

    NASA Astrophysics Data System (ADS)

    Fedotov, Gleb; Gothe, Ralf; Mokeev, Victor

    2013-04-01

    In this talk we present preliminary ^amp;+^amp;-p electroproduction cross sections off protons in the kinematical area of W from 1.4 to 1.8 GeV and Q^2 from 0.4 to 1.1 GeV^2. Our kinematical coverage in part overlap with previous CLAS measurements, but offers more than a factor six finer binning in Q^2. The physics analysis of these data within the framework of the JM model will allow us to determine the electrocouplings and the partial πδ, ρp decay widths of several high lying nucleon resonances S31(1620), S11(1650), F15(1685), D33(1700), P13(1720) and to further explore the evidence for the 3/2^+(1720) candidate-state. Analysis of the single pion electroproduction data measured with CLAS in the aforementioned kinematic region is in progress. Single and charged double pion exclusive channels are major contributors to the meson electroproduction in the N* excitation region with different non-resonant mechanisms. A successful description of all observables in these exclusive channels with consistent N* electrocouplings will offer evidence for the reliable evaluation of these fundamental quantities.

  15. cAMP-PKA phosphorylation of tau confers risk for degeneration in aging association cortex

    PubMed Central

    Carlyle, Becky C.; Nairn, Angus C.; Wang, Min; Yang, Yang; Jin, Lu E.; Simen, Arthur A.; Ramos, Brian P.; Bordner, Kelly A.; Craft, George E.; Davies, Peter; Pletikos, Mihovil; Šestan, Nenad; Arnsten, Amy F. T.; Paspalas, Constantinos D.

    2014-01-01

    The pattern of neurodegeneration in Alzheimer’s disease (AD) is very distinctive: neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau selectively affect pyramidal neurons of the aging association cortex that interconnect extensively through glutamate synapses on dendritic spines. In contrast, primary sensory cortices have few NFTs, even in late-stage disease. Understanding this selective vulnerability, and why advancing age is such a high risk factor for the degenerative process, may help to reveal disease etiology and provide targets for intervention. Our study has revealed age-related increase in cAMP-dependent protein kinase (PKA) phosphorylation of tau at serine 214 (pS214-tau) in monkey dorsolateral prefrontal association cortex (dlPFC), which specifically targets spine synapses and the Ca2+-storing spine apparatus. This increase is mirrored by loss of phosphodiesterase 4A from the spine apparatus, consistent with increase in cAMP-Ca2+ signaling in aging spines. Phosphorylated tau was not detected in primary visual cortex, similar to the pattern observed in AD. We also report electron microscopic evidence of previously unidentified vesicular trafficking of phosphorylated tau in normal association cortex—in axons in young dlPFC vs. in spines in aged dlPFC—consistent with the transneuronal lesion spread reported in genetic rodent models. pS214-Tau was not observed in normal aged mice, suggesting that it arises with the evolutionary expansion of corticocortical connections in primates, crossing the threshold into NFTs and degeneration in humans. Thus, the cAMP-Ca2+ signaling mechanisms, needed for flexibly modulating network strength in young association cortex, confer vulnerability to degeneration when dysregulated with advancing age. PMID:24707050

  16. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  17. Amp Synthesis in Aqueous Solution of Adenosine and Phosphorus Pentoxide

    NASA Astrophysics Data System (ADS)

    Yamagata, Y.; Kojima, H.; Ejiri, K.; Inomata, K.

    1982-12-01

    Possible formation of a P4O10 molecule in magma, the stability of the molecule in hydrous volcanic gas at high temperatures and a possible prebiotic phosphate cycle were discussed in relation to chemical evolution. To demonstrate the utility of phosphorus pentoxide as a phosphorylating agent, aqueous solutions of adenosine (0.02M) and phosphorus pentoxide (0.2M) were incubated at 37°C for 5 months. The pH of the solutions was adjusted every day or every few days to each fixed value (9.0, 10.5, 11.5, 12.5) with 10 N NaOH. The HPLC analysis showed the formation of 2'-AMP, 3'-AMP, 5'-AMP, cyclic (2' 3')-AMP and cyclic (3' 5')-AMP. The main components of the products were 2'- and 3'-AMP, though cyclic (2' 3')-AMP was the main component in the early period of the incubation at pH 9.0. The yields (conversion rate of adenosine to AMPs) were increased almost linearly with the incubation time for 5 months in the case of pH 9.0. The final yields were about 3% (pH 9.0), 6% (pH 9.0, 1 M NaCl), 5% (pH 9.0, 0.01 M CaCl2, 0.01 M MgCl2), 7% (pH 9.0, 0.5 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 9% (pH 9.0, 1 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 32% (pH 10.5), 43% (pH 11.5), 35% (pH 12.5).

  18. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  19. Bacterial Cyclic AMP-Phosphodiesterase Activity Coordinates Biofilm Formation

    PubMed Central

    Kalivoda, Eric J.; Brothers, Kimberly M.; Stella, Nicholas A.; Schmitt, Matthew J.; Shanks, Robert M. Q.

    2013-01-01

    Biofilm-related infections are a major contributor to human disease, and the capacity for surface attachment and biofilm formation are key attributes for the pathogenesis of microbes. Serratia marcescens type I fimbriae-dependent biofilms are coordinated by the adenylate cyclase, CyaA, and the cyclic 3′,5′-adenosine monophosphate (cAMP)-cAMP receptor protein (CRP) complex. This study uses S. marcescens as a model system to test the role of cAMP-phosphodiesterase activity in controlling biofilm formation. Herein we describe the characterization of a putative S. marcescens cAMP-phosphodiesterase gene (SMA3506), designated as cpdS, and demonstrated to be a functional cAMP-phosphodiesterase both in vitro and in vivo. Deletion of cpdS resulted in defective biofilm formation and reduced type I fimbriae production, whereas multicopy expression of cpdS conferred a type I fimbriae-dependent hyper-biofilm. Together, these results support a model in which bacterial cAMP-phosphodiesterase activity modulates biofilm formation. PMID:23923059

  20. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  1. Foundational development of an advanced nuclear reactor integrated safety code.

    SciTech Connect

    Clarno, Kevin; Lorber, Alfred Abraham; Pryor, Richard J.; Spotz, William F.; Schmidt, Rodney Cannon; Belcourt, Kenneth; Hooper, Russell Warren; Humphries, Larry LaRon

    2010-02-01

    This report describes the activities and results of a Sandia LDRD project whose objective was to develop and demonstrate foundational aspects of a next-generation nuclear reactor safety code that leverages advanced computational technology. The project scope was directed towards the systems-level modeling and simulation of an advanced, sodium cooled fast reactor, but the approach developed has a more general applicability. The major accomplishments of the LDRD are centered around the following two activities. (1) The development and testing of LIME, a Lightweight Integrating Multi-physics Environment for coupling codes that is designed to enable both 'legacy' and 'new' physics codes to be combined and strongly coupled using advanced nonlinear solution methods. (2) The development and initial demonstration of BRISC, a prototype next-generation nuclear reactor integrated safety code. BRISC leverages LIME to tightly couple the physics models in several different codes (written in a variety of languages) into one integrated package for simulating accident scenarios in a liquid sodium cooled 'burner' nuclear reactor. Other activities and accomplishments of the LDRD include (a) further development, application and demonstration of the 'non-linear elimination' strategy to enable physics codes that do not provide residuals to be incorporated into LIME, (b) significant extensions of the RIO CFD code capabilities, (c) complex 3D solid modeling and meshing of major fast reactor components and regions, and (d) an approach for multi-physics coupling across non-conformal mesh interfaces.

  2. The Search for a π1(1400) Exotic Meson in the γp->^amp;++η^amp;- System

    NASA Astrophysics Data System (ADS)

    Schott, Diane

    2013-04-01

    Over twenty years ago QCD-inspired models of hadronic states suggested the existence of mesons beyond the Naive Quark Model (NQM), which motivated a rigorous search for exotic mesons. The lightest of these states is the π1(1400) decaying to η^amp;- observed by experiment E852 at Brookhaven and the VES collaboration at IHEP. Photoproduction is predicted to favor production of a J^PC=1^-+ gluonic excitation resulting in the increase of the ratio of π1 to a2 mesons. A Partial Wave Analysis was conducted on the reaction γp->^amp;++X->p^amp;+^amp;-(η), using the ^amp;++ to select the pion exchange. The analysis has shown the final spectra of the resonance decaying to η^amp;- to be dominated by the quantum state of J^PC=2^++ corresponding to the presence of the a2(1320). The J^PC=1^-+ state, shows no structure in the intensity distribution. The phase difference between the J^PC=1^-+ and J^PC=2^++ amplitudes show the interference between the two states. This is the first spin-parity analysis of the ηπ final state in photoproduction.

  3. Cyclic Di-AMP Homeostasis in Bacillus subtilis

    PubMed Central

    Mehne, Felix M. P.; Gunka, Katrin; Eilers, Hinnerk; Herzberg, Christina; Kaever, Volkhard; Stülke, Jörg

    2013-01-01

    The genome of the Gram-positive soil bacterium Bacillus subtilis encodes three potential diadenylate cyclases that may synthesize the signaling nucleotide cyclic di-AMP (c-di-AMP). These enzymes are expressed under different conditions in different cell compartments, and they localize to distinct positions in the cell. Here we demonstrate the diadenylate cyclase activity of the so far uncharacterized enzymes CdaA (previously known as YbbP) and CdaS (YojJ). Our work confirms that c-di-AMP is essential for the growth of B. subtilis and shows that an excess of the molecule is also harmful for the bacteria. Several lines of evidence suggest that the diadenylate cyclase CdaA is part of the conserved essential cda-glm module involved in cell wall metabolism. In contrast, the CdaS enzyme seems to provide c-di-AMP for spores. Accumulation of large amounts of c-di-AMP impairs the growth of B. subtilis and results in the formation of aberrant curly cells. This phenotype can be partially suppressed by elevated concentrations of magnesium. These observations suggest that c-di-AMP interferes with the peptidoglycan synthesis machinery. The activity of the diadenylate cyclases is controlled by distinct molecular mechanisms. CdaA is stimulated by a regulatory interaction with the CdaR (YbbR) protein. In contrast, the activity of CdaS seems to be intrinsically restricted, and a single amino acid substitution is sufficient to drastically increase the activity of the enzyme. Taken together, our results support the idea of an important role for c-di-AMP in B. subtilis and suggest that the levels of the nucleotide have to be tightly controlled. PMID:23192352

  4. Intraoperative urinary cyclic AMP monitoring in primary hyperparathyroidism.

    PubMed Central

    Schenk, W G; Wills, M; MacLeod, M S; Hanks, J B

    1993-01-01

    OBJECTIVE: This study examined the utility of intraoperative urinary cyclic 3'5' adenosine monophosphate (UcAMP), an indicator of parathyroid (PTH) hormone end-organ activity, as a "biochemical frozen section," signaling the real-time resolution of PTH hyperactivity during surgery for primary hyperparathyroidism. SUMMARY BACKGROUND DATA: The unsuccessful initial neck exploration for primary hyperparathyroidism, leaving the patient with persistent hyperfunctioning parathyroid tissue, results in part from the surgeon's inability intraoperatively to correlate a gland's gross appearance and size estimation with physiologic function. Preoperative imaging, intraoperative imaging, and intraoperative histologic/cytologic surveillance have not resolved this dilemma. METHODS: Twenty-seven patients underwent a prospective intraoperative UcAMP monitoring protocol. The patients all had a clinical diagnosis of primary hyperparathyroidism and an average preoperative serum calcium of 12.0 +/- 0.3 mg/dl. UcAMP was assayed intraoperatively using 20-minute nonequilibrium radioimmunoassay providing real-time feedback to the operating team. RESULTS: All patients had an elevated UcAMP confirming PTh hyperactivity at the beginning of the procedure. One patient, subsequently found to have an supernumerary ectopic adenoma, had four normal glands identified intraoperatively, and his intraoperative UcAMP values corroborated persistent hyperparathyroidism, the UcAMP of the remaining 26 patients decreased from 7.0 +/- 1.1 to 2.7 +/- 0.7 nm.dl GF (p < .00005) after complete adenoma excision, and they remain normocalcemic. The protocol provided useful and relevant information to the operating team, and aided in surgical decision-making, in 10 of the 27 cases (37%). CONCLUSION: Intraoperative biochemical surveillance with ucAMP monitoring reliably signals resolution of PTH hyperfunction. It is a useful adjunct to the surgeon's skill, judgment, and experience in parathyroid surgery. PMID:8387765

  5. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  6. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  7. Cyclic AMP, a nonessential regulator of the cell cycle.

    PubMed Central

    Coffino, P; Gray, J W; Tomkins, G M

    1975-01-01

    Flow-microfluorimetric analysis has been carried out on populations of exponentially growing S49 mouse lymphoma cells treated with dibutyryl cyclic AMP. The drug produces a specific concentration-dependent block in the G-1 phase of the cell cycle while other phases of the cycle are not perceptibly altered. The cell cycle of a line of mutant cells lacking the cyclic AMP-dependent protein kinase is not affected by the drug. Since these mutant cells have been shown to maintain a normal cell cycle, even in the presence of high levels of cyclic AMP, periodic fluctuations in the levels of the cyclic nucleotide cannot be required for or determine progression through the cell cycle. PMID:165491

  8. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  9. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  10. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence.

  11. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells

    PubMed Central

    Khan, D. R.; Guillemette, C.; Sirard, M. A.

    2015-01-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3′5′-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca2+) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  12. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  13. The field concept in Ampère's magnetostatics

    NASA Astrophysics Data System (ADS)

    Davis, Artice M.

    2009-08-01

    We update Ampère's theory using vector notation and derive his expression for the force between two current elements. We assume that the two elements are in different current loops and integrate over one to obtain the force on a differential element in the second. This procedure allows us to define the magnetic field in a natural manner and to derive the Lorentz force for a current segment. We equate the magnetic moments of current and permanent magnet dipoles and show that Biot and Savart could have performed their experiment using a small current loop, thus establishing the Biot-Savart law as a consequence of Ampère's theory.

  14. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  15. Luteinizing hormone-releasing hormone (LHRH) attenuates morphine-induced inhibition of cyclic AMP (cAMP) in opioid-responsive SK-N-SH cells.

    PubMed

    Ratka, A; Simpkins, J W

    1997-04-01

    SK-N-SH cells were used to assess the effects of luteinizing hormone-releasing hormone (LHRH) on opioid receptor-mediated changes in cyclic AMP (cAMP). Prostaglandin E1 (PGE1, 1 microM) caused a dramatic increase in cAMP levels. Treatment with 10 microM morphine (MOR) significantly inhibited the stimulatory effect of PGE1, LHRH (0.8 microM) caused an increase in the basal level of intracellular cAMP and potentiated the stimulatory effect of PGE1 on cAMP accumulation. In cells pretreated with LHRH the inhibitory effect of MOR on cAMP accumulation was significantly attenuated. An LHRH antagonist had no effect on cAMP. The involvement of pertussis toxin (PTX)-sensitive G proteins in the actions of LHRH was studied. PTX increased the stimulatory effect of PGE1 on cAMP and attenuated the inhibitory effect of MOR. However, PTX pretreatment prevented the effects of LHRH on the intracellular actions of PGE1 but exerted an additive effect with LHRH in blocking the MOR-induced decrease in cAMP levels. We conclude that LHRH attenuates the inhibitory, opioid receptor-mediated effect of MOR on intracellular cAMP accumulation in SK-N-SH cells, and that the G protein-independent mechanism may be involved in LHRH-induced attenuation of the inhibitory effect of MOR on neuronal cAMP.

  16. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  17. Glucose-induced hyperaccumulation of cyclic AMP and defective glucose repression in yeast strains with reduced activity of cyclic AMP-dependent protein kinase.

    PubMed

    Mbonyi, K; van Aelst, L; Argüelles, J C; Jans, A W; Thevelein, J M

    1990-09-01

    Addition of glucose or related fermentable sugars to derepressed cells of the yeast Saccharomyces cerevisiae triggers a RAS-mediated cyclic AMP (cAMP) signal that induces a protein phosphorylation cascade. In yeast mutants (tpk1w1, tpk2w1, and tpk3w1) containing reduced activity of cAMP-dependent protein kinase, fermentable sugars, as opposed to nonfermentable carbon sources, induced a permanent hyperaccumulation of cAMP. This finding confirms previous conclusions that fermentable sugars are specific stimulators of cAMP synthesis in yeast cells. Despite the huge cAMP levels present in these mutants, deletion of the gene (BCY1) coding for the regulatory subunit of cAMP-dependent protein kinase severely reduced hyperaccumulation of cAMP. Glucose-induced hyperaccumulation of cAMP was also observed in exponential-phase glucose-grown cells of the tpklw1 and tpk2w1 strains but not the tpk3w1 strain even though addition of glucose to glucose-repressed wild-type cells did not induce a cAMP signal. Investigation of mitochondrial respiration by in vivo 31P nuclear magnetic resonance spectroscopy showed the tpk1w1 and tpk2w1 strains, to be defective in glucose repression. These results are consistent with the idea that the signal transmission pathway from glucose to adenyl cyclase contains a glucose-repressible protein. They also show that a certain level of cAMP-dependent protein phosphorylation is required for glucose repression. Investigation of the glucose-induced cAMP signal and glucose-induced activation of trehalase in derepressed cells of strains containing only one of the wild-type TPK genes indicates that the transient nature of the cAMP signal is due to feedback inhibition by cAMP-dependent protein kinase.

  18. Cyclic AMP modulates electrical signaling in a weakly electric fish.

    PubMed

    McAnelly, L; Silva, A; Zakon, H H

    2003-04-01

    Many species of electric fish show diurnal or socially elicited variation in electric organ discharge amplitude. In Sternopygus macrurus, activation of protein kinase A by 8-bromo-cAMP increases electrocyte sodium current magnitude. To determine whether the behavioral plasticity in electric organ discharge amplitude is controlled by electrocyte biophysical properties, we examined whether the effects of phosphorylation on ion currents in the electric organ translate directly into electric organ discharge changes. We injected the electric organ of restrained fish with 8-bromo-cAMP and monitored the electric organ discharge. The effect of protein kinase A activation on electrocyte action potentials was examined in isolated electric organ using two-electrode current clamp. Electric organ discharge and action potential amplitude and pulse duration increased in response to 8-bromo-cAMP. Pulse and action potential duration both increased by about 25%. However, the increase in electric organ discharge amplitude (approximately 400%) was several-fold greater than the action potential amplitude increase (approximately 40%). Resting membrane resistance decreased in electrocytes exposed to 8-bromo-cAMP. We propose that in the Thevenin equivalent circuit of the electric organ a moderate increase in action potential amplitude combined with a decrease in internal resistance produces a greater voltage drop across the external resistance (the water around the fish), accounting for the large increase in the externally recorded electric organ discharge.

  19. Cyclic AMP signalling pathways in the regulation of uterine relaxation

    PubMed Central

    Yuan, Wei; López Bernal, Andrés

    2007-01-01

    Studying the mechanism(s) of uterine relaxation is important and will be helpful in the prevention of obstetric difficulties such as preterm labour, which remains a major cause of perinatal mortality and morbidity. Multiple signalling pathways regulate the balance between maintaining relative uterine quiescence during gestation, and the transition to the contractile state at the onset of parturition. Elevation of intracellular cyclic AMP promotes myometrial relaxation, and thus quiescence, via effects on multiple intracellular targets including calcium channels, potassium channels and myosin light chain kinase. A complete understanding of cAMP regulatory pathways (synthesis and hydrolysis) would assist in the development of better tocolytics to delay or inhibit preterm labour. Here we review the enzymes involved in cAMP homoeostasis (adenylyl cyclases and phosphodiesterases) and possible myometrial substrates for the cAMP dependent protein kinase. We must emphasise the need to identify novel pharmacological targets in human pregnant myometrium to achieve safe and selective uterine relaxation when this is indicated in preterm labour or other obstetric complications. PMID:17570154

  20. Fluorescence study of Escherichia coli cyclic AMP receptor protein.

    PubMed

    Wasylewski, M; Małecki, J; Wasylewski, Z

    1995-07-01

    Time-resolved, steady-state fluorescence and fluorescence-detected circular dichroism (FDCD) have been used to resolve the fluorescence contributions of the two tryptophan residues, Trp-13 and Trp-85, in the cyclic AMP receptor protein (CRP). The iodide and acrylamide quenching data show that in CRP one tryptophan residue, Trp-85, is buried within the protein matrix and the other, Trp-13, is moderately exposed on the surface of the protein. Fluorescence-quenching-resolved spectra show that Trp-13 has emission at about 350 nm and contributes 76-83% to the total fluorescence emission. The Trp-85, unquenchable by iodide and acrylamide, has the fluorescence emission at about 337 nm. The time-resolved fluorescence measurements show that Trp-13 has a longer fluorescence decay time. The Trp-85 exhibits a shorter fluorescence decay time. In the CRP-cAMP complex the Trp-85, previously buried in the apoprotein becomes totally exposed to the iodide and acrylamide quenchers. The FDCD spectra indicate that in the CRP-cAMP complex Trp-85 remains in the same environment as in the protein alone. It has been proposed that the binding of cAMP to CRP is accompanied by a hinge reorientation of two protein domains. This allows for penetration of the quencher molecules into the Trp-85 residue previously buried in the protein matrix. PMID:8590598

  1. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  2. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  3. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  4. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  5. Role of CNPase in the oligodendrocytic extracellular 2',3'-cAMP-adenosine pathway.

    PubMed

    Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Bansal, Rashmi; Goebbels, Sandra; Nave, Klaus-Armin; Kochanek, Patrick M; Jackson, Edwin K

    2013-10-01

    Extracellular adenosine 3',5'-cyclic monophosphate (3',5'-cAMP) is an endogenous source of localized adenosine production in many organs. Recent studies suggest that extracellular 2',3'-cAMP (positional isomer of 3',5'-cAMP) is also a source of adenosine, particularly in the brain in vivo post-injury. Moreover, in vitro studies show that both microglia and astrocytes can convert extracellular 2',3'-cAMP to adenosine. Here, we examined the ability of primary mouse oligodendrocytes and neurons to metabolize extracellular 2',3'-cAMP and their respective adenosine monophosphates (2'-AMP and 3'-AMP). Cells were also isolated from mice deficient in 2',3'-cyclic nucleotide-3'-phosphodiesterase (CNPase). Oligodendrocytes metabolized 2',3'-cAMP to 2'-AMP with 10-fold greater efficiency than did neurons (and also more than previously examined microglia and astrocytes); whereas, the production of 3'-AMP was minimal in both oligodendrocytes and neurons. The production of 2'-AMP from 2',3'-cAMP was reduced by 65% in CNPase -/- versus CNPase +/+ oligodendrocytes. Oligodendrocytes also converted 2'-AMP to adenosine, and this was also attenuated in CNPase -/- oligodendrocytes. Inhibition of classic 3',5'-cAMP-3'-phosphodiesterases with 3-isobutyl-1-methylxanthine did not block metabolism of 2',3'-cAMP to 2'-AMP and inhibition of classic ecto-5'-nucleotidase (CD73) with α,β-methylene-adenosine-5'-diphosphate did not attenuate the conversion of 2'-AMP to adenosine. These studies demonstrate that oligodendrocytes express the extracellular 2',3'-cAMP-adenosine pathway (2',3'-cAMP → 2'-AMP → adenosine). This pathway is more robustly expressed in oligodendrocytes than in all other CNS cell types because CNPase is the predominant enzyme that metabolizes 2',3'-cAMP to 2-AMP in CNS cells. By reducing levels of 2',3'-cAMP (a mitochondrial toxin) and increasing levels of adenosine (a neuroprotectant), oligodendrocytes may protect axons from injury. PMID:23922219

  6. Presence of free cyclic AMP receptor protein and regulation of its level by cyclic AMP in neuroblastoma-glioma hybrid cells.

    PubMed Central

    Walter, U; Costa, M R; Breakefield, X O; Greengard, P

    1979-01-01

    Neuroblastoma-glioma hybrid cells of line 108CC-5 were found to contain high levels of soluble adenosine 3',5'-cyclic monophosphate (cAMP)-dependent protein kinase activity and high levels of two specific cAMP receptor proteins, RI and RII. Treatment of the hybrid cells with dibutyryl cAMP increased the level of RI but did not significantly affect the level either of RII or of cAMP-dependent protein kinase activity. The effect of dibutyryl cAMP could be mimicked by prostaglandin E1 and 3-isobutyl-1-methylxanthine, both of which are known to raise cAMP levels in neuroblastoma-glioma hybrid cells. Both in control as well as in dibutyryl cAMP-treated cells, RII but not RI was associated with cAMP-dependent protein kinase. Several lines of evidence suggest that RI represents the free regulatory subunit of type I cAMP-dependent protein kinase. The presence of this regulatory subunit as free cAMP receptor protein in neuroblastoma-glioma hybrid cells may be of significance with respect to the regulation of growth and differentiation in tumor cells. Images PMID:226964

  7. Purification, characterization, and sequencing of novel antimicrobial peptides, Tu-AMP 1 and Tu-AMP 2, from bulbs of tulip (Tulipa gesneriana L.).

    PubMed

    Fujimura, Masatoshi; Ideguchi, Mineo; Minami, Yuji; Watanabe, Keiichi; Tadera, Kenjiro

    2004-03-01

    Novel antimicrobial peptides (AMP), designated Tu-AMP 1 and Tu-AMP 2, were purified from the bulbs of tulip (Tulipa gesneriana L.) by chitin affinity chromatography and reverse-phase high-performance liquid chromatography (HPLC). They bind to chitin in a reversible way. They were basic peptides having isoelectric points of over 12. Tu-AMP 1 and Tu-AMP 2 had molecular masses of 4,988 Da and 5,006 Da on MALDI-TOF MS analysis, and their extinction coefficients of 1% aqueous solutions at 280 nm were 3.3 and 3.4, respectively. Half of all amino acid residues of Tu-AMP 1 and Tu-AMP 2 were occupied by cysteine, arginine, lysine, and proline. The concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic bacteria and fungi were 2 to 20 microg/ml. The structural characteristics of Tu-AMP 1 and Tu-AMP 2 indicated that they were novel thionin-like antimicrobial peptides, though Tu-AMP 2 was a heterodimer composes of two short peptides joined with disulfide bonds.

  8. Trehalase activity and cyclic AMP content during early development of Mucor rouxii spores.

    PubMed Central

    Dewerchin, M A; Van Laere, A J

    1984-01-01

    Incubation of Mucor rouxii sporangiospores in complex medium under aerobic conditions resulted in a transient 20-fold increase in trehalase activity. Maximum activity was reached after 15 min. Simultaneously, the cyclic AMP (cAMP) content increased approximately eightfold, reaching a maximum within 10 min. Increases in trehalase activity and cAMP content were also observed under anaerobic conditions (CO2). The extent of trehalase activation and the changes in cAMP content, during both aerobic and anaerobic incubation, varied with the medium used. Trehalase was activated in vitro by a cAMP- and ATP-dependent process. An even faster activation was obtained when cAMP was replaced by the catalytic subunit of beef heart protein kinase. The coincidence of, and the correlation between, increased cAMP contents and trehalase activities support the involvement of a cAMP-dependent phosphorylation in the in vivo regulation of trehalase activity. PMID:6327611

  9. cAMP-synthesis in a medullary thyroid carcinoma cell line: response to adrenergic agents and prostaglandines.

    PubMed

    Mertens, P R; Goretzki, P E; Keck, E

    1999-01-01

    Calcitonin secretion by C-cells is mediated through intracellular 3'5'-cyclic adenosine monophosphate (cAMP) and calcium signaling. Calcitonin release stimulation tests may take advantage of both signaling cascades in screening for medullary thyroid carcinomas (MTC). To elucidate the regulation of the adenylyl cyclase system we have determined cAMP levels of a calcitonin-expressing MTC cell line (RG) after exposure to adrenergic agents and prostaglandines. In early passages (20-30) cAMP concentrations were significantly elevated in RG cells after exposure to beta-adrenergic agents and prostaglandines E1 and E2. In advanced passages (60-80) the beta-adrenergic response was no longer detectable and adrenergic receptors were uncoupled from the adenylyl cyclase complex; while the effect of prostaglandines E1 and E2 remained unaffected. Preincubation with dexamethasone, in a process requiring protein new synthesis, re-established the adrenergic response in later passages, indicating that RG cells dedifferentiated in culture over time. Our in vitro findings suggest that MTC cell dedifferentiation may be accompanied by adrenergic receptor-uncoupling from the adenylate cyclase system and that this process may be reversed by dexamethasone incubation.

  10. The cAMP/protein kinase A signaling pathway in pathogenic basidiomycete fungi: Connections with iron homeostasis

    PubMed Central

    Choi, Jaehyuk; Jung, Won Hee; Kronstad, James W.

    2015-01-01

    A number of pathogenic species of basidiomycete fungi are either life-threatening pathogens of humans or major economic pests for crop production. Sensing the host is a key aspect of pathogen proliferation during disease, and signal transduction pathways are critically important for detecting environmental conditions and facilitating adaptation. This review focuses on the contributions of the cAMP/protein kinase A (PKA) signaling pathway in Cryptococcus neoformans, a species that causes meningitis in humans, and Ustilago maydis, a model phytopathogen that causes a smut disease on maize. Environmental sensing by the cAMP/PKA pathway regulates the production of key virulence traits in C. neoformans including the polysaccharide capsule and melanin. For U. maydis, the pathway controls the dimorphic transition from budding growth to the filamentous cell type required for proliferation in plant tissue. We discuss recent advances in identifying new components of the cAMP/PKA pathway in these pathogens and highlight an emerging theme that pathway signaling influences iron acquisition. PMID:26231374

  11. High Precision Thermal, Structural and Optical Analysis of an External Occulter Using a Common Model and the General Purpose Multi-Physics Analysis Tool Cielo

    NASA Technical Reports Server (NTRS)

    Hoff, Claus; Cady, Eric; Chainyk, Mike; Kissil, Andrew; Levine, Marie; Moore, Greg

    2011-01-01

    The efficient simulation of multidisciplinary thermo-opto-mechanical effects in precision deployable systems has for years been limited by numerical toolsets that do not necessarily share the same finite element basis, level of mesh discretization, data formats, or compute platforms. Cielo, a general purpose integrated modeling tool funded by the Jet Propulsion Laboratory and the Exoplanet Exploration Program, addresses shortcomings in the current state of the art via features that enable the use of a single, common model for thermal, structural and optical aberration analysis, producing results of greater accuracy, without the need for results interpolation or mapping. This paper will highlight some of these advances, and will demonstrate them within the context of detailed external occulter analyses, focusing on in-plane deformations of the petal edges for both steady-state and transient conditions, with subsequent optical performance metrics including intensity distributions at the pupil and image plane.

  12. Multi-physics modelling contributions to investigate the atmospheric cosmic rays on the single event upset sensitivity along the scaling trend of CMOS technologies.

    PubMed

    Hubert, G; Regis, D; Cheminet, A; Gatti, M; Lacoste, V

    2014-10-01

    Particles originating from primary cosmic radiation, which hit the Earth's atmosphere give rise to a complex field of secondary particles. These particles include neutrons, protons, muons, pions, etc. Since the 1980s it has been known that terrestrial cosmic rays can penetrate the natural shielding of buildings, equipment and circuit package and induce soft errors in integrated circuits. Recently, research has shown that commercial static random access memories are now so small and sufficiently sensitive that single event upsets (SEUs) may be induced from the electronic stopping of a proton. With continued advancements in process size, this downward trend in sensitivity is expected to continue. Then, muon soft errors have been predicted for nano-electronics. This paper describes the effects in the specific cases such as neutron-, proton- and muon-induced SEU observed in complementary metal-oxide semiconductor. The results will allow investigating the technology node sensitivity along the scaling trend.

  13. Multi-physics modelling contributions to investigate the atmospheric cosmic rays on the single event upset sensitivity along the scaling trend of CMOS technologies.

    PubMed

    Hubert, G; Regis, D; Cheminet, A; Gatti, M; Lacoste, V

    2014-10-01

    Particles originating from primary cosmic radiation, which hit the Earth's atmosphere give rise to a complex field of secondary particles. These particles include neutrons, protons, muons, pions, etc. Since the 1980s it has been known that terrestrial cosmic rays can penetrate the natural shielding of buildings, equipment and circuit package and induce soft errors in integrated circuits. Recently, research has shown that commercial static random access memories are now so small and sufficiently sensitive that single event upsets (SEUs) may be induced from the electronic stopping of a proton. With continued advancements in process size, this downward trend in sensitivity is expected to continue. Then, muon soft errors have been predicted for nano-electronics. This paper describes the effects in the specific cases such as neutron-, proton- and muon-induced SEU observed in complementary metal-oxide semiconductor. The results will allow investigating the technology node sensitivity along the scaling trend. PMID:24500239

  14. Operational, hyper-resolution hydrologic modeling over the contiguous U.S. using themulti-scale, multi-physics WRF-Hydro Modeling and Data Assimilation System.

    NASA Astrophysics Data System (ADS)

    Gochis, D. J.; Cosgrove, B.; Yu, W.; Clark, E. P.; Yates, D. N.; Dugger, A. L.; McCreight, J. L.; Pan, L.; Zhang, Y.; rafeei-Nasab, A.; Karsten, L. R.; Cline, D. W.; Sampson, K. M.; Newman, A. J.; Wood, A.; Win-Gildenmeister, M.

    2015-12-01

    Operational flood, flash flood and water supply forecasting is typically conducted using a host of different observational and modeling tools that range widely in process complexity, spatial resolution andobservational data sources. While such tailored approaches can provide significant skill in specific water forecasting applications, the lack of a more coordinated general approach can result in inconsistency between various forecast products and can inhibit transfer of information, methodologies between forecast systems. With the aim of improving the timeliness, consistency and spatial fidelity hydrologic prediction products, the U.S. National Weather Service has initiated an effort to provide street-level, water prediction services for the nation. This effort seeks to incorporate advances in hydrometeorological observing capabilities, new hydrologic data assimilation methodologies, improvements in hydrographic and geospatial information and advances in the ulitizion of high performance computers for process-based hydrologic modeling. This talk will summarize the proposed Initial Operating Capability (IOC) for national water prediction using the community WRF-Hydro modeling system, scheduled for operational execution during late spring of 2016. Four different configurations of the WRF-Hydro system are planned including an Analysis and Data Assimilation configuration, Short Range (0-2 day) and Medium Range (0-10 day) deterministic configurations and a Long Range (0-30 day) enesmble configuration. Streamflow analyses and forecasts from each model configurations will be produced on 2.7 million river reaches of the NHDPlusv2 hydrographic dataset. This presentation summarizes results from a number of different model development and benchmarking activities conducted as part of the IOC effort. Results from prototype real-time forecasting activities conducted during the 2015 National Flood Interoperability Experiment (NFIE) will be presented as will retrospective

  15. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens.

  16. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  17. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity.

  18. Regulatory components in Citrobacter freundii ampC beta-lactamase induction.

    PubMed

    Lindberg, F; Westman, L; Normark, S

    1985-07-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase similar to the constitutively expressed ampC beta-lactamase of Escherichia coli. In the latter species the ampC gene is located next to the fumarate reductase (frd) operon, whereas in C. freundii the ampC gene is known to be separated from frd by 1100 base pairs. This intervening DNA segment carries a gene, ampR, coding for a 31-kilodalton polypeptide. The cloned C. freundii OS60 ampC gene is inducible by beta-lactam antibiotics in E. coli, but only in the presence of an intact ampR gene. In the absence of inducer the AmpR protein represses C. freundii ampC synthesis 2.5-fold. Addition of beta-lactams induced expression from the cloned ampC beta-lactamase gene 11-fold. Thus, the AmpR protein has a positive effect on ampC expression in the presence of inducing beta-lactams. Two spontaneous mutants of C. freundii were isolated that constitutively overproduce the ampC beta-lactamase. The mutations in both these strains occurred outside the frd-amp region, suggesting that there is at least one additional component in the regulatory system. With the cloned C. freundii ampC gene in E. coli, mutants with the same phenotype could be obtained. These mutations were located on the E. coli chromosome. The constitutive beta-lactamase overproduction in these mutants requires the presence of an intact ampR gene.

  19. Protein Kinase A-Dependent and -Independent Signaling Pathways Contribute to Cyclic AMP-Stimulated Proliferation

    PubMed Central

    Cass, Lisa A.; Summers, Scott A.; Prendergast, Gregory V.; Backer, Jonathan M.; Birnbaum, Morris J.; Meinkoth, Judy L.

    1999-01-01

    The effects of cyclic AMP (cAMP) on cell proliferation are cell type specific. Although the growth-inhibitory effects of cAMP have been well studied, much less is known regarding how cAMP stimulates proliferation. We report that cAMP stimulates proliferation through both protein kinase A (PKA)-dependent and PKA-independent signaling pathways and that phosphatidylinositol 3-kinase (PI3K) is required for cAMP-stimulated mitogenesis. In cells where cAMP is a mitogen, cAMP-elevating agents stimulate membrane ruffling, Akt phosphorylation, and p70 ribosomal S6 protein kinase (p70s6k) activity. cAMP effects on ruffle formation and Akt were PKA independent but sensitive to wortmannin. In contrast, cAMP-stimulated p70s6k activity was repressed by PKA inhibitors but not by wortmannin or microinjection of the N-terminal SH2 domain of the p85 regulatory subunit of PI3K, indicating that p70s6k and Akt can be regulated independently. Microinjection of highly specific inhibitors of PI3K or Rac1, or treatment with the p70s6k inhibitor rapamycin, impaired cAMP-stimulated DNA synthesis, demonstrating that PKA-dependent and -independent pathways contribute to cAMP-mediated mitogenesis. Direct elevation of PI3K activity through microinjection of an antibody that stimulates PI3K activity or stable expression of membrane-localized p110 was sufficient to confer hormone-independent DNA synthesis when accompanied by elevations in p70s6k activity. These findings indicate that multiple pathways contribute to cAMP-stimulated mitogenesis, only some of which are PKA dependent. Furthermore, they demonstrate that the ability of cAMP to stimulate both p70s6k- and PI3K-dependent pathways is an important facet of cAMP-regulated cell cycle progression. PMID:10454535

  20. Epidermal chalone and cyclic AMP: an in vivo study.

    PubMed

    Elgjo, K

    1975-01-01

    Water extracts of skin contain two factors that inhibit epidermal cell proliferation: one substance inhibits epidermal cells in the G2 phase (the epidermal G2 inhibitor), and another inhibits the transit of cells from the G1 phase into the S phase (the epidermal G1 inhibitor). Pretreatment of mice with a beta-receptor antagonist (propranolol) abolished the activity of the G2 inhibitor but not that of the G1 inhibitor. After pretreatment with both propranolol and a phosphodiesterase inhibitor (caffine)the G2 inhibitor had full effect. Cafine alone had a moderately inhibitory effect on epidermal G2 cells and enhanced the depressing effect of the G1 inhibitor on epidermal DNA synthesis. AMP level in epidermis to be active. Cyclic AMP is probably also involved in the regulation of the rate of transit of epidermal G1 cells into the S phase but the epidermal cyclic AMP level seems not to be so critical for the efficacy of the epidermal G2 inhibitor in epidermal cell differentiation. PMID:162919

  1. Cyclic AMP and its functional relationship in Tetrahymena: a comparison between phagocytosis and glucose uptake.

    PubMed

    Csaba, G; Nagy, S U; Lantos, T

    1978-01-01

    In Tetrahymena, an increase in the level of cAMP is accompanied by an increased phagocytotic rate, whereas increased sugar uptake is parallelled by a decreased cAMP level. The increase in cAMP level seems to be decisive with respect to phagocytosis as a basic phenomenon of life. In the action of epinephrine, however, some mechanism other than cAMP mediation may be involved. Depending on concentration, one hormone may provoke either an increase or a decrease in cAMP level, and this in turn triggers the corresponding function.

  2. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  3. 3':5'-cyclic AMP and hormonal control of puparium formation in the fleshfly Sarcophaga bullata.

    PubMed

    Fraenkel, G; Blechl, A; Blechl, J; Herman, P; Seligman, M I

    1977-05-01

    Injection of 3':5'-cyclic AMP (cAMP) into larvae of the fly Sarcophaga bullata 3-4 hr before the beginning of puparium formation (red-spiracle stage) greatly accelerates the onset of tanning without affecting initiation of puparium formation (anterior retraction). Accelerated tanning resembles real tanning in two important respects: the solubility of cuticular proteins becomes reduced and [U-14C]tyrosine is incorporated into the cuticle. Of a number of cAMP analogues tested, 3':5'- cyclic GMP, 2':3'-cyclic AMP, and 5'-AMP were inactive, dibutyryl-3':5'-cAMP had only slight activity, and cyclic IMP and deoxy-3':5'-cAMP showed some activity. Theophylline enhanced the effect of small doses of cAMP or of blood, diluted 1:8, active in the puparium tanning factor. Injection of dopa, dopamine, acetyldopamine, or epinephrine, but not of tyrosine, had an accelerating effect similar to that of cAMP. The tanning-inhibiting effect of DL-alpha-methyl-alpha-hydrazino-beta-(3,4-dihydroxyphenyl)propionic acid monohydrate is reversed by dopamine or epinephrine, but not by tyrosine, dopa, or cAMP. Evidence is presented to indicate that the responses to cAMP are not artifacts but reflect actual biochemical events during tanning.

  4. Orthologous and Paralogous AmpD Peptidoglycan Amidases from Gram-Negative Bacteria

    PubMed Central

    Rivera, Ivanna; Molina, Rafael; Lee, Mijoon; Mobashery, Shahriar

    2016-01-01

    Cell wall recycling and β-lactam antibiotic resistance are linked in Enterobacteriaceae and in Pseudomonas aeruginosa. This process involves a large number of murolytic enzymes, among them a cytoplasmic peptidoglycan amidase AmpD, which plays an essential role by cleaving the peptide stem from key intermediates en route to the β-lactamase production (a resistance mechanism) and cell wall recycling. Uniquely, P. aeruginosa has two additional paralogues of AmpD, designated AmpDh2 and AmpDh3, which are periplasmic enzymes. Despite the fact that AmpDh2 and AmpDh3 share a common motif for their respective catalytic domains, they are each comprised of multidomain architectures and exhibit distinct oligomerization properties. We review herein the structural and biochemical properties of orthologous and paralogous AmpD proteins and discuss their implication in cell wall recycling and antibiotic resistance processes. PMID:27326855

  5. A Fluorescent Transport Assay Enables Studying AmpG Permeases Involved in Peptidoglycan Recycling and Antibiotic Resistance.

    PubMed

    Perley-Robertson, G Evan; Yadav, Anuj K; Winogrodzki, Judith L; Stubbs, Keith A; Mark, Brian L; Vocadlo, David J

    2016-09-16

    Inducible AmpC β-lactamases deactivate a broad-spectrum of β-lactam antibiotics and afford antibiotic resistance in many Gram-negative bacteria. The disturbance of peptidoglycan recycling caused by β-lactam antibiotics leads to accumulation of GlcNAc-1,6-anhydroMurNAc-peptides, which are transported by AmpG to the cytoplasm where they are processed into AmpC inducers. AmpG transporters are poorly understood; however, their loss restores susceptibility toward β-lactam antibiotics, highlighting AmpG as a potential target for resistance-attenuating therapeutics. We prepare a GlcNAc-1,6-anhydroMurNAc-fluorophore conjugate and, using live E. coli spheroplasts, quantitatively analyze its transport by AmpG and inhibition of this process by a competing substrate. Further, we use this transport assay to evaluate the function of two AmpG homologues from Pseudomonas aeruginosa and show that P. aeruginosa AmpG (Pa-AmpG) but not AmpP (Pa-AmpP) transports this probe substrate. We corroborate these results by AmpC induction assays with Pa-AmpG and Pa-AmpP. This fluorescent AmpG probe and spheroplast-based transport assay will enable improved understanding of PG recycling and of permeases from the major facilitator superfamily of transport proteins and may aid in identification of AmpG antagonists that combat AmpC-mediated resistance toward β-lactam antibiotics.

  6. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  7. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel.

  8. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  9. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells.

    PubMed

    Breit, Andreas; Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas

    2016-07-01

    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction. PMID:27144291

  10. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells.

    PubMed

    Breit, Andreas; Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas

    2016-07-01

    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction.

  11. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  12. Concerted Regulation of cGMP and cAMP Phosphodiesterases in Early Cardiac Hypertrophy Induced by Angiotensin II

    PubMed Central

    Mokni, Walid; Keravis, Thérèse; Etienne-Selloum, Nelly; Walter, Alison; Kane, Modou O.; Schini-Kerth, Valérie B.; Lugnier, Claire

    2010-01-01

    Left ventricular hypertrophy leads to heart failure and represents a high risk leading to premature death. Cyclic nucleotides (cAMP and cGMP) play a major role in heart contractility and cyclic nucleotide phosphodiesterases (PDEs) are involved in different stages of advanced cardiac diseases. We have investigated their contributions in the very initial stages of left ventricular hypertrophy development. Wistar male rats were treated over two weeks by chronic infusion of angiotensin II using osmotic mini-pumps. Left cardiac ventricles were used as total homogenates for analysis. PDE1 to PDE5 specific activities and protein and mRNA expressions were explored. Rats developed arterial hypertension associated with a slight cardiac hypertrophy (+24%). cAMP-PDE4 activity was specifically increased while cGMP-PDE activities were broadly increased (+130% for PDE1; +76% for PDE2; +113% for PDE5) and associated with increased expressions for PDE1A, PDE1C and PDE5A. The cGMP-PDE1 activation by Ca2+/CaM was reduced. BNP expression was increased by 3.5-fold, while NOX2 expression was reduced by 66% and AMP kinase activation was increased by 64%. In early cardiac hypertrophy induced by angiotensin II, all specific PDE activities in left cardiac ventricles were increased, favoring an increase in cGMP hydrolysis by PDE1, PDE2 and PDE5. Increased cAMP hydrolysis was related to PDE4. We observed the establishment of two cardioprotective mechanisms and we suggest that these mechanisms could lead to increase intracellular cGMP: i) increased expression of BNP could increase “particulate” cGMP pool; ii) increased activation of AMPK, subsequent to increase in PDE4 activity and 5′AMP generation, could elevate “soluble” cGMP pool by enhancing NO bioavailability through NOX2 down-regulation. More studies are needed to support these assumptions. Nevertheless, our results suggest a potential link between PDE4 and AMPK/NOX2 and they point out that cGMP-PDEs, especially PDE1 and PDE2

  13. A novel cysteine-rich antifungal peptide ToAMP4 from Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, Eugene A; Andreev, Yaroslav A; Odintsova, T I; Kozlov, S A; Grishin, Eugene V; Egorov, Tsezi A

    2013-09-01

    A novel peptide named ToAMP4 was isolated from Taraxacum officinale Wigg. flowers by a combination of acetic acid extraction and different types of chromatography: affinity, size-exclusion, and RP-HPLC. The amino acid sequence of ToAMP4 was determined by automated Edman degradation. The peptide is basic, consists of 41 amino acids, and incorporates three disulphide bonds. Due to the unusual cysteine spacing pattern, ToAMP4 does not belong to any known plant AMP family, but classifies together with two other antimicrobial peptides ToAMP1 and ToAMP2 previously isolated from the dandelion flowers. To study the biological activity of ToAMP4, it was successfully produced in a prokaryotic expression system as a fusion protein with thioredoxin. The recombinant peptide was shown to be identical to the native ToAMP4 by chromatographic behavior, molecular mass, and N-terminal amino acid sequence. The peptide displays broad-spectrum antifungal activity against important phytopathogens. Two ToAMP4-mediated inhibition strategies depending on the fungus were demonstrated. The results obtained add to our knowledge on the structural and functional diversity of AMPs in plants.

  14. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  15. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  16. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  17. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  18. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  19. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  20. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  1. Amp-hour counting control for PV hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-06-01

    The performance of an amp-hour (Ah) counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based PV hybrid charge controller. This work included extensive field testing of the charge algorithm on flooded lead-antimony and valve regulated lead-acid (VRLA) batteries. The test results after one-year have demonstrated that PV charge utilization, battery charge control, and battery state of charge (SOC) has been significantly improved by providing maximum charge to the batteries while limiting battery overcharge to manufacturers specifications during variable solar resource and load periods.

  2. Op. amps in power amplification: a laboratory exercise on feedback

    NASA Astrophysics Data System (ADS)

    Borcherds, P. H.

    1984-05-01

    Rapid and continuing developments in electronics make it necessary to revise constantly the teaching of electronics and to replace obsolescent laboratory exercises. The author describes a new exercise which believes helps students' (and lecturers') understanding of negative feedback. A power amplifier is constructed from an operational amplifier (op. amp.) together with a complementary pair of transistors as an output stage. To make the exercise more realistic a low impedance (8 Omega ) loudspeaker is used as the load. The amplifier is developed and tested stage by stage, and at each stage the defects apparent at the previous stage are eliminated.

  3. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  4. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases.

  5. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  6. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP.

  7. Cyclic AMP Can Decrease Expression of Genes Subject to Catabolite Repression in Saccharomyces cerevisiae

    PubMed Central

    Zaragoza, Oscar; Lindley, Chris; Gancedo, Juana M.

    1999-01-01

    External cyclic AMP (cAMP) hindered the derepression of gluconeogenic enzymes in a pde2 mutant of Saccharomyces cerevisiae, but it did not prevent invertase derepression. cAMP reduced nearly 20-fold the transcription driven by upstream activation sequence (UAS1FBP1) from FBP1, encoding fructose-1,6-bisphosphatase; it decreased 2-fold the activation of transcription by UAS2FBP1. Nuclear extracts from cells derepressed in the presence of cAMP were impaired in the formation of specific UASFBP1-protein complexes in band shift experiments. cAMP does not appear to act through the repressing protein Mig1. Control of FBP1 transcription through cAMP is redundant with other regulatory mechanisms. PMID:10198033

  8. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  9. Expression of Dm-AMP1 in rice confers resistance to Magnaporthe oryzae and Rhizoctonia solani.

    PubMed

    Jha, Sanjay; Tank, Harsukh G; Prasad, Bishun Deo; Chattoo, Bharat B

    2009-02-01

    Magnaporthe oryzae and Rhizoctonia solani, are among the most important pathogens of rice, severely limiting its productivity. Dm-AMP1, an antifungal plant defensin from Dahlia merckii, was expressed in rice (Oryza sativa L. sp. indica cv. Pusa basmati 1) using Agrobacterium tumefaciens-mediated transformation. Expression levels of Dm-AMP1 ranged from 0.43% to 0.57% of total soluble protein in transgenic plants. It was observed that constitutive expression of Dm-AMP1 suppresses the growth of M. oryzae and R. solani by 84% and 72%, respectively. Transgenic expression of Dm-AMP1 was not accompanied by an induction of pathogenesis-related (PR) gene expression, indicating that the expression of DmAMP1 directly inhibits the pathogen. The results of in vitro, in planta and microscopic analyses suggest that Dm-AMP1 expression has the potential to provide broad-spectrum disease resistance in rice. PMID:18618285

  10. Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy.

    PubMed

    Yang, Haihua; Yang, Linghai

    2016-08-01

    In mammals, cyclic adenosine monophosphate (cAMP) is an intracellular second messenger that is usually elicited by binding of hormones and neurotransmitters to G protein-coupled receptors (GPCRs). cAMP exerts many of its physiological effects by activating cAMP-dependent protein kinase (PKA), which in turn phosphorylates and regulates the functions of downstream protein targets including ion channels, enzymes, and transcription factors. cAMP/PKA signaling pathway regulates glucose homeostasis at multiple levels including insulin and glucagon secretion, glucose uptake, glycogen synthesis and breakdown, gluconeogenesis, and neural control of glucose homeostasis. This review summarizes recent genetic and pharmacological studies concerning the regulation of glucose homeostasis by cAMP/PKA in pancreas, liver, skeletal muscle, adipose tissues, and brain. We also discuss the strategies for targeting cAMP/PKA pathway for research and potential therapeutic treatment of type 2 diabetes mellitus (T2D). PMID:27194812

  11. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  12. Reanalyzing the Ampère-Maxwell Law

    NASA Astrophysics Data System (ADS)

    Hill, S. Eric

    2011-09-01

    In a recent TPT article, I addressed a common miscommunication about Faraday's law, namely, that introductory texts often say the law expresses a causal relationship between the magnetic fields time variation and the electric fields circulation. In that article, I demonstrated that these field behaviors share a common cause in a time-varying current density. From that, many readers may have rightly guessed at a symmetric conclusion: while the Ampère-Maxwell law is commonly said to express a causal relation between the electric fields time variation and the magnetic fields circulation, these field behaviors share a distinct, common cause. Together, Faraday's law and the Ampère-Maxwell law constitute half of Maxwell's laws that form a foundation for almost all of electricity and magnetism. By misrepresenting these two laws, introductory texts not only present students with unnecessary conceptual hurdles early in their physics educations but also leave them with enduring misunderstandings about the very foundation of electricity and magnetism. Fortunately, compared to what is commonly taught, the actual cause of these field variations is conceptually simpler and more consistent with what the students will have already learned in the introductory texts' own earlier chapters.

  13. Cyclic GMP-AMP Displays Mucosal Adjuvant Activity in Mice

    PubMed Central

    Škrnjug, Ivana

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity – a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines. PMID:25295996

  14. Regulation of cAMP-dependent Protein Kinases

    PubMed Central

    Diskar, Mandy; Zenn, Hans-Michael; Kaupisch, Alexandra; Kaufholz, Melanie; Brockmeyer, Stefanie; Sohmen, Daniel; Berrera, Marco; Zaccolo, Manuela; Boshart, Michael; Herberg, Friedrich W.; Prinz, Anke

    2010-01-01

    cAMP-dependent protein kinases are reversibly complexed with any of the four isoforms of regulatory (R) subunits, which contain either a substrate or a pseudosubstrate autoinhibitory domain. The human protein kinase X (PrKX) is an exemption as it is inhibited only by pseudosubstrate inhibitors, i.e. RIα or RIβ but not by substrate inhibitors RIIα or RIIβ. Detailed examination of the capacity of five PrKX-like kinases ranging from human to protozoa (Trypanosoma brucei) to form holoenzymes with human R subunits in living cells shows that this preference for pseudosubstrate inhibitors is evolutionarily conserved. To elucidate the molecular basis of this inhibitory pattern, we applied bioluminescence resonance energy transfer and surface plasmon resonance in combination with site-directed mutagenesis. We observed that the conserved αH-αI loop residue Arg-283 in PrKX is crucial for its RI over RII preference, as a R283L mutant was able to form a holoenzyme complex with wild type RII subunits. Changing the corresponding αH-αI loop residue in PKA Cα (L277R), significantly destabilized holoenzyme complexes in vitro, as cAMP-mediated holoenzyme activation was facilitated by a factor of 2–4, and lead to a decreased affinity of the mutant C subunit for R subunits, significantly affecting RII containing holoenzymes. PMID:20819953

  15. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  16. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  17. Impact of AmpC Derepression on Fitness and Virulence: the Mechanism or the Pathway?

    PubMed Central

    Pérez-Gallego, Marcelo; Torrens, Gabriel; Castillo-Vera, Jane; Moya, Bartolomé; Zamorano, Laura; Hultenby, Kjell; Albertí, Sebastián; Mellroth, Peter; Henriques-Normark, Birgitta; Normark, Staffan

    2016-01-01

    ABSTRACT Understanding the interplay between antibiotic resistance and bacterial fitness and virulence is essential to guide individual treatments and improve global antibiotic policies. A paradigmatic example of a resistance mechanism is the intrinsic inducible chromosomal β-lactamase AmpC from multiple Gram-negative bacteria, including Pseudomonas aeruginosa, a major nosocomial pathogen. The regulation of ampC expression is intimately linked to peptidoglycan recycling, and AmpC-mediated β-lactam resistance is frequently mediated by inactivating mutations in ampD, encoding an N-acetyl-anhydromuramyl-l-alanine amidase, affecting the levels of ampC-activating muropeptides. Here we dissect the impact of the multiple pathways causing AmpC hyperproduction on P. aeruginosa fitness and virulence. Through a detailed analysis, we demonstrate that the lack of all three P. aeruginosa AmpD amidases causes a dramatic effect in fitness and pathogenicity, severely compromising growth rates, motility, and cytotoxicity; the latter effect is likely achieved by repressing key virulence factors, such as protease LasA, phospholipase C, or type III secretion system components. We also show that ampC overexpression is required but not sufficient to confer the growth-motility-cytotoxicity impaired phenotype and that alternative pathways leading to similar levels of ampC hyperexpression and resistance, such as those involving PBP4, had no fitness-virulence cost. Further analysis indicated that fitness-virulence impairment is caused by overexpressing ampC in the absence of cell wall recycling, as reproduced by expressing ampC from a plasmid in an AmpG (muropeptide permease)-deficient background. Thus, our findings represent a major step in the understanding of β-lactam resistance biology and its interplay with fitness and pathogenesis. PMID:27795406

  18. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  19. Cyclic AMP pathway modifies memory through neural cell adhesion molecule alterations in the rat hippocampus.

    PubMed

    Razmi, Ali; Sahebgharani, Mousa; Khani, Mohammad Hossein; Paylakhi, Seyed Hassan; Faizi, Mehrdad; Zarrindast, Mohammad-Reza

    2014-01-01

    Neural Cell Adhesion Molecules (NCAMs) are known to influence memory by affecting neural cell-cell and cell-extracellular matrix junctions. This study investigated the possible role of cAMP pathway in the expression of hippocampal NCAM and its polysialylated derivative (PSA-NCAM). The following pharmacological tools were employed for manipulation of cAMP pathway: a) forskolin; the activator of adenylyl cyclase (AC), b) 8-Br-cAMP; a protein kinase A (PKA) agonist, c) 8-pCPT-2'-O-Me-cAMP; a selective enhancer of exchange protein activated by cAMP (Epac) and d) Rp-cAMP; a PKA inhibitor. Memory acquisition was tested by passive avoidance paradigm after injecting the above compounds for three consecutive days into the CA1 region of dorsal hippocampus of rats. Forskolin and 8-Br-cAMP enhanced memory retrieval while Rp-cAMP significantly reduced memory and NCAM levels. 8-pCPT-2'-O-Me-cAMP failed to alter memory performance or NCAM levels as compared to vehicle. We observed no significant changes in PSA-NCAM, however the expression of St8sia4 and St8sia2 (the polysialyltransferase isoforms) were altered. The mRNA levels of St8sia4 was down-regulated by 8-Br-cAMP, Rp-cAMP and 8-pCPT while forskolin led to almost 3 and 5 fold increase in mRNAs of St8sia2 and St8sia4, respectively. The current insight might endorse the predominant role of PKA as compared to Epac in cAMP pathway in expression of NCAM and memory function. PMID:24901853

  20. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  1. Butyrate activates the cAMP-protein kinase A-cAMP response element-binding protein signaling pathway in Caco-2 cells.

    PubMed

    Wang, Aihua; Si, Hongwei; Liu, Dongmin; Jiang, Honglin

    2012-01-01

    Butyrate is a major SCFA produced by microbial fermentation of dietary fiber in the gastrointestinal tract. Butyrate is widely thought to mediate the benefits of fiber and resistant starch consumption to colon health in humans. Besides serving as a substrate for energy production, butyrate has many regulatory effects in animals. Little is known about the signaling mechanisms underlying the regulatory effects of butyrate and other SCFA. In this study, we determined whether butyrate can activate cAMP-protein kinase A (PKA)- cAMP response element (CRE)-binding protein (CREB) signaling in Caco-2 cells, a model of intestinal epithelial cells. Butyrate promoted luciferase expression from a CRE-reporter construct, induced phosphorylation of CREB, increased the activity of PKA, and elevated the levels of cAMP in Caco-2 cells. These data suggest that butyrate activates cAMP-PKA-CREB signaling in Caco-2 cells. Butyrate, however, had no effect on the activities of adenylyl cyclase (AC) and phosphodiesterase (PDE), two enzymes that determine the production and degradation of intracellular cAMP, respectively. Because the activities of AC and PDE are primarily regulated by G protein-coupled receptor (GPR)-mediated intracellular signaling, lack of an effect of butyrate on these two enzymes suggests that butyrate does not activate cAMP-PKA-CREB signaling through GPR. Butyrate-treated Caco-2 cells had greater concentrations of ATP than untreated cells. Because ATP is the substrate for cAMP production, this difference suggests that butyrate may activate cAMP-PKA-CREB signaling in Caco-2 cells through increased ATP production. Overall, this study raises the possibility that some of the regulatory effects of butyrate in animals, including those on the colonocytes, may be mediated by the cAMP-PKA-CREB signaling pathway at the cellular level.

  2. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  3. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  4. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  5. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  6. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.

    PubMed Central

    Montminy, M R; Sevarino, K A; Wagner, J A; Mandel, G; Goodman, R H

    1986-01-01

    We have examined the regulation of somatostatin gene expression by cAMP in PC12 rat pheochromocytoma cells transfected with the rat somatostatin gene. Forskolin at 10 microM caused a 4-fold increase in somatostatin mRNA levels within 4 hr of treatment in stably transfected cells. Chimeric genes containing the somatostatin gene promoter fused to the bacterial reporter gene encoding chloramphenicol acetyltransferase were also induced by cAMP in PC12 cells. To delineate the sequences required for response to cAMP, we constructed a series of promoter deletion mutants. Our studies defined a region between 60 and 29 base pairs upstream from the transcriptional initiation site that conferred cAMP responsiveness when placed adjacent to the simian virus 40 promoter. Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP. cAMP responsiveness was greatly reduced when the somatostatin fusion genes were transfected into the mutant PC12 line A126-1B2, which is deficient in cAMP-dependent protein kinase 2. Our studies indicate that transcriptional regulation of the somatostatin gene by cAMP requires protein kinase 2 activity and may depend upon a highly conserved promoter element. Images PMID:2875459

  7. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis.

    PubMed

    Zhou, Zhiwen; Tanaka, Kenji F; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  8. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  9. Increase in Endogenous and Exogenous Cyclic AMP Levels Inhibits Sclerotial Development in Sclerotinia sclerotiorum

    PubMed Central

    Rollins, Jeffrey A.; Dickman, Martin B.

    1998-01-01

    Growth and development of a wild-type Sclerotinia sclerotiorum isolate were examined in the presence of various pharmacological compounds to investigate signal transduction pathways that influence the development of sclerotia. Compounds known to increase endogenous cyclic AMP (cAMP) levels in other organisms by inhibiting phosphodiesterase activity (caffeine and 3-isobutyl-1-methyl xanthine) or by activating adenylate cyclase (NaF) reduced or eliminated sclerotial development in S. sclerotiorum. Growth in the presence of 5 mM caffeine correlated with increased levels of endogenous cAMP in mycelia. In addition, incorporation of cAMP into the growth medium decreased or eliminated the production of sclerotia in a concentration-dependent manner and increased the accumulation of oxalic acid. Inhibition of sclerotial development was cAMP specific, as exogenous cyclic GMP, AMP, and ATP did not influence sclerotial development. Transfer of developing cultures to cAMP-containing medium at successive time points demonstrated that cAMP inhibits development prior to or during sclerotial initiation. Together, these results indicate that cAMP plays a role in the early transition between mycelial growth and sclerotial development. PMID:9647827

  10. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  11. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  12. Advance care directives

    MedlinePlus

    ... advance directive; Do-not-resuscitate - advance directive; Durable power of attorney - advance care directive; POA - advance care directive; Health care agent - advance care directive; Health care proxy - ...

  13. Isolation and characterization of cAMP-resistant mutants of the H-4 rat hepatoma cells

    SciTech Connect

    Liu, A.Y.; Lin, Z.

    1987-05-01

    H-4 rat hepatoma cells were mutagenized with ethyl methane-sulfonate and the frequency of emergence of cAMP resistant mutant cells were evaluated by cloning the EMS-treated cells in a semi-solid agar medium that contained either 1-3 mM 8-bromo-cAMP plus 1 mM 3-isobutyl-1-methyl xanthine or 5 ..mu..g/ml cholera toxin plus 1 mM IBMX. cAMP resistant mutants emerged at a frequency of 8 x 10/sup -5/. 15 colonies were isolated, recloned, grown in mass culture, and cell extracts were prepared. Analysis of cAMP-dependent protein kinase demonstrated that: (1) the type II enzyme is the only cAMP-dependent protein kinase detected in extracts of the hepatoma cells; (2) of the 15 cAMP resistant clonal cell lines examined, only one (H/sub 4/M/sub 18/) was found to be devoid of cAMP-dependent protein kinase activity. In another cell line (H/sub 4/M/sub 10/) the activity was 30% of that of the parental H-4 cells; (3) there was an increase (130-300%) in cAMP-dependent protein kinase activity in 13/15 of the mutant cell lines over that of the parental H-4 cells. Analysis of cAMP-phosphodiesterase demonstrated significant increases (150-370%) in the enzyme activity in extracts of the mutants over that of the H-4 parental line. Their results suggest that while a deficiency in cAMP-dependent protein kinase may confer resistance to the hepatoma cells against the cytostatic effects of 8-bromo-cAMP and cholera toxin, other events such as overexpression of phosphodiesterase may contribute to this phenotype.

  14. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  15. cAMP Signaling Prevents Podocyte Apoptosis via Activation of Protein Kinase A and Mitochondrial Fusion

    PubMed Central

    Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y.; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  16. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  17. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  18. Polynomial solutions of the Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Aminov, Yu A.

    2014-11-01

    The question of the existence of polynomial solutions to the Monge-Ampère equation zxxzyy-zxy^2=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  19. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  20. Amp: A modular approach to machine learning in atomistic simulations

    NASA Astrophysics Data System (ADS)

    Khorshidi, Alireza; Peterson, Andrew A.

    2016-10-01

    Electronic structure calculations, such as those employing Kohn-Sham density functional theory or ab initio wavefunction theories, have allowed for atomistic-level understandings of a wide variety of phenomena and properties of matter at small scales. However, the computational cost of electronic structure methods drastically increases with length and time scales, which makes these methods difficult for long time-scale molecular dynamics simulations or large-sized systems. Machine-learning techniques can provide accurate potentials that can match the quality of electronic structure calculations, provided sufficient training data. These potentials can then be used to rapidly simulate large and long time-scale phenomena at similar quality to the parent electronic structure approach. Machine-learning potentials usually take a bias-free mathematical form and can be readily developed for a wide variety of systems. Electronic structure calculations have favorable properties-namely that they are noiseless and targeted training data can be produced on-demand-that make them particularly well-suited for machine learning. This paper discusses our modular approach to atomistic machine learning through the development of the open-source Atomistic Machine-learning Package (Amp), which allows for representations of both the total and atom-centered potential energy surface, in both periodic and non-periodic systems. Potentials developed through the atom-centered approach are simultaneously applicable for systems with various sizes. Interpolation can be enhanced by introducing custom descriptors of the local environment. We demonstrate this in the current work for Gaussian-type, bispectrum, and Zernike-type descriptors. Amp has an intuitive and modular structure with an interface through the python scripting language yet has parallelizable fortran components for demanding tasks; it is designed to integrate closely with the widely used Atomic Simulation Environment (ASE), which

  1. AMP-deaminase from thymus of patients with myasthenia gravis.

    PubMed

    Rybakowska, I; Szydłowska, M; Szrok, S; Bakuła, S; Kaletha, K

    2015-01-01

    Myasthenia gravis (MG) is characterized clinically by skeletal muscle fatigue following the excessive exercise. Interestingly most of MG patients manifest parallely also some abnormalities of the thymus.AMP-deaminase (AMPD) from human thymus was not a subject of studies up to now. In this paper, mRNA expression and some physico-chemical and immunological properties of AMPD purified from the thymus of MG patients were described. Experiments performed identified the liver isozyme (AMPD2) as the main isoform of AMPD expressed in this organ. The activity of AMPD found in this organ was higher than in other human non-(skeletal) muscle tissues indicating on role the enzyme may play in supplying of guanylates required for the intensive multiplication of thymocytes.

  2. Heterogeneity of Calcium Channel/cAMP-Dependent Transcriptional Activation.

    PubMed

    Kobrinsky, Evgeny

    2015-01-01

    The major function of the voltage-gated calcium channels is to provide the Ca(2+) flux into the cell. L-type voltage-gated calcium channels (Cav1) serve as voltage sensors that couple membrane depolarization to many intracellular processes. Electrical activity in excitable cells affects gene expression through signaling pathways involved in the excitation-transcription (E-T) coupling. E-T coupling starts with activation of the Cav1 channel and results in initiation of the cAMP-response element binding protein (CREB)-dependent transcription. In this review we discuss the new quantitative approaches to measuring E-T signaling events. We describe the use of wavelet transform to detect heterogeneity of transcriptional activation in nuclei. Furthermore, we discuss the properties of discovered microdomains of nuclear signaling associated with the E-T coupling and the basis of the frequency-dependent transcriptional regulation.

  3. AMP-activated protein kinase and metabolic control

    PubMed Central

    Viollet, Benoit; Andreelli, Fabrizio

    2011-01-01

    AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, is a major regulator of cellular and whole-body energy homeostasis that coordinates metabolic pathways in order to balance nutrient supply with energy demand. It is now recognized that pharmacological activation of AMPK improves blood glucose homeostasis, lipid profile and blood pressure in insulin-resistant rodents. Indeed, AMPK activation mimics the beneficial effects of physical activity or those of calorie restriction by acting on multiple cellular targets. In addition it is now demonstrated that AMPK is one of the probable (albeit indirect) targets of major antidiabetic drugs including, the biguanides (metformin) and thiazolidinediones, as well as of insulin sensitizing adipokines (e.g., adiponectin). Taken together, such findings highlight the logic underlying the concept of targeting the AMPK pathway for the treatment of metabolic syndrome and type 2 diabetes. PMID:21484577

  4. Next-step-targeted experiments on the Mega-Amp Spherical Tokamak

    NASA Astrophysics Data System (ADS)

    Gryaznevich, M.; Akers, R. J.; Counsell, G. F.; Cunningham, G.; Dnestrovskij, A.; Field, A. R.; Hender, T. C.; Kirk, A.; Lloyd, B.; Meyer, H.; Morris, A. W.; Sykes, A.; Tabasso, A.; Valovic, M.; Voss, G. M.; Wilson, H. R.

    2003-05-01

    Since its first physics campaign, the principal parameters on MAST (Mega-Amp Spherical Tokamak) [A. Sykes et al., Nuclear Fusion 41, 1423 (2001)] have been brought up towards their design values. Considerable advances have been made in a range of physics areas of direct relevance to the International Thermonuclear Experimental Reactor (ITER) [ITER Physics Basis, Nuclear Fusion 39, 2175 (1999)]. In this paper, results on H-mode access, global confinement and pedestal studies are presented and compared with conventional aspect ratio tokamak scalings. Physics and engineering requirements relevant to next step spherical tokamak devices are discussed, in particular the plasma formation, current ramp-up and sustainment, and plasma exhaust. Results of first experiments directly targeting these issues are presented: Plasma current up to 0.5 MA has been produced without use of the central solenoid flux, and current ramp-up and sustainment without use of the central solenoid flux has been demonstrated. Experiments on neutral beam heating and current drive (CD) demonstrate up to 50% bootstrap current fraction and good CD efficiency, and divertor power loading has been found to be tolerable and have a favorable outboard asymmetry.

  5. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    SciTech Connect

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil Lee, Zang Hee

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  6. Asymptotic behavior on a kind of parabolic Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Wang, Bo; Bao, Jiguang

    2015-07-01

    In this paper, we apply level set and nonlinear perturbation methods to obtain the asymptotic behavior of the solution to a kind of parabolic Monge-Ampère equation at infinity. The Jörgens-Calabi-Pogorelov theorem for parabolic and elliptic Monge-Ampère equation can be regarded as special cases of our result.

  7. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  8. A possible signal-coupling role for cyclic AMP during endocytosis in Amoeba proteus.

    PubMed

    Prusch, R D; Roscoe, J C

    1993-01-01

    Cytoplasmic levels of cAMP in Amoeba proteus were measured utilizing radioimmunoassays under control conditions and when stimulated by inducers of either pinocytosis or phagocytosis. In control cells, cytoplasmic cAMP levels were approximately 0.39 pM/mg cells. When exposed to either chemotactic peptide or mannose which stimulate phagocytosis in the amoeba, there is a rapid doubling of the cAMP level within 45 sec of stimulation which then returns to the control level within 3-5 min. Theophylline prolongs the elevation of cytoplasmic cAMP in stimulated cells and is also capable of eliciting food vacuole formation in the amoeba. In addition isoproterenol also causes food vacuole formation in the amoeba as well as a large and prolonged increase in cytoplasmic cAMP levels. Inducers of pinocytosis (BSA and Na Cl) also elicit changes in cytoplasmic cAMP in the amoeba, but the response appears to differ from that elicited by inducers of phagocytosis in that the peak cAMP levels are broader and biphasic. It is concluded that cAMP plays a signal-coupling role during the early phases of both forms of endocytosis in Amoeba proteus.

  9. BaAMPs: the database of biofilm-active antimicrobial peptides.

    PubMed

    Di Luca, Mariagrazia; Maccari, Giuseppe; Maisetta, Giuseppantonio; Batoni, Giovanna

    2015-01-01

    Antimicrobial peptides (AMPs) are increasingly being considered as novel agents against biofilms. The development of AMP-based anti-biofilm strategies strongly relies on the design of sequences optimized to target specific features of sessile bacterial/fungal communities. Although several AMP databases have been created and successfully exploited for AMP design, all of these use data collected on peptides tested against planktonic microorganisms. Here, an open-access, manually curated database of AMPs specifically assayed against microbial biofilms (BaAMPs) is presented for the first time. In collecting relevant data from the literature an effort was made to define a minimal standard set of essential information including, for each AMP, the microbial species and biofilm conditions against which it was tested, and the specific assay and peptide concentration used. The availability of these data in an organized framework will benefit anti-biofilm research and support the design of novel molecules active against biofilm. BaAMPs is accessible at http://www.baamps.it. PMID:25760404

  10. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  11. Phosphorylation and inhibition of. gamma. -glutamyl transferase activity by cAMP-dependent protein kinase

    SciTech Connect

    Kolesnichenko, L.S.; Chernov, N.N.

    1986-10-20

    It was shown that preparations of bovine kidney ..gamma..-glutamyl transferase of differing degrees of purity are phosphorylated by cAMP-dependent protein kinase. This is accompanied by a decrease in both the transferase and hydrolase activities of the enzyme. Consequently, ..gamma..-glutamyl transferase may serve as the substrate and target of the regulation of cAMP-dependent protein kinase.

  12. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  13. Changes in the cyclic AMP content during growth and development of Acetabularia.

    PubMed

    Minder, C; Vanden Driessche, T

    1978-05-26

    The 3',5'-adenosine monophosphate (cyclic-AMP) content of the unicellular alga Acetabularia has been examined at various developmental stages. It has been found that very young algae, less than 10mm in length, have a high cAMP content [more than 7 pmoles per 100 mg wet weight (WW)], but that with the growth of the algae, the cAMP content decreases rapidly, reaching the low level of 0.5--1.0 pmoles per 100mg WW. The cAMP content remains at this level until cap differentiation, after which an increase in cAMP content accompanies cap enlargement. It has been shown that these results are unlikely to be affected by changes in the cAMP content induced by variations in circadian rhythm. Treatment with theophylline (2.10(-3) M), a phosphodieterase inhibitor, results in an increase in the cAMP content and delays growth and cap formation. Experiments on the effects of theophylline upon the circadian rhythm of oxygen evolution have shown that the continuous presence of theophylline in the culture medium does not induce a phase shift in the rhythm. The cAMP content of anucleate Acetabularia shows development stage variations parallel to that of the whole algae.

  14. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent.

    PubMed

    Stella, Nicholas A; Shanks, Robert M Q

    2014-05-01

    The cyclic-nucleotide 3',5'-cyclic AMP (cAMP) is an ancient and widespread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-cyclic-AMP receptor protein regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein, similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP.

  15. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  16. cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes.

    PubMed

    Bodor, J; Spetz, A L; Strominger, J L; Habener, J F

    1996-04-16

    Stimulation of the cAMP-dependent signaling pathway exerts an inhibitory effect on the proliferation and effector functions of T cells. The ability of T cells to form high intracellular levels of cAMP is acquired during development in the human thymus and is retained by the majority of mature peripheral T lymphocytes. Here we show that elevated cAMP levels in T cells correlate with the expression of the potent transcriptional repressor ICER (inducible cAMP early repressor) previously described in the hypothalamic-pituitary-gonadal axis. Further, in transcriptional assays in vivo, ICER inhibits calcineurin-mediated expression of the interleukin 2 promoter as well as Tax-mediated transactivation of the human T-lymphotropic virus type I (HTLV-I) promoter. Thus, the induction of ICER in T cells may play an important role in the cAMP-induced quiescence and the persistent latency of HTLV-I.

  17. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  18. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  19. Positive Effect of Carbon Sources on Natural Transformation in Escherichia coli: Role of Low-Level Cyclic AMP (cAMP)-cAMP Receptor Protein in the Derepression of rpoS

    PubMed Central

    Guo, Mengyue; Wang, Huanyu; Xie, Nengbin

    2015-01-01

    ABSTRACT Natural plasmid transformation of Escherichia coli is a complex process that occurs strictly on agar plates and requires the global stress response factor σS. Here, we showed that additional carbon sources could significantly enhance the transformability of E. coli. Inactivation of phosphotransferase system genes (ptsH, ptsG, and crr) caused an increase in the transformation frequency, and the addition of cyclic AMP (cAMP) neutralized the promotional effect of carbon sources. This implies a negative role of cAMP in natural transformation. Further study showed that crp and cyaA mutations conferred a higher transformation frequency, suggesting that the cAMP-cAMP receptor protein (CRP) complex has an inhibitory effect on transformation. Moreover, we observed that rpoS is negatively regulated by cAMP-CRP in early log phase and that both crp and cyaA mutants show no transformation superiority when rpoS is knocked out. Therefore, it can be concluded that both the crp and cyaA mutations derepress rpoS expression in early log phase, whereby they aid in the promotion of natural transformation ability. We also showed that the accumulation of RpoS during early log phase can account for the enhanced transformation aroused by additional carbon sources. Our results thus demonstrated that the presence of additional carbon sources promotes competence development and natural transformation by reducing cAMP-CRP and, thus, derepressing rpoS expression during log phase. This finding could contribute to a better understanding of the relationship between nutrition state and competence, as well as the mechanism of natural plasmid transformation in E. coli. IMPORTANCE Escherichia coli, which is not usually considered to be naturally transformable, was found to spontaneously take up plasmid DNA on agar plates. Researching the mechanism of natural transformation is important for understanding the role of transformation in evolution, as well as in the transfer of pathogenicity and

  20. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex.

    PubMed

    Guérin, François; Isnard, Christophe; Cattoir, Vincent; Giard, Jean Christophe

    2015-12-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-D-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  1. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  2. AMP-18 protects barrier function of colonic epithelial cells: role of tight junction proteins

    PubMed Central

    Walsh-Reitz, Margaret M.; Huang, Erick F.; Musch, Mark W.; Chang, Eugene B.; Martin, Terence E.; Kartha, Sreedharan; Toback, F. Gary

    2005-01-01

    AMP-18, a novel gastric antrum mucosal protein, and a synthetic peptide of amino acids 77-97, have mitogenic and motogenic properties for epithelial cells. The possibility that AMP-18 is also protective was evaluated in the colonic mucosa of mice and monolayer cultures of human colonic epithelial Caco2/bbe (C2) cells. Administration of AMP peptide to mice with dextran sulfate sodium (DSS)-induced colonic injury delayed the onset of bloody diarrhea, and reduced weight loss. Treatment of C2 cells with AMP peptide protected monolayers against decreases in transepithelial electrical resistance (TER) induced by the oxidant monochloramine, indomethacin, or DSS. A molecular mechanism for these barrier-protective effects was sought by asking if AMP peptide acted on specific tight junction (TJ) proteins. Immunoblots of detergent-insoluble fractions of C2 cells treated with AMP peptide exhibited increased accumulation of specific TJ proteins. Occludin immunoreactivity was also increased in detergent-insoluble fractions obtained from colonic mucosal cells of mice injected with AMP peptide. Laser scanning confocal microscopy (CF) supported the capacity of AMP peptide to enhance accumulation of occludin and ZO-1 in TJ domains of C2 cell monolayers, and together with immunoblot analysis showed that the peptide protected against loss of these TJ proteins following oxidant injury. AMP peptide also protected against a fall in TER during disruption of actin filaments by cytochalasin D, and stabilized perijunctional actin during oxidant injury when assessed by CF. These findings suggest that AMP-18 could protect the intestinal mucosal barrier by acting on specific TJ proteins and stabilizing perijunctional actin. PMID:15961882

  3. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  4. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  5. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  6. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

    PubMed

    Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

    2004-01-01

    AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

  7. cAMP mediators of pulsatile insulin secretion from glucose-stimulated single beta-cells.

    PubMed

    Idevall-Hagren, Olof; Barg, Sebastian; Gylfe, Erik; Tengholm, Anders

    2010-07-23

    Pulsatile insulin release from glucose-stimulated beta-cells is driven by oscillations of the Ca(2+) and cAMP concentrations in the subplasma membrane space ([Ca(2+)](pm) and [cAMP](pm)). To clarify mechanisms by which cAMP regulates insulin secretion, we performed parallel evanescent wave fluorescence imaging of [cAMP](pm), [Ca(2+)](pm), and phosphatidylinositol 3,4,5-trisphosphate (PIP(3)) in the plasma membrane. This lipid is formed by autocrine insulin receptor activation and was used to monitor insulin release kinetics from single MIN6 beta-cells. Elevation of the glucose concentration from 3 to 11 mm induced, after a 2.7-min delay, coordinated oscillations of [Ca(2+)](pm), [cAMP](pm), and PIP(3). Inhibitors of protein kinase A (PKA) markedly diminished the PIP(3) response when applied before glucose stimulation, but did not affect already manifested PIP(3) oscillations. The reduced PIP(3) response could be attributed to accelerated depolarization causing early rise of [Ca(2+)](pm) that preceded the elevation of [cAMP](pm). However, the amplitude of the PIP(3) response after PKA inhibition was restored by a specific agonist to the cAMP-dependent guanine nucleotide exchange factor Epac. Suppression of cAMP formation with adenylyl cyclase inhibitors reduced already established PIP(3) oscillations in glucose-stimulated cells, and this effect was almost completely counteracted by the Epac agonist. In cells treated with small interfering RNA targeting Epac2, the amplitudes of the glucose-induced PIP(3) oscillations were reduced, and the Epac agonist was without effect. The data indicate that temporal coordination of the triggering [Ca(2+)](pm) and amplifying [cAMP](pm) signals is important for glucose-induced pulsatile insulin release. Although both PKA and Epac2 partake in initiating insulin secretion, the cAMP dependence of established pulsatility is mediated by Epac2.

  8. DBcAMP stimulates vesicle transport and HRP excretion in isolated perfused rat liver.

    PubMed

    Hayakawa, T; Bruck, R; Ng, O C; Boyer, J L

    1990-11-01

    To clarify the effect of adenosine 3',5'-cyclic monophosphate (cAMP) on the transcytotic vesicle pathway, we measured the biliary excretion of bile acid, phospholipid, and horseradish peroxidase (HRP) in the isolated perfused rat liver (IPRL) with or without infusion of N6,2'-O-dibutyryl-cAMP (DBcAMP). A linear relationship between bile flow and bile acid excretion was observed in both control and DBcAMP-infused livers. DBcAMP increased the y-axis intercept from 1.10 +/- 0.16 to 1.48 +/- 0.19 microliters.min-1.g liver-1 (P less than 0.01) and the slope from 6.5 +/- 1.99 to 10.77 +/- 1.71 microliters/mumol bile acid (P less than 0.01). DBcAMP also increased the biliary excretion of bile acid and phospholipid during a 1.0 mumol/min infusion of taurocholate. When HRP was pulse loaded for 1 min, HRP appeared in bile in early (4-6 min) and late (20-25 min) peaks. DBcAMP markedly increased the late peak of HRP from 0.33 +/- 0.08 to 1.15 +/- 0.32 ng.min-1.g liver-1 (P less than 0.01), a phenomenon blocked by colchicine. An electron-microscopic morphometric analysis indicated that DBcAMP increased both the density and %area of HRP-containing vesicles in the pericanalicular area, compared with controls, 18 min after a 1-min pulse of HRP. DBcAMP had no effect on the uptake rate of HRP in 4-h primary hepatocyte cultures but stimulated biliary excretion of HRP when preloaded in the IPRL. These findings indicate that cAMP regulates excretory function in part by stimulating the microtubule-dependent transcytotic vesicle transport system.

  9. Advanced Combustion Modeling for Complex Turbulent Flows

    NASA Technical Reports Server (NTRS)

    Ham, Frank Stanford

    2005-01-01

    The next generation of aircraft engines will need to pass stricter efficiency and emission tests. NASA's Ultra-Efficient Engine Technology (UEET) program has set an ambitious goal of 70% reduction of NO(x) emissions and a 15% increase in fuel efficiency of aircraft engines. We will demonstrate the state-of-the-art combustion tools developed a t Stanford's Center for Turbulence Research (CTR) as part of this program. In the last decade, CTR has spear-headed a multi-physics-based combustion modeling program. Key technologies have been transferred to the aerospace industry and are currently being used for engine simulations. In this demo, we will showcase the next-generation combustion modeling tools that integrate a very high level of detailed physics into advanced flow simulation codes. Combustor flows involve multi-phase physics with liquid fuel jet breakup, evaporation, and eventual combustion. Individual components of the simulation are verified against complex test cases and show excellent agreement with experimental data.

  10. Advanced Microsensors

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This video looks at a spinoff application of the technology from advanced microsensors -- those that monitor and determine conditions of spacecraft like the Space Shuttle. The application featured is concerned with the monitoring of the health of premature babies.

  11. Advanced Composition

    ERIC Educational Resources Information Center

    Sarantos, R. L.

    1974-01-01

    This is an excerpt from a course for advanced students, designed to teach proficiency in English composition by providing activities specifically geared to the elimination of native language interference. (LG)

  12. Prostaglandins and muscarinic agonists induce cyclic AMP attenuation by two distinct mechanisms in the pregnant-rat myometrium. Interaction between cyclic AMP and Ca2+ signals.

    PubMed Central

    Goureau, O; Tanfin, Z; Harbon, S

    1990-01-01

    In pregnant-rat myometrium (day 21 of gestation), isoprenaline-induced cyclic AMP accumulation, resulting from receptor-mediated activation of adenylate cyclase, was negatively regulated by prostaglandins [PGE2, PGF2 alpha; EC50 (concn. giving 50% of maximal response) = 2 nM] and by the muscarinic agonist carbachol (EC50 = 2 microM). PG-induced inhibition was prevented by pertussis-toxin treatment, supporting the idea that it was mediated by the inhibitory G-protein Gi through the inhibitory pathway of the adenylate cyclase. Both isoprenaline-induced stimulation and PG-evoked inhibition of cyclic AMP were insensitive to Ca2+ depletion. By contrast, carbachol-evoked attenuation of cyclic AMP accumulation was dependent on Ca2+ and was insensitive to pertussis toxin. The inhibitory effect of carbachol was mimicked by ionomycin. Indirect evidence was thus provided for the enhancement of cyclic AMP degradation by a Ca2(+)-dependent phosphodiesterase activity in the muscarinic-mediated effect. The attenuation of cyclic AMP elicited by carbachol coincided with carbachol-stimulated inositol phosphate (InsP3, InsP2 and InsP) generation, which displayed an almost identical EC50 (3 microM) and was similarly unaffected by pertussis toxin. Both carbachol effects were reproduced by oxotremorine, whereas pilocarpine (a partial muscarinic agonist) failed to induce any decrease in cyclic AMP accumulation and concurrently was unable to stimulate the generation of inositol phosphates. These data support our proposal for a carbachol-mediated enhancement of a Ca2(+)-dependent phosphodiesterase activity, compatible with the rises in Ca2+ associated with muscarinic-induced increased generation of inositol phosphates. They further illustrate that a cross-talk between the two major transmembrane signalling systems contributed to an ultimate decrease in cyclic AMP in the pregnant-rat myometrium near term. PMID:1700899

  13. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  14. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  15. The role of the RAS pathway in iAMP21-ALL.

    PubMed

    Ryan, S L; Matheson, E; Grossmann, V; Sinclair, P; Bashton, M; Schwab, C; Towers, W; Partington, M; Elliott, A; Minto, L; Richardson, S; Rahman, T; Keavney, B; Skinner, R; Bown, N; Haferlach, T; Vandenberghe, P; Haferlach, C; Santibanez-Koref, M; Moorman, A V; Kohlmann, A; Irving, J A E; Harrison, C J

    2016-09-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAFs) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (⩾35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (⩾35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients.

  16. The role of the RAS pathway in iAMP21-ALL

    PubMed Central

    Ryan, Sarra L.; Matheson, Elizabeth; Grossmann, Vera; Sinclair, Paul; Bashton, Matthew; Schwab, Claire; Towers, Will; Partington, Matthew; Elliott, Alannah; Minto, Lynne; Richardson, Stacey; Rahman, Thahira; Keavney, Bernard; Skinner, Roderick; Bown, Nick; Haferlach, Torsten; Vandenberghe, Peter; Haferlach, Claudia; Santibanez-Koref, Mauro; Moorman, Anthony V.; Kohlmann, Alexander; Irving, Julie A. E.; Harrison, Christine J.

    2016-01-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAF) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (≥35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (≥35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients. PMID:27168466

  17. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  18. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  19. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  20. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  1. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  2. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  3. From drought sensing to developmental control: evolution of cyclic AMP signaling in social amoebas.

    PubMed

    Ritchie, Allyson V; van Es, Saskia; Fouquet, Celine; Schaap, Pauline

    2008-10-01

    Amoebas and other protists commonly encyst when faced with environmental stress. Although little is known of the signaling pathways that mediate encystation, the analogous process of spore formation in dictyostelid social amoebas is better understood. In Dictyostelium discoideum, secreted cyclic AMP (cAMP) mediates the aggregation of starving amoebas and induces the differentiation of prespore cells. Intracellular cAMP acting on cAMP-dependent protein kinase (PKA) triggers the maturation of spores and prevents their germination under the prevalent conditions of high osmolality in the spore head. The osmolyte-activated adenylate cyclase, ACG, produces cAMP for prespore differentiation and inhibition of spore germination. To retrace the origin of ACG function, we investigated ACG gene conservation and function in species that span the dictyostelid phylogeny. ACG genes, osmolyte-activated ACG activity, and osmoregulation of spore germination were detected in species that represent the 4 major groups of Dictyostelia. Unlike the derived species D. discoideum, many basal Dictyostelia have retained the ancestral mechanism of encystation from solitary amoebas. In these species and in solitary amoebas, encystation is independently triggered by starvation or by high osmolality. Osmolyte-induced encystation was accompanied by an increase in cAMP and prevented by inhibition of PKA, indicating that ACG and PKA activation mediate this response. We propose that high osmolality signals drought in soil amoebas and that developmental cAMP signaling in the Dictyostelia has evolved from this stress response.

  4. The mechanisms of action of cAMP. A quantum chemical study.

    PubMed

    van Ool, P J; Buck, H M

    1982-01-01

    Quantum chemical calculations were performed on the formation of intermediates with trigonal bipyramidal (TBP) configurations in the hydrolysis of adenosine 3',5'-monophosphate (cAMP) with phosphodiesterases and the activation of protein kinases by cAMP. The results show that in the reaction sequence concerning the hydrolysis of cAMP with phosphodiesterase the TBP intermediate must possess an equatorial-apical cyclic phosphate ring with the 3'-oxygen atom in the apical position. This could be an additional reason for the sensitivity of the 3' position in cAMP towards modifications in comparison with the 5' position. According to the calculations, a mechanistic model is presented for the enzymatic hydrolysis of cAMP with the involvement of a covalently bonded enzyme-nucleotide intermediate. Also a model is offered for the activation of protein kinase by cAMP. The activation of protein kinase is assumed to proceed via diequatorial-ring-positioned TBP intermediates resulting in the formation of a covalent bond between cAMP and the protein kinase with retention of the cyclic phosphate ring. It seems likely that the enzyme-nucleotide intermediate enforces a conformational change in the enzyme, which causes the dissociation of the regulatory and catalytic subunit of the protein kinase, necessary for a physiological response.

  5. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent

    PubMed Central

    Stella, Nicholas A.; Shanks, Robert M. Q.

    2014-01-01

    The cyclic-nucleotide 3’,5’-cyclic AMP (cAMP) is an ancient and wide spread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-CRP regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP. PMID:24619531

  6. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  7. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  8. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  9. Cyclic AMP levels during induction and repression of cellulase biosynthesis in Thermomonospora curvata

    SciTech Connect

    Wood, W.E.; Neubauer, D.G.; Stutzenberger, F.J.

    1984-12-01

    Specific cellulase production rates (SCPR) were compared with intracellular cyclic AMP (cAMP) levels in the thermophilic actinomycete, Thermomonospora curvata, during growth on several carbon sources in a chemically defined medium. SCPR and cAMP levels were 0.03 U (endoglucanase (EG) units) and 2 pmol per mg of dry cells, respectively, during exponential growth on glucose. These values increased to about 6 and 25, respectively, during growth on cellulose. Detectable EG production ceased when cAMP levels dropped below 10. Cellobiose (usually considered to be a cellulase inducer) caused a sharp decrease in cAMP levels and repressed EG production when added to cellulose-grown cultures. 2-deoxy-D-glucose, although nometabolizable in T. curvata, depressed cAMP to levels observed with glucose, but unlike glucose, the 2DG effect persisted until cells were washed and transferred to fresh medium. SCPR values and cAMP levels in cells grown in continuous culture under conditions of cellobiose limitation were markedly influenced by dilution rate (D). The maxima for both occurred at D = 0.085 (culture generation time of 11.8 h). When D was held constant and cellobiose concentration was increased over a 14-fold range to support higher steady state population levels, SCPR values decreased about fivefold, indicating that extracellular catabolite accumulation may be a factor in EG repression. The role of cAMP in the mechanism of this repression appears to be neither simple nor direct, since large changes (up to 200-fold) in SCPR accompany relatively small changes (10-fold) in cellular cAMP levels.

  10. Modulation of a human lymphoblastoid B cell line by cyclic AMP. Ig secretion and phosphatidylcholine metabolism

    SciTech Connect

    Shearer, W.T.; Patke, C.L.; Gilliam, E.B.; Rosenblatt, H.M.; Barron, K.S.; Orson, F.M.

    1988-09-01

    A transformed human B cell line, LA350, was found to be sensitive to cAMP-elevating agents by responding with rapid (0 to 2 h) severalfold elevations of intracellular cAMP to treatment with cholera toxin, isobutylmethylxanthine (IBMX), forskolin, and dibutyryl cAMP (all p less than 0.001). These cAMP-elevating agents also produced significant inhibitions of subsequent (48 to 72 h) Ig secretion by the same B cells as measured by a reverse hemolytic plaque assay and an enzyme-linked immunoadsorbent assay for IgM (both p less than 0.001). PMA- and IBMX-treated cells were particularly responsive to the effects of cholera toxin, showing a doubling of cAMP content and profound decrease in Ig production (p less than 0.001). Because our previous studies had correlated activation of the metabolic turnover of the phosphatidylcholine (PC) fraction of membrane phospholipids with enhanced Ig secretion, we examined the sensitivity of PC metabolism to cAMP in control and PMA-stimulated cells. Formation of PC was found to be inhibited by forskolin and IBMX (both p less than 0.002) but breakdown of PC was stimulated (p less than 0.001). These findings imply that as the enzymatic products of PC, choline phosphate and diacylglycerol, are depleted due to the combined effects of cAMP upon synthesis and turnover of PC, there is a decrease in Ig secretion. Since diacylglycerol activates protein kinase C, it appears reasonable that Ig secretion is at least partially regulated by cAMP-responsive alterations in PC metabolism produced by protein kinase C-induced phosphorylation. We conclude that the early cAMP-sensitive changes in PC metabolism in this activated B cell line may signal for subsequent alterations in Ig secretion.

  11. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  12. Modulation of dihydropyridine-sensitive calcium channels in Drosophila by a cAMP-mediated pathway.

    PubMed

    Bhattacharya, A; Gu, G G; Singh, S

    1999-06-15

    Drosophila has proved to be a valuable system for studying the structure and function of ion channels. However, relatively little is known about the regulation of ion channels, particularly that of Ca2+ channels, in Drosophila. Physiological and pharmacological differences between invertebrate and mammalian L-type Ca2+ channels raise questions on the extent of conservation of Ca2+ channel modulatory pathways. We have examined the role of cyclic adenosine monophosphate (cAMP) cascade in modulating the dihydropyridine (DHP)-sensitive Ca2+ channels in the larval muscles of Drosophila, using mutations and drugs that disrupt specific steps in this pathway. The L-type (DHP-sensitive) Ca2+ channel current was increased in the dunce mutants, which have high cAMP concentration owing to cAMP-specific phosphodiesterase (PDE) disruption. The current was decreased in the rutabaga mutants, where adenylyl cyclase (AC) activity is altered thereby decreasing the cAMP concentration. The dunce effect was mimicked by 8-Br-cAMP, a cAMP analog, and IBMX, a PDE inhibitor. The rutabaga effect was rescued by forskolin, an AC activator. H-89, an inhibitor of protein kinase-A (PKA), reduced the current and inhibited the effect of 8-Br-cAMP. The data suggest modulation of L-type Ca2+ channels of Drosophila via a cAMP-PKA mediated pathway. While there are differences in L-type channels, as well as in components of cAMP cascade, between Drosophila and vertebrates, main features of the modulatory pathway have been conserved. The data also raise questions on the likely role of DHP-sensitive Ca2+ channel modulation in synaptic plasticity, and learning and memory, processes disrupted by the dnc and the rut mutations. PMID:10380071

  13. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  14. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  15. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  16. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade.

    PubMed

    Astakhova, Luba A; Samoiliuk, Evgeniia V; Govardovskii, Victor I; Firsov, Michael L

    2012-10-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide-gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca(2+) exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca(2+)](in). Analysis by a complete model of rod phototransduction suggests that an increase of [Ca(2+)](in) might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca(2+)](in) and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  17. Association of the cyclic AMP chemotaxis receptor with the detergent- insoluble cytoskeleton of Dictyostelium discoideum

    PubMed Central

    1984-01-01

    Treatment of 6-h differentiated Dictyostelium discoideum cells with the nonionic detergent Triton X-100 dissolves away membranes and soluble components, as judged by marker enzyme distributions, leaving intact a cytoskeletal residue that contains approximately 10% of the cell protein and 50% of the actin. Nitrobenzooxadiazo-phallacidin staining for F-actin and electron microscopy of detergent-extracted whole-mounts indicate that the cytoskeletons retain the size and shape of intact cells and contain F-actin in cortical meshworks. The cytoskeletons contain little if any remaining membrane material by morphological criteria, and the plasma membrane enzymes cyclic nucleotide phosphodiesterase and alkaline phosphatase are absent from the insoluble residue, which retains only 15% of the membrane concanavalin A-binding glycoproteins. This detergent-insoluble residue retains a specific [3H]cAMP-binding site with the nucleotide specificity, rapid kinetics and approximate affinity of the cAMP receptor on intact cells. Upon detergent extraction of cells, the number of cAMP-binding sites increases 20-70%. The binding site is attached to the insoluble residue whether or not the cAMP receptor is occupied at the time of detergent addition. The pH dependence for recovery of the insoluble cAMP-binding site is much sharper than that on intact cells or membranes with an optimum at pH 6.1. Conditions of pH and ionic composition that lead to disruption of the cytoskeleton upon detergent treatment also result in the loss of cAMP binding. During differentiation, the detergent- insoluble cAMP binding increases in parallel with cell surface cAMP receptors and chemotaxis to cAMP. PMID:6693497

  18. Role of cyclic AMP in pulmonary xenobiotic metabolism with special emphasis on benzo(a)pyrene

    SciTech Connect

    Schaeffer, V.H.

    1986-01-01

    This thesis was intended to investigate the role of the intracellular regulator, cAMP, on pulmonary xenobiotic metabolism using the well-studied carcinogen, benzo(a)pyrene (BP) as a representative xenobiotic. Lung slices from rats administered N/sup 6/, O/sup 2/', dibutyryl cAMP (DcAMP), theophylline or forskolin, all of which elevated biologically reactive cAMP levels in the lung, showed an increased ability to metabolize (/sup 3/H)-BP. This effect occurred beyond 6 hr following treatment and reached a maximum at 12 hr, at a time when cAMP content had already peaked and returned to basal levels. The perfusion of BP through the isolated lungs of animals administered DcAMP in vivo indicated that the BP metabolites primarily responsible for the cyclic nucleotide-induced increase in metabolism were the 3-hydroxy BP, 9-hydroxy BP, BP 9, 10 diol, BP-glucuronides and BP-glutathione conjugates. Kinetic analysis indicated that the Km component of these reactions was altered without a corresponding change in Vmax, suggesting that elevated pulmonary cAMP content may be affecting the detoxication enzymes, UDP-glucuronyltransferase and sulfotransferase. Studies with pulmonary microsomes from DcAMP-treated animals indicated that the cyclic nucleotide not only enhanced the hydroxylation of BP but also the cytochrome P450-dependent hydroxylation of coumarin. This is supported by the fact that DcAMP administration in vivo also enhanced phosphorylation of two classes of nuclear proteins, histones and nuclear acidic proteins, believed to play a role in the transcription of RNA and DNA.

  19. Role of phosphodiesterases in the shaping of sub-plasma-membrane cAMP oscillations and pulsatile insulin secretion.

    PubMed

    Tian, Geng; Sågetorp, Jenny; Xu, Yunjian; Shuai, Hongyan; Degerman, Eva; Tengholm, Anders

    2012-11-01

    Specificity and versatility in cyclic AMP (cAMP) signalling are governed by the spatial localisation and temporal dynamics of the signal. Phosphodiesterases (PDEs) are important for shaping cAMP signals by hydrolyzing the nucleotide. In pancreatic β-cells, glucose triggers sub-plasma-membrane cAMP oscillations, which are important for insulin secretion, but the mechanisms underlying the oscillations are poorly understood. Here, we investigated the role of different PDEs in the generation of cAMP oscillations by monitoring the concentration of cAMP in the sub-plasma-membrane space ([cAMP](pm)) with ratiometric evanescent wave microscopy in MIN6 cells or mouse pancreatic β-cells expressing a fluorescent translocation biosensor. The general PDE inhibitor IBMX increased [cAMP](pm), and whereas oscillations were frequently observed at 50 µM IBMX, 300 µM-1 mM of the inhibitor caused a stable increase in [cAMP](pm). The [cAMP](pm) was nevertheless markedly suppressed by the adenylyl cyclase inhibitor 2',5'-dideoxyadenosine, indicating IBMX-insensitive cAMP degradation. Among IBMX-sensitive PDEs, PDE3 was most important for maintaining a low basal level of [cAMP](pm) in unstimulated cells. After glucose induction of [cAMP](pm) oscillations, inhibitors of PDE1, PDE3 and PDE4 inhibitors the average cAMP level, often without disturbing the [cAMP](pm) rhythmicity. Knockdown of the IBMX-insensitive PDE8B by shRNA in MIN6 cells increased the basal level of [cAMP](pm) and prevented the [cAMP](pm)-lowering effect of 2',5'-dideoxyadenosine after exposure to IBMX. Moreover, PDE8B-knockdown cells showed reduced glucose-induced [cAMP](pm) oscillations and loss of the normal pulsatile pattern of insulin secretion. It is concluded that [cAMP](pm) oscillations in β-cells are caused by periodic variations in cAMP generation, and that several PDEs, including PDE1, PDE3 and the IBMX-insensitive PDE8B, are required for shaping the sub-membrane cAMP signals and pulsatile insulin release.

  20. [Adrenaline and cyclic AMP stimulation of ketopentose and sedoheptulose formation in rat liver homogenates].

    PubMed

    Kolotilova, A I; Glushankov, E P; Epifanova, Iu E

    1976-01-01

    Formation of sedoheptulose-7-phosphate and ketopentose phosphate was studied in vitro as affected by epinephrine and cAMP. No effect of epinephrine on the activity of transketolase was found with ribose-5-phosphate as a substrate of the nonoxidative reactions of the pentose phosphate ccyle. Epinephrine and cAMP enhance the formation of ketopentoses and sedoheptulose with glycogen as a main carbohydrate source, which is most pronounced in the experiments with cold preincubation. The phosphorylase system mediate influence of epinephrine and cAMP on the nonoxidative reactions products may be assumed.

  1. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  2. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release

    PubMed Central

    Atchison, Douglas K.; Harding, Pamela; Cecilia Ortiz-Capisano, M.; Peterson, Edward L.

    2012-01-01

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log10 means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot−1·h−1 (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells. PMID:22896038

  3. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release.

    PubMed

    Atchison, Douglas K; Harding, Pamela; Cecilia Ortiz-Capisano, M; Peterson, Edward L; Beierwaltes, William H

    2012-10-15

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log(10) means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot(-1)·h(-1) (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells.

  4. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  5. Cyclic AMP regulates the biosynthesis of cellobiohydrolase in Cellulomonas flavigena growing in sugar cane bagasse.

    PubMed

    Herrera-Herrera, Jesús Antonio; Pérez-Avalos, Odilia; Salgado, Luis M; Ponce-Noyola, Teresa

    2009-10-01

    Cellulomonas flavigena produces a battery of cellulase components that act concertedly to degrade cellulose. The addition of cAMP to repressed C. flavigena cultures released catabolic repression, while addition of cAMP to induced C. flavigena cultures led to a cellobiohydrolase hyperproduction. Exogenous cAMP showed positive regulation on cellobiohydrolase production in C. flavigena grown on sugar cane bagasse. A C. flavigena cellobiohydrolase gene was cloned (named celA), which coded for a 71- kDa enzyme. Upstream, a repressor celR1, identified as a 38 kDa protein, was monitored by use of polyclonal antibodies.

  6. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  7. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  8. Binding of the Citrobacter freundii AmpR regulator to a single DNA site provides both autoregulation and activation of the inducible ampC beta-lactamase gene.

    PubMed Central

    Lindquist, S; Lindberg, F; Normark, S

    1989-01-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase. Induction requires the product of the ampR gene, which is transcribed in the opposite orientation from the ampC beta-lactamase gene. We show here that the AmpR protein acts as a transcriptional activator by binding to a DNA region immediately upstream of the ampC promoter. The DNase I footprint pattern was not affected by growth in the presence of beta-lactam inducer or by the use of extracts prepared from cells carrying the ampD2 allele leading to semiconstitutive production of beta-lactamase. It is suggested that activation of AmpR facilitates binding or open complex formation for RNA polymerase at the ampC promoter. The AmpR-binding site overlaps the ampR promoter, and beta-galactosidase activity was decreased from an ampR-lacZ transcriptional fusion when AmpR was expressed from a coresident plasmid, suggesting that ampR is autogenously controlled. The AmpR protein belongs to a family of highly homologous transcriptional activators that includes LysR, which regulates the E. coli lysine synthetase gene, and the NodD protein, which regulates expression of a number of genes involved in nodulation in Rhizobium. The lack of sequence homology to any known beta-lactam-binding protein suggests that AmpR does not bind directly to the beta-lactam inducer but interacts with a second messenger of unknown nature. Images PMID:2786868

  9. Technological Advancements

    ERIC Educational Resources Information Center

    Kennedy, Mike

    2010-01-01

    The influx of technology has brought significant improvements to school facilities. Many of those advancements can be found in classrooms, but when students head down the hall to use the washrooms, they are likely to find a host of technological innovations that have improved conditions in that part of the building. This article describes modern…

  10. Research Advances

    ERIC Educational Resources Information Center

    King, Angela G.

    2004-01-01

    Research advances, a new feature in Journal of Chemical Engineering that brings information about innovations in current areas of research to high school and college science faculty with an intent to provide educators with timely descriptions of latest progress in research that can be integrated into existing courses to update course content and…

  11. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    SciTech Connect

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  12. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-11-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  13. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  14. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  15. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  16. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  17. N-Acetyl-D- and L-esters of 5'-AMP hydrolyze at different rates

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1993-01-01

    Studies of the properties of aminoacyl derivatives of 5'-AMP are aimed at understanding the origin of the process of protein synthesis. Aminoacyl (2',3') esters of 5'-AMP can serve as models of the 3'-terminus of aminoacyl tRNA. We report here on the relative rates of hydrolysis of Ac-D- and L-Phe AMP esters as a function of pH. At all pHs above 3, the rate constant of hydrolysis of the Ac-L-Phe ester is 1.7 to 2.1 times that of Ac-D-Phe ester. The D-isomer seems partially protected from hydrolysis by a stronger association with the adenine ring of the 5'-AMP.

  18. Role of the cAMP Pathway in Glucose and Lipid Metabolism.

    PubMed

    Ravnskjaer, Kim; Madiraju, Anila; Montminy, Marc

    2016-01-01

    3'-5'-Cyclic adenosine monophosphate (cyclic AMP or cAMP) was first described in 1957 as an intracellular second messenger mediating the effects of glucagon and epinephrine on hepatic glycogenolysis (Berthet et al., J Biol Chem 224(1):463-475, 1957). Since this initial characterization, cAMP has been firmly established as a versatile molecular signal involved in both central and peripheral regulation of energy homeostasis and nutrient partitioning. Many of these effects appear to be mediated at the transcriptional level, in part through the activation of the transcription factor CREB and its coactivators. Here we review current understanding of the mechanisms by which the cAMP signaling pathway triggers metabolic programs in insulin-responsive tissues.

  19. The plasma cyclic AMP response to catecholamines as potentiated by phentolamine in rats.

    PubMed

    Kunitada, S; Ui, M

    1978-05-15

    Norepinephrine failed to increase plasma cyclic AMP when injected alone into fasted rats, in contrast with sharp increases elicited by isoproterenol, epinephrine or tyramine. In rats pretreated with 6-hydroxydopamine or cocain, however, there was significant increase in plasma cyclic AMP after norepinephrine injection, suggesting that the rapid neuronal catecholamine uptake was at least partly responsible for the lack of norepinephrine action. Phentolamine was very effective in enhancing the epinephrine-, norepinephrine- or tyramine-induced increase in plasma cyclic AMP but without effect on the isoproterenol-induced increase. Blockade of postsynaptic alpha-adrenoceptors, rather than of presynaptic receptors, is likely to be involved in the phentolamine potentiation, since it was even observed in rats treated with 6-hydroxydopamine or cocaine. A discussion is presented regarding the mechanism by which cyclic AMP generation is influenced by the alpha- and beta-adrenoceptor interaction on effector cell membranes.

  20. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  1. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  2. NMR studies of the AMP-binding site and mechanism of adenylate kinase.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1987-03-24

    NMR has previously been used to determine the conformation of enzyme-bound MgATP and to locate the MgATP-binding site on adenylate kinase [Fry, D. C., Kuby, S. A., & Mildvan, A. S. (1985) Biochemistry 24, 4680-4694]. To determine the conformation and location of the other substrate, AMP, distances have been measured from Cr3+AMPPCP, a linear competitive inhibitor with respect to MgATP, to six protons and to the phosphorus atom of AMP on adenylate kinase, with the paramagnetic probe-T1 method. Time-dependent nuclear Overhauser effects (NOEs) have been used to measure five interproton distances on enzyme-bound AMP. These distances were used to determine the conformation of bound AMP in addition to its position with respect to metal-ATP. Enzyme-bound AMP exhibits a high anti-glycosyl torsional angle (chi = 110 +/- 10 degrees), a 3'-endo,2'-exo ribose pucker (delta = 105 +/- 10 degrees), and gauche-trans orientations about the C4'-C5' bond (gamma = 180 +/- 10 degrees) and the C5'-O5' bond (beta = 170 +/- 20 degrees). The distance from Cr3+ to the phosphorus of AMP is 5.9 +/- 0.3 A, indicating a reaction coordinate distance of approximately 3 A, which is consistent with an associative SN2 mechanism for the phosphoryl transfer. Ten intermolecular NOEs, from protons of the enzyme to those of AMP, were detected, indicating the proximity of at least three hydrophobic amino acids to bound AMP. These constraints, together with the conformation of AMP and the intersubstrate distances, were used to position AMP into the X-ray structure of adenylate kinase. The AMP binding site is found to be near (less than or equal to 4 A from) Leu-116, Arg-171, Val-173, Val-182, and Leu-190; all of these residues have been found to be invariant in muscle-type rabbit, calf, human, porcine [Kuby, S. A., Palmieri, R. H., Frischat, A., Fischer, A. H., Wu, L. H., Maland, L., & Manship, M. (1984) Biochemistry 23, 2393-2399], and chicken adenylate kinase [Kishi, F., Maruyama, M., Tanizawa, Y

  3. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal

  4. Effect of Glucagon on Net Splanchnic Cyclic AMP Production in Normal and Diabetic Men

    PubMed Central

    Liljenquist, John E.; Bomboy, James D.; Lewis, Stephen B.; Sinclair-Smith, Bruce C.; Felts, Philip W.; Lacy, William W.; Crofford, Oscar B.; Liddle, Grant W.

    1974-01-01

    Glucagon activates hepatic adenylate cyclase, thereby increasing acutely the liver content of cyclic AMP (cAMP) as well as the release of cAMP into the hepatic vein. Insulin, on the other hand, antagonizes this glucagon-mediated cAMP production, thus providing a hypothetical mechanism through which insulin might correct some of the metabolic abnormalities of diabetes. To study this hormonal interaction in man, net splanchnic cAMP production (NScAMPP) was investigated in normal and insulin-dependent diabetic men under basal conditions and in response to intravenous glucagon, 50 ng/kg/min for 2 h. In normals (n=19), basal hepatic vein cAMP concentration was 23.6±1.1 nM and NScAMPP was 1.7±0.6 nmol/min. Glucagon stimulated NScAMPP in four normal subjects to a peak of 99.6±43 nmol/min at 25 min with a subsequent fall to 12.4±5.1 nmol/min by 90 min despite continuing glucagon infusion. Endogenous insulin secretion was stimulated as indicated by rising levels of immunoreactive insulin and C-peptide (connecting peptide) immunoreactivity, raising the possibility that endogenous insulin might be responsible for the fall in NScAMPP that followed the initial spike. In the diabetics (n=8), basal hepatic vein cAMP concentration was 24.7±1.2 nM and NScAMPP was undetectable. Glucagon stimulated NScAMPP in five diabetics to a peak of 169.9±42.6 with a subsequent fall to 17.4±3.9 nmol/min by 90 min even though endogenous insulin secretion was not stimulated (no rise in C-peptide immunoreactivity). Although the mean increase in NScAMPP was greater in the diabetics, the two groups did not differ significantly. Conclusions. In normal resting man the liver is a significant source of circulating cAMP. Diabetics do not release abnormally large amounts of hepatic cAMP under basal conditions. Glucagon markedly enhances hepatic cAMP release with a spike-decline pattern in both normal and diabetic men. The decline in hepatic cAMP release despite continuing glucagon stimulation is due

  5. SCAP/SREBP pathway is required for the full steroidogenic response to cyclic AMP.

    PubMed

    Shimizu-Albergine, Masami; Van Yserloo, Brian; Golkowski, Martin G; Ong, Shao-En; Beavo, Joseph A; Bornfeldt, Karin E

    2016-09-20

    Luteinizing hormone (LH) stimulates steroidogenesis largely through a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically dependent on the availability of cholesterol at mitochondrial sites of synthesis. This cholesterol is provided by cellular uptake of lipoproteins, mobilization of intracellular lipid, and de novo synthesis. Whether and how these pathways are coordinated by cAMP are poorly understood. Recent phosphoproteomic analyses of cAMP-dependent phosphorylation sites in MA10 Leydig cells suggested that cAMP regulates multiple steps in these processes, including activation of the SCAP/SREBP pathway. SCAP [sterol-regulatory element-binding protein (SREBP) cleavage-activating protein] acts as a cholesterol sensor responsible for regulating intracellular cholesterol balance. Its role in cAMP-mediated control of steroidogenesis has not been explored. We used two CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated protein 9) knockout approaches to test the role of SCAP in steroidogenesis. Our results demonstrate that SCAP is required for progesterone production induced by concurrent inhibition of the cAMP phosphodiesterases PDE4 and PDE8. These inhibitors increased SCAP phosphorylation, SREBP2 activation, and subsequent expression of cholesterol biosynthetic genes, whereas SCAP deficiency largely prevented these effects. Reexpression of SCAP in SCAP-deficient cells restored SREBP2 protein expression and partially restored steroidogenic responses, confirming the requirement of SCAP-SREBP2 in steroidogenesis. Inhibitors of 3-hydroxy-3-methylglutaryl-Coenzyme A reductase and isoprenylation attenuated, whereas exogenously provided cholesterol augmented, PDE inhibitor-induced steroidogenesis, suggesting that the cholesterol substrate needed for steroidogenesis is provided by both de novo synthesis and isoprenylation-dependent mechanisms. Overall, these results demonstrate a novel role for LH/cAMP in SCAP

  6. Estradiol increases cAMP in the oviductal secretory cells through a nongenomic mechanism.

    PubMed

    Oróstica, María L; Lopez, John; Rojas, Israel; Rocco, Jocelyn; Díaz, Patricia; Reuquén, Patricia; Cardenas, Hugo; Parada-Bustamante, Alexis; Orihuela, Pedro A

    2014-09-01

    In the rat oviduct, estradiol (E2) accelerates egg transport by a nongenomic action that requires previous conversion of E2 to methoxyestrogens via catechol-O-methyltranferase (COMT) and activation of estrogen receptor (ER) with subsequent production of cAMP and inositol triphosphate (IP3). However, the role of the different oviductal cellular phenotypes on this E2 nongenomic pathway remains undetermined. The aim of this study was to investigate the effect of E2 on the levels of cAMP and IP3 in primary cultures of secretory and smooth muscle cells from rat oviducts and determine the mechanism by which E2 increases cAMP in the secretory cells. In the secretory cells, E2 increased cAMP but not IP3, while in the smooth muscle cells E2 decreased cAMP and increased IP3. Suppression of protein synthesis by actinomycin D did not prevent the E2-induced cAMP increase, but this was blocked by the ER antagonist ICI 182 780 and the inhibitors of COMT OR 486, G protein-α inhibitory (Gαi) protein pertussis toxin and adenylyl cyclase (AC) SQ 22536. Expression of the mRNA for the enzymes that metabolizes estrogens, Comt, Cyp1a1, and Cyp1b1 was found in the secretory cells, but this was not affected by E2. Finally, confocal immunofluorescence analysis showed that E2 induced colocalization between ESR1 (ERα) and Gαi in extranuclear regions of the secretory cells. We conclude that E2 differentially regulates cAMP and IP3 in the secretory and smooth muscle cells of the rat oviduct. In the secretory cells, E2 increases cAMP via a nongenomic action that requires activation of COMT and ER, coupling between ESR1 and Gαi, and stimulation of AC.

  7. Studying the regulation of endosomal cAMP production in GPCR signaling

    PubMed Central

    Gidon, Alexandre; Feinstein, Timothy N.; Xiao, Kunhong; Vilardaga, Jean-Pierre

    2016-01-01

    We describe methods based on live cell fluorescent microscopy and mass spectrometry to characterize the mechanism of endosomal cAMP production and its regulation using the parathyroid hormone (PTH) type 1 receptor as a prime example. These methods permit to measure rapid changes of cAMP levels in response to PTH, kinetics of endosomal ligand–receptor interaction, pH changes associated with receptor trafficking, and to identify the endosomal receptor interactome. PMID:26928541

  8. The ever unfolding story of cAMP signaling in trypanosomatids: vive la difference!

    PubMed Central

    Tagoe, Daniel N. A.; Kalejaiye, Titilola D.; de Koning, Harry P.

    2015-01-01

    Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi), sleeping sickness (Trypanosoma brucei spp.), and leishmaniasis (Leishmania spp). Although cAMP is produced during the life cycle stages of these parasites, its signaling pathways are very different from those of mammals. The absence of G-protein-coupled receptors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D), which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well conserved genes for catalytic and regulatory domains of protein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signaling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs) whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signaling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signaling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics. PMID:26441645

  9. Cyclic-AMP Mediated Regulation of ABCB mRNA Expression in Mussel Haemocytes

    PubMed Central

    Franzellitti, Silvia; Fabbri, Elena

    2013-01-01

    Background The multixenobiotic resistance system (MXR) allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp). In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. Methodology/Principal Findings cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis) exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX) alone or in combination with 0.3 ng/L propranolol (PROP). FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin) and pharmacological modulators (PROP, forskolin, dbcAMP, and H89) of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT) decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. Conclusions This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels. PMID:23593491

  10. Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

    1998-01-01

    The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

  11. 5′-AMP impacts lymphocyte recirculation through activation of A2B receptors

    PubMed Central

    Bouma, Hjalmar R.; Mandl, Judith N.; Strijkstra, Arjen M.; Boerema, Ate S.; Kok, Jan-Willem; van Dam, Annie; IJzerman, Ad; Kroese, Frans G. M.; Henning, Robert H.

    2013-01-01

    Natural hibernation consists of torpid phases with metabolic suppression alternating with euthermic periods. Induction of torpor holds substantial promise in various medical conditions, including trauma, major surgery, and transplantation. Torpor in mice can be induced pharmacologically by 5′-AMP. Previously, we showed that during natural torpor, the reduction in body temperature results in lymphopenia via a reduction in plasma S1P. Here, we show that during torpor induced by 5′-AMP, there is a similar reduction in the number of circulating lymphocytes that is a result of their retention in secondary lymphoid organs. This lymphopenia could be mimicked by engagement of A2BRs by a selective A2BR agonist (LUF6210) in the absence of changes in temperature and prevented by A2BR antagonists during 5′-AMP-induced torpor. In addition, forced cooling of mice led to peripheral blood lymphopenia, independent of A2BR signaling. The induction of torpor using 5′-AMP impacted the migration of lymphocytes within and between secondary lymphoid organs. During torpor, the homing into LNs was impaired, and two-photon intravital microscopy revealed that cell motility was decreased significantly and rapidly upon 5′-AMP administration. Furthermore, the S1P plasma concentration was reduced by 5′-AMP but not by LUF6210. S1P plasma levels restored upon arousal. Likely, the reduced migration in LNs combined with the reduced S1P plasma level substantially reduces lymphocyte egress after injection of 5′-AMP. In conclusion, 5′-AMP induces a state of pharmacological torpor in mice, during which, lymphopenia is governed primarily by body temperature-independent suppression of lymphocyte egress from LNs. PMID:23682128

  12. Modeling mutant phenotypes and oscillatory dynamics in the Saccharomyces cerevisiae cAMP-PKA pathway

    PubMed Central

    2013-01-01

    Background The cyclic AMP-Protein Kinase A (cAMP-PKA) pathway is an evolutionarily conserved signal transduction mechanism that regulates cellular growth and differentiation in animals and fungi. We present a mathematical model that recapitulates the short-term and long-term dynamics of this pathway in the budding yeast, Saccharomyces cerevisiae. Our model is aimed at recapitulating the dynamics of cAMP signaling for wild-type cells as well as single (pde1Δ and pde2Δ) and double (pde1Δpde2Δ) phosphodiesterase mutants. Results Our model focuses on PKA-mediated negative feedback on the activity of phosphodiesterases and the Ras branch of the cAMP-PKA pathway. We show that both of these types of negative feedback are required to reproduce the wild-type signaling behavior that occurs on both short and long time scales, as well as the the observed responses of phosphodiesterase mutants. A novel feature of our model is that, for a wide range of parameters, it predicts that intracellular cAMP concentrations should exhibit decaying oscillatory dynamics in their approach to steady state following glucose stimulation. Experimental measurements of cAMP levels in two genetic backgrounds of S. cerevisiae confirmed the presence of decaying cAMP oscillations as predicted by the model. Conclusions Our model of the cAMP-PKA pathway provides new insights into how yeast respond to alterations in their nutrient environment. Because the model has both predictive and explanatory power it will serve as a foundation for future mathematical and experimental studies of this important signaling network. PMID:23680078

  13. CREB modulates calcium signaling in cAMP-induced bone marrow stromal cells (BMSCs).

    PubMed

    Zhang, Linxia; Liu, Li; Thompson, Ryan; Chan, Christina

    2014-10-01

    Calcium signaling has a versatile role in many important cellular functions. Despite its importance, regulation of calcium signaling in bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) has not been explored extensively. Our previous study revealed that cyclic adenosine monophosphate (cAMP) enabled BMSCs to generate calcium signal upon stimulation by dopamine, KCl and glutamate. Concurrently, cAMP transiently activated the transcription factor cAMP response element binding protein (CREB) in BMSCs. Activity of CREB can be modulated by the calcium/calmodulin-dependent kinase signaling pathway, however, whether the calcium signaling observed in cAMP-induced BMSCs requires CREB has not been investigated. In an effort to uncover the role of CREB in the generation of calcium signaling in response to modulators such as dopamine and KCl, we knocked down CREB activity in BMSCs. Our study indicated that BMSCs, but not its close relative fibroblasts, are responsive to dopamine and KCl after cAMP treatment. Calcium signal elicited by dopamine depends, in part, on calcium influx whereas that elicited by KCl depends completely on calcium influx. Knock-down of CREB activity significantly reduced or abolished the cAMP-induced calcium response, and reintroducing a constitutively active CREB partially restored the calcium response.

  14. Dynamic fluctuations provide the basis of a conformational switch mechanism in apo cyclic AMP receptor protein.

    PubMed

    Aykaç Fas, Burcu; Tutar, Yusuf; Haliloğlu, Türkan

    2013-01-01

    Escherichia coli cyclic AMP Receptor Protein (CRP) undergoes conformational changes with cAMP binding and allosterically promotes CRP to bind specifically to the DNA. In that, the structural and dynamic properties of apo CRP prior to cAMP binding are of interest for the comprehension of the activation mechanism. Here, the dynamics of apo CRP monomer/dimer and holo CRP dimer were studied by Molecular Dynamics (MD) simulations and Gaussian Network Model (GNM). The interplay of the inter-domain hinge with the cAMP and DNA binding domains are pre-disposed in the apo state as a conformational switch in the CRP's allosteric communication mechanism. The hinge at L134-D138 displaying intra- and inter-subunit coupled fluctuations with the cAMP and DNA binding domains leads to the emergence of stronger coupled fluctuations between the two domains and describes an on state. The flexible regions at K52-E58, P154/D155 and I175 maintain the dynamic coupling of the two domains. With a shift in the inter-domain hinge position towards the N terminus, nevertheless, the latter correlations between the domains loosen and become disordered; L134-D138 dynamically interacts only with the cAMP and DNA binding domains of its own subunit, and an off state is assumed. We present a mechanistic view on how the structural dynamic units are hierarchically built for the allosteric functional mechanism; from apo CRP monomer to apo-to-holo CRP dimers.

  15. Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

    PubMed Central

    Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

    2015-01-01

    During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

  16. Pharmacological elevation of cyclic AMP and transmitter release at the mouse neuromuscular junction.

    PubMed

    Dryden, W F; Singh, Y N; Gordon, T; Lazarenko, G

    1988-03-01

    Intracellular recordings of spontaneous and evoked end-plate potentials have been made at the neuromuscular junction of mouse hemidiaphragms to determine a possible role of cyclic AMP (cAMP) in the release of acetylcholine from presynaptic terminals. Spontaneous release, as determined from the frequency of miniature end-plate potentials, was increased by drugs that inhibit phosphodiesterase: isobutylmethylxanthine (IBMX), SQ 20,009, theophylline, and caffeine; drugs that stimulate adenylate cyclase: forskolin, fluoride, and cholera toxin, and the stable analogue of cAMP: 8-bromo-cAMP but not dibutyryl cAMP. Release increased with time during maintained exposure to the drugs and generally followed a simple exponential time course with time constants ranging from 8 to 17 min at 20 degrees C, except for SQ 20,009 and cholera toxin which required longer exposure times for effect. The order of potency of the phosphodiesterase inhibitors was IBMX = SQ 20,009 greater than theophylline = caffeine. This is consistent with an effect mediated by an increase in cAMP concentrations within the nerve terminal. Evoked release, determined from the quantal content of the end-plate potential, was increased to a lesser extent than spontaneous release. The results are discussed with reference to the possible involvement of second messengers in the release of vesicles from nerve terminals in vertebrate synapses.

  17. Odor-induced cAMP production in Drosophila melanogaster olfactory sensory neurons.

    PubMed

    Miazzi, Fabio; Hansson, Bill S; Wicher, Dieter

    2016-06-15

    Insect odorant receptors are seven transmembrane domain proteins that form cation channels, whose functional properties such as receptor sensitivity are subject to regulation by intracellular signaling cascades. Here, we used the cAMP fluorescent indicator Epac1-camps to investigate the occurrence of odor-induced cAMP production in olfactory sensory neurons (OSNs) of Drosophila melanogaster We show that stimulation of the receptor complex with an odor mixture or with the synthetic agonist VUAA1 induces a cAMP response. Moreover, we show that while the intracellular Ca(2+) concentration influences cAMP production, the OSN-specific receptor OrX is necessary to elicit cAMP responses in Ca(2+)-free conditions. These results provide direct evidence of a relationship between odorant receptor stimulation and cAMP production in olfactory sensory neurons in the fruit fly antenna and show that this method can be used to further investigate the role that this second messenger plays in insect olfaction. PMID:27045092

  18. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  19. CREB modulates calcium signaling in cAMP-induced bone marrow stromal cells (BMSCs)

    PubMed Central

    Zhang, Linxia; Liu, Li; Thompson, Ryan; Chan, Christina

    2014-01-01

    Calcium signaling has a versatile role in many important cellular functions. Despite its importance, regulation of calcium signaling in bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) has not been explored extensively. Our previous study revealed that cyclic adenosine monophosphate (cAMP) enabled BMSCs to generate calcium signal upon stimulation by dopamine, KCl and glutamate. Concurrently, cAMP transiently activated the transcription factor cAMP response element binding protein (CREB) in BMSCs. Activity of CREB can be modulated by the calcium/calmodulin-dependent kinase signaling pathway, however, whether the calcium signaling observed in cAMP-induced BMSCs requires CREB has not been investigated. In an effort to uncover the role of CREB in the generation of calcium signaling in response to modulators such as dopamine and KCl, we knocked down CREB activity in BMSCs. Our study indicated that BMSCs, but not its close relative fibroblasts, are responsive to dopamine and KCl after cAMP treatment. Calcium signal elicited by dopamine depends, in part, on calcium influx whereas that elicited by KCl depends completely on calcium influx. Knock-down of CREB activity significantly reduced or abolished the cAMP-induced calcium response, and reintroducing a constitutively active CREB partially restored the calcium response. PMID:25154887

  20. Involvement of Type 4 cAMP-Phosphodiesterase in the Myogenic Differentiation of L6 Cells

    PubMed Central

    Naro, Fabio; Sette, Claudio; Vicini, Elena; De Arcangelis, Vania; Grange, Muriel; Conti, Marco; Lagarde, Michel; Molinaro, Mario; Adamo, Sergio; Némoz, Georges

    1999-01-01

    Myogenic cell differentiation is induced by Arg8-vasopressin, whereas high cAMP levels and protein kinase A (PKA) activity inhibit myogenesis. We investigated the role of type 4 phosphodiesterase (PDE4) during L6-C5 myoblast differentiation. Selective PDE4 inhibition resulted in suppression of differentiation induced by vasopressin. PDE4 inhibition prevented vasopressin-induced nuclear translocation of the muscle-specific transcription factor myogenin without affecting its overall expression level. The effects of PDE4 inhibition could be attributed to an increase of cAMP levels and PKA activity. RNase protection, reverse transcriptase PCR, immunoprecipitation, Western blot, and enzyme activity assays demonstrated that the PDE4D3 isoform is the major PDE4 expressed in L6-C5 myoblasts and myotubes, accounting for 75% of total cAMP-hydrolyzing activity. Vasopressin cell stimulation caused a biphasic increase of PDE4 activity, which peaked at 2 and 15 min and remained elevated for 48 h. In the continuous presence of vasopressin, cAMP levels and PKA activity were lowered. PDE4D3 overexpression increased spontaneous and vasopressin-dependent differentiation of L6-C5 cells. These results show that PDE4D3 plays a key role in the control of cAMP levels and differentiation of L6-C5 cells. Through the modulation of PDE4 activity, vasopressin inhibits the cAMP signal transduction pathway, which regulates myogenesis possibly by controlling the subcellular localization of myogenin. PMID:10588663

  1. Identification of Novel Genes Responsible for Overexpression of ampC in Pseudomonas aeruginosa PAO1

    PubMed Central

    Tsutsumi, Yuko; Tomita, Haruyoshi

    2013-01-01

    The development of resistance to antipseudomonal penicillins and cephalosporins mediated by the chromosomal ampC gene in Pseudomonas aeruginosa is of clinical importance. We isolated piperacillin-resistant mutants derived from P. aeruginosa PAO1 and analyzed two mutants that had an insertion in mpl and nuoN. One mutant, YT1677, was resistant to piperacillin and ceftazidime and had an insertion in mpl, which encodes UDP-N-acetylmuramate:l-alanyl-γ-d-glutamyl-meso-diaminopimelate ligase. The other mutant, YT7988, showed increased MICs of piperacillin, ceftazidime, cefepime, and cefoperazone, and the insertion was mapped to nuoN, which encodes NADH dehydrogenase I chain N. Complementation experiments demonstrated that these mutations resulted in higher levels of resistance to β-lactams. The expression of genes reported to be involved in β-lactam resistance was examined by real-time PCR in YT1677 and YT7988 mutants. Overexpression was observed for only ampC, and other genes were expressed normally. Deletion of the ampR gene in YT1677 and YT7988 resulted in decreased expression of ampC, indicating that the mutations in YT1677 and YT7988 affected the expression of ampC through the function of AmpR. PMID:24041903

  2. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression.

  3. Advanced Combustion

    SciTech Connect

    Holcomb, Gordon R.

    2013-03-11

    The activity reported in this presentation is to provide the mechanical and physical property information needed to allow rational design, development and/or choice of alloys, manufacturing approaches, and environmental exposure and component life models to enable oxy-fuel combustion boilers to operate at Ultra-Supercritical (up to 650{degrees}C & between 22-30 MPa) and/or Advanced Ultra-Supercritical conditions (760{degrees}C & 35 MPa).

  4. Advanced computing

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Advanced concepts in hardware, software and algorithms are being pursued for application in next generation space computers and for ground based analysis of space data. The research program focuses on massively parallel computation and neural networks, as well as optical processing and optical networking which are discussed under photonics. Also included are theoretical programs in neural and nonlinear science, and device development for magnetic and ferroelectric memories.

  5. Advanced Nanoemulsions

    NASA Astrophysics Data System (ADS)

    Fryd, Michael M.; Mason, Thomas G.

    2012-05-01

    Recent advances in the growing field of nanoemulsions are opening up new applications in many areas such as pharmaceuticals, foods, and cosmetics. Moreover, highly controlled nanoemulsions can also serve as excellent model systems for investigating basic scientific questions about soft matter. Here, we highlight some of the most recent developments in nanoemulsions, focusing on methods of formation, surface modification, material properties, and characterization. These developments provide insight into the substantial advantages that nanoemulsions can offer over their microscale emulsion counterparts.

  6. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 3: AMPS payload to instruments ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    General physical, functional, and operational interface control requirements for instruments on the first AMPS payload are presented. Interface specifications are included to satisfy ground handling, prelaunch, launch, stowage, operation, and landing activities. Applicable supporting documentation to implement the information is also given.

  7. Requirement of cAMP Signaling for Schwann Cell Differentiation Restricts the Onset of Myelination

    PubMed Central

    Bacallao, Ketty; Monje, Paula V.

    2015-01-01

    Isolated Schwann cells (SCs) respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1). To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP) and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC) agonists and antagonists revealed that selective transmembrane AC (tmAC) activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC), a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the uncoupling of signals

  8. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells

    PubMed Central

    Poole, Jill A.; Nordgren, Tara M.; DeVasure, Jane M.; Heires, Art J.; Bailey, Kristina L.; Romberger, Debra J.

    2014-01-01

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  9. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells.

    PubMed

    Wyatt, Todd A; Poole, Jill A; Nordgren, Tara M; DeVasure, Jane M; Heires, Art J; Bailey, Kristina L; Romberger, Debra J

    2014-10-15

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  10. Requirement of cAMP signaling for Schwann cell differentiation restricts the onset of myelination.

    PubMed

    Bacallao, Ketty; Monje, Paula V

    2015-01-01

    Isolated Schwann cells (SCs) respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1). To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP) and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC) agonists and antagonists revealed that selective transmembrane AC (tmAC) activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC), a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the uncoupling of signals

  11. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.

    1985-01-01

    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  12. Autocrine activation of neuronal NMDA receptors by aspartate mediates dopamine- and cAMP-induced CREB-dependent gene transcription.

    PubMed

    Almeida, Luis E F; Murray, Peter D; Zielke, H Ronald; Roby, Clinton D; Kingsbury, Tami J; Krueger, Bruce K

    2009-10-01

    cAMP can stimulate the transcription of many activity-dependent genes via activation of the transcription factor, cAMP response element-binding protein (CREB). However, in mouse cortical neuron cultures, prior to synaptogenesis, neither cAMP nor dopamine, which acts via cAMP, stimulated CREB-dependent gene transcription when NR2B-containing NMDA receptors (NMDARs) were blocked. Stimulation of transcription by cAMP was potentiated by inhibitors of excitatory amino acid uptake, suggesting a role for extracellular glutamate or aspartate in cAMP-induced transcription. Aspartate was identified as the extracellular messenger: enzymatic scavenging of l-aspartate, but not glutamate, blocked stimulation of CREB-dependent gene transcription by cAMP; moreover, cAMP induced aspartate but not glutamate release. Together, these results suggest that cAMP acts via an autocrine or paracrine pathway to release aspartate, which activates NR2B-containing NMDARs, leading to Ca(2+) entry and activation of transcription. This cAMP/aspartate/NMDAR signaling pathway may mediate the effects of transmitters such as dopamine on axon growth and synaptogenesis in developing neurons or on synaptic plasticity in mature neural networks.

  13. AmpG is required for BlaXc beta-lactamase expression in Xanthomonas campestris pv. campestris str. 17.

    PubMed

    Yang, Tsuey-Ching; Chen, Tzu-Fan; Tsai, Jeffrey J P; Hu, Rouh-Mei

    2013-03-01

    The chromosomal ampR(Xc) -bla(Xc) module is essential for the β-lactam resistance of Xanthomonas campestris pv. campestris. Bla(Xc) β-lactamase is expressed at a high basal level in the absence of an inducer and its expression can be further induced by β-lactam. In enterobacteria, ampG encodes an inner membrane facilitator involved in the recycling of murein degradation compounds. An isogenic ampG mutant (XcampG) of X. campestris pv. campestris str. 17 (Xc17) was constructed to investigate the link between murein recycling and bla(Xc) expression. Our data demonstrate that (1) XcampG is susceptible to β-lactam antibiotics; (2) AmpG(Xc) is essential for expression of bla(Xc) ; (3) AmpGs of Xc17, Stenotrophomonas maltophilia KJ (SmKJ) and Escherichia coli DH5α can complement the defect of XcampG; (4) overexpression of AmpG(X) (c) significantly increased bla(Xc) expression; and (5) AmpG(Xc) from Xc17 is able to restore β-lactamase induction of the ampN(Xc) -ampG(Xc) double mutant of SmKJ. In Xc17, ampG(Xc) can be expressed from the promoter residing in the intergenic region of ampN(Xc) -ampG(Xc) and the expression is independent of β-lactam induction. AmpN, which is required for β-lactamases induction in SmKJ, is not required for the β-lactam antibiotic resistance of Xc17.

  14. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  15. Cholesterol ester hydrolase in pig liver is activated by cyclic AMP-dependent protein kinase

    SciTech Connect

    Chen, J.J.S.; Dubin, E.; Margolis, S.

    1986-05-01

    To examine whether hepatic neutral cholesterol ester hydrolase (CEH) is regulated by phosphorylation, the authors have assayed CEH activity from pig liver cytosol by measuring /sup 14/C-oleate release from labeled cholesteryl oleate at pH 7.4. When pig liver cytosol was incubated with 2 mM Mg and 0.5 mM ATP, CEH activity was increased (141 +/- 8% of control, mean +/- SEM). Addition of 25..mu..M cyclic AMP (cAMP) further activated CEH activity (164 +/- 4% of control) as compared to incubation with Mg and ATP (p < 0.02). In the presence of 5 mM EDTA or in the absence of either Mg or ATP, no activation of CEH was observed. The activation was completely abolished by further incubation of activated cytosol with E. coli alkaline phosphatase. Activation of CEH activity was partially prevented by the addition of protein kinase inhibitor (p < 0.02) and this effect was completely reversed in the presence of exogenous cAMP-dependent protein kinase (p < 0.05). To examine further the role of the cAMP-dependent protein kinase, CEH activity was purified 240-fold by 35% (NH/sub 4/)/sub 2/SO/sub 4/ precipitation and Sepharose 4B chromatography. Incubation of partially purified CEH fractions with Mg, ATP and cAMP did not increase CEH activity. Addition of exogenous cAMP-dependent protein kinase activated CEH activity of partially purified fractions. The authors observations indicate that pig liver CEH is activated by phosphorylation mediated by cAMP-dependent protein kinase.

  16. Effect of Elevated Intracellular cAMP Levels on Actomyosin Contraction in Bovine Trabecular Meshwork Cells

    PubMed Central

    Ramachandran, Charanya; Patil, Rajkumar V.; Sharif, Najam A.

    2011-01-01

    Purpose. Elevated cAMP in the trabecular meshwork (TM) cells increases the aqueous humor outflow facility. The authors investigated the mechanisms by which elevated cAMP opposes the RhoA-Rho kinase pathway, leading to the relaxation of the actomyosin system in bovine TM cells. Methods. Forskolin (Fsk) and rolipram were used to elevate cAMP levels. Changes in the phosphorylation of RhoA at Ser188 (a putative inhibitory site), the regulatory light chain of myosin (pMLC), and the regulatory subunit of myosin phosphatase (MYPT1) were determined by Western blot analysis. The actomyosin contraction was measured by collagen gel contraction (CGC) assay. The impact of cAMP on cell-matrix adhesion was followed by immunostaining of focal adhesion proteins and by electric cell-substrate impedance sensing. Results. Elevated cAMP led to an increase in the phosphorylation of RhoA at Ser188, to the inhibition of endothelin-1 (ET-1)–induced activation of RhoA, and to the formation of stress fibers. The loss of pMLC along the stress fibers was comparable to that induced by Y-27632 (Rho kinase inhibitor). A concomitant reduction in both MYPT1 phosphorylation and pMLC was observed. Elevated cAMP also reduced (ET-1)–induced CGC and the cell-substrate resistance by >50%. Conclusions. In TM cells, elevated cAMP leads to the phosphorylation of RhoA at Ser188. Consequent inhibition of RhoA activity reduces the phosphorylation of MYPT1 at Thr853, leading to a reduction in MLC phosphorylation and actomyosin contraction. These actions, similar to those of the Rho kinase inhibitors, possibly underlie the reported increase in outflow facility in response to Fsk perfusion ex vivo. PMID:21071747

  17. Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

    SciTech Connect

    Kasai, Ayumi; Yao, Jian; Yamauchi, Kozue; Hiramatsu, Nobuhiko; Hayakawa, Kunihiro; Meng, Yiman; Maeda, Shuichiro; Kitamura, Masanori . E-mail: masanori@yamanashi.ac.jp

    2006-02-15

    In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE{sup cyp}) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR{sup MMTV}) to improve sensitivity of assays. We found that DRE{sup cyp}-LTR{sup MMTV} responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE{sup cyp}-LTR{sup MMTV} and not involved in this process. In contrast to the effect of dioxin, the activation of DRE{sup cyp}-LTR{sup MMTV} by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE{sup cyp}, LTR{sup MMTV} nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE{sup cyp} with LTR{sup MMTV} causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE{sup cyp}-LTR{sup MMTV}-based bioassays for detection and quantification of dioxins and dioxin-like compounds.

  18. Expression of nitric oxide synthase in rat glomerular mesangial cells mediated by cyclic AMP.

    PubMed Central

    Mühl, H.; Kunz, D.; Pfeilschifter, J.

    1994-01-01

    1. Treatment of rat mesangial cells with interleukin 1 beta (IL-1 beta) or tumour necrosis factor alpha (TNF alpha) has been shown to induce a macrophage-type of nitric oxide (NO) synthase. Here we report that adenosine 3':5'-cyclic monophosphate (cyclic AMP) is another mediator that triggers induction of NO synthase in mesangial cells. 2. Incubation of mesangial cells with the beta-adrenoceptor agonist, salbutamol, forskolin or cholera toxin, which all activate adenylate cyclase and increase intracellular cyclic AMP concentration, increased nitrite formation in a dose-dependent manner. Likewise, the addition of the membrane-permeable cyclic AMP analogue, N6, 0-2'-dibutyryladenosine 3',5'-phosphate (Bt2 cyclic AMP) or the phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine enhanced NO synthase activity in a dose-dependent manner. 3. There was a lag period of about 8 h before a significantly enhanced secretion of nitrite could be detected upon exposure of cells to forskolin and for maximal stimulation, forskolin had to be present during the whole incubation period. 4. Treatment of mesangial cells with actinomycin D, cycloheximide or dexamethasone completely suppressed forskolin-stimulated NO-synthase activity, thus demonstrating that transcription and protein synthesis are necessary for nitrite formation. 5. Bt2 cyclic AMP, the most potent inducer of nitrite production, increased NO synthase mRNA levels in mesangial cells in a time- and dose-dependent fashion. Dexamethasone completely inhibited the increase of NO synthase mRNA in response to Bt2 cyclic AMP. 6. Combination of Bt2 cyclic AMP and IL-1 beta or TNF alpha revealed a strong synergy in terms of nitrite formation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7 Figure 8 Figure 9 PMID:7518300

  19. Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

    PubMed Central

    Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

    2016-01-01

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

  20. Carbachol and bradykinin elevate cyclic AMP and rapidly deplete ATP in cultured rat sympathetic neurons.

    PubMed Central

    Suidan, H S; Murrell, R D; Tolkovsky, A M

    1991-01-01

    The agonists carbachol (CCh) and bradykinin (BK) and 54 mM KCl (high K+) were among the most potent stimulants of cyclic AMP (cAMP) production in cultured rat sympathetic neurons, measured with the use of a high-fidelity assay developed for small samples. The rise in cAMP evoked by CCh (through muscarinic receptors), BK, and high K+ was inhibited in Ca2(+)-depleted medium (1.3 mM Ca2+ and 2 mM BAPTA or EGTA), which also prevented the sustained rise in [Ca2+]i evoked by each of these stimuli, showing that elevation of cAMP requires extracellular Ca2+ and, possibly, Ca2+ influx. Preliminary results obtained with the novel calmodulin inhibitor CGS 9343B, which blocked the elevation of cAMP, and with the cyclogenase inhibitor indomethacin, which partially blocked the actions of the agonists but not those of high K+, suggest that calmodulin and arachidonate metabolites may be two components of the signaling pathway. In addition to their effects on cAMP metabolism, CCh, muscarine, and BK, but not nicotine, caused a 30-40% decrease in ATP levels. This effect was much greater than that evoked by high K+ and was largely inhibited by CGS 9343B but slightly enhanced in the Ca(+)-depleted medium, showing that agonists are still active in the absence of [Ca2+]o. Thus, agonists that activate phosphoinositide metabolism can also increase cAMP production and substantially deplete cells of ATP. These novel actions may have to be taken into account when the mechanisms by which such agonists regulate cell function are being considered. PMID:1848792

  1. Effects of dibutyryl cyclic AMP and papaverine on intrahepatocytic bile acid transport. Role of vesicle transport.

    PubMed

    Hoshino, M; Ohiwa, T; Hayakawa, T; Kamiya, Y; Tanaka, A; Hirano, A; Kumai, T; Katagiri, K; Miyaji, M; Takeuchi, T

    1993-09-01

    The secondary messenger cyclic AMP plays an important role in regulating biliary excretory function by stimulating the transcytotic vesicle transport system, whereas papaverine exerts an inhibitory effect on this system. We therefore investigated their effects on bile acid-induced cytotoxicity and intrahepatocytic content of bile acid in primary cultured rat hepatocytes. Simultaneous addition of 1 mM dibutyryl cyclic AMP (DBcAMP), an analogue of cAMP, with 1 mM taurochenodeoxycholic acid (TCDCA) significantly decreased the release of lactate dehydrogenase (LDH) as compared with the case with 1 mM TCDCA alone (7.1 +/- 0.13% of total versus 10.7 +/- 0.3%). In contrast, 0.1 mM papaverine approximately doubled the amount of LDH (22.0 +/- 0.6% of total versus 10.7 +/- 0.3%; P < 0.01). The intracellular content of TCDCA 180 min after the administration of 1 mM TCDCA alone was 20.8 +/- 0.7 nmol/mg protein, that after simultaneous administration of 1 mM DBcAMP, 16.2 +/- 1.0 nmol/mg protein, and that after the simultaneous administration of 0.1 mM papaverine, 38.5 +/- 1.9 nmol/mg protein. A clear correlation between the release of LDH from hepatocytes and the intracellular content of TCDCA was thus observed. When given together with 1 mM taurocholic acid (TCA) or 1 mM tauroursodeoxycholic acid (TUDCA), papaverine exerted little effect on cytotoxicity or intrahepatocytic bile acid content. When cells were bathed in a medium free of bile acid after pretreatment with 1 mM TCDCA and 1 mM DBcAMP, additional exposure to DBcAMP for 30 min significantly stimulated reduction of intracellular TCDCA content (30.2 +/- 0.4% of total versus 44.0 +/- 1.4%).(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Advanced LIGO

    NASA Astrophysics Data System (ADS)

    LIGO Scientific Collaboration; Aasi, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V.; Affeldt, C.; Aggarwal, N.; Aguiar, O. D.; Ain, A.; Ajith, P.; Alemic, A.; Allen, B.; Amariutei, D.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C.; Areeda, J. S.; Ashton, G.; Ast, S.; Aston, S. M.; Aufmuth, P.; Aulbert, C.; Aylott, B. E.; Babak, S.; Baker, P. T.; Ballmer, S. W.; Barayoga, J. C.; Barbet, M.; Barclay, S.; Barish, B. C.; Barker, D.; Barr, B.; Barsotti, L.; Bartlett, J.; Barton, M. A.; Bartos, I.; Bassiri, R.; Batch, J. C.; Baune, C.; Behnke, B.; Bell, A. S.; Bell, C.; Benacquista, M.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Biscans, S.; Biwer, C.; Blackburn, J. K.; Blackburn, L.; Blair, C. D.; Blair, D.; Bock, O.; Bodiya, T. P.; Bojtos, P.; Bond, C.; Bork, R.; Born, M.; Bose, Sukanta; Brady, P. R.; Braginsky, V. B.; Brau, J. E.; Bridges, D. O.; Brinkmann, M.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Buchman, S.; Buikema, A.; Buonanno, A.; Cadonati, L.; Calderón Bustillo, J.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Caride, S.; Caudill, S.; Cavaglià, M.; Cepeda, C.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chao, S.; Charlton, P.; Chen, Y.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Collette, C.; Cominsky, L.; Constancio, M., Jr.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Costa, C. A.; Coughlin, M. W.; Countryman, S.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Cutler, C.; Dahl, K.; Dal Canton, T.; Damjanic, M.; Danilishin, S. L.; Danzmann, K.; Dartez, L.; Dave, I.; Daveloza, H.; Davies, G. S.; Daw, E. J.; DeBra, D.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; DeRosa, R. T.; DeSalvo, R.; Dhurandhar, S.; D´ıaz, M.; Di Palma, I.; Dojcinoski, G.; Dominguez, E.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Driggers, J. C.; Du, Z.; Dwyer, S.; Eberle, T.; Edo, T.; Edwards, M.; Edwards, M.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Essick, R.; Etzel, T.; Evans, M.; Evans, T.; Factourovich, M.; Fairhurst, S.; Fan, X.; Fang, Q.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Feldbaum, D.; Ferreira, E. C.; Fisher, R. P.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fuentes-Tapia, S.; Fulda, P.; Fyffe, M.; Gair, J. R.; Gaonkar, S.; Gehrels, N.; Gergely, L. Á.; Giaime, J. A.; Giardina, K. D.; Gleason, J.; Goetz, E.; Goetz, R.; Gondan, L.; González, G.; Gordon, N.; Gorodetsky, M. L.; Gossan, S.; Goßler, S.; Gräf, C.; Graff, P. B.; Grant, A.; Gras, S.; Gray, C.; Greenhalgh, R. J. S.; Gretarsson, A. M.; Grote, H.; Grunewald, S.; Guido, C. J.; Guo, X.; Gushwa, K.; Gustafson, E. K.; Gustafson, R.; Hacker, J.; Hall, E. D.; Hammond, G.; Hanke, M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harry, G. M.; Harry, I. W.; Hart, M.; Hartman, M. T.; Haster, C.-J.; Haughian, K.; Hee, S.; Heintze, M.; Heinzel, G.; Hendry, M.; Heng, I. S.; Heptonstall, A. W.; Heurs, M.; Hewitson, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hollitt, S. E.; Holt, K.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E.; Howell, E. J.; Hu, Y. M.; Huerta, E.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh, M.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Islas, G.; Isler, J. C.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacobson, M.; Jang, H.; Jawahar, S.; Ji, Y.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Ju, L.; Haris, K.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Katsavounidis, E.; Katzman, W.; Kaufer, H.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Keiser, G. M.; Keitel, D.; Kelley, D. B.; Kells, W.; Keppel, D. G.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khazanov, E. A.; Kim, C.; Kim, K.; Kim, N. G.; Kim, N.; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Klimenko, S.; Kline, J.; Koehlenbeck, S.; Kokeyama, K.; Kondrashov, V.; Korobko, M.; Korth, W. Z.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krueger, C.; Kuehn, G.; Kumar, A.; Kumar, P.; Kuo, L.; Landry, M.; Lantz, B.; Larson, S.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Le, J.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Leong, J. R.; Levin, Y.; Levine, B.; Lewis, J.; Li, T. G. F.; Libbrecht, K.; Libson, A.; Lin, A. C.; Littenberg, T. B.; Lockerbie, N. A.; Lockett, V.; Logue, J.; Lombardi, A. L.; Lormand, M.; Lough, J.; Lubinski, M. J.; Lück, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macarthur, J.; MacDonald, T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña-Sandoval, F.; Magee, R.; Mageswaran, M.; Maglione, C.; Mailand, K.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Márka, S.; Márka, Z.; Markosyan, A.; Maros, E.; Martin, I. W.; Martin, R. M.; Martynov, D.; Marx, J. N.; Mason, K.; Massinger, T. J.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McLin, K.; McWilliams, S.; Meadors, G. D.; Meinders, M.; Melatos, A.; Mendell, G.; Mercer, R. A.; Meshkov, S.; Messenger, C.; Meyers, P. M.; Miao, H.; Middleton, H.; Mikhailov, E. E.; Miller, A.; Miller, J.; Millhouse, M.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moe, B.; Mohanty, S. D.; Mohapatra, S. R. P.; Moore, B.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D.; Murray, P. G.; Mytidis, A.; Nash, T.; Nayak, R. K.; Necula, V.; Nedkova, K.; Newton, G.; Nguyen, T.; Nielsen, A. B.; Nissanke, S.; Nitz, A. H.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oppermann, P.; Oram, R.; O'Reilly, B.; Ortega, W.; O'Shaughnessy, R.; Osthelder, C.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Padilla, C.; Pai, A.; Pai, S.; Palashov, O.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Papa, M. A.; Paris, H.; Patrick, Z.; Pedraza, M.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Phelps, M.; Pierro, V.; Pinto, I. M.; Pitkin, M.; Poeld, J.; Post, A.; Poteomkin, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S.; Prestegard, T.; Price, L. R.; Principe, M.; Privitera, S.; Prix, R.; Prokhorov, L.; Puncken, O.; Pürrer, M.; Qin, J.; Quetschke, V.; Quintero, E.; Quiroga, G.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajalakshmi, G.; Rakhmanov, M.; Ramirez, K.; Raymond, V.; Reed, C. M.; Reid, S.; Reitze, D. H.; Reula, O.; Riles, K.; Robertson, N. A.; Robie, R.; Rollins, J. G.; Roma, V.; Romano, J. D.; Romanov, G.; Romie, J. H.; Rowan, S.; Rüdiger, A.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Sammut, L.; Sandberg, V.; Sanders, J. R.; Sannibale, V.; Santiago-Prieto, I.; Sathyaprakash, B. S.; Saulson, P. R.; Savage, R.; Sawadsky, A.; Scheuer, J.; Schilling, R.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sergeev, A.; Serna, G.; Sevigny, A.; Shaddock, D. A.; Shahriar, M. S.; Shaltev, M.; Shao, Z.; Shapiro, B.; Shawhan, P.; Shoemaker, D. H.; Sidery, T. L.; Siemens, X.; Sigg, D.; Silva, A. D.; Simakov, D.; Singer, A.; Singer, L.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, J. R.; Smith, M. R.; Smith, R. J. E.; Smith-Lefebvre, N. D.; Son, E. J.; Sorazu, B.; Souradeep, T.; Staley, A.; Stebbins, J.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Steplewski, S.; Stevenson, S.; Stone, R.; Strain, K. A.; Strigin, S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sutton, P. J.; Szczepanczyk, M.; Szeifert, G.; Talukder, D.; Tanner, D. B.; Tápai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, R.; Tellez, G.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, V.; Tomlinson, C.; Torres, C. V.; Torrie, C. I.; Traylor, G.; Tse, M.; Tshilumba, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; Vallisneri, M.; van Veggel, A. A.; Vass, S.; Vaulin, R.; Vecchio, A.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Vincent-Finley, R.; Vitale, S.; Vo, T.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, H.; Wang, M.; Wang, X.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; White, D. J.; Whiting, B. F.; Wilkinson, C.; Williams, L.; Williams, R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Xie, S.; Yablon, J.; Yakushin, I.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yang, Q.; Zanolin, M.; Zhang, Fan; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhu, X. J.; Zucker, M. E.; Zuraw, S.; Zweizig, J.

    2015-04-01

    The Advanced LIGO gravitational wave detectors are second-generation instruments designed and built for the two LIGO observatories in Hanford, WA and Livingston, LA, USA. The two instruments are identical in design, and are specialized versions of a Michelson interferometer with 4 km long arms. As in Initial LIGO, Fabry-Perot cavities are used in the arms to increase the interaction time with a gravitational wave, and power recycling is used to increase the effective laser power. Signal recycling has been added in Advanced LIGO to improve the frequency response. In the most sensitive frequency region around 100 Hz, the design strain sensitivity is a factor of 10 better than Initial LIGO. In addition, the low frequency end of the sensitivity band is moved from 40 Hz down to 10 Hz. All interferometer components have been replaced with improved technologies to achieve this sensitivity gain. Much better seismic isolation and test mass suspensions are responsible for the gains at lower frequencies. Higher laser power, larger test masses and improved mirror coatings lead to the improved sensitivity at mid and high frequencies. Data collecting runs with these new instruments are planned to begin in mid-2015.

  3. NO-Evoked macrophage apoptosis is attenuated by cAMP-induced gene expression.

    PubMed Central

    von Knethen, A.; Brockhaus, F.; Kleiter, I.; Brüne, B.

    1999-01-01

    BACKGROUND: Previous work has suggested that an increase in expression of cyclooxygenase-2, concomitant formation of E-type prostanoids, and in turn intracellular cAMP conveys macrophage resistance against apoptosis. MATERIALS AND METHODS: We analyzed the effects of lipophilic cAMP analogs on nitric oxide (NO)-induced apoptosis in RAW 264.7 macrophages and human primary monocyte-derived macrophages. Parameters comprised DNA fragmentation (diphenylamine assay), annexin V staining of phosphatidylserine, caspase activity (quantitated by the cleavage of a fluorogenic caspase-3-like substrate Ac-DEVD-AMC), and mitochondrial membrane depolarization (DeltaPsi), analyzed using DiOC(6)(3). Western blots detected accumulation of the tumor suppressor protein p53, relocation of cytochrome c, and expression of the antiapoptotic protein Bcl-X(L). A cAMP response-element decoy approach confirmed cAMP-dependent gene induction. RESULTS: We verified resistance of murine and human macrophages against NO donors such as S-nitrosoglutathione or spermine-NO by pre-exposing cells to lipophilic cAMP analogs or by pretreatment with lipopolysaccaride, interferon-gamma, and N(G)-nitroarginine-methylester for 15 hr. Cellular prestimulation decreased NO-evoked apoptosis, as apoptotic parameters were basically absent. Macrophage protection was not achieved during a short period of preexposure, i.e., 1 hr. To verify gene induction as the underlying protective principle, we treated RAW cells with oligonucleotides containing a cAMP-responsive element in order to scavenge cAMP response element-binding protein prior to its promoter-activating ability. Decoy oligonucleotides, but not an unrelated control oligonucleotide, weakened cAMP-evoked protection and re-established a p53 response following NO addition. CONCLUSION: Gene induction by cAMP protects macrophages against apoptosis that occurs as a result of excessive NO formation. Decreasing programmed cell death of macrophages may perpetuate

  4. [Cyclic AMP level in the muscle tissue of cattle and the physico-chemical properties of meat].

    PubMed

    Górna, M; Wieckowski, W

    1982-01-01

    The purpose of this study was to determine quantitative changes of cyclic adenosine mono-phosphate (c-AMP) level in meat of slaughter bulls. Meat samples were taken from the muscle longissimus dorsi (LD) of bulls overstressed by transport, which were stunned with electricity without rest. The obtained data did not show statistical correlations between c-AMP level and pI-values but showed statistical correlations between c-AMP level and some sensory properties of beef. The highest concentration of c-AMP was detected in the muscle about 90 minutes after slaughter. Individual differences in the concentration of c-AMP in the LD were observed in 30 min. after slaughter. In this time the high c-AMP level was correlated with the colour and sensory properties of meat and bouillon.

  5. The cyclic AMP phosphodiesterase RegA critically regulates encystation in social and pathogenic amoebas.

    PubMed

    Du, Qingyou; Schilde, Christina; Birgersson, Elin; Chen, Zhi-hui; McElroy, Stuart; Schaap, Pauline

    2014-02-01

    Amoebas survive environmental stress by differentiating into encapsulated cysts. As cysts, pathogenic amoebas resist antibiotics, which particularly counteracts treatment of vision-destroying Acanthamoeba keratitis. Limited genetic tractability of amoeba pathogens has left their encystation mechanisms unexplored. The social amoeba Dictyostelium discoideum forms spores in multicellular fruiting bodies to survive starvation, while other dictyostelids, such as Polysphondylium pallidum can additionally encyst as single cells. Sporulation is induced by cAMP acting on PKA, with the cAMP phosphodiesterase RegA critically regulating cAMP levels. We show here that RegA is deeply conserved in social and pathogenic amoebas and that deletion of the RegA gene in P. pallidum causes precocious encystation and prevents cyst germination. We heterologously expressed and characterized Acanthamoeba RegA and performed a compound screen to identify RegA inhibitors. Two effective inhibitors increased cAMP levels and triggered Acanthamoeba encystation. Our results show that RegA critically regulates Amoebozoan encystation and that components of the cAMP signalling pathway could be effective targets for therapeutic intervention with encystation.

  6. Actin induction during PMA and cAMP-dependent signal pathway activation in Entamoeba histolytica trophozoites.

    PubMed

    Ortiz, D; del Carmen Dominguez-Robles, M; Villegas-Sepúlveda, N; Meza, I

    2000-10-01

    Activation of PKC or cAMP-dependent signalling pathways in Entamoeba histolytica triggers the phosphorylation of proteins involved in actin rearrangements necessary for adhesion and locomotion. Analogous motifs to SRE and CRE sequences--known to respond to PMA and cAMP--were identified within the 5' regulatory region (5'RR) of one of the parasite actin genes. These sequences could be involved in the actin transcriptional upregulation reported during signalling. To test this hypothesis, a plasmid containing the 5'RR of the actin gene fused to the bacterial neomycin gene (neo) was used for stable transfection. Expression of neo and endogenous actin was measured after stimulation of transfected amoebae by PMA and dcAMP. It was found that both compounds induced neo and actin expression and showed a co-operative effect in the induction of neo. Induction by PMA or dcAMP failed if the directing amoebic 5'RR lacked SRE and CRE motifs. Transfection of amoebae with plasmid constructs, containing either progressive deletions of the actin 5'RR or site-directed mutations of the SRE and CRE-like motifs, corroborated that these sequences and a co-ordinated participation of PKC- and PKA-activated transcription factors are responsible for the increments in neo and actin mRNAs. In vivo, these PMA and cAMP-response elements could play an important role in regulating actin expression and organization in signalling processes activated during tissue invasion.

  7. Origin and evolution of the AmpC beta-lactamases of Citrobacter freundii.

    PubMed

    Barlow, Miriam; Hall, Barry G

    2002-05-01

    To determine whether the widespread clinical use of beta-lactams has been selective for Citrobacter freundii-derived alleles of plasmid ampC genes, we generated a Bayesian consensus phylogeny of the published ampC sequences and compared the MICs of 16 beta-lactam antibiotics for Escherichia coli strains containing cloned copies of the C. freundii ampC alleles. We found that for the majority of compounds investigated, there has been essentially no increase in beta-lactam resistance conferred by those alleles. We also found that ampC alleles from the chromosomes of two beta-lactam-sensitive C. freundii strains isolated in the 1920s, before the clinical use of antibiotics, were as effective at providing beta-lactam resistance in E. coli as were the plasmid-borne alleles from beta-lactam-resistant clinical isolates. These results suggest that selection for increased resistance to beta-lactam antibiotics has not been a significant force directing the evolution of the C. freundii ampC alleles found in beta-lactam-resistant clinical isolates.

  8. What is the role of antimicrobial peptides (AMP) in acne vulgaris?

    PubMed

    Harder, Jürgen; Tsuruta, Daisuke; Murakami, Masamoto; Kurokawa, Ichiro

    2013-06-01

    Acne vulgaris is the most common disorder of the pilosebaceous unit leading to inflamed skin characterized by the formation of comedones, papules, pustules and scarring. There is increasing evidence that the abundance of Propionibacterium acnes (P. acnes) in the inflamed acne lesions triggers inflammation. Therefore, in addition to treatment with retinoids, the use of antimicrobial agents has been established as a treatment option for acne. This indicates that antimicrobial mechanisms to control the growth of P. acnes may have an important influence on the severity of inflammatory acne. One import antimicrobial innate defense system comprises the production of antimicrobial peptides (AMP), small molecules with a broad spectrum of antimicrobial activity as well as immunomodulatory properties. Although the role of AMP in acne is still emerging, there is increasing evidence that AMP may be of importance in acne. The aim of this viewpoint is to provide some hypotheses about the potential function of AMP in the pathogenesis of acne and to discuss potential AMP-based therapies for the treatment of acne.

  9. Presynaptic H3 autoreceptors modulate histamine synthesis through cAMP pathway.

    PubMed

    Gomez-Ramirez, Jordi; Ortiz, Jordi; Blanco, Isaac

    2002-01-01

    Histamine H3 receptors modulate histamine synthesis, although little is known about the transduction mechanisms involved. To investigate this issue, we have used a preparation of rat brain cortical miniprisms in which histamine synthesis can be modulated by depolarization and by H3 receptor ligands. When the miniprisms were incubated in presence of forskolin, dibutyryl-cAMP, or 3-isobutyl-1-methylxanthine (IBMX), histamine synthesis was stimulated in 34, 29, and 47%, respectively. These stimulations could be prevented by the selective cAMP protein kinase blocker Rp-adenosine 3',5'-cyclic monophosphothioate triethylamine (Rp-cAMPs). Preincubation with the H3 receptor agonist imetit prevented IBMX- (100% blockade) and forskolin- (70% blockade) induced stimulation of histamine synthesis. The H3 inverse agonist thioperamide enhanced histamine synthesis in the presence of 1 mM IBMX or 30 mM potassium (+47 and +45%, respectively). Similarly, the H3 antagonist clobenpropit enhanced histamine synthesis in the presence of 30 mM potassium (+ 59%). The cAMP-dependent protein kinase blockers Rp-cAMPs and PKI14-22 could impair the effects of thioperamide and clobenpropit, respectively. These results indicate that the adenylate cyclase-protein kinase A pathway is involved in the modulation of histamine synthesis by H3 autoreceptors present in histaminergic nerve terminals.

  10. Pseudomonas aeruginosa AmpR: an acute–chronic switch regulator

    PubMed Central

    Balasubramanian, Deepak; Kumari, Hansi; Mathee, Kalai

    2015-01-01

    Pseudomonas aeruginosa is one of the most intractable human pathogens that pose serious clinical challenge due to extensive prevalence of multidrug-resistant clinical isolates. Armed with abundant virulence and antibiotic resistance mechanisms, it is a major etiologic agent in a number of acute and chronic infections. A complex and intricate network of regulators dictates the expression of pathogenicity factors in P. aeruginosa. Some proteins within the network play key roles and control multiple pathways. This review discusses the role of one such protein, AmpR, which was initially recognized for its role in antibiotic resistance by regulating AmpC β-lactamase. Recent genomic, proteomic and phenotypic analyses demonstrate that AmpR regulates expression of hundreds of genes that are involved in diverse pathways such as β-lactam and non-β-lactam resistance, quorum sensing and associated virulence phenotypes, protein phosphorylation, and physiological processes. Finally, ampR mutations in clinical isolates are reviewed to shed light on important residues required for its function in antibiotic resistance. The prevalence and evolutionary implications of AmpR in pathogenic and nonpathogenic proteobacteria are also discussed. A comprehensive understanding of proteins at nodal positions in the P. aeruginosa regulatory network is crucial in understanding, and ultimately targeting, the pathogenic stratagems of this organism. PMID:25066236

  11. Cesium absorption from acidic solutions using ammonium molybdophosphate on a polyacrylonitrile support (AMP-PAN)

    SciTech Connect

    Miller, C.J.; Olson, A.L.; Johnson, C.K.

    1995-12-01

    Recent efforts at the Idaho Chemical Processing Plant (ICPP) have included evaluation of cesium removal technologies as applied to ICPP acidic radioactive waste streams. Ammonium molybdophosphate (AMP) immobilized on a polyacrylonitrile support (AMP-PAN) has been studied as an ion exchange agent for cesium removal from acidic waste solutions. Capacities, distribution coefficients, elutability, and kinetics of cesium-extraction have been evaluated. Exchange breakthrough curves using small columns have been determined from 1M HNO{sub 3} and simulated waste solutions. The theoretical capacity of AMP is 213 g Cs/kg AMP. The average experimental capacity in batch contacts with various acidic solutions was 150 g Cs/kg AMP. The measured cesium distribution coefficients from actual waste solutions were 3287 mL/g for dissolved zirconia calcines, and 2679 mL/g for sodium-bearing waste. The cesium in the dissolved alumina calcines was analyzed for; however, the concentration was below analytical detectable limits resulting in inconclusive results. The reaction kinetics are very rapid (2-10 minutes). Cesium absorption appears to be independent of acid concentration over the range tested (0.1 M to 5 M HNO{sub 3}).

  12. Intercellular redistribution of cAMP underlies selective suppression of cancer cell growth by connexin26.

    PubMed

    Chandrasekhar, Anjana; Kalmykov, Edward A; Polusani, Srikanth R; Mathis, Sandra A; Zucker, Shoshanna N; Nicholson, Bruce J

    2013-01-01

    Connexins (Cx), which constitute gap junction intercellular channels in vertebrates, have been shown to suppress transformed cell growth and tumorigenesis, but the mechanism(s) still remain largely speculative. Here, we define the molecular basis by which Cx26, but less frequently Cx43 or Cx32, selectively confer growth suppression on cancer cells. Functional intercellular coupling is shown to be required, producing partial blocks of the cell cycle due to prolonged activation of several mitogenic kinases. PKA is both necessary and sufficient for the Cx26 induced growth inhibition in low serum and the absence of anchorage. Activation of PKA was not associated with elevated cAMP levels, but appeared to result from a redistribution of cAMP throughout the cell population, eliminating the cell cycle oscillations in cAMP required for efficient cell cycle progression. Cx43 and Cx32 fail to mediate this redistribution as, unlike Cx26, these channels are closed during the G2/M phase of the cell cycle when cAMP levels peak. Comparisons of tumor cell lines indicate that this is a general pattern, with growth suppression by connexins occurring whenever cAMP oscillates with the cell cycle, and the gap junction remain open throughout the cell cycle. Thus, gap junctional coupling, in the absence of any external signals, provides a general means to limit the mitotic rate of cell populations. PMID:24312655

  13. cAMP-Signalling Regulates Gametocyte-Infected Erythrocyte Deformability Required for Malaria Parasite Transmission

    PubMed Central

    Thompson, Eloise; Breil, Florence; Lorthiois, Audrey; Dupuy, Florian; Cummings, Ross; Duffier, Yoann; Corbett, Yolanda; Mercereau-Puijalon, Odile; Vernick, Kenneth; Taramelli, Donatella; Baker, David A.; Langsley, Gordon; Lavazec, Catherine

    2015-01-01

    Blocking Plasmodium falciparum transmission to mosquitoes has been designated a strategic objective in the global agenda of malaria elimination. Transmission is ensured by gametocyte-infected erythrocytes (GIE) that sequester in the bone marrow and at maturation are released into peripheral blood from where they are taken up during a mosquito blood meal. Release into the blood circulation is accompanied by an increase in GIE deformability that allows them to pass through the spleen. Here, we used a microsphere matrix to mimic splenic filtration and investigated the role of cAMP-signalling in regulating GIE deformability. We demonstrated that mature GIE deformability is dependent on reduced cAMP-signalling and on increased phosphodiesterase expression in stage V gametocytes, and that parasite cAMP-dependent kinase activity contributes to the stiffness of immature gametocytes. Importantly, pharmacological agents that raise cAMP levels in transmissible stage V gametocytes render them less deformable and hence less likely to circulate through the spleen. Therefore, phosphodiesterase inhibitors that raise cAMP levels in P. falciparum infected erythrocytes, such as sildenafil, represent new candidate drugs to block transmission of malaria parasites. PMID:25951195

  14. Adenylate Kinase and AMP Signaling Networks: Metabolic Monitoring, Signal Communication and Body Energy Sensing

    PubMed Central

    Dzeja, Petras; Terzic, Andre

    2009-01-01

    Adenylate kinase and downstream AMP signaling is an integrated metabolic monitoring system which reads the cellular energy state in order to tune and report signals to metabolic sensors. A network of adenylate kinase isoforms (AK1-AK7) are distributed throughout intracellular compartments, interstitial space and body fluids to regulate energetic and metabolic signaling circuits, securing efficient cell energy economy, signal communication and stress response. The dynamics of adenylate kinase-catalyzed phosphotransfer regulates multiple intracellular and extracellular energy-dependent and nucleotide signaling processes, including excitation-contraction coupling, hormone secretion, cell and ciliary motility, nuclear transport, energetics of cell cycle, DNA synthesis and repair, and developmental programming. Metabolomic analyses indicate that cellular, interstitial and blood AMP levels are potential metabolic signals associated with vital functions including body energy sensing, sleep, hibernation and food intake. Either low or excess AMP signaling has been linked to human disease such as diabetes, obesity and hypertrophic cardiomyopathy. Recent studies indicate that derangements in adenylate kinase-mediated energetic signaling due to mutations in AK1, AK2 or AK7 isoforms are associated with hemolytic anemia, reticular dysgenesis and ciliary dyskinesia. Moreover, hormonal, food and antidiabetic drug actions are frequently coupled to alterations of cellular AMP levels and associated signaling. Thus, by monitoring energy state and generating and distributing AMP metabolic signals adenylate kinase represents a unique hub within the cellular homeostatic network. PMID:19468337

  15. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  16. Retromer terminates the generation of cAMP by internalized PTH-receptors

    PubMed Central

    Feinstein, Timothy N.; Wehbi, Vanessa L.; Ardura, Juan; Wheeler, David S.; Ferrandon, Sebastien; Gardella, Thomas J.; Vilardaga, Jean-Pierre

    2011-01-01

    Generation of cAMP by G protein–coupled receptors (GPCRs) and its termination is currently thought to occur exclusively at the plasma membrane of cells. Under existing models of receptor regulation, this signal is primarily restricted by desensitizationof the receptors through their binding to β-arrestins. However, this paradigm is not consistent with recent observations that the parathyroid hormone receptor type 1 (PTHR) continues to stimulate cAMP production even after receptor internalization, as β-arrestins are known to rapidly bind and internalize activated PTHR. Here we show that β-arrestin1 binding prolongs rather than terminates cAMP generation by PTHR, and that cAMP generation correlates with the persistence of arrestin-receptor complexes on endosomes. We found that PTHR signaling is instead turned-off by the retromer complex, which regulates traffic of internalized receptor from endosomes to the Golgi apparatus. Thus, binding by the retromer complex regulates sustained cAMP generation triggered by an internalized GPCR. PMID:21445058

  17. Renal Epithelial Cyst Formation and Enlargement in vitro: Dependence on cAMP

    NASA Astrophysics Data System (ADS)

    Mangoo-Karim, Roberto; Uchic, Marie; Lechene, Claude; Grantham, Jared J.

    1989-08-01

    Cysts, a common abnormality of kidneys, are collections of urine-like fluid enclosed by a continuous layer of epithelial cells. Renal cysts derive from nephrons and collecting ducts and progressively enlarge as a consequence of epithelial proliferation and transepithelial fluid secretion. The initiation of cyst formation and the factors that control cyst enlargement are unknown. We used an in vitro model of renal cysts to explore the role of the cAMP signal transduction system in the formation and expansion of cysts. MDCK cells, cultured in hydrated-collagen gel, produced polarized monolayered epithelial cysts when intracellular cAMP was increased by prostaglandin E1, arginine vasopressin, cholera toxin, forskolin, or 8-bromoadenosine 3',5'-cyclic monophosphate. All agonists were potentiated by 3-isobutyl-1-methylxanthine, a nucleotide phosphodiesterase inhibitor. The cell proliferation component of cyst enlargement was accelerated by cAMP agonists, as shown by the increased growth of MDCK cells in subconfluent monolayers. The fluid secretion component, reflected by the transepithelial movement of fluid across polarized monolayers of MDCK cells grown on permeable supports, was stimulated by cAMP agonists in the basolateral medium. Chloride levels were higher in the cyst fluid and the secreted fluid than in the bathing medium. We conclude that the development of MDCK cysts is dependent on cAMP. This signal transduction system may be an important modulator of epithelial cell proliferation and transepithelial fluid secretion in the kidney.

  18. Senescent-induced dysregulation of cAMP/CREB signaling and correlations with cognitive decline

    PubMed Central

    Hansen, Rolf T.; Zhang, Han-Ting

    2013-01-01

    It is well known that alongside senescence there is a gradual decline in cognitive ability, most noticeably certain kinds of memory such as working, episodic, spatial, and long term memory. However, until recently, not much has been known regarding the specific mechanisms responsible for the decline in cognitive ability with age. Over the past decades, researchers have become more interested in cAMP signaling, and its downstream transcription factor cAMP response element binding protein (CREB) in the context of senescence. However, there is still a lack of understanding on what ultimately causes the cognitive deficits observed with senescence. This review will focus on the changes in intracellular signaling in the brain, more specifically, alterations in cAMP/CREB signaling in aging. In addition, the downstream effects of altered cAMP signaling on cognitive ability with age will be further discussed. Overall, understanding the senescent-related changes that occur in cAMP/CREB signaling could be important for the development of novel drug targets for both healthy aging, and pathological aging such as Alzheimer's disease. PMID:23623816

  19. Strain-dependent occurrence of functional GTP:AMP phosphotransferase (AK3) in Saccharomyces cerevisiae.

    PubMed

    Schricker, R; Magdolen, V; Strobel, G; Bogengruber, E; Breitenbach, M; Bandlow, W

    1995-12-29

    The gene for yeast GTP:AMP phosphotransferase (PAK3) was found to encode a nonfunctional protein in 10 laboratory strains and one brewers' strain. The protein product showed high similarity to vertebrate AK3 and was located exclusively in the mitochondrial matrix. The deduced amino acid sequence revealed a protein that was shorter at the carboxyl terminus than all other known adenylate kinases. Introduction of a +1 frameshift into the 3'-terminal region of the gene extended homology of the deduced amino acid sequence to other members of the adenylate kinase family including vertebrate AK3. Frameshift mutations obtained after in vitro and in vivo mutagenesis were capable of complementing the adk1 temperature-conditional deficiency in Escherichia coli, indicating that the frameshift led to the expression of a protein that could phosphorylate AMP. Some yeasts, however, including strain D273-10B, two wine yeasts, and two more distantly related yeast genera, harbored an active allele, named AKY3, which contained a +1 frameshift close to the carboxyl terminus as compared with the laboratory strains. The encoded protein exhibited GTP:AMP and ITP:AMP phosphotransferase activities but did not accept ATP as phosphate donor. Although single copy in the haploid genome, disruption of the AKY3 allele displayed no phenotype, excluding the possibility that laboratory and brewers' strains had collected second site suppressors. It must be concluded that yeast mitochondria can completely dispense with GTP:AMP phosphotransferase activity.

  20. Diatom acclimation to elevated CO2 via cAMP signalling and coordinated gene expression

    NASA Astrophysics Data System (ADS)

    Hennon, Gwenn M. M.; Ashworth, Justin; Groussman, Ryan D.; Berthiaume, Chris; Morales, Rhonda L.; Baliga, Nitin S.; Orellana, Mónica V.; Armbrust, E. V.

    2015-08-01

    Diatoms are responsible for ~40% of marine primary productivity, fuelling the oceanic carbon cycle and contributing to natural carbon sequestration in the deep ocean. Diatoms rely on energetically expensive carbon concentrating mechanisms (CCMs) to fix carbon efficiently at modern levels of CO2 (refs , , ). How diatoms may respond over the short and long term to rising atmospheric CO2 remains an open question. Here we use nitrate-limited chemostats to show that the model diatom Thalassiosira pseudonana rapidly responds to increasing CO2 by differentially expressing gene clusters that regulate transcription and chromosome folding, and subsequently reduces transcription of photosynthesis and respiration gene clusters under steady-state elevated CO2. These results suggest that exposure to elevated CO2 first causes a shift in regulation, and then a metabolic rearrangement. Genes in one CO2-responsive cluster included CCM and photorespiration genes that share a putative cAMP-responsive cis-regulatory sequence, implying these genes are co-regulated in response to CO2, with cAMP as an intermediate messenger. We verified cAMP-induced downregulation of CCM gene δ-CA3 in nutrient-replete diatom cultures by inhibiting the hydrolysis of cAMP. These results indicate an important role for cAMP in downregulating CCM and photorespiration genes under elevated CO2 and provide insights into mechanisms of diatom acclimation in response to climate change.

  1. The role of ventral striatal cAMP signaling in stress-induced behaviors

    PubMed Central

    Plattner, Florian; Hayashi, Kanehiro; Hernandez, Adan; Benavides, David R.; Tassin, Tara C.; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W.; Yuen, Eunice Y.; Yan, Zhen; Goldberg, Matthew S.; Nairn, Angus C.; Greengard, Paul; Nestler, Eric J.; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D.; Bibb, James A.

    2015-01-01

    The cAMP/PKA signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitates cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targets the regulation of PDE4 by Cdk5, all produced analogical effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  2. alpha-Tocopherol decreases the somatostatin receptor-effector system and increases the cyclic AMP/cyclic AMP response element binding protein pathway in the rat dentate gyrus.

    PubMed

    Hernández-Pinto, A M; Puebla-Jiménez, L; Arilla-Ferreiro, E

    2009-08-01

    Neuronal survival has been shown to be enhanced by alpha-tocopherol and modulated by cyclic AMP (cAMP). Somatostatin (SST) receptors couple negatively to adenylyl cyclase (AC), thus leading to decreased cAMP levels. Whether alpha-tocopherol can stimulate neuronal survival via regulation of the somatostatinergic system, however, is unknown. The aim of this study was to investigate the effects of alpha-tocopherol on the SST signaling pathway in the rat dentate gyrus. To that end, 15-week-old male Sprague-Dawley rats were treated daily for 1 week with (+)-alpha-tocopherol or vehicle and sacrificed on the day following the last administration. No changes in either SST-like immunoreactivity (SST-LI) content or SST mRNA levels were detected in the dentate gyrus as a result of alpha-tocopherol treatment. A significant decrease in the density of the SST binding sites and an increase in the dissociation constant, however, were detected. The lower SST receptor density in the alpha-tocopherol-treated rats correlated with a significant decrease in the protein levels of the SST receptor subtypes SSTR1-SSTR4, whereas the corresponding mRNA levels were unaltered. G-protein-coupled-receptor kinase 2 expression was decreased by alpha-tocopherol treatment. This vitamin induced a significant increase in both basal and forskolin-stimulated AC activity, as well as a decrease in the inhibitory effect of SST on AC. Whereas the protein levels of AC type V/VI were not modified by alpha-tocopherol administration, ACVIII expression was significantly enhanced, suggesting it might account for the increase in AC activity. In addition, this treatment led to a reduction in Gialpha1-3 protein levels and in Gi functionality. alpha-Tocopherol did not affect the expression of the regulator of G-protein signaling 6/7 (RGS6/7). Finally, alpha-tocopherol induced an increase in the levels of phosphorylated cAMP response element binding protein (p-CREB) and total CREB in the dentate gyrus. Since CREB

  3. Genetically-encoded yellow fluorescent cAMP indicator with an expanded dynamic range for dual-color imaging.

    PubMed

    Odaka, Haruki; Arai, Satoshi; Inoue, Takafumi; Kitaguchi, Tetsuya

    2014-01-01

    Cyclic AMP is a ubiquitous second messenger, which mediates many cellular responses mainly initiated by activation of cell surface receptors. Various Förster resonance energy transfer-based ratiometric cAMP indicators have been created for monitoring the spatial and temporal dynamics of cAMP at the single-cell level. However, single fluorescent protein-based cAMP indicators have been poorly developed, with improvement required for dynamic range and brightness. Based on our previous yellow fluorescent protein-based cAMP indicator, Flamindo, we developed an improved yellow fluorescent cAMP indicator named Flamindo2. Flamindo2 has a 2-fold expanded dynamic range and 8-fold increased brightness compared with Flamindo by optimization of linker peptides in the vicinity of the chromophore. We found that fluorescence intensity of Flamindo2 was decreased to 25% in response to cAMP. Live-cell cAMP imaging of the cytosol and nucleus in COS7 cells using Flamindo2 and nlsFlamindo2, respectively, showed that forskolin elevated cAMP levels in each compartment with different kinetics. Furthermore, dual-color imaging of cAMP and Ca2+ with Flamindo2 and a red fluorescent Ca2+ indicator, R-GECO, showed that cAMP and Ca2+ elevation were induced by noradrenaline in single HeLa cells. Our study shows that Flamindo2, which is feasible for multi-color imaging with other intracellular signaling molecules, is useful and is an alternative tool for live-cell imaging of intracellular cAMP dynamics.

  4. Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii beta-lactamase.

    PubMed Central

    Lindberg, F; Lindquist, S; Normark, S

    1987-01-01

    In Citrobacter freundii and Enterobacter cloacae, synthesis of AmpC beta-lactamase is inducible by the addition of beta-lactams to the growth medium. Spontaneous mutants that constitutively overproduce the enzyme occur at a high frequency. When the C. freundii ampC beta-lactamase gene is cloned into Escherichia coli together with the regulatory gene ampR, beta-lactamase expression from the clone is inducible. Spontaneous cefotaxime-resistant mutants were selected from an E. coli strain carrying the cloned C. freundii ampC and ampR genes on a plasmid. Virtually all isolates had chromosomal mutations leading to semiconstitutive overproduction of beta-lactamase. The mutation ampD2 in one such mutant was caused by an IS1 insertion into the hitherto unknown ampD gene, located between nadC and aroP at minute 2.4 on the E. coli chromosome. The wild-type ampD allele cloned on a plasmid could fully trans-complement beta-lactamase-overproducing mutants of both E. coli and C. freundii, restoring the wild-type phenotype of highly inducible enzyme synthesis. This indicates that these E. coli and C. freundii mutants have their lesions in ampD. We hypothesize that induction of beta-lactamase synthesis is caused by blocking of the AmpD function by the beta-lactam inducer and that this leads directly or indirectly to an AmpR-mediated stimulation of ampC expression. PMID:3032901

  5. Pyridinium-based tripodal chemosensor in visual sensing of AMP in water by indicator displacement assay (IDA).

    PubMed

    Ghosh, Kumaresh; Ali, Sk Sarfaraj; Sarkar, Avik Ranjan; Samadder, Asmita; Khuda-Bukhsh, Anisur Rahman; Petsalakis, Ioannis D; Theodorakopoulos, Giannoula

    2013-09-14

    A simple pyridinium-based tripodal chemosensor, 1, effectively recognizes AMP over ATP and ADP through indicator displacement assay (IDA) technique in water at pH 6.4. The good recognition of 1 is due to the better accommodation of AMP at the core of 1 as well as functional interaction involving hydrogen bonding and charge-charge interaction. The sensor 1 also recognizes intracellular AMP.

  6. DhhP, a Cyclic di-AMP Phosphodiesterase of Borrelia burgdorferi, Is Essential for Cell Growth and Virulence

    PubMed Central

    Ye, Meiping; Zhang, Jun-Jie; Fang, Xin; Lawlis, Gavin B.; Troxell, Bryan; Zhou, Yan; Gomelsky, Mark

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a recently discovered second messenger in bacteria. Most of work on c-di-AMP signaling has been done in Gram-positive bacteria, firmicutes, and actinobacteria, where c-di-AMP signaling pathways affect potassium transport, cell wall structure, and antibiotic resistance. Little is known about c-di-AMP signaling in other bacteria. Borrelia burgdorferi, the causative agent of Lyme disease, is a spirochete that has a Gram-negative dual membrane. In this study, we demonstrated that B. burgdorferi BB0619, a DHH-DHHA1 domain protein (herein designated DhhP), functions as c-di-AMP phosphodiesterase. Recombinant DhhP hydrolyzed c-di-AMP to pApA in a Mn2+- or Mg2+-dependent manner. In contrast to c-di-AMP phosphodiesterases reported thus far, DhhP appears to be essential for B. burgdorferi growth both in vitro and in the mammalian host. Inactivation of the chromosomal dhhP gene could be achieved only in the presence of a plasmid-encoded inducible dhhP gene. The conditional dhhP mutant had a dramatic increase in intracellular c-di-AMP level in comparison to the isogenic wild-type strain. Unlike what has been observed in Gram-positive bacteria, elevated cellular c-di-AMP in B. burgdorferi did not result in an increased resistance to β-lactamase antibiotics, suggesting that c-di-AMP's functions in spirochetes differ from those in Gram-positive bacteria. In addition, the dhhP mutant was defective in induction of the σS factor, RpoS, and the RpoS-dependent outer membrane virulence factor OspC, which uncovers an important role of c-di-AMP in B. burgdorferi virulence. PMID:24566626

  7. Cyclic AMP Control Measured in Two Compartments in HEK293 Cells: Phosphodiesterase KM Is More Important than Phosphodiesterase Localization

    PubMed Central

    Matthiesen, Karina; Nielsen, Jacob

    2011-01-01

    The intracellular second messenger cyclic AMP (cAMP) is degraded by phosphodiesterases (PDE). The knowledge of individual families and subtypes of PDEs is considerable, but how the different PDEs collaborate in the cell to control a cAMP signal is still not fully understood. In order to investigate compartmentalized cAMP signaling, we have generated a membrane-targeted variant of the cAMP Bioluminiscence Resonance Energy Transfer (BRET) sensor CAMYEL and have compared intracellular cAMP measurements with it to measurements with the cytosolic BRET sensor CAMYEL in HEK293 cells. With these sensors we observed a slightly higher cAMP response to adenylyl cyclase activation at the plasma membrane compared to the cytosol, which is in accordance with earlier results from Fluorescence Resonance Energy Transfer (FRET) sensors. We have analyzed PDE activity in fractionated lysates from HEK293 cells using selective PDE inhibitors and have identified PDE3 and PDE10A as the major membrane-bound PDEs and PDE4 as the major cytosolic PDE. Inhibition of membrane-bound or cytosolic PDEs can potentiate the cAMP response to adenylyl cyclase activation, but we see no significant difference between the potentiation of the cAMP response at the plasma membrane and in cytosol when membrane-bound and cytosolic PDEs are inhibited. When different levels of stimulation were tested, we found that PDEs 3 and 10 are mainly responsible for cAMP degradation at low intracellular cAMP concentrations, whereas PDE4 is more important for control of cAMP at higher concentrations. PMID:21931705

  8. cAMP-mediated and metabolic amplification of insulin secretion are distinct pathways sharing independence of β-cell microfilaments.

    PubMed

    Mourad, Nizar I; Nenquin, Myriam; Henquin, Jean-Claude

    2012-10-01

    Insulin secretion is triggered by an increase in the cytosolic calcium concentration ([Ca(2+)](c)) in β-cells. Ca(2+)-induced exocytosis of insulin granules can be augmented by metabolic amplification (unknown signals generated through glucose metabolism) or neurohormonal amplification (in particular cAMP mediated). Functional actin microfilaments are not required for metabolic amplification, but their possible role in cAMP-mediated amplification is unknown. It is also uncertain whether cAMP (generated in response to glucose) is implicated in metabolic amplification. These questions were addressed using isolated mouse islets. cAMP levels were increased by phosphodiesterase inhibition (with isobutylmethylxanthine) and adenylate-cyclase stimulation (with forskolin or glucagon-like peptide-1, 7-36 amide). Raising cAMP levels had no steady-state impact on actin polymerization in control islets. Neither disruption (depolymerization by latrunculin) nor stabilization (polymerization by jasplakinolide) of actin microfilaments was counteracted by cAMP. Both changes increased both phases of glucose- or tolbutamide-induced insulin secretion but did not prevent further amplification by cAMP. These large changes in secretion were not caused by changes in [Ca(2+)](c), which was only slightly increased by cAMP. Both phases of insulin secretion were larger in response to glucose than tolbutamide, although [Ca(2+)](c) was lower. This difference in secretion, which reflects metabolic amplification, was independent of microfilaments, was not attributable to differences in cAMP, and persisted in presence of dibutyryl-cAMP or when cAMP levels were variably raised by isobutylmethylxanthine + forskolin or glucagon-like peptide-1, 7-36 amide. We conclude that metabolic and cAMP-mediated amplification of insulin secretion are distinct pathways that accelerate acquisition of release competence by insulin granules that can access exocytotic sites without intervention of microfilaments.

  9. Role of Rac 1 and cAMP in endothelial barrier stabilization and thrombin-induced barrier breakdown.

    PubMed

    Baumer, Y; Spindler, V; Werthmann, R C; Bünemann, M; Waschke, J

    2009-09-01

    Barrier stabilizing effects of cAMP as well as of the small GTPase Rac 1 are well established. Moreover, it is generally believed that permeability-increasing mediators such as thrombin disrupt endothelial barrier functions primarily via activation of Rho A. In this study, we provide evidence that decrease of both cAMP levels and of Rac 1 activity contribute to thrombin-mediated barrier breakdown. Treatment of human dermal microvascular endothelial cells (HDMEC) with Rac 1-inhibitor NSC-23766 decreased transendothelial electrical resistance (TER) and caused intercellular gap formation. These effects were reversed by addition of forskolin/rolipram (F/R) to increase intracellular cAMP but not by the cAMP analogue 8-pCPT-2'-O-Methyl-cAMP (O-Me-cAMP) which primarily stimulates protein kinase A (PKA)-independent signaling via Epac/Rap 1. However, both F/R and O-Me-cAMP did not increase TER above control levels in the presence of NSC-23766 in contrast to experiments without Rac 1 inhibition. Because Rac 1 was required for maintenance of barrier functions as well as for cAMP-mediated barrier stabilization, we tested the role of Rac 1 and cAMP in thrombin-induced barrier breakdown. Thrombin-induced drop of TER and intercellular gap formation were paralleled by a rapid decrease of cAMP as revealed by fluorescence resonance energy transfer (FRET). The efficacy of F/R or O-Me-cAMP to block barrier-destabilizing effects of thrombin was comparable to Y27632-induced inhibition of Rho kinase but was blunted when Rac 1 was inactivated by NSC-23766. Taken together, these data indicate that decrease of cAMP and Rac 1 activity may be an important step in inflammatory barrier disruption.

  10. Characterization of chromosomal qnrB and ampC alleles in Citrobacter freundii isolates from different origins.

    PubMed

    Liao, Xiaoping; Fang, Liangxing; Li, Liang; Sun, Jian; Li, Xingping; Chen, Muya; Deng, Hui; Yang, Qiu'e; Li, Xue; Liu, Yahong

    2015-10-01

    The association of ESBLs (extended-spectrum beta-lactamases)/pAmpCs (plasmid-mediated AmpC β-lactamases) with PMQR (plasmid mediated quinolone resistance) in gram-negative bacteria has been of great concern. The present study was performed to characterize the diversity, gene location, genetic context, and evolution of ampC and qnrB alleles in isolates of Citrobacter freundii. Fifteen isolates of C. freundii were identified from a total of 788 isolates of Enterobacteriaceae derived from humans, animals, animal food products, and the environment between 2010 and 2012. Co-existence of qnrB/ΔqnrB with ampC was detected in all C. freundii isolates. Both ampC and qnrB genes were found to be located on the chromosome, but were distantly separated on the chromosome. Seven and six novel alleles were discovered for the 10 ampC and qnrB variants detected in this study, respectively. Phylogenetic analysis showed that the new alleles differed a little from the variants of ampC/qnrB previously described in this genus. The genetic context surrounding ampC genes was AmpR-AmpC-Blc-SugE. However, five different genetic contexts surrounding qnrB/ΔqnrB genes were observed, but they occurred in all cases between the pspF and sapA genes. Additionally, cloning experiments showed that the regions containing different qnrB alleles, even with different genetic contexts, contributed to the reduction of quinolone susceptibility. Our results showed that the chromosomal ampC and qnrB alleles are closely related to C. freundii. However, unlike ampC, qnrB alleles seemed to be related to the genetic contexts surrounding them. The evolution of these two genes in C. freundii isolates might be through different pathways.

  11. Effect of cholera toxin on cAMP levels and Na/sup +/ influx in isolated intestinal epithelial cells

    SciTech Connect

    Hyun, C.S.; Kimmich, G.A.

    1982-09-01

    Freshly isolated chicken intestinal cells contain approximately 20 pmol adenosine 3',5'-cyclic monophosphate (cAMP)/mg cellular protein. Incubation with 3 ..mu..g/ml cholera toxin (CT) at 37/sup 0/C induces an elevation of cellular cAMP beginning 10-15 min after initial exposure. The response is linear with time for 40-50 min and causes a six- to eightfold increase over control levels at steady state. Dibutyryl cAMP and agents that increase cAMP production inhibit Na/sup +/ influx into the isolated enterocytes. Chlorpromazine completely abolishes the toxin-induced elevation of cAMP in the isolated cells and also reverses the effect on Na/sup +/ entry. The data provide evidence for a cAMP-mediated control of intestinal cell Na/sup +/ uptake, which may represent the mechanistic basis for the antiabsorptive effect of CT on Na/sup +/ during induction of intestinal secretory activity. Studies on the time-dependent effects of chlorpromazine on both intracellular cAMP concentration and Na/sup +/ influx suggest that the reactivation of the Na/sup +/ transport system after cAMP-induced inhibition is slow relative to the disappearance of cAMP.

  12. The interplay between cyclic AMP, MAPK, and NF-κB pathways in response to proinflammatory signals in microglia.

    PubMed

    Ghosh, Mousumi; Aguirre, Vladimir; Wai, Khine; Felfly, Hady; Dietrich, W Dalton; Pearse, Damien D

    2015-01-01

    Cyclic AMP is an important intracellular regulator of microglial cell homeostasis and its negative perturbation through proinflammatory signaling results in microglial cell activation. Though cytokines, TNF-α and IL-1β, decrease intracellular cyclic AMP, the mechanism by which this occurs is poorly understood. The current study examined which signaling pathways are responsible for decreasing cyclic AMP in microglia following TNF-α stimulation and sought to identify the role cyclic AMP plays in regulating these pathways. In EOC2 microglia, TNF-α produced a dramatic reduction in cyclic AMP and increased cyclic AMP-dependent PDE activity that could be antagonized by Rolipram, myristoylated-PKI, PD98059, or JSH-23, implicating a role for PDE4, PKA, MEK, and NF-κB in this regulation. Following TNF-α there were significant increases in iNOS and COX-2 immunoreactivity, phosphorylated ERK1/2 and NF-κB-p65, IκB degradation, and NF-κB p65 nuclear translocation, which were reduced in the presence of high levels of cyclic AMP, indicating that reductions in cyclic AMP during cytokine stimulation are important for removing its inhibitory action on NF-κB activation and subsequent proinflammatory gene expression. Further elucidation of the signaling crosstalk involved in decreasing cyclic AMP in response to inflammatory signals may provide novel therapeutic targets for modulating microglial cell activation during neurological injury and disease. PMID:25722974

  13. Advanced Pacemaker

    NASA Technical Reports Server (NTRS)

    1990-01-01

    Synchrony, developed by St. Jude Medical's Cardiac Rhythm Management Division (formerly known as Pacesetter Systems, Inc.) is an advanced state-of-the-art implantable pacemaker that closely matches the natural rhythm of the heart. The companion element of the Synchrony Pacemaker System is the Programmer Analyzer APS-II which allows a doctor to reprogram and fine tune the pacemaker to each user's special requirements without surgery. The two-way communications capability that allows the physician to instruct and query the pacemaker is accomplished by bidirectional telemetry. APS-II features 28 pacing functions and thousands of programming combinations to accommodate diverse lifestyles. Microprocessor unit also records and stores pertinent patient data up to a year.

  14. Effects of ethanol on cAMP production in murine embryonic palate mesenchymal cells

    SciTech Connect

    Weston, W.M.; Greene, R.M. )

    1991-01-01

    Ethanol affected the ability of murine embryonic palate mesenchymal (MEPM) cells to produce cAMP in response to hormone treatment. Acute exposure to ethanol resulted in an increase in hormone-stimulated cAMP levels, while chronic ethanol treatment led to decreased sensitivity to hormone. Forskolin-stimulated cAMP levels were decreased by both acute and chronic ethanol treatment, while the cells' response to cholera toxin was unchanged by ethanol treatment. The lack of sensitivity of the cholera toxin response to ethanol suggests that,in contrast to what has been observed in other systems, ethanol does not affect the production or activity of G{alpha}s in MEPM cells. These results suggest a possible explanation for the molecular basis for the craniofacial abnormalities observed in the fetal alcohol syndrome.

  15. Involvement of the second messenger cAMP in gravity-signal transduction in physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Rabien, H.; Ivanova, K.

    The aim of the investigation was to clarify, whether cellular signal processing following graviperception involves second messenger pathways. The test object was a most gravisensitive free-living ameboid cell, the myxomycete (acellular slime mold) Physarum polycephalum. It was demonstrated that the motor response is related to acceleration-dependent changes in the levels of the cellular second messenger cyclic adenosine monophosphate (cAMP). Rotating Physarum plasmodia in the gravity field of the Earth about a horizontal axis increased their cAMP concentration. Depriving the cells for a few days of the acceleration stimulus (near weightlessness in a space experiment on STS-69) slightly lowered plasmodial cAMP levels. Thus, the results provide first indications that the acceleration-stimulus signal transduction chain of Physarum uses an ubiquitous second messenger pathway.

  16. Improved Synthesis of Biotinol-5′-AMP: Implications for Antibacterial Discovery

    PubMed Central

    2014-01-01

    An improved synthesis of biotinol-5′-AMP, an acyl-AMP mimic of the natural reaction intermediate of biotin protein ligase (BPL), is reported. This compound was shown to be a pan inhibitor of BPLs from a series of clinically important bacteria, particularly Staphylococcus aureus and Mycobacterium tuberculosis, and kinetic analysis revealed it to be competitive against the substrate biotin. Biotinol-5′-AMP also exhibits antibacterial activity against a panel of clinical isolates of S. aureus and M. tuberculosis with MIC values of 1–8 and 0.5–2.5 μg/mL, respectively, while being devoid of cytotoxicity to human HepG2 cells. PMID:25699152

  17. Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection

    PubMed Central

    Hurt, K. Joseph; Sezen, Sena F.; Lagoda, Gwen F.; Musicki, Biljana; Rameau, Gerald A.; Snyder, Solomon H.; Burnett, Arthur L.

    2012-01-01

    Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor l-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction. PMID:23012472

  18. Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

    NASA Astrophysics Data System (ADS)

    Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

    1996-06-01

    cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

  19. Effect of leaving group on the oligomerization of 5'-AMP on montmorillonite. [Abstract only

    NASA Technical Reports Server (NTRS)

    Prabahar, K. Joseph; Ferris, James P.

    1994-01-01

    The oligomerization of imidazole derivative of 5'-AMP (ImpA) in the presence of montmorillonite clay yields oligomers containing up to 10 monomer units. In these reactions, the heterocyclic base, imidazole is the leaving group. In our present study, we synthesized a series of activated nucleotides of 5'AMP using other leaving groups such as pyrazole, 1,2,4-triazole, piperidine, morpholine, 4-aminopyridine, 4-methylaminopyridine, 4-dimethylaminopyridine, 2-aminobenzimidazole etc. to determine the effect of amine leaving group on the products of the oligomerization reaction. Earlier results from our laboratory showed that the presence AppA in the clay reaction of ImpA enhances the oligomerization reaction to yield higher oligomers. We also studied the effect of AppA in the clay mediated oligomerization reaction of the activated nucleotides. Oligomerization of 2-amino-benzimidazole derivative of 5'-AMP gave higher oligomers containing up to nine monomer units in the presence of AppA.

  20. Modulation of adhesion-dependent cAMP signaling by echistatin and alendronate

    NASA Technical Reports Server (NTRS)

    Fong, J. H.; Ingber, D. E.

    1996-01-01

    We measured intracellular cAMP levels in cells during attachment and spreading on different extracellular matrix (ECM) proteins. Increases in cAMP were observed within minutes when cells attached to fibronectin, vitronectin, and a synthetic RGD-containing fibronectin peptide (Petite 2000), but not when they adhered to another integrin alpha nu beta 3 ligand, echistatin. Because echistatin also inhibits bone resorption, we measured the effects of adding another osteoporosis inhibitor, alendronate, in this system. Alendronate inhibited the cAMP increase induced by ligands that primarily utilize integrin alpha nu beta 3 (vitronectin, Peptite 2000), but not by fibronectin which can also use integrin alpha 5 beta 1. These results show that cell adhesion to ECM can increase intracellular cAPM levels and raise the possibility that inhibitors of osteoporosis may act, in part, by preventing activation of this pathway by integrins.

  1. Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection.

    PubMed

    Hurt, K Joseph; Sezen, Sena F; Lagoda, Gwen F; Musicki, Biljana; Rameau, Gerald A; Snyder, Solomon H; Burnett, Arthur L

    2012-10-01

    Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor L-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction.

  2. The cyclic AMP signaling pathway: Exploring targets for successful drug discovery (Review)

    PubMed Central

    YAN, KUO; GAO, LI-NA; CUI, YUAN-LU; ZHANG, YI; ZHOU, XIN

    2016-01-01

    During development of disease, complex intracellular signaling pathways regulate an intricate series of events, including resistance to external toxins, the secretion of cytokines and the production of pathological phenomena. Adenosine 3′,5′-cyclic monophosphate (cAMP) is a nucleotide that acts as a key second messenger in numerous signal transduction pathways. cAMP regulates various cellular functions, including cell growth and differentiation, gene transcription and protein expression. This review aimed to provide an understanding of the effects of the cAMP signaling pathway and the associated factors on disease occurrence and development by examining the information from a new perspective. These novel insights aimed to promote the development of novel therapeutic approaches and aid in the development of new drugs. PMID:27035868

  3. Modeling and simulation challenges pursued by the Consortium for Advanced Simulation of Light Water Reactors (CASL)

    NASA Astrophysics Data System (ADS)

    Turinsky, Paul J.; Kothe, Douglas B.

    2016-05-01

    The Consortium for the Advanced Simulation of Light Water Reactors (CASL), the first Energy Innovation Hub of the Department of Energy, was established in 2010 with the goal of providing modeling and simulation (M&S) capabilities that support and accelerate the improvement of nuclear energy's economic competitiveness and the reduction of spent nuclear fuel volume per unit energy, and all while assuring nuclear safety. To accomplish this requires advances in M&S capabilities in radiation transport, thermal-hydraulics, fuel performance and corrosion chemistry. To focus CASL's R&D, industry challenge problems have been defined, which equate with long standing issues of the nuclear power industry that M&S can assist in addressing. To date CASL has developed a multi-physics "core simulator" based upon pin-resolved radiation transport and subchannel (within fuel assembly) thermal-hydraulics, capitalizing on the capabilities of high performance computing. CASL's fuel performance M&S capability can also be optionally integrated into the core simulator, yielding a coupled multi-physics capability with untapped predictive potential. Material models have been developed to enhance predictive capabilities of fuel clad creep and growth, along with deeper understanding of zirconium alloy clad oxidation and hydrogen pickup. Understanding of corrosion chemistry (e.g., CRUD formation) has evolved at all scales: micro, meso and macro. CFD R&D has focused on improvement in closure models for subcooled boiling and bubbly flow, and the formulation of robust numerical solution algorithms. For multiphysics integration, several iterative acceleration methods have been assessed, illuminating areas where further research is needed. Finally, uncertainty quantification and data assimilation techniques, based upon sampling approaches, have been made more feasible for practicing nuclear engineers via R&D on dimensional reduction and biased sampling. Industry adoption of CASL's evolving M

  4. Cyclic AMP synergizes with butyrate in promoting β-defensin 9 expression in chickens.

    PubMed

    Sunkara, Lakshmi T; Zeng, Xiangfang; Curtis, Amanda R; Zhang, Guolong

    2014-02-01

    Host defense peptides (HDP) have both microbicidal and immunomodulatory properties. Specific induction of endogenous HDP synthesis has emerged as a novel approach to antimicrobial therapy. Cyclic adenosine monophosphate (cAMP) and butyrate have been implicated in HDP induction in humans. However, the role of cAMP signaling and the possible interactions between cAMP and butyrate in regulating HDP expression in other species remain unknown. Here we report that activation of cAMP signaling induces HDP gene expression in chickens as exemplified by β-defensin 9 (AvBD9). We further showed that, albeit being weak inducers, cAMP agonists synergize strongly with butyrate or butyrate analogs in AvBD9 induction in macrophages and primary jejunal explants. Additionally, oral supplementation of forskolin, an adenylyl cyclase agonist in the form of a Coleus forskohlii extract, was found to induce AvBD9 expression in the crop of chickens. Furthermore, feeding with both forskolin and butyrate showed an obvious synergy in triggering AvBD9 expression in the crop and jejunum of chickens. Surprisingly, inhibition of the MEK-ERK mitogen-activated protein kinase (MAPK) pathway augmented the butyrate-FSK synergy, whereas blocking JNK or p38 MAPK pathway significantly diminished AvBD9 induction in chicken macrophages and jejunal explants in response to butyrate and FSK individually or in combination. Collectively, these results suggest the potential for concomitant use of butyrate and cAMP signaling activators in enhancing HDP expression, innate immunity, and disease resistance in both animals and humans.

  5. A CaMKII/PDE4D negative feedback regulates cAMP signaling

    PubMed Central

    Mika, Delphine; Richter, Wito; Conti, Marco

    2015-01-01

    cAMP production and protein kinase A (PKA) are the most widely studied steps in β-adrenergic receptor (βAR) signaling in the heart; however, the multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII) is also activated in response to βAR stimulation and is involved in the regulation of cardiac excitation-contraction coupling. Its activity and expression are increased during cardiac hypertrophy, in heart failure, and under conditions that promote arrhythmias both in animal models and in the human heart, underscoring the clinical relevance of CaMKII in cardiac pathophysiology. Both CaMKII and PKA phosphorylate a number of protein targets critical for Ca2+ handling and contraction with similar, but not always identical, functional consequences. How these two pathways communicate with each other remains incompletely understood, however. To maintain homeostasis, cyclic nucleotide levels are regulated by phosphodiesterases (PDEs), with PDE4s predominantly responsible for cAMP degradation in the rodent heart. Here we have reassessed the interaction between cAMP/PKA and Ca2+/CaMKII signaling. We demonstrate that CaMKII activity constrains basal and βAR-activated cAMP levels. Moreover, we show that these effects are mediated, at least in part, by CaMKII regulation of PDE4D. This regulation establishes a negative feedback loop necessary to maintain cAMP/CaMKII homeostasis, revealing a previously unidentified function for PDE4D as a critical integrator of cAMP/PKA and Ca2+/CaMKII signaling. PMID:25646485

  6. Xanthine effects on renal proximal tubular function and cyclic AMP metabolism.

    PubMed

    Coulson, R; Scheinman, S J

    1989-02-01

    We evaluated the renal effects of xanthines using two in vitro models: the isolated perfused rat kidney (IPRK) and cultured opossum kidney (OK) cells, a continuous cell line that resembles proximal tubule and responds to parathyroid hormone (PTH). 1,3-Diethyl-8-phenylxanthine (DPX) a potent adenosine receptor antagonist, increased urine volume, glomerular filtration rate, vascular resistance and the fractional excretions of Na, K, Ca and Pi in the IPRK. DPX lowered the Na-dependent uptake of Pi by OK cells. By comparison enprofylline, 3-propylxanthine (ENP), a weak adenosine receptor antagonist, produced a slight elevation in glomerular filtration rate but no changes in electrolyte excretion by IPRK or Pi uptake by OK cells. Both DPX and ENP produced negligible elevations in basal IPRK cAMP. A 1-nM bolus of PTH elevated urinary and perfusate cAMP 50- and 10-fold, respectively. PTH-elevated urinary and perfusate cAMP were augmented further 4- to 7-fold with DPX and 3- to 4-fold with ENP (All IPRK experiments used 50 microM xanthine). OK cells produced a 2-fold cAMP response to 10 nM PTH alone. OK cells treated with 50 microM DPX exhibited no increase in basal but a 13-fold increase in PTH-stimulated cell cAMP. The rank order of potency at 50 microM to augment OK cell cAMP with 10 nM PTH was DPX greater than 1,3-dipropyl-8-cyclopentylxanthine (DPC) greater than 1-methyl-3-isobutylxanthine greater than theobromine greater than theophylline greater than caffeine greater than ENP = no effect.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2537403

  7. Cyclic AMP-dependent protein phosphorylation in isolated neuronal growth cones from developing rat forebrain.

    PubMed

    Lockerbie, R O; Eddé, B; Prochiantz, A

    1989-03-01

    We have shown recently that neuronal growth cones isolated from developing rat forebrain possess an appreciable activity of adenylate cyclase, which produces cyclic AMP and can be stimulated by various neurotransmitter receptor agonists and by forskolin. To investigate cyclic AMP-mediated biochemical mechanisms in isolated growth cones, we have centered the present study on cyclic AMP-dependent protein phosphorylation. One-dimensional gel electrophoretic analysis showed that cyclic AMP analogs increased incorporation of 32P into several phosphoproteins in molecular mass ranges of 50-58 and 76-82 kilodaltons, including those of 82, 76, and 51 kilodaltons. Two-dimensional electrophoresis, using isoelectric focusing in the first dimension, resolved phosphorylated alpha- and beta-tubulin species, actin, a very acidic protein (isoelectric point 4.0) with a molecular mass of 93 kilodaltons, and two proteins (x and x') closely neighboring beta-tubulin. Two other phosphoproteins seen in the gels had molecular masses of 56 and 51 kilodaltons (respective isoelectric points, 4.5 and 4.4) and, along with the 93-kilodalton phosphoprotein, were highly enriched in the isolated growth cones. Only the tubulin and actin species were major proteins in the isolated growth cones. Cyclic AMP analogs enhanced incorporation of 32P into phosphoproteins x and x', and, as assessed by immunoprecipitation, into beta-tubulin. Peptide digest experiments suggested that phosphoproteins x and x' are unrelated to beta-tubulin. Nonequilibrium two-dimensional electrophoresis resolved many phosphoproteins, of which a 79- and 75-kilodalton doublet, a 74-kilodalton species, and a 58-kilodalton doublet showed enhanced incorporation of 32P in the presence of cyclic AMP.

  8. Structural Basis for the cAMP-dependent Gating in the Human HCN4 Channel

    SciTech Connect

    X Xu; Z Vysotskaya; Q Liu; L Zhou

    2011-12-31

    Hyperpolarization-activated cAMP-regulated (HCN) channels play important physiological roles in both cardiovascular and central nervous systems. Among the four HCN isoforms, HCN2 and HCN4 show high expression levels in the human heart, with HCN4 being the major cardiac isoform. The previously published crystal structure of the mouse HCN2 (mHCN2) C-terminal fragment, including the C-linker and the cyclic-nucleotide binding domain (CNBD), has provided many insights into cAMP-dependent gating in HCN channels. However, structures of other mammalian HCN channel isoforms have been lacking. Here we used a combination of approaches including structural biology, biochemistry, and electrophysiology to study cAMP-dependent gating in HCN4 channel. First we solved the crystal structure of the C-terminal fragment of human HCN4 (hHCN4) channel at 2.4 {angstrom}. Overall we observed a high similarity between mHCN2 and hHCN4 crystal structures. Functional comparison between two isoforms revealed that compared with mHCN2, the hHCN4 protein exhibited marked different contributions to channel function, such as a {approx}3-fold reduction in the response to cAMP. Guided by structural differences in the loop region between {beta}4 and {beta}5 strands, we identified residues that could partially account for the differences in response to cAMP between mHCN2 and hHCN4 proteins. Moreover, upon cAMP binding, the hHCN4 C-terminal protein exerts a much prolonged effect in channel deactivation that could have significant physiological contributions.

  9. Cyclic AMP-receptor proteins in heart muscle of rats flown on Cosmos 1887.

    PubMed

    Mednieks, M I; Popova, I A; Grindeland, R E

    1991-10-01

    A frequent cellular response to organismal stress is the increase in ligand binding by beta-adrenergic receptors. The extracellular signal is amplified by intracellular increases in cyclic AMP and the ensuing activation of cyclic AMP-dependent protein kinase (cAPK). The molecular mechanisms involve the binding of cyclic AMP to regulatory (R) subunits of cAPK, thus freeing the catalytic subunit for protein phosphorylation. This study was carried out to determine the cellular compartmentalization of the cyclic AMP-receptor proteins in heart ventricular tissue obtained from rats flown on the Cosmos 1887 mission. Photoaffinity labeling of soluble and particulate cell fractions with an [32P]-8-azido analog of cyclic AMP was followed by electrophoretic separation of the proteins and by autoradiographic identification of the labeled isoforms of cAPK R subunits. The results showed that RII in the particulate subcellular fraction was significantly decreased in heart cells from rats in the flight group when compared to controls. Protein banding patterns in both the cytoplasmic fraction and in a fraction enriched in chromatin-bound proteins showed some variability in tissues of individual animals, but exhibited no changes that could be directly attributed to flight conditions. No significant change was apparent in the distribution of RI or RII cyclic AMP binding in the soluble fractions. These findings indicate that the cardiac cell integrity or its protein content is not compromised under flight conditions. There is, however, what appears to be an adaptive molecular response which can be detected using microanalytical methods, indicating that a major hormone regulated mechanism may be affected during some phase of travel in space.

  10. -Adrenergic receptors on rat ventricular myocytes: characteristics and linkage to cAMP metabolism

    SciTech Connect

    Buxton, I.L.O.; Brunton, L.L.

    1986-08-01

    When incubated with purified cardiomyocytes from adult rat ventricle, the 1-antagonist (TH)prazosin binds to a single class of sites with high affinity. Competition for (TH)prazosin binding by the 2-selective antagonist yohimbine and the nonselective -antagonist phentolamine demonstrates that these receptors are of the 1-subtype. In addition, incubation of myocyte membranes with (TH)yohimbine results in no measurable specific binding. Agonist competition for (TH)prazosin binding to membranes prepared from purified myocytes demonstrates the presence of two components of binding: 28% of 1-receptors interact with norepinephrine with high affinity (K/sub D/ = 36 nM), whereas the majority of receptors (72%) have a low affinity for agonist (K/sub D/ = 2.2 M). After addition of 10 M GTP, norepinephrine competes for (TH)prazosin binding to a single class of sites with lower affinity (K/sub D/ = 2.2 M). Incubation of intact myocytes for 2 min with 1 M norepinephrine leads to significantly less cyclic AMP (cAMP) accumulation than stimulation with either norepinephrine plus prazosin or isoproterenol. Likewise, incubation of intact myocytes with 10 W M norepinephrine leads to significantly less activation of cAMP-dependent protein kinase than when myocytes are stimulated by both norepinephrine and the 1-adrenergic antagonist, prazosin or the US -adrenergic agonist, isoproterenol. They conclude that the cardiomyocyte 1 receptor is coupled to a guanine nucleotide-binding protein, that 1-receptors are functionally linked to decreased intracellular cAMP content, and that this change in cellular cAMP is expressed as described activation of cAMP-dependent protein kinase.

  11. Cyclic AMP-mediated endocytosis of intestinal epithelial NHE3 requires binding to synaptotagmin 1

    PubMed Central

    Musch, Mark W.; Arvans, Donna L.; Wang, Yunwei; Nakagawa, Yasushi; Solomaha, Elena

    2010-01-01

    The apical membrane Na+-H+ exchanger (NHE)3 is regulated by cAMP-dependent phosphorylation, which inhibits its activity through membrane endocytosis. The clathrin complex adaptor protein synaptotagmin 1 (Syt 1) appears to be essential to this process, but little is known about its expression in intestinal epithelial cells or interaction with NHE3. The intestinal epithelial expression and apical location of Syt 1 were determined by Syt 1 mRNA profiling and immunolocalization. Tandem mass spectrometry was used for protein identification. Bis(sulfosuccinimidyl) suberate (BS3) cross linking suggested that NHE3 and Syt 1 were in a membrane complex following cAMP stimulation of Caco2BBE (Brush Border Expressions) cells. To investigate the regulation of NHE3 appearance in a Syt 1-containing membrane compartment, doxycycline-inducible hemaglutinin (HA)-tagged NHE3 was expressed in Caco2BBE cells. HA-NHE3 correctly targeted to the apical membrane, where, upon cAMP stimulation, it was internalized with a Syt 1-containing compartment. Site-directed mutagenesis of NHE3 showed that serine 605 (S605) was pivotal to NHE3 and Syt 1 association and internalization. Direct Syt 1 interaction with NHE3 was suggested by fluorescence resonance energy transfer (FRET) analysis. The physiological role of S552 was less clear. By FRET, this serine residue appeared to be involved in cAMP-induced Syt 1 binding of NHE3. However, when HA-tagged NHE3 S552A was expressed in Caco2 cells, the mutated construct was not inserted into the apical membrane. We conclude that intestinal epithelial Syt 1 plays an important role in cAMP-stimulated endocytosis of apical NHE3 through cAMP-dependent phosphorylation of S605 that is required for NHE3 and Syt 1 association. PMID:19926819

  12. Isolation of novel ribozymes that ligate AMP-activated RNA substrates

    NASA Technical Reports Server (NTRS)

    Hager, A. J.; Szostak, J. W.

    1997-01-01

    BACKGROUND: The protein enzymes RNA ligase and DNA ligase catalyze the ligation of nucleic acids via an adenosine-5'-5'-pyrophosphate 'capped' RNA or DNA intermediate. The activation of nucleic acid substrates by adenosine 5'-monophosphate (AMP) may be a vestige of 'RNA world' catalysis. AMP-activated ligation seems ideally suited for catalysis by ribozymes (RNA enzymes), because an RNA motif capable of tightly and specifically binding AMP has previously been isolated. RESULTS: We used in vitro selection and directed evolution to explore the ability of ribozymes to catalyze the template-directed ligation of AMP-activated RNAs. We subjected a pool of 10(15) RNA molecules, each consisting of long random sequences flanking a mutagenized adenosine triphosphate (ATP) aptamer, to ten rounds of in vitro selection, including three rounds involving mutagenic polymerase chain reaction. Selection was for the ligation of an oligonucleotide to the 5'-capped active pool RNA species. Many different ligase ribozymes were isolated; these ribozymes had rates of reaction up to 0.4 ligations per hour, corresponding to rate accelerations of approximately 5 x10(5) over the templated, but otherwise uncatalyzed, background reaction rate. Three characterized ribozymes catalyzed the formation of 3'-5'-phosphodiester bonds and were highly specific for activation by AMP at the ligation site. CONCLUSIONS: The existence of a new class of ligase ribozymes is consistent with the hypothesis that the unusual mechanism of the biological ligases resulted from a conservation of mechanism during an evolutionary replacement of a primordial ribozyme ligase by a more modern protein enzyme. The newly isolated ligase ribozymes may also provide a starting point for the isolation of ribozymes that catalyze the polymerization of AMP-activated oligonucleotides or mononucleotides, which might have been the prebiotic analogs of nucleoside triphosphates.

  13. Regulation of chloride self exchange by cAMP in cortical collecting tubule

    SciTech Connect

    Tago, K.; Schuster, V.L.; Stokes, J.B.

    1986-07-01

    The hormonal control of Cl transport was examined in rabbit cortical collecting tubules using the lumen-to-bath /sup 36/Cl tracer rate coefficient (K/sub Cl/, nm/s). Tracer movement via Sl-HCO/sub 3/ exchange was minimized by using HCO/sub 3/-CO/sub 2/-free solutions. The electrical driving force was minimized by treating with amiloride. Under these conditions, net Cl transport was zero, yet there was a large K/sub Cl/ that fell 88% on removing bath (trans) Cl. These results are consistent with the mechanism of tracer flux being predominantly Cl self exchange. K/sub Cl/ fell spontaneously with time in vitro; after this decline K/sub Cl/ could be stimulated with 8-bromo-cAMP. cAMP present from the onset of perfusion prevented the time-dependent fall in K/sub Cl/. When tracer movement was restricted to diffusion by eliminating Cl self exchange (0 Cl bath), cAMP had no effect on K/sub Cl/. Although both isoproterenol and vasopressin are known to stimulate adenylate cyclase in this epithelium, only isoproterenol mimicked the cAMP effect on K/sub Cl/. The isoproterenol effect was blocked by either propranolol or prostaglandin E/sub 2/. Lumen addition of the disulfonic stilbene DIDS had no effect on K/sub Cl/. Lumen addition of furosemide or trichloromethiazide had minimal or no effect. Taken together, these results indicate that Cl self exchange is regulated by ..beta..-adrenergic agents acting via cAMP. The lack of an effect of vasopressin suggests cellular heterogeneity in this response to cAMP.

  14. Alterations of cAMP-dependent signaling in dystrophic skeletal muscle

    PubMed Central

    Rudolf, Rüdiger; Khan, Muzamil M.; Lustrino, Danilo; Labeit, Siegfried; Kettelhut, Ísis C.; Navegantes, Luiz C. C.

    2013-01-01

    Autonomic regulation processes in striated muscles are largely mediated by cAMP/PKA-signaling. In order to achieve specificity of signaling its spatial-temporal compartmentation plays a critical role. We discuss here how specificity of cAMP/PKA-signaling can be achieved in skeletal muscle by spatio-temporal compartmentation. While a microdomain containing PKA type I in the region of the neuromuscular junction (NMJ) is important for postsynaptic, activity-dependent stabilization of the nicotinic acetylcholine receptor (AChR), PKA type I and II microdomains in the sarcomeric part of skeletal muscle are likely to play different roles, including the regulation of muscle homeostasis. These microdomains are due to specific A-kinase anchoring proteins, like rapsyn and myospryn. Importantly, recent evidence indicates that compartmentation of the cAMP/PKA-dependent signaling pathway and pharmacological activation of cAMP production are aberrant in different skeletal muscles disorders. Thus, we discuss here their potential as targets for palliative treatment of certain forms of dystrophy and myasthenia. Under physiological conditions, the neuropeptide, α-calcitonin-related peptide, as well as catecholamines are the most-mentioned natural triggers for activating cAMP/PKA signaling in skeletal muscle. While the precise domains and functions of these first messengers are still under investigation, agonists of β2-adrenoceptors clearly exhibit anabolic activity under normal conditions and reduce protein degradation during atrophic periods. Past and recent studies suggest direct sympathetic innervation of skeletal muscle fibers. In summary, the organization and roles of cAMP-dependent signaling in skeletal muscle are increasingly understood, revealing crucial functions in processes like nerve-muscle interaction and muscle trophicity. PMID:24146652

  15. Chromosomally Encoded AmpC-Type β-Lactamase in a Clinical Isolate of Proteus mirabilis

    PubMed Central

    Bret, L.; Chanal-Claris, C.; Sirot, D.; Chaibi, E. B.; Labia, R.; Sirot, J.

    1998-01-01

    A clinical strain of Proteus mirabilis (CF09) isolated from urine specimens of a patient displayed resistance to amoxicillin (MIC >4,096 μg/ml), ticarcillin (4,096 μg/ml), cefoxitin (64 μg/ml), cefotaxime (256 μg/ml), and ceftazidime (128 μg/ml) and required an elevated MIC of aztreonam (4 μg/ml). Clavulanic acid did not act synergistically with cephalosporins. Two β-lactamases with apparent pIs of 5.6 and 9.0 were identified by isoelectric focusing on a gel. Substrate and inhibition profiles were characteristic of an AmpC-type β-lactamase with a pI of 9.0. Amplification by PCR with primers for ampC genes (Escherichia coli, Enterobacter cloacae, and Citrobacter freundii) of a 756-bp DNA fragment from strain CF09 was obtained only with C. freundii-specific primers. Hybridization results showed that the ampC gene is only chromosomally located while the TEM gene is plasmid located. After cloning of the gene, analysis of the complete nucleotide sequence (1,146 bp) showed that this ampC gene is close to blaCMY-2, from which it differs by three point mutations leading to amino acid substitutions Glu → Gly at position 22, Trp → Arg at position 201, and Ser → Asn at position 343. AmpC β-lactamases derived from that of C. freundii (LAT-1, LAT-2, BIL-1, and CMY-2) have been found in Klebsiella pneumoniae, E. coli, and Enterobacter aerogenes and have been reported to be plasmid borne. This is the first example of a chromosomally encoded AmpC-type β-lactamase observed in P. mirabilis. We suggest that it be designated CMY-3. PMID:9593136

  16. Cyclic AMP-receptor proteins in heart muscle of rats flown on Cosmos 1887.

    PubMed

    Mednieks, M I; Popova, I A; Grindeland, R E

    1991-10-01

    A frequent cellular response to organismal stress is the increase in ligand binding by beta-adrenergic receptors. The extracellular signal is amplified by intracellular increases in cyclic AMP and the ensuing activation of cyclic AMP-dependent protein kinase (cAPK). The molecular mechanisms involve the binding of cyclic AMP to regulatory (R) subunits of cAPK, thus freeing the catalytic subunit for protein phosphorylation. This study was carried out to determine the cellular compartmentalization of the cyclic AMP-receptor proteins in heart ventricular tissue obtained from rats flown on the Cosmos 1887 mission. Photoaffinity labeling of soluble and particulate cell fractions with an [32P]-8-azido analog of cyclic AMP was followed by electrophoretic separation of the proteins and by autoradiographic identification of the labeled isoforms of cAPK R subunits. The results showed that RII in the particulate subcellular fraction was significantly decreased in heart cells from rats in the flight group when compared to controls. Protein banding patterns in both the cytoplasmic fraction and in a fraction enriched in chromatin-bound proteins showed some variability in tissues of individual animals, but exhibited no changes that could be directly attributed to flight conditions. No significant change was apparent in the distribution of RI or RII cyclic AMP binding in the soluble fractions. These findings indicate that the cardiac cell integrity or its protein content is not compromised under flight conditions. There is, however, what appears to be an adaptive molecular response which can be detected using microanalytical methods, indicating that a major hormone regulated mechanism may be affected during some phase of travel in space. PMID:1662483

  17. Rolipram stimulates angiogenesis and attenuates neuronal apoptosis through the cAMP/cAMP-responsive element binding protein pathway following ischemic stroke in rats

    PubMed Central

    HU, SHOUYE; CAO, QINGWEN; XU, PENG; JI, WENCHEN; WANG, GANG; ZHANG, YUELIN

    2016-01-01

    Rolipram, a phosphodiesterase-4 inhibitor, can activate the cyclic adenosine monophosphate (cAMP)/cAMP-responsive element binding protein (CREB) pathway to facilitate functional recovery following ischemic stroke. However, to date, the effects of rolipram on angiogenesis and cerebral ischemia-induced neuronal apoptosis are yet to be fully elucidated. In this study, the aim was to reveal the effect of rolipram on the angiogenesis and neuronal apoptosis following brain cerebral ischemia. Rat models of ischemic stroke were established following transient middle cerebral artery occlusion and rolipram was administered for three, seven and 14 days. The results were examined using behavioral tests, triphenyl tetrazolium chloride staining, immunostaining and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) to evaluate the effects of rolipram therapy on functional outcome, angiogenesis and apoptosis. Western blot analysis was used to show the phosphorylated- (p-)CREB protein level in the ischemic hemisphere. The rolipram treatment group exhibited a marked reduction in infarct size and modified neurological severity score compared with the vehicle group, and rolipram treatment significantly promoted the microvessel density in the ischemic boundary region and increased p-CREB protein levels in the ischemic hemisphere. Furthermore, a significant reduction in the number of TUNEL-positive cells was observed in the rolipram group compared with the vehicle group. These findings suggest that rolipram has the ability to attenuate cerebral ischemic injury, stimulate angiogenesis and reduce neuronal apoptosis though the cAMP/CREB pathway. PMID:26998028

  18. Association of Novel Nonsynonymous Single Nucleotide Polymorphisms in ampD with Cephalosporin Resistance and Phylogenetic Variations in ampC, ampR, ompF, and ompC in Enterobacter cloacae Isolates That Are Highly Resistant to Carbapenems

    PubMed Central

    Ellington, Matthew J.; Hopkins, Katie L.; Turton, Jane F.; Doumith, Michel; Loy, Richard; Staves, Peter; Hinic, Vladimira; Frei, Reno; Woodford, Neil

    2016-01-01

    In Enterobacter cloacae, the genetic lesions associated with derepression of the AmpC β-lactamase include diverse single nucleotide polymorphisms (SNPs) and/or indels in the ampD and ampR genes and SNPs in ampC, while diverse SNPs in the promoter region or SNPs/indels within the coding sequence of outer membrane proteins have been described to alter porin production leading to carbapenem resistance. We sought to define the underlying mechanisms conferring cephalosporin and carbapenem resistance in a collection of E. cloacae isolates with unusually high carbapenem resistance and no known carbapenemase and, in contrast to many previous studies, considered the SNPs we detected in relation to the multilocus sequence type (MLST)-based phylogeny of our collection. Whole-genome sequencing was applied on the most resistant isolates to seek novel carbapenemases, expression of ampC was measured by reverse transcriptase PCR, and porin translation was detected by SDS-PAGE. SNPs occurring in ampC, ampR, ompF, and ompC genes (and their promoter regions) were mostly phylogenetic variations, relating to the isolates' sequence types, whereas nonsynonymous SNPs in ampD were associated with derepression of AmpC and cephalosporin resistance. The additional loss of porins resulted in high-level carbapenem resistance, underlining the clinical importance of chromosomal mutations among carbapenem-resistant E. cloacae. PMID:26856839

  19. Amp-hour counting charge control for photovoltaic hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-10-01

    An amp-hour counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based photovoltaic hybrid charge controller. This work included extensive laboratory and field testing of the charge algorithm on vented lead-antimony and valve regulated lead-acid batteries. The test results have shown that with proper setup amp-hour counting charge control is more effective than conventional voltage regulated sub-array shedding in returning the lead-acid battery to a high state of charge.

  20. YC-1 potentiates cAMP-induced CREB activation and nitric oxide production in alveolar macrophages

    SciTech Connect

    Hwang, Tsong-Long; Tang, Ming-Chi; Kuo, Liang-Mou; Chang, Wen-De; Chung, Pei-Jen; Chang, Ya-Wen; Fang, Yao-Ching

    2012-04-15

    Alveolar macrophages play significant roles in the pathogenesis of several inflammatory lung diseases. Increases in exhaled nitric oxide (NO) are well documented to reflect disease severity in the airway. In this study, we investigated the effect of 3-(5′-hydroxymethyl-2′-furyl)-1-benzyl indazole (YC-1), a known activator of soluble guanylyl cyclase, on prostaglandin (PG)E{sub 1} (a stable PGE{sub 2} analogue) and forskolin (a adenylate cyclase activator) induced NO production and inducible NO synthase (iNOS) expression in rat alveolar macrophages (NR8383). YC-1 did not directly cause NO production or iNOS expression, but drastically potentiated PGE{sub 1}- or forskolin-induced NO production and iNOS expression in NR8383 alveolar macrophages. Combination treatment with YC-1 and PGE{sub 1} significantly increased phosphorylation of the cAMP response element-binding protein (CREB), but not nuclear factor (NF)-κB activation. The combined effect on NO production, iNOS expression, and CREB phosphorylation was reversed by a protein kinase (PK)A inhibitor (H89), suggesting that the potentiating functions were mediated through a cAMP/PKA signaling pathway. Consistent with this, cAMP analogues, but not the cGMP analogue, caused NO release, iNOS expression, and CREB activation. YC-1 treatment induced an increase in PGE{sub 1}-induced cAMP formation, which occurred through the inhibition of cAMP-specific phosphodiesterase (PDE) activity. Furthermore, the combination of rolipram (an inhibitor of PDE4), but not milronone (an inhibitor of PDE3), and PGE{sub 1} also triggered NO production and iNOS expression. In summary, YC-1 potentiates PGE{sub 1}-induced NO production and iNOS expression in alveolar macrophages through inhibition of cAMP PDE activity and activation of the cAMP/PKA/CREB signaling pathway. Highlights: ► YC-1 potentiated PGE1-induced iNOS expression in alveolar macrophages. ► The combination of YC-1 and PGE1 increased CREB but not NFκB activation.

  1. Catalytic roles of the AMP at the 3' end of tRNAs

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1994-01-01

    Recent reports suggest that the ribosome retains considerable peptidyl transferase activity even when much of the protein of the ribosome is removed and further suggests that rRNA may be the peptidyl transferase. The work here suggests that the AMP residue at the 3' terminus of each tRNA has some catalytic activity both in the esterification reaction and in forming a pseudopeptide, AcGly, and further suggests that whatever peptidyl transferase is, it finds a cooperative substrate in the aminoacyl-AMP at the 3' terminus of tRNA.

  2. Inducible AmpC β-Lactamase of a New Member Enterobacteriaceae

    PubMed Central

    Bonnet, Richard; Chanal, Catherine; Ageron, Elisabeth; Sirot, Danielle; De Champs, Christophe; Grimont, Patrick; Sirot, Jacques

    2002-01-01

    Extensive biochemical testing and 16S rRNA and rpoB sequence analysis revealed that clinical strain CF01Ent1, initially identified as Buttiauxella agrestis by the use of Api 32 biochemical strips, is a new organism in the Enterobacteriaceae family. It produced an inducible AmpC-type β-lactamase whose sequence shares 69 to 72% identity with those of the other AmpC-type β-lactamases of Enterobacteriaceae. This enzyme exhibits an atypical high affinity for all β-lactams tested. PMID:12234870

  3. Biochemical and Molecular Characterization of Three New Variants of AmpC β-Lactamases from Morganella morganii

    PubMed Central

    Power, Pablo; Galleni, Moreno; Ayala, Juan A.; Gutkind, Gabriel

    2006-01-01

    Morganella morganii produces an inducible, chromosomally encoded AmpC β-lactamase. We describe in this study three new variants of AmpC within this species with apparent pIs of 6.6 (M19 from M. morganii strain PP19), 7.4 (M29 from M. morganii strain PP29), and 7.8 (M37 from M. morganii strain PP37). After gene sequencing, deduced amino acid sequences displayed one to six substitutions when compared to the available Morganella AmpC sequences. An AmpR-encoding gene was also found upstream of ampC, including the LysR regulators' helix-turn-helix DNA-binding domain and the putative T-N11-A-protected region in the ampR-ampC intercistronic sequence. All three AmpC variants were purified from in vitro-generated derepressed mutants and showed overall similar kinetic parameters. None of the observed amino acid changes, occurring at the surface of the protein, appear to have a major influence in their catalytic properties. Morganella AmpCs exhibit the highest catalytic efficiencies (kcat/Km) on classical penicillins, cefoxitin, narrow-spectrum cephalosporins, and cefotaxime. Cefotaxime was more effectively hydrolyzed than other oxyimino-cephalosporins, whereas cefepime was 3 log-fold less efficiently hydrolyzed than other cephalosporins such as cephalothin. Several differences with other AmpC β-lactamases were found. Ampicillin was more efficiently hydrolyzed than benzylpenicillin. High kcat/Km values were observed for oxacillin and piperacillin, which are usually poor substrates for AmpC. A fairly efficient hydrolysis of imipenem was detected as well. Aztreonam, carbenicillin, and tazobactam were effective transient inactivators of these variants. PMID:16495258

  4. Effects of cyclic AMP on growth and differentiation of rat retinoblastoma-like tumor cells in vitro.

    PubMed

    Nishida, T; Mukai, N; Solish, S P; Pomeroy, M

    1982-02-01

    We examined the effects of cyclic AMP (cAMP) on the growth and differentiation of RAO 188 cells, a cultured cell line derived from a retinoblastoma-like tumor induced in an inbred rat by intravitreous inoculation with human adenovirus serotype 12. After adding cAMP analogs (dibutyryl cAMP and 8-bromo cAMP) and phosphodiesterase inhibitors (theophylline, amino-phylline, and 1-methyl-3-isobutyl xanthine) to the RAO 188 cell culture medium, we measured changes in cell incorporation of the DNA and RNA precursors 14C-thymidine and 3H-uridine, and we observed the morphologic alterations of RAO 188 by phase-contrast and transmission and scanning electron microscopy. Incorporation of the labeled precursors decreased with increased concentrations of cAMP analogs and phosphodiesterase inhibitors. Incorporation of the labeled precursors was inhibited shortly after the addition of dibutyryl cAMP to the culture medium. The effect was maximal at 8 hr and was sustained for up to 48 hr. Reversibility of cAMP effects on incorporation gradually decreased for 10 days; at 10 days these effects were essentially irreversible. Neuritelike processes developed shortly after cAMP analog treatment and formed a network after 24 hr. Transmission electron microscopy disclosed changes in the cell membrane and cytoplasm of cells treated with 8-bromo cAMP and theophylline: perturbation of the cell membrane and the appearance of intercellular junctional devices and microfilaments. The activity of glutamate decarboxylase, which is involved in the biosynthesis of gamma-aminobutyric acid, was increased in treated cells. These results show that cAMP decreases DNA and RNA synthesis and cell proliferation and facilitates morphologic and biochemical differentiation of RAO 188 cells.

  5. An HD-domain phosphodiesterase mediates cooperative hydrolysis of c-di-AMP to affect bacterial growth and virulence

    PubMed Central

    Huynh, TuAnh Ngoc; Luo, Shukun; Pensinger, Daniel; Sauer, John-Demian; Tong, Liang; Woodward, Joshua J.

    2015-01-01

    The nucleotide cyclic di-3′,5′- adenosine monophosphate (c-di-AMP) was recently identified as an essential and widespread second messenger in bacterial signaling. Among c-di-AMP–producing bacteria, altered nucleotide levels result in several physiological defects and attenuated virulence. Thus, a detailed molecular understanding of c-di-AMP metabolism is of both fundamental and practical interest. Currently, c-di-AMP degradation is recognized solely among DHH-DHHA1 domain-containing phosphodiesterases. Using chemical proteomics, we identified the Listeria monocytogenes protein PgpH as a molecular target of c-di-AMP. Biochemical and structural studies revealed that the PgpH His-Asp (HD) domain bound c-di-AMP with high affinity and specifically hydrolyzed this nucleotide to 5′-pApA. PgpH hydrolysis activity was inhibited by ppGpp, indicating a cross-talk between c-di-AMP signaling and the stringent response. Genetic analyses supported coordinated regulation of c-di-AMP levels in and out of the host. Intriguingly, a L. monocytogenes mutant that lacks c-di-AMP phosphodiesterases exhibited elevated c-di-AMP levels, hyperinduced a host type-I IFN response, and was significantly attenuated for infection. Furthermore, PgpH homologs, which belong to the 7TMR-HD family, are widespread among hundreds of c-di-AMP synthesizing microorganisms. Thus, PgpH represents a broadly conserved class of c-di-AMP phosphodiesterase with possibly other physiological functions in this crucial signaling network. PMID:25583510

  6. Regulatory Action of Calcium Ion on Cyclic AMP-Enhanced Expression of Implantation-Related Factors in Human Endometrial Cells

    PubMed Central

    Kusama, Kazuya; Yoshie, Mikihiro; Tamura, Kazuhiro; Imakawa, Kazuhiko; Isaka, Keiichi; Tachikawa, Eiichi

    2015-01-01

    Decidualization of human endometrial stroma and gland development is mediated through cyclic AMP (cAMP), but the role of intracellular calcium ion (Ca2+) on cAMP mediated-signaling in human endometrial stroma and glandular epithelia has not been well-characterized. The present study was designed to investigate the role of intracellular Ca2+ on cAMP mediated-decidualization and gland maturation events, which can be identified by the up-regulation of prolactin and IGF-binding protein (IGFBP)1 in human endometrial stromal cells (ESCs), and cyclooxygenase 2 (COX2) and prostaglandin E2 (PGE2) and glandular epithelial EM-1 cells. Increases in decidual prolactin and IGFBP-1 transcript levels, induced by cAMP-elevating agents forskolin or dibutyryl cyclic AMP, were inhibited by Ca2+ influx into ESCs with Ca2+ ionophores (alamethicin, ionomycin) in a dose-dependent manner. Conversely, inhibitors of Ca2+ influx through L-type voltage-dependent Ca2+ channel (VDCC), nifedipine and verapamil, enhanced the decidual gene expression. Furthermore, dantrolene, an inhibitor of Ca2+ release from the intracellular Ca2+ store, up-regulated prolactin and IGFBP-1 expression. Ca2+ ionophores decreased intracellular cAMP concentrations, whereas nifedipine, verapamil or dantrolene increased cAMP concentrations in ESCs. In glandular epithelial cells, similar responses in COX2 expression and PGE2 production were found when intracellular cAMP levels were up-regulated by decreases in Ca2+ concentrations. Thus, a marked decrease in cytosolic Ca2+ levels caused the elevation of cAMP concentrations, resulting in enhanced expression of implantation-related factors including decidual markers. These findings suggest that fluctuation in cytosolic Ca2+ concentrations alters intracellular cAMP levels, which then regulate differentiation of endometrial stromal and glandular epithelial cells. PMID:26161798

  7. Opposing roles of PKA and EPAC in the cAMP-dependent regulation of schwann cell proliferation and differentiation [corrected].

    PubMed

    Bacallao, Ketty; Monje, Paula V

    2013-01-01

    In Schwann cells (SCs), cyclic adenosine monophosphate (cAMP) not only induces differentiation into a myelinating SC-related phenotype, but also synergistically enhances the mitogenic action of growth factors such as neuregulin. To better understand the molecular mechanism by which cAMP exerts these apparently contradictory functions, we investigated the role of the two main effectors of cAMP, protein kinase A (PKA) and the exchange protein activated by cAMP (EPAC), on the proliferation and differentiation of both isolated and axon-related SCs. For these studies, a variety of PKA and EPAC agonists and antagonists were used, including pathway-selective analogs of cAMP and pharmacological inhibitors. Our studies indicated that the activity of PKA rather than EPAC was required for the adjuvant effect of cAMP on S-phase entry, whereas the activity of EPAC rather than PKA was required for SC differentiation and myelin formation. Even though selective EPAC activation had an overall anti-proliferative effect in SCs, it failed to drive the expression of Krox-20, a master regulator of myelination, and that of myelin-specific proteins and lipids, suggesting that EPAC activation was insufficient to drive a full differentiating response. Interestingly, inhibition of EPAC activity resulted in a drastic impairment of SC differentiation and myelin formation but not Krox-20 expression, which indicates an independent mechanism of Krox-20 regulation in response to cAMP. In conclusion, our data supports the idea that the outcome of cAMP signaling in SCs depends on the particular set of effectors activated. Whereas the mitogenic action of cAMP relies exclusively on PKA activity, the differentiating action of cAMP requires a PKA-independent (non-canonical) cAMP-specific pathway that is partially transduced by EPAC.

  8. Biochemical and molecular characterization of three new variants of AmpC beta-lactamases from Morganella morganii.

    PubMed

    Power, Pablo; Galleni, Moreno; Ayala, Juan A; Gutkind, Gabriel

    2006-03-01

    Morganella morganii produces an inducible, chromosomally encoded AmpC beta-lactamase. We describe in this study three new variants of AmpC within this species with apparent pIs of 6.6 (M19 from M. morganii strain PP19), 7.4 (M29 from M. morganii strain PP29), and 7.8 (M37 from M. morganii strain PP37). After gene sequencing, deduced amino acid sequences displayed one to six substitutions when compared to the available Morganella AmpC sequences. An AmpR-encoding gene was also found upstream of ampC, including the LysR regulators' helix-turn-helix DNA-binding domain and the putative T-N11-A-protected region in the ampR-ampC intercistronic sequence. All three AmpC variants were purified from in vitro-generated derepressed mutants and showed overall similar kinetic parameters. None of the observed amino acid changes, occurring at the surface of the protein, appear to have a major influence in their catalytic properties. Morganella AmpCs exhibit the highest catalytic efficiencies (k(cat)/K(m)) on classical penicillins, cefoxitin, narrow-spectrum cephalosporins, and cefotaxime. Cefotaxime was more effectively hydrolyzed than other oxyimino-cephalosporins, whereas cefepime was 3 log-fold less efficiently hydrolyzed than other cephalosporins such as cephalothin. Several differences with other AmpC beta-lactamases were found. Ampicillin was more efficiently hydrolyzed than benzylpenicillin. High k(cat)/K(m) values were observed for oxacillin and piperacillin, which are usually poor substrates for AmpC. A fairly efficient hydrolysis of imipenem was detected as well. Aztreonam, carbenicillin, and tazobactam were effective transient inactivators of these variants.

  9. Regulatory Action of Calcium Ion on Cyclic AMP-Enhanced Expression of Implantation-Related Factors in Human Endometrial Cells.

    PubMed

    Kusama, Kazuya; Yoshie, Mikihiro; Tamura, Kazuhiro; Imakawa, Kazuhiko; Isaka, Keiichi; Tachikawa, Eiichi

    2015-01-01

    Decidualization of human endometrial stroma and gland development is mediated through cyclic AMP (cAMP), but the role of intracellular calcium ion (Ca2+) on cAMP mediated-signaling in human endometrial stroma and glandular epithelia has not been well-characterized. The present study was designed to investigate the role of intracellular Ca2+ on cAMP mediated-decidualization and gland maturation events, which can be identified by the up-regulation of prolactin and IGF-binding protein (IGFBP)1 in human endometrial stromal cells (ESCs), and cyclooxygenase 2 (COX2) and prostaglandin E2 (PGE2) and glandular epithelial EM-1 cells. Increases in decidual prolactin and IGFBP-1 transcript levels, induced by cAMP-elevating agents forskolin or dibutyryl cyclic AMP, were inhibited by Ca2+ influx into ESCs with Ca2+ ionophores (alamethicin, ionomycin) in a dose-dependent manner. Conversely, inhibitors of Ca2+ influx through L-type voltage-dependent Ca2+ channel (VDCC), nifedipine and verapamil, enhanced the decidual gene expression. Furthermore, dantrolene, an inhibitor of Ca2+ release from the intracellular Ca2+ store, up-regulated prolactin and IGFBP-1 expression. Ca2+ ionophores decreased intracellular cAMP concentrations, whereas nifedipine, verapamil or dantrolene increased cAMP concentrations in ESCs. In glandular epithelial cells, similar responses in COX2 expression and PGE2 production were found when intracellular cAMP levels were up-regulated by decreases in Ca2+ concentrations. Thus, a marked decrease in cytosolic Ca2+ levels caused the elevation of cAMP concentrations, resulting in enhanced expression of implantation-related factors including decidual markers. These findings suggest that fluctuation in cytosolic Ca2+ concentrations alters intracellular cAMP levels, which then regulate differentiation of endometrial stromal and glandular epithelial cells. PMID:26161798

  10. Stimulation of oxidative phosphorylation by calcium in cardiac mitochondria is not influenced by cAMP and PKA activity.

    PubMed

    Covian, Raul; French, Stephanie; Kusnetz, Heather; Balaban, Robert S

    2014-12-01

    Cardiac oxidative ATP generation is finely tuned to match several-fold increases in energy demand. Calcium has been proposed to play a role in the activation of ATP production via PKA phosphorylation in response to intramitochondrial cAMP generation. We evaluated the effect of cAMP, its membrane permeable analogs (dibutyryl-cAMP, 8-bromo-cAMP), and the PKA inhibitor H89 on respiration of isolated pig heart mitochondria. cAMP analogs did not stimulate State 3 respiration of Ca2 +-depleted mitochondria (82.2 ± 3.6% of control), in contrast to the 2-fold activation induced by 0.95 μM free Ca2 +, which was unaffected by H89. Using fluorescence and integrating sphere spectroscopy, we determined that Ca2 + increased the reduction of NADH (8%), and of cytochromes bH (3%), c1 (3%), c (4%), and a (2%), together with a doubling of conductances for Complex I + III and Complex IV. None of these changes were induced by cAMP analogs nor abolished by H89. In Ca2 +-undepleted mitochondria, we observed only slight changes in State 3 respiration rates upon addition of 50 μM cAMP (85 ± 9.9%), dibutyryl-cAMP (80.1 ± 5.2%), 8-bromo-cAMP (88.6 ± 3.3%), or 1 μM H89 (89.7 ± 19.9%) with respect to controls. Similar results were obtained when measuring respiration in heart homogenates. Addition of exogenous PKA with dibutyryl-cAMP or the constitutively active catalytic subunit of PKA to isolated mitochondria decreased State 3 respiration by only 5–15%. These functional studies suggest that alterations in mitochondrial cAMP and PKA activity do not contribute significantly to the acute Ca2 + stimulation of oxidative phosphorylation

  11. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  12. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.

    PubMed

    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D

    1994-09-01

    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  13. Crystallization and preliminary X-ray diffraction of the DEAD-box protein Mss116p complexed with an RNA oligonucleotide and AMP-PNP

    SciTech Connect

    Del Campo, Mark; Lambowitz, Alan M.

    2009-09-02

    The Saccharomyces cerevisiae DEAD-box protein Mss116p is a general RNA chaperone which functions in mitochondrial group I and group II intron splicing, translation and RNA-end processing. For crystallization trials, full-length Mss116p and a C-terminally truncated protein (Mss116p/{Delta}598-664) were overproduced in Escherichia coli and purified to homogeneity. Mss116p exhibited low solubility in standard solutions ({le}1 mg ml{sup -1}), but its solubility could be increased by adding 50 mM L-arginine plus 50 mM L-glutamate and 50% glycerol to achieve concentrations of {approx}10 mg ml{sup -1}. Initial crystals were obtained by the microbatch method in the presence of a U{sub 10} RNA oligonucleotide and the ATP analog AMP-PNP and were then improved by using seeding and sitting-drop vapor diffusion. A cryocooled crystal of Mss116p/{Delta}598-664 in complex with AMP-PNP and U{sub 10} belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 88.54, b = 126.52, c = 55.52 {angstrom}, and diffracted X-rays to beyond 1.9 {angstrom} resolution using synchrotron radiation from sector 21 at the Advanced Photon Source.

  14. Advanced stellarators

    NASA Astrophysics Data System (ADS)

    Schlüter, Arnulf

    1983-03-01

    Toroidal confinement of a plasma by an external magnetic field is not compatible with axisymmetry, in contrast to confinement by the pinch effect of induced electric currents as in a tokomak or by the reversed field pinch configuration. The existence of magnetic surfaces throughout the region in which grad p ≠ 0 is therefore not guaranteed in such configurations, though it is necessary for MHD-equilibrium when the lines of force possess a finite twist (or "rotational transform"). These twisted equilibria are called stellarators. The other type of external confinement requires all lines of force to be closed upon themselves and p to be function of the well defined quantity Q = φ d l/ B only. The resulting "bumpy" tori are sometimes also referred to as being M + S like. By discussing specific examples it is shown that stellarator configurations exist which retain as much as possible the properties of M + S like configurations, combine these with the magnetic well, and with an approximation to the isodynamic requirement of D. Palumbo. These so-called Advanced Stellarators shown an improvement in predicted particle confinement and beta-limit compared to the classical stellarators. They can also be viewed as forming a system of linked stabilized mirrors of small mirror ratio. These fields can be produced by modular coils. A prototype of such a configuration is being designed by the stellarator division of IPP under the name of Wendelstein VII-AS. Expected physical data and technical details of W VII-AS are given.

  15. Advanced capacitors

    NASA Astrophysics Data System (ADS)

    Parker, R. D.; Buritz, R. S.; Taylor, A. R.; Bullwinkel, E. P.

    1982-11-01

    An experimental development program was conducted to develop and test advanced dielectric materials for capacitors for airborne power systems. High rep rate and low rate capacitors for use in pulse-forming networks, high voltage filter capacitors, and high frequency ac capacitors for series resonant inverters were considered. The initial goal was to develop an improved polysulfone film. Initially, low breakdown strength was thought to be related to inclusions of conductive particles. The effect of filtration of the casting solution was investigated. These experiments showed that more filtration was not the entire solution to low breakdown. The film samples were found to contain dissolved ionic impurities that move through the dielectric when voltage is applied and cause enhancement of the electric field. These contaminants enter the film via the resin and solvent, and can be partially removed. However, these treatments did not significantly improve the breakdown characteristics. A new material, Ultem, was proposed for use in high energy density capacitors. This new polyetherimide resin has properties similar to polysulfone and polyimide, with improvement in breakdown characteristics and temperature capability. The technique of casting films on a roughened drum was demonstrated, and found useful in preparing textured films. this is the first step toward a replacement for kraft paper.

  16. Advanced capacitors

    NASA Astrophysics Data System (ADS)

    Ennis, J. B.; Buritz, R. S.

    1984-10-01

    This report describes an experimental program to develop and test advanced dielectric materials for capacitors for airborne power systems. Five classes of capacitors were considered: high rep rate and low rep rate pulse capacitors for use in pulse-forming networks, high voltage filter capacitors, high frequency AC capacitors for series resonant inverters, and AC filter capacitors. To meet these requirements, existing dielectric materials were modified, and new materials were developed. The initial goal was to develop an improved polysulfone film with fewer imperfections that could operate at significantly higher electrical stresses. It was shown that contaminants enter the film via the resin and solvent, and that they can be partially removed. As far as developed, however, these treatments did not significantly improved the breakdown characteristics. The technique of casting films on a roughened drum was demonstrated, and found useful in preparing textured films -- the first step toward a replacement for Kraft paper. A new material, Ultem, was proposed for use in high energy density capacitors. This new polyetherimide resin has properties similar to polysulfone and polyimide, with improvement in breakdown characteristics and temperature capability. This material was selected for further study in model capacitor designs.

  17. New perspectives in signaling mediated by receptors coupled to stimulatory G protein: the emerging significance of cAMP efflux and extracellular cAMP-adenosine pathway.

    PubMed

    Godinho, Rosely O; Duarte, Thiago; Pacini, Enio S A

    2015-01-01

    G protein-coupled receptors (GPCRs) linked to stimulatory G (Gs) proteins (GsPCRs) mediate increases in intracellular cyclic AMP as consequence of activation of nine adenylyl cyclases , which differ considerably in their cellular distribution and activation mechanisms. Once produced, cyclic AMP may act via distinct intracellular signaling effectors such as protein kinase A and the exchange proteins activated by cAMP (Epacs). More recently, attention has been focused on the efflux of cAMP through a specific transport system named multidrug resistance proteins that belongs to the ATP-binding cassette transporter superfamily. Outside the cell, cAMP is metabolized into adenosine, which is able to activate four distinct subtypes of adenosine receptors, members of the GPCR family: A1, A2A, A2B, and A3. Taking into account that this phenomenon occurs in numerous cell types, as consequence of GsPCR activation and increment in intracellular cAMP levels, in this review, we will discuss the impact of cAMP efflux and the extracellular cAMP-adenosine pathway on the regulation of GsPCR-induced cell response.

  18. Adenylyl cyclase activation underlies intracellular cyclic AMP accumulation, cyclic AMP transport, and extracellular adenosine accumulation evoked by beta-adrenergic receptor stimulation in mixed cultures of neurons and astrocytes derived from rat cerebral cortex.

    PubMed

    Rosenberg, P A; Li, Y

    1995-09-18

    We have previously shown that stimulation of cortical cultures containing both neurons and astrocytes with the beta-adrenergic agonist isoproterenol (ISO) results in transport of cAMP from astrocytes followed by extracellular hydrolysis to adenosine [Rosenberg et al. J. Neurosci. 14 (1994) 2953-2965]. In this study we found that the endogenous catecholamines epinephrine (EPI) and norepinephrine (NE), but not dopamine, serotonin, or histamine, all at 10 microM, significantly stimulated intracellular cAMP accumulation, cAMP transport, and extracellular adenosine accumulation in cortical cultures. Detailed dose-response experiments were performed for NE and EPI, as well as ISO. For each catecholamine, the potencies in evoking intracellular cAMP accumulation, cAMP transport, and extracellular adenosine accumulation were similar. These data provide additional evidence that a single common mechanism, namely beta-adrenergic mediated activation of adenylyl cyclase, underlies intracellular cAMP accumulation, cAMP transport, and extracellular adenosine accumulation. It appears that regulation of extracellular adenosine levels via cAMP transport and extracellular hydrolysis to adenosine may be a final common pathway of neuromodulation in cerebral cortex for catecholamines, and, indeed, any substance whose receptors are coupled to adenylyl cyclase.

  19. New perspectives in signaling mediated by receptors coupled to stimulatory G protein: the emerging significance of cAMP efflux and extracellular cAMP-adenosine pathway

    PubMed Central

    Godinho, Rosely O.; Duarte, Thiago; Pacini, Enio S. A.

    2015-01-01

    G protein-coupled receptors (GPCRs) linked to stimulatory G (Gs) proteins (GsPCRs) mediate increases in intracellular cyclic AMP as consequence of activation of nine adenylyl cyclases , which differ considerably in their cellular distribution and activation mechanisms. Once produced, cyclic AMP may act via distinct intracellular signaling effectors such as protein kinase A and the exchange proteins activated by cAMP (Epacs). More recently, attention has been focused on the efflux of cAMP through a specific transport system named multidrug resistance proteins that belongs to the ATP-binding cassette transporter superfamily. Outside the cell, cAMP is metabolized into adenosine, which is able to activate four distinct subtypes of adenosine receptors, members of the GPCR family: A1, A2A, A2B, and A3. Taking into account that this phenomenon occurs in numerous cell types, as consequence of GsPCR activation and increment in intracellular cAMP levels, in this review, we will discuss the impact of cAMP efflux and the extracellular cAMP-adenosine pathway on the regulation of GsPCR-induced cell response. PMID:25859216

  20. Application of AirCell Cellular AMPS Network and Iridium Satellite System Dual Mode Service to Air Traffic Management

    NASA Technical Reports Server (NTRS)

    Shamma, Mohammed A.

    2004-01-01

    The AirCell/Iridium dual mode service is evaluated for potential applications to Air Traffic Management (ATM) communication needs. The AirCell system which is largely based on the Advanced Mobile Phone System (AMPS) technology, and the Iridium FDMA/TDMA system largely based on the Global System for Mobile Communications(GSM) technology, can both provide communication relief for existing or future aeronautical communication links. Both have a potential to serve as experimental platforms for future technologies via a cost effective approach. The two systems are well established in the entire CONUS and globally hence making it feasible to utilize in all regions, for all altitudes, and all classes of aircraft. Both systems have been certified for air usage. The paper summarizes the specifications of the AirCell/Iridium system, as well as the ATM current and future links, and application specifications. the paper highlights the scenarios, applications, and conditions under which the AirCell/Iridium technology can be suited for ATM Communication.

  1. EppA, a Putative Substrate of DdERK2, Regulates Cyclic AMP Relay and Chemotaxis in Dictyostelium discoideum

    PubMed Central

    Chen, Songyang; Segall, Jeffrey E.

    2006-01-01

    The mitogen-activated protein kinase DdERK2 is critical for cyclic AMP (cAMP) relay and chemotaxis to cAMP and folate, but the details downstream of DdERK2 are unclear. To search for targets of DdERK2 in Dictyostelium discoideum,32PO43−-labeled protein samples from wild-type and Dderk2− cells were resolved by 2-dimensional electrophoresis. Mass spectrometry was used to identify a novel 45-kDa protein, named EppA (ERK2-dependent phosphoprotein A), as a substrate of DdERK2 in Dictyostelium. Mutation of potential DdERK2 phosphorylation sites demonstrated that phosphorylation on serine 250 of EppA is DdERK2 dependent. Changing serine 250 to alanine delayed development of Dictyostelium and reduced Dictyostelium chemotaxis to cAMP. Although overexpression of EppA had no significant effect on the development or chemotaxis of Dictyostelium, disruption of the eppA gene led to delayed development and reduced chemotactic responses to both cAMP and folate. Both eppA gene disruption and overexpression of EppA carrying the serine 250-to-alanine mutation led to inhibition of intracellular cAMP accumulation in response to chemoattractant cAMP, a pivotal process in Dictyostelium chemotaxis and development. Our studies indicate that EppA regulates extracellular cAMP-induced signal relay and chemotaxis of Dictyostelium. PMID:16835457

  2. cAMP controls the balance of the propulsive forces generated by the two flagella of Chlamydomonas.

    PubMed

    Saegusa, Yu; Yoshimura, Kenjiro

    2015-08-01

    The motility of cilia and flagella of eukaryotic cells is controlled by second messengers such as Ca(2+), cAMP, and cGMP. In this study, the cAMP-dependent control of flagellar bending of Chlamydomonas is investigated by applying cAMP through photolysis of 4,5-dimethoxy-2-nitrobenzyl adenosine 3',5'-cyclicmonophosphate (caged cAMP). When cAMP is applied to demembranated and reactivated cells, cells begin to swim with a larger helical path. This change is due to a larger turn about the axis normal to the anterior-posterior axis, indicating an increased imbalance in the propulsive forces generated by the cis-flagellum (flagellum nearer to the eyespot) and trans-flagellum (flagellum farther from the eyespot). Consistently, when cAMP is applied to isolated axonemes, some axonemes show attenuated motility whereas others do not. Axonemes from uni1 mutants, which have only trans-flagella, do not respond to cAMP. These observations indicate that cAMP controls the balance of the forces generated by cis- and trans-flagella in Chlamydomonas.

  3. 78 FR 1252 - CalAmp Wireless Networks Corporation (CWNC), Satellite Products Division, Including On-Site...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... December 13, 2011 (76 FR 77556). At the request of the State of Minnesota, the Department reviewed the... Employment and Training Administration CalAmp Wireless Networks Corporation (CWNC), Satellite Products... workers of CalAmp Products, Inc., Satellite Products Division, including on-site leased workers...

  4. Human dermal microvascular endothelial cells in vitro: effect of cyclic AMP on cellular morphology and proliferation rate.

    PubMed

    Davison, P M; Karasek, M A

    1981-02-01

    Macrovascular endothelial cells isolated from the human umbilical vein and microvessel endothelium from the newborn foreskin dermis differ in their requirements for optimal growth in vitro. In the presence of 5 X 10(-4) M dibutyryl cyclic AMP (Bt2cAMP), human dermal microvessel endothelial cell proliferation rate increased to give a cell number of 203% of controls values by day 10 in culture. The cells retained their characteristic endothelial cell morphology, reached confluence, and could be serially passaged. Cells grown in the absence of Bt2cAMP did not proliferate readily and grew in a disorganized pattern. The effect of Bt2cAMP on microvascular endothelial cell proliferation rate and morphology could be duplicated by cholera toxin (CT) used together with isobutyl methylxanthine (IMX). These agents were found to elevate intracellular levels of cyclic AMP in microvascular endothelium over 40-fold. Human umbilical vein cells in culture failed to respond to either Bt2cAMP or CT together with IMX. The growth-promoting effect of dibutyryl cyclic AMP (Bt2cAMP) on human foreskin dermal microvascular endothelium in vitro is in marked contrast to the lack of response of human umbilical vein cells. These results provide further evidence of differences in the mechanisms that regulate macro and microvessel endothelial cell proliferation in vitro.

  5. Serum-stimulated cyclic-AMP production in S49 lymphoma cells grown in serum-free medium.

    PubMed

    Darfler, F J; Mullen, M D; Insel, P A

    1984-03-23

    Growth of S49 lymphoma cells with horse serum leads to an increase in cellular cAMP phosphodiesterase activity and a resultant loss of hormone- and cholera-toxin-stimulated cAMP accumulation. We now show that the serum requires protein synthesis to produce these effects. Further, we show that acute addition of serum to wild-type S49 cells, grown in serum-free medium, rapidly (under 2 min) and transiently (under 30 min) stimulates cellular cAMP, 10-fold over basal levels. This 'acute' effect of serum was not observed in UNC S49 cells, suggesting that a functional Ns, the guanine nucleotide regulatory component that mediates stimulation of adenylate cyclase, is required for the serum-mediated stimulation of cellular cAMP. Serum added acutely to wild-type S49 cells also augmented cAMP accumulation in response to isoproterenol and forskolin. The half-maximally effective concentrations of horse serum that acutely stimulated or more slowly decreased the cAMP accumulation were approx. 0.2% and 2.0%, respectively. Preliminary attempts to characterize further the serum factor indicate that it has a high (250 000-300 000) molecular weight and is insensitive to boiling; chromatography on Sepharose CL-6B yields a 100-fold purification. Thus, the serum contains one or more components that activate adenylate cyclase, increase cellular cAMP levels and ultimately induce cAMP phosphodiesterase in S49 lymphoma cells. PMID:6322858

  6. Heparin modulates intracellular cyclic AMP in human trabecular bone cells and adherent rheumatoid synovial cells.

    PubMed Central

    Crisp, A J; Roelke, M S; Goldring, S R; Krane, S M

    1984-01-01

    Cells were cultured from explants of human trabecular bone excised from eight patients and incubated usually for 20 minutes with bovine parathyroid hormone, salmon calcitonin, prostaglandin E2, or heparin. The intracellular content of cyclic AMP was measured by radioimmunoassay and was significantly increased by parathyroid hormone in four, by calcitonin in two, by prostaglandin E2 in eight, and by heparin in seven out of eight cultures. In the two cultures containing calcitonin-responsive cells heparin inhibited the cyclic AMP response induced by calcitonin. Heparin did not affect the cyclic AMP response to parathyroid hormone or prostaglandin E2. Heparin also increased the cyclic AMP content of cultured adherent rheumatoid synovial cells. It is proposed that, in certain situations of focal pathological bone resorption, although concentrations of circulating hormones may be normal, the local release of products such as heparin may modify the effect of hormones which regulate connective tissue homoeostasis. local changes in hormone responses could contribute to the enhanced bone resorption associated with inflammatory processes such as rheumatoid arthritis. Images PMID:6089675

  7. AMP-activated Protein Kinase Is Activated as a Consequence of Lipolysis in the Adipocyte

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is activated in adipocytes during exercise and other states in which lipolysis is stimulated. However, the mechanism(s) responsible for this effect and its physiological relevance are unclear. To examine these questions, 3T3-L1 adipocytes were treated with agents...

  8. Regularity of the Dirichlet problem for the complex Monge-Ampère equation

    PubMed Central

    Moriyon, Roberto

    1979-01-01

    Regularity up to the boundary of the solutions of a boundary value problem for a complex Monge-Ampère equation on perturbations of an annulus in Cn is proven. The result can be applied to the classification of such domains. PMID:16592626

  9. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 5: Technical summary

    NASA Technical Reports Server (NTRS)

    1976-01-01

    Engineering and operational facets associated with the implementation of the first two AMPS flights are covered. The payload is described including all systems and subsystems and the mission planning and flight operations are described too. Payload integration, ground operations, and logistics are included along with key supporting analyses and mass properties.

  10. Localized cyclic AMP-dependent protein kinase activity is required for myogenic cell fusion

    SciTech Connect

    Mukai, Atsushi; Hashimoto, Naohiro

    2008-01-15

    Multinucleated myotubes are formed by fusion of mononucleated myogenic progenitor cells (myoblasts) during terminal skeletal muscle differentiation. In addition, myoblasts fuse with myotubes, but terminally differentiated myotubes have not been shown to fuse with each other. We show here that an adenylate cyclase activator, forskolin, and other reagents that elevate intracellular cyclic AMP (cAMP) levels induced cell fusion between small bipolar myotubes in vitro. Then an extra-large myotube, designated a 'myosheet,' was produced by both primary and established mouse myogenic cells. Myotube-to-myotube fusion always occurred between the leading edge of lamellipodia at the polar end of one myotube and the lateral plasma membrane of the other. Forskolin enhanced the formation of lamellipodia where cAMP-dependent protein kinase (PKA) was accumulated. Blocking enzymatic activity or anchoring of PKA suppressed forskolin-enhanced lamellipodium formation and prevented fusion of multinucleated myotubes. Localized PKA activity was also required for fusion of mononucleated myoblasts. The present results suggest that localized PKA plays a pivotal role in the early steps of myogenic cell fusion, such as cell-to-cell contact/recognition through lamellipodium formation. Furthermore, the localized cAMP-PKA pathway might be involved in the specification of the fusion-competent areas of the plasma membrane in lamellipodia of myogenic cells.

  11. Effect of saucerneol D on melanin production in cAMP-elevated melanocytes.

    PubMed

    Yun, Ji Young; Roh, Eunmiri; Son, Jong-Keun; Lee, Seung Ho; Seo, Chang-Seob; Hwang, Bang Yeon; Han, Sang-Bae; Kim, Youngsoo

    2011-08-01

    Intracellular cAMP stimulates microphthalmia-associated transcription factor (MITF) induction in melanocytes through cAMP-responsive element binding protein (CREB), which plays a pivotal role in the gene expression of tyrosinase for melanin biosynthesis. In the present study, saucerneol D as a lignan constituent of Saururus chinensis (Saururaceae family) efficiently inhibited melanin production with IC(50) values of 188-297 nM in B16 melanoma cells stimulated with α-melanocyte stimulating hormone (α-MSH) or other cAMP elevators. Moreover, saucerneol D down-regulated α-MSH-induced gene expression of tyrosinase at the transcription level in B16 cells, but it did not directly inhibit the catalytic activity of cell-free tyrosinase. As to the molecular basis of hypopigmenting action, saucerneol D inhibited α-MSH-induced phosphorylation of CREB in the cells, and sequentially suppressed MITF induction. Taken together, this study provides saucerneol D down-regulated the gene expression of tyrosinase, resulting in the inhibition of cAMP-induced melanin biosynthesis, and suggests pharmacological potential of the lignan structure in skin hyperpigmentation. PMID:21910056

  12. The relationship between cAMP, Ca(2)+, and transport of CFTR to the plasma membrane.

    PubMed

    Chen, P; Hwang, T C; Gillis, K D

    2001-08-01

    The mechanism whereby cAMP stimulates Cl(-) flux through CFTR ion channels in secretory epithelia remains controversial. It is generally accepted that phosphorylation by cAMP-dependent protein kinase increases the open probability of the CFTR channel. A more controversial hypothesis is that cAMP triggers the translocation of CFTR from an intracellular pool to the cell surface. We have monitored membrane turnover in Calu-3 cells, a cell line derived from human airway submucosal glands that expresses high levels of CFTR using membrane capacitance and FM1-43 fluorescence measurements. Using a conventional capacitance measurement technique, we observe an apparent increase in membrane capacitance in most cells that exhibit an increase in Cl(-) current. However, after we carefully correct our recordings for changes in membrane conductance, the apparent changes in capacitance are eliminated. Measurements using the fluorescent membrane marker FM1-43 also indicate that no changes in membrane turnover accompany the activation of CFTR. Robust membrane insertion can be triggered with photorelease of caged Ca(2)+ in Calu-3 cells. However, no increase in Cl(-) current accompanies Ca(2)+-evoked membrane fusion. We conclude that neither increases in cAMP or Ca(2)+ lead to transport of CFTR to the plasma membrane in Calu-3 cells. In addition, we conclude that membrane capacitance measurements must be interpreted with caution when large changes in membrane conductance occur. PMID:11479341

  13. Trapping of a transcription complex using a new nucleotide analogue: AMP aluminium fluoride.

    PubMed

    Joly, Nicolas; Rappas, Mathieu; Buck, Martin; Zhang, Xiaodong

    2008-02-01

    Mechanochemical proteins rely on ATP hydrolysis to establish the different functional states required for their biological output. Studying the transient functional intermediate states these proteins adopt as they progress through the ATP hydrolysis cycle is key to understanding the molecular basis of their mechanism. Many of these intermediates have been successfully 'trapped' and functionally characterised using ATP analogues. Here, we present a new nucleotide analogue, AMP-AlF(x), which traps PspF, a bacterial enhancer binding protein, in a stable complex with the sigma(54)-RNA polymerase holoenzyme. The crystal structure of AMP-AlF(x)*PspF(1-275) provides new information on protein-nucleotide interactions and suggests that the beta and gamma phosphates are more important than the alpha phosphate in terms of sensing nucleotide bound states. In addition, functional data obtained with AMP-AlF(x) establish distinct roles for the conserved catalytic AAA(+) (ATPases associated with various cellular activities) residues, suggesting that AMP-AlF(x) is a powerful new tool to study AAA(+) protein family members and, more generally, Walker motif ATPases. PMID:18082766

  14. Multiple protein kinase A-regulated events are required for transcriptional induction by cAMP.

    PubMed Central

    Brindle, P; Nakajima, T; Montminy, M

    1995-01-01

    The second messenger cAMP stimulates the expression of numerous genes via the protein kinase A-mediated phosphorylation of the cAMP response element-binding protein (CREB) at Ser-133. Ser-133 phosphorylation, in turn, appears to induce target gene expression by promoting interaction between CREB and CBP, a 265-kDa nuclear phospho-CREB-binding protein. It is unclear, however, whether Ser-133 phosphorylation per se is sufficient for CREB-CBP complex formation and for target gene induction in vivo. Here we examine CREB activity in Jurkat T cells after stimulation of the T-cell receptor (TCR), an event that leads to calcium entry and diacylglycerol production. Triggering of the TCR stimulated Ser-133 phosphorylation of CREB with high stoichiometry, but TCR activation did not promote CREB-CBP complex formation or target gene induction unless suboptimal doses of cAMP agonist were provided as a costimulus. Our results demonstrate that, in addition to mediating Ser-133 phosphorylation of CREB, protein kinase A regulates additional proteins that are required for recruitment of the transcriptional apparatus to cAMP-responsive genes. Images Fig. 1 Fig. 2 Fig. 3 PMID:7479832

  15. Regulation of laminin and entactin mRNA levels by retinoic acid and dibutyryl cyclic AMP

    SciTech Connect

    Durkin, M.E.; Phillips, S.L.; Carlin, B.E.; Merlie, J.P.; Chung, A.E.

    1986-05-01

    Retinoic acid and dibutyryl cAMP induced F9 embryonal carcinoma cells to differentiate to parietal endoderm; the morphological changes were accompanied by the increased synthesis of the basement membrane glycoproteins laminin and entactin. cDNA clones have been isolated for the A (400 kD), B1 (220 kD), and B2 (205 kD) chains of laminin. Northern blot analysis indicated that the A, B1, and B2 chains were encoded by RNA species of 9.8, 6.0, and 8.0 kb, respectively. The kinetics of induction of the laminin mRNAs were studied by dot-blotting dilutions of RNA extracted from F9 cells cultured in retinoic acid and dibutyryl cAMP for increasing amounts of time and hybridizing to /sup 32/P-labeled recombinant plasmids. Very low levels of the A and B chain RNAs were found in uninduced cells, and a large increase occurred between 48 and 72 hr of growth in retinoic acid and dibutyryl cAMP. A cDNA clone was also obtained for entactin, a 150 kD glycoprotein that forms a complex with laminin. Retinoic acid and dibutyryl cAMP treatment also increased the amount of entactin RNA in F9 cells. These results suggested that a common mechanism may exist for the coordinate regulation of the 4 basement membrane protein genes during differentiation.

  16. H2S induces vasoconstriction of rat cerebral arteries via cAMP/adenylyl cyclase pathway.

    PubMed

    Li, Sen; Ping, Na-Na; Cao, Lei; Mi, Yan-Ni; Cao, Yong-Xiao

    2015-12-15

    Hydrogen sulfide (H2S), traditionally known for its toxic effects, is now involved in regulating vascular tone. Here we investigated the vasoconstrictive effect of H2S on cerebral artery and the underlying mechanism. Sodium hydrosulfide (NaHS), a donor of H2S, concentration-dependently induced vasoconstriction on basilar artery, which was enhanced in the presence of isoprenaline, a β-adrenoceptor agonist or forskolin, an adenylyl cyclase activator. Administration of NaHS attenuated the vasorelaxant effects of isoprenaline or forskolin. Meanwhile, the NaHS-induced vasoconstriction was diminished in the presence of 8B-cAMP, an analog of cAMP, but was not affected by Bay K-8644, a selective L-type Ca(2+) channel agonist. These results could be explained by the revised effects of NaHS on isoprenaline-induced cAMP elevation and forskolin-stimulated adenylyl cyclase activity. Additionally, NaHS-induced vasoconstriction was enhanced by removing the endothelium or in the presence of L-NAME, an inhibitor of nitric oxide synthase. L-NAME only partially attenuated the effect of NaHS which was given together with forskolin on the pre-contracted artery. In conclusion, H2S induces vasoconstriction of cerebral artery via, at least in part, cAMP/adenylyl cyclase pathway.

  17. Synapse number and synaptic efficacy are regulated by presynaptic cAMP and protein kinase A.

    PubMed

    Munno, David W; Prince, David J; Syed, Naweed I

    2003-05-15

    The mechanisms by which neurons regulate the number and strength of synapses during development and synaptic plasticity have not yet been defined fully. This lack of fundamental knowledge in the fields of neurodevelopment and synaptic plasticity can be attributed, in part, to compensatory mechanisms by which neurons accommodate for the loss of function in their synaptic partners. This is generally achieved either by scaling up neuronal transmitter release capabilities or by enhancing the postsynaptic responsiveness. Here, we demonstrate that regulation of synaptic strength and number between identified Lymnaea neurons visceral dorsal 4 (VD4, the presynaptic cell) and left pedal dorsal 1 (LPeD1, the postsynaptic cell) requires presynaptic activation of a cAMP-PKA-dependent signal. Experimental activation of the cAMP-PKA pathway resulted in reduced synaptic efficacy, whereas inhibition of the cAMP-PKA cascade permitted hyperinnervation and an overall enhancement of synaptic strength. Because synaptic transmission between VD4 and LPeD1 does not require a cAMP-PKA pathway, our data show that these messengers may play a novel role in regulating the synaptic efficacy during early synaptogenesis and plasticity.

  18. Modulation of norepinephrine-stimulated cyclic AMP accumulation in rat pinealocytes by n-3 fatty acids.

    PubMed

    Delton-Vandenbroucke, I; Sarda, N; Molière, P; Lagarde, M; Gharib, A

    1996-10-01

    This work showed that docosahexaenoic (22:6n-3) and eicosapentaenoic (20:5n-3) acid supplementation for 48 h have opposite effects on the norepinephrine-stimulated cyclic AMP accumulation in rat pinealocytes. We found that 22:6n-3 supplementation of pineal cells, done by increasing specifically 22:6n-3 in phospholipid and triacylglycerol pools, led to inhibition of norepinephrine-stimulated cyclic AMP production whereas 20:5n-3 supplementation, by increasing 20:5n-3, and 22:5n-3 and 22:6n-3 in the same pools, stimulated it. In contrast, direct treatment of pinealocytes with each fatty acid (50 microM) did not affect cyclic AMP production in the presence of (0.1-10 microM) norepinephrine. The results indicate that, using pharmacological agents such as forskolin or prazosin: (a) neither basal nor forskolin-stimulated cyclic AMP levels were modified in fatty acid-supplemented cells compared to control cells; (b) in the presence of 1 microM prazosin, the activation by 20:5n-3 was still effective whereas no additional inhibition of norepinephrine stimulation was observed in 22:6n-3-supplemented cells. Taken together our results suggest that 22:6n-3 or 20:5n-3 supplementation modulates specifically the alpha 1- or beta-adrenoceptors in the rat pineal gland.

  19. Dendritic geometry shapes neuronal cAMP signalling to the nucleus

    PubMed Central

    Li, Lu; Gervasi, Nicolas; Girault, Jean-Antoine

    2015-01-01

    Neurons have complex dendritic trees, receiving numerous inputs at various distances from the cell body. Yet the rules of molecular signal propagation from dendrites to nuclei are unknown. DARPP-32 is a phosphorylation-regulated signalling hub in striatal output neurons. We combine diffusion-reaction modelling and live imaging to investigate cAMP-activated DARPP-32 signalling to the nucleus. The model predicts maximal effects on the nucleus of cAMP production in secondary dendrites, due to segmental decrease of dendrite diameter. Variations in branching, perikaryon size or spines have less pronounced effects. Biosensor kinase activity measurement following cAMP or dopamine uncaging confirms these predictions. Histone 3 phosphorylation, regulated by this pathway, is best stimulated by cAMP released in secondary-like dendrites. Thus, unexpectedly, the efficacy of diffusion-based signalling from dendrites to nucleus is not inversely proportional to the distance. We suggest a general mechanism by which dendritic geometry counterbalances the effect of dendritic distance for signalling to the nucleus. PMID:25692798

  20. Role of the cAMP-binding protein Epac in cardiovascular physiology and pathophysiology.

    PubMed

    Métrich, Mélanie; Berthouze, Magali; Morel, Eric; Crozatier, Bertrand; Gomez, Ana Maria; Lezoualc'h, Frank

    2010-03-01

    Exchange proteins directly activated by cyclic AMP (Epac) were discovered 10 years ago as new sensors for the second messenger cyclic AMP (cAMP). Epac family, including Epac1 and Epac2, are guanine nucleotide exchange factors for the Ras-like small GTPases Rap1 and Rap2 and function independently of protein kinase A. Given the importance of cAMP in the cardiovascular system, numerous molecular and cellular studies using specific Epac agonists have analyzed the role and the regulation of Epac proteins in cardiovascular physiology and pathophysiology. The specific functions of Epac proteins may depend upon their microcellular environments as well as their expression and localization. This review discusses recent data showing the involvement of Epac in vascular cell migration, endothelial permeability, and inflammation through specific signaling pathways. In addition, we present evidence that Epac regulates the activity of various cellular compartments of the cardiac myocyte and influences calcium handling and excitation-contraction coupling. The potential role of Epac in cardiovascular disorders such as cardiac hypertrophy and remodeling is also discussed.

  1. 78 FR 1264 - CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative Determination Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employment and Training Administration CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative Determination Regarding Application for Reconsideration By application dated September 26, 2012, the State...

  2. Engineering of a red-light–activated human cAMP/cGMP-specific phosphodiesterase

    PubMed Central

    Gasser, Carlos; Taiber, Sandra; Yeh, Chen-Min; Wittig, Charlotte Helene; Hegemann, Peter; Ryu, Soojin; Wunder, Frank; Möglich, Andreas

    2014-01-01

    Sensory photoreceptors elicit vital physiological adaptations in response to incident light. As light-regulated actuators, photoreceptors underpin optogenetics, which denotes the noninvasive, reversible, and spatiotemporally precise perturbation by light of living cells and organisms. Of particular versatility, naturally occurring photoactivated adenylate cyclases promote the synthesis of the second messenger cAMP under blue light. Here, we have engineered a light-activated phosphodiesterase (LAPD) with complementary light sensitivity and catalytic activity by recombining the photosensor module of Deinococcus radiodurans bacterial phytochrome with the effector module of Homo sapiens phosphodiesterase 2A. Upon red-light absorption, LAPD up-regulates hydrolysis of cAMP and cGMP by up to sixfold, whereas far-red light can be used to down-regulate activity. LAPD also mediates light-activated cAMP and cGMP hydrolysis in eukaryotic cell cultures and in zebrafish embryos; crucially, the biliverdin chromophore of LAPD is available endogenously and does not need to be provided exogenously. LAPD thus establishes a new optogenetic modality that permits light control over diverse cAMP/cGMP-mediated physiological processes. Because red light penetrates tissue more deeply than light of shorter wavelengths, LAPD appears particularly attractive for studies in living organisms. PMID:24889611

  3. Structural Insights into the Mechanism of the Allosteric Transitions of Mycobacterium tuberculosis cAMP Receptor Protein

    SciTech Connect

    Reddy, Manchi C.M.; Palaninathan, Satheesh K.; Bruning, John B.; Thurman, Cory; Smith, Danielle; Sacchettini, James C.

    2010-02-11

    The cAMP receptor protein (CRP) from Mycobacterium tuberculosis is a cAMP-responsive global transcriptional regulator, responsible for the regulation of a multitude of diverse proteins. We have determined the crystal structures of the CRP {center_dot} cAMP and CRP {center_dot} N{sup 6}-cAMP derivative-bound forms of the enzyme to 2.2- and 2.3 {angstrom}-resolution, respectively, to investigate cAMP-mediated conformational and structural changes. The allosteric switch from the open, inactive conformation to the closed, active conformation begins with a number of changes in the ligand-binding cavity upon cAMP binding. These subtle structural changes and numerous non-bonding interactions between cAMP, the N-domain residues, and the C-domain helices demonstrate that the N-domain hairpin loop acts as a structural mediator of the allosteric switch. Based on the CRP {center_dot} N{sup 6}-cAMP crystal structure, binding of N{sup 6}-cAMP with a bulkier methylphenylethyl extension from the N{sup 6} atom stabilizes the cAMP-binding domain, N-domain hairpin, and C-terminal domain in a similar manner as that of the CRP {center_dot} cAMP structure, maintaining structural integrity within the subunits. However, the bulkier N{sup 6} extension of N{sup 6}-cAMP (in R conformation) is accommodated only in subunit A with minor changes, whereas in subunit B, the N{sup 6} extension is in the S conformation hindering the hinge region of the central helix. As a result, the entire N-domain and the C-domain of subunit B integrated by the cAMP portion of this ligand, together tilt away ({approx}7{sup o} tilt) from central helix C, positioning the helix-turn-helix motif in an unfavorable position for the DNA substrate, asymmetrically. Together, these crystal structures demonstrate the mechanism of action of the cAMP molecule and its role in integrating the active CRP structure.

  4. Astrocyte arachidonate and palmitate uptake and metabolism is differentially modulated by dibutyryl-cAMP treatment.

    PubMed

    Seeger, D R; Murphy, C C; Murphy, E J

    2016-07-01

    Astrocytes play a vital role in brain lipid metabolism; however the impact of the phenotypic shift in astrocytes to a reactive state on arachidonic acid metabolism is unknown. Therefore, we determined the impact of dibutyryl-cAMP (dBcAMP) treatment on radiolabeled arachidonic acid ([1-(14)C]20:4n-6) and palmitic acid ([1-(14)C]16:0) uptake and metabolism in primary cultured murine cortical astrocytes. In dBcAMP treated astrocytes, total [1-(14)C]20:4n-6 uptake was increased 1.9-fold compared to control, while total [1-(14)C]16:0 uptake was unaffected. Gene expression of long-chain acyl-CoA synthetases (Acsl), acyl-CoA hydrolase (Acot7), fatty acid binding protein(s) (Fabp) and alpha-synuclein (Snca) were determined using qRT-PCR. dBcAMP treatment increased expression of Acsl3 (4.8-fold) and Acsl4 (1.3-fold), which preferentially use [1-(14)C]20:4n-6 and are highly expressed in astrocytes, consistent with the increase in [1-(14)C]20:4n-6 uptake. However, expression of Fabp5 and Fabp7 were significantly reduced by 25% and 45%, respectively. Acot7 (20%) was also reduced, suggesting dBcAMP treatment favors acyl-CoA formation. dBcAMP treatment enhanced [1-(14)C]20:4n-6 (2.2-fold) and [1-(14)C]16:0 (1.6-fold) esterification into total phospholipids, but the greater esterification of [1-(14)C]20:4n-6 is consistent with the observed uptake through increased Acsl, but not Fabp expression. Although total [1-(14)C]16:0 uptake was not affected, there was a dramatic decrease in [1-(14)C]16:0 in the free fatty acid pool as esterification into the phospholipid pool was increased, which is consistent with the increase in Acsl3 and Acsl4 expression. In summary, our data demonstrates that dBcAMP treatment increases [1-(14)C]20:4n-6 uptake in astrocytes and this increase appears to be due to increased expression of Acsl3 and Acsl4 coupled with a reduction in Acot7 expression. PMID:27255639

  5. Structural insights into Cn-AMP1, a short disulfide-free multifunctional peptide from green coconut water.

    PubMed

    Santana, Mábio J; de Oliveira, Aline L; Queiroz Júnior, Luiz H K; Mandal, Santi M; Matos, Carolina O; Dias, Renata de O; Franco, Octavio L; Lião, Luciano M

    2015-02-27

    Multifunctional and promiscuous antimicrobial peptides (AMPs) can be used as an efficient strategy to control pathogens. However, little is known about the structural properties of plant promiscuous AMPs without disulfide bonds. CD and NMR were used to elucidate the structure of the promiscuous peptide Cn-AMP1, a disulfide-free peptide isolated from green coconut water. Data here reported shows that peptide structure is transitory and could be different according to the micro-environment. In this regard, Cn-AMP1 showed a random coil in a water environment and an α-helical structure in the presence of SDS-d25 micelles. Moreover, deuterium exchange experiments showed that Gly4, Arg5 and Met9 residues are less accessible to solvent, suggesting that flexibility and cationic charges seem to be essential for Cn-AMP1 multiple activities.

  6. Isolation and Some Properties of the Antimicrobial Peptide (Pa-AMP) from the Seeds of Pokeweed (Phytolacca americana).

    PubMed

    Minami, Y; Higuchi, S; Yagi, F; Tadera, K

    1998-01-01

    An antimicrobial peptide, designated Pa-AMP, was purified by gel filtration on Sephadex G-75 followed by S-Sepharose, Cosmosil-SP, and reverse-phase HPLC from the seeds of pokeweed (Phytolacca americana). Pa-AMP is a basic peptide having an isoelectric point of over 10 and its extinction coefficient at 280 nm of 1% aqueous solution was 7.7. Pa-AMP has a molecular mass of 4 kDa and 3.4 kDa on tricine SDS-PAGE under nonreducing and reducing conditions, respectively. The N-terminal amino acid of Pa-AMP was blocked. The concentrations of peptide required for 50% inhibition (IC50) of the growth of plant pathogenic fungi, Gram-positive, and Gram-negative bacteria were 3 to 41 μg/ml. Differing from other peptides, Pa-AMP inhibited the growth of some Gram-negative bacteria.

  7. Cyclic nucleotides of cone-dominant retinas. Reduction of cyclic AMP levels by light and by cone degeneration.

    PubMed

    Farber, D B; Souza, D W; Chase, D G; Lolley, R N

    1981-01-01

    Dark-adapted retinas or whole eyes of 13-line ground squirrels (Citellus tridecemlineatus) and western fence lizards (Sceloporus occidentalis) contain higher levels of cyclic AMP than of cyclic GMP. In these cone-dominant retinas, light reduces cyclic AMP content selectively. Freezing of dark- or light-adapted retinas or eyes also reduces cyclic AMP content, with only minimal changes in cyclic GMP levels. In addition, exposure of frozen retinas of dark-adapted ground squirrel to light results in a significant decrease in cyclic AMP content. The destruction of cone visual cells of ground squirrel retina by iodoacetic acid injection decreases the cyclic nucleotide content of the dark-adapted retina. Considering the relative loss of cyclic nucleotides from cone degeneration, we estimate that the content of cyclic AMP in visual cells of ground squirrel retina is about four times greater than that of cyclic GMP. PMID:6256308

  8. The Role of Cyclic AMP in Normalizing the Function of Engineered Human Blood Microvessels in Microfluidic Collagen Gels

    PubMed Central

    Wong, Keith H. K.; Truslow, James G.; Tien, Joe

    2010-01-01

    Nearly all engineered tissues must eventually be vascularized to survive. To this end, we and others have recently developed methods to synthesize extracellular matrix-based scaffolds that contain open microfluidic networks. These scaffolds serve as templates for the formation of endothelial tubes that can be perfused; whether such microvascular structures are stable and/or functional is largely unknown. Here, we show that compounds that elevate intracellular concentrations of the second messenger cyclic AMP (cAMP) strongly normalize the phenotype of engineered human microvessels in microfluidic type I collagen gels. Cyclic AMP-elevating agents promoted vascular stability and barrier function, and reduced cellular turnover. Under conditions that induced the highest levels of cAMP, the physiology of engineered microvessels in vitro quantitatively mirrored that of native vessels in vivo. Computational analysis indicated that cAMP stabilized vessels partly via its enhancement of barrier function. PMID:20303168

  9. Terrestrial exposure and effects of Headline AMP(®) Fungicide on amphibians.

    PubMed

    Cusaac, J Patrick W; Mimbs, William H; Belden, Jason B; Smith, Loren M; McMurry, Scott T

    2015-08-01

    Recent studies have demonstrated that a pyraclostrobin-containing fungicide (Headline(®) Fungicide--Headline(®) Fungicide and Headline AMP(®) Fungicide are registered trademarks of BASF) is toxic to amphibians at environmentally relevant concentrations. However, these studies were performed in a laboratory setting of a worst-case direct exposure in clean media. Interception of spray by the crop canopy and ground cover used by animals for security cover will influence exposure. Thus, risk to amphibians is unclear in an environmentally realistic field environment. We tested exposure and toxicity of Headline AMP(®) Fungicide to amphibians in multiple agricultural habitat scenarios (e.g., within treated crop vs. grassy areas adjacent to crop) and at two rates during routine aerial application. Specifically, we placed Woodhouse's toads (Bufo woodhousii) and Blanchard's cricket frogs (Acris blanchardi) in enclosures located within treated and untreated corn (VT stage, approximate height = 3 m), and in the potential drift area (adjacent to treated corn) during aerial application of Headline AMP Fungicide at either 731 or 1052 ml/ha (70 and 100 % the maximum application rate in corn, respectively). Mean concentrations of pyraclostrobin measured at ground level were ≤19 % of nominal application rate in all areas. Overall, mean mortality of recovered individuals of both species was ≤15 %, and mortality within Headline AMP Fungicide-treated corn (where risk was anticipated to be highest) was <10 %. It is important to understand that application timing, interception by the crop canopy (which varies both within and between crop systems), and timing of amphibian presence in the crop field influences risk of exposure and effects; however, our results demonstrate that amphibians inhabiting VT stage corn during routine aerial application of Headline AMP Fungicide are at low risk for acute mortality, matching existing laboratory results from acute toxicity studies of

  10. ABCC5 is required for cAMP-mediated hindgut invagination in sea urchin embryos

    PubMed Central

    Shipp, Lauren E.; Hill, Rose Z.; Moy, Gary W.; Gökırmak, Tufan; Hamdoun, Amro

    2015-01-01

    ATP-binding cassette (ABC) transporters are evolutionarily conserved proteins that pump diverse substrates across membranes. Many are known to efflux signaling molecules and are extensively expressed during development. However, the role of transporters in moving extracellular signals that regulate embryogenesis is largely unexplored. Here, we show that a mesodermal ABCC (MRP) transporter is necessary for endodermal gut morphogenesis in sea urchin embryos. This transporter, Sp-ABCC5a (C5a), is expressed in pigment cells and their precursors, which are a subset of the non-skeletogenic mesoderm (NSM) cells. C5a expression depends on Delta/Notch signaling from skeletogenic mesoderm and is downstream of Gcm in the aboral NSM gene regulatory network. Long-term imaging of development reveals that C5a knockdown embryos gastrulate, but ∼90% develop a prolapse of the hindgut by the late prism stage (∼8 h after C5a protein expression normally peaks). Since C5a orthologs efflux cyclic nucleotides, and cAMP-dependent protein kinase (Sp-CAPK/PKA) is expressed in pigment cells, we examined whether C5a could be involved in gastrulation through cAMP transport. Consistent with this hypothesis, membrane-permeable pCPT-cAMP rescues the prolapse phenotype in C5a knockdown embryos, and causes archenteron hyper-invagination in control embryos. In addition, the cAMP-producing enzyme soluble adenylyl cyclase (sAC) is expressed in pigment cells, and its inhibition impairs gastrulation. Together, our data support a model in which C5a transports sAC-derived cAMP from pigment cells to control late invagination of the hindgut. Little is known about the ancestral functions of ABCC5/MRP5 transporters, and this study reveals a novel role for these proteins in mesoderm-endoderm signaling during embryogenesis. PMID:26395488

  11. Adenosine modulates light responses of rat retinal ganglion cell photoreceptors througha cAMP-mediated pathway

    PubMed Central

    Sodhi, Puneet; Hartwick, Andrew T E

    2014-01-01

    Adenosine is an established neuromodulator in the mammalian retina, with A1 adenosine receptors being especially prevalent in the innermost ganglion cell layer. Activation of A1 receptors causes inhibition of adenylate cyclase, decreases in intracellular cyclic AMP (cAMP) levels and inhibition of protein kinase A (PKA). In this work, our aim was to characterize the effects of adenosine on the light responses of intrinsically photosensitive retinal ganglion cells (ipRGCs) and to determine whether these photoreceptors are subject to neuromodulation through intracellular cAMP-related signalling pathways. Using multielectrode array recordings from postnatal and adult rat retinas, we demonstrated that adenosine significantly shortened the duration of ipRGC photoresponses and reduced the number of light-evoked spikes fired by these neurons. The effects were A1 adenosine receptor-mediated, and the expression of this receptor on melanopsin-containing ipRGCs was confirmed by calcium imaging experiments on isolated cells in purified cultures. While inhibition of the cAMP/PKA pathway by adenosine shortened ipRGC light responses, stimulation of this pathway with compounds such as forskolin had the opposite effect and lengthened the duration of ipRGC spiking. Our findings reveal that the modification of ipRGC photoresponses through a cAMP/PKA pathway is a general feature of rat ganglion cell photoreceptors, and this pathway can be inhibited through activation of A1 receptors by adenosine. As adenosine levels in the retina rise at night, adenosinergic modulation of ipRGCs may serve as an internal regulatory mechanism to limit transmission of nocturnal photic signals by ipRGCs to the brain. Targeting retinal A1 adenosine receptors for ipRGC inhibition represents a potential therapeutic target for sleep disorders and migraine-associated photophobia. PMID:25038240

  12. Coupling gene expression to cAMP signalling: role of CREB and CREM.

    PubMed

    Sassone-Corsi, P

    1998-01-01

    Several endocrine and neuronal functions are governed by the cAMP-dependent pathway. Transcriptional regulation upon stimulation of this pathway is mediated by a family of cAMP-responsive nuclear factors. This family consists of a large number of members, which may act as activators or repressors. These factors contain the basic domain/leucine zipper motifs and bind as dimers to cAMP-response elements (CRE). CRE-binding protein (CREBs) function is modulated by phosphorylation by several kinases. Direct activation of gene expression by CREB requires phosphorylation by the cAMP-dependent PKA to serine 133. Among the repressors, ICER (Inducible cAMP Early Repressor) deserves special mention. ICER is generated from an alternative CREM promoter and is the only inducible CRE-binding protein. ICER negatively autoregulates the alternative promoter, generating a feedback loop. ICER expression is tissue specific and developmentally regulated. The kinetics of ICER expression are characteristic of an early response gene. CREM plays a key physiological and developmental role within the hypothalamic-pituitary-gonadal axis. The transcriptional activator CREM is highly expressed in postmeiotic cells. The role of CREM in spermiogenesis was addressed using CREM knock-out mice. Spermatogenesis stops at the first step of spermiogenesis in the mutants and there is a significant increase in apoptotic germ cells. This phenotype is reminiscent of cases of human infertility. ICER is regulated in a circadian manner in the pineal gland, the site of the hormone melatonin production. This night-day oscillation is driven by the endogenous clock (located in the suprachiasmatic nucleus). The synthesis of melatonin is regulated by a rate-limiting enzyme, serotonin N-acetyltransferase (NAT). Analysis of the CREM-null mice and of the promoter of the NAT gene revealed that ICER controls the amplitude and rhythmicity of NAT, and thus the oscillation in the hormonal synthesis of melatonin.

  13. Modification by phosphate of PTH-dependent renal cyclic AMP response.

    PubMed

    Guillemant, J; Guillemant, S

    1993-04-01

    The PTH response and the renal cAMP response obtained after oral administration of either tricalcium phosphate or calcium gluconolactate were compared in 12 young adult males. Each subject was studied during a control period of two hours before and during an experimental period of four hours after ingestion of a single oral dose of calcium salt. The respective dosages (1.2 g of calcium plus 0.6 g phosphorus for tricalcium phosphate; 0.5 g of calcium for gluconolactate calcium) were chosen to provide similar significant (p = 0.0001) increases in serum ionized calcium (from 1.23 to 1.29 mmol/l vs from 1.23 to 1.28 mmol/l). After tricalcium phosphate a modest (10%) but significant (p < 0.001) rise in serum phosphate was observed. In both series of experiments similar inhibitory effects on PTH circulating levels were obtained (from 22.6 to 12.4 pg/ml after tricalcium phosphate and from 24.1 to 10.6 pg/ml after calcium gluconolactate). After ingestion of calcium gluconolactate the renal secretion of cAMP fell from 12.68 to 8.64 nmol/l GF (p < 0.001), whereas no significant alterations of the mean values of nephrogenous cAMP were detected after ingestion of tricalcium phosphate. In accordance with the role of cAMP as a second messenger, after calcium gluconolactate we obtained a significant increase in tubular maximal reabsorption of phosphate (p < 0.0001) contrasting with the absence of significant effect after tricalcium phosphate. The present results confirm that suppression of PTH secretion only depends on the rise of serum ionized calcium and suggest that additional phosphate administration could have a decoupling effect between PTH and renal cAMP secretion. PMID:8390394

  14. Characterization of ESBL- and AmpC-Producing Enterobacteriaceae from Diseased Companion Animals in Europe.

    PubMed

    Bogaerts, Pierre; Huang, Te-Din; Bouchahrouf, Warda; Bauraing, Caroline; Berhin, Catherine; El Garch, Farid; Glupczynski, Youri

    2015-12-01

    The study aimed to characterize beta-lactam resistance mechanisms of Enterobacteriaceae isolates recovered from diseased dogs and cats between 2008 and 2010 in a European surveillance program (ComPath I) for the antibiotic susceptibility of bacterial pathogens. A total of 608 non-duplicated Enterobacteriaceae isolates were obtained prior antibiotic treatment from diseased dogs (n=464) and cats (n=144). Among the 608 Enterobacteriaceae isolates, 22 presented a minimal inhibitory concentration against cefotaxime above EUCAST breakpoints of susceptibility. All the 22 isolates remained susceptible to carbapenems. Ten isolates were confirmed as extended-spectrum-beta-lactamase (ESBL) producers by PCR-sequencing of bla coding genes including 9 blaCTX-M (CTX-M-1, 14, 15, 32,…) and 1 blaTEM-52 and 12 were AmpC-producing isolates (10 plasmidic CMY-2 group and 2 isolates overexpressing their chromosomal AmpC). ESBLs and plasmid-mediated AmpC (pAmpC)-producing isolates were mainly recovered from dogs (n=17) suffering from urinary tract infections (n=13) and originated from eight different countries. ESBL-bearing plasmids were mostly associated with IncFII incompatibility groups while CMY-2 was predominantly associated with plasmid of the IncI1 group. ESBL/pAmpC-producing Escherichia coli belonged to phylogroup A (n=5), B2 (n=4), and D (n=5). Multilocus sequence typing analysis revealed that among three CTX-M-15-producing E. coli, two belong to sequence type (ST) 131 and one to ST405. The presence of CTX-M-15 including on IncFII plasmids in E. coli ST131-B2 has also been described in isolates of human origin. This suggests the possibility of exchanges of these isolates from humans to companion animals or vice-versa.

  15. Cell behavior in Dictyostelium discoideum: preaggregation response to localized cyclic AMP pulses

    PubMed Central

    1982-01-01

    The motion of cells in the aggregation phase of Dictyostelium discoideum development is complex. To probe its mechanisms we applied precisely timed (+/- 1 s) and positioned (+/-2 micrometers) pulses of cyclic AMP to fields of cells of moderate density using a micropipette. We recorded cell behavior by time lapse microcinematography and extracted cell motion data from the film with our Galatea computer system. Analysis of these data reveals: (a) Chemotaxis lasts only about as long as the cyclic AMP signal; in particular, brief pulses (approximately 5 s) do not induce chemotaxis. (b) Chemotactic competence increases gradually from within an hour after the initiation of development (starvation) to full competence at approximately 15 h when aggregation begins under our conditions. (c) Cell motion reverses rapidly (within 20 s) when the external gradient is reversed. There is no refractory period for motion. We present a new description of the process of aggregation consistent with our result and other recent findings. (d) The behavioral response to cyclic AMP includes a phenomenon we call "cringing." In a prototypical cringe the cell speed drops within 3 s after a brief cyclic AMP stimulus, and the cell stops and rounds and then resumes motion after 25 s. (e) The development of the speed response in cringing as the cells age closely parallels the development of the cyclic AMP-induced light-scattering response of cells in suspension. (f) Cringing occurs in natural populations during weak oriented movement. The computerized analysis of cell behavior proves to be a powerful technique which can reveal significant phenomena that are not apparent to the eye even after repeated examination of the film. PMID:6282894

  16. ABCC5 is required for cAMP-mediated hindgut invagination in sea urchin embryos.

    PubMed

    Shipp, Lauren E; Hill, Rose Z; Moy, Gary W; Gökırmak, Tufan; Hamdoun, Amro

    2015-10-15

    ATP-binding cassette (ABC) transporters are evolutionarily conserved proteins that pump diverse substrates across membranes. Many are known to efflux signaling molecules and are extensively expressed during development. However, the role of transporters in moving extracellular signals that regulate embryogenesis is largely unexplored. Here, we show that a mesodermal ABCC (MRP) transporter is necessary for endodermal gut morphogenesis in sea urchin embryos. This transporter, Sp-ABCC5a (C5a), is expressed in pigment cells and their precursors, which are a subset of the non-skeletogenic mesoderm (NSM) cells. C5a expression depends on Delta/Notch signaling from skeletogenic mesoderm and is downstream of Gcm in the aboral NSM gene regulatory network. Long-term imaging of development reveals that C5a knockdown embryos gastrulate, but ∼90% develop a prolapse of the hindgut by the late prism stage (∼8 h after C5a protein expression normally peaks). Since C5a orthologs efflux cyclic nucleotides, and cAMP-dependent protein kinase (Sp-CAPK/PKA) is expressed in pigment cells, we examined whether C5a could be involved in gastrulation through cAMP transport. Consistent with this hypothesis, membrane-permeable pCPT-cAMP rescues the prolapse phenotype in C5a knockdown embryos, and causes archenteron hyper-invagination in control embryos. In addition, the cAMP-producing enzyme soluble adenylyl cyclase (sAC) is expressed in pigment cells, and its inhibition impairs gastrulation. Together, our data support a model in which C5a transports sAC-derived cAMP from pigment cells to control late invagination of the hindgut. Little is known about the ancestral functions of ABCC5/MRP5 transporters, and this study reveals a novel role for these proteins in mesoderm-endoderm signaling during embryogenesis. PMID:26395488

  17. The Small Molecule Hyperphyllin Enhances Leaf Formation Rate and Mimics Shoot Meristem Integrity Defects Associated with AMP1 Deficiency.

    PubMed

    Poretska, Olena; Yang, Saiqi; Pitorre, Delphine; Rozhon, Wilfried; Zwerger, Karin; Uribe, Marcos Castellanos; May, Sean; McCourt, Peter; Poppenberger, Brigitte; Sieberer, Tobias

    2016-06-01

    ALTERED MERISTEM PROGRAM1 (AMP1) is a member of the M28 family of carboxypeptidases with a pivotal role in plant development and stress adaptation. Its most prominent mutant defect is a unique hypertrophic shoot phenotype combining a strongly increased organ formation rate with enhanced meristem size and the formation of ectopic meristem poles. However, so far the role of AMP1 in shoot development could not be assigned to a specific molecular pathway nor is its biochemical function resolved. In this work we evaluated the level of functional conservation between AMP1 and its human homolog HsGCPII, a tumor marker of medical interest. We show that HsGCPII cannot substitute AMP1 in planta and that an HsGCPII-specific inhibitor does not evoke amp1-specific phenotypes. We used a chemical genetic approach to identify the drug hyperphyllin (HP), which specifically mimics the shoot defects of amp1, including plastochron reduction and enlargement and multiplication of the shoot meristem. We assessed the structural requirements of HP activity and excluded that it is a cytokinin analog. HP-treated wild-type plants showed amp1-related tissue-specific changes of various marker genes and a significant transcriptomic overlap with the mutant. HP was ineffective in amp1 and elevated the protein levels of PHAVOLUTA, consistent with the postulated role of AMP1 in miRNA-controlled translation, further supporting an AMP1-related mode of action. Our work suggests that plant and animal members of the M28 family of proteases adopted unrelated functions. With HP we provide a tool to characterize the plant-specific functions of this important class of proteins. PMID:27208298

  18. Intracellular cyclic AMP not calcium, determines the direction of vesicle movement in melanophores: direct measurement by fluorescence ratio imaging

    PubMed Central

    1992-01-01

    Intracellular movement of vesiculated pigment granules in angelfish melanophores is regulated by a signalling pathway that triggers kinesin and dyneinlike microtubule motor proteins. We have tested the relative importance of intracellular Ca2+ ([Ca2+]i) vs cAMP ([cAMP]i) in the control of such motility by adrenergic agonists, using fluorescence ratio imaging and many ways to artificially stimulate or suppress signals in these pathways. Fura-2 imaging reported a [Ca2+]i elevation accompanying pigment aggregation, but this increase was not essential since movement was not induced with the calcium ionophore, ionomycin, nor was movement blocked when the increases were suppressed by withdrawal of extracellular Ca2+ or loading of intracellular BAPTA. The phosphatase inhibitor, okadaic acid, blocked aggregation and induced dispersion at concentrations that suggested that the protein phosphatase PP-1 or PP-2A was continuously turning phosphate over during intracellular motility. cAMP was monitored dynamically in single living cells by microinjecting cAMP-dependent kinase in which the catalytic and regulatory subunits were labeled with fluorescein and rhodamine respectively (Adams et al., 1991. Nature (Lond.). 349:694- 697). Ratio imaging of F1CRhR showed that the alpha 2-adrenergic receptor-mediated aggregation was accompanied by a dose-dependent decrease in [cAMP]i. The decrease in [cAMP]i was both necessary and sufficient for aggregation, since cAMP analogs or microinjected free catalytic subunit of A kinase-blocked aggregation or caused dispersal, whereas the cAMP antagonist RpcAMPs or the microinjection of the specific kinase inhibitor PKI5-24 amide induced aggregation. Our conclusion that cAMP, not calcium, controls bidirectional microtubule dependent motility in melanophores might be relevant to other instances of non-muscle cell motility. PMID:1348251

  19. Different roles of GNAS and cAMP signaling during early and late stages of osteogenic differentiation.

    PubMed

    Zhang, S; Kaplan, F S; Shore, E M

    2012-09-01

    Progressive osseous heteroplasia (POH) and fibrous dysplasia (FD) are genetic diseases of bone formation at opposite ends of the osteogenic spectrum: imperfect osteogenesis of the skeleton occurs in FD, while heterotopic ossification in skin, subcutaneous fat, and skeletal muscle forms in POH. POH is caused by heterozygous inactivating germline mutations in GNAS, which encodes G-protein subunits regulating the cAMP pathway, while FD is caused by GNAS somatic activating mutations. We used pluripotent mouse ES cells to examine the effects of Gnas dysregulation on osteoblast differentiation. At the earliest stages of osteogenesis, Gnas transcripts Gsα, XLαs and 1A are expressed at low levels and cAMP levels are also low. Inhibition of cAMP signaling (as in POH) by 2',5'-dideoxyadenosine enhanced osteoblast differentiation while conversely, increased cAMP signaling (as in FD), induced by forskolin, inhibited osteoblast differentiation. Notably, increased cAMP was inhibitory for osteogenesis only at early stages after osteogenic induction. Expression of osteogenic and adipogenic markers showed that increased cAMP enhanced adipogenesis and impaired osteoblast differentiation even in the presence of osteogenic factors, supporting cAMP as a critical regulator of osteoblast and adipocyte lineage commitment. Furthermore, increased cAMP signaling decreased BMP pathway signaling, indicating that G protein-cAMP pathway activation (as in FD) inhibits osteoblast differentiation, at least in part by blocking the BMP-Smad pathway, and suggesting that GNAS inactivation as occurs in POH enhances osteoblast differentiation, at least in part by stimulating BMP signaling. These data support that differences in cAMP levels during early stages of cell differentiation regulate cell fate decisions. Supporting information available online at http:/www.thieme-connect.de/ejournals/toc/hmr. PMID:22903279

  20. The signaling module cAMP/Epac/Rap1/PLCε/IP3 mobilizes acrosomal calcium during sperm exocytosis.

    PubMed

    Lucchesi, Ornella; Ruete, María C; Bustos, Matías A; Quevedo, María F; Tomes, Claudia N

    2016-04-01

    Exocytosis of the sperm's single secretory granule, or acrosome, is a regulated exocytosis triggered by components of the egg's investments. In addition to external calcium, sperm exocytosis (termed the acrosome reaction) requires cAMP synthesized endogenously and calcium mobilized from the acrosome through IP3-sensitive channels. The relevant cAMP target is Epac. In the first part of this paper, we present a novel tool (the TAT-cAMP sponge) to investigate cAMP-related signaling pathways in response to progesterone as acrosome reaction trigger. The TAT-cAMP sponge consists of the cAMP-binding sites of protein kinase A regulatory subunit RIβ fused to the protein transduction domain TAT of the human immunodeficiency virus-1. The sponge permeated into sperm, sequestered endogenous cAMP, and blocked exocytosis. Progesterone increased the population of sperm with Rap1-GTP, Rab3-GTP, and Rab27-GTP in the acrosomal region; pretreatment with the TAT-cAMP