Sample records for aeration-dependent gene expression

  1. Method of controlling gene expression


    Peters, Norman K.; Frost, John W.; Long, Sharon R.


    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  2. The flow of gene expression.


    Misteli, Tom


    Gene expression is a highly interconnected multistep process. A recent meeting in Iguazu Falls, Argentina, highlighted the need to uncover both the molecular details of each single step as well as the mechanisms of coordination among processes in order to fully understand the expression of genes.

  3. Discovering modulators of gene expression

    PubMed Central

    Babur, Özgün; Demir, Emek; Gönen, Mithat; Sander, Chris; Dogrusoz, Ugur


    Proteins that modulate the activity of transcription factors, often called modulators, play a critical role in creating tissue- and context-specific gene expression responses to the signals cells receive. GEM (Gene Expression Modulation) is a probabilistic framework that predicts modulators, their affected targets and mode of action by combining gene expression profiles, protein–protein interactions and transcription factor–target relationships. Using GEM, we correctly predicted a significant number of androgen receptor modulators and observed that most modulators can both act as co-activators and co-repressors for different target genes. PMID:20466809

  4. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian


    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  5. Monoallelic Gene Expression in Mammals.


    Chess, Andrew


    Monoallelic expression not due to cis-regulatory sequence polymorphism poses an intriguing problem in epigenetics because it requires the unequal treatment of two segments of DNA that are present in the same nucleus and that can indeed have absolutely identical sequences. Here, I focus on a few recent developments in the field of monoallelic expression that are of particular interest and raise interesting questions for future work. One development is regarding analyses of imprinted genes, in which recent work suggests the possibility that intriguing networks of imprinted genes exist and are important for genetic and physiological studies. Another issue that has been raised in recent years by a number of publications is the question of how skewed allelic expression should be for it to be designated as monoallelic expression and, further, what methods are appropriate or inappropriate for analyzing genomic data to examine allele-specific expression. Perhaps the most exciting recent development in mammalian monoallelic expression is a clever and carefully executed analysis of genetic diversity of autosomal genes subject to random monoallelic expression (RMAE), which provides compelling evidence for distinct evolutionary forces acting on random monoallelically expressed genes.

  6. Tuning noise in gene expression.


    Tyagi, Sanjay


    The relative contribution of promoter architecture and the associated chromatin environment in regulating gene expression noise has remained elusive. In their recent work, Arkin, Schaffer and colleagues (Dey et al, 2015) show that mean expression and noise for a given promoter at different genomic loci are uncorrelated and influenced by the local chromatin environment.

  7. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  8. Differential gene expression in glaucoma.


    Jakobs, Tatjana C


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  9. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa


    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  10. Zipf's Law in Gene Expression

    NASA Astrophysics Data System (ADS)

    Furusawa, Chikara; Kaneko, Kunihiko


    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  11. Neighboring Genes Show Correlated Evolution in Gene Expression.


    Ghanbarian, Avazeh T; Hurst, Laurence D


    When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking.

  12. Regulation of ABO gene expression.


    Kominato, Yoshihiko; Hata, Yukiko; Matsui, Kazuhiro; Takizawa, Hisao


    The ABO blood group system is important in blood transfusions and in identifying individuals during criminal investigations. Two carbohydrate antigens, the A and B antigens, and their antibodies constitute this system. Although biochemical and molecular genetic studies have demonstrated the molecular basis of the histo-blood group ABO system, some aspects remain to be elucidated. To explain the molecular basis of how the ABO genes are controlled in cell type-specific expression, during normal cell differentiation, and in cancer cells with invasive and metastatic potential that lack A/B antigens, it is essential to understand the regulatory mechanism of ABO gene transcription. We review the transcriptional regulation of the ABO gene, including positive and negative elements in the upstream region of the gene, and draw some inferences that help to explain the phenomena described above.

  13. Gene expression profile of pulpitis

    PubMed Central

    Galicia, Johnah C.; Henson, Brett R.; Parker, Joel S.; Khan, Asma A.


    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the Significance Analysis of Microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (≥30mm on VAS) compared to those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  14. Gene expression profile of pulpitis.


    Galicia, J C; Henson, B R; Parker, J S; Khan, A A


    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology.

  15. Gene expression throughout a vertebrate's embryogenesis

    PubMed Central


    Background Describing the patterns of gene expression during embryonic development has broadened our understanding of the processes and patterns that define morphogenesis. Yet gene expression patterns have not been described throughout vertebrate embryogenesis. This study presents statistical analyses of gene expression during all 40 developmental stages in the teleost Fundulus heteroclitus using four biological replicates per stage. Results Patterns of gene expression for 7,000 genes appear to be important as they recapitulate developmental timing. Among the 45% of genes with significant expression differences between pairs of temporally adjacent stages, significant differences in gene expression vary from as few as five to more than 660. Five adjacent stages have disproportionately more significant changes in gene expression (> 200 genes) relative to other stages: four to eight and eight to sixteen cell stages, onset of circulation, pre and post-hatch, and during complete yolk absorption. The fewest differences among adjacent stages occur during gastrulation. Yet, at stage 16, (pre-mid-gastrulation) the largest number of genes has peak expression. This stage has an over representation of genes in oxidative respiration and protein expression (ribosomes, translational genes and proteases). Unexpectedly, among all ribosomal genes, both strong positive and negative correlations occur. Similar correlated patterns of expression occur among all significant genes. Conclusions These data provide statistical support for the temporal dynamics of developmental gene expression during all stages of vertebrate development. PMID:21356103

  16. Does FACS perturb gene expression?


    Richardson, Graham M; Lannigan, Joanne; Macara, Ian G


    Fluorescence activated cell sorting is the technique most commonly used to separate primary mammary epithelial sub-populations. Many studies incorporate this technique before analyzing gene expression within specific cellular lineages. However, to our knowledge, no one has examined the effects of fluorescence activated cell sorting (FACS) separation on short-term transcriptional profiles. In this study, we isolated a heterogeneous mixture of cells from the mouse mammary gland. To determine the effects of the isolation and separation process on gene expression, we harvested RNA from the cells before enzymatic digestion, following enzymatic digestion, and following a mock FACS sort where the entire cohort of cells was retained. A strict protocol was followed to minimize disruption to the cells, and to ensure that no subpopulations were enriched or lost. Microarray analysis demonstrated that FACS causes minimal disruptions to gene expression patterns, but prior steps in the mammary cell isolation process are followed by upregulation of 18 miRNA's and rapid decreases in their predicted target transcripts. © 2015 International Society for Advancement of Cytometry.

  17. The Gene Expression Omnibus Database.


    Clough, Emily; Barrett, Tanya


    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome-protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at

  18. Classification of genes based on gene expression analysis

    SciTech Connect

    Angelova, M. Myers, C. Faith, J.


    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  19. Harnessing gene expression networks to prioritize candidate epileptic encephalopathy genes.


    Oliver, Karen L; Lukic, Vesna; Thorne, Natalie P; Berkovic, Samuel F; Scheffer, Ingrid E; Bahlo, Melanie


    We apply a novel gene expression network analysis to a cohort of 182 recently reported candidate Epileptic Encephalopathy genes to identify those most likely to be true Epileptic Encephalopathy genes. These candidate genes were identified as having single variants of likely pathogenic significance discovered in a large-scale massively parallel sequencing study. Candidate Epileptic Encephalopathy genes were prioritized according to their co-expression with 29 known Epileptic Encephalopathy genes. We utilized developing brain and adult brain gene expression data from the Allen Human Brain Atlas (AHBA) and compared this to data from Celsius: a large, heterogeneous gene expression data warehouse. We show replicable prioritization results using these three independent gene expression resources, two of which are brain-specific, with small sample size, and the third derived from a heterogeneous collection of tissues with large sample size. Of the nineteen genes that we predicted with the highest likelihood to be true Epileptic Encephalopathy genes, two (GNAO1 and GRIN2B) have recently been independently reported and confirmed. We compare our results to those produced by an established in silico prioritization approach called Endeavour, and finally present gene expression networks for the known and candidate Epileptic Encephalopathy genes. This highlights sub-networks of gene expression, particularly in the network derived from the adult AHBA gene expression dataset. These networks give clues to the likely biological interactions between Epileptic Encephalopathy genes, potentially highlighting underlying mechanisms and avenues for therapeutic targets.

  20. Pulmonary Gene Expression Profiling of Inhaled Ricin

    DTIC Science & Technology


    in which 34 genes had statistically significant changes in gene expression. Transcripts identified by the assay included those that facilitate...gene expression. Transcripts identified by the assay included those that facilitate tissue healing (early growth response gene (egr)-1), regulate...impingement to determine aerosol concentration. Ricin concentrations from impinger samples were measured by protein assay (Pierce, MicroBCA, Rockford

  1. Does inbreeding affect gene expression in birds?


    Hansson, Bengt; Naurin, Sara; Hasselquist, Dennis


    Inbreeding increases homozygosity, exposes genome-wide recessive deleterious alleles and often reduces fitness. The physiological and reproductive consequences of inbreeding may be manifested already during gene regulation, but the degree to which inbreeding influences gene expression is unknown in most organisms, including in birds. To evaluate the pattern of inbreeding-affected gene expression over the genome and in relation to sex, we performed a transcriptome-wide gene expression (10 695 genes) study of brain tissue of 10-day-old inbred and outbred, male and female zebra finches. We found significantly lower gene expression in females compared with males at Z-linked genes, confirming that dosage compensation is incomplete in female birds. However, inbreeding did not affect gene expression at autosomal or sex-linked genes, neither in males nor in females. Analyses of single genes again found a clear sex-biased expression at Z-linked genes, whereas only a single gene was significantly affected by inbreeding. The weak effect of inbreeding on gene expression in zebra finches contrasts to the situation, for example, in Drosophila where inbreeding has been found to influence gene expression more generally and at stress-related genes in particular.

  2. [Neuronal plasticity and gene expression].


    Sokolova, O O; Shtark, M B; Lisachev, P D


    Neuronal plasticity--a fundamental feature of brain--provides adequate interactions with dynamic environment. One of the most deeply investigated forms of the neuronal plasticity is a long-term potentiation (LTP)--a phenomenon underlying learning and memory. Signal paths activated during LTP converge into the nuclear of the neuron, giving rise to launch of the molecular-genetic programs, which mediate structural and functional remodeling of synapses. In the review data concerning involvement of multilevel gene expression into plastic change under neuronal activation are summarized.

  3. Mechanoregulation of gene expression in fibroblasts

    PubMed Central

    Wang, James H.-C.; Thampatty, Bhavani P.; Lin, Jeen-Shang; Im, Hee-Jeong


    Mechanical loads placed on connective tissues alter gene expression in fibroblasts through mechanotransduction mechanisms by which cells convert mechanical signals into cellular biological events, such as gene expression of extracellular matrix components (e.g., collagen). This mechanical regulation of ECM gene expression affords maintenance of connective tissue homeostasis. However, mechanical loads can also interfere with homeostatic cellular gene expression and consequently cause the pathogenesis of connective tissue diseases such as tendinopathy and osteoarthritis. Therefore, the regulation of gene expression by mechanical loads is closely related to connective tissue physiology and pathology. This article reviews the effects of various mechanical loading conditions on gene regulation in fibroblasts and discusses several mechanotransduction mechanisms. Future research directions in mechanoregulation of gene expression are also suggested. PMID:17331678

  4. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.


    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  5. Norovirus gene expression and replication.


    Thorne, Lucy G; Goodfellow, Ian G


    Noroviruses are small, positive-sense RNA viruses within the family Caliciviridae, and are now accepted widely as a major cause of acute gastroenteritis in both developed and developing countries. Despite their impact, our understanding of the life cycle of noroviruses has lagged behind that of other RNA viruses due to the inability to culture human noroviruses (HuNVs). Our knowledge of norovirus biology has improved significantly over the past decade as a result of numerous technological advances. The use of a HuNV replicon, improved biochemical and cell-based assays, combined with the discovery of a murine norovirus capable of replication in cell culture, has improved greatly our understanding of the molecular mechanisms of norovirus genome translation and replication, as well as the interaction with host cell processes. In this review, the current state of knowledge of the intracellular life of noroviruses is discussed with particular emphasis on the mechanisms of viral gene expression and viral genome replication.

  6. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K


    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  7. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  8. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  9. Methods for monitoring multiple gene expression


    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  10. Estimation and Testing of Gene Expression Heterosis

    PubMed Central

    Liu, Peng; Nettleton, Dan


    Heterosis, also known as the hybrid vigor, occurs when the mean phenotype of hybrid off-spring is superior to that of its two inbred parents. The heterosis phenomenon is extensively utilized in agriculture though the molecular basis is still unknown. In an effort to understand phenotypic heterosis at the molecular level, researchers have begun to compare expression levels of thousands of genes between parental inbred lines and their hybrid offspring to search for evidence of gene expression heterosis. Standard statistical approaches for separately analyzing expression data for each gene can produce biased and highly variable estimates and unreliable tests of heterosis. To address these shortcomings, we develop a hierarchical model to borrow information across genes. Using our modeling framework, we derive empirical Bayes estimators and an inference strategy to identify gene expression heterosis. Simulation results show that our proposed method outperforms the more traditional strategy used to detect gene expression heterosis. This article has supplementary material online. PMID:25435758

  11. Estimation and Testing of Gene Expression Heterosis.


    Ji, Tieming; Liu, Peng; Nettleton, Dan


    Heterosis, also known as the hybrid vigor, occurs when the mean phenotype of hybrid off-spring is superior to that of its two inbred parents. The heterosis phenomenon is extensively utilized in agriculture though the molecular basis is still unknown. In an effort to understand phenotypic heterosis at the molecular level, researchers have begun to compare expression levels of thousands of genes between parental inbred lines and their hybrid offspring to search for evidence of gene expression heterosis. Standard statistical approaches for separately analyzing expression data for each gene can produce biased and highly variable estimates and unreliable tests of heterosis. To address these shortcomings, we develop a hierarchical model to borrow information across genes. Using our modeling framework, we derive empirical Bayes estimators and an inference strategy to identify gene expression heterosis. Simulation results show that our proposed method outperforms the more traditional strategy used to detect gene expression heterosis. This article has supplementary material online.

  12. Gene Expression Patterns in Ovarian Carcinomas

    PubMed Central

    Schaner, Marci E.; Ross, Douglas T.; Ciaravino, Giuseppe; Sørlie, Therese; Troyanskaya, Olga; Diehn, Maximilian; Wang, Yan C.; Duran, George E.; Sikic, Thomas L.; Caldeira, Sandra; Skomedal, Hanne; Tu, I-Ping; Hernandez-Boussard, Tina; Johnson, Steven W.; O'Dwyer, Peter J.; Fero, Michael J.; Kristensen, Gunnar B.; Børresen-Dale, Anne-Lise; Hastie, Trevor; Tibshirani, Robert; van de Rijn, Matt; Teng, Nelson N.; Longacre, Teri A.; Botstein, David; Brown, Patrick O.; Sikic, Branimir I.


    We used DNA microarrays to characterize the global gene expression patterns in surface epithelial cancers of the ovary. We identified groups of genes that distinguished the clear cell subtype from other ovarian carcinomas, grade I and II from grade III serous papillary carcinomas, and ovarian from breast carcinomas. Six clear cell carcinomas were distinguished from 36 other ovarian carcinomas (predominantly serous papillary) based on their gene expression patterns. The differences may yield insights into the worse prognosis and therapeutic resistance associated with clear cell carcinomas. A comparison of the gene expression patterns in the ovarian cancers to published data of gene expression in breast cancers revealed a large number of differentially expressed genes. We identified a group of 62 genes that correctly classified all 125 breast and ovarian cancer specimens. Among the best discriminators more highly expressed in the ovarian carcinomas were PAX8 (paired box gene 8), mesothelin, and ephrin-B1 (EFNB1). Although estrogen receptor was expressed in both the ovarian and breast cancers, genes that are coregulated with the estrogen receptor in breast cancers, including GATA-3, LIV-1, and X-box binding protein 1, did not show a similar pattern of coexpression in the ovarian cancers. PMID:12960427

  13. Arabidopsis gene expression patterns during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  14. Stratified gene expression analysis identifies major amyotrophic lateral sclerosis genes.


    Jones, Ashley R; Troakes, Claire; King, Andrew; Sahni, Vibhu; De Jong, Simone; Bossers, Koen; Papouli, Efterpi; Mirza, Muddassar; Al-Sarraj, Safa; Shaw, Christopher E; Shaw, Pamela J; Kirby, Janine; Veldink, Jan H; Macklis, Jeffrey D; Powell, John F; Al-Chalabi, Ammar


    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of motor neurons resulting in progressive paralysis. Gene expression studies of ALS only rarely identify the same gene pathways as gene association studies. We hypothesized that analyzing tissues by matching on degree of disease severity would identify different patterns of gene expression from a traditional case-control comparison. We analyzed gene expression changes in 4 postmortem central nervous system regions, stratified by severity of motor neuron loss. An overall comparison of cases (n = 6) and controls (n = 3) identified known ALS gene, SOX5, as showing differential expression (log2 fold change = 0.09, p = 5.5 × 10(-5)). Analyses stratified by disease severity identified expression changes in C9orf72 (p = 2.77 × 10(-3)), MATR3 (p = 3.46 × 10(-3)), and VEGFA (p = 8.21 × 10(-4)), all implicated in ALS through genetic studies, and changes in other genes in pathways involving RNA processing and immune response. These findings suggest that analysis of gene expression stratified by disease severity can identify major ALS genes and may be more efficient than traditional case-control comparison.

  15. Gene Expression Noise, Fitness Landscapes, and Evolution

    NASA Astrophysics Data System (ADS)

    Charlebois, Daniel

    The stochastic (or noisy) process of gene expression can have fitness consequences for living organisms. For example, gene expression noise facilitates the development of drug resistance by increasing the time scale at which beneficial phenotypic states can be maintained. The present work investigates the relationship between gene expression noise and the fitness landscape. By incorporating the costs and benefits of gene expression, we track how the fluctuation magnitude and timescale of expression noise evolve in simulations of cell populations under stress. We find that properties of expression noise evolve to maximize fitness on the fitness landscape, and that low levels of expression noise emerge when the fitness benefits of gene expression exceed the fitness costs (and that high levels of noise emerge when the costs of expression exceed the benefits). The findings from our theoretical/computational work offer new hypotheses on the development of drug resistance, some of which are now being investigated in evolution experiments in our laboratory using well-characterized synthetic gene regulatory networks in budding yeast. Nserc Postdoctoral Fellowship (Grant No. PDF-453977-2014).

  16. Gene expression in the etiology of schizophrenia.


    Bray, Nicholas J


    Gene expression represents a fundamental interface between genes and environment in the development and ongoing plasticity of the human brain. Individual differences in gene expression are likely to underpin much of human diversity, including psychiatric illness. In the past decade, the development of microarray and proteomic technology has enabled global description of gene expression in schizophrenia. However, it is difficult on the basis of gene expression assays alone to distinguish between those changes that constitute primary etiology and those that reflect secondary pathology, compensatory mechanisms, or confounding influences. In this respect, tests of genetic association with schizophrenia will be instructive because changes in gene expression that result from gene variants that are associated with the disorder are likely to be of primary etiological significance. However, regulatory polymorphism is extremely difficult to recognize on the basis of sequence interrogation alone. Functional assays at the messenger RNA and/or protein level will be essential in elucidating the molecular mechanisms underlying genetic association with schizophrenia and are likely to become increasingly important in the identification of regulatory variants with which to test for association with the disorder and related traits. Once established, etiologically relevant changes in gene expression can be recapitulated in model systems in order to elucidate the molecular and physiological pathways that may ultimately give rise to the condition.

  17. Noise minimisation in gene expression switches.


    Monteoliva, Diana; McCarthy, Christina B; Diambra, Luis


    Gene expression is subject to stochastic variation which leads to fluctuations in the rate of protein production. Recently, a study in yeast at a genomic scale showed that, in some cases, gene expression variability alters phenotypes while, in other cases, these remain unchanged despite fluctuations in the expression of other genes. These studies suggested that noise in gene expression is a physiologically relevant trait and, to prevent harmful stochastic variation in the expression levels of some genes, it can be subject to minimisation. However, the mechanisms for noise minimisation are still unclear. In the present work, we analysed how noise expression depends on the architecture of the cis-regulatory system, in particular on the number of regulatory binding sites. Using analytical calculations and stochastic simulations, we found that the fluctuation level in noise expression decreased with the number of regulatory sites when regulatory transcription factors interacted with only one other bound transcription factor. In contrast, we observed that there was an optimal number of binding sites when transcription factors interacted with many bound transcription factors. This finding suggested a new mechanism for preventing large fluctuations in the expression of genes which are sensitive to the concentration of regulators.

  18. Noise Minimisation in Gene Expression Switches

    PubMed Central

    Monteoliva, Diana; McCarthy, Christina B.; Diambra, Luis


    Gene expression is subject to stochastic variation which leads to fluctuations in the rate of protein production. Recently, a study in yeast at a genomic scale showed that, in some cases, gene expression variability alters phenotypes while, in other cases, these remain unchanged despite fluctuations in the expression of other genes. These studies suggested that noise in gene expression is a physiologically relevant trait and, to prevent harmful stochastic variation in the expression levels of some genes, it can be subject to minimisation. However, the mechanisms for noise minimisation are still unclear. In the present work, we analysed how noise expression depends on the architecture of the cis-regulatory system, in particular on the number of regulatory binding sites. Using analytical calculations and stochastic simulations, we found that the fluctuation level in noise expression decreased with the number of regulatory sites when regulatory transcription factors interacted with only one other bound transcription factor. In contrast, we observed that there was an optimal number of binding sites when transcription factors interacted with many bound transcription factors. This finding suggested a new mechanism for preventing large fluctuations in the expression of genes which are sensitive to the concentration of regulators. PMID:24376783

  19. Nucleosome repositioning underlies dynamic gene expression.


    Nocetti, Nicolas; Whitehouse, Iestyn


    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions.

  20. Gene Expression Patterns in Human Liver Cancers

    PubMed Central

    Chen, Xin; Cheung, Siu Tim; So, Samuel; Fan, Sheung Tat; Barry, Christopher; Higgins, John; Lai, Kin-Man; Ji, Jiafu; Dudoit, Sandrine; Ng, Irene O.L.; van de Rijn, Matt; Botstein, David; Brown, Patrick O.


    Hepatocellular carcinoma (HCC) is a leading cause of death worldwide. Using cDNA microarrays to characterize patterns of gene expression in HCC, we found consistent differences between the expression patterns in HCC compared with those seen in nontumor liver tissues. The expression patterns in HCC were also readily distinguished from those associated with tumors metastatic to liver. The global gene expression patterns intrinsic to each tumor were sufficiently distinctive that multiple tumor nodules from the same patient could usually be recognized and distinguished from all the others in the large sample set on the basis of their gene expression patterns alone. The distinctive gene expression patterns are characteristic of the tumors and not the patient; the expression programs seen in clonally independent tumor nodules in the same patient were no more similar than those in tumors from different patients. Moreover, clonally related tumor masses that showed distinct expression profiles were also distinguished by genotypic differences. Some features of the gene expression patterns were associated with specific phenotypic and genotypic characteristics of the tumors, including growth rate, vascular invasion, and p53 overexpression. PMID:12058060

  1. Digital gene expression signatures for maize development.


    Eveland, Andrea L; Satoh-Nagasawa, Namiko; Goldshmidt, Alexander; Meyer, Sandra; Beatty, Mary; Sakai, Hajime; Ware, Doreen; Jackson, David


    Genome-wide expression signatures detect specific perturbations in developmental programs and contribute to functional resolution of key regulatory networks. In maize (Zea mays) inflorescences, mutations in the RAMOSA (RA) genes affect the determinacy of axillary meristems and thus alter branching patterns, an important agronomic trait. In this work, we developed and tested a framework for analysis of tag-based, digital gene expression profiles using Illumina's high-throughput sequencing technology and the newly assembled B73 maize reference genome. We also used a mutation in the RA3 gene to identify putative expression signatures specific to stem cell fate in axillary meristem determinacy. The RA3 gene encodes a trehalose-6-phosphate phosphatase and may act at the interface between developmental and metabolic processes. Deep sequencing of digital gene expression libraries, representing three biological replicate ear samples from wild-type and ra3 plants, generated 27 million 20- to 21-nucleotide reads with frequencies spanning 4 orders of magnitude. Unique sequence tags were anchored to 3'-ends of individual transcripts by DpnII and NlaIII digests, which were multiplexed during sequencing. We mapped 86% of nonredundant signature tags to the maize genome, which associated with 37,117 gene models and unannotated regions of expression. In total, 66% of genes were detected by at least nine reads in immature maize ears. We used comparative genomics to leverage existing information from Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) in functional analyses of differentially expressed maize genes. Results from this study provide a basis for the analysis of short-read expression data in maize and resolved specific expression signatures that will help define mechanisms of action for the RA3 gene.

  2. Gene expression homeostasis and chromosome architecture

    PubMed Central

    Seshasayee, Aswin Sai Narain


    In rapidly growing populations of bacterial cells, including those of the model organism Escherichia coli, genes essential for growth - such as those involved in protein synthesis - are expressed at high levels; this is in contrast to many horizontally-acquired genes, which are maintained at low transcriptional levels.1 This balance in gene expression states between 2 distinct classes of genes is established by a galaxy of transcriptional regulators, including the so-called nucleoid associated proteins (NAP) that contribute to shaping the chromosome.2 Besides these active players in gene regulation, it is not too far-fetched to anticipate that genome organization in terms of how genes are arranged on the chromosome,3 which is the result of long-drawn transactions among genome rearrangement processes and selection, and the manner in which it is structured inside the cell, plays a role in establishing this balance. A recent study from our group has contributed to the literature investigating the interplay between global transcriptional regulators and genome organization in establishing gene expression homeostasis.4 In particular, we address a triangle of functional interactions among genome organization, gene expression homeostasis and horizontal gene transfer. PMID:25997086

  3. Unmasking ultradian rhythms in gene expression

    PubMed Central

    van der Veen, Daan R.; Gerkema, Menno P.


    Biological oscillations with an ultradian time scale of 1 to several hours include cycles in behavioral arousal, episodic glucocorticoid release, and gene expression. Ultradian rhythms are thought to have an extrinsic origin because of a perceived absence of ultradian rhythmicity in vitro and a lack of known molecular ultradian oscillators. We designed a novel, non–spectral-analysis method of separating ultradian from circadian components and applied it to a published gene expression dataset with an ultradian sampling resolution. Ultradian rhythms in mouse hepatocytes in vivo have been published, and we validated our approach using this control by confirming 175 of 323 ultradian genes identified in a prior study and found 862 additional ultradian genes. For the first time, we now report ultradian expression of >900 genes in vitro. Sixty genes exhibited ultradian transcriptional rhythmicity, both in vivo and in vitro, including 5 genes involved in the cell cycle. Within these 60 genes, we identified significant enrichment of specific DNA motifs in the 1000 bp proximal promotor, some of which associate with known transcriptional factors. These findings are in strong support of instrinsically driven ultradian rhythms and expose potential molecular mechanisms and functions underlying ultradian rhythms that remain unknown.—Van der Veen, D. R., Gerkema, M. P. Unmasking ultradian rhythms in gene expression. PMID:27871062

  4. Expression of polarity genes in human cancer.


    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z


    Polarity protein complexes are crucial for epithelial apical-basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function.

  5. Regulation of Gene Expression in Protozoa Parasites

    PubMed Central

    Gomez, Consuelo; Esther Ramirez, M.; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A.


    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis. PMID:20204171

  6. Dynamic modeling of gene expression data

    NASA Technical Reports Server (NTRS)

    Holter, N. S.; Maritan, A.; Cieplak, M.; Fedoroff, N. V.; Banavar, J. R.


    We describe the time evolution of gene expression levels by using a time translational matrix to predict future expression levels of genes based on their expression levels at some initial time. We deduce the time translational matrix for previously published DNA microarray gene expression data sets by modeling them within a linear framework by using the characteristic modes obtained by singular value decomposition. The resulting time translation matrix provides a measure of the relationships among the modes and governs their time evolution. We show that a truncated matrix linking just a few modes is a good approximation of the full time translation matrix. This finding suggests that the number of essential connections among the genes is small.

  7. Mining Gene Expression Data of Multiple Sclerosis

    PubMed Central

    Zhu, Zhenli; Huang, Zhengliang; Li, Ke


    Objectives Microarray produces a large amount of gene expression data, containing various biological implications. The challenge is to detect a panel of discriminative genes associated with disease. This study proposed a robust classification model for gene selection using gene expression data, and performed an analysis to identify disease-related genes using multiple sclerosis as an example. Materials and methods Gene expression profiles based on the transcriptome of peripheral blood mononuclear cells from a total of 44 samples from 26 multiple sclerosis patients and 18 individuals with other neurological diseases (control) were analyzed. Feature selection algorithms including Support Vector Machine based on Recursive Feature Elimination, Receiver Operating Characteristic Curve, and Boruta algorithms were jointly performed to select candidate genes associating with multiple sclerosis. Multiple classification models categorized samples into two different groups based on the identified genes. Models’ performance was evaluated using cross-validation methods, and an optimal classifier for gene selection was determined. Results An overlapping feature set was identified consisting of 8 genes that were differentially expressed between the two phenotype groups. The genes were significantly associated with the pathways of apoptosis and cytokine-cytokine receptor interaction. TNFSF10 was significantly associated with multiple sclerosis. A Support Vector Machine model was established based on the featured genes and gave a practical accuracy of ∼86%. This binary classification model also outperformed the other models in terms of Sensitivity, Specificity and F1 score. Conclusions The combined analytical framework integrating feature ranking algorithms and Support Vector Machine model could be used for selecting genes for other diseases. PMID:24932510

  8. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C


    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  9. Imputing gene expression to maximize platform compatibility.


    Zhou, Weizhuang; Han, Lichy; Altman, Russ B


    Microarray measurements of gene expression constitute a large fraction of publicly shared biological data, and are available in the Gene Expression Omnibus (GEO). Many studies use GEO data to shape hypotheses and improve statistical power. Within GEO, the Affymetrix HG-U133A and HG-U133 Plus 2.0 are the two most commonly used microarray platforms for human samples; the HG-U133 Plus 2.0 platform contains 54 220 probes and the HG-U133A array contains a proper subset (21 722 probes). When different platforms are involved, the subset of common genes is most easily compared. This approach results in the exclusion of substantial measured data and can limit downstream analysis. To predict the expression values for the genes unique to the HG-U133 Plus 2.0 platform, we constructed a series of gene expression inference models based on genes common to both platforms. Our model predicts gene expression values that are within the variability observed in controlled replicate studies and are highly correlated with measured data. Using six previously published studies, we also demonstrate the improved performance of the enlarged feature space generated by our model in downstream analysis.

  10. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.


    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana


    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  11. Perspectives: Gene Expression in Fisheries Management

    USGS Publications Warehouse

    Nielsen, Jennifer L.; Pavey, Scott A.


    Functional genes and gene expression have been connected to physiological traits linked to effective production and broodstock selection in aquaculture, selective implications of commercial fish harvest, and adaptive changes reflected in non-commercial fish populations subject to human disturbance and climate change. Gene mapping using single nucleotide polymorphisms (SNPs) to identify functional genes, gene expression (analogue microarrays and real-time PCR), and digital sequencing technologies looking at RNA transcripts present new concepts and opportunities in support of effective and sustainable fisheries. Genomic tools have been rapidly growing in aquaculture research addressing aspects of fish health, toxicology, and early development. Genomic technologies linking effects in functional genes involved in growth, maturation and life history development have been tied to selection resulting from harvest practices. Incorporating new and ever-increasing knowledge of fish genomes is opening a different perspective on local adaptation that will prove invaluable in wild fish conservation and management. Conservation of fish stocks is rapidly incorporating research on critical adaptive responses directed at the effects of human disturbance and climate change through gene expression studies. Genomic studies of fish populations can be generally grouped into three broad categories: 1) evolutionary genomics and biodiversity; 2) adaptive physiological responses to a changing environment; and 3) adaptive behavioral genomics and life history diversity. We review current genomic research in fisheries focusing on those that use microarrays to explore differences in gene expression among phenotypes and within or across populations, information that is critically important to the conservation of fish and their relationship to humans.

  12. Control of gene expression in trypanosomes.

    PubMed Central

    Vanhamme, L; Pays, E


    Trypanosomes are protozoan agents of major parasitic diseases such as Chagas' disease in South America and sleeping sickness of humans and nagana disease of cattle in Africa. They are transmitted to mammalian hosts by specific insect vectors. Their life cycle consists of a succession of differentiation and growth phases requiring regulated gene expression to adapt to the changing extracellular environment. Typical of such stage-specific expression is that of the major surface antigens of Trypanosoma brucei, procyclin in the procyclic (insect) form and the variant surface glycoprotein (VSG) in the bloodstream (mammalian) form. In trypanosomes, the regulation of gene expression is effected mainly at posttranscriptional levels, since primary transcription of most of the genes occurs in long polycistronic units and is constitutive. The transcripts are processed by transsplicing and polyadenylation under the influence of intergenic polypyrimidine tracts. These events show some developmental regulation. Untranslated sequences of the mRNAs seem to play a prominent role in the stage-specific control of individual gene expression, through a modulation of mRNA abundance. The VSG and procyclin transcription units exhibit particular features that are probably related to the need for a high level of expression. The promoters and RNA polymerase driving the expression of these units resemble those of the ribosomal genes. Their mutually exclusive expression is ensured by controls operating at several levels, including RNA elongation. Antigenic variation in the bloodstream is achieved through DNA rearrangements or alternative activation of the telomeric VSG gene expression sites. Recent discoveries, such as the existence of a novel nucleotide in telomeric DNA and the generation of point mutations in VSG genes, have shed new light on the mechanisms and consequences of antigenic variation. PMID:7603410

  13. Resource Sharing Controls Gene Expression Bursting.


    Caveney, Patrick M; Norred, S Elizabeth; Chin, Charles W; Boreyko, Jonathan B; Razooky, Brandon S; Retterer, Scott T; Collier, C Patrick; Simpson, Michael L


    Episodic gene expression, with periods of high expression separated by periods of no expression, is a pervasive biological phenomenon. This bursty pattern of expression draws from a finite reservoir of expression machinery in a highly time variant way, i.e., requiring no resources most of the time but drawing heavily on them during short intense bursts, that intimately links expression bursting and resource sharing. Yet, most recent investigations have focused on specific molecular mechanisms intrinsic to the bursty behavior of individual genes, while little is known about the interplay between resource sharing and global expression bursting behavior. Here, we confine Escherichia coli cell extract in both cell-sized microfluidic chambers and lipid-based vesicles to explore how resource sharing influences expression bursting. Interestingly, expression burst size, but not burst frequency, is highly sensitive to the size of the shared transcription and translation resource pools. The intriguing implication of these results is that expression bursts are more readily amplified than initiated, suggesting that burst formation occurs through positive feedback or cooperativity. When extrapolated to prokaryotic cells, these results suggest that large translational bursts may be correlated with large transcriptional bursts. This correlation is supported by recently reported transcription and translation bursting studies in E. coli. The results reported here demonstrate a strong intimate link between global expression burst patterns and resource sharing, and they suggest that bursting plays an important role in optimizing the use of limited, shared expression resources.

  14. Application of multidisciplinary analysis to gene expression.

    SciTech Connect

    Wang, Xuefel; Kang, Huining; Fields, Chris; Cowie, Jim R.; Davidson, George S.; Haaland, David Michael; Sibirtsev, Valeriy; Mosquera-Caro, Monica P.; Xu, Yuexian; Martin, Shawn Bryan; Helman, Paul; Andries, Erik; Ar, Kerem; Potter, Jeffrey; Willman, Cheryl L.; Murphy, Maurice H.


    Molecular analysis of cancer, at the genomic level, could lead to individualized patient diagnostics and treatments. The developments to follow will signal a significant paradigm shift in the clinical management of human cancer. Despite our initial hopes, however, it seems that simple analysis of microarray data cannot elucidate clinically significant gene functions and mechanisms. Extracting biological information from microarray data requires a complicated path involving multidisciplinary teams of biomedical researchers, computer scientists, mathematicians, statisticians, and computational linguists. The integration of the diverse outputs of each team is the limiting factor in the progress to discover candidate genes and pathways associated with the molecular biology of cancer. Specifically, one must deal with sets of significant genes identified by each method and extract whatever useful information may be found by comparing these different gene lists. Here we present our experience with such comparisons, and share methods developed in the analysis of an infant leukemia cohort studied on Affymetrix HG-U95A arrays. In particular, spatial gene clustering, hyper-dimensional projections, and computational linguistics were used to compare different gene lists. In spatial gene clustering, different gene lists are grouped together and visualized on a three-dimensional expression map, where genes with similar expressions are co-located. In another approach, projections from gene expression space onto a sphere clarify how groups of genes can jointly have more predictive power than groups of individually selected genes. Finally, online literature is automatically rearranged to present information about genes common to multiple groups, or to contrast the differences between the lists. The combination of these methods has improved our understanding of infant leukemia. While the complicated reality of the biology dashed our initial, optimistic hopes for simple answers from

  15. Modeling gene expression in time and space.


    Rué, Pau; Garcia-Ojalvo, Jordi


    Cell populations rarely exhibit gene-expression profiles that are homogeneous in time and space. In the temporal domain, dynamical behaviors such as oscillations and pulses of protein production pervade cell biology, underlying phenomena as diverse as circadian rhythmicity, cell cycle control, stress and damage responses, and stem-cell pluripotency. In multicellular populations, spatial heterogeneities are crucial for decision making and development, among many other functions. Cells need to exquisitely coordinate this temporal and spatial variation to survive. Although the spatiotemporal character of gene expression is challenging to quantify experimentally at the level of individual cells, it is beneficial from the modeling viewpoint, because it provides strong constraints that can be probed by theoretically analyzing mathematical models of candidate gene and protein circuits. Here, we review recent examples of temporal dynamics and spatial patterning in gene expression to show how modeling such phenomenology can help us unravel the molecular mechanisms of cellular function.

  16. Chemically regulated gene expression in plants.


    Padidam, Malla


    Chemically inducible systems that activate or inactivate gene expression have many potential applications in the determination of gene function and in plant biotechnology. The precise timing and control of gene expression are important aspects of chemically inducible systems. Several systems have been developed and used to analyze gene function, marker-free plant transformation, site-specific DNA excision, activation tagging, conditional genetic complementation, and restoration of male fertility. Chemicals that are used to regulate transgene expression include the antibiotic tetracycline, the steroids dexamethasone and estradiol, copper, ethanol, the inducer of pathogen-related proteins benzothiadiazol, herbicide safeners, and the insecticide methoxyfenozide. Systems that are suitable for field application are particularly useful for experimental systems and have potential applications in biotechnology.


    PubMed Central

    Metz, Richard P.; Qu, Xiaoyu; Laffin, Brian; Earnest, David; Porter, Weston W.


    Mouse mammary epithelial cells (HC-11) and mammary tissues were analyzed for developmental changes in circadian clock, cellular proliferation and differentiation marker genes. Expression of the clock genes, Per1 and Bmal1, were elevated in differentiated HC-11 cells whereas Per2 mRNA levels were higher in undifferentiated cells. This differentiation-dependent profile of clock gene expression was consistent with that observed in mouse mammary glands as Per1 and Bmal1 mRNA levels were elevated in late pregnant and lactating mammary tissues, while Per2 expression was higher in proliferating virgin and early pregnant glands. In both HC-11 cells and mammary glands, elevated Per2 expression was positively correlated with c-Myc and Cyclin D1 mRNA levels while Per1 and Bmal1 expression changed in conjunction with ß-casein mRNA levels. Interestingly, developmental stage had differential effects on rhythms of clock gene expression in the mammary gland. These data suggest that circadian clock genes may play a role in mouse mammary gland development and differentiation. PMID:16261617

  18. Paternally expressed genes predominate in the placenta.


    Wang, Xu; Miller, Donald C; Harman, Rebecca; Antczak, Douglas F; Clark, Andrew G


    The discovery of genomic imprinting through studies of manipulated mouse embryos indicated that the paternal genome has a major influence on placental development. However, previous research has not demonstrated paternal bias in imprinted genes. We applied RNA sequencing to trophoblast tissue from reciprocal hybrids of horse and donkey, where genotypic differences allowed parent-of-origin identification of most expressed genes. Using this approach, we identified a core group of 15 ancient imprinted genes, of which 10 were paternally expressed. An additional 78 candidate imprinted genes identified by RNA sequencing also showed paternal bias. Pyrosequencing was used to confirm the imprinting status of six of the genes, including the insulin receptor (INSR), which may play a role in growth regulation with its reciprocally imprinted ligand, histone acetyltransferase-1 (HAT1), a gene involved in chromatin modification, and lymphocyte antigen 6 complex, locus G6C, a newly identified imprinted gene in the major histocompatibility complex. The 78 candidate imprinted genes displayed parent-of-origin expression bias in placenta but not fetus, and most showed less than 100% silencing of the imprinted allele. Some displayed variability in imprinting status among individuals. This variability results in a unique epigenetic signature for each placenta that contributes to variation in the intrauterine environment and thus presents the opportunity for natural selection to operate on parent-of-origin differential regulation. Taken together, these features highlight the plasticity of imprinting in mammals and the central importance of the placenta as a target tissue for genomic imprinting.

  19. Hepatic Xenobiotic Metabolizing Enzyme Gene Expression ...

    EPA Pesticide Factsheets

    BACKGROUND: Differences in responses to environmental chemicals and drugs between life stages are likely due in part to differences in the expression of xenobiotic metabolizing enzymes and transporters (XMETs). No comprehensive analysis of the mRNA expression of XMETs has been carried out through life stages in any species. RESULTS: Using full-genome arrays, the mRNA expression of all XMETs and their regulatory proteins was examined during fetal (gestation day (GD) 19), neonatal (postnatal day (PND) 7), prepubescent (PND32), middle age (12 months), and old age (18 and 24 months) in the C57BL/6J (C57) mouse liver and compared to adults. Fetal and neonatal life stages exhibited dramatic differences in XMET mRNA expression compared to the relatively minor effects of old age. The total number of XMET probe sets that differed from adults was 636, 500, 84, 5, 43, and 102 for GD19, PND7, PND32, 12 months, 18 months and 24 months, respectively. At all life stages except PND32, under-expressed genes outnumbered over-expressed genes. The altered XMETs included those in all of the major metabolic and transport phases including introduction of reactive or polar groups (Phase I), conjugation (Phase II) and excretion (Phase III). In the fetus and neonate, parallel increases in expression were noted in the dioxin receptor, Nrf2 components and their regulated genes while nuclear receptors and regulated genes were generally down-regulated. Suppression of male-specific XMETs w

  20. Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.


    Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko


    Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering.

  1. Expression of myriapod pair rule gene orthologs

    PubMed Central


    Background Segmentation is a hallmark of the arthropods; most knowledge about the molecular basis of arthropod segmentation comes from work on the fly Drosophila melanogaster. In this species a hierarchic cascade of segmentation genes subdivides the blastoderm stepwise into single segment wide regions. However, segmentation in the fly is a derived feature since all segments form virtually simultaneously. Conversely, in the vast majority of arthropods the posterior segments form one at a time from a posterior pre-segmental zone. The pair rule genes (PRGs) comprise an important level of the Drosophila segmentation gene cascade and are indeed the first genes that are expressed in typical transverse stripes in the early embryo. Information on expression and function of PRGs outside the insects, however, is scarce. Results Here we present the expression of the pair rule gene orthologs in the pill millipede Glomeris marginata (Myriapoda: Diplopoda). We find evidence that these genes are involved in segmentation and that components of the hierarchic interaction of the gene network as found in insects may be conserved. We further provide evidence that segments are formed in a single-segment periodicity rather than in pairs of two like in another myriapod, the centipede Strigamia maritima. Finally we show that decoupling of dorsal and ventral segmentation in Glomeris appears already at the level of the PRGs. Conclusions Although the pair rule gene network is partially conserved among insects and myriapods, some aspects of PRG interaction are, as suggested by expression pattern analysis, convergent, even within the Myriapoda. Conserved expression patterns of PRGs in insects and myriapods, however, may represent ancestral features involved in segmenting the arthropod ancestor. PMID:21352542

  2. Human AZU-1 gene, variants thereof and expressed gene products


    Chen, Huei-Mei; Bissell, Mina


    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  3. Rubisco gene expression in C4 plants.


    Patel, Minesh; Berry, James O


    In leaves of most C(4) plants, ribulose 1,5 bisphosphate carboxylase (Rubisco) accumulates only in bundle sheath (bs) cells that surround the vascular centres, and not in mesophyll (mp) cells. It has been shown previously that in the C(4) dicots amaranth and Flaveria bidentis, post-transcriptional control of mRNA translation and stability mediate the C(4) expression patterns of genes encoding the large and small Rubisco subunits (chloroplast rbcL and nuclear RbcS, respectively). Translational control appears to regulate bs cell-specific Rubisco gene expression during early dicot leaf development, while control of mRNA stability appears to mediate bs-specific accumulation of RbcS and rbcL transcripts in mature leaves. Post-transcriptional control is also involved in the regulation of Rubisco gene expression by light, and in response to photosynthetic activity. Transgenic and transient expression studies in F. bidentis provide direct evidence for post-transcriptional control of bs cell-specific RbcS expression, which is mediated by the 5' and 3' untranslated regions (UTRs) of the mRNA. Comparisons of Rubisco gene expression in these dicots and in the monocot maize indicates possible commonalities in the regulation of RbcS and rbcL genes in these divergent C(4) species. Now that the role of post-transcriptional regulation in C(4) gene expression has been established, it is likely that future studies of mRNA-protein interactions will address long-standing questions about the establishment and maintenance of cell type-specificity in these plants. Some of these regulatory mechanisms may have ancestral origins in C(3) species, through modification of pre-existing factors, or by the acquisition of novel C(4) processes.

  4. Alternative-splicing-mediated gene expression

    NASA Astrophysics Data System (ADS)

    Wang, Qianliang; Zhou, Tianshou


    Alternative splicing (AS) is a fundamental process during gene expression and has been found to be ubiquitous in eukaryotes. However, how AS impacts gene expression levels both quantitatively and qualitatively remains to be fully explored. Here, we analyze two common models of gene expression, each incorporating a simple splice mechanism that a pre-mRNA is spliced into two mature mRNA isoforms in a probabilistic manner. In the constitutive expression case, we show that the steady-state molecular numbers of two mature mRNA isoforms follow mutually independent Poisson distributions. In the bursting expression case, we demonstrate that the tail decay of the steady-state distribution for both mature mRNA isoforms that in general are not mutually independent can be characterized by the product of mean burst size and splicing probability. In both cases, we find that AS can efficiently modulate both the variability (measured by variance) and the noise level of the total mature mRNA, and in particular, the latter is always lower than the noise level of the pre-mRNA, implying that AS always reduces the noise. These results altogether reveal that AS is a mechanism of efficiently controlling the gene expression noise.

  5. Gene expression profiles in irradiated cancer cells

    NASA Astrophysics Data System (ADS)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.


    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  6. Gene expression profiles in irradiated cancer cells

    SciTech Connect

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.


    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  7. Visualizing Gene Expression In Situ

    SciTech Connect

    Burlage, R.S.


    Visualizing bacterial cells and describing their responses to the environment are difficult tasks. Their small size is the chief reason for the difficulty, which means that we must often use many millions of cells in a sample in order to determine what the average response of the bacteria is. However, an average response can sometimes mask important events in bacterial physiology, which means that our understanding of these organisms will suffer. We have used a variety of instruments to visualize bacterial cells, all of which tell us something different about the sample. We use a fluorescence activated cell sorter to sort cells based on the fluorescence provided by bioreporter genes, and these can be used to select for particular genetic mutations. Cells can be visualized by epifluorescent microscopy, and sensitive photodetectors can be added that allow us to find a single bacterial cell that is fluorescent or bioluminescent. We have also used standard photomultipliers to examine cell aggregates as field bioreporter microorganisms. Examples of each of these instruments show how our understanding of bacterial physiology has changed with the technology.

  8. Gene expression profile in pelvic organ prolapse†

    PubMed Central

    Brizzolara, S.S.; Killeen, J.; Urschitz, J.


    It was hypothesized that the processes contributing to pelvic organ prolapse (POP) may be identified by transcriptional profiling of pelvic connective tissue in conjunction with light microscopy. In order to test this, we performed a frequency-matched case–control study of women undergoing hysterectomy for POP and controls. Total RNA, extracted from uterosacral and round ligament samples used to generate labeled cRNA, was hybridized to microarrays and analyzed for the expression of 32 878 genes. Significance Analysis of Microarrays (Stanford University, CA, USA) identified differentially expressed genes used for ontoanalysis. Quantitative PCR (qPCR) confirmed results. Light microscopy confirmed the tissue type and assessed inflammatory infiltration. The analysis of 34 arrays revealed 249 differentially expressed genes with fold changes (FC) larger than 1.5 and false discovery rates ≤5.2%. Immunity and defense was the most significant biological process differentially expressed in POP. qPCR confirmed the elevated steady-state mRNA levels for four genes: interleukin-6 (FC 9.8), thrombospondin 1 (FC 3.5) and prostaglandin-endoperoxide synthase 2 (FC 2.4) and activating transcription factor 3 (FC 2.6). Light microscopy showed all the samples were composed of fibromuscular connective tissue with no inflammatory infiltrates. In conclusion, genes enriched for ‘immunity and defense’ contribute to POP independent of inflammatory infiltrates. PMID:19056808

  9. Clustering of High Throughput Gene Expression Data

    PubMed Central

    Pirim, Harun; Ekşioğlu, Burak; Perkins, Andy; Yüceer, Çetin


    High throughput biological data need to be processed, analyzed, and interpreted to address problems in life sciences. Bioinformatics, computational biology, and systems biology deal with biological problems using computational methods. Clustering is one of the methods used to gain insight into biological processes, particularly at the genomics level. Clearly, clustering can be used in many areas of biological data analysis. However, this paper presents a review of the current clustering algorithms designed especially for analyzing gene expression data. It is also intended to introduce one of the main problems in bioinformatics - clustering gene expression data - to the operations research community. PMID:23144527

  10. Facilitated diffusion buffers noise in gene expression.


    Schoech, Armin P; Zabet, Nicolae Radu


    Transcription factors perform facilitated diffusion [three-dimensional (3D) diffusion in the cytosol and 1D diffusion on the DNA] when binding to their target sites to regulate gene expression. Here, we investigated the influence of this binding mechanism on the noise in gene expression. Our results showed that, for biologically relevant parameters, the binding process can be represented by a two-state Markov model and that the accelerated target finding due to facilitated diffusion leads to a reduction in both the mRNA and the protein noise.

  11. Facilitated diffusion buffers noise in gene expression

    NASA Astrophysics Data System (ADS)

    Schoech, Armin P.; Zabet, Nicolae Radu


    Transcription factors perform facilitated diffusion [three-dimensional (3D) diffusion in the cytosol and 1D diffusion on the DNA] when binding to their target sites to regulate gene expression. Here, we investigated the influence of this binding mechanism on the noise in gene expression. Our results showed that, for biologically relevant parameters, the binding process can be represented by a two-state Markov model and that the accelerated target finding due to facilitated diffusion leads to a reduction in both the mRNA and the protein noise.

  12. Objective and subjective probability in gene expression.


    Velasco, Joel D


    In this paper I address the question of whether the probabilities that appear in models of stochastic gene expression are objective or subjective. I argue that while our best models of the phenomena in question are stochastic models, this fact should not lead us to automatically assume that the processes are inherently stochastic. After distinguishing between models and reality, I give a brief introduction to the philosophical problem of the interpretation of probability statements. I argue that the objective vs. subjective distinction is a false dichotomy and is an unhelpful distinction in this case. Instead, the probabilities in our models of gene expression exhibit standard features of both objectivity and subjectivity.

  13. Genomic signatures of germline gene expression.


    McVicker, Graham; Green, Phil


    Transcribed regions in the human genome differ from adjacent intergenic regions in transposable element density, crossover rates, and asymmetric substitution and sequence composition patterns. We tested whether these differences reflect selection or are instead a byproduct of germline transcription, using publicly available gene expression data from a variety of germline and somatic tissues. Crossover rate shows a strong negative correlation with gene expression in meiotic tissues, suggesting that crossover is inhibited by transcription. Strand-biased composition (G+T content) and A → G versus T → C substitution asymmetry are both positively correlated with germline gene expression. We find no evidence for a strand bias in allele frequency data, implying that the substitution asymmetry reflects a mutation rather than a fixation bias. The density of transposable elements is positively correlated with germline expression, suggesting that such elements preferentially insert into regions that are actively transcribed. For each of the features examined, our analyses favor a nonselective explanation for the observed trends and point to the role of germline gene expression in shaping the mammalian genome.

  14. [Imprinting genes and it's expression in Arabidopsis].


    Zhang, Hong-Yu; Xu, Pei-Zhou; Yang, Hua; Wu, Xian-Jun


    Genomic imprinting refers to the phenomenon that the expression of a gene copy depends on its parent of origin. The Arabidopsis imprinted FIS (Fertilisation-independent seed) genes, mea, fis2, and fie, play essential roles in the repression of central cell and the regulation of early endosperm development. fis mutants display two phenotypes: autonomous diploid endosperm development when fertilization is absent and un-cellularised endosperm formation when fertilization occurs. The FIS Polycomb protein complex including the above three FIS proteins catalyzes histone H3 K27 tri-methylation on target loci. DME (DEMETER), a DNA glycosylase, and AtMET1 (Methyltransferase1), a DNA methyltransferase, are involved in the regulation of imprinted expression of both mea and fis2. This review summarizes the studies on the Arabidopsis imprinted FIS genes and other related genes. Recent works have shown that the insertion of transposons may affect nearby gene expression, which may be the main driving force behind the evolution of genomic imprinting. This summary covers the achievements on Arabidopsis imprinted genes will provide important information for studies on genomic imprinting in the important crops such as rice and maize.

  15. Sequence and gene expression evolution of paralogous genes in willows

    PubMed Central

    Harikrishnan, Srilakshmy L.; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  16. Sequence and gene expression evolution of paralogous genes in willows.


    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  17. The TRANSFAC system on gene expression regulation.


    Wingender, E; Chen, X; Fricke, E; Geffers, R; Hehl, R; Liebich, I; Krull, M; Matys, V; Michael, H; Ohnhäuser, R; Prüss, M; Schacherer, F; Thiele, S; Urbach, S


    The TRANSFAC database on transcription factors and their DNA-binding sites and profiles ( has been quantitatively extended and supplemented by a number of modules. These modules give information about pathologically relevant mutations in regulatory regions and transcription factor genes (PathoDB), scaffold/matrix attached regions (S/MARt DB), signal transduction (TRANSPATH) and gene expression sources (CYTOMER). Altogether, these distinct database modules constitute the TRANSFAC system. They are accompanied by a number of program routines for identifying potential transcription factor binding sites or for localizing individual components in the regulatory network of a cell.

  18. Marker gene tethering by nucleoporins affects gene expression in plants.


    Smith, Sarah; Galinha, Carla; Desset, Sophie; Tolmie, Frances; Evans, David; Tatout, Christophe; Graumann, Katja


    In non-plant systems, chromatin association with the nuclear periphery affects gene expression, where interactions with nuclear envelope proteins can repress and interactions with nucleoporins can enhance transcription. In plants, both hetero- and euchromatin can localize at the nuclear periphery, but the effect of proximity to the nuclear periphery on gene expression remains largely unknown. This study explores the putative function of Seh1 and Nup50a nucleoporins on gene expression by using the Lac Operator / Lac Repressor (LacI-LacO) system adapted to Arabidopsis thaliana. We used LacO fused to the luciferase reporter gene (LacO:Luc) to investigate whether binding of the LacO:Luc transgene to nucleoporin:LacI protein fusions alters luciferase expression. Two separate nucleoporin-LacI-YFP fusions were introduced into single insert, homozygous LacO:Luc Arabidopsis plants. Homozygous plants carrying LacO:Luc and a single insert of either Seh1-LacI-YFP or Nup50a-LacI-YFP were tested for luciferase activity and compared to plants containing LacO:Luc only. Seh1-LacI-YFP increased, while Nup50a-LacI-YFP decreased luciferase activity. Seh1-LacI-YFP accumulated at the nuclear periphery as expected, while Nup50a-LacI-YFP was nucleoplasmic and was not selected for further study. Protein and RNA levels of luciferase were quantified by western blotting and RT-qPCR, respectively. Increased luciferase activity in LacO:Luc+Seh1-LacI-YFP plants was correlated with increased luciferase protein and RNA levels. This change of luciferase expression was abolished by disruption of LacI-LacO binding by treating with IPTG in young seedlings, rosette leaves and inflorescences. This study suggests that association with the nuclear periphery is involved in the regulation of gene expression in plants.

  19. Transgenic control of perforin gene expression

    SciTech Connect

    Lichtenheld, M.G.; Podack, E.R.; Levy, R.B.


    Perforin is a pore-forming effector molecule of CTL and NK cells. To characterize perforin gene expression and its transcriptional control mechanisms in vivo, expression of a cell surface tag, i.e., human CD4, was driven by 5.1 kb of the murin perforin 5{prime} flanking and promoter region in transgenic mice. Six out of seven transgenic lines expressed the perforin-tag hybrid gene at low to intermediate levels, depending on the integration site. Transgene expression occurred in all cells that physiologically are able to express perforin. At the whole organ level, significant amounts of transgenic mRNA and endogenous perforin mRNA were co-expressed in the lymphoid organs, as well as in the lung, the ileum, the oviduct/uterus, and the bone marrow. At the single cell level, the perforin tag was present on NK cells and on CD8{sup +}, as well as on CD4{sup +} cells. Also targeted were Thy-1.2{sup +} {gamma}{delta} T cells, but not Thy-1.2{sup -} {gamma}{delta} T cells, B cells, nor monocytes. During thymic T cell development, transgene expression occurred in double negative (CD4{sup -}CD8{sup -}) thymocytes and was detected at all subsequent stages, but exceeded the expression levels of the endogenous gene in the thymus. In conclusion, the analyzed perforin 5{prime} flanking and promoter region contains important cis-acting sequences that restrict perforin expression to T cells and NK cells, and therefore provides a unique tool for manipulating T cell and/or Nk cell-mediated immune responses in transgenic mice. On the other hand, the normal control of perforin gene expression involves at least one additional negative control mechanism that was not mediated by the transgenic promoter and upstream region. This control restricts perforin gene expression in thymically developing T cells and in most resting peripheral T cells, but can be released upon T cell activation. 43 refs., 7 figs., 1 tab.

  20. Organization and expression of hair follicle genes.


    Rogers, G E; Powell, B C


    Several families of proteins are expressed in the growth of hair and an estimated 50-100 proteins constitute the final hair fiber. The cumbersome nomenclature for naming these different proteins has led to a proposal to modify that which is currently used for epidermal keratins. Investigations of the organization of hair genes indicate that the members of each family are clustered in the genome and their expression could be under some general control. Interestingly, the protein called trichohyalin, markedly distinct from the hair proteins, is produced in the inner root sheath cells and the gene for it has been found to be located at the same human chromosome locus as the genes for profilaggrin, involucrin, and loricrin. A mainstream objective is to identify controls responsible for the production in the hair cortex of keratin intermediate filaments (IFs) and two large groups of keratin-associated proteins (KAPs) rich in the amino acids cysteine or glycine/tyrosine. A specific family of cysteine-rich proteins is expressed in the hair cuticle. Comparisons of promoter regions of IF genes and KAP genes, including a recently characterized gene for a glycine/tyrosine-rich protein, have revealed putative hair-specific motifs in addition to known elements that regulate gene expression. In the sheep, the patterns of expression in hair differentiation are particularly interesting insofar as there are distinct segments of para- and orthocortical type cells that have significantly different pathways of expression. The testing of candidate hair-specific regulatory sequences by mouse transgenesis has produced several interesting hair phenotypes. Transgenic sheep over-expressing keratin genes but showing no hair growth change have been obtained and compared with the equivalent transgenic hair-loss mice. Studies of the effects of amino acid supply on the rate of hair growth have demonstrated that with cysteine supplementation of sheep a perturbation occurs in which there is a

  1. Regulation of Calreticulin Gene Expression by Calcium

    PubMed Central

    Waser, Mathilde; Mesaeli, Nasrin; Spencer, Charlotte; Michalak, Marek


    We have isolated and characterized a 12-kb mouse genomic DNA fragment containing the entire calreticulin gene and 2.14 kb of the promoter region. The mouse calreticulin gene consists of nine exons and eight introns, and it spans 4.2 kb of genomic DNA. A 1.8-kb fragment of the calreticulin promoter was subcloned into a reporter gene plasmid containing chloramphenicol acetyltransferase. This construct was then used in transient and stable transfection of NIH/ 3T3 cells. Treatment of transfected cells either with the Ca2+ ionophore A23187, or with the ER Ca2+-ATPase inhibitor thapsigargin, resulted in a five- to sevenfold increase of the expression of chloramphenicol acetyltransferase protein. Transactivation of the calreticulin promoter was also increased by fourfold in NIH/3T3 cells treated with bradykinin, a hormone that induces Ca2+ release from the intracellular Ca2+ stores. Analysis of the promoter deletion constructs revealed that A23187- and thapsigargin-responsive regions are confined to two regions (−115 to −260 and −685 to −1,763) in the calreticulin promoter that contain the CCAAT nucleotide sequences. Northern blot analysis of cells treated with A23187, or with thapsigargin, revealed a fivefold increase in calreticulin mRNA levels. Thapsigargin also induced a fourfold increase in calreticulun protein levels. Importantly, we show by nuclear run-on transcription analysis that calreticulin gene transcription is increased in NIH/3T3 cells treated with A23187 and thapsigargin in vivo. This increase in gene expression required over 4 h of continuous incubation with the drugs and was also sensitive to treatment with cycloheximide, suggesting that it is dependent on protein synthesis. Changes in the concentration of extracellular and cytoplasmic Ca2+ did not affect the increased expression of the calreticulin gene. These studies suggest that stress response to the depletion of intracellular Ca2+ stores induces expression of the calreticulin gene in vitro

  2. The frustrated gene: origins of eukaryotic gene expression

    PubMed Central

    Madhani, Hiten D.


    Eukarytotic gene expression is frustrated by a series of steps that are generally not observed in prokaryotes and are therefore not essential for the basic chemistry of transcription and translation. Their evolution may have been driven by the need to defend against parasitic nucleic acids. PMID:24209615

  3. Trigger finger, tendinosis, and intratendinous gene expression.


    Lundin, A-C; Aspenberg, P; Eliasson, P


    The pathogenesis of trigger finger has generally been ascribed to primary changes in the first annular ligament. In contrast, we recently found histological changes in the tendons, similar to the findings in Achilles tendinosis or tendinopathy. We therefore hypothesized that trigger finger tendons would show differences in gene expression in comparison to normal tendons in a pattern similar to what is published for Achilles tendinosis. We performed quantitative real-time polymerase chain reaction on biopsies from finger flexor tendons, 13 trigger fingers and 13 apparently healthy control tendons, to assess the expression of 10 genes which have been described to be differently expressed in tendinosis (collagen type 1a1, collagen 3a1, MMP-2, MMP-3, ADAMTS-5, TIMP-3, aggrecan, biglycan, decorin, and versican). In trigger finger tendons, collagen types 1a1 and 3a1, aggrecan and biglycan were all up-regulated, and MMP-3and TIMP-3 were down-regulated. These changes were statistically significant and have been previously described for Achilles tendinosis. The remaining four genes were not significantly altered. The changes in gene expression support the hypothesis that trigger finger is a form of tendinosis. Because trigger finger is a common condition, often treated surgically, it could provide opportunities for clinical research on tendinosis.

  4. The low noise limit in gene expression

    SciTech Connect

    Dar, Roy D.; Weinberger, Leor S.; Cox, Chris D.; Simpson, Michael L.; Razooky, Brandon S.


    Protein noise measurements are increasingly used to elucidate biophysical parameters. Unfortunately noise analyses are often at odds with directly measured parameters. Here we show that these inconsistencies arise from two problematic analytical choices: (i) the assumption that protein translation rate is invariant for different proteins of different abundances, which has inadvertently led to (ii) the assumption that a large constitutive extrinsic noise sets the low noise limit in gene expression. While growing evidence suggests that transcriptional bursting may set the low noise limit, variability in translational bursting has been largely ignored. We show that genome-wide systematic variation in translational efficiency can-and in the case of E. coli does-control the low noise limit in gene expression. Therefore constitutive extrinsic noise is small and only plays a role in the absence of a systematic variation in translational efficiency. Lastly, these results show the existence of two distinct expression noise patterns: (1) a global noise floor uniformly imposed on all genes by expression bursting; and (2) high noise distributed to only a select group of genes.

  5. The Low Noise Limit in Gene Expression

    PubMed Central

    Dar, Roy D.; Razooky, Brandon S.; Weinberger, Leor S.; Cox, Chris D.; Simpson, Michael L.


    Protein noise measurements are increasingly used to elucidate biophysical parameters. Unfortunately noise analyses are often at odds with directly measured parameters. Here we show that these inconsistencies arise from two problematic analytical choices: (i) the assumption that protein translation rate is invariant for different proteins of different abundances, which has inadvertently led to (ii) the assumption that a large constitutive extrinsic noise sets the low noise limit in gene expression. While growing evidence suggests that transcriptional bursting may set the low noise limit, variability in translational bursting has been largely ignored. We show that genome-wide systematic variation in translational efficiency can–and in the case of E. coli does–control the low noise limit in gene expression. Therefore constitutive extrinsic noise is small and only plays a role in the absence of a systematic variation in translational efficiency. These results show the existence of two distinct expression noise patterns: (1) a global noise floor uniformly imposed on all genes by expression bursting; and (2) high noise distributed to only a select group of genes. PMID:26488303

  6. Digital gene expression signatures for maize development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genome-wide expression signatures detect specific perturbations in developmental programs and contribute to functional resolution of key regulatory networks. In maize (Zea mays) inflorescences, mutations in the RAMOSA (RA) genes affect determinacy of axillary meristems and thus alter branching patt...

  7. Analysis of baseline gene expression levels from ...

    EPA Pesticide Factsheets

    The use of gene expression profiling to predict chemical mode of action would be enhanced by better characterization of variance due to individual, environmental, and technical factors. Meta-analysis of microarray data from untreated or vehicle-treated animals within the control arm of toxicogenomics studies has yielded useful information on baseline fluctuations in gene expression. A dataset of control animal microarray expression data was assembled by a working group of the Health and Environmental Sciences Institute's Technical Committee on the Application of Genomics in Mechanism Based Risk Assessment in order to provide a public resource for assessments of variability in baseline gene expression. Data from over 500 Affymetrix microarrays from control rat liver and kidney were collected from 16 different institutions. Thirty-five biological and technical factors were obtained for each animal, describing a wide range of study characteristics, and a subset were evaluated in detail for their contribution to total variability using multivariate statistical and graphical techniques. The study factors that emerged as key sources of variability included gender, organ section, strain, and fasting state. These and other study factors were identified as key descriptors that should be included in the minimal information about a toxicogenomics study needed for interpretation of results by an independent source. Genes that are the most and least variable, gender-selectiv

  8. Multiple Stochastic Point Processes in Gene Expression

    NASA Astrophysics Data System (ADS)

    Murugan, Rajamanickam


    We generalize the idea of multiple-stochasticity in chemical reaction systems to gene expression. Using Chemical Langevin Equation approach we investigate how this multiple-stochasticity can influence the overall molecular number fluctuations. We show that the main sources of this multiple-stochasticity in gene expression could be the randomness in transcription and translation initiation times which in turn originates from the underlying bio-macromolecular recognition processes such as the site-specific DNA-protein interactions and therefore can be internally regulated by the supra-molecular structural factors such as the condensation/super-coiling of DNA. Our theory predicts that (1) in case of gene expression system, the variances ( φ) introduced by the randomness in transcription and translation initiation-times approximately scales with the degree of condensation ( s) of DNA or mRNA as φ ∝ s -6. From the theoretical analysis of the Fano factor as well as coefficient of variation associated with the protein number fluctuations we predict that (2) unlike the singly-stochastic case where the Fano factor has been shown to be a monotonous function of translation rate, in case of multiple-stochastic gene expression the Fano factor is a turn over function with a definite minimum. This in turn suggests that the multiple-stochastic processes can also be well tuned to behave like a singly-stochastic point processes by adjusting the rate parameters.

  9. The low noise limit in gene expression


    Dar, Roy D.; Weinberger, Leor S.; Cox, Chris D.; ...


    Protein noise measurements are increasingly used to elucidate biophysical parameters. Unfortunately noise analyses are often at odds with directly measured parameters. Here we show that these inconsistencies arise from two problematic analytical choices: (i) the assumption that protein translation rate is invariant for different proteins of different abundances, which has inadvertently led to (ii) the assumption that a large constitutive extrinsic noise sets the low noise limit in gene expression. While growing evidence suggests that transcriptional bursting may set the low noise limit, variability in translational bursting has been largely ignored. We show that genome-wide systematic variation in translational efficiencymore » can-and in the case of E. coli does-control the low noise limit in gene expression. Therefore constitutive extrinsic noise is small and only plays a role in the absence of a systematic variation in translational efficiency. Lastly, these results show the existence of two distinct expression noise patterns: (1) a global noise floor uniformly imposed on all genes by expression bursting; and (2) high noise distributed to only a select group of genes.« less

  10. Expression of mouse metallothionein genes in tobacco

    SciTech Connect

    Maiti, I.B.; Yeargan, R.; Wagner, G.J.; Hunt, A.G. )


    We have expressed a mouse metallothionein (NT) gene in tobacco under control of the cauliflower mosaic virus (CaMV) 35S promoter and a pea ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) gene promoter. Seedlings in which MT gene expression is driven by the 35S promoter are resistant to toxic levels of cadmium. Mature plants carrying the 35S-MT gene accumulate less Cd in their leaves when exposed to low levels of Cd in laboratory growth conditions. Plants with the rbcS-MT construction express this gene in a light-regulated and tissue-specific manner, as expected. Moreover, the MT levels in leaves in these plants are about 20% of those seen in 35S-MT plants. These plants are currently being tested for Cd resistance. In addition, a small field evaluation of 35S-MT lines for Cd levels is being evaluated. These experiments will address the possibility of using MTs to alter Cd levels in crop species.

  11. Regulation of methane genes and genome expression

    SciTech Connect

    John N. Reeve


    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  12. Fluid Mechanics, Arterial Disease, and Gene Expression

    PubMed Central

    Tarbell, John M.; Shi, Zhong-Dong; Dunn, Jessilyn; Jo, Hanjoong


    This review places modern research developments in vascular mechanobiology in the context of hemodynamic phenomena in the cardiovascular system and the discrete localization of vascular disease. The modern origins of this field are traced, beginning in the 1960s when associations between flow characteristics, particularly blood flow–induced wall shear stress, and the localization of atherosclerotic plaques were uncovered, and continuing to fluid shear stress effects on the vascular lining endothelial) cells (ECs), including their effects on EC morphology, biochemical production, and gene expression. The earliest single-gene studies and genome-wide analyses are considered. The final section moves from the ECs lining the vessel wall to the smooth muscle cells and fibroblasts within the wall that are fluid me chanically activated by interstitial flow that imposes shear stresses on their surfaces comparable with those of flowing blood on EC surfaces. Interstitial flow stimulates biochemical production and gene expression, much like blood flow on ECs. PMID:25360054

  13. Fluid Mechanics, Arterial Disease, and Gene Expression.


    Tarbell, John M; Shi, Zhong-Dong; Dunn, Jessilyn; Jo, Hanjoong


    This review places modern research developments in vascular mechanobiology in the context of hemodynamic phenomena in the cardiovascular system and the discrete localization of vascular disease. The modern origins of this field are traced, beginning in the 1960s when associations between flow characteristics, particularly blood flow-induced wall shear stress, and the localization of atherosclerotic plaques were uncovered, and continuing to fluid shear stress effects on the vascular lining endothelial) cells (ECs), including their effects on EC morphology, biochemical production, and gene expression. The earliest single-gene studies and genome-wide analyses are considered. The final section moves from the ECs lining the vessel wall to the smooth muscle cells and fibroblasts within the wall that are fluid me chanically activated by interstitial flow that imposes shear stresses on their surfaces comparable with those of flowing blood on EC surfaces. Interstitial flow stimulates biochemical production and gene expression, much like blood flow on ECs.

  14. Gene expression profiling of human ovarian tumours

    PubMed Central

    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; LiVolsi, V A; Johnson, S W


    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT–PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers. PMID:16969345

  15. Gene expression profiling of human ovarian tumours.


    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; Livolsi, V A; Johnson, S W


    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT-PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers.

  16. Repression of gene expression by oxidative stress.

    PubMed Central

    Morel, Y; Barouki, R


    Gene expression is modulated by both physiological signals (hormones, cytokines, etc.) and environmental stimuli (physical parameters, xenobiotics, etc.). Oxidative stress appears to be a key pleiotropic modulator which may be involved in either pathway. Indeed, reactive oxygen species (ROS) have been described as second messengers for several growth factors and cytokines, but have also been shown to rise following cellular insults such as xenobiotic metabolism or enzymic deficiency. Extensive studies on the induction of stress-response genes by oxidative stress have been reported. In contrast, owing to the historical focus on gene induction, less attention has been paid to gene repression by ROS. However, a growing number of studies have shown that moderate (i.e. non-cytotoxic) oxidative stress specifically down-regulates the expression of various genes. In this review, we describe the alteration of several physiological functions resulting from oxidative-stress-mediated inhibition of gene transcription. We will then focus on the repressive oxidative modulation of various transcription factors elicited by ROS. PMID:10477257

  17. [Structure and expression of thyroglobulin gene].


    Vassart, G; Brocas, H; Christophe, D; de Martynoff, G; Leriche, A; Mercken, L; Pohl, V; Van Heuverswyn, B


    Thyroglobulin is composed of two 300000 dalton polypeptide chains, translated from an 8000 base mRNA. Preparation of a full length cDNA and its cloning in E. coli have lead to the demonstration that the polypeptides of thyroglobulin protomers were identical. Used as molecular probes, the cloned cDNA allowed the isolation of a fragment of thyroglobulin gene. Electron microscopic studies have demonstrated that this gene contains more than 90% intronic material separating small size exons (less than 200 bp). Sequencing of bovine thyroglobulin structural gene is in progress. Preliminary results show evidence for the existence of repetitive segments. Availability of cloned DNA complementary to bovine and human thyroglobulin mRNA allows the study of genetic defects of thyroglobulin gene expression in the human and in various animal models.

  18. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

    PubMed Central

    Moignard, Victoria; Göttgens, Berthold; Adryan, Boris


    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete pipeline for the analysis of single cell qPCR data that uses the mathematics behind bursty expression to develop more accurate and robust algorithms for analyzing the origin of heterogeneity in experimental samples, specifically an algorithm for clustering cells by their bursting behavior (Simulated Annealing for Bursty Expression Clustering, SABEC) and a statistical tool for comparing the kinetic parameters of bursty expression across populations of cells (Estimation of Parameter changes in Kinetics, EPiK). We applied these methods to hematopoiesis, including a new single cell dataset in which transcription factors (TFs) involved in the earliest branchpoint of blood differentiation were individually up- and down-regulated. We could identify two unique sub-populations within a seemingly homogenous group of hematopoietic stem cells. In addition, we could predict regulatory mechanisms controlling the expression levels of eighteen key hematopoietic transcription factors throughout differentiation. Detailed information about gene regulatory mechanisms can therefore be obtained simply from high throughput single cell gene expression data, which should be widely applicable given the rapid expansion of single cell genomics. PMID:27551778

  19. Coevolution of gene expression among interacting proteins

    SciTech Connect

    Fraser, Hunter B.; Hirsh, Aaron E.; Wall, Dennis P.; Eisen,Michael B.


    Physically interacting proteins or parts of proteins are expected to evolve in a coordinated manner that preserves proper interactions. Such coevolution at the amino acid-sequence level is well documented and has been used to predict interacting proteins, domains, and amino acids. Interacting proteins are also often precisely coexpressed with one another, presumably to maintain proper stoichiometry among interacting components. Here, we show that the expression levels of physically interacting proteins coevolve. We estimate average expression levels of genes from four closely related fungi of the genus Saccharomyces using the codon adaptation index and show that expression levels of interacting proteins exhibit coordinated changes in these different species. We find that this coevolution of expression is a more powerful predictor of physical interaction than is coevolution of amino acid sequence. These results demonstrate previously uncharacterized coevolution of gene expression, adding a different dimension to the study of the coevolution of interacting proteins and underscoring the importance of maintaining coexpression of interacting proteins over evolutionary time. Our results also suggest that expression coevolution can be used for computational prediction of protein protein interactions.

  20. Differential var gene expression in children with malaria and antidromic effects on host gene expression.


    Kalmbach, Yvonne; Rottmann, Matthias; Kombila, Maryvonne; Kremsner, Peter G; Beck, Hans-Peter; Kun, Jürgen F J


    Among 62 children with mild malaria, cerebral malaria, or severe malarial anemia, we analyzed the transcription of different var gene types. There was no difference in parasitemia level or body temperature between groups. However, a significantly different expression pattern was observed in children with cerebral malaria, compared with that in patients in the other 2 groups: children with cerebral malaria had lower expression of the upsA subtype but higher expression of the upsB and upsC subtypes. Furthermore, expression of human genes responsive to tumor necrosis factor and hypoxia correlated with distinct ups types.

  1. Transcriptome-Level Signatures in Gene Expression and Gene Expression Variability during Bacterial Adaptive Evolution

    PubMed Central

    Erickson, Keesha E.; Otoupal, Peter B.


    ABSTRACT Antibiotic-resistant bacteria are an increasingly serious public health concern, as strains emerge that demonstrate resistance to almost all available treatments. One factor that contributes to the crisis is the adaptive ability of bacteria, which exhibit remarkable phenotypic and gene expression heterogeneity in order to gain a survival advantage in damaging environments. This high degree of variability in gene expression across biological populations makes it a challenging task to identify key regulators of bacterial adaptation. Here, we research the regulation of adaptive resistance by investigating transcriptome profiles of Escherichia coli upon adaptation to disparate toxins, including antibiotics and biofuels. We locate potential target genes via conventional gene expression analysis as well as using a new analysis technique examining differential gene expression variability. By investigating trends across the diverse adaptation conditions, we identify a focused set of genes with conserved behavior, including those involved in cell motility, metabolism, membrane structure, and transport, and several genes of unknown function. To validate the biological relevance of the observed changes, we synthetically perturb gene expression using clustered regularly interspaced short palindromic repeat (CRISPR)-dCas9. Manipulation of select genes in combination with antibiotic treatment promotes adaptive resistance as demonstrated by an increased degree of antibiotic tolerance and heterogeneity in MICs. We study the mechanisms by which identified genes influence adaptation and find that select differentially variable genes have the potential to impact metabolic rates, mutation rates, and motility. Overall, this work provides evidence for a complex nongenetic response, encompassing shifts in gene expression and gene expression variability, which underlies adaptive resistance. IMPORTANCE Even initially sensitive bacteria can rapidly thwart antibiotic treatment

  2. Transcriptome-Level Signatures in Gene Expression and Gene Expression Variability during Bacterial Adaptive Evolution.


    Erickson, Keesha E; Otoupal, Peter B; Chatterjee, Anushree


    Antibiotic-resistant bacteria are an increasingly serious public health concern, as strains emerge that demonstrate resistance to almost all available treatments. One factor that contributes to the crisis is the adaptive ability of bacteria, which exhibit remarkable phenotypic and gene expression heterogeneity in order to gain a survival advantage in damaging environments. This high degree of variability in gene expression across biological populations makes it a challenging task to identify key regulators of bacterial adaptation. Here, we research the regulation of adaptive resistance by investigating transcriptome profiles of Escherichia coli upon adaptation to disparate toxins, including antibiotics and biofuels. We locate potential target genes via conventional gene expression analysis as well as using a new analysis technique examining differential gene expression variability. By investigating trends across the diverse adaptation conditions, we identify a focused set of genes with conserved behavior, including those involved in cell motility, metabolism, membrane structure, and transport, and several genes of unknown function. To validate the biological relevance of the observed changes, we synthetically perturb gene expression using clustered regularly interspaced short palindromic repeat (CRISPR)-dCas9. Manipulation of select genes in combination with antibiotic treatment promotes adaptive resistance as demonstrated by an increased degree of antibiotic tolerance and heterogeneity in MICs. We study the mechanisms by which identified genes influence adaptation and find that select differentially variable genes have the potential to impact metabolic rates, mutation rates, and motility. Overall, this work provides evidence for a complex nongenetic response, encompassing shifts in gene expression and gene expression variability, which underlies adaptive resistance. IMPORTANCE Even initially sensitive bacteria can rapidly thwart antibiotic treatment through stress

  3. Gene expression regulation in roots under drought.


    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona


    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots.

  4. Expression of bacterial genes in plant cells.

    PubMed Central

    Fraley, R T; Rogers, S G; Horsch, R B; Sanders, P R; Flick, J S; Adams, S P; Bittner, M L; Brand, L A; Fink, C L; Fry, J S; Galluppi, G R; Goldberg, S B; Hoffmann, N L; Woo, S C


    Chimeric bacterial genes conferring resistance to aminoglycoside antibiotics have been inserted into the Agrobacterium tumefaciens tumor-inducing (Ti) plasmid and introduced into plant cells by in vitro transformation techniques. The chimeric genes contain the nopaline synthase 5' and 3' regulatory regions joined to the genes for neomycin phosphotransferase type I or type II. The chimeric genes were cloned into an intermediate vector, pMON120, and inserted into pTiB6S3 by recombination and then introduced into petunia and tobacco cells by cocultivating A. tumefaciens cells with protoplast-derived cells. Southern hybridization was used to confirm the presence of the chimeric genes in the transformed plant tissues. Expression of the chimeric genes was determined by the ability of the transformed cells to proliferate on medium containing normally inhibitory levels of kanamycin (50 micrograms/ml) or other aminoglycoside antibiotics. Plant cells transformed by wild-type pTiB6S3 or derivatives carrying the bacterial neomycin phosphotransferase genes with their own promoters failed to grow under these conditions. The significance of these results for plant genetic engineering is discussed. Images PMID:6308651

  5. Transient gene expression in electroporated Solanum protoplasts.


    Jones, H; Ooms, G; Jones, M G


    Electroporation was used to evaluate parameters important in transient gene expression in potato protoplasts. The protoplasts were from leaves of wild potato Solanum brevidens, and from leaves, tubers and suspension cells of cultivated Solanum tuberosum cv. Désirée. Reporter enzyme activity, chloramphenicol acetyl transferase (CAT) under the control of the cauliflower mosaic virus (CaMV) 35S promoter, depended on the field strength and the pulse duration used for electroporation. Using field pulses of 85 ms duration, the optimum field strengths for maximum CAT activity were: S. brevidens mesophyll protoplasts--250 V/cm; Désirée mesophyll protoplasts--225 V/cm; Désirée suspension culture protoplasts--225 V/cm; and Désirée tuber protoplasts--150 V/cm. The optimum field strengths correlated inversely with the size of the protoplasts electroporated; this is consistent with biophysical theory. In time courses, maximum CAT activity (in Désirée mesophyll protoplasts) occurred 36-48 h after electroporation. Examination at optimised conditions of a chimaeric gene consisting of a class II patatin promoter linked to the beta-glucuronidase (gus) gene, showed expression (at DNA concentrations between 0-10 pmol/ml) comparable to the CaMV 35S promoter in both tuber and mesophyll protoplasts. At higher DNA concentrations (20-30 pmol/ml) the patatin promoter directed 4-5 times higher levels of gus expression. Implications and potential contributions towards studying gene expression, in particular of homologous genes in potato, are discussed.

  6. Toward stable gene expression in CHO cells

    PubMed Central

    Mariati; Koh, Esther YC; Yeo, Jessna HM; Ho, Steven CL; Yang, Yuansheng


    Maintaining high gene expression level during long-term culture is critical when producing therapeutic recombinant proteins using mammalian cells. Transcriptional silencing of promoters, most likely due to epigenetic events such as DNA methylation and histone modifications, is one of the major mechanisms causing production instability. Previous studies demonstrated that the core CpG island element (IE) from the hamster adenine phosphoribosyltransferase gene is effective to prevent DNA methylation. We generated one set of modified human cytomegalovirus (hCMV) promoters by insertion of one or two copies of IE in either forward or reverse orientations into different locations of the hCMV promoter. The modified hCMV with one copy of IE inserted between the hCMV enhancer and core promoter in reverse orientation (MR1) was most effective at enhancing expression stability in CHO cells without comprising expression level when compared with the wild type hCMV. We also found that insertion of IE into a chimeric murine CMV (mCMV) enhancer and human elongation factor-1α core (hEF) promoter in reverse orientation did not enhance expression stability, indicating that the effect of IE on expression stability is possibly promoter specific. PMID:25482237

  7. Engineering Genes for Predictable Protein Expression

    PubMed Central

    Gustafsson, Claes; Minshull, Jeremy; Govindarajan, Sridhar; Ness, Jon; Villalobos, Alan; Welch, Mark


    The DNA sequence used to encode a polypeptide can have dramatic effects on its expression. Lack of readily available tools has until recently inhibited meaningful experimental investigation of this phenomenon. Advances in synthetic biology and the application of modern engineering approaches now provide the tools for systematic analysis of the sequence variables affecting heterologous expression of recombinant proteins. We here discuss how these new tools are being applied and how they circumvent the constraints of previous approaches, highlighting some of the surprising and promising results emerging from the developing field of gene engineering. PMID:22425659

  8. Engineering genes for predictable protein expression.


    Gustafsson, Claes; Minshull, Jeremy; Govindarajan, Sridhar; Ness, Jon; Villalobos, Alan; Welch, Mark


    The DNA sequence used to encode a polypeptide can have dramatic effects on its expression. Lack of readily available tools has until recently inhibited meaningful experimental investigation of this phenomenon. Advances in synthetic biology and the application of modern engineering approaches now provide the tools for systematic analysis of the sequence variables affecting heterologous expression of recombinant proteins. We here discuss how these new tools are being applied and how they circumvent the constraints of previous approaches, highlighting some of the surprising and promising results emerging from the developing field of gene engineering.

  9. Cancer outlier differential gene expression detection.


    Wu, Baolin


    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at

  10. Programming gene expression with combinatorial promoters

    PubMed Central

    Cox, Robert Sidney; Surette, Michael G; Elowitz, Michael B


    Promoters control the expression of genes in response to one or more transcription factors (TFs). The architecture of a promoter is the arrangement and type of binding sites within it. To understand natural genetic circuits and to design promoters for synthetic biology, it is essential to understand the relationship between promoter function and architecture. We constructed a combinatorial library of random promoter architectures. We characterized 288 promoters in Escherichia coli, each containing up to three inputs from four different TFs. The library design allowed for multiple −10 and −35 boxes, and we observed varied promoter strength over five decades. To further analyze the functional repertoire, we defined a representation of promoter function in terms of regulatory range, logic type, and symmetry. Using these results, we identified heuristic rules for programming gene expression with combinatorial promoters. PMID:18004278

  11. Combinatorial engineering for heterologous gene expression.


    Zwick, Friederike; Lale, Rahmi; Valla, Svein


    Tools for strain engineering with predictable outcome are of crucial importance for the nascent field of synthetic biology. The success of combining different DNA biological parts is often restricted by poorly understood factors deriving from the complexity of the systems. We have previously identified variants for different regulatory elements of the expression cassette XylS/Pm. When such elements are combined they act in a manner consistent with their individual behavior, as long as they affect different functions, such as transcription and translation. Interestingly, sequence context does not seem to influence the final outcome significantly. Expression of reporter gene bla could be increased up to 75 times at the protein level by combining three variants in one cassette. For other tested reporter genes similar results were obtained, except that the stimulatory effect was quantitatively less. Combination of individually characterized DNA parts thus stands as suitable method to achieve a desired phenotype.

  12. Structure, expression and functions of MTA genes.


    Kumar, Rakesh; Wang, Rui-An


    Metastatic associated proteins (MTA) are integrators of upstream regulatory signals with the ability to act as master coregulators for modifying gene transcriptional activity. The MTA family includes three genes and multiple alternatively spliced variants. The MTA proteins neither have their own enzymatic activity nor have been shown to directly interact with DNA. However, MTA proteins interact with a variety of chromatin remodeling factors and complexes with enzymatic activities for modulating the plasticity of nucleosomes, leading to the repression or derepression of target genes or other extra-nuclear and nucleosome remodeling and histone deacetylase (NuRD)-complex independent activities. The functions of MTA family members are driven by the steady state levels and subcellular localization of MTA proteins, the dynamic nature of modifying signals and enzymes, the structural features and post-translational modification of protein domains, interactions with binding proteins, and the nature of the engaged and resulting features of nucleosomes in the proximity of target genes. In general, MTA1 and MTA2 are the most upregulated genes in human cancer and correlate well with aggressive phenotypes, therapeutic resistance, poor prognosis and ultimately, unfavorable survival of cancer patients. Here we will discuss the structure, expression and functions of the MTA family of genes in the context of cancer cells.

  13. Identifying driver genes in cancer by triangulating gene expression, gene location, and survival data.


    Rouam, Sigrid; Miller, Lance D; Karuturi, R Krishna Murthy


    Driver genes are directly responsible for oncogenesis and identifying them is essential in order to fully understand the mechanisms of cancer. However, it is difficult to delineate them from the larger pool of genes that are deregulated in cancer (ie, passenger genes). In order to address this problem, we developed an approach called TRIAngulating Gene Expression (TRIAGE through clinico-genomic intersects). Here, we present a refinement of this approach incorporating a new scoring methodology to identify putative driver genes that are deregulated in cancer. TRIAGE triangulates - or integrates - three levels of information: gene expression, gene location, and patient survival. First, TRIAGE identifies regions of deregulated expression (ie, expression footprints) by deriving a newly established measure called the Local Singular Value Decomposition (LSVD) score for each locus. Driver genes are then distinguished from passenger genes using dual survival analyses. Incorporating measurements of gene expression and weighting them according to the LSVD weight of each tumor, these analyses are performed using the genes located in significant expression footprints. Here, we first use simulated data to characterize the newly established LSVD score. We then present the results of our application of this refined version of TRIAGE to gene expression data from five cancer types. This refined version of TRIAGE not only allowed us to identify known prominent driver genes, such as MMP1, IL8, and COL1A2, but it also led us to identify several novel ones. These results illustrate that TRIAGE complements existing tools, allows for the identification of genes that drive cancer and could perhaps elucidate potential future targets of novel anticancer therapeutics.

  14. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.


    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  15. Nonreplicating vaccinia vector efficiently expresses recombinant genes.


    Sutter, G; Moss, B


    Modified vaccinia Ankara (MVA), a highly attenuated vaccinia virus strain that has been safety tested in humans, was evaluated for use as an expression vector. MVA has multiple genomic deletions and is severely host cell restricted: it grows well in avian cells but is unable to multiply in human and most other mammalian cells tested. Nevertheless, we found that replication of viral DNA appeared normal and that both early and late viral proteins were synthesized in human cells. Proteolytic processing of viral structural proteins was inhibited, however, and only immature virus particles were detected by electron microscopy. We constructed an insertion plasmid with the Escherichia coli lacZ gene under the control of the vaccinia virus late promoter P11, flanked by sequences of MVA DNA, to allow homologous recombination at the site of a naturally occurring 3500-base-pair deletion within the MVA genome. MVA recombinants were isolated and propagated in permissive avian cells and shown to express the enzyme beta-galactosidase upon infection of nonpermissive human cells. The amount of enzyme made was similar to that produced by a recombinant of vaccinia virus strain Western Reserve, which also had the lacZ gene under control of the P11 promoter, but multiplied to high titers. Since recombinant gene expression is unimpaired in nonpermissive human cells, MVA may serve as a highly efficient and exceptionally safe vector.

  16. A gene expression biomarker accurately predicts estrogen ...

    EPA Pesticide Factsheets

    The EPA’s vision for the Endocrine Disruptor Screening Program (EDSP) in the 21st Century (EDSP21) includes utilization of high-throughput screening (HTS) assays coupled with computational modeling to prioritize chemicals with the goal of eventually replacing current Tier 1 screening tests. The ToxCast program currently includes 18 HTS in vitro assays that evaluate the ability of chemicals to modulate estrogen receptor α (ERα), an important endocrine target. We propose microarray-based gene expression profiling as a complementary approach to predict ERα modulation and have developed computational methods to identify ERα modulators in an existing database of whole-genome microarray data. The ERα biomarker consisted of 46 ERα-regulated genes with consistent expression patterns across 7 known ER agonists and 3 known ER antagonists. The biomarker was evaluated as a predictive tool using the fold-change rank-based Running Fisher algorithm by comparison to annotated gene expression data sets from experiments in MCF-7 cells. Using 141 comparisons from chemical- and hormone-treated cells, the biomarker gave a balanced accuracy for prediction of ERα activation or suppression of 94% or 93%, respectively. The biomarker was able to correctly classify 18 out of 21 (86%) OECD ER reference chemicals including “very weak” agonists and replicated predictions based on 18 in vitro ER-associated HTS assays. For 114 chemicals present in both the HTS data and the MCF-7 c

  17. Expression of foreign genes in filamentous cyanobacteria

    SciTech Connect

    Kuritz, T.; Wolk, C.P. )


    Several advantages make cyanobacteria attractive hosts for biodegradative genes and possibly for other exogenous genes that have practical uses. The authors have obtained expression in Anabaena sp. strain PCC 7120 and Nostoc ellipsosporum of a dechlorination operon, fcbAB, from Arthrobacter globiformis, and have also developed a simple method for qualitative assessment of dechlorination by microorganisms, such as cyanobacteria, whose metabolism is dependent on the presence of chloride in the medium. Transcription of fcbAB under the control of a variety of promoters was monitored by placing luxAB (encoding luciferase) downstream from fcbAB, and by measuring light emission from luciferase. They believe that the system that they have described has value as a means to screen for factors influencing transcription of foreign genes in cyanobacteria.

  18. GeneTIER: prioritization of candidate disease genes using tissue-specific gene expression profiles

    PubMed Central

    Antanaviciute, Agne; Daly, Catherine; Crinnion, Laura A.; Markham, Alexander F.; Watson, Christopher M.; Bonthron, David T.; Carr, Ian M.


    Motivation: In attempts to determine the genetic causes of human disease, researchers are often faced with a large number of candidate genes. Linkage studies can point to a genomic region containing hundreds of genes, while the high-throughput sequencing approach will often identify a great number of non-synonymous genetic variants. Since systematic experimental verification of each such candidate gene is not feasible, a method is needed to decide which genes are worth investigating further. Computational gene prioritization presents itself as a solution to this problem, systematically analyzing and sorting each gene from the most to least likely to be the disease-causing gene, in a fraction of the time it would take a researcher to perform such queries manually. Results: Here, we present Gene TIssue Expression Ranker (GeneTIER), a new web-based application for candidate gene prioritization. GeneTIER replaces knowledge-based inference traditionally used in candidate disease gene prioritization applications with experimental data from tissue-specific gene expression datasets and thus largely overcomes the bias toward the better characterized genes/diseases that commonly afflict other methods. We show that our approach is capable of accurate candidate gene prioritization and illustrate its strengths and weaknesses using case study examples. Availability and Implementation: Freely available on the web at Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25861967

  19. Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

    SciTech Connect

    Salem, Tamer Z.; Zhang, Fengrui; Thiem, Suzanne M.


    Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

  20. Screening of differentially expressed genes in pathological scar tissues using expression microarray.


    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S


    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  1. Gene expression and IG-DMR hypomethylation of maternally expressed gene 3 in developing corticospinal neurons.


    Qu, Chunsheng; Jiang, Tian; Li, Yong; Wang, Xiongwei; Cao, Huateng; Xu, Hongping; Qu, Jia; Chen, Jie-Guang


    The mammalian cerebral cortex plays a central role in higher cognitive functions and in the complex task of motor control. Maternally expressed gene 3 (Meg3) appears to play a role in cortical development and neurodegeneration, but the expression and regulation of Meg3 in the cortex is not clear. In this study, we examined the expression of transcript variants of Meg3 in the developing mouse cerebral cortex. By in situ hybridization, we found that a novel transcript variant of Meg3 with 8 small exons was expressed in the developing cortex, whereas the long isoforms of Meg3 (~11 kb) were enriched in corticospinal neurons (CSNs) in layer V of the cortex. No transcript variants of Meg3 were found in the neural progenitors at E12.5, when the intergenic differential methylation region (IG-DMR) near Meg3 was highly methylated. IG-DMR became demethylated at E15.5 and remained hypomethylated in early CSNs isolated from Fezf2-EGFP transgenic mice. The expression of Meg3 transcript variant 1 was inversely correlated with the IG-DMR methylation level during development. Moreover, expression of paternally expressed gene Peg11 was limited to the upper layers, consistent with the idea that the maternally expressed gene may be preferentially transcribed in the lower layers of the cortex. The spatiotemporal expression pattern of Meg3 suggests that it may participate in the early development of CSNs and contribute to cortical malfunctions related to aberrant imprinting in Meg3.

  2. Gravity-Induced Gene Expression in Plants.

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Heber, Steffen; Howard, Brian; Myburg-Nichols, Henrietta; Hammond, Rebecca; Salinas-Mondragon, Raul; Brown, Christopher S.

    Plants sense changes in their orientation towards the vector of gravity and respond with directional growth. Several metabolites in the signal transduction cascade have been identified. However, very little is known about the interaction between these sensing and signal transduction events and even less is known about their role in the differential growth response. Gravity induced changes in transcript abundance have been identified in Arabidopsis whole seedlings and root apices (Moseyko et al. 2002; Kimbrough et al. 2004). Gravity induced transcript abundance changes can be observed within less than 1 min after stimulation (Salinas-Mondragon et al. 2005). Gene expression however requires not only transcription but also translation of the mRNA. Translation can only occur when mRNA is associated with ribosomes, even though not all mRNA associated with ribosomes is actively translated. To approximate translational capacity we quantified whole genome transcript abundances in corn stem pulvini during the first hour after gravity stimulation in total and poly-ribosomal fractions. As in Arabidopsis root apices, transcript abundances of several clusters of genes responded to gravity stimulation. The vast majority of these transcripts were also found to associate with polyribosomes in the same temporal and quantitative pattern. These genes are transcriptionally regulated by gravity stimulation, but do not exhibit translational regulation. However, a small group of genes showed increased transcriptional regulation after gravity stimulation, but no association with polysomes. These transcripts likely are translationally repressed. The mechanism of translational repression for these transcripts is unknown. Based on the hypothesis that the genes essential for gravitropic responses should be expressed in most or all species, we compared the temporal gravity induced expression pattern of all orthologs identified between maize and Arabidopsis. A small group of genes showed high

  3. X chromosome regulation of autosomal gene expression in bovine blastocysts.


    Itoh, Yuichiro; Arnold, Arthur P


    Although X chromosome inactivation in female mammals evolved to balance the expression of X chromosome and autosomal genes in the two sexes, female embryos pass through developmental stages in which both X chromosomes are active in somatic cells. Bovine blastocysts show higher expression of many X genes in XX than XY embryos, suggesting that X inactivation is not complete. Here, we reanalyzed bovine blastocyst microarray expression data from a network perspective with a focus on interactions between X chromosome and autosomal genes. Whereas male-to-female ratios of expression of autosomal genes were distributed around a mean of 1, X chromosome genes were clearly shifted towards higher expression in females. We generated gene coexpression networks and identified a major module of genes with correlated gene expression that includes female-biased X genes and sexually dimorphic autosomal genes for which the sexual dimorphism is likely driven by the X genes. In this module, expression of X chromosome genes correlates with autosome genes, more than the expression of autosomal genes with each other. Our study identifies correlated patterns of autosomal and X-linked genes that are likely influenced by the sexual imbalance of X gene expression when X inactivation is inefficient.

  4. Gene expression and cAMP.

    PubMed Central

    Nagamine, Y; Reich, E


    By comparing the 5'-flanking region of the porcine gene for the urokinase form of plasminogen activator with those of other cAMP-regulated genes, we identify a 29-nucleotide sequence that is tentatively proposed as the cAMP-regulatory unit. Homologous sequences are present (i) in the cAMP-regulated rat tyrosine aminotransferase, prolactin, and phosphoenolpyruvate carboxykinase genes and (ii) 5' to the transcription initiation sites of cAMP-regulated Escherichia coli genes. From this we conclude that the expression of cAMP-responsive genes in higher eukaryotes may be controlled, as in E. coli, by proteins that form complexes with cAMP and then show sequence-specific DNA-binding properties. The complex formed by cAMP and the regulatory subunit of the type II mammalian protein kinase might be one candidate for this function. Based on several homologies we suggest that this subunit may have retained both the DNA-binding specificity and transcription-regulating properties in addition to the nucleotide-binding domains of the bacterial cAMP-binding protein. If this were so, dissociation of protein kinase by cAMP would activate two processes: (i) protein phosphorylation by the catalytic subunit and (ii) transcription regulation by the regulatory subunit. PMID:2991882

  5. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A


    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  6. Studying the complex expression dependences between sets of coexpressed genes.


    Huerta, Mario; Casanova, Oriol; Barchino, Roberto; Flores, Jose; Querol, Enrique; Cedano, Juan


    Organisms simplify the orchestration of gene expression by coregulating genes whose products function together in the cell. The use of clustering methods to obtain sets of coexpressed genes from expression arrays is very common; nevertheless there are no appropriate tools to study the expression networks among these sets of coexpressed genes. The aim of the developed tools is to allow studying the complex expression dependences that exist between sets of coexpressed genes. For this purpose, we start detecting the nonlinear expression relationships between pairs of genes, plus the coexpressed genes. Next, we form networks among sets of coexpressed genes that maintain nonlinear expression dependences between all of them. The expression relationship between the sets of coexpressed genes is defined by the expression relationship between the skeletons of these sets, where this skeleton represents the coexpressed genes with a well-defined nonlinear expression relationship with the skeleton of the other sets. As a result, we can study the nonlinear expression relationships between a target gene and other sets of coexpressed genes, or start the study from the skeleton of the sets, to study the complex relationships of activation and deactivation between the sets of coexpressed genes that carry out the different cellular processes present in the expression experiments.

  7. Covariance Structure Models for Gene Expression Microarray Data

    ERIC Educational Resources Information Center

    Xie, Jun; Bentler, Peter M.


    Covariance structure models are applied to gene expression data using a factor model, a path model, and their combination. The factor model is based on a few factors that capture most of the expression information. A common factor of a group of genes may represent a common protein factor for the transcript of the co-expressed genes, and hence, it…

  8. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository.


    Edgar, Ron; Domrachev, Michael; Lash, Alex E


    The Gene Expression Omnibus (GEO) project was initiated in response to the growing demand for a public repository for high-throughput gene expression data. GEO provides a flexible and open design that facilitates submission, storage and retrieval of heterogeneous data sets from high-throughput gene expression and genomic hybridization experiments. GEO is not intended to replace in house gene expression databases that benefit from coherent data sets, and which are constructed to facilitate a particular analytic method, but rather complement these by acting as a tertiary, central data distribution hub. The three central data entities of GEO are platforms, samples and series, and were designed with gene expression and genomic hybridization experiments in mind. A platform is, essentially, a list of probes that define what set of molecules may be detected. A sample describes the set of molecules that are being probed and references a single platform used to generate its molecular abundance data. A series organizes samples into the meaningful data sets which make up an experiment. The GEO repository is publicly accessible through the World Wide Web at

  9. Novel recombinant papillomavirus genomes expressing selectable genes

    PubMed Central

    Van Doorslaer, Koenraad; Porter, Samuel; McKinney, Caleb; Stepp, Wesley H.; McBride, Alison A.


    Papillomaviruses infect and replicate in keratinocytes, but viral proteins are initially expressed at low levels and there is no effective and quantitative method to determine the efficiency of infection on a cell-to-cell basis. Here we describe human papillomavirus (HPV) genomes that express marker proteins (antibiotic resistance genes and Green Fluorescent Protein), and can be used to elucidate early stages in HPV infection of primary keratinocytes. To generate these recombinant genomes, the late region of the oncogenic HPV18 genome was replaced by CpG free marker genes. Insertion of these exogenous genes did not affect early replication, and had only minimal effects on early viral transcription. When introduced into primary keratinocytes, the recombinant marker genomes gave rise to drug-resistant keratinocyte colonies and cell lines, which maintained the extrachromosomal recombinant genome long-term. Furthermore, the HPV18 “marker” genomes could be packaged into viral particles (quasivirions) and used to infect primary human keratinocytes in culture. This resulted in the outgrowth of drug-resistant keratinocyte colonies containing replicating HPV18 genomes. In summary, we describe HPV18 marker genomes that can be used to quantitatively investigate many aspects of the viral life cycle. PMID:27892937

  10. Nuclear AXIN2 represses MYC gene expression

    SciTech Connect

    Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S.


    Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling.

  11. Inducible gene expression systems and plant biotechnology.


    Corrado, Giandomenico; Karali, Marianthi


    Plant biotechnology relies heavily on the genetic manipulation of crops. Almost invariantly, the gene of interest is expressed in a constitutive fashion, although this may not be strictly necessary for several applications. Currently, there are several regulatable expression systems for the temporal, spatial and quantitative control of transgene activity. These molecular switches are based on components derived from different organisms, which range from viruses to higher eukaryotes. Many inducible systems have been designed for fundamental and applied research and since their initial development, they have become increasingly popular in plant molecular biology. This review covers a broad number of inducible expression systems examining their properties and relevance for plant biotechnology in its various guises, from molecular breeding to pharmaceutical and industrial applications. For each system, we examine some advantages and limitations, also in relation to the strategy on which they rely. Besides being necessary to control useful genes that may negatively affect crop yield and quality, we discuss that inducible systems can be also used to increase public acceptance of GMOs, reducing some of the most common concerns. Finally, we suggest some directions and future developments for their further diffusion in agriculture and biotechnology.

  12. Combined clustering models for the analysis of gene expression

    SciTech Connect

    Angelova, M. Ellman, J.


    Clustering has become one of the fundamental tools for analyzing gene expression and producing gene classifications. Clustering models enable finding patterns of similarity in order to understand gene function, gene regulation, cellular processes and sub-types of cells. The clustering results however have to be combined with sequence data or knowledge about gene functionality in order to make biologically meaningful conclusions. In this work, we explore a new model that integrates gene expression with sequence or text information.

  13. Using PCR to Target Misconceptions about Gene Expression

    PubMed Central

    Wright, Leslie K.; Newman, Dina L.


    We present a PCR-based laboratory exercise that can be used with first- or second-year biology students to help overcome common misconceptions about gene expression. Biology students typically do not have a clear understanding of the difference between genes (DNA) and gene expression (mRNA/protein) and often believe that genes exist in an organism or cell only when they are expressed. This laboratory exercise allows students to carry out a PCR-based experiment designed to challenge their misunderstanding of the difference between genes and gene expression. Students first transform E. coli with an inducible GFP gene containing plasmid and observe induced and un-induced colonies. The following exercise creates cognitive dissonance when actual PCR results contradict their initial (incorrect) predictions of the presence of the GFP gene in transformed cells. Field testing of this laboratory exercise resulted in learning gains on both knowledge and application questions on concepts related to genes and gene expression. PMID:23858358

  14. Regulation of Airway Mucin Gene Expression

    PubMed Central

    Thai, Philip; Loukoianov, Artem; Wachi, Shinichiro; Wu, Reen


    Mucins are important components that exert a variety of functions in cell-cell interaction, epidermal growth factor receptor signaling, and airways protection. In the conducting airways of the lungs, mucins are the major contributor to the viscoelastic property of mucous secretion, which is the major barrier to trapping inhaled microbial organism, particulates, and oxidative pollutants. The homeostasis of mucin production is an important feature in conducting airways for the maintenance of mucociliary function. Aberrant mucin secretion and accumulation in airway lumen are clinical hallmarks associated with various lung diseases, such as asthma, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, and lung cancer. Among 20 known mucin genes identified, 11 of them have been verified at either the mRNA and/or protein level in airways. The regulation of mucin genes is complicated, as are the mediators and signaling pathways. This review summarizes the current view on the mediators, the signaling pathways, and the transcriptional units that are involved in the regulation of airway mucin gene expression. In addition, we also point out essential features of epigenetic mechanisms for the regulation of these genes. PMID:17961085

  15. Hyperbaric oxygen treatment induces antioxidant gene expression.


    Godman, Cassandra A; Joshi, Rashmi; Giardina, Charles; Perdrizet, George; Hightower, Lawrence E


    Although the underlying molecular causes of aging are not entirely clear, hormetic agents like exercise, heat, and calorie restriction may generate a mild pro-oxidant stress that induces cell protective responses to promote healthy aging. As an individual ages, many cellular and physiological processes decline, including wound healing and reparative angiogenesis. This is particularly critical in patients with chronic non-healing wounds who tend to be older. We are interested in the potential beneficial effects of hyperbaric oxygen as a mild hormetic stress on human microvascular endothelial cells. We analyzed global gene expression changes in human endothelial cells following a hyperbaric exposure comparable to a clinical treatment. Our analysis revealed an upregulation of antioxidant, cytoprotective, and immediate early genes. This increase coincided with an increased resistance to a lethal oxidative stress. Our data indicate that hyperbaric oxygen can induce protection against oxidative insults in endothelial cells and may provide an easily administered hormetic treatment to help promote healthy aging.

  16. Expressing exogenous genes in newts by transgenesis.


    Casco-Robles, Martin Miguel; Yamada, Shouta; Miura, Tomoya; Nakamura, Kenta; Haynes, Tracy; Maki, Nobuyasu; Del Rio-Tsonis, Katia; Tsonis, Panagiotis A; Chiba, Chikafumi


    The great regenerative abilities of newts provide the impetus for studies at the molecular level. However, efficient methods for gene regulation have historically been quite limited. Here we describe a protocol for transgenically expressing exogenous genes in the newt Cynops pyrrhogaster. This method is simple: a reaction mixture of I-SceI meganuclease and a plasmid DNA carrying a transgene cassette flanked by the enzyme recognition sites is directly injected into fertilized eggs. The protocol achieves a high efficiency of transgenesis, comparable to protocols used in other animal systems, and it provides a practical number of transgenic newts (∼20% of injected embryos) that survive beyond metamorphosis and that can be applied to regenerative studies. The entire protocol for obtaining transgenic adult newts takes 4-5 months.

  17. Gene expression signatures in lymphoid tumours.


    Kees, Ursula R


    Lymphoid tumours comprise the acute and chronic leukaemias, the broad spectrum of lymphomas, including Hodgkin's disease, and multiple myeloma. The subdivision of the acute leukaemias according to the proliferating type of white blood cells has had a major impact on the care of these patients. More recently, specific chromosomal translocations have been used to identify patients who may benefit from more intensive therapies. The novel high-throughput genomic technologies, such as microarrays, provide new avenues for the molecular diagnosis of the haematological malignancies. Rapid advances in genome sequencing and gene expression profiling provide unprecedented opportunities to identify specific genes involved in complex biological processes, including tumorigenesis. The features of microarray technology and the variety of experimental approaches to elucidate lymphoid malignancies are discussed. Microarray technology has the potential to lead to more accurate prognostic assessment for patients and is expected to ultimately allow the clinician to select therapies optimally suited to each patient.

  18. Retrotransposons as regulators of gene expression.


    Elbarbary, Reyad A; Lucas, Bronwyn A; Maquat, Lynne E


    Transposable elements (TEs) are both a boon and a bane to eukaryotic organisms, depending on where they integrate into the genome and how their sequences function once integrated. We focus on two types of TEs: long interspersed elements (LINEs) and short interspersed elements (SINEs). LINEs and SINEs are retrotransposons; that is, they transpose via an RNA intermediate. We discuss how LINEs and SINEs have expanded in eukaryotic genomes and contribute to genome evolution. An emerging body of evidence indicates that LINEs and SINEs function to regulate gene expression by affecting chromatin structure, gene transcription, pre-mRNA processing, or aspects of mRNA metabolism. We also describe how adenosine-to-inosine editing influences SINE function and how ongoing retrotransposition is countered by the body's defense mechanisms.

  19. Gene expression-targeted isoflavone therapy.


    Węgrzyn, Alicja


    Lysosomal storage diseases (LSD) form a group of inherited metabolic disorders caused by dysfunction of one of the lysosomal proteins, resulting in the accumulation of certain compounds. Although these disorders are among first genetic diseases for which specific treatments were proposed, there are still serious unsolved problems that require development of novel therapeutic procedures. An example is neuronopathy, which develops in most of LSD and cannot be treated efficiently by currently approved therapies. Recently, a new potential therapy, called gene expression-targeted isoflavone therapy (GET IT), has been proposed for a group of LSD named mucopolysaccharidoses (MPS), in which storage of incompletely degraded glycosaminoglycans (GAGs) results in severe symptoms of virtually all tissues and organs, including central nervous system. The idea of this therapy is to inhibit synthesis of GAGs by modulating expression of genes coding for enzymes involved in synthesis of these compounds. Such a modulation is possible by using isoflavones, particularly genistein, which interfere with a signal transduction process necessary for stimulation of expression of certain genes. Results of in vitro experiments and studies on animal models indicated a high efficiency of GET IT, including correction of behavior of affected mice. However, clinical trials, performed with soy isoflavone extracts, revealed only limited efficacy. This caused a controversy about GET IT as a potential, effective treatment of patients suffering from MPS, especially neuronopathic forms of these diseases. It this critical review, I present possible molecular mechanisms of therapeutic action of isoflavones (particularly genistein) and suggest that efficacy of GET IT might be sufficiently high when using relatively high doses of synthetic genistein (which was employed in experiments on cell cultures and mouse models) rather than low doses of soy isoflavone extracts (which were used in clinical trials). This

  20. Maternal diet programs embryonic kidney gene expression.


    Welham, Simon J M; Riley, Paul R; Wade, Angie; Hubank, Mike; Woolf, Adrian S


    Human epidemiological data associating birth weight with adult disease suggest that organogenesis is "programmed" by maternal diet. In rats, protein restriction in pregnancy produces offspring with fewer renal glomeruli and higher systemic blood pressures than controls. We tested the hypothesis that maternal diet alters gene expression in the metanephros, the precursor of the definitive mammalian kidney. We demonstrated that maternal low-protein diet initiated when pregnancy starts and maintained to embryonic day 13, when the metanephros consists of mesenchyme surrounding a once-branched ureteric bud, is sufficient to significantly reduce glomerular numbers in offspring by about 20%. As assessed by representational difference analyses and real-time quantitative polymerase chain reactions, low-protein diet modulated gene expression in embryonic day 13 metanephroi. In particular, levels of prox-1, the ortholog of Drosophila transcription factor prospero, and cofilin-1, a regulator of the actin cytoskeleton, were reduced. During normal metanephrogenesis, prox-1 protein was first detected in mesenchymal cells around the ureteric tree and thereafter in nascent nephron epithelia, whereas cofilin-1 immunolocalized to bud derivatives and condensing mesenchyme. Previously, we reported that low-protein diets increased mesenchymal apoptosis cells when metanephrogenesis began and thereafter reduced numbers of precursor cells. Collectively, these studies prove that the maternal diet programs the embryonic kidney, altering cell turnover and gene expression at a time when nephrons and glomeruli have yet to form. The human implication is that the maternal diet ingested between conception and 5- 6-wk gestation contributes to the variation in glomerular numbers that are known to occur between healthy and hypertensive populations.

  1. Pathway network inference from gene expression data

    PubMed Central


    Background The development of high-throughput omics technologies enabled genome-wide measurements of the activity of cellular elements and provides the analytical resources for the progress of the Systems Biology discipline. Analysis and interpretation of gene expression data has evolved from the gene to the pathway and interaction level, i.e. from the detection of differentially expressed genes, to the establishment of gene interaction networks and the identification of enriched functional categories. Still, the understanding of biological systems requires a further level of analysis that addresses the characterization of the interaction between functional modules. Results We present a novel computational methodology to study the functional interconnections among the molecular elements of a biological system. The PANA approach uses high-throughput genomics measurements and a functional annotation scheme to extract an activity profile from each functional block -or pathway- followed by machine-learning methods to infer the relationships between these functional profiles. The result is a global, interconnected network of pathways that represents the functional cross-talk within the molecular system. We have applied this approach to describe the functional transcriptional connections during the yeast cell cycle and to identify pathways that change their connectivity in a disease condition using an Alzheimer example. Conclusions PANA is a useful tool to deepen in our understanding of the functional interdependences that operate within complex biological systems. We show the approach is algorithmically consistent and the inferred network is well supported by the available functional data. The method allows the dissection of the molecular basis of the functional connections and we describe the different regulatory mechanisms that explain the network's topology obtained for the yeast cell cycle data. PMID:25032889

  2. Altered gene expression correlates with DNA structure.


    Kohwi, Y; Kohwi-Shigematsu, T


    We examined the participation of triplex DNA structure in gene regulation using a poly(dG)-poly(dC) sequence as a model. We show that a poly(dG)-poly(dC) sequence, which can adopt an intramolecular dG.dG.dC triplex under superhelical strain, strongly augments gene expression when placed 5' to a promoter. The activity of this sequence exhibits a striking length dependency: dG tracts of 27-30 bp augment the expression of a reporter gene to a level comparable to that observed with the polyoma enhancer in mouse LTK- cells, whereas tracts of 35 bp and longer have virtually no effect. A supercoiled plasmid containing a dG tract of 30 bp competes in vivo for a trans-acting factor as revealed by reduction in the reporter gene transcription driven by the (dG)29/promoter of the test plasmid, while dGs of 35 bp and longer in the competition plasmid failed to compete. In purified supercoiled plasmid DNA at a superhelical density of -0.05, dG tracts of 32 bp and longer form a triplex, whereas those of 30 bp and shorter remain double-stranded under a PBS solution. These results suggest that a localized superhelical strain can exist, at least transiently, in mouse LTK- cells, and before being relaxed by topoisomerases this rapidly induces dG tracts of 35 bp and longer to adopt a triplex preventing the factor from binding. Thus, these data suggest that a poly(dG)-poly(dC) sequence can function as a negative regulator by adopting an intramolecular triple helix structure in vivo.

  3. Dynamics of single-cell gene expression

    PubMed Central

    Longo, Diane; Hasty, Jeff


    Cellular behavior has traditionally been investigated by utilizing bulk-scale methods that measure average values for a population of cells. Such population-wide studies mask the behavior of individual cells and are often insufficient for characterizing biological processes in which cellular heterogeneity plays a key role. A unifying theme of many recent studies has been a focus on the development and utilization of single-cell experimental techniques that are capable of probing key biological phenomena in individual living cells. Recently, novel information about gene expression dynamics has been obtained from single-cell experiments that draw upon the unique capabilities of fluorescent reporter proteins. PMID:17130866

  4. Solid state nanopores for gene expression profiling

    NASA Astrophysics Data System (ADS)

    Mussi, V.; Fanzio, P.; Repetto, L.; Firpo, G.; Valbusa, U.; Scaruffi, P.; Stigliani, S.; Tonini, G. P.


    Recently, nanopore technology has been introduced for genome analysis. Here we show results related to the possibility of preparing "engineered solid state nanopores". The nanopores were fabricated on a suspended Si 3N 4 membrane by Focused Ion Beam (FIB) drilling and chemically functionalized in order to covalently bind oligonucleotides (probes) on their surface. Our data show the stable effect of DNA attachment on the ionic current measured through the nanopore, making it possible to conceive and develop a selective biosensor for gene expression profiling.

  5. Clinical diagnostic gene expression thyroid testing.


    Steward, David L; Kloos, Richard T


    Thyroid fine-needle aspiration biopsies are cytologically indeterminate in 15% to 30% of cases. When cytologically indeterminate thyroid nodules undergo diagnostic surgery, approximately three-quarters prove to be histologically benign. A negative predictive value of more than or equal to 94% for the Afirma Gene Expression Classifier (GEC) is achieved for indeterminate nodules. Most Afirma GEC benign nodules can be clinically observed, as suggested by the National Comprehensive Cancer Network Thyroid Carcinoma Guideline. More than half of the benign nodules with indeterminate cytology (Bethesda categories III/IV) can be identified as GEC benign and removed from the surgical pool to prevent unnecessary diagnostic surgery.

  6. Clustering gene expression data using graph separators.


    Kaba, Bangaly; Pinet, Nicolas; Lelandais, Gaëlle; Sigayret, Alain; Berry, Anne


    Recent work has used graphs to modelize expression data from microarray experiments, in view of partitioning the genes into clusters. In this paper, we introduce the use of a decomposition by clique separators. Our aim is to improve the classical clustering methods in two ways: first we want to allow an overlap between clusters, as this seems biologically sound, and second we want to be guided by the structure of the graph to define the number of clusters. We test this approach with a well-known yeast database (Saccharomyces cerevisiae). Our results are good, as the expression profiles of the clusters we find are very coherent. Moreover, we are able to organize into another graph the clusters we find, and order them in a fashion which turns out to respect the chronological order defined by the the sporulation process.

  7. Gene expression during the life cycle of Drosophila melanogaster.


    Arbeitman, Michelle N; Furlong, Eileen E M; Imam, Farhad; Johnson, Eric; Null, Brian H; Baker, Bruce S; Krasnow, Mark A; Scott, Matthew P; Davis, Ronald W; White, Kevin P


    Molecular genetic studies of Drosophila melanogaster have led to profound advances in understanding the regulation of development. Here we report gene expression patterns for nearly one-third of all Drosophila genes during a complete time course of development. Mutations that eliminate eye or germline tissue were used to further analyze tissue-specific gene expression programs. These studies define major characteristics of the transcriptional programs that underlie the life cycle, compare development in males and females, and show that large-scale gene expression data collected from whole animals can be used to identify genes expressed in particular tissues and organs or genes involved in specific biological and biochemical processes.

  8. Gene Expression During the Life Cycle of Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Arbeitman, Michelle N.; Furlong, Eileen E. M.; Imam, Farhad; Johnson, Eric; Null, Brian H.; Baker, Bruce S.; Krasnow, Mark A.; Scott, Matthew P.; Davis, Ronald W.; White, Kevin P.


    Molecular genetic studies of Drosophila melanogaster have led to profound advances in understanding the regulation of development. Here we report gene expression patterns for nearly one-third of all Drosophila genes during a complete time course of development. Mutations that eliminate eye or germline tissue were used to further analyze tissue-specific gene expression programs. These studies define major characteristics of the transcriptional programs that underlie the life cycle, compare development in males and females, and show that large-scale gene expression data collected from whole animals can be used to identify genes expressed in particular tissues and organs or genes involved in specific biological and biochemical processes.

  9. An extensive network of coupling among gene expression machines.


    Maniatis, Tom; Reed, Robin


    Gene expression in eukaryotes requires several multi-component cellular machines. Each machine carries out a separate step in the gene expression pathway, which includes transcription, several pre-messenger RNA processing steps and the export of mature mRNA to the cytoplasm. Recent studies lead to the view that, in contrast to a simple linear assembly line, a complex and extensively coupled network has evolved to coordinate the activities of the gene expression machines. The extensive coupling is consistent with a model in which the machines are tethered to each other to form 'gene expression factories' that maximize the efficiency and specificity of each step in gene expression.

  10. A Double Selection Approach to Achieve Specific Expression of Toxin Genes for Ovarian Cancer Gene Therapy

    DTIC Science & Technology


    specific expression of toxin genes for ovarian cancer gene therapy PRINCIPAL INVESTIGATOR: David T. Curiel, M.D., Ph.D. Gene Siegal...A double selection approach to achieve specific expression of toxin genes for ovarian cancer gene therapy 5b. GRANT NUMBER W81XWH-05-1-0035...cancer. This system should result in highly efficient and specific expression of toxin encoding genes in tumor cells, enabling these cells to be

  11. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O


    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  12. Identification of human HK genes and gene expression regulation study in cancer from transcriptomics data analysis.


    Chen, Meili; Xiao, Jingfa; Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun


    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer.

  13. Gut microbiota, host gene expression, and aging.


    Patrignani, Paola; Tacconelli, Stefania; Bruno, Annalisa


    Novel concepts of disease susceptibility and development suggest an important role of gastrointestinal microbiota and microbial pathogens. They can contribute to physiological systems and disease processes, even outside of the gastrointestinal tract. There is increasing evidence that genetics of the host influence and interact with gut microbiota. Moreover, aging-associated oxidative stress may cause morphologic alterations of bacterial cells, thus influencing the aggressive potential and virulence markers of an anaerobic bacterium and finally the type of interaction with the host. At the same time, microbiota may influence host gene expression and it is becoming apparent that it may occur through the regulation of microRNAs. They are short single-stranded noncoding RNAs that regulate posttranscriptional gene expression by affecting mRNA stability and/or translational repression of their target mRNAs. The introduction of -omics approaches (such as metagenomics, metaproteomics, and metatranscriptomics) in microbiota research will certainly advance our knowledge of this area. This will lead to greatly deepen our understanding of the molecular targets in the homeostatic interaction between the gut microbiota and the host and, thereby, promises to reveal new ways to treat diseases and maintain health.

  14. Posttranscriptional Control of Gene Expression in Yeast

    PubMed Central

    McCarthy, John E. G.


    Studies of the budding yeast Saccharomyces cerevisiae have greatly advanced our understanding of the posttranscriptional steps of eukaryotic gene expression. Given the wide range of experimental tools applicable to S. cerevisiae and the recent determination of its complete genomic sequence, many of the key challenges of the posttranscriptional control field can be tackled particularly effectively by using this organism. This article reviews the current knowledge of the cellular components and mechanisms related to translation and mRNA decay, with the emphasis on the molecular basis for rate control and gene regulation. Recent progress in characterizing translation factors and their protein-protein and RNA-protein interactions has been rapid. Against the background of a growing body of structural information, the review discusses the thermodynamic and kinetic principles that govern the translation process. As in prokaryotic systems, translational initiation is a key point of control. Modulation of the activities of translational initiation factors imposes global regulation in the cell, while structural features of particular 5′ untranslated regions, such as upstream open reading frames and effector binding sites, allow for gene-specific regulation. Recent data have revealed many new details of the molecular mechanisms involved while providing insight into the functional overlaps and molecular networking that are apparently a key feature of evolving cellular systems. An overall picture of the mechanisms governing mRNA decay has only very recently begun to develop. The latest work has revealed new information about the mRNA decay pathways, the components of the mRNA degradation machinery, and the way in which these might relate to the translation apparatus. Overall, major challenges still to be addressed include the task of relating principles of posttranscriptional control to cellular compartmentalization and polysome structure and the role of molecular channelling

  15. Social regulation of cortisol receptor gene expression

    PubMed Central

    Korzan, Wayne J.; Grone, Brian P.; Fernald, Russell D.


    In many social species, individuals influence the reproductive capacity of conspecifics. In a well-studied African cichlid fish species, Astatotilapia burtoni, males are either dominant (D) and reproductively competent or non-dominant (ND) and reproductively suppressed as evidenced by reduced gonadotropin releasing hormone (GnRH1) release, regressed gonads, lower levels of androgens and elevated levels of cortisol. Here, we asked whether androgen and cortisol levels might regulate this reproductive suppression. Astatotilapia burtoni has four glucocorticoid receptors (GR1a, GR1b, GR2 and MR), encoded by three genes, and two androgen receptors (ARα and ARβ), encoded by two genes. We previously showed that ARα and ARβ are expressed in GnRH1 neurons in the preoptic area (POA), which regulates reproduction, and that the mRNA levels of these receptors are regulated by social status. Here, we show that GR1, GR2 and MR mRNAs are also expressed in GnRH1 neurons in the POA, revealing potential mechanisms for both androgens and cortisol to influence reproductive capacity. We measured AR, MR and GR mRNA expression levels in a microdissected region of the POA containing GnRH1 neurons, comparing D and ND males. Using quantitative PCR (qPCR), we found D males had higher mRNA levels of ARα, MR, total GR1a and GR2 in the POA compared with ND males. In contrast, ND males had significantly higher levels of GR1b mRNA, a receptor subtype with a reduced transcriptional response to cortisol. Through this novel regulation of receptor type, neurons in the POA of an ND male will be less affected by the higher levels of cortisol typical of low status, suggesting GR receptor type change as a potential adaptive mechanism to mediate high cortisol levels during social suppression. PMID:25013108

  16. Expressing genes do not forget their LINEs: transposable elements and gene expression.


    Kines, Kristine J; Belancio, Victoria P


    Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue- or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored.

  17. [Mechanism on differential gene expression and heterosis formation].


    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong


    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  18. Correspondence between resting state activity and brain gene expression

    PubMed Central

    Wang, Guang-Zhong; Belgard, T. Grant; Mao, Deng; Chen, Leslie; Berto, Stefano; Preuss, Todd M.; Lu, Hanzhang; Geschwind, Daniel H.; Konopka, Genevieve


    SUMMARY The relationship between functional brain activity and gene expression has not been fully explored in the human brain. Here, we identify significant correlations between gene expression in the brain and functional activity by comparing fractional Amplitude of Low Frequency Fluctuations (fALFF) from two independent human fMRI resting state datasets to regional cortical gene expression from a newly generated RNA-seq dataset and two additional gene expression datasets to obtain robust and reproducible correlations. We find significantly more genes correlated with fALFF than expected by chance, and identify specific genes correlated with the imaging signals in multiple expression datasets in the default mode network. Together, these data support a population-level relationship between regional steady state brain gene expression and resting state brain activity. PMID:26590343

  19. Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae.

    PubMed Central

    Chen, C Y; Oppermann, H; Hitzeman, R A


    DNA sequences normally flanking the highly expressed yeast 3-phosphoglycerate kinase (PGK) gene have been placed adjacent to heterologous mammalian genes on high copy number plasmid vectors and used for expression experiments in yeast. For many genes thus far expressed with this system, expression has been 15-50 times lower than the expression of the natural homologous PGK gene on the same plasmid. We have extensively investigated this dramatic difference and have found that in most cases it is directly proportional to the steady-state levels of mRNAs. We demonstrate this phenomenon and suggest possible causes for this effect on mRNA levels. Images PMID:6096814

  20. Sequence determinants of prokaryotic gene expression level under heat stress.


    Xiong, Heng; Yang, Yi; Hu, Xiao-Pan; He, Yi-Ming; Ma, Bin-Guang


    Prokaryotic gene expression is environment-dependent and temperature plays an important role in shaping the gene expression profile. Revealing the regulation mechanisms of gene expression pertaining to temperature has attracted tremendous efforts in recent years particularly owning to the yielding of transcriptome and proteome data by high-throughput techniques. However, most of the previous works concentrated on the characterization of the gene expression profile of individual organism and little effort has been made to disclose the commonality among organisms, especially for the gene sequence features. In this report, we collected the transcriptome and proteome data measured under heat stress condition from recently published literature and studied the sequence determinants for the expression level of heat-responsive genes on multiple layers. Our results showed that there indeed exist commonness and consistent patterns of the sequence features among organisms for the differentially expressed genes under heat stress condition. Some features are attributed to the requirement of thermostability while some are dominated by gene function. The revealed sequence determinants of bacterial gene expression level under heat stress complement the knowledge about the regulation factors of prokaryotic gene expression responding to the change of environmental conditions. Furthermore, comparisons to thermophilic adaption have been performed to reveal the similarity and dissimilarity of the sequence determinants for the response to heat stress and for the adaption to high habitat temperature, which elucidates the complex landscape of gene expression related to the same physical factor of temperature.

  1. Gene Expression patterns in cryogenically stored Arabidopsis thaliana shoot tips

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes expressed in response to cryostress in plant shoot tips are not known. In this project we compared the gene expression patterns in untreated, cryoprotectant-treated, and recovering shoot tips using differential display methods. This project identified two genes that appeared to be differ...

  2. Gene expression profiling in male genital lichen sclerosus

    PubMed Central

    Edmonds, Emma; Barton, Geraint; Buisson, Sandrine; Francis, Nick; Gotch, Frances; Game, Laurence; Haddad, Munther; Dinneen, Michael; Bunker, Chris


    Male genital lichen sclerosus (MGLSc) has a bimodal distribution in boys and men. It is associated with squamous cell carcinoma (SCC). The pathogenesis of MGLSc is unknown. HPV and autoimmune mechanisms have been mooted. Anti extracellular matrix protein (ECM)1 antibodies have been identified in women with GLSc. The gene expression pattern of LSc is unknown. Using DNA microarrays we studied differences in gene expression in healthy and diseased prepuces obtained at circumcision in adult males with MGLSc (n = 4), paediatric LSc (n = 2) and normal healthy paediatric foreskin (n = 4). In adult samples 51 genes with significantly increased expression and 87 genes with significantly reduced expression were identified; paediatric samples revealed 190 genes with significantly increased expression and 148 genes with significantly reduced expression. Concordance of expression profiles between adult and paediatric samples indicates the same disease process. Functional analysis revealed increased expression in the adult and child MGSLc samples in the immune response/cellular defence gene ontology (GO) category and reduced expression in other categories including genes related to squamous cancer. No specific HPV, autoimmune or squamous carcinogenesis-associated gene expression patterns were found. ECM1 and CABLES1 expression were significantly reduced in paediatric and adult samples respectively. PMID:21718371

  3. Evolution of Gene Expression Balance Among Homeologs of Natural Polyploids

    PubMed Central

    Mutti, Jasdeep S.; Bhullar, Ramanjot K.; Gill, Kulvinder S.


    Polyploidy is a major evolutionary process in eukaryotes, yet the expression balance of homeologs in natural polyploids is largely unknown. To study this expression balance, the expression patterns of 2180 structurally well-characterized genes of wheat were studied, of which 813 had the expected three copies and 375 had less than three. Copy numbers of the remaining 992 ranged from 4 to 14, including homeologs, orthologs, and paralogs. Of the genes with three structural copies corresponding to homeologs, 55% expressed from all three, 38% from two, and the remaining 7% expressed from only one of the three copies. Homeologs of 76–87% of the genes showed differential expression patterns in different tissues, thus have evolved different gene expression controls, possibly resulting in novel functions. Homeologs of 55% of the genes showed tissue-specific expression, with the largest percentage (14%) in the anthers and the smallest (7%) in the pistils. The highest number (1.72/3) of homeologs/gene expression was in the roots and the lowest (1.03/3) in the anthers. As the expression of homeologs changed with changes in structural copy number, about 30% of the genes showed dosage dependence. Chromosomal location also impacted expression pattern as a significantly higher proportion of genes in the proximal regions showed expression from all three copies compared to that present in the distal regions. PMID:28193629

  4. Evaluating Fumonisin Gene Expression in Fusarium verticillioides.


    Scala, Valeria; Visentin, Ivan; Cardinale, Francesca


    Transcript levels of key genes in a biosynthetic pathway are often taken as a proxy for metabolite production. This is the case of FUM1, encoding the first dedicated enzyme in the metabolic pathway leading to the production of the mycotoxins Fumonisins by fungal species belonging to the genus Fusarium. FUM1 expression can be quantified by different methods; here, we detail a protocol based on quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), by which relative or absolute transcript abundance can be estimated in Fusaria grown in vitro or in planta. As very seldom commercial kits for RNA extraction and cDNA synthesis are optimized for fungal samples, we developed a protocol tailored for these organisms, which stands alone but can be also easily integrated with specific reagents and kits commercially available.

  5. Monoallelic expression of the human FOXP2 speech gene

    PubMed Central

    Adegbola, Abidemi A.; Cox, Gerald F.; Bradshaw, Elizabeth M.; Hafler, David A.; Gimelbrant, Alexander; Chess, Andrew


    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations. PMID:25422445

  6. Monoallelic expression of the human FOXP2 speech gene.


    Adegbola, Abidemi A; Cox, Gerald F; Bradshaw, Elizabeth M; Hafler, David A; Gimelbrant, Alexander; Chess, Andrew


    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations.

  7. Phenotypic plasticity and divergence in gene expression.


    Healy, Timothy M; Schulte, Patricia M


    The extent to which phenotypic plasticity, or the ability of a single genotype to produce different phenotypes in different environments, impedes or promotes genetic divergence has been a matter of debate within evolutionary biology for many decades (see, for example, Ghalambor et al. ; Pfennig et al. ). Similarly, the role of evolution in shaping phenotypic plasticity remains poorly understood (Pigliucci ). In this issue of Molecular Ecology, Dayan et al. () provide empirical data relevant to these questions by assessing the extent of plasticity and divergence in the expression levels of 2272 genes in muscle tissue from killifish (genus Fundulus) exposed to different temperatures. F. heteroclitus (Fig. A) and F. grandis are minnows that inhabit estuarine marshes (Fig. B) along the coasts of the Atlantic Ocean and Gulf of Mexico in North America. These habitats undergo large variations in temperature both daily and seasonally, and these fish are known to demonstrate substantial phenotypic plasticity in response to temperature change (e.g. Fangue et al. ). Furthermore, the range of F. heteroclitus spans a large latitudinal gradient of temperatures, such that northern populations experience temperatures that are on average ~10°C colder than do southern populations (Schulte ). By comparing gene expression patterns between populations of these fish from different thermal habitats held in the laboratory at three different temperatures, Dayan et al. () address two important questions regarding the interacting effects of plasticity and evolution: (i) How does phenotypic plasticity affect adaptive divergence? and (ii) How does adaptive divergence affect plasticity?

  8. Modulation of R-gene expression across environments

    PubMed Central

    MacQueen, Alice; Bergelson, Joy


    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription–PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment—be it a change in biotic or abiotic conditions—led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments. PMID:26983577

  9. Modulation of R-gene expression across environments.


    MacQueen, Alice; Bergelson, Joy


    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription-PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment--be it a change in biotic or abiotic conditions--led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments.

  10. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.


    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  11. Noise in gene expression: origins, consequences, and control.


    Raser, Jonathan M; O'Shea, Erin K


    Genetically identical cells and organisms exhibit remarkable diversity even when they have identical histories of environmental exposure. Noise, or variation, in the process of gene expression may contribute to this phenotypic variability. Recent studies suggest that this noise has multiple sources, including the stochastic or inherently random nature of the biochemical reactions of gene expression. In this review, we summarize noise terminology and comment on recent investigations into the sources, consequences, and control of noise in gene expression.

  12. Carcinogen-induced trans activation of gene expression.

    PubMed Central

    Kleinberger, T; Flint, Y B; Blank, M; Etkin, S; Lavi, S


    We report a new mechanism of carcinogen action by which the expression of several genes was concomitantly enhanced. This mechanism involved the altered activity of cellular factors which modulate the expression of genes under their control. The increased expression was regulated at least in part on the transcriptional level and did not require amplification of the overexpressed genes. This phenomenon was transient; it was apparent as early as 24 h after carcinogen treatment and declined a few days later. Images PMID:2835673

  13. Carcinogen-induced trans activation of gene expression

    SciTech Connect

    Kleinberger, T.; Flint, Y.B.; Blank, M.; Etkin, S.; Lavi, S.


    The authors report a new mechanism of carcinogen action by which the expression of several genes was concomitantly enhanced. This mechanism involved the altered activity of cellular factors which modulate the expression of genes under their control. The increased expression was regulated at least in part on the transcriptional level and did not require amplification of the overexpressed genes. This phenomenon was transient; it was apparent as early as 24 h after carcinogen treatment and declined a few days later.

  14. cell type–specific gene expression differences in complex tissues

    PubMed Central

    Shen-Orr, Shai S; Tibshirani, Robert; Khatri, Purvesh; Bodian, Dale L; Staedtler, Frank; Perry, Nicholas M; Hastie, Trevor; Sarwal, Minnie M; Davis, Mark M; Butte, Atul J


    We describe cell type–specific significance analysis of microarrays (cssam) for analyzing differential gene expression for each cell type in a biological sample from microarray data and relative cell-type frequencies. first, we validated cssam with predesigned mixtures and then applied it to whole-blood gene expression datasets from stable post-transplant kidney transplant recipients and those experiencing acute transplant rejection, which revealed hundreds of differentially expressed genes that were otherwise undetectable. PMID:20208531

  15. Clustering cancer gene expression data by projective clustering ensemble

    PubMed Central

    Yu, Xianxue; Yu, Guoxian


    Gene expression data analysis has paramount implications for gene treatments, cancer diagnosis and other domains. Clustering is an important and promising tool to analyze gene expression data. Gene expression data is often characterized by a large amount of genes but with limited samples, thus various projective clustering techniques and ensemble techniques have been suggested to combat with these challenges. However, it is rather challenging to synergy these two kinds of techniques together to avoid the curse of dimensionality problem and to boost the performance of gene expression data clustering. In this paper, we employ a projective clustering ensemble (PCE) to integrate the advantages of projective clustering and ensemble clustering, and to avoid the dilemma of combining multiple projective clusterings. Our experimental results on publicly available cancer gene expression data show PCE can improve the quality of clustering gene expression data by at least 4.5% (on average) than other related techniques, including dimensionality reduction based single clustering and ensemble approaches. The empirical study demonstrates that, to further boost the performance of clustering cancer gene expression data, it is necessary and promising to synergy projective clustering with ensemble clustering. PCE can serve as an effective alternative technique for clustering gene expression data. PMID:28234920

  16. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central


    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  17. Sex-specific gene expression in the BXD mouse liver.


    Gatti, Daniel M; Zhao, Ni; Chesler, Elissa J; Bradford, Blair U; Shabalin, Andrey A; Yordanova, Roumyana; Lu, Lu; Rusyn, Ivan


    Differences in clinical phenotypes between the sexes are well documented and have their roots in differential gene expression. While sex has a major effect on gene expression, transcription is also influenced by complex interactions between individual genetic variation and environmental stimuli. In this study, we sought to understand how genetic variation affects sex-related differences in liver gene expression by performing genetic mapping of genomewide liver mRNA expression data in a genetically defined population of naive male and female mice from C57BL/6J, DBA/2J, B6D2F1, and 37 C57BL/6J x DBA/2J (BXD) recombinant inbred strains. As expected, we found that many genes important to xenobiotic metabolism and other important pathways exhibit sexually dimorphic expression. We also performed gene expression quantitative trait locus mapping in this panel and report that the most significant loci that appear to regulate a larger number of genes than expected by chance are largely sex independent. Importantly, we found that the degree of correlation within gene expression networks differs substantially between the sexes. Finally, we compare our results to a recently released human liver gene expression data set and report on important similarities in sexually dimorphic liver gene expression between mouse and human. This study enhances our understanding of sex differences at the genome level and between species, as well as increasing our knowledge of the molecular underpinnings of sex differences in responses to xenobiotics.

  18. Analysis of HOX gene expression patterns in human breast cancer.


    Hur, Ho; Lee, Ji-Yeon; Yun, Hyo Jung; Park, Byeong Woo; Kim, Myoung Hee


    HOX genes are highly conserved transcription factors that determine the identity of cells and tissues along the anterior-posterior body axis in developing embryos. Aberrations in HOX gene expression have been shown in various tumors. However, the correlation of HOX gene expression patterns with tumorigenesis and cancer progression has not been fully characterized. Here, to analyze putative candidate HOX genes involved in breast cancer tumorigenesis and progression, the expression patterns of 39 HOX genes were analyzed using breast cancer cell lines and patient-derived breast tissues. In vitro analysis revealed that HOXA and HOXB gene expression occurred in a subtype-specific manner in breast cancer cell lines, whereas most HOXC genes were strongly expressed in most cell lines. Among the 39 HOX genes analyzed, 25 were chosen for further analysis in malignant and non-malignant tissues. Fourteen genes, encoding HOXA6, A13, B2, B4, B5, B6, B7, B8, B9, C5, C9, C13, D1, and D8, out of 25 showed statistically significant differential expression patterns between non-malignant and malignant breast tissues and are putative candidates associated with the development and malignant progression of breast cancer. Our data provide a valuable resource for furthering our understanding of HOX gene expression in breast cancer and the possible involvement of HOX genes in tumor progression.

  19. The complexity of gene expression dynamics revealed by permutation entropy

    PubMed Central


    Background High complexity is considered a hallmark of living systems. Here we investigate the complexity of temporal gene expression patterns using the concept of Permutation Entropy (PE) first introduced in dynamical systems theory. The analysis of gene expression data has so far focused primarily on the identification of differentially expressed genes, or on the elucidation of pathway and regulatory relationships. We aim to study gene expression time series data from the viewpoint of complexity. Results Applying the PE complexity metric to abiotic stress response time series data in Arabidopsis thaliana, genes involved in stress response and signaling were found to be associated with the highest complexity not only under stress, but surprisingly, also under reference, non-stress conditions. Genes with house-keeping functions exhibited lower PE complexity. Compared to reference conditions, the PE of temporal gene expression patterns generally increased upon stress exposure. High-complexity genes were found to have longer upstream intergenic regions and more cis-regulatory motifs in their promoter regions indicative of a more complex regulatory apparatus needed to orchestrate their expression, and to be associated with higher correlation network connectivity degree. Arabidopsis genes also present in other plant species were observed to exhibit decreased PE complexity compared to Arabidopsis specific genes. Conclusions We show that Permutation Entropy is a simple yet robust and powerful approach to identify temporal gene expression profiles of varying complexity that is equally applicable to other types of molecular profile data. PMID:21176199

  20. Transposable element influences on gene expression in plants.


    Hirsch, Cory D; Springer, Nathan M


    Transposable elements (TEs) comprise a major portion of many plant genomes and bursts of TE movements cause novel genomic variation within species. In order to maintain proper gene function, plant genomes have evolved a variety of mechanisms to tolerate the presence of TEs within or near genes. Here, we review our understanding of the interactions between TEs and gene expression in plants by assessing three ways that transposons can influence gene expression. First, there is growing evidence that TE insertions within introns or untranslated regions of genes are often tolerated and have minimal impact on expression level or splicing. However, there are examples in which TE insertions within genes can result in aberrant or novel transcripts. Second, TEs can provide novel alternative promoters, which can lead to new expression patterns or original coding potential of an alternate transcript. Third, TE insertions near genes can influence regulation of gene expression through a variety of mechanisms. For example, TEs may provide novel cis-acting regulatory sites behaving as enhancers or insert within existing enhancers to influence transcript production. Alternatively, TEs may change chromatin modifications in regions near genes, which in turn can influence gene expression levels. Together, the interactions of genes and TEs provide abundant evidence for the role of TEs in changing basic functions within plant genomes beyond acting as latent genomic elements or as simple insertional mutagens. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  1. Tensor decomposition for multi-tissue gene expression experiments

    PubMed Central

    Hore, Victoria; Viñuela, Ana; Buil, Alfonso; Knight, Julian; McCarthy, Mark I; Small, Kerrin; Marchini, Jonathan


    Genome wide association studies of gene expression traits and other cellular phenotypes have been successful in revealing links between genetic variation and biological processes. The majority of discoveries have uncovered cis eQTL effects via mass univariate testing of SNPs against gene expression in single tissues. We present a Bayesian method for multi-tissue experiments focusing on uncovering gene networks linked to genetic variation. Our method decomposes the 3D array (or tensor) of gene expression measurements into a set of latent components. We identify sparse gene networks, which can then be tested for association against genetic variation genome-wide. We apply our method to a dataset of 845 individuals from the TwinsUK cohort with gene expression measured via RNA sequencing in adipose, LCLs and skin. We uncover several gene networks with a genetic basis and clear biological and statistical significance. Extensions of this approach will allow integration of multi-omic, environmental and phenotypic datasets. PMID:27479908

  2. Optimization of transient gene expression system in Gerbera jemosonii petals.


    Hussein, Gihan M; Abu El-Heba, Ghada A; Abdou, Sara M; Abdallah, Naglaa A


    Low transformation efficiency and long generation time for production of transgenic Gerbera jemosonii plants leads to vulnerable gene function studies. Thus, transient expression of genes would be an efficient alternative. In this investigation, a transient expression system for gerbera petals based on the Agrobacterium infiltration protocol was developed using the reporter genes β-glucuronidase (gus) and green florescence protein (gfp). Results revealed the incapability of using the gfp gene as a reporter gene for transient expression study in gerbera flowers due to the detection of green fluorescent color in the non-infiltrated gerbera flower petals. However, the gus reporter gene was successfully utilized for optimizing and obtaining the suitable agroinfiltration system in gerbera flowers. The expression of GUS was detectable after three days of agroinfiltration in gerbera cultivars "Express" and "White Grizzly" with dark pink and white flower colors, respectively. The vacuum agroinfiltration protocol has been applied on the cultivar "Express" for evaluating the transient expression of the two genes involved in the anthocyanin pathway (iris-dfr and petunia-f3' 5'h), which is responsible for the color in flowers. In comparison to the control, transient expression results showed change in the anthocyanin pigment in all infiltrated flowers with color genes. Additionally, blue color was detected in the stigma and pollen grains in the infiltrated flowers. Moreover, blue colors with variant intensities were observed in produced calli during the routine work of stable transformation with f3' 5'h gene.

  3. Robust PCA based method for discovering differentially expressed genes.


    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong


    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  4. Gene expression profile analyses of mice livers injured by Leigongteng

    PubMed Central

    Chen, Yong; Zhang, Xiao-Ming; Han, Feng-Mei; Du, Peng; Xia, Qi-Song


    AIM: To analyze the gene expression profiles of mice livers injured by Leigongteng and explore the relationship between the differentially expressed genes and liver damage. METHODS: The experimental mice were randomly divided into a control group and a liver-injured group in which the mice were administrated 33 μγ of triptolide/kg per day for 30 d. Liver mRNAs were extracted from animals in both groups and were reverse-transcribed to cDNA with dUTP labeled by different fluorescence (Cy3, Cy5) as hybridization probes. The mixed probes were hybridized with oligonucleotide microarray chips. The fluorescent signal results were acquired by scanner and analyzed with software. RESULTS: Among the 35852 target genes, 29 genes were found to be significantly differentially expressed, with 20 genes up-regulated and 9 genes down-regulated. The reliability of the differentially expressed genes was validated by RT-PCR experiments of 5 randomly selected differentially expressed genes. CONCLUSION: Based on the biological functions of the differentially expressed genes, it is obvious that the occurrence and development of liver damage induced by Leigongteng in mice are highly associated with immune response, metabolism, apoptosis and the cell skeleton of liver cells. This might be important for elucidating the regulatory network of gene expression associated with liver damage and it may also be important for discovering the pathogenic mechanisms of liver damage induced by Leigongteng. PMID:17659714

  5. Aromatase gene expression in the stallion.


    Lemazurier, E; Sourdaine, P; Nativelle, C; Plainfossé, B; Séralini, G


    Adult stallion secretes very high estrogen levels in its testicular vein and semen, and the responsible enzyme cytochrome P450 aromatase (P450 arom) is known to be present mainly in Leydig cells. We studied in further details the distribution of equine aromatase in various adult tissues including the brain (hypothalamic area), liver, kidney, small intestine, muscle, bulbourethral gland and testes. The aromatase mRNA was essentially detected by RT-PCR in testis (169+/-14 amol of aromatase mRNA per microg of total RNA) and was barely detectable in brain, or below 0.1 amol/microg RNA in other tissues. This range of expression was confirmed by ELISA (50+/-7 pg/microg total protein) in the testis, and by immunoblot, evidencing a 53 kDA specific protein band in testis and brain only. The corresponding aromatase activity was well detected, by 3H(2)O release from 1beta, 2beta(3)H-androstenedione, in testis and brain (200+/-23 and 25+/-6 pmol/min per mg, respectively) and below 3 pmol product formed/min per mg in other tissues. This study indicates that the testis, among the tissues analyzed, is the major source of aromatase in the adult stallion, and that the aromatase gene expression is specifically enhanced at this level, and is responsible for the high estrogen synthesis observed. Moreover, the study of aromatase in one colt testis has shown lower levels of transcripts, protein and enzyme activity, evidencing that aromatase is regulated during the development and may serve as a useful marker of testicular function. As the second organ where aromatase mRNA and activity are both well detected is brain, this study also underlines the possible role of neurosteroids in stallion on behaviour, brain function or central endocrine control.

  6. Genes, environment and gene expression in colon tissue: a pathway approach to determining functionality.


    Slattery, Martha L; Pellatt, Daniel F; Wolff, Roger K; Lundgreen, Abbie


    Genetic and environmental factors have been shown to work together to alter cancer risk. In this study we evaluate previously identified gene and lifestyle interactions in a candidate pathway that were associated with colon cancer risk to see if these interactions altered gene expression. We analyzed non-tumor RNA-seq data from 144 colon cancer patients who had genotype, recent cigarette smoking, diet, body mass index (BMI), and recent aspirin/non-steroidal anti-inflammatory use data. Using a false discovery rate of 0.1, we evaluated differential gene expression between high and low levels of lifestyle exposure and genotypes using DESeq2. Thirteen pathway genes and 17 SNPs within those genes were associated with altered expression of other genes in the pathway. BMI, NSAIDs use and dietary components of the oxidative balance score (OBS) also were associated with altered gene expression. SNPs previously identified as interacting with these lifestyle factors, altered expression of pathway genes. NSAIDs interacted with 10 genes (15 SNPs) within those genes to alter expression of 28 pathway genes; recent cigarette smoking interacted with seven genes (nine SNPs) to alter expression of 27 genes. BMI interacted with FLT1, KDR, SEPN1, TERT, TXNRD2, and VEGFA to alter expression of eight genes. Three genes (five SNPs) interacted with OBS to alter expression of 12 genes. These data provide support for previously identified lifestyle and gene interactions associated with colon cancer in that they altered expression of key pathway genes. The need to consider lifestyle factors in conjunction with genetic factors is illustrated.

  7. Population and sex differences in Drosophila melanogaster brain gene expression

    PubMed Central


    Background Changes in gene regulation are thought to be crucial for the adaptation of organisms to their environment. Transcriptome analyses can be used to identify candidate genes for ecological adaptation, but can be complicated by variation in gene expression between tissues, sexes, or individuals. Here we use high-throughput RNA sequencing of a single Drosophila melanogaster tissue to detect brain-specific differences in gene expression between the sexes and between two populations, one from the ancestral species range in sub-Saharan Africa and one from the recently colonized species range in Europe. Results Relatively few genes (<100) displayed sexually dimorphic expression in the brain, but there was an enrichment of sex-biased genes, especially male-biased genes, on the X chromosome. Over 340 genes differed in brain expression between flies from the African and European populations, with the inter-population divergence being highly correlated between males and females. The differentially expressed genes included those involved in stress response, olfaction, and detoxification. Expression differences were associated with transposable element insertions at two genes implicated in insecticide resistance (Cyp6g1 and CHKov1). Conclusions Analysis of the brain transcriptome revealed many genes differing in expression between populations that were not detected in previous studies using whole flies. There was little evidence for sex-specific regulatory adaptation in the brain, as most expression differences between populations were observed in both males and females. The enrichment of genes with sexually dimorphic expression on the X chromosome is consistent with dosage compensation mechanisms affecting sex-biased expression in somatic tissues. PMID:23170910

  8. Social Regulation of Gene Expression in Threespine Sticklebacks

    PubMed Central

    Greenwood, Anna K.; Peichel, Catherine L.


    Identifying genes that are differentially expressed in response to social interactions is informative for understanding the molecular basis of social behavior. To address this question, we described changes in gene expression as a result of differences in the extent of social interactions. We housed threespine stickleback (Gasterosteus aculeatus) females in either group conditions or individually for one week, then measured levels of gene expression in three brain regions using RNA-sequencing. We found that numerous genes in the hindbrain/cerebellum had altered expression in response to group or individual housing. However, relatively few genes were differentially expressed in either the diencephalon or telencephalon. The list of genes upregulated in fish from social groups included many genes related to neural development and cell adhesion as well as genes with functions in sensory signaling, stress, and social and reproductive behavior. The list of genes expressed at higher levels in individually-housed fish included several genes previously identified as regulated by social interactions in other animals. The identified genes are interesting targets for future research on the molecular mechanisms of normal social interactions. PMID:26367311

  9. Large Scale Gene Expression Meta-Analysis Reveals Tissue-Specific, Sex-Biased Gene Expression in Humans

    PubMed Central

    Mayne, Benjamin T.; Bianco-Miotto, Tina; Buckberry, Sam; Breen, James; Clifton, Vicki; Shoubridge, Cheryl; Roberts, Claire T.


    The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analyzed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes), followed by the heart (375 genes), kidney (224 genes), colon (218 genes), and thyroid (163 genes). More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs, and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases. PMID:27790248

  10. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.


    Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan


    The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs onwards.

  11. Gene expression within a dynamic nuclear landscape

    PubMed Central

    Shav-Tal, Yaron; Darzacq, Xavier; Singer, Robert H


    Molecular imaging in living cells or organisms now allows us to observe macromolecular assemblies with a time resolution sufficient to address cause-and-effect relationships on specific molecules. These emerging technologies have gained much interest from the scientific community since they have been able to reveal novel concepts in cell biology, thereby changing our vision of the cell. One main paradigm is that cells stochastically vary, thus implying that population analysis may be misleading. In fact, cells should be analyzed within time-resolved single-cell experiments rather than being compared to other cells within a population. Technological imaging developments as well as the stochastic events present in gene expression have been reviewed. Here, we discuss how the structural organization of the nucleus is revealed using noninvasive single-cell approaches, which ultimately lead to the resolution required for the analysis of highly controlled molecular processes taking place within live cells. We also describe the efforts being made towards physiological approaches within the context of living organisms. PMID:16900099

  12. Cell cycle gene expression under clinorotation

    NASA Astrophysics Data System (ADS)

    Artemenko, Olga


    Cyclins and cyclin-dependent kinase (CDK) are main regulators of the cell cycle of eukaryotes. It's assumes a significant change of their level in cells under microgravity conditions and by other physical factors actions. The clinorotation use enables to determine the influence of gravity on simulated events in the cell during the cell cycle - exit from the state of quiet stage and promotion presynthetic phase (G1) and DNA synthesis phase (S) of the cell cycle. For the clinorotation effect study on cell proliferation activity is the necessary studies of molecular mechanisms of cell cycle regulation and development of plants under altered gravity condition. The activity of cyclin D, which is responsible for the events of the cell cycle in presynthetic phase can be controlled by the action of endogenous as well as exogenous factors, but clinorotation is one of the factors that influence on genes expression that regulate the cell cycle.These data can be used as a model for further research of cyclin - CDK complex for study of molecular mechanisms regulation of growth and proliferation. In this investigation we tried to summarize and analyze known literature and own data we obtained relatively the main regulators of the cell cycle in altered gravity condition.

  13. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    SciTech Connect

    Charles J. Daniels


    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb

  14. Arabidopsis gene expression patterns are altered during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment

  15. Gene expression profiling of mouse embryos with microarrays

    PubMed Central

    Sharov, Alexei A.; Piao, Yulan; Ko, Minoru S. H.


    Global expression profiling by DNA microarrays provides a snapshot of cell and tissue status and becomes an essential tool in biological and medical sciences. Typical questions that can be addressed by microarray analysis in developmental biology include: (1) to find a set of genes expressed in a specific cell type; (2) to identify genes expressed commonly in multiple cell types; (3) to follow the time-course changes of gene expression patterns; (4) to demonstrate cell’s identity by showing similarities or differences among two or multiple cell types; (5) to find regulatory pathways and/or networks affected by gene manipulations, such as overexpression or repression of gene expression; (6) to find downstream target genes of transcription factors; (7) to find downstream target genes of cell signaling; (8) to examine the effects of environmental manipulation of cells on gene expression patterns; and (9) to find the effects of genetic manipulation in embryos and adults. Here we describe strategies for executing these experiments and monitoring changes of cell state with gene expression microarrays in application to mouse embryology. Both statistical assessment and interpretation of data are discussed. We also present a protocol for performing microarray analysis on a small amount of embryonic materials. PMID:20699157

  16. Stably Expressed Genes Involved in Basic Cellular Functions

    PubMed Central

    Wang, Kejian; Fuscoe, James C.


    Stably Expressed Genes (SEGs) whose expression varies within a narrow range may be involved in core cellular processes necessary for basic functions. To identify such genes, we re-analyzed existing RNA-Seq gene expression profiles across 11 organs at 4 developmental stages (from immature to old age) in both sexes of F344 rats (n = 4/group; 320 samples). Expression changes (calculated as the maximum expression / minimum expression for each gene) of >19000 genes across organs, ages, and sexes ranged from 2.35 to >109-fold, with a median of 165-fold. The expression of 278 SEGs was found to vary ≤4-fold and these genes were significantly involved in protein catabolism (proteasome and ubiquitination), RNA transport, protein processing, and the spliceosome. Such stability of expression was further validated in human samples where the expression variability of the homologous human SEGs was significantly lower than that of other genes in the human genome. It was also found that the homologous human SEGs were generally less subject to non-synonymous mutation than other genes, as would be expected of stably expressed genes. We also found that knockout of SEG homologs in mouse models was more likely to cause complete preweaning lethality than non-SEG homologs, corroborating the fundamental roles played by SEGs in biological development. Such stably expressed genes and pathways across life-stages suggest that tight control of these processes is important in basic cellular functions and that perturbation by endogenous (e.g., genetics) or exogenous agents (e.g., drugs, environmental factors) may cause serious adverse effects. PMID:28125669

  17. Expression and mapping of anthocyanin biosynthesis genes in carrot

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Anthocyanin gene expression has been extensively studied in leaves, fruits and flowers of numerous plants. Little, however, is known about anthocyanin accumulation in roots, or in carrots or other Apiaceae. We quantified expression of six anthocyanin biosynthetic genes (phenylalanine ammonia-lyase (...

  18. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad


    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  19. Bioinformatic Analysis of Gene Expression for Melanoma Treatment

    PubMed Central

    Kawakami, Akinori; Fisher, David E.


    Bioinformatic analysis of genome-wide gene expression allows us to characterize cells, including melanomas. Gene expression profiles have been generated in various stages of melanomas and analyzed by researchers in unique ways. Lauss et al. compared their melanoma subtypes with those of The Cancer Genome Atlas Network and found consistency between the two studies. PMID:27884291

  20. MEPD: medaka expression pattern database, genes and more

    PubMed Central

    Alonso-Barba, Juan I.; Rahman, Raza-Ur; Wittbrodt, Joachim; Mateo, Juan L.


    The Medaka Expression Pattern Database (MEPD; is designed as a repository of medaka expression data for the scientific community. In this update we present two main improvements. First, we have changed the previous clone-centric view for in situ data to a gene-centric view. This is possible because now we have linked all the data present in MEPD to the medaka gene annotation in ENSEMBL. In addition, we have also connected the medaka genes in MEPD to their corresponding orthologous gene in zebrafish, again using the ENSEMBL database. Based on this, we provide a link to the Zebrafish Model Organism Database (ZFIN) to allow researches to compare expression data between these two fish model organisms. As a second major improvement, we have modified the design of the database to enable it to host regulatory elements, promoters or enhancers, expression patterns in addition to gene expression. The combination of gene expression, by traditional in situ, and regulatory element expression, typically by fluorescence reporter gene, within the same platform assures consistency in terms of annotation. In our opinion, this will allow researchers to uncover new insights between the expression domain of genes and their regulatory landscape. PMID:26450962

  1. Digital Gene Expression Tag Profiling Analysis of the Gene Expression Patterns Regulating the Early Stage of Mouse Spermatogenesis

    PubMed Central

    Meng, Lijun; Liu, Meiling; Zhao, Lina; Hu, Fen; Ding, Cunbao; Wang, Yang; He, Baoling; Pan, Yuxin; Fang, Wei; Chen, Jing; Hu, Songnian; Jia, Mengchun


    Detailed characterization of the gene expression patterns in spermatogonia and primary spermatocytes is critical to understand the processes which occur prior to meiosis during normal spermatogenesis. The genome-wide expression profiles of mouse type B spermatogonia and primary spermatocytes were investigated using the Solexa/Illumina digital gene expression (DGE) system, a tag based high-throughput transcriptome sequencing method, and the developmental processes which occur during early spermatogenesis were systematically analyzed. Gene expression patterns vary significantly between mouse type B spermatogonia and primary spermatocytes. The functional analysis revealed that genes related to junction assembly, regulation of the actin cytoskeleton and pluripotency were most significantly differently expressed. Pathway analysis indicated that the Wnt non-canonical signaling pathway played a central role and interacted with the actin filament organization pathway during the development of spermatogonia. This study provides a foundation for further analysis of the gene expression patterns and signaling pathways which regulate the molecular mechanisms of early spermatogenesis. PMID:23554914

  2. Gene Expression Measurement Module (GEMM) - a fully automated, miniaturized instrument for measuring gene expression in space

    NASA Astrophysics Data System (ADS)

    Karouia, Fathi; Ricco, Antonio; Pohorille, Andrew; Peyvan, Kianoosh


    The capability to measure gene expression on board spacecrafts opens the doors to a large number of experiments on the influence of space environment on biological systems that will profoundly impact our ability to conduct safe and effective space travel, and might also shed light on terrestrial physiology or biological function and human disease and aging processes. Measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, determine metabolic basis of microbial pathogenicity and drug resistance, test our ability to sustain and grow in space organisms that can be used for life support and in situ resource utilization during long-duration space exploration, and monitor both the spacecraft environment and crew health. These and other applications hold significant potential for discoveries in space biology, biotechnology and medicine. Accordingly, supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measuring microbial expression of thousands of genes from multiple samples. The instrument will be capable of (1) lysing bacterial cell walls, (2) extracting and purifying RNA released from cells, (3) hybridizing it on a microarray and (4) providing electrochemical readout, all in a microfluidics cartridge. The prototype under development is suitable for deployment on nanosatellite platforms developed by the NASA Small Spacecraft Office. The first target application is to cultivate and measure gene expression of the photosynthetic bacterium Synechococcus elongatus, i.e. a cyanobacterium known to exhibit remarkable metabolic diversity and resilience to adverse conditions

  3. The effect of negative autoregulation on eukaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Nevozhay, Dmitry; Adams, Rhys; Murphy, Kevin; Josic, Kresimir; Balázsi, G. Ábor


    Negative autoregulation is a frequent motif in gene regulatory networks, which has been studied extensively in prokaryotes. Nevertheless, some effects of negative feedback on gene expression in eukaryotic transcriptional networks remain unknown. We studied how the strength of negative feedback regulation affects the characteristics of gene expression in yeast cells carrying synthetic transcriptional cascades. We observed a drastic reduction of gene expression noise and a change in the shape of the dose-response curve. We explained these experimentally observed effects by stochastic simulations and a simple set of algebraic equations.

  4. Features of Gene Expression of Bacillus pumilus Metalloendopeptidase.


    Rudakova, N L; Sabirova, A R; Balaban, N P; Tikhonova, A O; Sharipova, M R


    Features of gene expression of the secreted Bacillus pumilus metalloendopeptidase belonging to the adamalysin/reprolysin family were investigated. In the regulatory region of the gene, we identified hypothetical binding sites for transcription factors CcpA and TnrA. We found that the expression of the metalloendopeptidase gene is controlled by mechanisms of carbon and nitrogen catabolite repression. In experiments involving nitrogen metabolism regulatory protein mutant strains, we found that the control of the metalloendopeptidase gene expression involves proteins of ammonium transport GlnK and AmtB interacting with the TnrA-regulator.

  5. Direct Introduction of Genes into Rats and Expression of the Genes

    NASA Astrophysics Data System (ADS)

    Benvenisty, Nissim; Reshef, Lea


    A method of introducing actively expressed genes into intact mammals is described. DNA precipitated with calcium phosphate has been injected intraperitoneally into newborn rats. The injected genes have been taken up and expressed by the animal tissues. To examine the generality of the method we have injected newborn rats with the chloramphenicol acetyltransferase prokaryotic gene fused with various viral and cellular gene promoters and the gene for hepatitis B surface antigen, and we observed appearance of chloramphenicol acetyltransferase activity and hepatitis B surface antigen in liver and spleen. In addition, administration of genes coding for hormones (insulin or growth hormone) resulted in their expression.

  6. Effects of G-gene Deletion and Replacement on Rabies Virus Vector Gene Expression

    PubMed Central

    Sato, Sho; Ohara, Shinya; Tsutsui, Ken-Ichiro; Iijima, Toshio


    The glycoprotein-gene (G gene) -deleted rabies virus (RV) vector is a powerful tool to examine the function and structure of neural circuits. We previously reported that the deletion of the G gene enhances the transgene expression level of the RV vector. However, the mechanism of this enhancement remains to be clarified. We presume that there are two possible factors for this enhancement. The first factor is the glycoprotein of RV, which shows cytotoxicity; thus, may cause a dysfunction in the translation process of infected cells. The second possible factor is the enhanced expression of the L gene, which encodes viral RNA polymerase. In the RV, it is known that the gene expression level is altered depending on the position of the gene. Since G-gene deletion displaces the L gene in the genome, the expression of the L gene and viral transcription may be enhanced. In this study, we compared the transgene expression level and viral transcription of three recombinant RV vectors. The effect of glycoprotein was examined by comparing the viral gene expression of G-gene-intact RV and G-gene-replaced RV. Despite the fact that the L-gene transcription level of these two RV vectors was similar, the G-gene-replaced RV vector showed higher viral transcription and transgene expression level than the G-gene-intact RV vector. To examine the effect of the position of the L gene, we compared the viral gene expression of the G-gene-deleted RV and G-gene-replaced RV. The G-gene-deleted RV vector showed higher L-gene transcription, viral transcription, and transgene expression level than the G-gene-replaced RV vector. These results indicate that G-gene deletion enhances the transgene expression level through at least two factors, the absence of glycoprotein and enhancement of L-gene expression. These findings enable investigators to design a useful viral vector that shows a controlled desirable transgene expression level in applications. PMID:26023771

  7. Key aspects of analyzing microarray gene-expression data.


    Chen, James J


    One major challenge with the use of microarray technology is the analysis of massive amounts of gene-expression data for various applications. This review addresses the key aspects of the microarray gene-expression data analysis for the two most common objectives: class comparison and class prediction. Class comparison mainly aims to select which genes are differentially expressed across experimental conditions. Gene selection is separated into two steps: gene ranking and assigning a significance level. Class prediction uses expression profiling analysis to develop a prediction model for patient selection, diagnostic prediction or prognostic classification. Development of a prediction model involves two components: model building and performance assessment. It also describes two additional data analysis methods: gene-class testing and multiple ordering criteria.

  8. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana


    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  9. Identification of Development and Pathogenicity Related Gene in Botrytis cinerea via Digital Gene Expression Profile

    PubMed Central

    Zhao, Bin; Si, He Long; Sun, Zhi Ying; Xu, Zheng; Chen, Zhan; Zhang, Jin lin; Xing, Ji Hong; Dong, Jin Gao


    Background: Botrytis cinerea, a haploid Euascomycete fungus that infects numerous crops, has been used as a model system for studying molecular phytopathology. Botrytis cinerea adopts various modes of infection, which are mediated by a number of pathogenicity and virulence-related genes. Many of these genes have not been reported previously. Objectives: This study aimed to investigate development and pathogenicity-related genes between a novel nonpathogenic mutant and the Wild Type (WT) in B. cinerea. Materials and Methods: Digital Gene Expression (DGE) tag profiling can reveal novel genes that may be involved in development and pathogenicity of plant pathogen. A large volume of B. cinerea tag-seq was generated to identify differential expressed genes by the Illumina DGE tag profiling technology. Results: A total of 4,182,944 and 4,182,021 clean tags were obtained from the WT and a nonpathogenic mutant stain (BCt89), respectively, and 10,410 differentially expressed genes were identified. In addition, 84 genes were expressed in the WT only while 34 genes were expressed in the mutant only. A total of 664 differentially expressed genes were involved in 91 Kyoto Encyclopedia of Genes and Genome pathways, including signaling and metabolic pathways. Conclusions: Expression levels of 1,426 genes were significantly up-regulated in the mutant compared to WT. Furthermore, 301 genes were down-regulated with False Discovery Rates (FDR) of < 0.001 and absolute value of log2 Ratio of ≥ 1. PMID:26034553

  10. Fundamental principles of energy consumption for gene expression

    NASA Astrophysics Data System (ADS)

    Huang, Lifang; Yuan, Zhanjiang; Yu, Jianshe; Zhou, Tianshou


    How energy is consumed in gene expression is largely unknown mainly due to complexity of non-equilibrium mechanisms affecting expression levels. Here, by analyzing a representative gene model that considers complexity of gene expression, we show that negative feedback increases energy consumption but positive feedback has an opposite effect; promoter leakage always reduces energy consumption; generating more bursts needs to consume more energy; and the speed of promoter switching is at the cost of energy consumption. We also find that the relationship between energy consumption and expression noise is multi-mode, depending on both the type of feedback and the speed of promoter switching. Altogether, these results constitute fundamental principles of energy consumption for gene expression, which lay a foundation for designing biologically reasonable gene modules. In addition, we discuss possible biological implications of these principles by combining experimental facts.

  11. Dimensionality of Data Matrices with Applications to Gene Expression Profiles

    ERIC Educational Resources Information Center

    Feng, Xingdong


    Probe-level microarray data are usually stored in matrices. Take a given probe set (gene), for example, each row of the matrix corresponds to an array, and each column corresponds to a probe. Often, people summarize each array by the gene expression level. Is one number sufficient to summarize a whole probe set for a specific gene in an array?…

  12. Sources of stochasticity in constitutive and autoregulated gene expression

    NASA Astrophysics Data System (ADS)

    Marathe, Rahul; Gomez, David; Klumpp, Stefan


    Gene expression is inherently noisy as many steps in the read-out of the genetic information are stochastic. To disentangle the effect of different sources of stochasticity in such systems, we consider various models that describe some processes as stochastic and others as deterministic. We review earlier results for unregulated (constitutive) gene expression and present new results for a gene controlled by negative autoregulation with cell growth modeled by linear volume growth.

  13. Chamber Specific Gene Expression Landscape of the Zebrafish Heart

    PubMed Central

    Singh, Angom Ramcharan; Sivadas, Ambily; Sabharwal, Ankit; Vellarikal, Shamsudheen Karuthedath; Jayarajan, Rijith; Verma, Ankit; Kapoor, Shruti; Joshi, Adita; Scaria, Vinod; Sivasubbu, Sridhar


    The organization of structure and function of cardiac chambers in vertebrates is defined by chamber-specific distinct gene expression. This peculiarity and uniqueness of the genetic signatures demonstrates functional resolution attributed to the different chambers of the heart. Altered expression of the cardiac chamber genes can lead to individual chamber related dysfunctions and disease patho-physiologies. Information on transcriptional repertoire of cardiac compartments is important to understand the spectrum of chamber specific anomalies. We have carried out a genome wide transcriptome profiling study of the three cardiac chambers in the zebrafish heart using RNA sequencing. We have captured the gene expression patterns of 13,396 protein coding genes in the three cardiac chambers—atrium, ventricle and bulbus arteriosus. Of these, 7,260 known protein coding genes are highly expressed (≥10 FPKM) in the zebrafish heart. Thus, this study represents nearly an all-inclusive information on the zebrafish cardiac transcriptome. In this study, a total of 96 differentially expressed genes across the three cardiac chambers in zebrafish were identified. The atrium, ventricle and bulbus arteriosus displayed 20, 32 and 44 uniquely expressing genes respectively. We validated the expression of predicted chamber-restricted genes using independent semi-quantitative and qualitative experimental techniques. In addition, we identified 23 putative novel protein coding genes that are specifically restricted to the ventricle and not in the atrium or bulbus arteriosus. In our knowledge, these 23 novel genes have either not been investigated in detail or are sparsely studied. The transcriptome identified in this study includes 68 differentially expressing zebrafish cardiac chamber genes that have a human ortholog. We also carried out spatiotemporal gene expression profiling of the 96 differentially expressed genes throughout the three cardiac chambers in 11 developmental stages and 6

  14. Gene Expression Profiling in the Type 1 Diabetes Rat Diaphragm

    PubMed Central

    van Lunteren, Erik; Moyer, Michelle


    Background Respiratory muscle contractile performance is impaired by diabetes, mechanisms of which included altered carbohydrate and lipid metabolism, oxidative stress and changes in membrane electrophysiology. The present study examined to what extent these cellular perturbations involve changes in gene expression. Methodology/Principal Findings Diaphragm muscle from streptozotocin-diabetic rats was analyzed with Affymetrix gene expression arrays. Diaphragm from diabetic rats had 105 genes with at least ±2-fold significantly changed expression (55 increased, 50 decreased), and these were assigned to gene ontology groups based on over-representation analysis using DAVID software. There was increased expression of genes involved in palmitoyl-CoA hydrolase activity (a component of lipid metabolism) (P = 0.037, n = 2 genes, fold change 4.2 to 27.5) and reduced expression of genes related to carbohydrate metabolism (P = 0.000061, n = 8 genes, fold change −2.0 to −8.5). Other gene ontology groups among upregulated genes were protein ubiquitination (P = 0.0053, n = 4, fold change 2.2 to 3.4), oxidoreductase activity (P = 0.024, n = 8, fold change 2.1 to 6.0), and morphogenesis (P = 0.012, n = 10, fold change 2.1 to 4.3). Other downregulated gene groups were extracellular region (including extracellular matrix and collagen) (P = 0.00032, n = 13, fold change −2.2 to −3.7) and organogenesis (P = 0.032, n = 7, fold change −2.1 to −3.7). Real-time PCR confirmed the directionality of changes in gene expression for 30 of 31 genes tested. Conclusions/Significance These data indicate that in diaphragm muscle type 1 diabetes increases expression of genes involved in lipid energetics, oxidative stress and protein ubiquitination, decreases expression of genes involved in carbohydrate metabolism, and has little effect on expression of ion channel genes. Reciprocal changes in expression of genes involved in

  15. Temporal Changes in Gene Expression Profile during Mature Adipocyte Dedifferentiation

    PubMed Central

    Côté, Julie Anne; Guénard, Frédéric; Lessard, Julie; Lapointe, Marc; Biron, Simon


    Objective. To characterize changes in gene expression profile during human mature adipocyte dedifferentiation in ceiling culture. Methods. Subcutaneous (SC) and omental (OM) adipose tissue samples were obtained from 4 participants paired for age and BMI. Isolated adipocytes were dedifferentiated in ceiling culture. Gene expression analysis at days 0, 4, 7, and 12 of the cultures was performed using Affymetrix Human Gene 2.0 STvi arrays. Hierarchical clustering according to similarity of expression changes was used to identify overrepresented functions. Results. Four clusters gathered genes with similar expression between day 4 to day 7 but decreasing expression from day 7 to day 12. Most of these genes coded for proteins involved in adipocyte functions (LIPE, PLIN1, DGAT2, PNPLA2, ADIPOQ, CEBPA, LPL, FABP4, SCD, INSR, and LEP). Expression of several genes coding for proteins implicated in cellular proliferation and growth or cell cycle increased significantly from day 7 to day 12 (WNT5A, KITLG, and FGF5). Genes coding for extracellular matrix proteins were differentially expressed between days 0, 4, 7, and 12 (COL1A1, COL1A2, and COL6A3, MMP1, and TGFB1). Conclusion. Dedifferentiation is associated with downregulation of transcripts encoding proteins involved in mature adipocyte functions and upregulation of genes involved in matrix remodeling, cellular development, and cell cycle.

  16. Regulation of mitochondrial gene expression, the epigenetic enigma.


    Mposhi, Archibold; Van der Wijst, Monique Gp; Faber, Klaas Nico; Rots, Marianne G


    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether mitochondrial DNA (mtDNA) undergoes similar epigenetic changes to regulate mitochondrial gene expression. Recently, it has been shown that mtDNA is differentially methylated in various diseases such as diabetes and colorectal cancer. Interestingly, this differential methylation was often associated with altered mitochondrial gene expression. However, the direct role of mtDNA methylation on gene expression remains elusive. Alternatively, the activity of the mitochondrial transcription factor A (TFAM), a protein involved in mtDNA packaging, might also influence gene expression. This review discusses the role of mtDNA methylation and potential epigenetic-like modifications of TFAM with respect to mtDNA transcription and replication. We suggest three mechanisms: (1) methylation within the non-coding D-loop, (2) methylation at gene start sites (GSS) and (3) post-translational modifications (PTMs) of TFAM. Unraveling mitochondrial gene expression regulation could open new therapeutic avenues for mitochondrial diseases.

  17. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies

    PubMed Central

    Chapman, Joanne R.; Waldenström, Jonas


    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies. PMID:26555275

  18. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies.


    Chapman, Joanne R; Waldenström, Jonas


    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.

  19. Clustering Algorithms: Their Application to Gene Expression Data

    PubMed Central

    Oyelade, Jelili; Isewon, Itunuoluwa; Oladipupo, Funke; Aromolaran, Olufemi; Uwoghiren, Efosa; Ameh, Faridah; Achas, Moses; Adebiyi, Ezekiel


    Gene expression data hide vital information required to understand the biological process that takes place in a particular organism in relation to its environment. Deciphering the hidden patterns in gene expression data proffers a prodigious preference to strengthen the understanding of functional genomics. The complexity of biological networks and the volume of genes present increase the challenges of comprehending and interpretation of the resulting mass of data, which consists of millions of measurements; these data also inhibit vagueness, imprecision, and noise. Therefore, the use of clustering techniques is a first step toward addressing these challenges, which is essential in the data mining process to reveal natural structures and identify interesting patterns in the underlying data. The clustering of gene expression data has been proven to be useful in making known the natural structure inherent in gene expression data, understanding gene functions, cellular processes, and subtypes of cells, mining useful information from noisy data, and understanding gene regulation. The other benefit of clustering gene expression data is the identification of homology, which is very important in vaccine design. This review examines the various clustering algorithms applicable to the gene expression data in order to discover and provide useful knowledge of the appropriate clustering technique that will guarantee stability and high degree of accuracy in its analysis procedure. PMID:27932867

  20. Modulation and Expression of Tumor Suppressor Genes by Environmental Agents.

    DTIC Science & Technology


    MAMA produced other tumors in medaka (e.g. liver) and Rb expression is altered in many human tumors , the capability of examining the pathology of all...AD GRANT NUMBER DAMDI7-93-J-3011 TITLE: Modulation and Expression of Tumor Suppressor Genes by Environmental Agents PRINCIPAL INVESTIGATOR: Gary K...SUBTITLE 5. FUNDING NUMBERS Modulation and Expression of Tumor Suppressor Genes by Environmental Agents DAMDl7-93- J-3011 6. AUTHOR(S) Gary K

  1. Gene Expression by Mouse Inner Ear Hair Cells during Development

    PubMed Central

    Scheffer, Déborah I.; Shen, Jun


    Hair cells of the inner ear are essential for hearing and balance. As a consequence, pathogenic variants in genes specifically expressed in hair cells often cause hereditary deafness. Hair cells are few in number and not easily isolated from the adjacent supporting cells, so the biochemistry and molecular biology of hair cells can be difficult to study. To study gene expression in hair cells, we developed a protocol for hair cell isolation by FACS. With nearly pure hair cells and surrounding cells, from cochlea and utricle and from E16 to P7, we performed a comprehensive cell type-specific RNA-Seq study of gene expression during mouse inner ear development. Expression profiling revealed new hair cell genes with distinct expression patterns: some are specific for vestibular hair cells, others for cochlear hair cells, and some are expressed just before or after maturation of mechanosensitivity. We found that many of the known hereditary deafness genes are much more highly expressed in hair cells than surrounding cells, suggesting that genes preferentially expressed in hair cells are good candidates for unknown deafness genes. PMID:25904789

  2. An atlas of gene expression and gene co-regulation in the human retina

    PubMed Central

    Pinelli, Michele; Carissimo, Annamaria; Cutillo, Luisa; Lai, Ching-Hung; Mutarelli, Margherita; Moretti, Maria Nicoletta; Singh, Marwah Veer; Karali, Marianthi; Carrella, Diego; Pizzo, Mariateresa; Russo, Francesco; Ferrari, Stefano; Ponzin, Diego; Angelini, Claudia; Banfi, Sandro; di Bernardo, Diego


    The human retina is a specialized tissue involved in light stimulus transduction. Despite its unique biology, an accurate reference transcriptome is still missing. Here, we performed gene expression analysis (RNA-seq) of 50 retinal samples from non-visually impaired post-mortem donors. We identified novel transcripts with high confidence (Observed Transcriptome (ObsT)) and quantified the expression level of known transcripts (Reference Transcriptome (RefT)). The ObsT included 77 623 transcripts (23 960 genes) covering 137 Mb (35 Mb new transcribed genome). Most of the transcripts (92%) were multi-exonic: 81% with known isoforms, 16% with new isoforms and 3% belonging to new genes. The RefT included 13 792 genes across 94 521 known transcripts. Mitochondrial genes were among the most highly expressed, accounting for about 10% of the reads. Of all the protein-coding genes in Gencode, 65% are expressed in the retina. We exploited inter-individual variability in gene expression to infer a gene co-expression network and to identify genes specifically expressed in photoreceptor cells. We experimentally validated the photoreceptors localization of three genes in human retina that had not been previously reported. RNA-seq data and the gene co-expression network are available online ( PMID:27235414

  3. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.


    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan


    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  4. BPH gene expression profile associated to prostate gland volume.


    Descazeaud, Aurelien; Rubin, Mark A; Hofer, Matthias; Setlur, Sunita; Nikolaief, Nathalie; Vacherot, Francis; Soyeux, Pascale; Kheuang, Laurence; Abbou, Claude C; Allory, Yves; de la Taille, Alexandre


    The aim of the current study was to analyze gene expression profiles in benign prostatic hyperplasia and to compare them with phenotypic properties. Thirty-seven specimens of benign prostatic hyperplasia were obtained from symptomatic patients undergoing surgery. RNA was extracted and hybridized to Affymetrix Chips containing 54,000 gene expression probes. Gene expression profiles were analyzed using cluster, TreeView, and significance analysis of microarrays softwares. In an initial unsupervised analysis, our 37 samples clustered hierarchically in 2 groups of 18 and 19 samples, respectively. Five clinical parameters were statistically different between the 2 groups: in group 1 compared with group 2, patients had larger prostate glands, had higher prostate specific antigen levels, were more likely to be treated by alpha blockers, to be operated by prostatectomy, and to have major irritative symptoms. The sole independent parameter associated with this dichotome clustering, however, was the prostate gland volume. Therefore, the role of prostate volume was explored in a supervised analysis. Gene expression of prostate glands <60 mL and >60 mL were compared using significance analysis of microarrays and 227 genes were found differentially expressed between the 2 groups (>2 change and false discovery rate of <5%). Several specific pathways including growth factors genes, cell cycle genes, apoptose genes, inflammation genes, and androgen regulated genes, displayed major differences between small and large prostate glands.

  5. Gene expression profile analysis of type 2 diabetic mouse liver.


    Zhang, Fang; Xu, Xiang; Zhang, Yi; Zhou, Ben; He, Zhishui; Zhai, Qiwei


    Liver plays a key role in glucose metabolism and homeostasis, and impaired hepatic glucose metabolism contributes to the development of type 2 diabetes. However, the precise gene expression profile of diabetic liver and its association with diabetes and related diseases are yet to be further elucidated. In this study, we detected the gene expression profile by high-throughput sequencing in 9-week-old normal and type 2 diabetic db/db mouse liver. Totally 12132 genes were detected, and 2627 genes were significantly changed in diabetic mouse liver. Biological process analysis showed that the upregulated genes in diabetic mouse liver were mainly enriched in metabolic processes. Surprisingly, the downregulated genes in diabetic mouse liver were mainly enriched in immune-related processes, although all the altered genes were still mainly enriched in metabolic processes. Similarly, KEGG pathway analysis showed that metabolic pathways were the major pathways altered in diabetic mouse liver, and downregulated genes were enriched in immune and cancer pathways. Analysis of the key enzyme genes in fatty acid and glucose metabolism showed that some key enzyme genes were significantly increased and none of the detected key enzyme genes were decreased. In addition, FunDo analysis showed that liver cancer and hepatitis were most likely to be associated with diabetes. Taken together, this study provides the digital gene expression profile of diabetic mouse liver, and demonstrates the main diabetes-associated hepatic biological processes, pathways, key enzyme genes in fatty acid and glucose metabolism and potential hepatic diseases.

  6. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)


    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  7. Cell Cycle Programs of Gene Expression Control Morphogenetic Protein Localization

    PubMed Central

    Lord, Matthew; Yang, Melody C.; Mischke, Michelle; Chant, John


    Genomic studies in yeast have revealed that one eighth of genes are cell cycle regulated in their expression. Almost without exception, the significance of cell cycle periodic gene expression has not been tested. Given that many such genes are critical to cellular morphogenesis, we wanted to examine the importance of periodic gene expression to this process. The expression profiles of two genes required for the axial pattern of cell division, BUD3 and BUD10/AXL2/SRO4, are strongly cell cycle regulated. BUD3 is expressed close to the onset of mitosis. BUD10 is expressed in late G1. Through promotor-swap experiments, the expression profile of each gene was altered and the consequences examined. We found that an S/G2 pulse of BUD3 expression controls the timing of Bud3p localization, but that this timing is not critical to Bud3p function. In contrast, a G1 pulse of BUD10 expression plays a direct role in Bud10p localization and function. Bud10p, a membrane protein, relies on the polarized secretory machinery specific to G1 to be delivered to its proper location. Such a secretion-based targeting mechanism for membrane proteins provides cells with flexibility in remodeling their architecture or evolving new forms. PMID:11134078

  8. Expression of heat shock protein genes in insect stress responses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The heat shock proteins (HSPs) that are abundantly expressed in insects are important modulators of insect survival. Expression of HSP genes in insects is not only developmentally regulated, but also induced by various stressors in order to confer protection against such stressors. The expression o...

  9. Green Fluorescent Protein as a Marker for Gene Expression

    NASA Astrophysics Data System (ADS)

    Chalfie, Martin; Tu, Yuan; Euskirchen, Ghia; Ward, William W.; Prasher, Douglas C.


    A complementary DNA for the Aequorea victoria green fluorescent protein (GFP) produces a fluorescent product when expressed in prokaryotic (Escherichia coli) or eukaryotic (Caenorhabditis elegans) cells. Because exogenous substrates and cofactors are not required for this fluorescence, GFP expression can be used to monitor gene expression and protein localization in living organisms.

  10. Gene expression profile analysis of ventilator-associated pneumonia

    PubMed Central



    Based on the gene expression profile of patients with ventilator-associated pneumonia (VAP) and patients not affected by the disease, the present study aimed to enhance the current understanding of VAP development using bioinformatics methods. The expression profile GSE30385 was downloaded from the Gene Expression Omnibus database. The Linear Models for Microarray Data package in R language was used to screen and identify differentially expressed genes (DEGs), which were grouped as up- and down-regulated genes. The up- and downregulated genes were functionally enriched using the Database for Annotation, Visualization and Integrated Discovery system and then annotated according to TRANSFAC, Tumor Suppressor Gene and Tumor Associated Gene databases. Subsequently, the protein-protein interaction (PPI) network was constructed, followed by module analysis using CFinder software. A total of 69 DEGs, including 33 up- and 36 downregulated genes were screened out in patients with VAP. Upregulated genes were mainly enriched in functions and pathways associated with the immune response (including the genes ELANE and LTF) and the mitogen-activated protein kinase (MAPK) signaling pathway (including MAPK14). The PPI network comprised 64 PPI pairs and 44 nodes. The top two modules were enriched in different pathways, including the MAPK signaling pathway. Genes including ELANE, LTF and MAPK14 may have important roles in the development of VAP via altering the immune response and the MAPK signaling pathway. PMID:26459786

  11. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    EPA Science Inventory

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...


    EPA Science Inventory

    Microarray data from independent labs and studies can be compared to potentially identify toxicologically and biologically relevant genes. The Baseline Animal Database working group of HESI was formed to assess baseline gene expression from microarray data derived from control or...

  13. Meta-analysis of gene expression data identifies causal genes for prostate cancer.


    Wang, Xiang-Yang; Hao, Jian-Wei; Zhou, Rui-Jin; Zhang, Xiang-Sheng; Yan, Tian-Zhong; Ding, De-Gang; Shan, Lei


    Prostate cancer is a leading cause of death in male populations across the globe. With the advent of gene expression arrays, many microarray studies have been conducted in prostate cancer, but the results have varied across different studies. To better understand the genetic and biologic mechanisms of prostate cancer, we conducted a meta-analysis of two studies on prostate cancer. Eight key genes were identified to be differentially expressed with progression. After gene co-expression analysis based on data from the GEO database, we obtained a co- expressed gene list which included 725 genes. Gene Ontology analysis revealed that these genes are involved in actin filament-based processes, locomotion and cell morphogenesis. Further analysis of the gene list should provide important clues for developing new prognostic markers and therapeutic targets.

  14. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.


    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan


    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  15. Regulation of gene expression by Goodwin's loop with many genes

    NASA Astrophysics Data System (ADS)

    Sielewiesiuk, Jan; Łopaciuk, Agata


    The paper presents a simple analysis of a long Goodwin's loop containing many genes. The genes form a closed series. The rate of transcription of any gene is up or down regulated by theprotein product of the preceding gene. We describe the loop with a system of ordinary differential equations of order s. Oscillatory solutions of the system are possible at the odd number of repressions and any number of inductions if the product of all Hill's coefficients, related to both repressions and inductions, is larger than:

  16. Indirect genomic effects on survival from gene expression data

    PubMed Central

    Ferkingstad, Egil; Frigessi, Arnoldo; Lyng, Heidi


    In cancer, genes may have indirect effects on patient survival, mediated through interactions with other genes. Methods to study the indirect effects that contribute significantly to survival are not available. We propose a novel methodology to detect and quantify indirect effects from gene expression data. We discover indirect effects through several target genes of transcription factors in cancer microarray data, pointing to genetic interactions that play a significant role in tumor progression. PMID:18358079

  17. Identifying nonspecific SAGE tags by context of gene expression.


    Ge, Xijin; Wang, San Ming


    Many serial analysis of gene expression (SAGE) tags can be matched to multiple genes, leading to difficulty in SAGE data interpretation and analysis. As only a subset of genes in the human genome are transcribed in a certain type of tissue/cell, we used microarray expression data from different tissue types to define contexts of gene expression and to annotate SAGE tags collected from the same or similar tissue sources. To predict the original transcript contributing a nonspecific SAGE tag collected from a particular tissue, we ranked the corresponding genes by their expression levels determined by microarray. We developed a tissue-specific SAGE tag annotation database based on microarray data collected from 73 normal human tissues and 18 cancer tissues and cell lines. The database can be queried online at: The accuracy of this database was confirmed by experimental data.

  18. Expression of ets family genes in hematopoietic-cells.


    Romanospica, V; Suzuki, H; Georgiou, P; Chen, S; Ascione, R; Papas, T; Bhat, N


    We have examined the expression of the ets family of transcription factors in different types of hematopoietic cells. Our results demonstrate that several members of the ets gene family are expressed differentially in hematopoietic cells. During phorbol ester induced differentiation of HL60 cells, ETS2, PEA3, as well as GABPalpha and GABPbeta mRNAs are coordinately induced. During the activation of T-cells, ETS2 proteins are induced; however, the expression of the ETS1 and ERGB gene products are reduced. These results demonstrate that the regulation of ets family of genes is complex and depends on cell type. This observation leads to the conclusion that the regulation of ets target genes, will be dependent, in part, upon the type of ets genes expressed in each particular cell type.

  19. A hammerhead ribozyme inhibits ADE1 gene expression in yeast.


    Ferbeyre, G; Bratty, J; Chen, H; Cedergren, R


    To study factors that affect in vivo ribozyme (Rz) activity, a model system has been devised in Saccharomyces cerevisiae based on the inhibition of ADE1 gene expression. This gene was chosen because Rz action can be evaluated visually by the Red phenotype produced when the activity of the gene product is inhibited. Different plasmid constructs allowed the expression of the Rz either in cis or in trans with respect to ADE1. Rz-related inhibition of ADE1 expression was correlated with a Red phenotype and a diminution of ADE1 mRNA levels only when the Rz gene was linked 5' to ADE1. The presence of the expected 3' cleavage fragment was demonstrated using a technique combining RNA ligation and PCR. This yeast system and detection technique are suited to the investigation of general factors affecting Rz-catalyzed inhibition of gene expression under in vivo conditions.

  20. Gene expression profiles of Nitrosomonas europaea, an obligate chemolitotroph

    SciTech Connect

    Daniel J. Arp


    Nitrosomonas europaea is an aerobic lithoautotrophic bacterium that uses ammonia (NH3) as its energy source. As a nitrifier, it is an important participant in the nitrogen cycle, which can also influence the carbon cycle. The focus of this work was to explore the genetic structure and mechanisms underlying the lithoautotrophic growth style of N. europaea. Whole genome gene expression: The gene expression profile of cells in exponential growth and during starvation was analyzed using microarrays. During growth, 98% of the genes increased in expression at least two fold compared to starvation conditions. In growing cells, approximately 30% of the genes were expressed eight fold higher, Approximately 10% were expressed more than 15 fold higher. Approximately 3% (91 genes) were expressed to more than 20 fold of their levels in starved cells. Carbon fixation gene expression: N. europaea fixes carbon via the Calvin-Benson-Bassham (CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). This study showed that transcription of cbb genes was up-regulated when the carbon source was limited, while amo, hao and other energy harvesting related genes were down-regulated. Iron related gene expression: Because N. europaea has a relatively high content of hemes, sufficient Fe must be available in the medium for it to grow. The genome revealed that approximately 5% of the coding genes in N. europaea are dedicated to Fe transport and assimilation. Nonetheless, with the exception of citrate biosynthesis genes, N. europaea lacks genes for siderophore production. The Fe requirements for growth and the expression of the putative membrane siderophore receptors were determined. The N. europaea genome has over 100 putative genes ({approx}5% of the coding genes) related to Fe uptake and its siderophore receptors could be grouped phylogenetically in four clusters. Fe related genes, such as a number of TonB-dependent Fe-siderophore receptors for ferrichrome and

  1. Gene expression profiles of Nitrosomonas europaea, an obligate chemolitotroph

    SciTech Connect

    Daniel J Arp


    Nitrosomonas europaea is an aerobic lithoautotrophic bacterium that uses ammonia (NH3) as its energy source. As a nitrifier, it is an important participant in the nitrogen cycle, which can also influence the carbon cycle. The focus of this work was to explore the genetic structure and mechanisms underlying the lithoautotrophic growth style of N. europaea. Whole genome gene expression. The gene expression profile of cells in exponential growth and during starvation was analyzed using microarrays. During growth, 98% of the genes increased in expression at least two fold compared to starvation conditions. In growing cells, approximately 30% of the genes were expressed eight fold higher, Approximately 10% were expressed more than 15 fold higher. Approximately 3% (91 genes) were expressed to more than 20 fold of their levels in starved cells. Carbon fixation gene expression. N. europaea fixes carbon via the Calvin-Benson-Bassham (CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). This study showed that transcription of cbb genes was up-regulated when the carbon source was limited, while amo, hao and other energy harvesting related genes were down-regulated. Iron related gene expression. Because N. europaea has a relatively high content of hemes, sufficient Fe must be available in the medium for it to grow. The genome revealed that approximately 5% of the coding genes in N. europaea are dedicated to Fe transport and assimilation. Nonetheless, with the exception of citrate biosynthesis genes, N. europaea lacks genes for siderophore production. The Fe requirements for growth and the expression of the putative membrane siderophore receptors were determined. The N. europaea genome has over 100 putative genes ({approx}5% of the coding genes) related to Fe uptake and its siderophore receptors could be grouped phylogenetically in four clusters. Fe related genes, such as a number of TonB-dependent Fe-siderophore receptors for ferrichrome and

  2. Prediction of gene expression in embryonic structures of Drosophila melanogaster.


    Samsonova, Anastasia A; Niranjan, Mahesan; Russell, Steven; Brazma, Alvis


    Understanding how sets of genes are coordinately regulated in space and time to generate the diversity of cell types that characterise complex metazoans is a major challenge in modern biology. The use of high-throughput approaches, such as large-scale in situ hybridisation and genome-wide expression profiling via DNA microarrays, is beginning to provide insights into the complexities of development. However, in many organisms the collection and annotation of comprehensive in situ localisation data is a difficult and time-consuming task. Here, we present a widely applicable computational approach, integrating developmental time-course microarray data with annotated in situ hybridisation studies, that facilitates the de novo prediction of tissue-specific expression for genes that have no in vivo gene expression localisation data available. Using a classification approach, trained with data from microarray and in situ hybridisation studies of gene expression during Drosophila embryonic development, we made a set of predictions on the tissue-specific expression of Drosophila genes that have not been systematically characterised by in situ hybridisation experiments. The reliability of our predictions is confirmed by literature-derived annotations in FlyBase, by overrepresentation of Gene Ontology biological process annotations, and, in a selected set, by detailed gene-specific studies from the literature. Our novel organism-independent method will be of considerable utility in enriching the annotation of gene function and expression in complex multicellular organisms.

  3. Detecting microRNA activity from gene expression data

    PubMed Central


    Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources. PMID:20482775

  4. Identification of reference genes in human myelomonocytic cells for gene expression studies in altered gravity.


    Thiel, Cora S; Hauschild, Swantje; Tauber, Svantje; Paulsen, Katrin; Raig, Christiane; Raem, Arnold; Biskup, Josefine; Gutewort, Annett; Hürlimann, Eva; Unverdorben, Felix; Buttron, Isabell; Lauber, Beatrice; Philpot, Claudia; Lier, Hartwin; Engelmann, Frank; Layer, Liliana E; Ullrich, Oliver


    Gene expression studies are indispensable for investigation and elucidation of molecular mechanisms. For the process of normalization, reference genes ("housekeeping genes") are essential to verify gene expression analysis. Thus, it is assumed that these reference genes demonstrate similar expression levels over all experimental conditions. However, common recommendations about reference genes were established during 1 g conditions and therefore their applicability in studies with altered gravity has not been demonstrated yet. The microarray technology is frequently used to generate expression profiles under defined conditions and to determine the relative difference in expression levels between two or more different states. In our study, we searched for potential reference genes with stable expression during different gravitational conditions (microgravity, normogravity, and hypergravity) which are additionally not altered in different hardware systems. We were able to identify eight genes (ALB, B4GALT6, GAPDH, HMBS, YWHAZ, ABCA5, ABCA9, and ABCC1) which demonstrated no altered gene expression levels in all tested conditions and therefore represent good candidates for the standardization of gene expression studies in altered gravity.

  5. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    PubMed Central

    Yao, Zizhen; Jaeger, Jochen C; Ruzzo, Walter L; Morale, Cecile Z; Emond, Mary; Francke, Uta; Milewicz, Dianna M; Schwartz, Stephen M; Mulvihill, Eileen R


    Background Marfan syndrome (MFS) is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value < 3 × 10-6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status). An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater. PMID:17850668

  6. Nonlinear model-based method for clustering periodically expressed genes.


    Tian, Li-Ping; Liu, Li-Zhi; Zhang, Qian-Wei; Wu, Fang-Xiang


    Clustering periodically expressed genes from their time-course expression data could help understand the molecular mechanism of those biological processes. In this paper, we propose a nonlinear model-based clustering method for periodically expressed gene profiles. As periodically expressed genes are associated with periodic biological processes, the proposed method naturally assumes that a periodically expressed gene dataset is generated by a number of periodical processes. Each periodical process is modelled by a linear combination of trigonometric sine and cosine functions in time plus a Gaussian noise term. A two stage method is proposed to estimate the model parameter, and a relocation-iteration algorithm is employed to assign each gene to an appropriate cluster. A bootstrapping method and an average adjusted Rand index (AARI) are employed to measure the quality of clustering. One synthetic dataset and two biological datasets were employed to evaluate the performance of the proposed method. The results show that our method allows the better quality clustering than other clustering methods (e.g., k-means) for periodically expressed gene data, and thus it is an effective cluster analysis method for periodically expressed gene data.

  7. The choice of reference genes for assessing gene expression in sugarcane under salinity and drought stresses.


    Guo, Jinlong; Ling, Hui; Wu, Qibin; Xu, Liping; Que, Youxiong


    Sugarcane (Saccharum spp. hybrids) is a world-wide cash crop for sugar and biofuel in tropical and subtropical regions and suffers serious losses in cane yield and sugar content under salinity and drought stresses. Although real-time quantitative PCR has a numerous advantage in the expression quantification of stress-related genes for the elaboration of the corresponding molecular mechanism in sugarcane, the variation happened across the process of gene expression quantification should be normalized and monitored by introducing one or several reference genes. To validate suitable reference genes or gene sets for sugarcane gene expression normalization, 13 candidate reference genes have been tested across 12 NaCl- and PEG-treated sugarcane samples for four sugarcane genotypes using four commonly used systematic statistical algorithms termed geNorm, BestKeeper, NormFinder and the deltaCt method. The results demonstrated that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and eukaryotic elongation factor 1-alpha (eEF-1a) were identified as suitable reference genes for gene expression normalization under salinity/drought-treatment in sugarcane. Moreover, the expression analyses of SuSK and 6PGDH further validated that a combination of clathrin adaptor complex (CAC) and cullin (CUL) as reference should be better for gene expression normalization. These results can facilitate the future research on gene expression in sugarcane under salinity and drought stresses.

  8. Analysis of bHLH coding genes using gene co-expression network approach.


    Srivastava, Swati; Sanchita; Singh, Garima; Singh, Noopur; Srivastava, Gaurava; Sharma, Ashok


    Network analysis provides a powerful framework for the interpretation of data. It uses novel reference network-based metrices for module evolution. These could be used to identify module of highly connected genes showing variation in co-expression network. In this study, a co-expression network-based approach was used for analyzing the genes from microarray data. Our approach consists of a simple but robust rank-based network construction. The publicly available gene expression data of Solanum tuberosum under cold and heat stresses were considered to create and analyze a gene co-expression network. The analysis provide highly co-expressed module of bHLH coding genes based on correlation values. Our approach was to analyze the variation of genes expression, according to the time period of stress through co-expression network approach. As the result, the seed genes were identified showing multiple connections with other genes in the same cluster. Seed genes were found to be vary in different time periods of stress. These analyzed seed genes may be utilized further as marker genes for developing the stress tolerant plant species.

  9. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.


    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques


    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  10. Identifying a gene expression signature of cluster headache in blood

    PubMed Central

    Eising, Else; Pelzer, Nadine; Vijfhuizen, Lisanne S.; Vries, Boukje de; Ferrari, Michel D.; ‘t Hoen, Peter A. C.; Terwindt, Gisela M.; van den Maagdenberg, Arn M. J. M.


    Cluster headache is a relatively rare headache disorder, typically characterized by multiple daily, short-lasting attacks of excruciating, unilateral (peri-)orbital or temporal pain associated with autonomic symptoms and restlessness. To better understand the pathophysiology of cluster headache, we used RNA sequencing to identify differentially expressed genes and pathways in whole blood of patients with episodic (n = 19) or chronic (n = 20) cluster headache in comparison with headache-free controls (n = 20). Gene expression data were analysed by gene and by module of co-expressed genes with particular attention to previously implicated disease pathways including hypocretin dysregulation. Only moderate gene expression differences were identified and no associations were found with previously reported pathogenic mechanisms. At the level of functional gene sets, associations were observed for genes involved in several brain-related mechanisms such as GABA receptor function and voltage-gated channels. In addition, genes and modules of co-expressed genes showed a role for intracellular signalling cascades, mitochondria and inflammation. Although larger study samples may be required to identify the full range of involved pathways, these results indicate a role for mitochondria, intracellular signalling and inflammation in cluster headache. PMID:28074859

  11. Novel redox nanomedicine improves gene expression of polyion complex vector

    NASA Astrophysics Data System (ADS)

    Toh, Kazuko; Yoshitomi, Toru; Ikeda, Yutaka; Nagasaki, Yukio


    Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an ROS scavenger. When polyethyleneimine (PEI)/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI)/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF)-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  12. Characterising Cytokine Gene Expression Signatures in Patients with Severe Sepsis

    PubMed Central

    Grealy, Robert; White, Mary; Stordeur, Patrick; Kelleher, Dermot; Doherty, Derek G.; McManus, Ross; Ryan, Thomas


    Introduction. Severe sepsis in humans may be related to an underlying profound immune suppressive state. We investigated the link between gene expression of immune regulatory cytokines and the range of illness severity in patients with infection and severe sepsis. Methods. A prospective observational study included 54 ICU patients with severe sepsis, 53 patients with infection without organ failure, and 20 healthy controls. Gene expression in peripheral blood mononuclear cells (PBMC) was measured using real-time polymerase chain reaction. Results. Infection differed from health by decreased expression of the IL2, and IL23 and greater expression of IL10 and IL27. Severe sepsis differed from infection by having decreased IL7, IL23, IFNγ, and TNFα gene expression. An algorithm utilising mRNA copy number for TNFα, IFNγ, IL7, IL10, and IL23 accurately distinguished sepsis from severe sepsis with a receiver operator characteristic value of 0.88. Gene expression was similar with gram-positive and gram-negative infection and was similar following medical and surgical severe sepsis. Severity of organ failure was associated with serum IL6 protein levels but not with any index of cytokine gene expression in PBMCs. Conclusions. Immune regulatory cytokine gene expression in PBMC provides a robust method of modelling patients' response to infection. PMID:23935244

  13. Patterns of soybean proline-rich protein gene expression.

    PubMed Central

    Wyatt, R E; Nagao, R T; Key, J L


    The expression patterns of three members of a gene family that encodes proline-rich proteins in soybean (SbPRPs) were examined using in situ hybridization experiments. In most instances, the expression of SbPRP genes was intense in a limited number of cell types of a particular organ. SbPRP1 RNA was localized in several cell types of soybean hypocotyls, including cells within the phloem and xylem. SbPRP1 expression increased within epidermal cells in the elongating and mature regions of the hypocotyl; expression was detected also in lignified cells surrounding the hilum of mature seeds. SbPRP2 RNA was present in cortical cells and in the vascular tissue of the hypocotyl, especially cells of the phloem. This gene was expressed also in the inner integuments of the mature seed coat. SbPRP3 RNA was localized specifically to the endodermoid layer of cells surrounding the stele in the elongating region of the hypocotyl, as well as in the epidermal cells of leaves and cotyledons. These data show that members of this gene family exhibit cell-specific expression. The members of the SbPRP gene family are expressed in different types of cells and in some cell types that also express the glycine-rich protein or hydroxyproline-rich glycoprotein classes of genes. PMID:1525563

  14. Digital gene expression for non-model organisms

    PubMed Central

    Hong, Lewis Z.; Li, Jun; Schmidt-Küntzel, Anne; Warren, Wesley C.; Barsh, Gregory S.


    Next-generation sequencing technologies offer new approaches for global measurements of gene expression but are mostly limited to organisms for which a high-quality assembled reference genome sequence is available. We present a method for gene expression profiling called EDGE, or EcoP15I-tagged Digital Gene Expression, based on ultra-high-throughput sequencing of 27-bp cDNA fragments that uniquely tag the corresponding gene, thereby allowing direct quantification of transcript abundance. We show that EDGE is capable of assaying for expression in >99% of genes in the genome and achieves saturation after 6–8 million reads. EDGE exhibits very little technical noise, reveals a large (106) dynamic range of gene expression, and is particularly suited for quantification of transcript abundance in non-model organisms where a high-quality annotated genome is not available. In a direct comparison with RNA-seq, both methods provide similar assessments of relative transcript abundance, but EDGE does better at detecting gene expression differences for poorly expressed genes and does not exhibit transcript length bias. Applying EDGE to laboratory mice, we show that a loss-of-function mutation in the melanocortin 1 receptor (Mc1r), recognized as a Mendelian determinant of yellow hair color in many different mammals, also causes reduced expression of genes involved in the interferon response. To illustrate the application of EDGE to a non-model organism, we examine skin biopsy samples from a cheetah (Acinonyx jubatus) and identify genes likely to control differences in the color of spotted versus non-spotted regions. PMID:21844123

  15. Validation of housekeeping genes for gene expression studies in an ice alga Chlamydomonas during freezing acclimation.


    Liu, Chenlin; Wu, Guangting; Huang, Xiaohang; Liu, Shenghao; Cong, Bailin


    Antarctic ice alga Chlamydomonas sp. ICE-L can endure extreme low temperature and high salinity stress under freezing conditions. To elucidate the molecular acclimation mechanisms using gene expression analysis, the expression stabilities of ten housekeeping genes of Chlamydomonas sp. ICE-L during freezing stress were analyzed. Some discrepancies were detected in the ranking of the candidate reference genes between geNorm and NormFinder programs, but there was substantial agreement between the groups of genes with the most and the least stable expression. RPL19 was ranked as the best candidate reference genes. Pairwise variation (V) analysis indicated the combination of two reference genes was sufficient for qRT-PCR data normalization under the experimental conditions. Considering the co-regulation between RPL19 and RPL32 (the most stable gene pairs given by geNorm program), we propose that the mean data rendered by RPL19 and GAPDH (the most stable gene pairs given by NormFinder program) be used to normalize gene expression values in Chlamydomonas sp. ICE-L more accurately. The example of FAD3 gene expression calculation demonstrated the importance of selecting an appropriate category and number of reference genes to achieve an accurate and reliable normalization of gene expression during freeze acclimation in Chlamydomonas sp. ICE-L.

  16. Gene expression profiles associated with aging and mortality in humans

    PubMed Central

    Kerber, Richard A; O’Brien, Elizabeth; Cawthon, Richard M


    We investigated the hypothesis that gene expression profiles in cultured cell lines from adults, aged 57–97 years, contain information about the biological age and potential longevity of the donors. We studied 104 unrelated grandparents from 31 Utah CEU (Centre d’Etude du Polymorphisme Humain – Utah) families, for whom lymphoblastoid cell lines were established in the 1980s. Combining publicly available gene expression data from these cell lines, and survival data from the Utah Population Database, we tested the relationship between expression of 2151 always-expressed genes, age, and survival of the donors. Approximately 16% of 2151 expression levels were associated with donor age: 10% decreased in expression with age, and 6% increased with age. Cell division cycle 42 (CDC42) and CORO1A exhibited strong associations both with age at draw and survival after draw (multiple comparisons-adjusted Monte Carlo P-value < 0.05). In general, gene expressions that increased with age were associated with increased mortality. Gene expressions that decreased with age were generally associated with reduced mortality. A multivariate estimate of biological age modeled from expression data was dominated by CDC42 expression, and was a significant predictor of survival after blood draw. A multivariate model of survival as a function of gene expression was dominated by CORO1A expression. This model accounted for approximately 23% of the variation in survival among the CEU grandparents. Some expression levels were negligibly associated with age in this cross-sectional dataset, but strongly associated with inter-individual differences in survival. These observations may lead to new insights regarding the genetic contribution to exceptional longevity. PMID:19245677

  17. Gene expression profiles associated with aging and mortality in humans.


    Kerber, Richard A; O'Brien, Elizabeth; Cawthon, Richard M


    We investigated the hypothesis that gene expression profiles in cultured cell lines from adults, aged 57-97 years, contain information about the biological age and potential longevity of the donors. We studied 104 unrelated grandparents from 31 Utah CEU (Centre d'Etude du Polymorphisme Humain - Utah) families, for whom lymphoblastoid cell lines were established in the 1980s. Combining publicly available gene expression data from these cell lines, and survival data from the Utah Population Database, we tested the relationship between expression of 2151 always-expressed genes, age, and survival of the donors. Approximately 16% of 2151 expression levels were associated with donor age: 10% decreased in expression with age, and 6% increased with age. Cell division cycle 42 (CDC42) and CORO1A exhibited strong associations both with age at draw and survival after draw (multiple comparisons-adjusted Monte Carlo P-value < 0.05). In general, gene expressions that increased with age were associated with increased mortality. Gene expressions that decreased with age were generally associated with reduced mortality. A multivariate estimate of biological age modeled from expression data was dominated by CDC42 expression, and was a significant predictor of survival after blood draw. A multivariate model of survival as a function of gene expression was dominated by CORO1A expression. This model accounted for approximately 23% of the variation in survival among the CEU grandparents. Some expression levels were negligibly associated with age in this cross-sectional dataset, but strongly associated with inter-individual differences in survival. These observations may lead to new insights regarding the genetic contribution to exceptional longevity.

  18. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong


    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  19. Gene Expression Profiling of Breast Cancer Brain Metastasis

    PubMed Central

    Lee, Ji Yun; Park, Kyunghee; Lee, Eunjin; Ahn, TaeJin; Jung, Hae Hyun; Lim, Sung Hee; Hong, Mineui; Do, In-Gu; Cho, Eun Yoon; Kim, Duk-Hwan; Kim, Ji-Yeon; Ahn, Jin Seok; Im, Young-Hyuck; Park, Yeon Hee


    The biology of breast cancer brain metastasis (BCBM) is poorly understood. We aimed to explore genes that are implicated in the process of brain metastasis of primary breast cancer (BC). NanoString nCounter Analysis covering 252 target genes was used for comparison of gene expression levels between 20 primary BCs that relapsed to brain and 41 BCBM samples. PAM50-based intrinsic subtypes such as HER2-enriched and basal-like were clearly over-represented in BCBM. A panel of 22 genes was found to be significantly differentially expressed between primary BC and BCBM. Five of these genes, CXCL12, MMP2, MMP11, VCAM1, and MME, which have previously been associated with tumor progression, angiogenesis, and metastasis, clearly discriminated between primary BC and BCBM. Notably, the five genes were significantly upregulated in primary BC compared to BCBM. Conversely, SOX2 and OLIG2 genes were upregulated in BCBM. These genes may participate in metastatic colonization but not in primary tumor development. Among patient-matched paired samples (n = 17), a PAM50 molecular subtype conversion was observed in eight cases (47.1%), with a trend toward unfavorable subtypes in patients with the distinct gene expression. Our findings, although not conclusive, reveal differentially expressed genes that might mediate the brain metastasis process. PMID:27340107

  20. Gene Expressions for Signal Transduction under Acidic Conditions

    PubMed Central

    Fukamachi, Toshihiko; Ikeda, Syunsuke; Wang, Xin; Saito, Hiromi; Tagawa, Masatoshi; Kobayashi, Hiroshi


    Although it is now well known that some diseased areas, such as cancer nests, inflammation loci, and infarction areas, are acidified, little is known about cellular signal transduction, gene expression, and cellular functions under acidic conditions. Our group showed that different signal proteins were activated under acidic conditions compared with those observed in a typical medium of around pH 7.4 that has been used until now. Investigations of gene expression under acidic conditions may be crucial to our understanding of signal transduction in acidic diseased areas. In this study, we investigated gene expression in mesothelioma cells cultured at an acidic pH using a DNA microarray technique. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. Genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors numbered 35, 32, and 17 among the 379 genes, respectively. Since the functions of 78 genes are unknown, it can be argued that cells may have other genes for signaling under acidic conditions. The expressions of 37 of the 379 genes were observed to increase after as little as 2 h. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively. These results suggest that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at a pH of around 7.4. PMID:24705103

  1. Development and application of a rat ovarian gene expression database.


    Jo, Misung; Gieske, Mary C; Payne, Charles E; Wheeler-Price, Sarah E; Gieske, Joseph B; Ignatius, Ignatius V; Curry, Thomas E; Ko, Chemyong


    The pituitary gonadotropins play a key role in follicular development and ovulation through the induction of specific genes. To identify these genes, we have constructed a genome-wide rat ovarian gene expression database (rOGED). The database was constructed from total RNA isolated from intact ovaries, granulosa cells, or residual ovarian tissues collected from immature pregnant mare serum gonadotropin (PMSG)/human chorionic gonadotropin-treated rats at 0 h (no PMSG), 12 h, and 48 h post PMSG, as well as 6 and 12 h post human chorionic gonadotropin. The total RNA was used for DNA microarray analysis using Affymetrix Rat Expression Arrays 230A and 230B (Affymetrix, Santa Clara, CA). The microarray data were compiled and used for display of individual gene expression profiles through specially developed software. The final rOGED provides immediate analysis of temporal gene expression profiles for over 28,000 genes in intact ovaries, granulosa cells, and residual ovarian tissue during follicular growth and the preovulatory period. The accuracy of the rOGED was validated against the gene profiles for over 20 known genes. The utility of the rOGED was demonstrated by identifying six genes that have not been described in the rat periovulatory ovary. The mRNA expression patterns and cellular localization for each of these six genes (estrogen sulfotransferase, synaptosomal-associated protein 25 kDa, runt-related transcription factor, calgranulin B, alpha1-macroglobulin, and MAPK phosphotase-3) were confirmed by Northern blot analyses and in situ hybridization, respectively. The current findings demonstrate that the rOGED can be used as an instant reference for ovarian gene expression profiles, as well as a reliable resource for identifying important yet, to date, unknown ovarian genes.

  2. Comparative analysis of hepatocellular carcinoma and cirrhosis gene expression profiles.


    Jiang, Mingming; Zeng, Qingfang; Dai, Suiping; Liang, Huixia; Dai, Fengying; Xie, Xueling; Lu, Kunlin; Gao, Chunfang


    Gene expression data of hepatocellular carcinoma (HCC) was compared with that of cirrhosis (C) to identify critical genes in HCC. A total of five gene expression data sets were downloaded from Gene Expression Omnibus. HCC and healthy samples were combined as dataset HCC, whereas cirrhosis samples were included in dataset C. A network was constructed for dataset HCC with the package R for performing Weighted Gene Co‑expression Network Analysis. Modules were identified by cluster analysis with the packages flashClust and dynamicTreeCut. Hub genes were screened out by calculating connectivity. Functional annotations were assigned to the hub genes using the Database for Annotation, Visualization and Integration Discovery, and functional annotation networks were visualized with Cytoscape. Following the exclusion of outlier samples, 394 HCC samples and 47 healthy samples were included in dataset HCC and 233 cirrhosis samples were included in dataset C. A total of 6 modules were identified in the weighted gene co‑expression network of dataset HCC (blue, brown, turquoise, green, red and yellow). Modules blue, brown and turquoise had high preservation whereas module yellow exhibited the lowest preservation. These modules were associated with transcription, mitosis, cation transportation, cation homeostasis, secretion and regulation of cyclase activity. Various hub genes of module yellow were cytokines, including chemokine (C‑C motif) ligand 22 and interleukin‑19, which may be important in the development of HCC. Gene expression profiles of HCC were compared with those of cirrhosis and numerous critical genes were identified, which may contribute to the progression of HCC. Further studies on these genes may improve the understanding of HCC pathogenesis.

  3. Discovering causes and cures for cancer from gene expression analysis.


    Weeraratna, Ashani T


    Tumorigenesis is governed by a series of complex genetic and epigenetic changes. Both mechanisms can result in either the silencing or aberrant expression of messages in a cell. Gene expression profiling techniques such as the serial analysis of gene expression (SAGE) or microarray analysis can provide global overviews of these changes, as well identify key genes and pathways involved in this process. This review outlines the current roles of these techniques in cancer research, and how they may contribute to finding not only mechanisms of this disease, but potential targets for therapy.

  4. Membrane channel gene expression in human costal and articular chondrocytes

    PubMed Central

    Asmar, A.; Barrett-Jolley, R.; Werner, A.; Kelly, R.; Stacey, M.


    ABSTRACT Chondrocytes are the uniquely resident cells found in all types of cartilage and key to their function is the ability to respond to mechanical loads with changes of metabolic activity. This mechanotransduction property is, in part, mediated through the activity of a range of expressed transmembrane channels; ion channels, gap junction proteins, and porins. Appropriate expression of ion channels has been shown essential for production of extracellular matrix and differential expression of transmembrane channels is correlated to musculoskeletal diseases such as osteoarthritis and Albers-Schönberg. In this study we analyzed the consistency of gene expression between channelomes of chondrocytes from human articular and costal (teenage and fetal origin) cartilages. Notably, we found 14 ion channel genes commonly expressed between articular and both types of costal cartilage chondrocytes. There were several other ion channel genes expressed only in articular (6 genes) or costal chondrocytes (5 genes). Significant differences in expression of BEST1 and KCNJ2 (Kir2.1) were observed between fetal and teenage costal cartilage. Interestingly, the large Ca2+ activated potassium channel (BKα, or KCNMA1) was very highly expressed in all chondrocytes examined. Expression of the gap junction genes for Panx1, GJA1 (Cx43) and GJC1 (Cx45) was also observed in chondrocytes from all cartilage samples. Together, this data highlights similarities between chondrocyte membrane channel gene expressions in cells derived from different anatomical sites, and may imply that common electrophysiological signaling pathways underlie cellular control. The high expression of a range of mechanically and metabolically sensitive membrane channels suggest that chondrocyte mechanotransduction may be more complex than previously thought. PMID:27116676

  5. Control of alphavirus-based gene expression using engineered riboswitches.


    Bell, Christie L; Yu, Dong; Smolke, Christina D; Geall, Andrew J; Beard, Clayton W; Mason, Peter W


    Alphavirus-based replicons are a promising nucleic acid vaccine platform characterized by robust gene expression and immune responses. To further explore their use in vaccination, replicons were engineered to allow conditional control over their gene expression. Riboswitches, comprising a ribozyme actuator and RNA aptamer sensor, were engineered into the replicon 3' UTR. Binding of ligand to aptamer modulates ribozyme activity and, therefore, gene expression. Expression from DNA-launched and VRP-packaged replicons containing riboswitches was successfully regulated, achieving a 47-fold change in expression and modulation of the resulting type I interferon response. Moreover, we developed a novel control architecture where riboswitches were integrated into the 3' and 5' UTR of the subgenomic RNA region of the TC-83 virus, leading to an 1160-fold regulation of viral replication. Our studies demonstrate that the use of riboswitches for control of RNA replicon expression and viral replication holds promise for development of novel and safer vaccination strategies.

  6. Scaling of Gene Expression with Transcription-Factor Fugacity

    PubMed Central

    Weinert, Franz M.; Brewster, Robert C.; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K.


    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve. PMID:25554908

  7. Scaling of gene expression with transcription-factor fugacity.


    Weinert, Franz M; Brewster, Robert C; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K


    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve.

  8. The Role of Nuclear Bodies in Gene Expression and Disease

    PubMed Central

    Morimoto, Marie; Boerkoel, Cornelius F.


    This review summarizes the current understanding of the role of nuclear bodies in regulating gene expression. The compartmentalization of cellular processes, such as ribosome biogenesis, RNA processing, cellular response to stress, transcription, modification and assembly of spliceosomal snRNPs, histone gene synthesis and nuclear RNA retention, has significant implications for gene regulation. These functional nuclear domains include the nucleolus, nuclear speckle, nuclear stress body, transcription factory, Cajal body, Gemini of Cajal body, histone locus body and paraspeckle. We herein review the roles of nuclear bodies in regulating gene expression and their relation to human health and disease. PMID:24040563

  9. Reference genes for gene expression studies in wheat flag leaves grown under different farming conditions

    PubMed Central


    Background Internal control genes with highly uniform expression throughout the experimental conditions are required for accurate gene expression analysis as no universal reference genes exists. In this study, the expression stability of 24 candidate genes from Triticum aestivum cv. Cubus flag leaves grown under organic and conventional farming systems was evaluated in two locations in order to select suitable genes that can be used for normalization of real-time quantitative reverse-transcription PCR (RT-qPCR) reactions. The genes were selected among the most common used reference genes as well as genes encoding proteins involved in several metabolic pathways. Findings Individual genes displayed different expression rates across all samples assayed. Applying geNorm, a set of three potential reference genes were suitable for normalization of RT-qPCR reactions in winter wheat flag leaves cv. Cubus: TaFNRII (ferredoxin-NADP(H) oxidoreductase; AJ457980.1), ACT2 (actin 2; TC234027), and rrn26 (a putative homologue to RNA 26S gene; AL827977.1). In addition of these three genes that were also top-ranked by NormFinder, two extra genes: CYP18-2 (Cyclophilin A, AY456122.1) and TaWIN1 (14-3-3 like protein, AB042193) were most consistently stably expressed. Furthermore, we showed that TaFNRII, ACT2, and CYP18-2 are suitable for gene expression normalization in other two winter wheat varieties (Tommi and Centenaire) grown under three treatments (organic, conventional and no nitrogen) and a different environment than the one tested with cv. Cubus. Conclusions This study provides a new set of reference genes which should improve the accuracy of gene expression analyses when using wheat flag leaves as those related to the improvement of nitrogen use efficiency for cereal production. PMID:21951810

  10. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.


    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira


    PRC2 genes were analyzed for their number of gene duplications, dN/dS ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  11. Gene expression changes during retinal development and rod specification

    PubMed Central

    Carrigan, Matthew; Hokamp, Karsten; Farrar, G. Jane


    Purpose Retinitis pigmentosa (RP) typically results from individual mutations in any one of >70 genes that cause rod photoreceptor cells to degenerate prematurely, eventually resulting in blindness. Gene therapies targeting individual RP genes have shown efficacy at clinical trial; however, these therapies require the surviving photoreceptor cells to be viable and functional, and may be economically feasible for only the more commonly mutated genes. An alternative potential treatment strategy, particularly for late stage disease, may involve stem cell transplants into the photoreceptor layer of the retina. Rod progenitors from postnatal mouse retinas can be transplanted and can form photoreceptors in recipient adult retinas; optimal numbers of transplantable cells are obtained from postnatal day 3–5 (P3–5) retinas. These cells can also be expanded in culture; however, this results in the loss of photoreceptor potential. Gene expression differences between postnatal retinas, cultured retinal progenitor cells (RPCs), and rod photoreceptor precursors were investigated to identify gene expression patterns involved in the specification of rod photoreceptors. Methods Microarrays were used to investigate differences in gene expression between cultured RPCs that have lost photoreceptor potential, P1 retinas, and fresh P5 retinas that contain significant numbers of transplantable photoreceptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photoreceptor precursors were compared with Rho-eGFP-negative cells from the same P5 retinas. Differential expression was confirmed with quantitative polymerase chain reaction (q-PCR). Results Analysis of the microarray data sets, including the use of t-distributed stochastic neighbor embedding (t-SNE) to identify expression pattern neighbors of key photoreceptor specific genes, resulted in the identification of 636 genes differentially regulated during rod specification. Forty-four of these

  12. PLEXdb: gene expression resources for plants and plant pathogens

    PubMed Central

    Dash, Sudhansu; Van Hemert, John; Hong, Lu; Wise, Roger P.; Dickerson, Julie A.


    PLEXdb (, in partnership with community databases, supports comparisons of gene expression across multiple plant and pathogen species, promoting individuals and/or consortia to upload genome-scale data sets to contrast them to previously archived data. These analyses facilitate the interpretation of structure, function and regulation of genes in economically important plants. A list of Gene Atlas experiments highlights data sets that give responses across different developmental stages, conditions and tissues. Tools at PLEXdb allow users to perform complex analyses quickly and easily. The Model Genome Interrogator (MGI) tool supports mapping gene lists onto corresponding genes from model plant organisms, including rice and Arabidopsis. MGI predicts homologies, displays gene structures and supporting information for annotated genes and full-length cDNAs. The gene list-processing wizard guides users through PLEXdb functions for creating, analyzing, annotating and managing gene lists. Users can upload their own lists or create them from the output of PLEXdb tools, and then apply diverse higher level analyses, such as ANOVA and clustering. PLEXdb also provides methods for users to track how gene expression changes across many different experiments using the Gene OscilloScope. This tool can identify interesting expression patterns, such as up-regulation under diverse conditions or checking any gene’s suitability as a steady-state control. PMID:22084198

  13. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

    PubMed Central

    Wang, Jianlin; Tian, Lu; Madlung, Andreas; Lee, Hyeon-Se; Chen, Meng; Lee, Jinsuk J; Watson, Brian; Kagochi, Trevor; Comai, Luca; Chen, Z Jeffrey


    Polyploidization is an abrupt speciation mechanism for eukaryotes and is especially common in plants. However, little is known about patterns and mechanisms of gene regulation during early stages of polyploid formation. Here we analyzed differential expression patterns of the progenitors' genes among successive selfing generations and independent lineages. The synthetic Arabidopsis allotetraploid lines were produced by a genetic cross between A. thaliana and A. arenosa autotetraploids. We found that some progenitors' genes are differentially expressed in early generations, whereas other genes are silenced in late generations or among different siblings within a selfing generation, suggesting that the silencing of progenitors' genes is rapidly and/or stochastically established. Moreover, a subset of genes is affected in autotetraploid and multiple independent allotetraploid lines and in A. suecica, a natural allotetraploid derived from A. thaliana and A. arenosa, indicating locus-specific susceptibility to ploidy-dependent gene regulation. The role of DNA methylation in silencing progenitors' genes is tested in DNA-hypomethylation transgenic lines of A. suecica using RNA interference (RNAi). Two silenced genes are reactivated in both ddm1- and met1-RNAi lines, consistent with the demethylation of centromeric repeats and gene-specific regions in the genome. A rapid and stochastic process of differential gene expression is reinforced by epigenetic regulation during polyploid formation and evolution. PMID:15342533

  14. Identification of Cancer Related Genes Using a Comprehensive Map of Human Gene Expression.


    Torrente, Aurora; Lukk, Margus; Xue, Vincent; Parkinson, Helen; Rung, Johan; Brazma, Alvis


    Rapid accumulation and availability of gene expression datasets in public repositories have enabled large-scale meta-analyses of combined data. The richness of cross-experiment data has provided new biological insights, including identification of new cancer genes. In this study, we compiled a human gene expression dataset from ∼40,000 publicly available Affymetrix HG-U133Plus2 arrays. After strict quality control and data normalisation the data was quantified in an expression matrix of ∼20,000 genes and ∼28,000 samples. To enable different ways of sample grouping, existing annotations where subjected to systematic ontology assisted categorisation and manual curation. Groups like normal tissues, neoplasmic tissues, cell lines, homoeotic cells and incompletely differentiated cells were created. Unsupervised analysis of the data confirmed global structure of expression consistent with earlier analysis but with more details revealed due to increased resolution. A suitable mixed-effects linear model was used to further investigate gene expression in solid tissue tumours, and to compare these with the respective healthy solid tissues. The analysis identified 1,285 genes with systematic expression change in cancer. The list is significantly enriched with known cancer genes from large, public, peer-reviewed databases, whereas the remaining ones are proposed as new cancer gene candidates. The compiled dataset is publicly available in the ArrayExpress Archive. It contains the most diverse collection of biological samples, making it the largest systematically annotated gene expression dataset of its kind in the public domain.

  15. Identification of Reference Genes in Human Myelomonocytic Cells for Gene Expression Studies in Altered Gravity

    PubMed Central

    Thiel, Cora S.; Hauschild, Swantje; Tauber, Svantje; Paulsen, Katrin; Raig, Christiane; Raem, Arnold; Biskup, Josefine; Gutewort, Annett; Hürlimann, Eva; Philpot, Claudia; Lier, Hartwin; Engelmann, Frank; Layer, Liliana E.


    Gene expression studies are indispensable for investigation and elucidation of molecular mechanisms. For the process of normalization, reference genes (“housekeeping genes”) are essential to verify gene expression analysis. Thus, it is assumed that these reference genes demonstrate similar expression levels over all experimental conditions. However, common recommendations about reference genes were established during 1 g conditions and therefore their applicability in studies with altered gravity has not been demonstrated yet. The microarray technology is frequently used to generate expression profiles under defined conditions and to determine the relative difference in expression levels between two or more different states. In our study, we searched for potential reference genes with stable expression during different gravitational conditions (microgravity, normogravity, and hypergravity) which are additionally not altered in different hardware systems. We were able to identify eight genes (ALB, B4GALT6, GAPDH, HMBS, YWHAZ, ABCA5, ABCA9, and ABCC1) which demonstrated no altered gene expression levels in all tested conditions and therefore represent good candidates for the standardization of gene expression studies in altered gravity. PMID:25654098

  16. Improved detection of differentially expressed genes through incorporation of gene locations.


    Xiao, Guanghua; Reilly, Cavan; Khodursky, Arkady B


    In determining differential expression in cDNA microarray experiments, the expression level of an individual gene is usually assumed to be independent of the expression levels of other genes, but many recent studies have shown that a gene's expression level tends to be similar to that of its neighbors on a chromosome, and differentially expressed (DE) genes are likely to form clusters of similar transcriptional activity along the chromosome. When modeled as a one-dimensional spatial series, the expression level of genes on the same chromosome frequently exhibit significant spatial correlation, reflecting spatial patterns in transcription. By modeling these spatial correlations, we can obtain improved estimates of transcript levels. Here, we demonstrate the existence of spatial correlations in transcriptional activity in the Escherichia coli (E. coli) chromosome across more than 50 experimental conditions. Based on this finding, we propose a hierarchical Bayesian model that borrows information from neighboring genes to improve the estimation of the expression level of a given gene and hence the detection of DE genes. Furthermore, we extend the model to account for the circular structure of E. coli chromosome and the intergenetic distance between gene neighbors. The simulation studies and analysis of real data examples in E. coli and yeast Saccharomyces cerevisiae show that the proposed method outperforms the commonly used significant analysis of microarray (SAM) t-statistic in detecting DE genes.

  17. All-optical regulation of gene expression in targeted cells

    NASA Astrophysics Data System (ADS)

    Wang, Yisen; He, Hao; Li, Shiyang; Liu, Dayong; Lan, Bei; Hu, Minglie; Cao, Youjia; Wang, Chingyue


    Controllable gene expression is always a challenge and of great significance to biomedical research and clinical applications. Recently, various approaches based on extra-engineered light-sensitive proteins have been developed to provide optogenetic actuators for gene expression. Complicated biomedical techniques including exogenous genes engineering, transfection, and material delivery are needed. Here we present an all-optical method to regulate gene expression in targeted cells. Intrinsic or exogenous genes can be activated by a Ca2+-sensitive transcription factor nuclear factor of activated T cells (NFAT) driven by a short flash of femtosecond-laser irradiation. When applied to mesenchymal stem cells, expression of a differentiation regulator Osterix can be activated by this method to potentially induce differentiation of them. A laser-induced ``Ca2+-comb'' (LiCCo) by multi-time laser exposure is further developed to enhance gene expression efficiency. This noninvasive method hence provides an encouraging advance of gene expression regulation, with promising potential of applying in cell biology and stem-cell science.

  18. Aberrant expression of homeobox gene SIX1 in Hodgkin lymphoma

    PubMed Central

    Nagel, Stefan; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G.; MacLeod, Roderick A.F.


    In Hodgkin lymphoma (HL) we recently identified deregulated expression of homeobox genes MSX1 and OTX2 which are physiologically involved in development of the embryonal neural plate border region. Here, we examined in HL homeobox gene SIX1 an additional regulator of this embryonal region mediating differentiation of placodal precursors. SIX1 was aberrantly activated in 12 % of HL patient samples in silico, indicating a pathological role in a subset of this B-cell malignancy. In addition, SIX1 expression was detected in HL cell lines which were used as models to reveal upstream factors and target genes of this basic developmental regulator. We detected increased copy numbers of the SIX1 locus at chromosome 14q23 correlating with enhanced expression while chromosomal translocations were absent. Moreover, comparative expression profiling data and pertinent gene modulation experiments indicated that the WNT-signalling pathway and transcription factor MEF2C regulate SIX1 expression. Genes encoding the transcription factors GATA2, GATA3, MSX1 and SPIB – all basic lymphoid regulators - were identified as targets of SIX1 in HL. In addition, cofactors EYA1 and TLE4, respectively, contrastingly mediated activation and suppression of SIX1 target gene expression. Thus, the protein domain interfaces may represent therapeutic targets in SIX1-positive HL subsets. Collectively, our data reveal a gene regulatory network with SIX1 centrally deregulating lymphoid differentiation and support concordance of lymphopoiesis/lymphomagenesis and developmental processes in the neural plate border region. PMID:26473286

  19. Global Gene Expression Analysis for the Assessment of Nanobiomaterials.


    Hanagata, Nobutaka


    Using global gene expression analysis, the effects of biomaterials and nanomaterials can be analyzed at the genetic level. Even though information obtained from global gene expression analysis can be useful for the evaluation and design of biomaterials and nanomaterials, its use for these purposes is not widespread. This is due to the difficulties involved in data analysis. Because the expression data of about 20,000 genes can be obtained at once with global gene expression analysis, the data must be analyzed using bioinformatics. A method of bioinformatic analysis called gene ontology can estimate the kinds of changes on cell functions caused by genes whose expression level is changed by biomaterials and nanomaterials. Also, by applying a statistical analysis technique called hierarchical clustering to global gene expression data between a variety of biomaterials, the effects of the properties of materials on cell functions can be estimated. In this chapter, these theories of analysis and examples of applications to nanomaterials and biomaterials are described. Furthermore, global microRNA analysis, a method that has gained attention in recent years, and its application to nanomaterials are introduced.

  20. Sleep and wakefulness modulate gene expression in Drosophila.


    Cirelli, Chiara; LaVaute, Timothy M; Tononi, Giulio


    In the mammalian brain, sleep and wakefulness are associated with widespread changes in gene expression. Sleep in fruit flies shares many features with mammalian sleep, but it is currently unknown to what extent behavioral states affect gene expression in Drosophila. To find out, we performed a comprehensive microarray analysis of gene expression in spontaneously awake, sleep-deprived and sleeping flies. Fly heads were collected at 4 am, after 8 h of spontaneous sleep or sleep deprivation, and at 4 pm, after 8 h of spontaneous wakefulness. As in rats, we found that behavioral state and time of day affect Drosophila gene expression to a comparable extent. As in rats, transcripts with higher expression in wakefulness and in sleep belong to different functional categories, and in several cases these groups overlap with those previously identified in rats. Wakefulness-related genes code for transcription factors and for proteins involved in the stress response, immune response, glutamatergic transmission, and carbohydrate metabolism. Sleep-related transcripts include the glial gene anachronism and several genes involved in lipid metabolism. Finally, the expression of many wakefulness-related and sleep-related Drosophila transcripts is also modulated by the time of day, suggesting an interaction at the molecular level between circadian and homeostatic mechanism of sleep regulation.

  1. Regulation of NKG2D ligand gene expression.


    Eagle, Robert A; Traherne, James A; Ashiru, Omodele; Wills, Mark R; Trowsdale, John


    The activating immunoreceptor NKG2D has seven known host ligands encoded by the MHC class I chain-related MIC and ULBP/RAET genes. Why there is such diversity of NKG2D ligands is not known but one hypothesis is that they are differentially expressed in different tissues in response to different stresses. To explore this, we compared expression patterns and promoters of NKG2D ligand genes. ULBP/RAET genes were transcribed independent of each other in a panel of cell lines. ULBP/RAET gene expression was upregulated on infection with human cytomegalovirus; however, a clinical strain, Toledo, induced expression more slowly than did a laboratory strain, AD169. ULBP4/RAET1E was not induced by infection with either strain. To investigate the mechanisms behind the similarities and differences in NKG2D ligand gene expression a comparative sequence analysis of NKG2D ligand gene putative promoter regions was conducted. Sequence alignments demonstrated that there was significant sequence diversity; however, one region of high similarity between most of the genes is evident. This region contains a number of potential transcription factor binding sites, including those involved in shock responses and sites for retinoic acid-induced factors. Promoters of some NKG2D ligand genes are polymorphic and several sequence alterations in these alleles abolished putative transcription factor binding.

  2. EXCAVATOR: a computer program for efficiently mining gene expression data.


    Xu, Dong; Olman, Victor; Wang, Li; Xu, Ying


    Massive amounts of gene expression data are generated using microarrays for functional studies of genes and gene expression data clustering is a useful tool for studying the functional relationship among genes in a biological process. We have developed a computer package EXCAVATOR for clustering gene expression profiles based on our new framework for representing gene expression data as a minimum spanning tree. EXCAVATOR uses a number of rigorous and efficient clustering algorithms. This program has a number of unique features, including capabilities for: (i) data- constrained clustering; (ii) identification of genes with similar expression profiles to pre-specified seed genes; (iii) cluster identification from a noisy background; (iv) computational comparison between different clustering results of the same data set. EXCAVATOR can be run from a Unix/Linux/DOS shell, from a Java interface or from a Web server. The clustering results can be visualized as colored figures and 2-dimensional plots. Moreover, EXCAVATOR provides a wide range of options for data formats, distance measures, objective functions, clustering algorithms, methods to choose number of clusters, etc. The effectiveness of EXCAVATOR has been demonstrated on several experimental data sets. Its performance compares favorably against the popular K-means clustering method in terms of clustering quality and computing time.

  3. GESearch: An Interactive GUI Tool for Identifying Gene Expression Signature.


    Ye, Ning; Yin, Hengfu; Liu, Jingjing; Dai, Xiaogang; Yin, Tongming


    The huge amount of gene expression data generated by microarray and next-generation sequencing technologies present challenges to exploit their biological meanings. When searching for the coexpression genes, the data mining process is largely affected by selection of algorithms. Thus, it is highly desirable to provide multiple options of algorithms in the user-friendly analytical toolkit to explore the gene expression signatures. For this purpose, we developed GESearch, an interactive graphical user interface (GUI) toolkit, which is written in MATLAB and supports a variety of gene expression data files. This analytical toolkit provides four models, including the mean, the regression, the delegate, and the ensemble models, to identify the coexpression genes, and enables the users to filter data and to select gene expression patterns by browsing the display window or by importing knowledge-based genes. Subsequently, the utility of this analytical toolkit is demonstrated by analyzing two sets of real-life microarray datasets from cell-cycle experiments. Overall, we have developed an interactive GUI toolkit that allows for choosing multiple algorithms for analyzing the gene expression signatures.

  4. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy


    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  5. Imprinted gene expression in fetal growth and development.


    Lambertini, L; Marsit, C J; Sharma, P; Maccani, M; Ma, Y; Hu, J; Chen, J


    Experimental studies showed that genomic imprinting is fundamental in fetoplacental development by timely regulating the expression of the imprinted genes to overlook a set of events determining placenta implantation, growth and embryogenesis. We examined the expression profile of 22 imprinted genes which have been linked to pregnancy abnormalities that may ultimately influence childhood development. The study was conducted in a subset of 106 placenta samples, overrepresented with small and large for gestational age cases, from the Rhode Island Child Health Study. We investigated associations between imprinted gene expression and three fetal development parameters: newborn head circumference, birth weight, and size for gestational age. Results from our investigation show that the maternally imprinted/paternally expressed gene ZNF331 inversely associates with each parameter to drive smaller fetal size, while paternally imprinted/maternally expressed gene SLC22A18 directly associates with the newborn head circumference promoting growth. Multidimensional Scaling analysis revealed two clusters within the 22 imprinted genes which are independently associated with fetoplacental development. Our data suggest that cluster 1 genes work by assuring cell growth and tissue development, while cluster 2 genes act by coordinating these processes. Results from this epidemiologic study offer solid support for the key role of imprinting in fetoplacental development.

  6. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo


    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  7. Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)

    USGS Publications Warehouse

    Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.


    Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.

  8. Noncytopathic Sindbis virus RNA vectors for heterologous gene expression

    PubMed Central

    Agapov, Eugene V.; Frolov, Ilya; Lindenbach, Brett D.; Prágai, Béla M.; Schlesinger, Sondra; Rice, Charles M.


    Infection of vertebrate cells with alphaviruses normally leads to prodigious expression of virus-encoded genes and a dramatic inhibition of host protein synthesis. Recombinant Sindbis viruses and replicons have been useful as vectors for high level foreign gene expression, but the cytopathic effects of viral replication have limited their use to transient studies. We recently selected Sindbis replicons capable of persistent, noncytopathic growth in BHK cells and describe here a new generation of Sindbis vectors useful for long-term foreign gene expression based on such replicons. Foreign genes of interest as well as the dominant selectable marker puromycin N-acteyltransferase, which confers resistance to the drug puromycin, were expressed as subgenomic transcripts of noncytopathic replicons or defective-interfering genomes complemented in trans by a replicon. Based on these strategies, we developed vectors that can be initiated via either RNA or DNA transfection and analyzed them for their level and stability of foreign gene expression. Noncytopathic Sindbis vectors express reasonably high levels of protein in nearly every cell. These vectors should prove to be flexible tools for the rapid expression of heterologous genes under conditions in which cellular metabolism is not perturbed, and we illustrate their utility with a number of foreign proteins. PMID:9789028

  9. Extreme changes to gene expression associated with homoploid hybrid speciation.


    Hegarty, Matthew J; Barker, Gary L; Brennan, Adrian C; Edwards, Keith J; Abbott, Richard J; Hiscock, Simon J


    Hybridization is an important cause of abrupt speciation. Hybrid speciation without a change in ploidy (homoploid hybrid speciation) is well-established in plants but has also been reported in animals and fungi. A notable example of recent homoploid hybrid speciation is Senecio squalidus (Oxford ragwort), which originated in the UK in the 18th Century following introduction of hybrid material from a hybrid zone between S. chrysanthemifolius and S. aethnensis on Mount Etna, Sicily. To investigate genetic divergence between these taxa, we used complementary DNA microarrays to compare patterns of floral gene expression. These analyses revealed major differences in gene expression between the parent species and wild and resynthesized S. squalidus. Comparisons of gene expression between S. aethnensis, S. chrysanthemifolius and natural S. squalidus identified genes potentially involved in local environmental adaptation. The analysis also revealed non-additive patterns of gene expression in the hybrid relative to its progenitors. These expression changes were more dramatic and widespread in resynthesized hybrids than in natural S. squalidus, suggesting that a unique expression pattern may have been fixed during the allopatric divergence of British S. squalidus. We speculate that hybridization-induced gene-expression change may provide an immediate source of novel phenotypic variation upon which selection can act to facilitate homoploid hybrid speciation in plants.

  10. Sex-Biased Gene Expression and Sexual Conflict throughout Development

    PubMed Central

    Ingleby, Fiona C.; Flis, Ilona; Morrow, Edward H.


    Sex-biased gene expression is likely to account for most sexually dimorphic traits because males and females share much of their genome. When fitness optima differ between sexes for a shared trait, sexual dimorphism can allow each sex to express their optimum trait phenotype, and in this way, the evolution of sex-biased gene expression is one mechanism that could help to resolve intralocus sexual conflict. Genome-wide patterns of sex-biased gene expression have been identified in a number of studies, which we review here. However, very little is known about how sex-biased gene expression relates to sex-specific fitness and about how sex-biased gene expression and conflict vary throughout development or across different genotypes, populations, and environments. We discuss the importance of these neglected areas of research and use data from a small-scale experiment on sex-specific expression of genes throughout development to highlight potentially interesting avenues for future research. PMID:25376837

  11. Identification of optimal housekeeping genes for examination of gene expression in bovine corpus luteum.


    Rekawiecki, Robert; Rutkowska, Joanna; Kotwica, Jan


    The selection of proper housekeeping genes for studies requiring genes expression normalization is an important step in the appropriate interpretation of results. The expression of housekeeping genes is regulated by many factors including age, gender, type of tissue or disease. The aim of the study was to identify optimal housekeeping genes in the corpus luteum obtained from cyclic or pregnant cows. The mRNA expression of thirteen housekeeping genes: C2orf29, SUZ12, TBP, TUBB2B, ZNF131, HPRT1, 18s RNA, GAPDH, SF3A1, SDHA, MRPL12, B2M and ACTB was measured by Real-time PCR. Range of cycle threshold (C(t)) values of the tested genes varied between 12 and 30 cycles, and 18s RNA had the highest coefficient of variation, whereas C2orf29 had the smallest coefficient. GeNorm software demonstrated C2orf29 and TBP as the most stable and 18s RNA and B2M as the most unstable housekeeping genes. Using the proposed cut-off value (0.15), no more than two of the best GeNorm housekeeping genes are proposed to be used in studies requiring gene expression normalization. NormFinder software demonstrated C2orf29 and SUZ12 as the best and 18s RNA and B2M as the worst housekeeping genes. The study indicates that selection of housekeeping genes may essentially affect the quality of the gene expression results.

  12. Structure and expression of ubiquitin genes of Drosophila melanogaster.

    PubMed Central

    Lee, H S; Simon, J A; Lis, J T


    We isolated and characterized two related ubiquitin genes from Drosophila melanogaster, polyubiquitin and UB3-D. The polyubiquitin gene contained 18 repeats of the 228-base-pair monomeric ubiquitin-encoding unit arranged in tandem. This gene was localized to a minor heat shock puff site, 63F, and it encoded a constitutively expressed 4.4-kilobase polyubiquitin-encoding mRNA, whose level was induced threefold by heat shock. To investigate the pattern of expression of the polyubiquitin gene in developing animals, a polyubiquitin-lacZ fusion gene was introduced into the Drosophila genome by germ line transformation. The fusion gene was expressed at high levels in a tissue-general manner at all life stages assayed. The ubiquitin-encoding gene, UB3-D, consisted of one ubiquitin-encoding unit directly fused, in frame, to a nonhomologous tail sequence. The amino acid sequence of the tail portion of the protein had 65% positional identity with that of yeast UBI3 protein, including a region that contained a potential nucleic acid-binding motif. The Drosophila UB3-D gene hybridized to a 0.9-kilobase mRNA that was constitutively expressed, and in contrast to the polyubiquitin gene, it was not inducible by heat shock. Images PMID:2463465

  13. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold


    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  14. Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; Peyvan, Kia; Karouia, Fathi; Ricco, Antonio


    The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with

  15. Splice variants and seasonal expression of buffalo HSF genes.


    Lal, Shardul Vikram; Brahma, Biswajit; Gohain, Moloya; Mohanta, Debashish; De, Bidan Chandra; Chopra, Meenu; Dass, Gulshan; Vats, Ashutosh; Upadhyay, Ramesh C; Datta, T K; De, Sachinandan


    In eukaryotes, the heat shock factors (HSFs) are recognized as the master regulator of the heat shock response. In this respect, the genes encoding the heat shock factors seem to be important for adaptation to thermal stress in organisms. Despite this, only few mammalian HSFs has been characterized. In this study, four major heat shock factor genes viz. HSF-1, 2, 4, and 5 were studied. The main objective of the present study was to characterize the cDNA encoding using conserved gene specific primers and to investigate the expression status of these buffalo HSF genes. Our RT-PCR analysis uncovered two distinct variants of buffalo HSF-1 and HSF-2 gene transcripts. In addition, we identified a variant of the HSF5 transcript in buffalo lacking a DNA-binding domain. In silico analysis of deduced amino acid sequences for buffalo HSF genes showed domain architecture similar to other mammalian species. Changes in the gene expression profile were noted by quantitative real-time PCR (qRT-PCR) analysis. We detected the transcript of buffalo HSF genes in different tissues. We also evaluated the seasonal changes in the expression of HSF genes. Interestingly, the transcript level of HSF-1 gene was found upregulated in months of high and low ambient temperatures. In contrast, the expression of the HSF-4 and 5 genes was found to be downregulated in months of high ambient temperature. This suggests that the intricate balance of different HSFs is adjusted to minimize the effect of seasonal changes in environmental conditions. These findings advance our understanding of the complex, context-dependent regulation of HSF gene expression under normal and stressful conditions.

  16. Identification of Haemophilus ducreyi genes expressed during human infection.


    Bauer, Margaret E; Fortney, Kate R; Harrison, Alistair; Janowicz, Diane M; Munson, Robert S; Spinola, Stanley M


    To identify Haemophilus ducreyi transcripts that are expressed during human infection, we used selective capture of transcribed sequences (SCOTS) with RNA isolated from pustules obtained from three volunteers infected with H. ducreyi, and with RNA isolated from broth-grown bacteria used to infect volunteers. With SCOTS, competitive hybridization of tissue-derived and broth-derived sequences identifies genes that may be preferentially expressed in vivo. Among the three tissue specimens, we identified 531 genes expressed in vivo. Southern blot analysis of 60 genes from each tissue showed that 87 % of the identified genes hybridized better with cDNA derived from tissue specimens than with cDNA derived from broth-grown bacteria. RT-PCR on nine additional pustules confirmed in vivo expression of 10 of 11 selected genes in other volunteers. Of the 531 genes, 139 were identified in at least two volunteers. These 139 genes fell into several functional categories, including biosynthesis and metabolism, regulation, and cellular processes, such as transcription, translation, cell division, DNA replication and repair, and transport. Detection of genes involved in anaerobic and aerobic respiration indicated that H. ducreyi likely encounters both microenvironments within the pustule. Other genes detected suggest an increase in DNA damage and stress in vivo. Genes involved in virulence in other bacterial pathogens and 32 genes encoding hypothetical proteins were identified, and may represent novel virulence factors. We identified three genes, lspA1, lspA2 and tadA, known to be required for virulence in humans. This is the first study to broadly define transcripts expressed by H. ducreyi in humans.

  17. Risk analysis of colorectal cancer incidence by gene expression analysis

    PubMed Central

    Shangkuan, Wei-Chuan; Lin, Hung-Che; Chang, Yu-Tien; Jian, Chen-En; Fan, Hueng-Chuen; Chen, Kang-Hua; Liu, Ya-Fang; Hsu, Huan-Ming; Chou, Hsiu-Ling; Yao, Chung-Tay


    Background Colorectal cancer (CRC) is one of the leading cancers worldwide. Several studies have performed microarray data analyses for cancer classification and prognostic analyses. Microarray assays also enable the identification of gene signatures for molecular characterization and treatment prediction. Objective Microarray gene expression data from the online Gene Expression Omnibus (GEO) database were used to to distinguish colorectal cancer from normal colon tissue samples. Methods We collected microarray data from the GEO database to establish colorectal cancer microarray gene expression datasets for a combined analysis. Using the Prediction Analysis for Microarrays (PAM) method and the GSEA MSigDB resource, we analyzed the 14,698 genes that were identified through an examination of their expression values between normal and tumor tissues. Results Ten genes (ABCG2, AQP8, SPIB, CA7, CLDN8, SCNN1B, SLC30A10, CD177, PADI2, and TGFBI) were found to be good indicators of the candidate genes that correlate with CRC. From these selected genes, an average of six significant genes were obtained using the PAM method, with an accuracy rate of 95%. The results demonstrate the potential of utilizing a model with the PAM method for data mining. After a detailed review of the published reports, the results confirmed that the screened candidate genes are good indicators for cancer risk analysis using the PAM method. Conclusions Six genes were selected with 95% accuracy to effectively classify normal and colorectal cancer tissues. We hope that these results will provide the basis for new research projects in clinical practice that aim to rapidly assess colorectal cancer risk using microarray gene expression analysis. PMID:28229027

  18. Pervasive Effects of Aging on Gene Expression in Wild Wolves.


    Charruau, Pauline; Johnston, Rachel A; Stahler, Daniel R; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W; vonHoldt, Bridgett M; Cole, Steven W; Tung, Jenny; Wayne, Robert K


    Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species' high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging.

  19. Multiscale Embedded Gene Co-expression Network Analysis

    PubMed Central

    Song, Won-Min; Zhang, Bin


    Gene co-expression network analysis has been shown effective in identifying functional co-expressed gene modules associated with complex human diseases. However, existing techniques to construct co-expression networks require some critical prior information such as predefined number of clusters, numerical thresholds for defining co-expression/interaction, or do not naturally reproduce the hallmarks of complex systems such as the scale-free degree distribution of small-worldness. Previously, a graph filtering technique called Planar Maximally Filtered Graph (PMFG) has been applied to many real-world data sets such as financial stock prices and gene expression to extract meaningful and relevant interactions. However, PMFG is not suitable for large-scale genomic data due to several drawbacks, such as the high computation complexity O(|V|3), the presence of false-positives due to the maximal planarity constraint, and the inadequacy of the clustering framework. Here, we developed a new co-expression network analysis framework called Multiscale Embedded Gene Co-expression Network Analysis (MEGENA) by: i) introducing quality control of co-expression similarities, ii) parallelizing embedded network construction, and iii) developing a novel clustering technique to identify multi-scale clustering structures in Planar Filtered Networks (PFNs). We applied MEGENA to a series of simulated data and the gene expression data in breast carcinoma and lung adenocarcinoma from The Cancer Genome Atlas (TCGA). MEGENA showed improved performance over well-established clustering methods and co-expression network construction approaches. MEGENA revealed not only meaningful multi-scale organizations of co-expressed gene clusters but also novel targets in breast carcinoma and lung adenocarcinoma. PMID:26618778

  20. DAWN: a framework to identify autism genes and subnetworks using gene expression and genetics

    PubMed Central


    Background De novo loss-of-function (dnLoF) mutations are found twofold more often in autism spectrum disorder (ASD) probands than their unaffected siblings. Multiple independent dnLoF mutations in the same gene implicate the gene in risk and hence provide a systematic, albeit arduous, path forward for ASD genetics. It is likely that using additional non-genetic data will enhance the ability to identify ASD genes. Methods To accelerate the search for ASD genes, we developed a novel algorithm, DAWN, to model two kinds of data: rare variations from exome sequencing and gene co-expression in the mid-fetal prefrontal and motor-somatosensory neocortex, a critical nexus for risk. The algorithm casts the ensemble data as a hidden Markov random field in which the graph structure is determined by gene co-expression and it combines these interrelationships with node-specific observations, namely gene identity, expression, genetic data and the estimated effect on risk. Results Using currently available genetic data and a specific developmental time period for gene co-expression, DAWN identified 127 genes that plausibly affect risk, and a set of likely ASD subnetworks. Validation experiments making use of published targeted resequencing results demonstrate its efficacy in reliably predicting ASD genes. DAWN also successfully predicts known ASD genes, not included in the genetic data used to create the model. Conclusions Validation studies demonstrate that DAWN is effective in predicting ASD genes and subnetworks by leveraging genetic and gene expression data. The findings reported here implicate neurite extension and neuronal arborization as risks for ASD. Using DAWN on emerging ASD sequence data and gene expression data from other brain regions and tissues would likely identify novel ASD genes. DAWN can also be used for other complex disorders to identify genes and subnetworks in those disorders. PMID:24602502

  1. Visually Relating Gene Expression and in vivo DNA Binding Data

    SciTech Connect

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd


    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  2. Regulation of gene expression in the nervous system

    SciTech Connect

    Stella, A.M.G. ); de Vellis, J. ); Perez-Polo, J.R. 62230.


    This book covers subjects under the following topics: Plenary Lecture; Growth factors; Regulation of gene expression in neurons; Cell adhesion molecules and development; Nervous tissue reaction to injury-aging; and Poster presentation.

  3. A genomics approach identifies senescence-specific gene expression regulation

    PubMed Central

    Lackner, Daniel H; Hayashi, Makoto T; Cesare, Anthony J; Karlseder, Jan


    Replicative senescence is a fundamental tumor-suppressive mechanism triggered by telomere erosion that results in a permanent cell cycle arrest. To understand the impact of telomere shortening on gene expression, we analyzed the transcriptome of diploid human fibroblasts as they progressed toward and entered into senescence. We distinguished novel transcription regulation due to replicative senescence by comparing senescence-specific expression profiles to profiles from cells arrested by DNA damage or serum starvation. Only a small specific subset of genes was identified that was truly senescence-regulated and changes in gene expression were exacerbated from presenescent to senescent cells. The majority of gene expression regulation in replicative senescence was shown to occur due to telomere shortening, as exogenous telomerase activity reverted most of these changes. PMID:24863242

  4. Complex roles of Stat1 in regulating gene expression.


    Ramana, C V; Chatterjee-Kishore, M; Nguyen, H; Stark, G R


    Stat1 is a fascinating and complex protein with multiple, yet contrasting transcriptional functions. Upon activation, it drives the expression of many genes but also suppresses the transcription of others. These opposing characteristics also apply to its role in facilitating crosstalk between signal transduction pathways, as it participates in both synergistic activation and inhibition of gene expression. Stat1 is a functional transcription factor even in the absence of inducer-mediated activation, participating in the constitutive expression of some genes. This review summarizes the well studied involvement of Stat1 in IFN-dependent and growth factor-dependent signaling and then describes the roles of Stat1 in positive, negative and constitutive regulation of gene expression as well as its participation in crosstalk between signal transduction pathways. Oncogene (2000).

  5. Gene expression defines natural changes in mammalian lifespan

    PubMed Central

    Fushan, Alexey A; Turanov, Anton A; Lee, Sang-Goo; Kim, Eun Bae; Lobanov, Alexei V; Yim, Sun Hee; Buffenstein, Rochelle; Lee, Sang-Rae; Chang, Kyu-Tae; Rhee, Hwanseok; Kim, Jong-So; Yang, Kap-Seok; Gladyshev, Vadim N


    Mammals differ more than 100-fold in maximum lifespan, which can be altered in either direction during evolution, but the molecular basis for natural changes in longevity is not understood. Divergent evolution of mammals also led to extensive changes in gene expression within and between lineages. To understand the relationship between lifespan and variation in gene expression, we carried out RNA-seq-based gene expression analyses of liver, kidney, and brain of 33 diverse species of mammals. Our analysis uncovered parallel evolution of gene expression and lifespan, as well as the associated life-history traits, and identified the processes and pathways involved. These findings provide direct insights into how nature reversibly adjusts lifespan and other traits during adaptive radiation of lineages. PMID:25677554

  6. A genomics approach identifies senescence-specific gene expression regulation.


    Lackner, Daniel H; Hayashi, Makoto T; Cesare, Anthony J; Karlseder, Jan


    Replicative senescence is a fundamental tumor-suppressive mechanism triggered by telomere erosion that results in a permanent cell cycle arrest. To understand the impact of telomere shortening on gene expression, we analyzed the transcriptome of diploid human fibroblasts as they progressed toward and entered into senescence. We distinguished novel transcription regulation due to replicative senescence by comparing senescence-specific expression profiles to profiles from cells arrested by DNA damage or serum starvation. Only a small specific subset of genes was identified that was truly senescence-regulated and changes in gene expression were exacerbated from presenescent to senescent cells. The majority of gene expression regulation in replicative senescence was shown to occur due to telomere shortening, as exogenous telomerase activity reverted most of these changes.


    EPA Science Inventory



    David J. Dix. National Health and Environmental Effects Research Laboratory, Office of Research and Development, US Environmental Protection Agency, Research Triangle...

  8. HTLV Tax gene expression in patients with lymphoproliferative disorders.

    PubMed Central

    Cardoso, E A; Miranda, N; Gameiro, P; Frade, M J; Figueiredo, M; Parreira, A


    AIMS: To study the expression of the human T lymphotropic virus (HTLV) Tax gene in peripheral blood mononuclear cells. METHODS: Blood was collected from 72 patients with lymphoproliferative disorders. Serum from all patients was assayed for antibodies directed against HTLV-I structural proteins by ELISA and western blotting. RNA was purified from fresh blood cells and amplified by reverse transcription polymerase chain reaction (RT-PCR). After Southern blotting, the PCR products were hybridised with a 32P end-labelled probe specific for the Tax gene. RESULTS: All samples were seronegative. A specific band for the Tax gene was found in five samples. Each of the patients positive for Tax gene expression had a different type of lymphoproliferative disorder. CONCLUSIONS: Infection by HTLV-I cannot be assessed solely by immunological assays, particularly when only disrupted virions are used. Sensitive molecular biology assays are essential for detecting viral gene expression in fresh blood cells. Images PMID:8944616

  9. Expression of streptavidin gene in bacteria and plants

    SciTech Connect

    Guan, Xueni; Wurtele, E.S.; Nikolau, B.J. )


    Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot.

  10. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses.


    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu


    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  11. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J


    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  12. Expression of a human placental alkaline phosphatase gene in transfected cells: Use as a reporter for studies of gene expression

    SciTech Connect

    Henthorn, P.; Zervos, P.; Raducha, M.; Harris, H.; Kadesch, T.


    The human placental alkaline phosphatase gene has been cloned and reintroduced into mammalian cells. When a plasmid carrying the gene under control of the simian virus 40 early promoter (pSV2Apap) is transfected into a variety of different cell types, placental alkaline phosphatase activity can readily be detected by using whole cell suspensions or cell lysates. Alkaline phosphatase activity can also be visualized directly in individual transfected cells by histochemical staining. The gene is appropriate for use as a reporter in studies of gene regulation since its expression is dependent on the presence of exogenous transcription control elements. The overall assay to detect the expression of the gene is quantitative, very rapid, and inexpensive. Cotransfections of cells with pSV2Apap and a related plasmid carrying the bacterial chloramphenicol acetyltransferase gene (pSV2Acat) indicate that transcription of these two genes is detected with roughly the same sensitivity.

  13. Identifying suitable reference genes for gene expression analysis in developing skeletal muscle in pigs

    PubMed Central

    Zhang, YuanYuan; Hua, Chaoju; Wang, Zishuai; Li, Kui


    The selection of suitable reference genes is crucial to accurately evaluate and normalize the relative expression level of target genes for gene function analysis. However, commonly used reference genes have variable expression levels in developing skeletal muscle. There are few reports that systematically evaluate the expression stability of reference genes across prenatal and postnatal developing skeletal muscle in mammals. Here, we used quantitative PCR to examine the expression levels of 15 candidate reference genes (ACTB, GAPDH, RNF7, RHOA, RPS18, RPL32, PPIA, H3F3, API5, B2M, AP1S1, DRAP1, TBP, WSB, and VAPB) in porcine skeletal muscle at 26 different developmental stages (15 prenatal and 11 postnatal periods). We evaluated gene expression stability using the computer algorithms geNorm, NormFinder, and BestKeeper. Our results indicated that GAPDH and ACTB had the greatest variability among the candidate genes across prenatal and postnatal stages of skeletal muscle development. RPS18, API5, and VAPB had stable expression levels in prenatal stages, whereas API5, RPS18, RPL32, and H3F3 had stable expression levels in postnatal stages. API5 and H3F3 expression levels had the greatest stability in all tested prenatal and postnatal stages, and were the most appropriate reference genes for gene expression normalization in developing skeletal muscle. Our data provide valuable information for gene expression analysis during different stages of skeletal muscle development in mammals. This information can provide a valuable guide for the analysis of human diseases. PMID:27994956

  14. Identifying suitable reference genes for gene expression analysis in developing skeletal muscle in pigs.


    Niu, Guanglin; Yang, Yalan; Zhang, YuanYuan; Hua, Chaoju; Wang, Zishuai; Tang, Zhonglin; Li, Kui


    The selection of suitable reference genes is crucial to accurately evaluate and normalize the relative expression level of target genes for gene function analysis. However, commonly used reference genes have variable expression levels in developing skeletal muscle. There are few reports that systematically evaluate the expression stability of reference genes across prenatal and postnatal developing skeletal muscle in mammals. Here, we used quantitative PCR to examine the expression levels of 15 candidate reference genes (ACTB, GAPDH, RNF7, RHOA, RPS18, RPL32, PPIA, H3F3, API5, B2M, AP1S1, DRAP1, TBP, WSB, and VAPB) in porcine skeletal muscle at 26 different developmental stages (15 prenatal and 11 postnatal periods). We evaluated gene expression stability using the computer algorithms geNorm, NormFinder, and BestKeeper. Our results indicated that GAPDH and ACTB had the greatest variability among the candidate genes across prenatal and postnatal stages of skeletal muscle development. RPS18, API5, and VAPB had stable expression levels in prenatal stages, whereas API5, RPS18, RPL32, and H3F3 had stable expression levels in postnatal stages. API5 and H3F3 expression levels had the greatest stability in all tested prenatal and postnatal stages, and were the most appropriate reference genes for gene expression normalization in developing skeletal muscle. Our data provide valuable information for gene expression analysis during different stages of skeletal muscle development in mammals. This information can provide a valuable guide for the analysis of human diseases.

  15. Visual sensitivities tuned by heterochronic shifts in opsin gene expression

    PubMed Central

    Carleton, Karen L; Spady, Tyrone C; Streelman, J Todd; Kidd, Michael R; McFarland, William N; Loew, Ellis R


    Background Cichlid fishes have radiated into hundreds of species in the Great Lakes of Africa. Brightly colored males display on leks and vie to be chosen by females as mates. Strong discrimination by females causes differential male mating success, rapid evolution of male color patterns and, possibly, speciation. In addition to differences in color pattern, Lake Malawi cichlids also show some of the largest known shifts in visual sensitivity among closely related species. These shifts result from modulated expression of seven cone opsin genes. However, the mechanisms for this modulated expression are unknown. Results In this work, we ask whether these differences might result from changes in developmental patterning of cone opsin genes. To test this, we compared the developmental pattern of cone opsin gene expression of the Nile tilapia, Oreochromis niloticus, with that of several cichlid species from Lake Malawi. In tilapia, quantitative polymerase chain reaction showed that opsin gene expression changes dynamically from a larval gene set through a juvenile set to a final adult set. In contrast, Lake Malawi species showed one of two developmental patterns. In some species, the expressed gene set changes slowly, either retaining the larval pattern or progressing only from larval to juvenile gene sets (neoteny). In the other species, the same genes are expressed in both larvae and adults but correspond to the tilapia adult genes (direct development). Conclusion Differences in visual sensitivities among species of Lake Malawi cichlids arise through heterochronic shifts relative to the ontogenetic pattern of the tilapia outgroup. Heterochrony has previously been shown to be a powerful mechanism for change in morphological evolution. We found that altering developmental expression patterns is also an important mechanism for altering sensory systems. These resulting sensory shifts will have major impacts on visual communication and could help drive cichlid speciation

  16. Equivalent Gene Expression Profiles between Glatopa™ and Copaxone®

    PubMed Central

    D’Alessandro, Josephine S.; Duffner, Jay; Pradines, Joel; Capila, Ishan; Garofalo, Kevin; Kaundinya, Ganesh; Greenberg, Benjamin M.; Kantor, Daniel; Ganguly, Tanmoy C.


    Glatopa™ is a generic glatiramer acetate recently approved for the treatment of patients with relapsing forms of multiple sclerosis. Gene expression profiling was performed as a means to evaluate equivalence of Glatopa and Copaxone®. Microarray analysis containing 39,429 unique probes across the entire genome was performed in murine glatiramer acetate—responsive Th2-polarized T cells, a test system highly relevant to the biology of glatiramer acetate. A closely related but nonequivalent glatiramoid molecule was used as a control to establish assay sensitivity. Multiple probe-level (Student’s t-test) and sample-level (principal component analysis, multidimensional scaling, and hierarchical clustering) statistical analyses were utilized to look for differences in gene expression induced by the test articles. The analyses were conducted across all genes measured, as well as across a subset of genes that were shown to be modulated by Copaxone. The following observations were made across multiple statistical analyses: the expression of numerous genes was significantly changed by treatment with Copaxone when compared against media-only control; gene expression profiles induced by Copaxone and Glatopa were not significantly different; and gene expression profiles induced by Copaxone and the nonequivalent glatiramoid were significantly different, underscoring the sensitivity of the test system and the multiple analysis methods. Comparative analysis was also performed on sets of transcripts relevant to T-cell biology and antigen presentation, among others that are known to be modulated by glatiramer acetate. No statistically significant differences were observed between Copaxone and Glatopa in the expression levels (magnitude and direction) of these glatiramer acetate-regulated genes. In conclusion, multiple methods consistently supported equivalent gene expression profiles between Copaxone and Glatopa. PMID:26473741

  17. Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.


    We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.

  18. On the robustness of complex heterogeneous gene expression networks.


    Gómez-Gardeñes, Jesús; Moreno, Yamir; Floría, Luis M


    We analyze a continuous gene expression model on the underlying topology of a complex heterogeneous network. Numerical simulations aimed at studying the chaotic and periodic dynamics of the model are performed. The results clearly indicate that there is a region in which the dynamical and structural complexity of the system avoid chaotic attractors. However, contrary to what has been reported for Random Boolean Networks, the chaotic phase cannot be completely suppressed, which has important bearings on network robustness and gene expression modeling.

  19. Gene Expression Profiling during Pregnancy in Rat Brain Tissue

    PubMed Central

    Mann, Phyllis E.


    The neurophysiological changes that occur during pregnancy in the female mammal have led to the coining of the phrases “expectant brain” and “maternal brain”. Although much is known of the hormonal changes during pregnancy, alterations in neurotransmitter gene expression have not been well-studied. We examined gene expression in the ventromedial nucleus of the hypothalamus (VMH) during pregnancy based on the fact that this nucleus not only modulates the physiological changes that occur during pregnancy but is also involved in the development of maternal behavior. This study was designed to identify genes that are differentially expressed between mid- and late-pregnancy in order to determine which genes may be associated with the onset and display of maternal behavior and the development of the maternal brain. A commercially available PCR array containing 84 neurotransmitter receptor and regulator genes (RT2 Profiler PCR array) was used. Brains were harvested from rats on days 12 and 21 of gestation, frozen, and micropunched to obtain the VMH. Total RNA was extracted, cDNA prepared, and SYBR Green qPCR was performed. In the VMH, expression of five genes were reduced on day 21 of gestation compared to day 12 (Chrna6, Drd5, Gabrr2, Prokr2, and Ppyr1) whereas Chat, Chrm5, Drd4, Gabra5, Gabrg2, LOC289606, Nmu5r2, and Npy5r expression was elevated. Five genes were chosen to be validated in an additional experiment based on their known involvement in maternal behavior onset. This experiment confirmed that gene expression for both the CCK-A receptor and the GABAAR γ2 receptor increases at the end of pregnancy. In general, these results identify genes possibly involved in the establishment of the maternal brain in rats and indicate possible new genes to be investigated. PMID:24961703

  20. Gene Expression Profiling in the Hibernating Primate, Cheirogaleus Medius

    PubMed Central

    Faherty, Sheena L.; Villanueva-Cañas, José Luis; Klopfer, Peter H.; Albà, M. Mar; Yoder, Anne D.


    Hibernation is a complex physiological response that some mammalian species employ to evade energetic demands. Previous work in mammalian hibernators suggests that hibernation is activated not by a set of genes unique to hibernators, but by differential expression of genes that are present in all mammals. This question of universal genetic mechanisms requires further investigation and can only be tested through additional investigations of phylogenetically dispersed species. To explore this question, we use RNA-Seq to investigate gene expression dynamics as they relate to the varying physiological states experienced throughout the year in a group of primate hibernators—Madagascar’s dwarf lemurs (genus Cheirogaleus). In a novel experimental approach, we use longitudinal sampling of biological tissues as a method for capturing gene expression profiles from the same individuals throughout their annual hibernation cycle. We identify 90 candidate genes that have variable expression patterns when comparing two active states (Active 1 and Active 2) with a torpor state. These include genes that are involved in metabolic pathways, feeding behavior, and circadian rhythms, as might be expected to correlate with seasonal physiological state changes. The identified genes appear to be critical for maintaining the health of an animal that undergoes prolonged periods of metabolic depression concurrent with the hibernation phenotype. By focusing on these differentially expressed genes in dwarf lemurs, we compare gene expression patterns in previously studied mammalian hibernators. Additionally, by employing evolutionary rate analysis, we find that hibernation-related genes do not evolve under positive selection in hibernating species relative to nonhibernators. PMID:27412611

  1. Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes.


    Fang, Xiefan; Mei, Wenbin; Barbazuk, William B; Rivkees, Scott A; Wendler, Christopher C


    Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20-60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3-65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes.

  2. Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes

    PubMed Central

    Fang, Xiefan; Mei, Wenbin; Barbazuk, William B.; Rivkees, Scott A.


    Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20–60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3–65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes. PMID:25354728

  3. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.


    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata


    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  4. The genetic basis of evolutionary change in gene expression levels

    PubMed Central

    Emerson, J. J.; Li, Wen-Hsiung


    The regulation of gene expression is an important determinant of organismal phenotype and evolution. However, the widespread recognition of this fact occurred long after the synthesis of evolution and genetics. Here, we give a brief sketch of thoughts regarding gene regulation in the history of evolution and genetics. We then review the development of genome-wide studies of gene regulatory variation in the context of the location and mode of action of the causative genetic changes. In particular, we review mapping of the genetic basis of expression variation through expression quantitative trait locus studies and measuring the cis/trans component of expression variation in allele-specific expression studies. We conclude by proposing a systematic integration of ideas that combines global mapping studies, cis/trans tests and modern population genetics methodologies, in order to directly estimate the forces acting on regulatory variation within and between species. PMID:20643748

  5. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.


    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu


    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  6. An Agent-Based Clustering Approach for Gene Selection in Gene Expression Microarray.


    Ramos, Juan; Castellanos-Garzón, José A; González-Briones, Alfonso; de Paz, Juan F; Corchado, Juan M


    Gene selection is a major research area in microarray analysis, which seeks to discover differentially expressed genes for a particular target annotation. Such genes also often called informative genes are able to differentiate tissue samples belonging to different classes of the studied disease. Despite the fact that there is a wide number of proposals, the complexity imposed by this problem remains a challenge today. This research proposes a gene selection approach by means of a clustering-based multi-agent system. This proposal manages different filter methods and gene clustering through coordinated agents to discover informative gene subsets. To assess the reliability of our approach, we have used four important and public gene expression datasets, two Lung cancer datasets, Colon and Leukemia cancer dataset. The achieved results have been validated through cluster validity measures, visual analytics, a classifier and compared with other gene selection methods, proving the reliability of our proposal.

  7. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.


    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong


    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  8. Ortho2ExpressMatrix—a web server that interprets cross-species gene expression data by gene family information

    PubMed Central


    Background The study of gene families is pivotal for the understanding of gene evolution across different organisms and such phylogenetic background is often used to infer biochemical functions of genes. Modern high-throughput experiments offer the possibility to analyze the entire transcriptome of an organism; however, it is often difficult to deduct functional information from that data. Results To improve functional interpretation of gene expression we introduce Ortho2ExpressMatrix, a novel tool that integrates complex gene family information, computed from sequence similarity, with comparative gene expression profiles of two pre-selected biological objects: gene families are displayed with two-dimensional matrices. Parameters of the tool are object type (two organisms, two individuals, two tissues, etc.), type of computational gene family inference, experimental meta-data, microarray platform, gene annotation level and genome build. Family information in Ortho2ExpressMatrix bases on computationally different protein family approaches such as EnsemblCompara, InParanoid, SYSTERS and Ensembl Family. Currently, respective all-against-all associations are available for five species: human, mouse, worm, fruit fly and yeast. Additionally, microRNA expression can be examined with respect to miRBase or TargetScan families. The visualization, which is typical for Ortho2ExpressMatrix, is performed as matrix view that displays functional traits of genes (differential expression) as well as sequence similarity of protein family members (BLAST e-values) in colour codes. Such translations are intended to facilitate the user's perception of the research object. Conclusions Ortho2ExpressMatrix integrates gene family information with genome-wide expression data in order to enhance functional interpretation of high-throughput analyses on diseases, environmental factors, or genetic modification or compound treatment experiments. The tool explores differential gene expression in

  9. Analytical workflow profiling gene expression in murine macrophages

    PubMed Central

    Nixon, Scott E.; González-Peña, Dianelys; Lawson, Marcus A.; McCusker, Robert H.; Hernandez, Alvaro G.; O’Connor, Jason C.; Dantzer, Robert; Kelley, Keith W.


    Comprehensive and simultaneous analysis of all genes in a biological sample is a capability of RNA-Seq technology. Analysis of the entire transcriptome benefits from summarization of genes at the functional level. As a cellular response of interest not previously explored with RNA-Seq, peritoneal macrophages from mice under two conditions (control and immunologically challenged) were analyzed for gene expression differences. Quantification of individual transcripts modeled RNA-Seq read distribution and uncertainty (using a Beta Negative Binomial distribution), then tested for differential transcript expression (False Discovery Rate-adjusted p-value < 0.05). Enrichment of functional categories utilized the list of differentially expressed genes. A total of 2079 differentially expressed transcripts representing 1884 genes were detected. Enrichment of 92 categories from Gene Ontology Biological Processes and Molecular Functions, and KEGG pathways were grouped into 6 clusters. Clusters included defense and inflammatory response (Enrichment Score = 11.24) and ribosomal activity (Enrichment Score = 17.89). Our work provides a context to the fine detail of individual gene expression differences in murine peritoneal macrophages during immunological challenge with high throughput RNA-Seq. PMID:25708305

  10. Random Subspace Aggregation for Cancer Prediction with Gene Expression Profiles

    PubMed Central

    Yuan, Xiguo; Zhang, Junying


    Background. Precisely predicting cancer is crucial for cancer treatment. Gene expression profiles make it possible to analyze patterns between genes and cancers on the genome-wide scale. Gene expression data analysis, however, is confronted with enormous challenges for its characteristics, such as high dimensionality, small sample size, and low Signal-to-Noise Ratio. Results. This paper proposes a method, termed RS_SVM, to predict gene expression profiles via aggregating SVM trained on random subspaces. After choosing gene features through statistical analysis, RS_SVM randomly selects feature subsets to yield random subspaces and training SVM classifiers accordingly and then aggregates SVM classifiers to capture the advantage of ensemble learning. Experiments on eight real gene expression datasets are performed to validate the RS_SVM method. Experimental results show that RS_SVM achieved better classification accuracy and generalization performance in contrast with single SVM, K-nearest neighbor, decision tree, Bagging, AdaBoost, and the state-of-the-art methods. Experiments also explored the effect of subspace size on prediction performance. Conclusions. The proposed RS_SVM method yielded superior performance in analyzing gene expression profiles, which demonstrates that RS_SVM provides a good channel for such biological data. PMID:27999797

  11. Constitutive androstane receptor activation evokes the expression of glycolytic genes.


    Yarushkin, Andrei A; Kazantseva, Yuliya A; Prokopyeva, Elena A; Markova, Diana N; Pustylnyak, Yuliya A; Pustylnyak, Vladimir O


    It is well-known that constitutive androstane receptor (CAR) activation by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) increases the liver-to-body weight ratio. CAR-mediated liver growth is correlated with increased expression of the pleiotropic transcription factor cMyc, which stimulates cell cycle regulatory genes and drives proliferating cells into S phase. Because glycolysis supports cell proliferation and cMyc is essential for the activation of glycolytic genes, we hypothesized that CAR-mediated up-regulation of cMyc in mouse livers might play a role in inducing the expression of glycolytic genes. The aim of the present study was to examine the effect of long-term CAR activation on glycolytic genes in a mouse model not subjected to metabolic stress. We demonstrated that long-term CAR activation by TCPOBOP increases expression of cMyc, which was correlated with reduced expression of gluconeogenic genes and up-regulation of glucose transporter, glycolytic and mitochondrial pyruvate metabolising genes. These changes in gene expression after TCPOBOP treatment were strongly correlated with changes in levels of glycolytic intermediates in mouse livers. Moreover, we demonstrated a significant positive regulatory effect of TCPOBOP-activated CAR on both mRNA and protein levels of Pkm2, a master regulator of glucose metabolism and cell proliferation. Thus, our findings provide evidence to support the conclusion that CAR activation initiates a transcriptional program that facilitates the coordinated metabolic activities required for cell proliferation.

  12. Gene expression profiling in peanut using high density oligonucleotide microarrays

    PubMed Central

    Payton, Paxton; Kottapalli, Kameswara Rao; Rowland, Diane; Faircloth, Wilson; Guo, Baozhu; Burow, Mark; Puppala, Naveen; Gallo, Maria


    Background Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently has a significant number of ESTs been released into the public domain. Utilization of these ESTs for oligonucleotide microarrays provides a means to investigate large-scale transcript responses to a variety of developmental and environmental signals, ultimately improving our understanding of plant biology. Results We have developed a high-density oligonucleotide microarray for peanut using 49,205 publicly available ESTs and tested the utility of this array for expression profiling in a variety of peanut tissues. To identify putatively tissue-specific genes and demonstrate the utility of this array for expression profiling in a variety of peanut tissues, we compared transcript levels in pod, peg, leaf, stem, and root tissues. Results from this experiment showed 108 putatively pod-specific/abundant genes, as well as transcripts whose expression was low or undetected in pod compared to peg, leaf, stem, or root. The transcripts significantly over-represented in pod include genes responsible for seed storage proteins and desiccation (e.g., late-embryogenesis abundant proteins, aquaporins, legumin B), oil production, and cellular defense. Additionally, almost half of the pod-abundant genes represent unknown genes allowing for the possibility of associating putative function to these previously uncharacterized genes. Conclusion The peanut oligonucleotide array represents the majority of publicly available peanut ESTs and can be used as a tool for expression profiling studies in diverse tissues. PMID:19523230

  13. Microenvironmental Gene Expression Plasticity Among Individual Drosophila melanogaster

    PubMed Central

    Lin, Yanzhu; Chen, Zhen-Xia; Oliver, Brian; Harbison, Susan T.


    Differences in phenotype among genetically identical individuals exposed to the same environmental condition are often noted in genetic studies. Despite this commonplace observation, little is known about the causes of this variability, which has been termed microenvironmental plasticity. One possibility is that stochastic or technical sources of variance produce these differences. A second possibility is that this variation has a genetic component. We have explored gene expression robustness in the transcriptomes of 730 individual Drosophila melanogaster of 16 fixed genotypes, nine of which are infected with Wolbachia. Three replicates of flies were grown, controlling for food, day/night cycles, humidity, temperature, sex, mating status, social exposure, and circadian timing of RNA extraction. Despite the use of inbred genotypes, and carefully controlled experimental conditions, thousands of genes were differentially expressed, revealing a unique and dynamic transcriptional signature for each individual fly. We found that 23% of the transcriptome was differentially expressed among individuals, and that the variability in gene expression among individuals is influenced by genotype. This transcriptional variation originated from specific gene pathways, suggesting a plastic response to the microenvironment; but there was also evidence of gene expression differences due to stochastic fluctuations. These observations reveal previously unappreciated genetic sources of variability in gene expression among individuals, which has implications for complex trait genetics and precision medicine. PMID:27770026

  14. Drosophila Myc is required for normal DREF gene expression

    SciTech Connect

    Dang Thi Phuong Thao; Seto, Hirokazu; Yamaguchi, Masamitsu


    The Drosophila DNA replication-related element-binding factor (dDREF) is required for the expression of many proliferation-related genes carrying the DRE sequence, 5'-TATCGATA. Finding a canonical E-box, 5'-CACGTG, in the dDREF gene promoter prompted us to explore the possibility that the dDREF gene is a target of Drosophila Myc (dMyc). Luciferase transient expression assays combined with RNA interference in Drosophila S2 cells revealed that knockdown of dmyc reduced dDREF gene promoter activity by 35% to 82%, an effect at least partly mediated by the E-box in the promoter. dm{sup 4}/Y hemizygous mutant larvae demonstrated no maternal dMyc and severe impairment of dDREF mRNA transcription. dMyc loss of function in dm{sup 2}/dm{sup 2} homozygous mutant follicle cell clones also resulted in loss of anti-dDREF immunostaining in nuclei. In contrast, co-expression of dMyc-dMax up-regulated dDREF promoter activity in S2 cells. Furthermore, dMyc over-expressing clones exhibited a high level of dDREF gene expression in wing and eye discs. These results taken together indicate that dMyc is indeed required for dDREF gene expression.

  15. Gene Expression in Adult Metafemales of Drosophila Melanogaster

    PubMed Central

    Birchler, J. A.; Hiebert, J. C.; Krietzman, M.


    The expression of selected X-linked and autosomal genes was examined in metafemales (3X:2A) compared to diploid sisters. Three enzyme activities (glucose-6-phosphate dehydrogenase, 6-phospho-gluconate dehydrogenase, β-hydroxyacid dehydrogenase) encoded by X-linked genes are not significantly different in the two classes of flies. In contrast, three autosomally encoded enzyme activities (alcohol dehydrogenase, α-glycerophosphate dehydrogenase, isocitrate dehydrogenase) are reduced in metafemales. Protein and DNA comparisons between metafemales and diploid sisters show a lowered level of total protein whereas the total DNA measurements are similar. Thus, the total cell number in metafemales is basically unchanged but gene expression is reduced. Phenotypic analysis of three autosomal loci, glass (gl), purple (pr) and pink-peach (p(p)), show that all three have lowered expression in metafemales while the X-linked loci, white-apricot (w(a)) and Bar (B), are dosage compensated. Quantitative dot blot analysis of messenger RNA levels of the second chromosomal locus, alcohol dehydrogenase (Adh), and the X chromosomal locus, rudimentary (r), show that Adh has reduced expression and r is partially compensated per total RNA in metafemales. It is proposed that the increased dosage of the X chromosome inversely affects both the X and autosomal gene expression but the simultaneous increased dosage of the structural genes on the X results in dosage compensation. The reduced levels of expression of autosomal genes could contribute to the great inviability of metafemales. PMID:2503426

  16. Screening for interaction effects in gene expression data

    PubMed Central

    Castaldi, Peter J.; Cho, Michael H.; Liang, Liming; Silverman, Edwin K.; Hersh, Craig P.; Rice, Kenneth


    Expression quantitative trait (eQTL) studies are a powerful tool for identifying genetic variants that affect levels of messenger RNA. Since gene expression is controlled by a complex network of gene-regulating factors, one way to identify these factors is to search for interaction effects between genetic variants and mRNA levels of transcription factors (TFs) and their respective target genes. However, identification of interaction effects in gene expression data pose a variety of methodological challenges, and it has become clear that such analyses should be conducted and interpreted with caution. Investigating the validity and interpretability of several interaction tests when screening for eQTL SNPs whose effect on the target gene expression is modified by the expression level of a transcription factor, we characterized two important methodological issues. First, we stress the scale-dependency of interaction effects and highlight that commonly applied transformation of gene expression data can induce or remove interactions, making interpretation of results more challenging. We then demonstrate that, in the setting of moderate to strong interaction effects on the order of what may be reasonably expected for eQTL studies, standard interaction screening can be biased due to heteroscedasticity induced by true interactions. Using simulation and real data analysis, we outline a set of reasonable minimum conditions and sample size requirements for reliable detection of variant-by-environment and variant-by-TF interactions using the heteroscedasticity consistent covariance-based approach. PMID:28301596

  17. Drosophila Myc is required for normal DREF gene expression.


    Thao, Dang Thi Phuong; Seto, Hirokazu; Yamaguchi, Masamitsu


    The Drosophila DNA replication-related element-binding factor (dDREF) is required for the expression of many proliferation-related genes carrying the DRE sequence, 5'-TATCGATA. Finding a canonical E-box, 5'-CACGTG, in the dDREF gene promoter prompted us to explore the possibility that the dDREF gene is a target of Drosophila Myc (dMyc). Luciferase transient expression assays combined with RNA interference in Drosophila S2 cells revealed that knockdown of dmyc reduced dDREF gene promoter activity by 35% to 82%, an effect at least partly mediated by the E-box in the promoter. dm(4)/Y hemizygous mutant larvae demonstrated no maternal dMyc and severe impairment of dDREF mRNA transcription. dMyc loss of function in dm(2)/dm(2) homozygous mutant follicle cell clones also resulted in loss of anti-dDREF immunostaining in nuclei. In contrast, co-expression of dMyc-dMax up-regulated dDREF promoter activity in S2 cells. Furthermore, dMyc over-expressing clones exhibited a high level of dDREF gene expression in wing and eye discs. These results taken together indicate that dMyc is indeed required for dDREF gene expression.

  18. Serial analysis of gene expression (SAGE) in rat liver regeneration

    SciTech Connect

    Cimica, Velasco . E-mail:; Batusic, Danko; Haralanova-Ilieva, Borislava; Chen, Yonglong; Hollemann, Thomas; Pieler, Tomas; Ramadori, Giuliano


    We have applied serial analysis of gene expression for studying the molecular mechanism of the rat liver regeneration in the model of 70% partial hepatectomy. We generated three SAGE libraries from a normal control liver (NL library: 52,343 tags), from a sham control operated liver (Sham library: 51,028 tags), and from a regenerating liver (PH library: 53,061 tags). By SAGE bioinformatics analysis we identified 40 induced genes and 20 repressed genes during the liver regeneration. We verified temporal expression of such genes by real time PCR during the regeneration process and we characterized 13 induced genes and 3 repressed genes. We found connective tissue growth factor transcript and protein induced very early at 4 h after PH operation before hepatocytes proliferation is triggered. Our study suggests CTGF as a growth factor signaling mediator that could be involved directly in the mechanism of liver regeneration induction.

  19. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.


    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong


    Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  20. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping


    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405


    EPA Science Inventory

    Normal Nasal Gene Expression Levels Using cDNA Array Technology.

    The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

  2. Quantitative gene expression profiles in real time from expressed sequence tag databases.


    Funari, Vincent A; Voevodski, Konstantin; Leyfer, Dimitry; Yerkes, Laura; Cramer, Donald; Tolan, Dean R


    An accumulation of expressed sequence tag (EST) data in the public domain and the availability of bioinformatic programs have made EST gene expression profiling a common practice. However, the utility and validity of using EST databases (e.g., dbEST) has been criticized, particularly for quantitative assessment of gene expression. Problems with EST sequencing errors, library construction, EST annotation, and multiple paralogs make generation of specific and sensitive qualitative arid quantitative expression profiles a concern. In addition, most EST-derived expression data exists in previously assembled databases. The Virtual Northern Blot (VNB) (http: // allows generation, evaluation, and optimization of expression profiles in real time, which is especially important for alternatively spliced, novel, or poorly characterized genes. Representative gene families with variable nucleotide sequence identity, tissue specificity, and levels of expression (bcl-xl, aldoA, and cyp2d9) are used to assess the quality of VNB's output. The profiles generated by VNB are more sensitive and specific than those constructed with ESTs listed in preindexed databases at UCSC and NCBI. Moreover, quantitative expression profiles produced by VNB are comparable to quantization obtained from Northern blots and qPCR. The VNB pipeline generates real-time gene expression profiles for single-gene queries that are both qualitatively and quantitatively reliable.

  3. Quantitative Gene Expression Profiles in Real Time From Expressed Sequence Tag Databases

    PubMed Central



    An accumulation of expressed sequence tag (EST) data in the public domain and the availability of bioinformatic programs have made EST gene expression profiling a common practice. However, the utility and validity of using EST databases (e.g., dbEST) has been criticized, particularly for quantitative assessment of gene expression. Problems with EST sequencing errors, library construction, EST annotation, and multiple paralogs make generation of specific and sensitive qualitative and quantitative expression profiles a concern. In addition, most EST-derived expression data exists in previously assembled databases. The Virtual Northern Blot (VNB) ( allows generation, evaluation, and optimization of expression profiles in real time, which is especially important for alternatively spliced, novel, or poorly characterized genes. Representative gene families with variable nucleotide sequence identity, tissue specificity, and levels of expression (bcl-xl, aldoA, and cyp2d9) are used to assess the quality of VNB’s output. The profiles generated by VNB are more sensitive and specific than those constructed with ESTs listed in preindexed databases at UCSI and NCBI. Moreover, quantitative expression profiles produced by VNB are comparable to quantization obtained from Northern blots and qPCR. The VNB pipeline generates real-time gene expression profiles for single-gene queries that are both qualitatively and quantitatively reliable. PMID:20635574

  4. Stochastic model of transcription factor-regulated gene expression

    NASA Astrophysics Data System (ADS)

    Karmakar, Rajesh; Bose, Indrani


    We consider a stochastic model of transcription factor (TF)-regulated gene expression. The model describes two genes, gene A and gene B, which synthesize the TFs and the target gene proteins, respectively. We show through analytic calculations that the TF fluctuations have a significant effect on the distribution of the target gene protein levels when the mean TF level falls in the highest sensitive region of the dose-response curve. We further study the effect of reducing the copy number of gene A from two to one. The enhanced TF fluctuations yield results different from those in the deterministic case. The probability that the target gene protein level exceeds a threshold value is calculated with the knowledge of the probability density functions associated with the TF and target gene protein levels. Numerical simulation results for a more detailed stochastic model are shown to be in agreement with those obtained through analytic calculations. The relevance of these results in the context of the genetic disorder haploinsufficiency is pointed out. Some experimental observations on the haploinsufficiency of the tumour suppressor gene, Nkx 3.1, are explained with the help of the stochastic model of TF-regulated gene expression.

  5. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  6. Validation of reference genes for gene expression studies in soybean aphid, Aphis glycines Matsumura

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative real-time PCR (qRT-PCR) is a common tool for quantifying mRNA transcripts. To normalize results, a reference gene is mandatory. Aphis glycines is a significant soybean pest, yet gene expression and functional genomics studies are hindered by a lack of stable reference genes. We evalu...

  7. Random forests-based differential analysis of gene sets for gene expression data.


    Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An


    In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for

  8. The mouse Gene Expression Database (GXD): 2017 update

    PubMed Central

    Finger, Jacqueline H.; Smith, Constance M.; Hayamizu, Terry F.; McCright, Ingeborg J.; Xu, Jingxia; Law, Meiyee; Shaw, David R.; Baldarelli, Richard M.; Beal, Jon S.; Blodgett, Olin; Campbell, Jeff W.; Corbani, Lori E.; Lewis, Jill R.; Forthofer, Kim L.; Frost, Pete J.; Giannatto, Sharon C.; Hutchins, Lucie N.; Miers, Dave B.; Motenko, Howie; Stone, Kevin R.; Eppig, Janan T.; Kadin, James A.; Richardson, Joel E.; Ringwald, Martin


    The Gene Expression Database (GXD; is an extensive and well-curated community resource of mouse developmental expression information. Through curation of the scientific literature and by collaborations with large-scale expression projects, GXD collects and integrates data from RNA in situ hybridization, immunohistochemistry, RT-PCR, northern blot and western blot experiments. Expression data from both wild-type and mutant mice are included. The expression data are combined with genetic and phenotypic data in Mouse Genome Informatics (MGI) and made readily accessible to many types of database searches. At present, GXD includes over 1.5 million expression results and more than 300 000 images, all annotated with detailed and standardized metadata. Since our last report in 2014, we have added a large amount of data, we have enhanced data and database infrastructure, and we have implemented many new search and display features. Interface enhancements include: a new Mouse Developmental Anatomy Browser; interactive tissue-by-developmental stage and tissue-by-gene matrix views; capabilities to filter and sort expression data summaries; a batch search utility; gene-based expression overviews; and links to expression data from other species. PMID:27899677

  9. Analysis of lamprey clustered Fox genes: insight into Fox gene evolution and expression in vertebrates.


    Wotton, Karl R; Shimeld, Sebastian M


    In the human genome, members of the FoxC, FoxF, FoxL1, and FoxQ1 gene families are found in two paralagous clusters. One cluster contains the genes FOXQ1, FOXF2, FOXC1 and the second consists of FOXF1, FOXC2, and FOXL1. In jawed vertebrates these genes are known to be expressed in different pharyngeal tissues and all, except FoxQ1, are involved in patterning the early embryonic mesoderm. We have previously traced the evolution of this cluster in the bony vertebrates, and the gene content is identical in the dogfish, a member of the most basally branching lineage of the jawed vertebrates. Here we extend these analyses to jawless vertebrates. Using genomic searches and molecular approaches we have identified homologues of these genes from lampreys. We identify two FoxC genes, two FoxF genes, two FoxQ1 genes and single FoxL1 gene. We examine the embryonic expression of one predominantly mesodermally expressed gene family, FoxC, and the endodermally expressed member of the cluster, FoxQ1. We identified FoxQ1 transcripts in the pharyngeal endoderm, while the two FoxC genes are differentially expressed in the pharyngeal mesenchyme and ectoderm. Furthermore we identify conserved expression of lamprey FoxC genes in the paraxial and intermediate mesoderms. We interpret our results through a chordate-wide comparison of expression patterns and discuss gene content in the context of theories on the evolution of the vertebrate genome.

  10. Multiple C4/Slp genes distinguished by expression after transfection.

    PubMed Central

    Robins, D M; Malissen, M; Hood, L; Ferreira, A; Walthall, D; Mitchell, M


    The S region of the murine major histocompatibility complex contains two closely related genes: C4, encoding the fourth component of complement, and Slp, encoding sex-limited protein. We cloned these genes from a cosmid library of the B10.W7R strain that does not show androgen regulation of the Slp protein. Restriction site polymorphisms revealed at least four C4-like genes within the Sw7 locus, indicating evolutionary amplification of this region. Transfection of these genes into L cells resulted in expression, processing, and secretion of immunologically correct C4 and Slp proteins. At least two different Slp genes and one C4 gene were capable, after transfection, of expressing C4 and Slp indistinguishable from macrophage-derived protein. A third Slp gene exists within this locus whose recombinant cognate did not express in L cells. Thus, the B10.W7R S region includes one C4 gene and at least three Slp-like genes. Images PMID:3023818

  11. Producing a Mammalian GFP Expression Vector Containing Neomycin Resistance Gene.


    Izadi, Manizheh; Abiri, Maryam; Keramatipour, Mohammad


    The green fluorescent protein (GFP) was originally isolated from the Jellyfish Aequorea Victoria that fluoresces green when exposed to blue light. GFP protein is composed of 238 amino acids with the molecular mass of 26.9 kD. The GFP gene is frequently used in cellular and molecular biology as a reporter gene. To date, many bacterial, yeast, fungal, plants, fly and mammalian cells, including human, have been created which express GFP. Martin Chalfie, Osamu Shimomura, and Roger Tsien were awarded the 2008 noble prize in chemistry for their discovery and development of GFP. In many studies on mammalian cells, GFP gene is introduced into cells using vector-based systems or a recombinant virus to track the location of a target protein or to study the expression level of the gene of interest, but in these studies there is no selection marker to normalize transfection. According to the importance of neomycin gene as a selection marker in mammalian cells, we aimed to produce a GFP expression vector that contains neomycin gene. GFP gene was separated from pEGFP-N1 vector and was inserted in the back-bone of pCDNA3.1/His/LacZ vector that contained the neomycin gene. The resulted vector contained GFP beside neomycin gene.

  12. Identification of wheat chromosomal regions containing expressed resistance genes.

    PubMed Central

    Dilbirligi, Muharrem; Erayman, Mustafa; Sandhu, Devinder; Sidhu, Deepak; Gill, Kulvinder S


    The objectives of this study were to isolate and physically localize expressed resistance (R) genes on wheat chromosomes. Irrespective of the host or pest type, most of the 46 cloned R genes from 12 plant species share a strong sequence similarity, especially for protein domains and motifs. By utilizing this structural similarity to perform modified RNA fingerprinting and data mining, we identified 184 putative expressed R genes of wheat. These include 87 NB/LRR types, 16 receptor-like kinases, and 13 Pto-like kinases. The remaining were seven Hm1 and two Hs1(pro-1) homologs, 17 pathogenicity related, and 42 unique NB/kinases. About 76% of the expressed R-gene candidates were rare transcripts, including 42 novel sequences. Physical mapping of 121 candidate R-gene sequences using 339 deletion lines localized 310 loci to 26 chromosomal regions encompassing approximately 16% of the wheat genome. Five major R-gene clusters that spanned only approximately 3% of the wheat genome but contained approximately 47% of the candidate R genes were observed. Comparative mapping localized 91% (82 of 90) of the phenotypically characterized R genes to 18 regions where 118 of the R-gene sequences mapped. PMID:15020436

  13. Histone modifications and skeletal muscle metabolic gene expression.


    McGee, Sean L; Hargreaves, Mark


    1. Skeletal muscle oxidative function and metabolic gene expression are co-ordinately downregulated in metabolic diseases such as insulin resistance, obesity and Type 2 diabetes. Altering skeletal muscle metabolic gene expression to favour enhanced energy expenditure is considered a potential therapy to combat these diseases. 2. Histone deacetylases (HDACs) are chromatin-remodelling enzymes that repress gene expression. It has been shown that HDAC4 and 5 co-operatively regulate a number of genes involved in various aspects of metabolism. Understanding how HDACs are regulated provides insights into the mechanisms regulating skeletal muscle metabolic gene expression. 3. Multiple kinases control phosphorylation-dependent nuclear export of HDACs, rendering them unable to repress transcription. We have found a major role for the AMP-activated protein kinase (AMPK) in response to energetic stress, yet metabolic gene expression is maintained in the absence of AMPK activity. Preliminary evidence suggests a potential role for protein kinase D, also a Class IIa HDAC kinase, in this response. 4. The HDACs are also regulated by ubiquitin-mediated proteasomal degradation, although the exact mediators of this process have not been identified. 5. Because HDACs appear to be critical regulators of skeletal muscle metabolic gene expression, HDAC inhibition could be an effective therapy to treat metabolic diseases. 6. Together, these data show that HDAC4 and 5 are critical regulators of metabolic gene expression and that understanding their regulation could provide a number of points of intervention for therapies designed to treat metabolic diseases, such as insulin resistance, obesity and Type 2 diabetes.

  14. Microarray studies of psychostimulant-induced changes in gene expression.


    Yuferov, Vadim; Nielsen, David; Butelman, Eduardo; Kreek, Mary Jeanne


    Alterations in the expression of multiple genes in many brain regions are likely to contribute to psychostimulant-induced behaviours. Microarray technology provides a powerful tool for the simultaneous interrogation of gene expression levels of a large number of genes. Several recent experimental studies, reviewed here, demonstrate the power, limitations and progress of microarray technology in the field of psychostimulant addiction. These studies vary in the paradigms of cocaine or amphetamine administration, drug doses, route and also mode of administration, duration of treatment, animal species, brain regions studied and time of tissue collection after final drug administration. The studies also utilize different microarray platforms and statistical techniques for analysis of differentially expressed genes. These variables influence substantially the results of these studies. It is clear that current microarray techniques cannot detect small changes reliably in gene expression of genes with low expression levels, including functionally significant changes in components of major neurotransmission systems such as glutamate, dopamine, opioid and GABA receptors, especially those that may occur after chronic drug administration or drug withdrawal. However, the microarray studies reviewed here showed cocaine- or amphetamine-induced alterations in the expression of numerous genes involved in the modulation of neuronal growth, cytoskeletal structures, synaptogenesis, signal transduction, apoptosis and cell metabolism. Application of laser capture microdissection and single-cell cDNA amplification may greatly enhance microarray studies of gene expression profiling. The combination of rapidly evolving microarray technology with established methods of neuroscience, molecular biology and genetics, as well as appropriate behavioural models of drug reinforcement, may provide a productive approach for delineating the neurobiological underpinnings of drug responses that lead to

  15. Effects of moderate drinking during pregnancy on placental gene expression

    PubMed Central

    Rosenberg, Martina J.; Wolff, Christina R.; El-Emawy, Ahmed; Staples, Miranda C.; Perrone-Bizzozero, Nora I.; Savage, Daniel D.


    Many children adversely affected by maternal drinking during pregnancy cannot be identified early in life using current diagnostic criteria for fetal alcohol spectrum disorder (FASD). We conducted a preliminary investigation to determine whether ethanol-induced alterations in placental gene expression may have some utility as a diagnostic indicator of maternal drinking during pregnancy and as a prognostic indicator of risk for adverse neurobehavioral outcomes in affected offspring. Pregnant Long-Evans rats voluntarily consumed either a 0 or 5% ethanol solution 4 h each day throughout gestation. Ethanol consumption produced a mean maternal daily intermittent peak serum ethanol concentration of 84 mg/dL. Placentas were harvested on gestational day 20 for gene expression studies. Microarray analysis of more than 28,000 genes revealed that the expression of 304 known genes was altered twofold or greater in placenta from ethanol-consuming dams compared with controls. About 76% of these genes were repressed in ethanol-exposed placentas. Gene expression changes involved proteins associated with central nervous system development; organ morphogenesis; immunological responses; endocrine function; ion homeostasis; and skeletal, cardiovascular, and cartilage development. To date, quantitative real-time polymerase chain reaction analysis has confirmed significant alterations in gene expression for 22 genes, including genes encoding for three calcium binding proteins, two matrix metalloproteinases, the cannabinoid 1, galanin 2 and toll-like receptor 4, iodothyronine deiodinase 2, 11-β hydroxysteroid dehydrogenase 2, placental growth factor, transforming growth factor alpha, gremlin 1, and epithelial growth factor (EGF)-containing extracellular matrix protein. These results suggest that the expression of a sufficiently large number of placental mRNAs is altered after moderate drinking during pregnancy to warrant more detailed investigation of the placenta as a biomarker system

  16. PLEXdb: Gene expression resources for plants and plant pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PLEXdb (Plant Expression Database), in partnership with community databases, supports comparisons of gene expression across multiple plant and pathogen species, promoting individuals and/or consortia to upload genome-scale data sets to contrast them to previously archived data. These analyses facili...

  17. VESPUCCI: Exploring Patterns of Gene Expression in Grapevine

    PubMed Central

    Moretto, Marco; Sonego, Paolo; Pilati, Stefania; Malacarne, Giulia; Costantini, Laura; Grzeskowiak, Lukasz; Bagagli, Giorgia; Grando, Maria Stella; Moser, Claudio; Engelen, Kristof


    Large-scale transcriptional studies aim to decipher the dynamic cellular responses to a stimulus, like different environmental conditions. In the era of high-throughput omics biology, the most used technologies for these purposes are microarray and RNA-Seq, whose data are usually required to be deposited in public repositories upon publication. Such repositories have the enormous potential to provide a comprehensive view of how different experimental conditions lead to expression changes, by comparing gene expression across all possible measured conditions. Unfortunately, this task is greatly impaired by differences among experimental platforms that make direct comparisons difficult. In this paper, we present the Vitis Expression Studies Platform Using COLOMBOS Compendia Instances (VESPUCCI), a gene expression compendium for grapevine which was built by adapting an approach originally developed for bacteria, and show how it can be used to investigate complex gene expression patterns. We integrated nearly all publicly available microarray and RNA-Seq expression data: 1608 gene expression samples from 10 different technological platforms. Each sample has been manually annotated using a controlled vocabulary developed ad hoc to ensure both human readability and computational tractability. Expression data in the compendium can be visually explored using several tools provided by the web interface or can be programmatically accessed using the REST interface. VESPUCCI is freely accessible at PMID:27242836

  18. Geometry of the Gene Expression Space of Individual Cells

    PubMed Central

    Korem, Yael; Szekely, Pablo; Hart, Yuval; Sheftel, Hila; Hausser, Jean; Mayo, Avi; Rothenberg, Michael E.; Kalisky, Tomer; Alon, Uri


    There is a revolution in the ability to analyze gene expression of single cells in a tissue. To understand this data we must comprehend how cells are distributed in a high-dimensional gene expression space. One open question is whether cell types form discrete clusters or whether gene expression forms a continuum of states. If such a continuum exists, what is its geometry? Recent theory on evolutionary trade-offs suggests that cells that need to perform multiple tasks are arranged in a polygon or polyhedron (line, triangle, tetrahedron and so on, generally called polytopes) in gene expression space, whose vertices are the expression profiles optimal for each task. Here, we analyze single-cell data from human and mouse tissues profiled using a variety of single-cell technologies. We fit the data to shapes with different numbers of vertices, compute their statistical significance, and infer their tasks. We find cases in which single cells fill out a continuum of expression states within a polyhedron. This occurs in intestinal progenitor cells, which fill out a tetrahedron in gene expression space. The four vertices of this tetrahedron are each enriched with genes for a specific task related to stemness and early differentiation. A polyhedral continuum of states is also found in spleen dendritic cells, known to perform multiple immune tasks: cells fill out a tetrahedron whose vertices correspond to key tasks related to maturation, pathogen sensing and communication with lymphocytes. A mixture of continuum-like distributions and discrete clusters is found in other cell types, including bone marrow and differentiated intestinal crypt cells. This approach can be used to understand the geometry and biological tasks of a wide range of single-cell datasets. The present results suggest that the concept of cell type may be expanded. In addition to discreet clusters in gene-expression space, we suggest a new possibility: a continuum of states within a polyhedron, in which the

  19. Differences in gene expression between mouse and human for dynamically regulated genes in early embryo.


    Madissoon, Elo; Töhönen, Virpi; Vesterlund, Liselotte; Katayama, Shintaro; Unneberg, Per; Inzunza, Jose; Hovatta, Outi; Kere, Juha


    Infertility is a worldwide concern that can be treated with in vitro fertilization (IVF). Improvements in IVF and infertility treatment depend largely on better understanding of the molecular mechanisms for human preimplantation development. Several large-scale studies have been conducted to identify gene expression patterns for the first five days of human development, and many functional studies utilize mouse as a model system. We have identified genes of possible importance for this time period by analyzing human microarray data and available data from online databases. We selected 70 candidate genes for human preimplantation development and investigated their expression in the early mouse development from oocyte to the 8-cell stage. Maternally loaded genes expectedly decreased in expression during development both in human and mouse. We discovered that 25 significantly upregulated genes after fertilization in human included 13 genes whose orthologs in mouse behaved differently and mimicked the expression profile of maternally expressed genes. Our findings highlight many significant differences in gene expression patterns during mouse and human preimplantation development. We also describe four cancer-testis antigen families that are also highly expressed in human embryos: PRAME, SSX, GAGE and MAGEA.

  20. Identification of housekeeping genes suitable for gene expression analysis in Jian carp (Cyprinus carpio var. jian).


    Tang, Yong-kai; Yu, Ju-hua; Xu, Pao; Li, Jian-lin; Li, Hong-xia; Ren, Hong-tao


    Jian carp (Cyprinus carpio var. jian) is an important economic fish species cultured in China. In this report, we performed a systematic analysis to identify an appropriate housekeeping (HK) gene for the study of gene expression in Jian carp. For this purpose, partial DNA sequences of four potential candidate genes (elongation factor 1 alpha (EF-1α), glyceraldehyde-3-phosphate (GAPDH), beta-actin (ACTB), and 18S ribosomal RNA (18S rRNA) were isolated, and their expression levels were studied using RNA extracted from nine tissues (forebrain, hypothalamus, liver, fore-intestine, hind-intestine, ovary, muscle, heart, kidney) in juvenile and adult Jian carp. Gene expression levels were quantified by quantitative real time RT-PCR (qRT-PCR), and expression stability was evaluated by comparing the coefficients of variation (CV) of the Ct values. The results showed that EF-1α was the most suitable HK gene in all tissues of juvenile and adult Jian carp. However, at distinct juvenile and adult developmental stages, there was not a single optimal gene for normalization of expression levels in all tissues. EF-1α was the most stable gene only in forebrain, hypothalamus, liver, heart, and kidney. These results provide data that can be expected to aid gene expression analysis in Jian carp research, but underline the importance of identifying the optimal HK gene for each new experimental paradigm.

  1. Repressor-mediated tissue-specific gene expression in plants


    Meagher, Richard B.; Balish, Rebecca S.; Tehryung, Kim; McKinney, Elizabeth C.


    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  2. Delivery of gene-expressing fragments using quantum dot

    NASA Astrophysics Data System (ADS)

    Hoshino, Akiyoshi; Manabe, Noriyoshi; Hanada, Sanshiro; Fujioka, Kouki; Yasuhara, Masato; Kondo, Akihiko; Yamamoto, Kenji


    Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. Fluorescent nanoparticles, such as nanocrystal quantum dots (QDs), have potential to be applied to molecular biology and bioimaging, since some nanocrystals emit higher and longer lasting fluorescence than conventional organic probes do. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced the gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/geneconstruct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as 1) the reading direction of gene fragments, 2) the quantity of gene fragments attached on the surface of QD-constructs, 3) the surface electronic charges varied according to the structure of QD/gene-constructs, and 4) the particle size of QD/gene complex varied according to the structure and amounts of gene fragments. Using this QD/geneconstruct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs was disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes. These results suggest that inappropriate treatment and disposal of QDs may still have risks to the environmental pollution including human health under certain conditions. Here we propose the further research for the immune and physiological responses in not only immune cells but also other cells, in order to clear the effect of all other nanoscale products as well as nanocrystal

  3. Photo-activatable Cre recombinase regulates gene expression in vivo.


    Schindler, Suzanne E; McCall, Jordan G; Yan, Ping; Hyrc, Krzystof L; Li, Mingjie; Tucker, Chandra L; Lee, Jin-Moo; Bruchas, Michael R; Diamond, Marc I


    Techniques allowing precise spatial and temporal control of gene expression in the brain are needed. Herein we describe optogenetic approaches using a photo-activatable Cre recombinase (PA-Cre) to stably modify gene expression in the mouse brain. Blue light illumination for 12 hours via optical fibers activated PA-Cre in the hippocampus, a deep brain structure. Two-photon illumination through a thinned skull window for 100 minutes activated PA-Cre within a sub-millimeter region of cortex. Light activation of PA-Cre may allow permanent gene modification with improved spatiotemporal precision compared to standard methods.

  4. Gene expression changes in chronic inflammatory demyelinating polyneuropathy skin biopsies.


    Puttini, Stefania; Panaite, Petrica-Adrian; Mermod, Nicolas; Renaud, Susanne; Steck, Andreas J; Kuntzer, Thierry


    Chronic-inflammatory demyelinating polyneuropathy (CIDP) is an immune-mediated disease with no known biomarkers for diagnosing the disease or assessing its prognosis. We performed transcriptional profiling microarray analysis on skin punch biopsies from 20 CIDP patients and 17 healthy controls to identify disease-associated gene expression changes. We demonstrate changes in expression of genes involved in immune and chemokine regulation, growth and repair. We also found a combination of two upregulated genes that can be proposed as a novel biomarker of the disorder.

  5. A unique mechanism regulating gene expression in 1-cell embryos

    PubMed Central

    YAMAMOTO, Ryoma; AOKI, Fugaku


    After fertilization, the genome of zygotes is transcriptionally silent. The timing of the initiation of transcription is species-specific and occurs at the mid-1-cell stage in mice. Recent analyses using high-throughput sequencing (HTS) have identified thousands of genes transcribed at the 1-cell stage, and the pattern of expression among these genes appears to be unique. In this article, we show the result of an additional analysis using HTS data from a previous study, and present the hypothesis that an extremely loose chromatin structure causes promiscuous gene expression in 1-cell embryos. PMID:27867162

  6. Various Spatiotemporal Expression Profiles of Anther-Expressed Genes in Rice

    PubMed Central

    Hobo, Tokunori; Suwabe, Keita; Aya, Koichiro; Suzuki, Go; Yano, Kentaro; Ishimizu, Takeshi; Fujita, Masahiro; Kikuchi, Shunsuke; Hamada, Kazuki; Miyano, Masumi; Fujioka, Tomoaki; Kaneko, Fumi; Kazama, Tomohiko; Mizuta, Yoko; Takahashi, Hirokazu; Shiono, Katsuhiro; Nakazono, Mikio; Tsutsumi, Nobuhiro; Nagamura, Yoshiaki; Kurata, Nori; Watanabe, Masao; Matsuoka, Makoto


    The male gametophyte and tapetum play different roles during anther development although they are differentiated from the same cell lineage, the L2 layer. Until now, it has not been possible to delineate their transcriptomes due to technical difficulties in separating the two cell types. In the present study, we characterized the separated transcriptomes of the rice microspore/pollen and tapetum using laser microdissection (LM)-mediated microarray. Spatiotemporal expression patterns of 28,141 anther-expressed genes were classified into 20 clusters, which contained 3,468 (12.3%) anther-enriched genes. In some clusters, synchronous gene expression in the microspore and tapetum at the same developmental stage was observed as a novel characteristic of the anther transcriptome. Noteworthy expression patterns are discussed in connection with gene ontology (GO) categories and gene annotations, which are related to important biological events in anther development, such as pollen maturation, pollen germination, pollen tube elongation and pollen wall formation. PMID:18776202

  7. Genome-Wide Analysis of Homeobox Gene Family in Legumes: Identification, Gene Duplication and Expression Profiling

    PubMed Central

    Garg, Rohini; Jain, Mukesh


    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development. PMID:25745864

  8. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling.


    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh


    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  9. Bacterial expression system with tightly regulated gene expression and plasmid copy number.


    Bowers, Lisa M; Lapoint, Kathleen; Anthony, Larry; Pluciennik, Anna; Filutowicz, Marcin


    A new Escherichia coli host/vector system has been engineered to allow tight and uniform modulation of gene expression and gamma origin (ori) plasmid copy number. Regulation of gamma ori plasmid copy number is achieved through arabinose-inducible expression of the necessary Rep protein, pi, whose gene was integrated into the chromosome of the host strain under control of the P(BAD) promoter. gamma ori replication can be uniformly modulated over 100-fold by changing the concentration of l-arabinose in the growth medium. This strain avoids the problem of all-or-nothing induction of P(BAD) because it is deficient in both arabinose uptake and degradation genes. Arabinose enters the cell by a mutant LacY transporter, LacYA177C, which is expressed from the host chromosome. Although this strain could be compatible with any gamma ori plasmid, we describe the utility of a gamma ori expression vector that allows especially tight regulation of gene expression. With this host/vector system, it is possible to independently modulate gene expression and gene dosage, facilitating the cloning and overproduction of toxic gene products. We describe the successful use of this system for cloning a highly potent toxin, Colicin E3, in the absence of its cognate immunity protein. This system could be useful for cloning genes encoding other potent toxins, screening libraries for potential toxins, and maintaining any gamma ori vector at precise copy levels in a cell.

  10. Microarray expression profiling identifies genes with altered expression in HDL-deficient mice

    SciTech Connect

    Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.; Speed, Terence P.; Rubin, Edward M.


    Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared with the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.

  11. Gene expression profiles in Finnish twins with multiple sclerosis

    PubMed Central

    Särkijärvi, Silja; Kuusisto, Hanna; Paalavuo, Raija; Levula, Mari; Airla, Nina; Lehtimäki, Terho; Kaprio, Jaakko; Koskenvuo, Markku; Elovaara, Irina


    Background Since genetic alterations influencing susceptibility to multiple sclerosis (MS), the most common autoimmune demyelinating disease of the central nervous system (CNS), are as yet poorly understood, the purpose of this study was to identify genes responsible for MS by studying monozygotic (MZ) twin pairs discordant for MS. Methods In order to identify genes involved in MS development, the gene expression profiles in blood mononuclear cells obtained from eight MZ twin pairs discordant for MS were analyzed by cDNA microarray technology detecting the expression of 8 300 genes. The twins were collected from the Finnish Twin Cohort Study and both affected subjects and their healthy siblings underwent neurological evaluation and cerebral and spinal magnetic resonance imaging. Gene expressions were confirmed by relative quantitative reverse transcription PCR. Results It appeared that 25 genes were at least two-fold up-regulated and 15 genes down-regulated in 25% (2/8) of twins with MS when compared to their healthy siblings. Moreover, 6/25 genes were up-regulated in 40% of MS twins and one gene, interferon alpha-inducible protein (clone IFI-6-16) (G1P3), in 50% of them. The six most constantly expressed genes are (1) G1P3, (2) POU domain, class 3, transcription factor 1, (3) myxovirus resistance 2, (4) lysosomal-associated multispanning membrane protein-5, (5) hemoglobin alpha 2 and (6) hemoglobin beta. Conclusion Over two-fold up-regulation of these six genes in almost half of MZ twins with MS suggests their role in MS pathogenesis. Studies using MZ MS twins obtained from genetically homogeneous population offer a unique opportunity to explore the genetic nature of MS. PMID:16504146

  12. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.


    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu


    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  13. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu


    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  14. Assessment of Suitable Reference Genes for Quantitative Gene Expression Studies in Melon Fruits

    PubMed Central

    Kong, Qiusheng; Gao, Lingyun; Cao, Lei; Liu, Yue; Saba, Hameed; Huang, Yuan; Bie, Zhilong


    Melon (Cucumis melo L.) is an attractive model plant for investigating fruit development because of its morphological, physiological, and biochemical diversity. Quantification of gene expression by quantitative reverse transcription polymerase chain reaction (qRT-PCR) with stably expressed reference genes for normalization can effectively elucidate the biological functions of genes that regulate fruit development. However, the reference genes for data normalization in melon fruits have not yet been systematically validated. This study aims to assess the suitability of 20 genes for their potential use as reference genes in melon fruits. Expression variations of these genes were measured in 24 samples that represented different developmental stages of fertilized and parthenocarpic melon fruits by qRT-PCR analysis. GeNorm identified ribosomal protein L (CmRPL) and cytosolic ribosomal protein S15 (CmRPS15) as the best pair of reference genes, and as many as five genes including CmRPL, CmRPS15, TIP41-like family protein (CmTIP41), cyclophilin ROC7 (CmCYP7), and ADP ribosylation factor 1 (CmADP) were required for more reliable normalization. NormFinder ranked CmRPS15 as the best single reference gene, and RAN GTPase gene family (CmRAN) and TATA-box binding protein (CmTBP2) as the best combination of reference genes in melon fruits. Their effectiveness was further validated by parallel analyses on the activities of soluble acid invertase and sucrose phosphate synthase, and expression profiles of their respective encoding genes CmAIN2 and CmSPS1, as well as sucrose contents during melon fruit ripening. The validated reference genes will help to improve the accuracy of gene expression studies in melon fruits. PMID:27536316

  15. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.


    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  16. Serial analysis of gene expression (SAGE): application in cancer research.


    Tuteja, Renu; Tuteja, Narendra


    Serial analysis of gene expression (SAGE) is a powerful tool that allows digital analysis of overall gene expression patterns. SAGE provides quantitative and comprehensive expression profiling in a given cell population. Because SAGE does not require a preexisting clone, it can be used to identify and quantitate new as well as known genes. It works by isolating short fragments of genetic information from the genes expressed in the cell being studied. These short sequences, called SAGE tags, are linked together for efficient sequencing. SAGE is particularly well suited for organisms whose genome is not completely sequenced, because it does not require a hybridization probe for each transcript and allows new genes to be discovered. New modifications of SAGE now permit the analysis of gene expression in cell sub-populations or micro-anatomic structures, providing access to unexplored transcriptomes of normal and disease biology. Data derived using the SAGE technology have been used to identify tumor markers for a variety of cancers, including gastrointestinal cancer, lung and thyroid cancer, breast and ovarian cancer, neuroblastoma and glioblastoma, prostate cancer, and renal cell carcinoma. In this review we present an outline of the method and updated information on the applications of SAGE technology to various cancers.

  17. Antisense transcription as a tool to tune gene expression.


    Brophy, Jennifer A N; Voigt, Christopher A


    A surprise that has emerged from transcriptomics is the prevalence of genomic antisense transcription, which occurs counter to gene orientation. While frequent, the roles of antisense transcription in regulation are poorly understood. We built a synthetic system in Escherichia coli to study how antisense transcription can change the expression of a gene and tune the response characteristics of a regulatory circuit. We developed a new genetic part that consists of a unidirectional terminator followed by a constitutive antisense promoter and demonstrate that this part represses gene expression proportionally to the antisense promoter strength. Chip-based oligo synthesis was applied to build a large library of 5,668 terminator-promoter combinations that was used to control the expression of three repressors (PhlF, SrpR, and TarA) in a simple genetic circuit (NOT gate). Using the library, we demonstrate that antisense promoters can be used to tune the threshold of a regulatory circuit without impacting other properties of its response function. Finally, we determined the relative contributions of antisense RNA and transcriptional interference to repressing gene expression and introduce a biophysical model to capture the impact of RNA polymerase collisions on gene repression. This work quantifies the role of antisense transcription in regulatory networks and introduces a new mode to control gene expression that has been previously overlooked in genetic engineering.

  18. Gene Expression Profiling of Flagellar Disassembly in Chlamydomonas reinhardtii

    PubMed Central

    Chamberlain, Kara L.; Miller, Steven H.; Keller, Laura R.


    Flagella are sensory organelles that interact with the environment through signal transduction and gene expression networks. We used microarray profiling to examine gene regulation associated with flagellar length change in the green alga Chlamydomonas reinhardtii. Microarrays were probed with fluorescently labeled cDNAs synthesized from RNA extracted from cells before and during flagellar assembly or disassembly. Evaluation of the gene expression profiles identified >100 clones showing at least a twofold change in expression during flagellar length changes. Products of these genes are associated not only with flagellar structure and motility but also with other cellular responses, including signal transduction and metabolism. Expression of specific genes from each category was further characterized at higher resolution by using quantitative real-time PCR (qRT–PCR). Analysis and comparison of the gene expression profiles coupled to flagellar assembly and disassembly revealed that each process involves a new and uncharacterized whole-cell response to flagellar length changes. This analysis lays the groundwork for a more comprehensive understanding of the cellular and molecular networks regulating flagellar length changes. PMID:18493036

  19. [Expression of acylamidase gene in Rhodococcus erythropolis strains].


    Lavrov, K V; Novikov, A D; Riabchenko, L E; Ianenko, A S


    The expression of a new acylamidase gene from R. erythropolis 37 was studied in Rhodococcus erythropolis strains. This acylamidase, as a result of its unique substrate specificity, can hydrolyse N-substituted amides (4'-nitroacetanilide, N-isopropylacrylamide, N'N-dimethylaminopropylacrylamide). A new expression system based on the use of the promoter region of nitrilhydratase genes from R. rhodochrous M8 was created to achieve constitutive synthesis of acylamidase in R. erythropolis cells. A fourfold improvement in the acylamidase activity of recombinant R. erythropolis cells as compared with the parent wild-type strain was obtained through the use of the new expression system.

  20. Antisense RNA suppression of peroxidase gene expression

    SciTech Connect

    Lagrimini, L.M.; Bradford, S.; De Leon, F.D. )


    The 5{prime} half the anionic peroxidase cDNA of tobacco was inserted into a CaMV 35S promoter/terminator expression cassette in the antisense configuration. This was inserted into the Agrobacterium-mediated plant transformation vector pCIBIO which includes kanamycin selection, transformed into two species of tobacco (N. tabacum and M. sylvestris), and plants were subsequently regenerated on kanamycin. Transgenic plants were analyzed for peroxidase expression and found to have 3-5 fold lower levels of peroxidase than wild-type plants. Isoelectric focusing demonstrated that the antisense RNA only suppressed the anionic peroxidase. Wound-induced peroxidase expression was found not to be affected by the antisense RNA. Northern blots show a greater than 5 fold suppression of anionic peroxidase mRNA in leaf tissue, and the antisense RNA was expressed at a level 2 fold over the endogenous mRNA. Plants were self-pollinated and F1 plants showed normal segregation. N. sylvestris transgenic plants with the lowest level of peroxidase are epinastic, and preliminary results indicate elevated auxin levels. Excised pith tissue from both species of transgenic plants rapidly collapse when exposed to air, while pith tissue from wild-type plants showed little change when exposed to air. Further characterization of these phenotypes is currently being made.

  1. Novel gene expression tools for rice biotechnology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biotechnology is an effective and important method of improving both quality and agronomic traits in rice. We are developing novel molecular tools for genetic engineering, with a focus on developing novel transgene expression control elements (i.e. promoters) for rice. A suite of monocot grass promo...

  2. Estrogen increases renal oxytocin receptor gene expression.


    Ostrowski, N L; Young, W S; Lolait, S J


    Estrogens have been implicated in the sodium and fluid imbalances associated with the menstrual cycle and late pregnancy. An estrogen-dependent role for renal oxytocin receptors in fluid homeostasis is suggested by the present findings which demonstrate that estradiol benzoate treatment increases the expression of the oxytocin receptor messenger ribonucleic acid and 125I-OTA binding to oxytocin receptors in the renal cortex and medullary collecting ducts of ovariectomized female rats. Moreover, estradiol induced high levels of oxytocin receptor expression in outer stripe proximal tubules of ovariectomized female and adrenalectomized male rats. Proximal tubule induction was inhibited in a dose-dependent manner by the antiestrogen tamoxifen, but cortical expression of oxytocin receptors in macula densa cells was unaffected by tamoxifen. These data demonstrate cell-specific regulation of oxytocin receptor expression in macula densa and proximal tubule cells, and suggest a important role for these receptors in mediating estrogen-induced alterations in renal fluid dynamics by possibly affecting glomerular filtration and water and solute reabsorption during high estrogen states.

  3. Efficiently finding regulatory elements using correlation with gene expression.


    Bannai, Hideo; Inenaga, Shunsuke; Shinohara, Ayumi; Takeda, Masayuki; Miyano, Satoru


    We present an efficient algorithm for detecting putative regulatory elements in the upstream DNA sequences of genes, using gene expression information obtained from microarray experiments. Based on a generalized suffix tree, our algorithm looks for motif patterns whose appearance in the upstream region is most correlated with the expression levels of the genes. We are able to find the optimal pattern, in time linear in the total length of the upstream sequences. We implement and apply our algorithm to publicly available microarray gene expression data, and show that our method is able to discover biologically significant motifs, including various motifs which have been reported previously using the same data set. We further discuss applications for which the efficiency of the method is essential, as well as possible extensions to our algorithm.

  4. Gene expression patterns in glucose-stimulated podocytes

    SciTech Connect

    Han, Seung Hyeok; Yang, Sanghwa; Jung, Dong Sub; Li, Jin Ji; Kim, Jin Ju; Kwak, Seung Jae; Kim, Dong Ki; Moon, Sung Jin; Lee, Jung Eun; Han, Dae-Suk; Kang, Shin-Wook


    To explore the mechanisms of podocyte injury under diabetic conditions, we performed an expression profile in glucose-stimulated podocytes. Differential gene expression profiles between conditionally immortalized mouse podocytes cultured in medium containing 5.6 and 30 mM glucose were measured with oligonucleotide microarrays. Of the genes identified, heme oxygenase-1, vascular endothelial growth factor-A, and thrombospondin-1 showed a consistently increased pattern, whereas angiotensin-converting enzyme-2 and peroxisomal proliferator activator receptor-{gamma} were down-regulated. These results were validated using real-time PCR and western blotting in podocytes, and with immunohistochemistry on renal tissues from streptozotocin-induced diabetic rats. Not only is this the first report of gene expression profiling of podocyte injury under diabetic conditions, but the identified genes are promising targets for future diabetes research.

  5. Histone availability as a strategy to control gene expression.


    Prado, Félix; Jimeno-González, Silvia; Reyes, José C


    Histone proteins are main structural components of the chromatin and major determinants of gene regulation. Expression of canonical histone genes is strictly controlled during the cell cycle in order to couple DNA replication with histone deposition. Indeed, reductions in the levels of canonical histones or defects in chromatin assembly cause genetic instability. Early data from yeast demonstrated that severe histone depletion also causes strong gene expression changes. We have recently reported that a moderated depletion of canonical histones in human cells leads to an open chromatin configuration, which in turn increases RNA polymerase II elongation rates and causes pre-mRNA splicing defects. Interestingly, some of the observed defects accompany the scheduled histone depletion that is associated with several senescence and aging processes. Thus, our comparison of induced and naturally-occurring histone depletion processes suggests that a programmed reduction of the level of canonical histones might be a strategy to control gene expression during specific physiological processes.

  6. FlyTED: the Drosophila Testis Gene Expression Database.


    Zhao, Jun; Klyne, Graham; Benson, Elizabeth; Gudmannsdottir, Elin; White-Cooper, Helen; Shotton, David


    FlyTED, the Drosophila Testis Gene Expression Database, is a biological research database for gene expression images from the testis of the fruit fly Drosophila melanogaster. It currently contains 2762 mRNA in situ hybridization images and ancillary metadata revealing the patterns of gene expression of 817 Drosophila genes in testes of wild type flies and of seven meiotic arrest mutant strains in which spermatogenesis is defective. This database has been built by adapting a widely used digital library repository software system, EPrints (, and provides both web-based search and browse interfaces, and programmatic access via an SQL dump, OAI-PMH and SPARQL. FlyTED is available at

  7. Bayesian median regression for temporal gene expression data

    NASA Astrophysics Data System (ADS)

    Yu, Keming; Vinciotti, Veronica; Liu, Xiaohui; 't Hoen, Peter A. C.


    Most of the existing methods for the identification of biologically interesting genes in a temporal expression profiling dataset do not fully exploit the temporal ordering in the dataset and are based on normality assumptions for the gene expression. In this paper, we introduce a Bayesian median regression model to detect genes whose temporal profile is significantly different across a number of biological conditions. The regression model is defined by a polynomial function where both time and condition effects as well as interactions between the two are included. MCMC-based inference returns the posterior distribution of the polynomial coefficients. From this a simple Bayes factor test is proposed to test for significance. The estimation of the median rather than the mean, and within a Bayesian framework, increases the robustness of the method compared to a Hotelling T2-test previously suggested. This is shown on simulated data and on muscular dystrophy gene expression data.

  8. Developmental expression profiles of Celsr (Flamingo) genes in the mouse.


    Tissir, F; De-Backer, O; Goffinet, A M; Lambert de Rouvroit, C


    Celsr, also called Flamingo (Fmi) genes encode proteins of the cadherin superfamily. Celsr cadherins are seven-pass transmembrane proteins with nine cadherin repeats in the extracellular domain, and an anonymous intracellular C-terminus. The Drosophila Fmi gene regulates epithelial planar cell polarity and dendritic field deployment. The three Flamingo gene orthologs in man and rodents are named, respectively, CELSR1-3 and Celsr1-3. Celsr1 and 2 are expressed during early development, in the brain and epithelia. In this report, we characterized further Celsr genes in the mouse, and examined their developmental pattern of expression. Each Celsr is expressed prominently in the developing brain following a specific pattern, suggesting that they serve distinct functions.

  9. Gene expression patterns associated with queen honey bee longevity.


    Corona, Miguel; Hughes, Kimberly A; Weaver, Daniel B; Robinson, Gene E


    The oxidative stress theory of aging proposes that accumulation of oxidative damage is the main proximate cause of aging and that lifespan is determined by the rate at which this damage occurs. Two predictions from this theory are that long-lived organisms produce fewer ROS or have increased antioxidant production. Based in these predictions, molecular mechanisms to promote longevity could include either changes in the regulation of mitochondrial genes that affect ROS production or elevated expression of antioxidant genes. We explored these possibilities in the honey bee, a good model for the study of aging because it has a caste system in which the same genome produces both a long-lived queen and a short-lived worker. We measured mRNA levels for genes encoding eight of the most prominent antioxidant enzymes and five mitochondrial proteins involved in respiration. The expression of antioxidant genes generally decreased with age in queens, but not in workers. Expression of most mitochondrial genes, in particular CytC, was higher in young queens, but these genes showed a faster age-related decline relative to workers. One exception to this trend was COX-I in thorax. This resulted in higher COX-I/CytC ratios in old queens compared to old workers, which suggests caste-specific differences in mitochondrial function that might be related to the caste-specific differences in longevity. Queen honey bee longevity appears to have evolved via mechanisms other than increased antioxidant gene expression.

  10. Expression Trend of Selected Ribosomal Protein Genes in Nasopharyngeal Carcinoma

    PubMed Central

    Ma, Xiang-Ru; Sim, Edmund Ui-Hang; Ling, Teck-Yee; Tiong, Thung-Sing; Subramaniam, Selva Kumar; Khoo, Alan Soo-Beng


    Background: Ribosomal proteins are traditionally associated with protein biosynthesis until recent studies that implicated their extraribosomal functions in human diseases and cancers. Our previous studies using GeneFishing™ DEG method and microarray revealed underexpression of three ribosomal protein genes, RPS26, RPS27, and RPL32 in cancer of the nasopharynx. Herein, we investigated the expression pattern and nucleotide sequence integrity of these genes in nasopharyngeal carcinoma to further delineate their involvement in tumourigenesis. The relationship of expression level with clinicopathologic factors was also statistically studied. Methods: Quantitative Polymerase Chain Reaction was performed on nasopharyngeal carcinoma and their paired normal tissues. Expression and sequence of these three genes were analysed. Results: All three ribosomal protein genes showed no significant difference in transcript expressions and no association could be established with clinicopathologic factors studied. No nucleotide aberrancy was detected in the coding regions of these genes. Conclusion: There is no early evidence to substantiate possible involvement of RPS26, RPS27, and RPL32 genes in NPC tumourigenesis. PMID:23613646

  11. Transposon-induced nuclear mutations that alter chloroplast gene expression

    SciTech Connect

    Barkan, A.


    The goal of this project is to use mutant phenotypes as a guide to nuclear genes that determine the timing and localization of chloroplast development The immediate goals are to identify nuclear mutants with defects in chloroplast gene expression from maize lines harboring active Mu transposons; characterize their phenotypes to determine the precise defect in gene expression; clone several of the most interesting mutations by exploiting the transposon tag; and use the clones to further define the roles of these genes in modulating chloroplast gene expression. Three mutants were described earlier that had global defects in chloroplast gene expression. We have found that two of these mutations are allelic. Both alleles have global defects in chloroplast translation initiation, as revealed by the failure to assemble chloroplast mRNAs into polysomes. We have isolated and characterized three new mutants from Mu lines that have novel defects in chloroplast RNA metabolism. We are now ready to begin the task of cloning several of these genes, by using the Mu transposon tag.

  12. Floating Escherichia coli by expressing cyanobacterial gas vesicle genes

    NASA Astrophysics Data System (ADS)

    Wang, Tianhe; Kang, Li; Li, Jiaheng; Wu, Wenjie; Zhang, Peiran; Gong, Minghao; Lai, Weihong; Zhang, Chunyan; Chang, Lei; Peng, Yong; Yang, Zhongzhou; Li, Lian; Bao, Yingying; Xu, Haowen; Zhang, Xiaohua; Sui, Zhenghong; Yang, Guanpin; Wang, Xianghong


    Gas vesicles are hollow, air-filled polyprotein structures that provide the buoyancy to cells. They are found in a variety of prokaryotes. In this study, we isolated a partial gas vesicle protein gene cluster containing gvpA and gvpC20Ψ from Planktothrix rubescens, and inserted it into an expression vector and expressed it in E. coli. The gas vesicle was developed in bacterial cells, which made bacterial cells to float on medium surface. We also amplified gvpA and gvpC20Ψ separately and synthesized an artificial operon by fusing these two genes with the standardized gene expression controlling elements of E. coli. The artificial operon was expressed in E. coli, forming gas vesicles and floating bacteria cells. Our findings verified that the whole set of genes and the overall structure of gas vesicle gene cluster are not necessary for developing gas vesicles in bacteria cells. Two genes, gvpA and gvpC20Ψ, of the gas vesicle gene cluster are sufficient for synthesizing an artificial operon that can develop gas vesicles in bacteria cells. Our findings provided a wide range of applications including easing the harvest of cultured microalgae and bacteria, as well as enriching and remediating aquatic pollutants by constructing gas vesicles in their cells.

  13. Selective gene expression by rat gastric corpus epithelium

    PubMed Central

    Goebel, M.; Stengel, A.; Sachs, G.


    The gastrointestinal (GI) tract is divided into several segments that have distinct functional properties, largely absorptive. The gastric corpus is the only segment thought of as largely secretory. Microarray hybridization of the gastric corpus mucosal epithelial cells was used to compare gene expression with other segments of the columnar GI tract followed by statistical data subtraction to identify genes selectively expressed by the rat gastric corpus mucosa. This provides a means of identifying less obvious specific functions of the corpus in addition to its secretion-related genes. For example, important properties found by this GI tract comparative transcriptome reflect the energy demand of acid secretion, a role in lipid metabolism, the large variety of resident neuroendocrine cells, responses to damaging agents and transcription factors defining differentiation of its epithelium. In terms of overlap of gastric corpus genes with the rest of the GI tract, the distal small bowel appears to express many of the gastric corpus genes in contrast to proximal small and large bowel. This differential map of gene expression by the gastric corpus epithelium will allow a more detailed description of major properties of the gastric corpus and may lead to the discovery of gastric corpus cell differentiation genes and those mis-regulated in gastric carcinomas. PMID:21177383

  14. Modification of Schwann cell gene expression by electroporation in vivo.


    Aspalter, Manuela; Vyas, Alka; Feiner, Jeffrey; Griffin, John; Brushart, Thomas; Redett, Richard


    Clinical outcomes of nerve grafting are often inferior to those of end-to-end nerve repair. This may be due, in part, to the routine use of cutaneous nerve to support motor axon regeneration. In previous work, we have demonstrated that Schwann cells express distinct sensory and motor phenotypes, and that these promote regeneration in a modality-specific fashion. Intra-operative modification of graft Schwann cell phenotype might therefore improve clinical outcomes. This paper demonstrates the feasibility of electroporating genes into intact nerve to modify Schwann cell gene expression. Initial trials established 70 V, 5 ms as optimum electroporation parameters. Intact, denervated, and reinnervated rat tibial nerves were electroporated with the YFP gene and evaluated serially by counting S-100 positive cells that expressed YFP. In intact nerve, a mean of 28% of Schwann cells expressed the gene at 3 days, falling to 20% at 7 days with little expression at later times. There were no significant differences among the three groups at each time period. Electronmicroscopic evaluation of treated, intact nerve revealed only occasional demyelination and axon degeneration. Intra-operative electroporation of nerve graft is thus a practical means of altering Schwann cell gene expression without the risks inherent in viral transfection.

  15. Gene expression profiles of bronchoalveolar cells in Pulmonary TB

    PubMed Central

    Raju, Bindu; Hoshino, Yoshihiko; Belitskaya-Lévy, Ilana; Dawson, Rod; Ress, Stanley; Gold, Jeffrey A.; Condos, Rany; Pine, Richard; Brown, Stuart; Nolan, Anna; Rom, William N.; Weiden, Michael D.


    The host response to Mycobacterium tuberculosis includes macrophage activation, inflammation with increased immune effector cells, tissue necrosis and cavity formation, and fibrosis, distortion, and bronchiectasis. To evaluate the molecular basis of the immune response in the lungs of patients with active pulmonary tuberculosis (TB), we used bronchoalveolar lavage to obtain cells at the site of infection. Affymetrix Genechip micro-arrays and cDNA nylon filter microarrays interrogated gene expression in BAL cells from 11 healthy controls and 17 patients with active pulmonary TB. We found altered gene expression for 69 genes in TB versus normal controls that included cell surface markers, cytokines, chemokines, receptors, transcription factors, and complement components. In addition, TB BAL cell gene expression patternssegregated into 2 groups: one suggestive of a T helper type 1 (Th1) cellular immune response with increased STAT-4, IFN-γ receptor, and MIG expression with increased IFN-γ protein levels in BAL fluid; the other group displayed characteristics of Th2 immunity with increased STAT-6, CD81, and IL-10 receptor expression. We were able to demonstrate that a Th2 presentation could change to a Th1 pattern after anti-tuberculous treatment in one TB patient studied serially. These gene expression data support the conclusion that pulmonary TB produces a global change in the BAL cell transcriptome with manifestations of either Th1 or Th2 immunity. PMID:17921069

  16. Oxygen-regulated gene expression in murine cumulus cells.


    Kind, Karen L; Tam, Kimberley K Y; Banwell, Kelly M; Gauld, Ashley D; Russell, Darryl L; Macpherson, Anne M; Brown, Hannah M; Frank, Laura A; Peet, Daniel J; Thompson, Jeremy G


    Oxygen is an important component of the environment of the cumulus-oocyte complex (COC), both in vivo within the ovarian follicle and during in vitro oocyte maturation (IVM). Cumulus cells have a key role in supporting oocyte development, and cumulus cell function and gene expression are known to be altered when the environment of the COC is perturbed. Oxygen-regulated gene expression is mediated through the actions of the transcription factors, the hypoxia-inducible factors (HIFs). In the present study, the effect of oxygen on cumulus cell gene expression was examined following in vitro maturation of the murine COC at 2%, 5% or 20% oxygen. Increased expression of HIF-responsive genes, including glucose transporter-1, lactate dehydrogenase A and BCL2/adenovirus E1B interacting protein 3, was observed in cumulus cells matured at 2% or 5%, compared with 20% oxygen. Stabilisation of HIF1α protein in cumulus cells exposed to low oxygen was confirmed by western blot and HIF-mediated transcriptional activity was demonstrated using a transgenic mouse expressing green fluorescent protein under the control of a promoter containing hypoxia response elements. These results indicate that oxygen concentration influences cumulus cell gene expression and support a role for HIF1α in mediating the cumulus cell response to varying oxygen.

  17. Rootstock effects on gene expression patterns in apple tree scions.


    Jensen, Philip J; Rytter, Jo; Detwiler, Elizabeth A; Travis, James W; McNellis, Timothy W


    Like many fruit trees, apple trees (Malus pumila) do not reproduce true-to-type from seed. Desirable cultivars are clonally propagated by grafting onto rootstocks that can alter the characteristics of the scion. For example, the M.7 EMLA rootstock is semi-dwarfing and reduces the susceptibility of the scion to Erwinia amylovora, the causal agent of fire blight disease. In contrast, the M.9 T337 rootstock is dwarfing and does not alter fire blight susceptibility of the scion. This study represents a comprehensive comparison of gene expression patterns in scions of the 'Gala' apple cultivar grafted to either M.7 EMLA or M.9 T337. Expression was determined by cDNA-AFLP coupled with silver staining of the gels. Scions grafted to the M.9 T337 rootstock showed higher expression of a number of photosynthesis-related, transcription/translation-related, and cell division-related genes, while scions grafted to the M.7 EMLA rootstock showed increased stress-related gene expression. The observed differences in gene expression showed a remarkable correlation with physiological differences between the two graft combinations. The roles that the differentially expressed genes might play in tree stature, stress tolerance, photosynthetic activity, fire blight resistance, and other differences conferred by the two rootstocks are discussed.

  18. Aging and Gene Expression in the Primate Brain

    SciTech Connect

    Fraser, Hunter B.; Khaitovich, Philipp; Plotkin, Joshua B.; Paabo, Svante; Eisen, Michael B.


    It is well established that gene expression levels in many organisms change during the aging process, and the advent of DNA microarrays has allowed genome-wide patterns of transcriptional changes associated with aging to be studied in both model organisms and various human tissues. Understanding the effects of aging on gene expression in the human brain is of particular interest, because of its relation to both normal and pathological neurodegeneration. Here we show that human cerebral cortex, human cerebellum, and chimpanzee cortex each undergo different patterns of age-related gene expression alterations. In humans, many more genes undergo consistent expression changes in the cortex than in the cerebellum; in chimpanzees, many genes change expression with age in cortex, but the pattern of changes in expression bears almost no resemblance to that of human cortex. These results demonstrate the diversity of aging patterns present within the human brain, as well as how rapidly genome-wide patterns of aging can evolve between species; they may also have implications for the oxidative free radical theory of aging, and help to improve our understanding of human neurodegenerative diseases.

  19. Enrichment of cells exhibiting tetracycline regulated gene expression.


    Nahreini, Piruz; Hanson, Amy J; Prasad, Kedar N


    Tetracycline controlled gene expression varies significantly among cells within a cell line. Chromosomal integration sites of the tetracycline transactivator (tTA) gene and/or the test gene presumably account for the variable efficacy of this system. We hypothesized that the efficacy of tetracycline regulated gene expression is more dependent on the level of tTA inside cells and less dependent on the integration sites of the tetracycline transcription units. To test this hypothesis, we established a TetOff regulatied expression of a short-lived enhanced GFP (d2EGFP) via retroviral vectors in a neuroblastoma cell line (NBP2). We then enriched for two populations of NBP2 cells; one expressing high levels of d2EGFP (HG) and the other expressing low levels of d2EGFP (LG) in the absence of doxycycline. We show that the tTA is more abundant in HG cells than in LG cells; the cAMP-mediated transactivation of tTA's promoter further increases the efficacy of the tetracycline system; and the efficient doxycycline regulated expression of a test gene (i.e., VP16CREB) is achieved in HG cells. Therefore, we have developed a simple method to enrich for a population of tetracycline-responsive cells with no need for screening for tetracycline-responsive clonal cell lines.

  20. The mouse Gene Expression Database (GXD): 2014 update.


    Smith, Constance M; Finger, Jacqueline H; Hayamizu, Terry F; McCright, Ingeborg J; Xu, Jingxia; Berghout, Joanne; Campbell, Jeff; Corbani, Lori E; Forthofer, Kim L; Frost, Pete J; Miers, Dave; Shaw, David R; Stone, Kevin R; Eppig, Janan T; Kadin, James A; Richardson, Joel E; Ringwald, Martin


    The Gene Expression Database (GXD; is an extensive and well-curated community resource of mouse developmental expression information. GXD collects different types of expression data from studies of wild-type and mutant mice, covering all developmental stages and including data from RNA in situ hybridization, immunohistochemistry, RT-PCR, northern blot and western blot experiments. The data are acquired from the scientific literature and from researchers, including groups doing large-scale expression studies. Integration with the other data in Mouse Genome Informatics (MGI) and interconnections with other databases places GXD's gene expression information in the larger biological and biomedical context. Since the last report, the utility of GXD has been greatly enhanced by the addition of new data and by the implementation of more powerful and versatile search and display features. Web interface enhancements include the capability to search for expression data for genes associated with specific phenotypes and/or human diseases; new, more interactive data summaries; easy downloading of data; direct searches of expression images via associated metadata; and new displays that combine image data and their associated annotations. At present, GXD includes >1.4 million expression results and 250,000 images that are accessible to our search tools.

  1. Optimization of Gene Expression through Divergent Mutational Paths

    PubMed Central

    Chou, Hsin-Hung; Marx, Christopher J.


    SUMMARY Adaptation under similar selective pressure often leads to comparable phenotypes. A longstanding question is whether such phenotypic repeatability entails similar (parallelism) or different genotypic changes (convergence). To better understand this, we characterized mutations that optimized expression of a plasmid-borne metabolic pathway during laboratory evolution of a bacterium. Expressing these pathway genes was essential for growth but came with substantial costs. Starting from overexpression, replicate populations founded by this bacterium all evolved to reduce expression. Despite this phenotypic repetitiveness, the underlying mutational spectrum was highly diverse. Analysis of these plasmid mutations identified three distinct means to modulate gene expression: (1) reducing the gene copy number, (2) lowering transcript stability, and (3) integration of the pathway-bearing plasmid into the host genome. Our study revealed diverse molecular changes beneath convergence to a simple phenotype. This complex genotype-phenotype mapping presents a challenge to inferring genetic evolution based solely on phenotypic changes. PMID:22832162

  2. [Alteration of isozyme gene expression during cell differentiation and oncogenesis].


    Yamada, K; Noguchi, T


    Rat pyruvate kinase (PK) has four isozymes, called the M1-, M2-, L-, and R-types. The M1- and M2-type isozymes of PK are produced from the PKM gene by alternative splicing, whereas the L- and R-type isozymes of PK are produced from the PKL gene by use of different tissue-specific promoters. In early development, only M2-type PK expresses in all tissues. After late morphogenesis, M1-, L-, and R-type PK express tissue-specifically. In contrast, cell proliferation such as regenerating liver and oncogenesis lead to decrease or cessation of the expression of tissue-specific PK isozymes and to stimulation of the expression of M2-type PK. These phenomena from the point of view transcriptional regulatory apparatus of the PKM and PKL gene are discussed.

  3. Network Security via Biometric Recognition of Patterns of Gene Expression

    NASA Technical Reports Server (NTRS)

    Shaw, Harry C.


    Molecular biology provides the ability to implement forms of information and network security completely outside the bounds of legacy security protocols and algorithms. This paper addresses an approach which instantiates the power of gene expression for security. Molecular biology provides a rich source of gene expression and regulation mechanisms, which can be adopted to use in the information and electronic communication domains. Conventional security protocols are becoming increasingly vulnerable due to more intensive, highly capable attacks on the underlying mathematics of cryptography. Security protocols are being undermined by social engineering and substandard implementations by IT organizations. Molecular biology can provide countermeasures to these weak points with the current security approaches. Future advances in instruments for analyzing assays will also enable this protocol to advance from one of cryptographic algorithms to an integrated system of cryptographic algorithms and real-time expression and assay of gene expression products.

  4. Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.


    Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C


    The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.

  5. Improved integrative framework combining association data with gene expression features to prioritize Crohn's disease genes.


    Ning, Kaida; Gettler, Kyle; Zhang, Wei; Ng, Sok Meng; Bowen, B Monica; Hyams, Jeffrey; Stephens, Michael C; Kugathasan, Subra; Denson, Lee A; Schadt, Eric E; Hoffman, Gabriel E; Cho, Judy H


    Genome-wide association studies in Crohn's disease (CD) have identified 140 genome-wide significant loci. However, identification of genes driving association signals remains challenging. Furthermore, genome-wide significant thresholds limit false positives at the expense of decreased sensitivity. In this study, we explored gene features contributing to CD pathogenicity, including gene-based association data from CD and autoimmune (AI) diseases, as well as gene expression features (eQTLs, epigenetic markers of expression and intestinal gene expression data). We developed an integrative model based on a CD reference gene set. This integrative approach outperformed gene-based association signals alone in identifying CD-related genes based on statistical validation, gene ontology enrichment, differential expression between M1 and M2 macrophages and a validation using genes causing monogenic forms of inflammatory bowel disease as a reference. Besides gene-level CD association P-values, association with AI diseases was the strongest predictor, highlighting generalized mechanisms of inflammation, and the interferon-γ pathway particularly. Within the 140 high-confidence CD regions, 598 of 1328 genes had low prioritization scores, highlighting genes unlikely to contribute to CD pathogenesis. For select regions, comparably high integrative model scores were observed for multiple genes. This is particularly evident for regions having extensive linkage disequilibrium such as the IBD5 locus. Our analyses provide a standardized reference for prioritizing potential CD-related genes, in regions with both highly significant and nominally significant gene-level association P-values. Our integrative model may be particularly valuable in prioritizing rare, potentially private, missense variants for which genome-wide evidence for association may be unattainable.

  6. Improved integrative framework combining association data with gene expression features to prioritize Crohn's disease genes

    PubMed Central

    Ning, Kaida; Gettler, Kyle; Zhang, Wei; Ng, Sok Meng; Bowen, B. Monica; Hyams, Jeffrey; Stephens, Michael C.; Kugathasan, Subra; Denson, Lee A.; Schadt, Eric E.; Hoffman, Gabriel E.; Cho, Judy H.


    Genome-wide association studies in Crohn's disease (CD) have identified 140 genome-wide significant loci. However, identification of genes driving association signals remains challenging. Furthermore, genome-wide significant thresholds limit false positives at the expense of decreased sensitivity. In this study, we explored gene features contributing to CD pathogenicity, including gene-based association data from CD and autoimmune (AI) diseases, as well as gene expression features (eQTLs, epigenetic markers of expression and intestinal gene expression data). We developed an integrative model based on a CD reference gene set. This integrative approach outperformed gene-based association signals alone in identifying CD-related genes based on statistical validation, gene ontology enrichment, differential expression between M1 and M2 macrophages and a validation using genes causing monogenic forms of inflammatory bowel disease as a reference. Besides gene-level CD association P-values, association with AI diseases was the strongest predictor, highlighting generalized mechanisms of inflammation, and the interferon-γ pathway particularly. Within the 140 high-confidence CD regions, 598 of 1328 genes had low prioritization scores, highlighting genes unlikely to contribute to CD pathogenesis. For select regions, comparably high integrative model scores were observed for multiple genes. This is particularly evident for regions having extensive linkage disequilibrium such as the IBD5 locus. Our analyses provide a standardized reference for prioritizing potential CD-related genes, in regions with both highly significant and nominally significant gene-level association P-values. Our integrative model may be particularly valuable in prioritizing rare, potentially private, missense variants for which genome-wide evidence for association may be unattainable. PMID:25935003

  7. A Weakened Transcriptional Enhancer Yields Variegated Gene Expression

    PubMed Central

    Collins, Cathy; Azmi, Peter; Berru, Maribel; Zhu, Xiaofu; Shulman, Marc J.


    Identical genes in the same cellular environment are sometimes expressed differently. In some cases, including the immunoglobulin heavy chain (IgH) locus, this type of differential gene expression has been related to the absence of a transcriptional enhancer. To gain additional information on the role of the IgH enhancer, we examined expression driven by enhancers that were merely weakened, rather than fully deleted, using both mutations and insulators to impair enhancer activity. For this purpose we used a LoxP/Cre system to place a reporter gene at the same genomic site of a stable cell line. Whereas expression of the reporter gene was uniformly high in the presence of the normal, uninsulated enhancer and undetectable in its absence, weakened enhancers yielded variegated expression of the reporter gene; i.e., the average level of expression of the same gene differed in different clones, and expression varied significantly among cells within individual clones. These results indicate that the weakened enhancer allows the reporter gene to exist in at least two states. Subtle aspects of the variegation suggest that the IgH enhancer decreases the average duration (half-life) of the silent state. This analysis has also tested the conventional wisdom that enhancer activity is independent of distance and orientation. Thus, our analysis of mutant (truncated) forms of the IgH enhancer revealed that the 250 bp core enhancer was active in its normal position, ∼1.4 kb 3′ of the promoter, but inactive ∼6 kb 3′, indicating that the activity of the core enhancer was distance-dependent. A longer segment – the core enhancer plus ∼1 kb of 3′ flanking material, including the 3′ matrix attachment region – was active, and the activity of this longer segment was orientation-dependent. Our data suggest that this 3′ flank includes binding sites for at least two activators. PMID:17183661

  8. Impact of RNA degradation on gene expression profiling

    PubMed Central


    Background Gene expression profiling is a highly sensitive technique which is used for profiling tumor samples for medical prognosis. RNA quality and degradation influence the analysis results of gene expression profiles. The impact of this influence on the profiles and its medical impact is not fully understood. As patient samples are very valuable for clinical studies, it is necessary to establish criteria for the RNA quality to be able to use these samples in later analysis. Methods To investigate the effects of RNA integrity on gene expression profiling, whole genome expression arrays were used. We used tumor biopsies from patients diagnosed with locally advanced rectal cancer. To simulate degradation, the isolated total RNA of all patients was subjected to heat-induced degradation in a time-dependent manner. Expression profiling was then performed and data were analyzed bioinformatically to assess the differences. Results The differences introduced by RNA degradation were largely outweighed by the biological differences between the patients. Only a relatively small number of probes (275 out of 41,000) show a significant effect due to degradation. The genes that show the strongest effect due to RNA degradation were, especially, those with short mRNAs and probe positions near the 5' end. Conclusions Degraded RNA from tumor samples (RIN > 5) can still be used to perform gene expression analysis. A much higher biological variance between patients is observed compared to the effect that is imposed by degradation of RNA. Nevertheless there are genes, very short ones and those with the probe binding side close to the 5' end that should be excluded from gene expression analysis when working with degraded RNA. These results are limited to the Agilent 44 k microarray platform and should be carefully interpreted when transferring to other settings. PMID:20696062

  9. Mitochondrial and Metabolic Gene Expression in the Aged Rat Heart

    PubMed Central

    Barton, Gregory P.; Sepe, Joseph J.; McKiernan, Susan H.; Aiken, Judd M.; Diffee, Gary M.


    Aging is associated with a decline in cardiac function. Exercise intervention has been suggested as a way to improve this decrement. Age-related decline in cardiac function is associated with decreases in fatty acid oxidation, mitochondrial function, and AMP-activated protein kinase (AMPK) activity. The molecular mechanisms involved with age-related changes in mitochondrial function and substrate metabolism are poorly understood. We determined gene expression differences in hearts of Young (6 mo), Old (33 mo), and old exercise trained (Old + EXE) (34 mo) FBN rats, using Qiagen PCR arrays for Glucose, Fatty acid, and Mitochondrial metabolism. Old rats demonstrated decreased (p < 0.05) expression for key genes in fatty acid oxidation, mitochondrial function, and AMPK signaling. There were no differences in the expression of genes involved in glucose metabolism with age. These gene expression changes occurred prior to altered protein translation as we found no differences in the protein content of peroxisome proliferator activated receptor gamma, coactivators 1 alpha (PGC-1α), peroxisome proliferator activated receptor alpha (PPARα), and AMPKα2 between young and old hearts. Four months of exercise training did not attenuate the decline in the gene expression in aged hearts. Despite this lack of change in gene expression, exercise-trained rats demonstrated increased exercise capacity compared to their sedentary counterparts. Taken together, our results show that differential expression of genes associated with fatty acid metabolism, AMPK signaling and mitochondrial function decrease in the aging heart which may play a role in age-related declines in fatty acid oxidation, AMPK activity, and mitochondrial function in the heart. PMID:27601998

  10. Evolution and Expression Patterns of TCP Genes in Asparagales.


    Madrigal, Yesenia; Alzate, Juan F; Pabón-Mora, Natalia


    CYCLOIDEA-like genes are involved in the symmetry gene network, limiting cell proliferation in the dorsal regions of bilateral flowers in core eudicots. CYC-like and closely related TCP genes (acronym for TEOSINTE BRANCHED1, CYCLOIDEA, and PROLIFERATION CELL FACTOR) have been poorly studied in Asparagales, the largest order of monocots that includes both bilateral flowers in Orchidaceae (ca. 25.000 spp) and radially symmetrical flowers in Hypoxidaceae (ca. 200 spp). With the aim of assessing TCP gene evolution in the Asparagales, we isolated TCP-like genes from publicly available databases and our own transcriptomes of Cattleya trianae (Orchidaceae) and Hypoxis decumbens (Hypoxidaceae). Our matrix contains 452 sequences representing the three major clades of TCP genes. Besides the previously identified CYC specific core eudicot duplications, our ML phylogenetic analyses recovered an early CIN-like duplication predating all angiosperms, two CIN-like Asparagales-specific duplications and a duplication prior to the diversification of Orchidoideae and Epidendroideae. In addition, we provide evidence of at least three duplications of PCF-like genes in Asparagales. While CIN-like and PCF-like genes have multiplied in Asparagales, likely enhancing the genetic network for cell proliferation, CYC-like genes remain as single, shorter copies with low expression. Homogeneous expression of CYC-like genes in the labellum as well as the lateral petals suggests little contribution to the bilateral perianth in C. trianae. CIN-like and PCF-like gene expression suggests conserved roles in cell proliferation in leaves, sepals and petals, carpels, ovules and fruits in Asparagales by comparison with previously reported functions in core eudicots and monocots. This is the first large scale analysis of TCP-like genes in Asparagales that will serve as a platform for in-depth functional studies in emerging model monocots.

  11. Evolution and Expression Patterns of TCP Genes in Asparagales

    PubMed Central

    Madrigal, Yesenia; Alzate, Juan F.; Pabón-Mora, Natalia


    CYCLOIDEA-like genes are involved in the symmetry gene network, limiting cell proliferation in the dorsal regions of bilateral flowers in core eudicots. CYC-like and closely related TCP genes (acronym for TEOSINTE BRANCHED1, CYCLOIDEA, and PROLIFERATION CELL FACTOR) have been poorly studied in Asparagales, the largest order of monocots that includes both bilateral flowers in Orchidaceae (ca. 25.000 spp) and radially symmetrical flowers in Hypoxidaceae (ca. 200 spp). With the aim of assessing TCP gene evolution in the Asparagales, we isolated TCP-like genes from publicly available databases and our own transcriptomes of Cattleya trianae (Orchidaceae) and Hypoxis decumbens (Hypoxidaceae). Our matrix contains 452 sequences representing the three major clades of TCP genes. Besides the previously identified CYC specific core eudicot duplications, our ML phylogenetic analyses recovered an early CIN-like duplication predating all angiosperms, two CIN-like Asparagales-specific duplications and a duplication prior to the diversification of Orchidoideae and Epidendroideae. In addition, we provide evidence of at least three duplications of PCF-like genes in Asparagales. While CIN-like and PCF-like genes have multiplied in Asparagales, likely enhancing the genetic network for cell proliferation, CYC-like genes remain as single, shorter copies with low expression. Homogeneous expression of CYC-like genes in the labellum as well as the lateral petals suggests little contribution to the bilateral perianth in C. trianae. CIN-like and PCF-like gene expression suggests conserved roles in cell proliferation in leaves, sepals and petals, carpels, ovules and fruits in Asparagales by comparison with previously reported functions in core eudicots and monocots. This is the first large scale analysis of TCP-like genes in Asparagales that will serve as a platform for in-depth functional studies in emerging model monocots. PMID:28144250

  12. A prognostic gene expression signature in infratentorial ependymoma.


    Wani, Khalida; Armstrong, Terri S; Vera-Bolanos, Elizabeth; Raghunathan, Aditya; Ellison, David; Gilbertson, Richard; Vaillant, Brian; Goldman, Stewart; Packer, Roger J; Fouladi, Maryam; Pollack, Ian; Mikkelsen, Tom; Prados, Michael; Omuro, Antonio; Soffietti, Riccardo; Ledoux, Alicia; Wilson, Charmaine; Long, Lihong; Gilbert, Mark R; Aldape, Ken


    Patients with ependymoma exhibit a wide range of clinical outcomes that are currently unexplained by clinical or histological factors. Little is known regarding molecular biomarkers that could predict clinical behavior. Since recent data suggest that these tumors display biological characteristics according to their location (cerebral vs. infratentorial vs. spinal cord), rather than explore a broad spectrum of ependymoma, we focused on molecular alterations in ependymomas arising in the infratentorial compartment. Unsupervised clustering of available gene expression microarray data revealed two major subgroups of infratentorial ependymoma. Group 1 tumors over expressed genes that were associated with mesenchyme, Group 2 tumors showed no distinct gene ontologies. To assess the prognostic significance of these gene expression subgroups, real-time reverse transcriptase polymerase chain reaction assays were performed on genes defining the subgroups in a training set. This resulted in a 10-gene prognostic signature. Multivariate analysis showed that the 10-gene signature was an independent predictor of recurrence-free survival after adjusting for clinical factors. Evaluation of an external dataset describing subgroups of infratentorial ependymomas showed concordance of subgroup definition, including validation of the mesenchymal subclass. Importantly, the 10-gene signature was validated as a predictor of recurrence-free survival in this dataset. Taken together, the results indicate a link between clinical outcome and biologically identified subsets of infratentorial ependymoma and offer the potential for prognostic testing to estimate clinical aggressiveness in these tumors.

  13. Visualization and Analysis of 3D Gene Expression Data

    SciTech Connect

    Bethel, E. Wes; Rubel, Oliver; Weber, Gunther H.; Hamann, Bernd; Hagen, Hans


    Recent methods for extracting precise measurements ofspatial gene expression patterns from three-dimensional (3D) image dataopens the way for new analysis of the complex gene regulatory networkscontrolling animal development. To support analysis of this novel andhighly complex data we developed PointCloudXplore (PCX), an integratedvisualization framework that supports dedicated multi-modal, physical andinformation visualization views along with algorithms to aid in analyzingthe relationships between gene expression levels. Using PCX, we helpedour science stakeholders to address many questions in 3D gene expressionresearch, e.g., to objectively define spatial pattern boundaries andtemporal profiles of genes and to analyze how mRNA patterns arecontrolled by their regulatory transcription factors.

  14. Murine heart gene expression during acute Chagasic myocarditis

    PubMed Central

    Henao-Martínez, Andrés F.; Parra-Henao, Gabriel


    Chagas disease is transmitted by the parasite, Trypanosoma cruzi. Acute infection is characterized by acute myocarditis, although it is largely asymptomatic. Initial cardiac insult could be a determinant to the posterior development of chronic Chagasic cardiomyopathy, usually after 10 years in only approximately 30% of chronically infected patients. Herein, we characterized the acute gene expression profiling in heart tissue of two strains of mice infected with T. cruzi (tulahuen strain) at 4 weeks and their respective controls. Gene sequence data are available at NCBI under GEO accession number: GSE63847. The output of the genes expression suggests differences in involvement of protein kinase B (AKT), NCAM1, HLA-DRA, and ubiquitin C genes networks. These gene activation differences may correlate with myocardial contractility during the acute infection. PMID:26484182

  15. Blood Gene Expression Profiling of Breast Cancer Survivors Experiencing Fibrosis

    SciTech Connect

    Landmark-Hoyvik, Hege; Dumeaux, Vanessa; Reinertsen, Kristin V.; Edvardsen, Hege; Fossa, Sophie D.; Borresen-Dale, Anne-Lise


    Purpose: To extend knowledge on the mechanisms and pathways involved in maintenance of radiation-induced fibrosis (RIF) by performing gene expression profiling of whole blood from breast cancer (BC) survivors with and without fibrosis 3-7 years after end of radiotherapy treatment. Methods and Materials: Gene expression profiles from blood were obtained for 254 BC survivors derived from a cohort of survivors, treated with adjuvant radiotherapy for breast cancer 3-7 years earlier. Analyses of transcriptional differences in blood gene expression between BC survivors with fibrosis (n = 31) and BC survivors without fibrosis (n = 223) were performed using R version 2.8.0 and tools from the Bioconductor project. Gene sets extracted through a literature search on fibrosis and breast cancer were subsequently used in gene set enrichment analysis. Results: Substantial differences in blood gene expression between BC survivors with and without fibrosis were observed, and 87 differentially expressed genes were identified through linear analysis. Transforming growth factor-{beta}1 signaling was identified as the most significant gene set, showing a down-regulation of most of the core genes, together with up-regulation of a transcriptional activator of the inhibitor of fibrinolysis, Plasminogen activator inhibitor 1 in the BC survivors with fibrosis. Conclusion: Transforming growth factor-{beta}1 signaling was found down-regulated during the maintenance phase of fibrosis as opposed to the up-regulation reported during the early, initiating phase of fibrosis. Hence, once the fibrotic tissue has developed, the maintenance phase might rather involve a deregulation of fibrinolysis and altered degradation of extracellular matrix components.

  16. Developmental expression of mucin genes in the human gastrointestinal system

    PubMed Central

    Reid, C; Harris, A


    Background and aims—Mucin glycoproteins play a key role in the normal function of the epithelium lining the gastrointestinal tract. The expression of mucin genes, MUC 3, 4, 5AC, 5B, 6, 7, and 8 in human fetal tissues was examined to establish the localisation and age of onset of expression of each mucin gene during human development. 
Methods—Mucin gene expression was assayed by mRNA in situ hybridisation. 
Results—Expression of MUC3 was detected in the small intestine and colon from 13 weeks gestation onwards and at low levels in the main pancreatic duct at 13 weeks only. MUC4 expression was seen at a low level in the colonic epithelium from 13 weeks of gestation but not elsewhere in the gastrointestinal tract. MUC5AC mRNA was detected in the colon at 17 weeks and at high levels in the stomach at 23 weeks. MUC6 transcripts were evident in the pancreatic ducts from 13 weeks of gestation and at high levels in the stomach at 23 weeks. MUC5B, MUC7, and MUC8 transcripts were not detected. 
Conclusions—Mucin genes are expressed from the early mid-trimester of gestation in the developing human fetal gastrointestinal tract. 

 Keywords: mucin; developmental expression; gastrointestinal tract PMID:9536947

  17. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.


    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo


    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  18. Sequential Logic Model Deciphers Dynamic Transcriptional Control of Gene Expressions

    PubMed Central

    Yeo, Zhen Xuan; Wong, Sum Thai; Arjunan, Satya Nanda Vel; Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar; Giuliani, Alessandro; Tsuchiya, Masa


    Background Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. Methodology Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM) is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. Principal Findings SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin) during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. Conclusions/Significance The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet providing rich biological

  19. Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene

    NASA Technical Reports Server (NTRS)

    Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.


    Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.

  20. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    PubMed Central

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring. PMID:27731423

  1. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    NASA Astrophysics Data System (ADS)

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring.

  2. Gap genes define the limits of antennapedia and bithorax gene expression during early development in Drosophila.

    PubMed Central

    Harding, K; Levine, M


    The maintenance of selective patterns of homeotic gene expression within the Drosophila CNS involves cross-regulatory interactions among the genes of the antennapedia and bithorax complexes (ANT-C and BX-C). Such a mechanism does not appear to be responsible for the establishment of these selective expression patterns during early development. Here we show that mutations in several of the gap genes strongly alter the early patterns of Antp and Abd-B expression. The altered patterns that are observed do not always correlate with simple expectations based on cuticular pattern defects observed in advanced-stage mutants. It appears that the initial patterns of Antp and Abd-B expression involve their differential regulation by a common set of gap genes. We propose that the gap genes are largely responsible for integrating the processes of segmentation and homeosis. Images PMID:2896123

  3. Validation of endogenous control reference genes for normalizing gene expression studies in endometrial carcinoma.


    Ayakannu, Thangesweran; Taylor, Anthony H; Willets, Jonathon M; Brown, Laurence; Lambert, David G; McDonald, John; Davies, Quentin; Moss, Esther L; Konje, Justin C


    Real-time quantitative RT-PCR (qRT-PCR) is a powerful technique used for the relative quantification of target genes, using reference (housekeeping) genes for normalization to ensure the generation of accurate and robust data. A systematic examination of the suitability of endogenous reference genes for gene expression studies in endometrial cancer tissues is absent. The aims of this study were therefore to identify and evaluate from the thirty-two possible reference genes from a TaqMan(®) array panel their suitability as an internal control gene. The mathematical software packages geNorm qBasePLUS identified Pumilio homolog 1 (Drosophila) (PUM1), ubiquitin C (UBC), phosphoglycerate kinase (PGK1), mitochondrial ribosomal protein L19 (MRPL19) and peptidylpropyl isomerase A (cyclophilin A) (PPIA) as the best reference gene combination, whilst NormFinder identified MRPL19 as the best single reference gene, with importin 8 (IPO8) and PPIA being the best combination of two reference genes. BestKeeper ranked MRPL19 as the most stably expressed gene. In addition, the study was validated by examining the relative expression of a test gene, which encodes the cannabinoid receptor 1 (CB1). A significant difference in CB1 mRNA expression between malignant and normal endometrium using MRPL19, PPIA, and IP08 in combination was observed. The use of MRPL19, IPO8 and PPIA was identified as the best reference gene combination for the normalization of gene expression levels in endometrial carcinoma. This study demonstrates that the arbitrary selection of endogenous control reference genes for normalization in qRT-PCR studies of endometrial carcinoma, without validation, risks the production of inaccurate data and should therefore be discouraged.

  4. Control of gene expression by CRISPR-Cas systems.


    Bikard, David; Marraffini, Luciano A


    Clustered regularly interspaced short palindromic repeats (CRISPR) loci and their associated cas (CRISPR-associated) genes provide adaptive immunity against viruses (phages) and other mobile genetic elements in bacteria and archaea. While most of the early work has largely been dominated by examples of CRISPR-Cas systems directing the cleavage of phage or plasmid DNA, recent studies have revealed a more complex landscape where CRISPR-Cas loci might be involved in gene regulation. In this review, we summarize the role of these loci in the regulation of gene expression as well as the recent development of synthetic gene regulation using engineered CRISPR-Cas systems.

  5. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.


    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  6. Computing gene expression data with a knowledge-based gene clustering approach.


    Rosa, Bruce A; Oh, Sookyung; Montgomery, Beronda L; Chen, Jin; Qin, Wensheng


    Computational analysis methods for gene expression data gathered in microarray experiments can be used to identify the functions of previously unstudied genes. While obtaining the expression data is not a difficult task, interpreting and extracting the information from the datasets is challenging. In this study, a knowledge-based approach which identifies and saves important functional genes before filtering based on variability and fold change differences was utilized to study light regulation. Two clustering methods were used to cluster the filtered datasets, and clusters containing a key light regulatory gene were located. The common genes to both of these clusters were identified, and the genes in the common cluster were ranked based on their coexpression to the key gene. This process was repeated for 11 key genes in 3 treatment combinations. The initial filtering method reduced the dataset size from 22,814 probes to an average of 1134 genes, and the resulting common cluster lists contained an average of only 14 genes. These common cluster lists scored higher gene enrichment scores than two individual clustering methods. In addition, the filtering method increased the proportion of light responsive genes in the dataset from 1.8% to 15.2%, and the cluster lists increased this proportion to 18.4%. The relatively short length of these common cluster lists compared to gene groups generated through typical clustering methods or coexpression networks narrows the search for novel functional genes while increasing the likelihood that they are biologically relevant.

  7. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.


    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  8. Gastric Cancer Associated Genes Identified by an Integrative Analysis of Gene Expression Data

    PubMed Central

    Jiang, Bing; Li, Shuwen; Jiang, Zhi


    Gastric cancer is one of the most severe complex diseases with high morbidity and mortality in the world. The molecular mechanisms and risk factors for this disease are still not clear since the cancer heterogeneity caused by different genetic and environmental factors. With more and more expression data accumulated nowadays, we can perform integrative analysis for these data to understand the complexity of gastric cancer and to identify consensus players for the heterogeneous cancer. In the present work, we screened the published gene expression data and analyzed them with integrative tool, combined with pathway and gene ontology enrichment investigation. We identified several consensus differentially expressed genes and these genes were further confirmed with literature mining; at last, two genes, that is, immunoglobulin J chain and C-X-C motif chemokine ligand 17, were screened as novel gastric cancer associated genes. Experimental validation is proposed to further confirm this finding. PMID:28232943

  9. Acute exercise regulates adipogenic gene expression in white adipose tissue.


    Shen, Y; Zhou, H; Jin, W; Lee, H J


    White adipose tissue expansion is associated with both hypertrophy and hyperplasia of adipocytes. Exercise training results in adipocyte hypotrophy by activating lipolysis, but it is poorly understood whether exercise regulates adipogenesis by altering adipogenic gene expression. The purpose of this study was to evaluate the effect of a single bout of swimming exercise on adipogenic gene expression in white adipose tissue (WAT). Male C57BL/6J mice were divided into two groups: a sedentary control group and a 120-minute swimming exercise group. Immediately after acute exercise, adipogenic gene expression in WAT was analysed by RT-PCR, and tdTomato positive cells in WAT from UCP1-cre-tdTomato mice were observed under a confocal microscope. In epididymal white adipose tissue (eWAT), PPARγ2 and C/EBPα expression at the mRNA level was significantly decreased with high induction of Wnt10b and KLFs (KLF2, KLF3, KLF7, KLF6, KLF9 and KLF15), whereas PPARγ2, not C/EBPα, was decreased with high induction of Wnt6 and KLFs (KLF2, KLF3, KLF7, KLF6 and KLF9) in inguinal white adipose tissue (iWAT) after acute exercise. The expression of C/EBPβ and C/EBPδ was upregulated in both WATs with a high level of PGC-1α expression. Expression level of UCP1 was increased only in adipocytes of eWAT, while beige cell specific gene expression was comparable between groups and tdTomato positive cells were not found in WAT of UCP1-cre-tdTomato reporter mouse immediately after acute exercise. These results suggest that acute exercise suppresses adipogenic gene expression and may regulate thermogenesis by activating C/EBPβ, PGC-1α and UCP1 in WAT.

  10. Duplicate gene expression in allopolyploid Gossypium reveals two temporally distinct phases of expression evolution

    PubMed Central

    Flagel, Lex; Udall, Joshua; Nettleton, Dan; Wendel, Jonathan


    Background Polyploidy has played a prominent role in shaping the genomic architecture of the angiosperms. Through allopolyploidization, several modern Gossypium (cotton) species contain two divergent, although largely redundant genomes. Owing to this redundancy, these genomes can play host to an array of evolutionary processes that act on duplicate genes. Results We compared homoeolog (genes duplicated by polyploidy) contributions to the transcriptome of a natural allopolyploid and a synthetic interspecific F1 hybrid, both derived from a merger between diploid species from the Gossypium A-genome and D-genome groups. Relative levels of A- and D-genome contributions to the petal transcriptome were determined for 1,383 gene pairs. This comparison permitted partitioning of homoeolog expression biases into those arising from genomic merger and those resulting from polyploidy. Within allopolyploid Gossypium, approximately 24% of the genes with biased (unequal contributions from the two homoeologous copies) expression patterns are inferred to have arisen as a consequence of genomic merger, indicating that a substantial fraction of homoeolog expression biases occur instantaneously with hybridization. The remaining 76% of biased homoeologs reflect long-term evolutionary forces, such as duplicate gene neofunctionalization and subfunctionalization. Finally, we observed a greater number of genes biased toward the paternal D-genome and that expression biases have tended to increases during allopolyploid evolution. Conclusion Our results indicate that allopolyploidization entails significant homoeolog expression modulation, both immediately as a consequence of genomic merger, and secondarily as a result of long-term evolutionary transformations in duplicate gene expression. PMID:18416842

  11. Metabolic regulation and gene expression during aestivation.


    Storey, Kenneth B; Storey, Janet M


    The biochemical regulation of aestivation, a state of aerobic hypometabolism, achieves actions including strong overall suppression of metabolic rate, reprioritization of energy use by diverse cell functions, and enhancement of defenses such as protein chaperones and antioxidants that aid long-term life extension. This is accomplished by mechanisms that include differential action of intracellular signaling cascades, reversible protein phosphorylation to alter the activity states of multiple enzymes and functional proteins, global suppression of transcription and translation, and selective gene upregulation. Recent advances in understanding the regulation of aestivation are discussed with a particular emphasis on land snail and anuran models.

  12. Biased gene fractionation and dominant gene expression among the subgenomes of Brassica rapa.


    Cheng, Feng; Wu, Jian; Fang, Lu; Sun, Silong; Liu, Bo; Lin, Ke; Bonnema, Guusje; Wang, Xiaowu


    Polyploidization, both ancient and recent, is frequent among plants. A "two-step theory" was proposed to explain the meso-triplication of the Brassica "A" genome: Brassica rapa. By accurately partitioning of this genome, we observed that genes in the less fractioned subgenome (LF) were dominantly expressed over the genes in more fractioned subgenomes (MFs: MF1 and MF2), while the genes in MF1 were slightly dominantly expressed over the genes in MF2. The results indicated that the dominantly expressed genes tended to be resistant against gene fractionation. By re-sequencing two B. rapa accessions: a vegetable turnip (VT117) and a Rapid Cycling line (L144), we found that genes in LF had less non-synonymous or frameshift mutations than genes in MFs; however mutation rates were not significantly different between MF1 and MF2. The differences in gene expression patterns and on-going gene death among the three subgenomes suggest that "two-step" genome triplication and differential subgenome methylation played important roles in the genome evolution of B. rapa.

  13. Nonsyntenic Genes Drive Highly Dynamic Complementation of Gene Expression in Maize Hybrids[W

    PubMed Central

    Larson, Nick B.; Marcon, Caroline; Schnable, James C.; Yeh, Cheng-Ting; Lanz, Christa; Nettleton, Dan; Piepho, Hans-Peter; Schnable, Patrick S.


    Maize (Zea mays) displays an exceptional level of structural genomic diversity, which is likely unique among higher eukaryotes. In this study, we surveyed how the genetic divergence of two maize inbred lines affects the transcriptomic landscape in four different primary root tissues of their F1-hybrid progeny. An extreme instance of complementation was frequently observed: genes that were expressed in only one parent but in both reciprocal hybrids. This single-parent expression (SPE) pattern was detected for 2341 genes with up to 1287 SPE patterns per tissue. As a consequence, the number of active genes in hybrids exceeded that of their parents in each tissue by >400. SPE patterns are highly dynamic, as illustrated by their excessive degree of tissue specificity (80%). The biological significance of this type of complementation is underpinned by the observation that a disproportionally high number of SPE genes (75 to 82%) is nonsyntenic, as opposed to all expressed genes (36%). These genes likely evolved after the last whole-genome duplication and are therefore younger than the syntenic genes. In summary, SPE genes shape the remarkable gene expression plasticity between root tissues and complementation in maize hybrids, resulting in a tissue-specific increase of active genes in F1-hybrids compared with their inbred parents. PMID:25315323

  14. Suitability of commonly used housekeeping genes in gene expression studies for space radiation research

    NASA Astrophysics Data System (ADS)

    Arenz, A.; Stojicic, N.; Lau, P.; Hellweg, C. E.; Baumstark-Khan, C.

    Research on the effects of ionizing radiation exposure involves the use of real-time reverse transcription polymerase chain reaction (qRT-PCR) for measuring changes in gene expression. Several variables need to be controlled for gene expression analysis, such as different amounts of starting material between the samples, variations in enzymatic efficiencies of the reverse transcription step, and differences in RNA integrity. Normalization of the obtained data to an invariant endogenous control gene (reference gene) is the elementary step in relative quantification strategy. There is a strong correlation between the quality of the normalized data and the stability of the reference gene itself. This is especially relevant when the samples have been obtained after exposure to radiation qualities inducing different amounts and kinds of damage, leading to effects on cell cycle delays or even on cell cycle blocks. In order to determine suitable reference genes as internal controls in qRT-PCR assays after exposure to ionizing radiation, we studied the gene expression levels of nine commonly used reference genes which are constitutively expressed in A549 lung cancer cells. Expression levels obtained for ACTB, B2M, GAPDH, PBGD, 18S rRNA, G6PDH, HPRT, UBC, TFRC and SDHA were determined after exposure to 2 and 6 Gy X-radiation. Gene expression data for Growth arrest and damage-inducible gene 45 (GADD45α) and Cyclin-dependent kinase inhibitor 1A (CDKN1A/p21CIP1) were selected to elucidate the influence of normalization by using appropriate and inappropriate internal control genes. According to these results, we strongly recommend the use of a panel of reference genes instead of only one.

  15. Probing cell-free gene expression noise in femtoliter volumes.


    Karig, David K; Jung, Seung-Yong; Srijanto, Bernadeta; Collier, C Patrick; Simpson, Michael L


    Cell-free systems offer a simplified and flexible context that enables important biological reactions while removing complicating factors such as fitness, division, and mutation that are associated with living cells. However, cell-free expression in unconfined spaces is missing important elements of expression in living cells. In particular, the small volume of living cells can give rise to significant stochastic effects, which are negligible in bulk cell-free reactions. Here, we confine cell-free gene expression reactions to cell-relevant 20 fL volumes (between the volumes of Escherichia coli and Saccharomyces cerevisiae ), in polydimethylsiloxane (PDMS) containers. We demonstrate that expression efficiency varies widely among different containers, likely due to non-Poisson distribution of expression machinery at the observed scale. Previously, this phenomenon has been observed only in liposomes. In addition, we analyze gene expression noise. This analysis is facilitated by our use of cell-free systems, which allow the mapping of the measured noise properties to intrinsic noise models. In contrast, previous live cell noise analysis efforts have been complicated by multiple noise sources. Noise analysis reveals signatures of translational bursting, while noise dynamics suggest that overall cell-free expression is limited by a diminishing translation rate. In addition to offering a unique approach to understanding noise in gene circuits, our work contributes to a deeper understanding of the biophysical properties of cell-free expression systems, thus aiding efforts to harness cell-free systems for synthetic biology applications.

  16. VSG gene expression site control in insect form Trypanosoma brucei.


    Rudenko, G; Blundell, P A; Taylor, M C; Kieft, R; Borst, P


    When the African trypanosome Trypanosoma brucei is taken up from mammals by a tse-tse fly, it replaces its variant surface glycoprotein (VSG) coat by a procyclin coat. Transcription of VSG genes stops in the fly, but transcription of sequences derived from the promoter area of the VSG expression site(s) remains high. Whether this is due to continuing high activity of one promoter or to low activity of many promoters was unclear. We have used the small differences between the sequences of different expression sites to show that multiple expression site promoters are active in insect form trypanosomes. This is confirmed by the low expression of single copy marker genes introduced into the transcribed area. However, if the expression site promoter is removed from the genomic location of the expression site and inserted in the non-transcribed spacer of the ribosomal DNA (rDNA), it is derepressed. Derepression of transcription can also be accomplished by replacing the promoter of an expression site by an rDNA promoter. We conclude that the down-regulation of VSG gene expression site promoters in insect form trypanosomes is affected by both the DNA sequence of the promoter and the genomic context in which it resides.

  17. Os odontoideum in ide